DOCSLIB.ORG

Leucine-Rich Repeat-Containing 8B Protein Is Associated with The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Leucine-Rich Repeat-Containing 8B Protein Is Associated with The © 2018. Published by The Company of Biologists Ltd | Journal of Cell Science (2018) 131, jcs213447. doi:10.1242/jcs.213447 CORRECTION Leucine-rich repeat-containing 8B protein is associated with the endoplasmic reticulum Ca2+ leak in HEK293 cells (doi: 10.1242/ jcs.203646) Arijita Ghosh, Nitin Khandelwal, Arvind Kumar and Amal Kanti Bera There were errors published in J. Cell Sci. (2017) 130, 3818-3828 (doi: 10.1242/jcs.203646). The incorrect actin loading controls were used for Fig. 1A and Fig. 3C. The corrected figure panels are shown below. The authors apologise to readers for any inconvenience caused. 2+ Fig. 1. Overexpression of LRRC8B attenuates the ATP-induced [Ca ]c rise. (A) Western blot showing the overexpression of LRRC8B in HEK293 cells following transient transfection. β-actin was used as a loading control. Fig. 3. LRRC8B regulates the ER Ca2+ pool. (C) Western blot showing the siRNA (50 nM)- mediated knockdown of endogenous LRRC8B expression in HEK293 cells. β-actin was used as an internal control. The expression level of LRRC8A was not affected. Journal of Cell Science 1 © 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 3818-3828 doi:10.1242/jcs.203646 RESEARCH ARTICLE Leucine-rich repeat-containing 8B protein is associated with the endoplasmic reticulum Ca2+ leak in HEK293 cells Arijita Ghosh1, Nitin Khandelwal2, Arvind Kumar2 and Amal Kanti Bera1,* ABSTRACT LRRC8 proteins have also been proposed to participate in cell Leucine-rich repeat-containing 8 (LRRC8) proteins have been proposed communication (Abascal and Zardoya, 2012). Of late, noteworthy to evolutionarily originate from the combination of the channel protein studies from two independent groups identified LRRC8A as a pannexin, and a leucine-rich repeat (LRR) domain. Five paralogs of component of the volume-regulated anion channel (VRAC) (Qiu LRRC8, namely LRRC8A, LRRC8B, LRRC8C, LRRC8D and LRRC8E et al., 2014; Voss et al., 2014). have been reported. LRRC8A has been shown to be instrumental in cell Regulation of volume is an inherent cellular property that is swelling. Here, we identify LRRC8B as a key player in the cellular Ca2+ executed by manipulating the passage of water and solutes across signaling network. Overexpression of human LRRC8B in HEK293 cells the plasma membrane. An increase in the cell volume as a result of reduced the Ca2+ level in the endoplasmic reticulum (ER). LRRC8B- osmotic swelling leads to an efflux of osmolytes, activating overexpressing cells exhibited a lesser release of Ca2+ from the ER in regulatory volume decrease (RVD). A multitude of channels have response to ATP, carbachol and intracellular administration of inositol been proposed to contribute to swelling-induced volume perturbations (Hoffmann et al., 2009; Wehner et al., 2003). (1,4,5)-trisphosphate (IP3). LRRC8B-knockdown cells showed a slower depletion of the ER Ca2+ stores when sarco-endoplasmic reticulum Although the existence of VRAC had been delineated earlier, the Ca2+-ATPase was blocked with thapsigargin (TG), while overexpression molecular entities comprising VRAC had not been identified until of LRRC8B had the opposite effect. LRRC8B-overexpressing cells recently (Jentsch et al., 2016; Okada, 1997; Strange et al., 1996). exhibited a higher level of store-operated Ca2+ entry following store- With evidence favoring LRRC8A as a major VRAC candidate, a depletion by TG. Collectively, LRRC8B participates in intracellular Ca2+ new avenue has opened up for further information on the detailed homeostasis by acting as a leak channel in the ER. This study gives a functioning of VRAC in general as well as in pathophysiology. fundamental understanding of the role of a novel protein in the elemental LRRC8A was found to be indispensable for VRAC, as its cellular process of ER Ca2+ leak and expands the known roles for knockdown suppressed endogenous outward-rectifying VRAC LRRC8 proteins. currents (Voss et al., 2014). A T44C mutation in the first transmembrane domain of LRRC8A rendered VRAC susceptible This article has an associated First Person interview with the first author to modification by the sulfhydral agent 2-sulfonatoethyl of the paper. methanethiosulfonate (MTSES) and resulted in altered ion selectivity, suggesting the possibility of LRRC8A being the pore- KEY WORDS: Ca2+ signaling, LRRC8, Pannexin, VRAC, Ion channel forming unit in a functional VRAC (Qiu et al., 2014). Interestingly, another study by Ullrich et al. demonstrated a role for the first INTRODUCTION extracellular loop joining the first and second transmembrane The importance of leucine-rich repeat-containing 8 (LRRC8) domains of LRRC8 in channel activation and ion selectivity proteins was first realized in B cell development. Identified in a (Ullrich et al., 2016). So far, studies on LRRC8 suggest that patient suffering from agammaglobulinemia, the very first reports LRRC8A forms an essential component of VRAC in the form of a on an LRRC8 gene highlighted the role of these proteins in B cell multimeric channel complex in association with other LRRC8 maturation (Kubota et al., 2004; Sawada et al., 2003). LRRC8 members, particularly LRRC8C and LRRC8D (Voss et al., 2014). proteins have been so far reported in various chordates, usually as Previous studies on LRRC8C and LRRC8D have revealed their five paralogs named LRRC8A (also known as SWELL1), participation in adipocyte differentiation and transport of small LRRC8B, LRRC8C, LRRC8D and LRRC8E. Bioinformatic molecules, respectively (Lee et al., 2014; Tominaga et al., 2004). studies have shown that LRRC8 proteins have striking similarities Recently, Syeda et al. showed that LRRC8A, along with other to the channel-forming pannexin proteins (Abascal and Zardoya, LRRC8 subunits formed anion selective channels when reconstituted 2012). LRRC8 proteins have been predicted to evolutionarily in a synthetic lipid bilayer. The reconstituted channel was activated originate from a combination of transmembrane domains of by osmotic gradient (Syeda et al., 2016). In rat astrocytes, LRRC8A pannexin at the N-terminal and a C-terminal leucine-rich tail. has been shown to play a vital role in excitatory amino acid release Based on sequence and structural similarities with pannexins, contributing to RVD, in accordance with the role of VRAC in the process (Hyzinski-García et al., 2014). LRRC8 proteins have also been implicated in cellular uptake of platinum-class anti-cancer 1Department of Biotechnology, Bhupat and Jyoti Mehta School of Biosciences, drugs. Cancer cells devoid of LRRC8A and LRRC8D have been Indian Institute of Technology Madras, Chennai 600036, Tamil Nadu, India. 2CSIR Centre for Cellular and Molecular Biology, Hyderabad 500007, India. shown to be resistant to cisplatin and carboplatin (Planells-Cases et al., 2015). Cisplatin has also been shown to activate LRRC8- *Author for correspondence ([email protected]) mediated currents in Xenopus oocytes highlighting the role of these A.K.B., 0000-0003-0362-5578 proteins in drug transport (Gradogna et al., 2017). Very recently, the role of VRAC has been outlined in the transport of neuroactive Received 6 March 2017; Accepted 25 September 2017 substances, with emphasis on LRRC8D and LRRC8E (Lutter et al., Journal of Cell Science 3818 RESEARCH ARTICLE Journal of Cell Science (2017) 130, 3818-3828 doi:10.1242/jcs.203646 2017). VRAC currents have been biophysically characterized in s.e.m., n=120 cells) in control cells (Fig. 1C,E). Interestingly, the 2+ Xenopus oocytes as well as in zebrafish, throwing light on the ATP-induced [Ca ]c rise in LRRC8B-transfected cells was VRAC channel properties and heteromeric stoichiometry (Gaitán- significantly less compared to that in control cells (Fig. 1C,E). Peñas et al., 2016; Yamada et al., 2016). Another recent article by F340/380 increased only ∼2.3 fold, from 1.3 to 3.05±0.1 (n=107). 2+ 2+ Choi et al. revealed a link between VRAC and inflammation. ATP is known to increase [Ca ]c by importing extracellular Ca as Disruption of LRRC8A resulted in attenuation of TNF-induced well as by inducing release of Ca2+ from the ER via the inflammation by reducing superoxide production which, in turn, phospholipase C (PLC) and inositol (1,4,5)-trisphosphate (IP3) affected endocytosis of TNF receptors (TNFR1) (Choi et al., 2016). pathway. To check whether LRRC8B affected the Ca2+ influx or the Despite the significant participation of LRRC8 proteins in release of Ca2+ from the ER stores, the experiment was performed in cellular events like T-lymphocyte development, B-cell maturation nominally Ca2+-free ECF. The inhibitory effect of LRRC8B and reactive oxygen species (ROS)-mediated inflammation, the was noticed even in Ca2+-free ECF (Fig. 1D,E). In control cells, most persistent aspect of LRRC8 has been their channel-forming the F340/380 showed a 3-fold increase from 0.85 to 2.5±0.07 (n=72), ability, initially strengthened by virtue of sharing evolutionary, whereas in LRRC8B-transfected cells the rise was 2-fold, which structural and sequential relationship with channel-forming elevated from 0.9 to 1.9±0.04 (n=107). This suggests that LRRC8B pannexins (Abascal and Zardoya, 2012; Choi et al., 2016; Kubota affected Ca2+ release from the ER stores. To confirm this hypothesis et al., 2004; Kumar et al., 2014; Sawada et al., 2003). Pannexins further, we activated IP3 receptors (IP3Rs) directly by injecting IP3 have been shown to participate in Ca2+ homeostasis by forming in cells through a patch pipette. Pipette solution containing 50 µM 2+ channels in the plasma membrane that release ATP (Bao et al., IP3 raised the F340/380 of Fura 2-loaded cells (bathed in Ca -free 2004). Extracellular ATP, in turn, increases intracellular Ca2+ ECF) immediately after ‘whole cell’ formation (Fig. S1A,B). Such a 2+ through the activation of purinergic receptors. Additionally, rise in the [Ca ]c was observed only when pipette solution 2+ pannexin 1 and 3 have been shown to form Ca -permeable contained IP3.
Load more

Recommended publications
  • The LRRC8A:C Heteromeric Channel Is a Cgamp Transporter and the Dominant
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.948273; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The LRRC8A:C Heteromeric Channel Is a cGAMP Transporter and the Dominant cGAMP Importer in Human Vasculature Cells Lauren J. Lahey1,2, Xianlan Wen3, Rachel E. Mardjuki2,4, Volker Böhnert2,5, Christopher Ritchie2,5, Jacqueline A. Carozza2,4, Gaelen T. Hess2,6, Merritt Maduke3, Michael C. Bassik2,6, and Lingyin Li2,5,7,* 1Biophysics Program, 2Stanford ChEM-H, 3Department of Molecular and Cellular Physiology, 4Department of Chemistry, 5Department of Biochemistry, 6Department of Genetics, Stanford University School of Medicine, Stanford, CA 94305 USA. 7Lead Contact *Correspondence: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.948273; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SUMMARY Extracellular 2'3'-cyclic-GMP-AMP (cGAMP) is an immunotransmitter secreted by cancer cells and taken up by host cells to activate the anti-cancer STING pathway. No cGAMP exporter has been identified, and SLC19A1, a recently identified cGAMP importer, does not account for the import actiVity in most cell types. Here, we identify the LRRC8A:C heteromeric channel, a volume-regulated anion channel (VRAC), as a cGAMP transporter. This channel mediates cGAMP import or export depending on the cGAMP chemical gradient. cGAMP influences anion influx through VRAC, indicating it is likely a direct substrate of the channel.
    [Show full text]
  • Selective Transport of Neurotransmitters and Modulators by Distinct Volume-Regulated LRRC8 Anion Channels Darius Lutter1,2,3, Florian Ullrich1,2, Jennifer C
    © 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 1122-1133 doi:10.1242/jcs.196253 RESEARCH ARTICLE Selective transport of neurotransmitters and modulators by distinct volume-regulated LRRC8 anion channels Darius Lutter1,2,3, Florian Ullrich1,2, Jennifer C. Lueck1,2,3, Stefan Kempa2 and Thomas J. Jentsch1,2,4,* ABSTRACT volume regulation (Jentsch, 2016; Nilius et al., 1997; Pedersen In response to swelling, mammalian cells release chloride and et al., 2016). This plasma membrane channel, which appears to be organic osmolytes through volume-regulated anion channels expressed in all cells, is normally closed but can be activated by cell swelling or other cellular signaling cascades. In most cells, VRAC (VRACs). VRACs are heteromers of LRRC8A and other LRRC8 − isoforms (LRRC8B to LRRC8E), which are co-expressed in HEK293 opening leads to an efflux of Cl , which, together with an efflux of + + and most other cells. The spectrum of VRAC substrates and its K through independent K channels, lowers the intracellular dependence on particular LRRC8 isoforms remains largely unknown. osmolarity and, by secondarily driving water efflux, results in We show that, besides the osmolytes taurine and myo-inositol, regulatory volume decrease. Cell swelling also stimulates an efflux ‘ ’ myo LRRC8 channels transport the neurotransmitters glutamate, of organic osmolytes such as -inositol, taurine and glutamate. aspartate and γ-aminobutyric acid (GABA) and the co-activator It was controversial whether this release occurs through VRAC or D-serine. HEK293 cells engineered to express defined subsets of through a distinct channel named VSOAC (for volume-sensitive LRRC8 isoforms were used to elucidate the subunit-dependence organic osmolyte/anion channel) (Jackson and Strange, 1993; of transport.
    [Show full text]
  • The LRRC8A:C Heteromeric Channel Is a Cgamp Transporter and the Dominant Cgamp Importer in Human Vasculature Cells
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.948273; this version posted March 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The LRRC8A:C Heteromeric Channel Is a cGAMP Transporter and the Dominant cGAMP Importer in Human Vasculature Cells Lauren J. Lahey1,2, Xianlan Wen3, Rachel E. Mardjuki2,4, Volker Böhnert2,5, Gaelen T. Hess2,6, Christopher Ritchie2,5, Jacqueline A. Carozza2,4, Merritt Maduke3, Michael C. Bassik2,6, and Lingyin Li2,5,7,* 1Biophysics Program, 2Stanford ChEM-H, 3Department of Molecular and Cellular Physiology, 4Department of Chemistry, 5Department of Biochemistry, 6Department of Genetics, Stanford University, School of Medicine, Stanford, CA 94305 USA. 7Lead Contact *Correspondence: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.948273; this version posted March 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SUMMARY Extracellular 2'3'-cyclic-GMP-AMP (cGAMP) is an immunotransmitter secreted by cancer cells and taken up by host cells to activate the anti-cancer STING pathway. No cGAMP exporter has been identified, and SLC19A1, a recently identified cGAMP importer, does not account for the import actiVity in most cell types. Here, we identify the LRRC8A:C heteromeric channel, a volume-regulated anion channel (VRAC), as a cGAMP transporter. This channel mediates cGAMP import or export depending on the cGAMP chemical gradient, and channel activation or inhibition modulates cGAMP transport.
    [Show full text]
  • Leucine-Rich Repeat Containing 8A Contributes to the Expansion Of
    © 2020. Published by The Company of Biologists Ltd | Biology Open (2020) 9, bio048264. doi:10.1242/bio.048264 RESEARCH ARTICLE Leucine-rich repeat containing 8A contributes to the expansion of brain ventricles in zebrafish embryos Yen-Tzu Tseng1, Chun-Lin Ko1, Chia-Teng Chang1, Yen-Hua Lee1, Wei-Chun Huang Fu2 and I-Hsuan Liu1,3,4,* ABSTRACT outwardly rectifying Cl− current and consequently an RVD when The sodium osmotic gradient is necessary for the initiation of brain cells were exposed to hypotonic solutions (Cahalan and Lewis, 1988; ventricle inflation, but a previous study predicted that organic and Hazama and Okada, 1988). Later, organic osmolytes such as inorganic osmolytes play equivalently important roles in osmotic taurine were considered accountable for at least half of the total homeostasis in astrocytes. To test whether organic osmoregulation RVD, and hence a putative volume-sensitive organic osmolyte/anion also plays a role in brain ventricle inflation, the core component for channel (VSOAC) was proposed for this activity (Garcia-Romeu volume-regulated anion and organic osmolyte channel, lrrc8a,was et al., 1991; Jackson and Strange, 1993; Strange and Jackson, 1995). investigated in the zebrafish model. RT-PCR and whole-mount in situ Due to the pharmacological similarity and controversial experimental hybridization indicated that both genes were ubiquitously expressed results, the question of whether VRAC is identical to VSOAC was through to 12 hpf, and around the ventricular layer of neural tubes and once a highly debated issue (Díaz et al., 1993; Kirk and Kirk, 1994; the cardiogenic region at 24 hpf. Knocking down either one lrrc8a Lambert and Hoffmann, 1994; Sanchez-Olea et al., 1995; Shennan paralog with morpholino oligos resulted in abnormalities in circulation et al., 1994).
    [Show full text]
  • Unexplored Therapeutic Opportunities in the Human Genome
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Rev Manuscript Author Drug Discov. Author Manuscript Author manuscript; available in PMC 2019 January 19. Published in final edited form as: Nat Rev Drug Discov. 2018 May ; 17(5): 317–332. doi:10.1038/nrd.2018.14. Unexplored therapeutic opportunities in the human genome Tudor I. Oprea1,2,3,4,*, Cristian G. Bologa1, Søren Brunak4, Allen Campbell5, Gregory N. Gan2, Anna Gaulton6, Shawn M. Gomez7,8, Rajarshi Guha9, Anne Hersey6, Jayme Holmes1, Ajit Jadhav9, Lars Juhl Jensen4, Gary L. Johnson8, Anneli Karlson6,20, Andrew R. Leach6, Avi Ma’ayan10, Anna Malovannaya11, Subramani Mani1, Stephen L. Mathias1, Michael T. McManus12, Terrence F. Meehan6, Christian von Mering13, Daniel Muthas14, Dac-Trung Nguyen9, John P. Overington6,21, George Papadatos6,22, Jun Qin11, Christian Reich15, Bryan L. Roth8, Stephan C. Schürer16, Anton Simeonov9, Larry A. Sklar2,17,18, Noel Southall9, Susumu Tomita19, Ilinca Tudose6,23, Oleg Ursu1, Dušica Vidovic16, Anna Waller17, David Westergaard4, Jeremy J. Yang1, and Gergely Zahoránszky-Köhalmi1,24 1Department of Internal Medicine, University of New Mexico School of Medicine, Albuquerque, NM, USA. 2UNM Comprehensive Cancer Center, Albuquerque, NM, USA. 3Department of Rheumatology and Inflammation Research, Institute of Medicine, Sahlgrenska Academy at * [email protected]. Competing interests The authors declare competing interests: see Web version for details. Publisher’s note Springer Nature remains neutral with regard to jurisdictional
    [Show full text]
  • LRRC8B (NM 015350) Human Tagged ORF Clone – RC205553
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC205553 LRRC8B (NM_015350) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: LRRC8B (NM_015350) Human Tagged ORF Clone Tag: Myc-DDK Symbol: LRRC8B Synonyms: TA-LRRP; TALRRP Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 LRRC8B (NM_015350) Human Tagged ORF Clone – RC205553 ORF Nucleotide >RC205553 representing NM_015350 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATTACACTAACTGAGCTAAAATGCTTAGCAGATGCTCAGTCATCTTATCACATCTTAAAACCATGGT GGGACGTCTTCTGGTATTACATCACACTGATCATGCTGCTGGTGGCCGTGCTGGCCGGAGCTCTCCAGCT GACGCAGAGCAGGGTTCTGTGCTGTCTTCCATGCAAAGTGGAATTTGACAATCACTGTGCCGTGCCTTGG GACATCCTGAAAGCCAGCATGAACACATCCTCTAATCCTGGGACACCGCTTCCGCTCCCCCTCCGAATTC AGAATGACCTCCACCGACAGCAGTACTCCTATATTGATGCCGTCTGTTACGAGAAACAGCTCCATTGGTT TGCAAAGTTTTTCCCCTATCTGGTGCTCTTGCACACGCTCATCTTTGCAGCCTGCAGCAACTTTTGGCTT CACTACCCCAGTACCAGTTCCAGGCTCGAGCATTTTGTGGCCATCCTTCACAAGTGCTTCGATTCTCCAT GGACCACCCGCGCCCTTTCAGAAACAGTGGCTGAGCAGTCAGTGAGGCCTCTGAAACTCTCCAAGTCCAA GATTTTGCTTTCGTCCTCAGGGTGTTCAGCTGACATAGATTCCGGCAAACAGTCATTGCCCTACCCACAG
    [Show full text]
  • LRRC8B (NM 015350) Human Tagged ORF Clone – RC205553L4
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC205553L4 LRRC8B (NM_015350) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: LRRC8B (NM_015350) Human Tagged ORF Clone Tag: mGFP Symbol: LRRC8B Synonyms: TA-LRRP; TALRRP Vector: pLenti-C-mGFP-P2A-Puro (PS100093) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC205553). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_015350 ORF Size: 2409 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 LRRC8B (NM_015350) Human Tagged ORF Clone – RC205553L4 OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at [email protected] or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g.
    [Show full text]
  • Structure of the Human Volume Regulated Anion Channel
    RESEARCH ARTICLE Structure of the human volume regulated anion channel Jennifer M Kefauver1,2, Kei Saotome1,2†, Adrienne E Dubin1†, Jesper Pallesen2, Christopher A Cottrell2, Stuart M Cahalan1‡, Zhaozhu Qiu3§#, Gunhee Hong1, Christopher S Crowley2,4, Tess Whitwam1, Wen-Hsin Lee2, Andrew B Ward2*, Ardem Patapoutian1* 1Department of Neuroscience, Howard Hughes Medical Institute, The Scripps Research Institute, La Jolla, United States; 2Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, United States; 3Genomics Institute of the Novartis Research Foundation, San Diego, United States; 4Department of Dermatology, University of California, San Diego, San Diego, United States *For correspondence: [email protected] (ABW); [email protected] (AP) Abstract SWELL1 (LRRC8A) is the only essential subunit of the Volume Regulated Anion Channel † (VRAC), which regulates cellular volume homeostasis and is activated by hypotonic solutions. These authors contributed equally to this work SWELL1, together with four other LRRC8 family members, potentially forms a vastly heterogeneous cohort of VRAC channels with different properties; however, SWELL1 alone is also functional. Here, ‡ Present address: Vertex we report a high-resolution cryo-electron microscopy structure of full-length human homo- Pharmaceuticals, San Diego, hexameric SWELL1. The structure reveals a trimer of dimers assembly with symmetry mismatch United States; §Department of between the pore-forming domain and the cytosolic leucine-rich repeat (LRR) domains. Importantly, Physiology, Johns Hopkins mutational analysis demonstrates that a charged residue at the narrowest constriction of the University School of Medicine, Baltimore, United States; homomeric channel is an important pore determinant of heteromeric VRAC. Additionally, a #Solomon H. Snyder Department mutation in the flexible N-terminal portion of SWELL1 affects pore properties, suggesting a of Neuroscience, Johns Hopkins putative link between intracellular structures and channel regulation.
    [Show full text]
  • SWELL1 Is a Regulator of Adipocyte Size, Insulin Signaling and Glucose Homeostasis
    SWELL1 is a regulator of adipocyte size, insulin signaling and glucose homeostasis The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Zhang, Y., L. Xie, S. K. Gunasekar, D. Tong, A. Mishra, W. J. Gibson, C. Wang, et al. 2017. “SWELL1 is a regulator of adipocyte size, insulin signaling and glucose homeostasis.” Nature cell biology 19 (5): 504-517. doi:10.1038/ncb3514. http://dx.doi.org/10.1038/ ncb3514. Published Version doi:10.1038/ncb3514 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:34492391 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Cell Manuscript Author Biol. Author manuscript; Manuscript Author available in PMC 2017 October 24. Published in final edited form as: Nat Cell Biol. 2017 May ; 19(5): 504–517. doi:10.1038/ncb3514. SWELL1 is a regulator of adipocyte size, insulin signaling and glucose homeostasis Yanhui Zhang1, Litao Xie1, Susheel K. Gunasekar1, Dan Tong1, Anil Mishra1, William J. Gibson2, Chuansong Wang3, Trevor Fidler4, Brodie Marthaler1, Aloysius Klingelhutz5, E. Dale Abel4, Isaac Samuel6, Jessica K. Smith6, Lei Cao3, and Rajan Sah1,4,* 1Department of Internal Medicine, Division of Cardiovascular Medicine, University of Iowa, Carver College of Medicine, Iowa City, IA, 52242 2Harvard Medical School, Boston, MA, 02115 3Department of Cancer Biology and Genetics, The Ohio State University, Columbus, Ohio 4Fraternal Order of the Eagles Diabetes Research Center, Iowa City, IA, 52242 5Department of Microbiology, University of Iowa, Carver College of Medicine, Iowa City, IA, 52242 6Department of Surgery, University of Iowa, Carver College of Medicine, Iowa City, IA, 52242 SUMMARY Adipocytes undergo considerable volumetric expansion in the setting of obesity.
    [Show full text]
  • LRRC8B Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP57072
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 LRRC8B Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP57072 Specification LRRC8B Polyclonal Antibody - Product Information Application IHC-P, IHC-F, IF, ICC Primary Accession Q6P9F7 Reactivity Rat, Pig, Cow Host Rabbit Clonality Polyclonal Calculated MW 92390 LRRC8B Polyclonal Antibody - Additional Information Gene ID 23507 Other Names Volume-regulated anion channel subunit LRRC8B, Leucine-rich repeat-containing protein 8B, T-cell activation leucine repeat-rich protein {ECO:0000303|Ref.1}, TA-LRRP {ECO:0000303|Ref.1}, LRRC8B {ECO:0000303|PubMed:22532330, ECO:0000312|HGNC:HGNC:30692} Format 0.01M TBS(pH7.4) with 1% BSA, 0.09% (W/V) sodium azide and 50% Glyce Storage Store at -20 ℃ for one year. Avoid repeated freeze/thaw cycles. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 ℃. LRRC8B Polyclonal Antibody - Protein Information Name LRRC8B {ECO:0000303|PubMed:22532330, ECO:0000312|HGNC:HGNC:30692} Function Non-essential component of the volume-regulated anion channel (VRAC, also named VSOAC channel), an anion Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 channel required to maintain a constant cell volume in response to extracellular or intracellular osmotic changes (PubMed:<a h ref="http://www.uniprot.org/citations/24790 029" target="_blank">24790029</a>, PubMed:<a href="http://www.uniprot.org/ci tations/26824658" target="_blank">26824658</a>, PubMed:<a href="http://www.uniprot.org/ci tations/28193731" target="_blank">28193731</a>).
    [Show full text]
  • Us 2018 / 0305689 A1
    US 20180305689A1 ( 19 ) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2018 /0305689 A1 Sætrom et al. ( 43 ) Pub . Date: Oct. 25 , 2018 ( 54 ) SARNA COMPOSITIONS AND METHODS OF plication No . 62 /150 , 895 , filed on Apr. 22 , 2015 , USE provisional application No . 62/ 150 ,904 , filed on Apr. 22 , 2015 , provisional application No. 62 / 150 , 908 , (71 ) Applicant: MINA THERAPEUTICS LIMITED , filed on Apr. 22 , 2015 , provisional application No. LONDON (GB ) 62 / 150 , 900 , filed on Apr. 22 , 2015 . (72 ) Inventors : Pål Sætrom , Trondheim (NO ) ; Endre Publication Classification Bakken Stovner , Trondheim (NO ) (51 ) Int . CI. C12N 15 / 113 (2006 .01 ) (21 ) Appl. No. : 15 /568 , 046 (52 ) U . S . CI. (22 ) PCT Filed : Apr. 21 , 2016 CPC .. .. .. C12N 15 / 113 ( 2013 .01 ) ; C12N 2310 / 34 ( 2013. 01 ) ; C12N 2310 /14 (2013 . 01 ) ; C12N ( 86 ) PCT No .: PCT/ GB2016 /051116 2310 / 11 (2013 .01 ) $ 371 ( c ) ( 1 ) , ( 2 ) Date : Oct . 20 , 2017 (57 ) ABSTRACT The invention relates to oligonucleotides , e . g . , saRNAS Related U . S . Application Data useful in upregulating the expression of a target gene and (60 ) Provisional application No . 62 / 150 ,892 , filed on Apr. therapeutic compositions comprising such oligonucleotides . 22 , 2015 , provisional application No . 62 / 150 ,893 , Methods of using the oligonucleotides and the therapeutic filed on Apr. 22 , 2015 , provisional application No . compositions are also provided . 62 / 150 ,897 , filed on Apr. 22 , 2015 , provisional ap Specification includes a Sequence Listing . SARNA sense strand (Fessenger 3 ' SARNA antisense strand (Guide ) Mathew, Si Target antisense RNA transcript, e . g . NAT Target Coding strand Gene Transcription start site ( T55 ) TY{ { ? ? Targeted Target transcript , e .
    [Show full text]
  • Identification of LRRC8 Heteromers As an Essential Component of The
    Reports show that VRAC represents a distinct class of anion channels that also con- Identification of LRRC8 Heteromers as duct organic osmolytes. To identify VRAC, we opted for a an Essential Component of the genome-wide RNA interference screen that could identify non-redundant VRAC components. Swelling-induced Volume-Regulated Anion Channel iodide influx into HEK cells expressing the iodide-sensitive yellow fluorescent VRAC protein YFP(H148Q/I152L) (17) was used as read-out in a fluorometric imag- Felizia K. Voss,1,2,3 Florian Ullrich,1,2,3 Jonas Münch,1,2,3 Katina Lazarow,1 Darius ing plate reader (Fig. 1A). Exposure to Lutter,1,2,3 Nancy Mah,2 Miguel A. Andrade-Navarro,2 Jens P. von Kries,1 Tobias saline containing 50 mM iodide en- Stauber,1,2* Thomas J. Jentsch1,2,4* tailed a slow fluorescence decay under isotonic conditions, whereas hypotonic- 1Leibniz-Institut für Molekulare Pharmakologie (FMP), Berlin. 2Max-Delbrück-Centrum für Molekulare ity induced a delayed increase in YFP 3 4 Medizin (MDC), Berlin. Graduate program of the Freie Universität Berlin. Neurocure, Charité quenching (Fig. 1B) that could be re- Universitätsmedizin, Berlin. duced by VRAC inhibitors like carbe- *Corresponding author. E-mail: [email protected] (T.J.J.); [email protected] (T.S.) noxolone (18) (fig. S1). In a prescreen targeting 21 anion transporters (table - - Regulation of cell volume is critical for many cellular and organismal functions, yet S1), only siRNAs against the Cl /HCO3 the molecular identity of a key player, the volume-regulated anion channel VRAC, exchanger AE2 gave significant effects has remained unknown.
    [Show full text]