FCUP i Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

“Black among black shadows” Gilbert Blaine, 1922

FCUP ii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP iii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Foreword

In compliance with the no. 2 of article 4 of the General Regulation of Third Cycles of the University of Porto and with article 31 of the Decree-Law no. 74/2006, of 24 March, with the alteration introduced by the Decree-Law no. 230/2009, of 14 September, the results of already published work were totally used and included in some of the chapters of this dissertation. As these studies were performed in collaboration with other authors, the candidate clarifies that, in all these works, participated in obtaining, interpreting, analysing and discussing the results, as well as in the writing of the published forms.

This thesis should be cited as: Vaz Pinto P (2018) Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani). Insights into its phylogeography, population genetics, demography and conservation. PhD Thesis, University of Porto, Porto, Portugal.

FCUP iv Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP v Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Aknowledgements

This dissertation is a milestone on a long, yet unfinished, journey that I have initiated many years back in the wonderful Angolan bush, and it would not have been possible without a vast array of contributions from many friends. I will try my best to recognize here at least some of the most relevant contributors.

First and foremost to my supervisor Nuno Ferrand, for his brilliance, friendship and enthusiasm while guiding me through this enterprise, and also by adding new layers to my views of the natural world. But most of all because he came up with the idea and convinced me to do the PhD, so quite literally, this work could never have materialized without Nuno.

To my co-supervisor Raquel Godinho, for her guidance, patience and warm hospitality. She forced me to raise my standards, and her pragmatic and hard-working attitude was inspirational and proved crucial for the success of this work. To my informal co- supervisor Pedro Beja for sharing his knowledge and adding several key contributions in critical stages.

I must address special thanks to Luis Veríssimo, with whom I have shared so many brainstorms that provided answers to outstanding questions and new lines of research. And Luis has always been available, donated some of his free time, and ended up kindly producing the majority of maps presented in this work. Also to Joana Rocha for spearheading many tasks in several papers, and to Hugo Fernandes for his artwork.

Thank you, to my good friend Filippo Nardin, who has always been there for me and provided critical assistance at various stages of this work.

To my friend Vladimir Russo, for his cool head and by putting down numerous “fires”. To Sendi Baptista for being a wonderful companion and precious collaborator in so many bush trips. To Abias Huongo, for his friendship and precious assistance.

A very special thank you to generals João Traguedo and Afonso Hanga for their friendship, unrelentless continuing support to my work and to the giant sable conservation, and commitment to the cause.

I must also aknowledge my many other Angolan friends who were instrumental in different ways for the success of various stages related to the conservation project on the ground, starting with Kalunga Lima who I have deerly missed, Henriette Koning,

FCUP vi Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Wolfram and Werner Brock, Nito Rocha, Harold Roberts, João Sousa, Miguel Morais, Carlos Cunha, David Schaad and Kostadin Louchanski. They were always supportive.

The team of local shepherds and rangers in Cangandala and Luando played a decisive role on the ground throughout the project, and several have become friends. A special thanks is due to Manuel Sacaia, for his enthusiasm and good humour, with whom I hope to share many more camp fires in the wilderness under Angolan starry nights.

To Brian Huntley, Richard Estes, Jeremy Andersen and John Walker, for being inspirational and for having shared with me their passion and immense knowledge on the giant sable antelope. And I am hugely indebted to Peter Morkel for his incredible skills and professionalism, and for his truthful and unrestricted commitment to conservation. It has been a privilege to know all of you.

To all the staff at CIBIO, particularly at the lab in CTM, making the magic of transforming tiny biological samples into quantifiable data.

A special mention is due to Carina Matos, Dario Martins, Valdemar Pinto and rest of the staff at Kissama Foundation for their continuing support for many years.

To the Catholic University of Angola and all my good friends at CEIC.

To the Ministry of Environment and Provincial Government of Malanje for having authorized the various research lines, and to all the good people in these institutions that have supported the activities. And of course to the various branches of FAA, the Angolan military forces, in particular the air force, for the outstanding efforts that made possible some of the more challenging initiatives.

I must also express my sincere gratitude to the institutions that have contributed financially to various components of the project, namely Sonangol, Esso Angola, Angola LNG, Whitley Award, Tusk Trust, Fondation Segré. In Particular, Laurentino Silva, Bill Cummings, Fernando Pegado, Miguel Cordeiro, David Mallon have never doubted the value of the project from the onset and ensured continuation of support when needed.

The financial donations received from the ExxonMobil Foundation specifically addressed several of the research lines covered by this thesis, and proved to be a critical contribution to the end result.

Finally but not least to my dearest, to my recently deceased father for having exposed me to the bush and wildlife while I was still a little kid, and to my mother for having always been tolerant and supportive. And of course to my lovely wife Paula, and our wonderful kids Beatriz, Afonso, Margarida and Frederico. I hope this work will make them all proud.

FCUP vii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Summary

The African continent is renowned for a remarkable diversity of bovid taxa, the end product of an explosive taxonomic radiation that was sparked by environmental changes during the Miocene. Having adapted to the vast array of ecological niches present in Africa, extant members of this highly speciose family come in many forms and sizes, but arguably none is as rare, revered and poorly known as the giant sable antelope (Hippotragus niger variani), which occupies the centre stage of this dissertation. Described as late as in the early twentieth century, the giant sable has never been found outside a small region confined to the Kwanza River basin in central Angola, and in spite of carrying a high cultural and iconic value, it is also one of the most endangered mammals in the world. Because of its rarity, historical background and the recent political turmoil that affected the country, few studies have focused on this taxon and conservation has been neglected, these constituting critical shortfalls that the current thesis aims to address. On a wider level, the sable antelope could be seen as a model species for biogeographical studies in Africa because it is one of the most highly specialized antelopes, closely associated with particular habitats, and yet widely distributed across the continent. In addition, the economic interest on sable has boomed in recent years, becoming one of the most prized high value species for the fast-growing multi-million dollar game farming industry in Southern Africa. Despite its importance and the increasing attention received by researchers over the years, we have identified various gaps on the species knowledge. Recent studies have relied on mitochondrial DNA fragments and limited datasets to infer phylogeographic patterns and intraspecific taxonomy, yet the results may not have improved much on previous data published by zoologists before the advent of DNA and based on morphological analyses. By adopting new tools and expanding the sampling effort, we expect this dissertation will much improve current knowledge on the species.

Within this framework we started by targeting the conservation crisis facing the giant sable antelope in Angola. The use of new molecular tools, namely autosomal markers not yet available for Hippotragus was considered crucial, and by developing a panel of 57 species-specific microsatellites, also successfully tested on congeneric roan antelope H. equinus, we were able to address specific questions affecting the giant sable, and provide for the first time estimates of genetic diversity further interpreted within the context of other populations. These initial efforts evidenced the giant sable as being seriously depleted of genetic diversity when compared to other sable populations. In

FCUP viii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) addition, analyses of allele frequency spectrums and allele sharing between populations, proved to be consistent with an evolutionary history of giant sable characterized by population bottlenecks and long-standing isolation.

A more decisive application for these nuclear markers consisted in providing support to specific conservation initiatives already unfolding on the ground. Here we report on how the sustained use of extensive field research methods based on field, aerial and trap- camera surveys, combined with modern molecular tools, has uncovered and allowed the documentation in unprecedented detail, of a remarkable case of interspecific introgressive hybridization between giant sable and roan antelope in Cangandala National Park. We explore how hybridization was sustained for several years following a steep poaching-induced population crash that led to the extirpation of all giant sable bulls in Cangandala. By demonstrating and quantifying the extent of the phenomenon we illustrate how the lack of conspecific mates can function as a mechanism promoting hybridization and increasing the extinction risk to endangered populations. Concrete actions were also implemented to reverse the extinction vortex in Cangandala, and we document the management measures adopted, including the use of breeding enclosures, veterinarian intervention on the hybrids, chemical immobilization of animals, and translocations, which have ultimately promoted the giant sable recovery in the park.

In order to expand the focus of this work we used next-generation sequencing methods to capture complete mitochondrial sequences, and an extensive sampling effort allowed us to obtain hundreds of extant sable samples pooled from across the whole species range. The dataset was further enhanced by adding important historical samples that filled a few geographical gaps and provided us with highly informative temporal sequences. With these tools available we investigated sable phylogeographic patterns in much greater detail and resolution than had previously been possible, and were able to clarify outstanding questions. The existence of a highly divergent mitochondrial lineage in west Tanzania was reinterpreted as signature of a past introgressive event involving an extinct taxon, and in addition we identified three main lineages in sable that originated nine haplogroups. These haplogroups are remarkably clustered into six geographical groupings well delimitated by physical boundaries. Our findings are consistent with an evolutionary history of the species shaped by Pleistocene climatic oscillations, but also highlights the role of geomorphological barriers such as rifts, rivers and mountain chains. In particular we hypothesize that late Pleistocene rearrangements in the Zambezi drainage system may help explain some vicarance episodes inferred to have occurred in southern Africa. Surprisingly, the giant sable antelope was found to be part of a central African lineage, sharing a common maternal ancestry with sables

FCUP ix Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) currently present in Malawi and west Tanzania, and therefore we suggest that the lineage may have originated in the Congo basin.

Applying the panel of microsatellites on our dataset resulted in the first comprehensive population genetics study of H. niger. Our results confirmed that contemporary sable populations display strong structuring patterns induced by physical barriers and demographic processes. We were able to define five main and well-defined population clusters, largely concordant with results obtained with mitogenomes except for the region of east Zambia and Malawi where recent mitochondrial introgression is suggested. Patterns of differentiation observed are indicative of low levels of gene flow among the main clusters, but contact zones were identified in east Zambia and central Mozambique. These results point towards the discrimination of five taxa for an intraspecific taxonomy, strongly supporting the validity of H. n. niger, H. n. roosevelti, H. n. kirkii and H. n. variani, and suggesting that the west Tanzanian sable may in the future warrant subspecific status.

We have successfully extracted DNA and tested the famous and mysterious Florence horn, which proved to be the earliest known material ascribed to giant sable, and predating the subspecies description in over forty years. By amplifying mitogenomic sequences from other historical giant sable samples obtained in museums and private collections in Europe and America, we have quantified a relevant loss of diversity resulting from a recent bottleneck. Two main mitochondrial lineages were identified in giant sable, but one of them, represented in the Florence horn and a few other historical samples, survived at least until 1982 and yet appears now to be extinct. These findings underline how the use of modern molecular tools can enhance natural history collections, and stress the value of these collections to inform and assist in the conservation of endangered populations.

Globally, we believe that this dissertation makes a significant contribution to address the plight of the giant sable, by unveiling the evolutionary processes that shaped the natural history of this magnificent antelope, and by assisting the implementation of specific conservation measures on the ground and developing new and still ongoing lines of research. At species level, this work constitutes a major improvement on previous knowledge regarding evolutionary relationships, phylogeographic patterning, degrees of differentiation and gene flow, and intraspecific taxonomy. Interpreting these results on a wider scale may provide important insights to explain general patterns of vicariance and speciation, and inter-relationships among closely related populations that ultimately may help us to better understand the biogeography of the African continent.

FCUP x Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP xi Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Resumo

O continente Africano é conhecido pela sua notável diversidade de bovídeos, o produto final de uma radiação taxonómica explosiva que foi desencadeada por transformações ambientais durante o Mioceno. Tendo-se adaptado a uma vasta diversidade de nichos ecológicos existentes em África, os atuais membros desta especiosa família surgem em várias formas e tamanhos, mas possivelmente nenhum é tão raro, admirado e pouco conhecido como a palanca-negra-gigante (Hippotragus niger variani), espécie que desempenha o papel principal nesta dissertação. Descrita apenas no início do século XX, a palanca-negra-gigante ocorre apenas numa pequena região confinada à bacia do Rio Kwanza, no coração de Angola, e apesar de manter um elevado valor cultural e simbólico, é também um dos mamíferos mais ameaçados de extinção no mundo. Por causa da sua raridade, antecedentes históricos e recente agitação política que afetou o país, poucos estudos se focaram neste táxon e a sua conservação foi igualmente negligenciada, pelo que a presente tese pretende atenuar estas importantes limitações. Numa escala mais alargada, a palanca-negra pode ser vista como uma espécie modelo para estudos de biogeografia em África não apenas por ser um dos antílopes mais especializados, fortemente associado a habitats específicos, mas também pela sua extensa distribuição no continente. Adicionalmente, o interesse económico das palancas teve um grande incremento em anos recentes, ao tornar-se uma das espécies mais valiosas e procuradas pela milionária indústria das fazendas de caça na África Austral. Apesar da sua importância e da crescente atenção recebida por investigadores ao longo dos anos, foram identificadas várias falhas no conhecimento da espécie. Estudos recentes recorreram a fragmentos de DNA mitocondrial, mas os resultados podem não ter melhorado muito os publicados em trabalhos anteriores pela zoologia tradicional e baseados em análises morfológicas. Adotando novas ferramentas e expandindo o esforço de amostragem, espera-se que esta dissertação venha a constituir uma importante contribuição para o conhecimento da espécie.

Neste enquadramento começou-se por lidar com a crise de conservação enfrentada pela palanca-negra-gigante em Angola. O uso das novas ferramentas moleculares, nomeadamente marcadores autossómicos até então não disponíveis para os Hippotragus, foi considerado essencial, e através do desenvolvimento de um painel de 57 microsatélotes específicos para a espécie, também testados com sucesso na congenérica palanca-ruana H. equinus, tornou-se possível abordar questões

FCUP xii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) específicas que afectavam a palanca negra gigante, fornecendo pela primeira vez estimativas da sua diversidade genética e enquadradas no contexto de outras populações. Adicionalmente, análises dos espectros de frequências alélicas e partilha de alelos entre populações, revelaram-se consistentes com uma história evolutiva da palanca negra gigante caracterizada por estrangulamentos populacionais e isolamento geográfico prolongado.

Uma aplicação mais decisiva destes marcadores nucleares consistiu no auxílio a iniciativas de conservação específicas que já estavam a decorrer no terreno. Aqui reporta-se como o uso extensivo de métodos de campo baseados em levantamentos terrestres, aéreos e com recurso a câmaras ocultas, combinado com modernas técnicas moleculares, revelou e permitiu a documentação com um detalhe sem precedentes, de um notável caso de hibridação e introgressão interespecífica entre a palanca-negra- gigante e a palanca-ruana no Parque Nacional da Cangandala. Explora-se aqui como a hibridação se manteve por vários anos no seguimento de um colapso populacional severo causado por caça-furtiva e que levou ao desaparecimento de todos os machos reprodutores na Cangandala. Ao ser demonstrada e quantificada a extensão do fenómeno, ilustra-se como a ausência de reprodutores conspecíficos pode funcionar como um mecanismo promotor de hibridação e desta forma aumentar o risco de extinção de populações ameaçadas. Foram também adoptadas ações concretas, incluindo a construção de recintos para reprodução, intervenção veterinária nos híbridos, imobilização química de animais e translocações, que em última análise promoveram a recuperação das palancas-negras-gigantes no Parque Nacional.

De forma a expandir o âmbito deste trabalho foram utilizados métodos de sequenciação de nova-geração, e um amplo esforço de amostragem que nos permitiu obter centenas de amostras atuais de palancas provenientes de quase toda a sua área de distribuição. O conjunto de dados foi ainda reforçado adicionando importantes amostras históricas que preencheram algumas falhas geográficas e constituiram sequências temporais muito informativas. Com estas ferramentas disponíveis, foram investigados padrões de filogeografia na palanca com muito mais detalhe e maior resolução do que foi possível até aqui, clarificando-se desta forma questões pendentes. A existência de uma linhagem mitocondrial altamente divergente na Tanzânia ocidental foi reinterpretada como uma assinatura de um evento passado de introgressão envolvendo um táxon extinto, e permitiu ainda a identificação de três linhagens principais na palanca que deram origem a nove haplogrupos. Estes haplogrupos agruparam-se de forma notável em seis regiões geográficas bem delimitadas por barreiras físicas. Estes resultados são consistentes com uma história evolutiva da espécie moldada por oscilações climáticas do

FCUP xiii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Pleistoceno, mas também realçam o papel de barreiras geomorfológicas tais como rifts, rios e cadeias montanhosas. Em particular, é avançada como hipótese que rearranjos no sistema de drenagem do Zambeze no final do Pleistoceno podem ajudar a explicar alguns dos episódios de isolamento que se infere terem ocorrido na África Austral. Surpreendentemente, os dados mostraram que a palanca-negra-gigante é parte da linhagem central, partilhando um ancestral comum com palancas atualmente presentes no Malawi e Tanzânia ocidental, e assim sugerimos que esta linhagem pode ter tido origem na bacia do Congo.

A aplicação do painel de microsatellites ao conjunto de dados resultou no primeiro estudo abrangente de genética populacional em H. niger. Os resultados obtidos confirmaram que as populações de palanca-negra contemporâneas evidenciam fortes padrões de estruturação induzidos por barreiras físicas e processos demográficos. Foi possível definir cinco populações principais e bem-delineadas, largamente concordantes com os resultados obtidos com a mito-genómica excepto para a região do Malawi e Zâmbia oriental, onde uma introgressão mitocondrial recente é sugerida. Os padrões de diferenciação observados são indicativos de reduzidos valores de fluxo génico entre os principais agrupamentos populacionais, mas zonas de contacto foram identificadas na Zâmbia oriental e no centro de Moçambique. Estes resultados sugerem a discriminação de cinco taxa para uma taxonomia intraespecífica, dando forte suporte para a validade de H. n. niger, H. n. roosevelti, H. n. kirkii e H. n. variani, e sugerindo ainda que as palancas da Tanzânia ocidental poderão no futuro merecer estatuto subespecífico.

Foi extraído e testado com sucesso ADN do famoso e misterioso corno de Florença, que demonstrou ser o mais antigo material conhecido atribuído à palanca-negra- gigante, antecipando a descrição da subespécie em mais de quarenta anos. Através da amplificação de sequências mito-genómicas de outras amostras históricas de palanca- negra-gigante obtidas em museus e coleções privadas na Europa e América, foi possível quantificar uma relevante perda de diversidade genética resultantes de um estrangulamento populacional recente. Duas linhagens mitocondriais principais foram identificadas na palanca-negra-gigante, sendo que uma delas, representada no corno de Florença e nalgumas outras amostras históricas, sobreviveu pelo menos até 1982 mas parece estar agora extinta. Estes resultados sublinham como o uso de modernas ferramentas moleculares podem enriquecer as coleções de história natural, e reforçam o valor destas colecções para informar e auxiliar na conservação de populações ameaçadas.

FCUP xiv Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Globalmente, acreditamos que esta dissertação fornece uma contribuição decisiva para lidar com a situação dramática em que se encontra a palanca-negra-gigante, revelando os processos evolutivos que moldaram a história natural deste magnífico antílope, e ajudando na implementação de medidas específicas de conservação no terreno e no desenvolvimento de novas linhas de investigação e de outras ainda em curso. A nível da espécie, este trabalho constitui um avanço significativo em termos de conhecimento disponível relativamente às relações evolutivas, padrões filogeográficos, graus de diferenciação e fluxo génico, e taxonomia intraespecífica. A interpretação destes resultados a uma escala mais alargada pode providenciar importantes contribuições para explicar padrões gerais de isolamento e especiação, e inter-relações entre populações evolutivamente próximas, que em última análise podem ajudar a compreender melhor a biogeografia do continente Africano.

FCUP xv Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Keywords

Ancient DNA, Angola, antelope, bottleneck, conservation genetics, demography, giant sable, hybridization, Hippotragus equinus, Hippotragus niger variani, introgression, microsatellites, mtDNA, nuclear markers, phylogeography, population genetics

Palavras-chave

Angola, antílope, demografia, DNA antigo, efeito de gargalo, filogeografia, genética da conservação, genética populacional, hibridação, Hippotragus equinus, Hippotragus niger variani, introgressão, marcadores nucleares, microsatélites, mtDNA, palanca- negra-gigante

FCUP xvi Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP xvii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table of Contents

AKNOWLEDGEMENTS v

SUMMARY vii RESUMO xi KEYWORDS/ PALAVRAS-CHAVE xv LIST OF TABLES AND FIGURES xix ABBREVIATIONS xxv

CHAPTER 1 – General Introduction 1

1.1. The giant sable antelope 3 1.1.1. General description 3 1.1.2. Discovery, hunting and the onset of conservation 5 1.1.3. Research under colonial rule 10 1.1.4. Historical distribution and population estimations 11 1.1.5. Biology 13 1.1.6. Cultural significance 16 1.2. Conservation crisis 17 1.2.1. Population collapse and rediscovery 18 1.2.2. Interspecific hybridization in Cangandala NP 19 1.3. Horse-like antelopes 22 1.3.1. Evolution of the genus Hippotragus 23 1.3.2. Roan and sable antelopes 26 1.3.3. Intraspecific taxonomy 31 1.4. Modern tools for Hippotragus evolutionary biology 35 1.4.1. Molecular markers 35 1.4.2. Molecular research on Hippotragus 38 1.5. Objectives and organization of the thesis 42 1.6. References 45

CHAPTER 2 – Consequences of a population collapse 61

Paper I – First estimates of genetic diversity for the highly endangered giant sable antelope using a set of 57 microsatellites 63 Paper II – Hybridization following population collapse in a critically endangered antelope 81 CHAPTER 3 – Sable phylogeographic patterns and population structuring 105

Paper III – Phylogeography of sable antelope shaped by geomorphology and climate 107 Paper IV – Population structure and differentiation patterns of sable antelope 155

FCUP xviii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

CHAPTER 4 – The giant sable in natural history collections 197

Paper V – Molecular contribution to resolve the origin of the mysterious Florence horn 199

CHAPTER 5 – General Discussion 211

5.1. Evolutionary history of Hippotragus niger 213 5.1.1. Evidence for an extinct taxon 213 5.1.2. Diversification and structuring 216 5.1.3. Factors shaping evolution of sable since the Pleistocene 220 5.1.1. Insights into the intraspecific taxonomy 230 5.1.5. Explaining Hippotragus niger variani 233 5.2. Managing the conservation crisis in Cangandala NP 236 5.2.1. Introgressive hybridization between giant sable and roan 238 5.2.2. Population recovery 241 5.3. Demographic trends in giant sable 243 5.3.1. Unravelling the giant sable population crash 244 5.3.2. Consequences of the bottleneck 248 5.4. The role of natural history collections 250 5.4.1. Contribution of NHC for sable molecular studies 251 5.4.2. The remarkable case of the Florence horn 252 5.5. Final considerations 253 5.5.1. Conservation of giant sable 254 5.5.2. Ecology and spatial use by giant sable 256 5.5.3. Future prospects 259 5.6. References 260

FCUP xix Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

List of Tables and Figures

CHAPTER 1 – General Introduction

Fig. 1.1 – Giant sable bull in Luando Nature Reserve 3

Fig. 1.2 – Typical sable skull compared with giant sable skull 4

Fig. 1.3 – Sizes of sable trophy horns in Rowland Ward’s record book 5

Fig. 1.4 – The Florence horn and museum label 6

Fig. 1.5 – Sable head drawing from original description 7

Fig. 1.6 – Photos of hunting trips in Angola, (a) Anita Curtis with bull shot, and (b) Count of Yebes with world trophy record 9

Fig. 1.7 – Researchers monitoring the giant sable in the 1970s 10

Fig. 1.8 – Map with location of the giant sable reserves in Angola 12

Fig. 1.9 – Images depicting habitat, (a) aerial view of woodlands in Luando, and (b) anhara covered with geoxyle vegetation 13

Fig. 1.10 – Feeding sequences, (a) bull browsing on leaves, and (b) herd with calves browsing on geoxyles 14

Fig. 1.11 – Aerial view of giant sable herd in Luando 15

Fig. 1.12 – Giant sable herd recorded by trap camera in Cangandala NP 19

Fig. 1.13 – Hybrids sableXroan, (a) Female hybrid from Kruger NP, and (b) hybrids recorded with trap camera in Cangandala NP 21

Fig. 1.14 – Cladogram representing phylogenetic relationships among extant Hippotragini 22

Fig. 1.15 – Plate depicting head of extinct bluebuck 25

Fig. 1.16 – Drawings representing heads of roan and giant sable 26

Fig. 1.17 – Maps showing the main phytocorias of the African savanna biome and ecoregions, superimposed on the distributions of (a) Roan, and (b) sable 30

Fig. 1.18 – Distribution maps with subspecies of (a) roan, and (b) sable 33

FCUP xx Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 1.19 – Cladograms representing intraspecific phylogenies adapted from previous efforts, for (a) roan, and (b) sable 39

CHAPTER 2 – Consequences of a population collapse

Paper I

Table 1 – Genetic diversity measures for three populations of H. niger and one sample of H. equinus, based on microsatellites 67

Fig. 1 – Allele frequency spectrum obtained from 57 and 54 microsatellites for three H. niger populations and one H. equinus sample 68

Supplementary Information

Table S1 – Genebank accession number, primer sequences, repeat motif dye, and multiplex conditions of 57 msats for H. niger 73

Table S2 – Genetic diversity measures by locus for three populations of H. niger and for H. equinus, based on microsatellites 77

Table S3 – Loci with Linkage Desiquilibrium 79

Paper II

Fig. 1 – Distribution of sable and roan in Africa, and study area 83

Fig. 2 – Temporal variation in population size and births of giant sable and hybrids in Cangandala NP 90

Fig. 3 – Schematic representation of diagnostic field characteristics of giant sable, roan, hybrids and backcrosses in CNP 91

Fig. 4 – Genetic evidence for sable X roan hybridization in CNP, with (a) first and second components of a principal component analyses, and (b) individual assignment to genetic clusters inferred by Bayesian analyses, with program Structure 92

Supplementary Information

Fig. S1 – Photos obtained from camera trapping in the study area 101

Fig. S2 – Different stages of the giant sable translocation program 102

Table S1 – Quantification of camera trapping data during the study 103

FCUP xxi Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S2 – Genetic diversity measures for populations of H. niger and for H. equinus, based on 51 microsatellites 103

Table S3 – Inferred ancestry of sableXroan hybrids in Cangandala NP 104

CHAPTER 3 – Sable phylogeographic patterns and population structuring

Paper III

Fig. 1 – Distribution range of H. niger and origin of samples 114

Fig. 2 – Neighbor-Net network based on uncorrected patristic distances in SplitsTree excluding sites with insertions/ deletions 115

Table 1 – Genetic diversity summary statistics based on complete mtDNA genome sequences 116

Fig. 3 – Medium-joining networks based on complete mtDNA sequences for each of the different geographic genetic groups 117

Table 2 – Median time for the most recent common ancestor and 95% Highest posterior density intervals 118

Fig. 4 – Evolutionary history of sable lineages across the species range and in relation to geographical features in Africa 121

Supplementary Information

Table S1 – List of modern samples with country and population 140

Table S2 – List of historic samples with age, country and population 148

Table S3 – Priors used for Bayesian analyses of divergence times 149

Table S4 – Genetic distances between different H. niger lineages 150

Table S5 – Genetic diversity summary statistics and standard deviations based on complete mtDNA genomes 150

Table S6 – Genetic diversity summary statistics and standard deviations for the highly divergent mtDNA sequences in Tanzania 151

Fig. S1 – Bayesian phylogenetic tree for 215 H. niger and 2 H. equinus based on whole mitochondrial genomes 152

Fig. S2 – Ratio of transitions for modern and historical samples 153

FCUP xxii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Paper IV

Fig. 1 – Population structure in pie charts and sable sample locations 162

Fig. 2 – Population substructure in pie charts for the main groups found in SplitsTree excluding sites with insertions/ deletions 163

Table 1 – Measures of genetic diversity by main groups and subgroups 164

Fig. 3 – Scatterplot of the first two principal components of DAPC evidencing the five genetic clusters considered 166

Fig. 4 – Scatterplot of the first two principal components of DAPC for nine subgroups, excluding Angolan and Tanzanian sable 167

Fig. 5 – Cavalli-Sforza network based on 50 microsatellites, showing the genetic subdivision in 12 subgroups 168

Table 2 – Genetic differentiation (Pairwise Fst) among the main groups 168

Table 3 – Hierarchical analyses of molecular variance (AMOVA) examining the partinioning of genetic variation 169

Supplementary Information

Table S1 – Geographic origin, group assignment and sample size 188

Table S2 – Hardy-Weinberg calculations performed with ARLEQUIN 190

Table S3 – List of localities and average likelihood (Qi) of individual assignment by origin to the five main clusters 191

Table S4 – Genetic differentiation (Pairwise Fst) among 12 subgroups 193

Table S5 – Results for the Mantel Test to determine isolation by distance within the five main sable groups 193

Fig. S1 – (a) Posterior likelihood values (LK) and (b) ΔK, for 10 independent Structure runs for the whole dataset 193

Fig. S2 – (a) Posterior likelihood values (LK) and (b) ΔK, for 10 independent Structure runs for the Southern population 194

Fig. S3 – (a) Posterior likelihood values (LK) and (b) ΔK, for 10 independent Structure runs for the Eastern population 194

FCUP xxiii Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. S4 – (a) Posterior likelihood values (LK) and (b) ΔK, for 10 independent Structure runs for the Zambian population 194

Fig. S5 – (a) Posterior likelihood values (LK) and (b) ΔK, for 10 independent Structure runs for the West Tanzanian population 195

Fig. S6 – (a) Posterior likelihood values (LK) and (b) ΔK, for 10 independent Structure runs for the Angolan population 195

CHAPTER 4 – The giant sable in natural history collections

Paper V

Fig. 1 – (a) The Florence horn, and (b) aerial photo of a giant sable bull 201

Table 1 – List of contemporary samples with origin and subspecies 203

Table 2 – List of historical samples with age, origin and subspecies 204

Fig. 2 – Maximum likelihood tree for the Florence horn and 32 sables based on whole mitochondrial genomes 205

CHAPTER 5 – General Discussion

Fig. 5.1 – Schematic representation of mitochondria capture following hybridization and introgression 215

Fig. 5.2 – Schematic representation of mitochondrial diversification within sable based on whole mitochondrial genomes 218

Fig. 5.3 – Sable distribution and clustering based on (a) mtDNA, and (b) microsatellites 219

Fig. 5.4 – Reconstruction of southern hemisphere palaeoclimates 222

Fig. 5.5 – Main African geomorphological features that have influenced sable diversification and current distribution 225

Fig. 5.6 – Distribution of major 5 sable populations and 12 subpopulations in relation to major geophysical features 228

Fig. 5.7 – Graphic representation proposed and traditional taxonomy, in

relation to results obtained from mtDNA and microsatellites 232

FCUP xxiv Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5.8 – Giant sable areas overlaying detailed maps of (a) soils, and (a) tree cover and vegetation 236

Fig. 5.9 – Images of sable X roan hybrid backcrosses 241

Fig. 5.10 – Recent demography of sables and hybrids in CNP 242

Fig. 5.11 – Current and historical range of giant sable and haplotype network, based on whole mitochondrial genomes 245

Fig. 5.12 – Core areas of historical distribution of giant sable in LNSR 247

Table 5.1 – Measures of genetic diversity in giant sable, comparing nuclear and mtDNA, CNP and LNSR, recent and historical 248

Fig. 5.13 – Accessing giant sable historical material: (a) museum skulls (b) sample extraction from old trophy 252

Fig. 5.14 – Plate depicting giant sable translocations, collaring and handling an injured animal 255

Fig. 5.15 – Age pyramids comparing current and theoretical populations 256

Fig. 5.16 – Giant sable spatial use inferred from GPS collars 257

Fig. 5.17 – Graphic representation of average bi-weekly movements of male and females, with data compiled from GPS collars 258

Appendix I

Fig. Ap.1 – Giant sable areas overlaying maps of (a) average rainfall and (b) tree cover and temperature 284

Fig. Ap.2 – Giant sable areas overlaying maps of (a) river basins and (b) hill-shaded relief 285

Fig. Ap. 3 – Giant sable areas overlaying distribution of landforms 286

Fig. Ap. 4 – Giant sable areas overlaying vegetation map 287

FCUP xxv Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Abbreviations

AD: anno Domini AFS: Allele Frequency Spectrum AMWE: Angolan Miombo Woodlands Ecoregion AR: Allelic Richness a.s.l.: at surface level bp: base pair

C4: Carbon 4 CNP: Cangandala National Park DAPC: Discriminant Analyses of Principal Components DNA: Deoxyribonucliec Acid DRC: Democratic Republic of Congo EAM: Eastern Arc Mountains EARS: Eastern African Rift System FAD: First Appearance Date

FIS: inbreeding coefficient

FST: fixation index GIS: Geographic Information System GLD: Genotypic Linkage Desiquilibrium GPS: Global Positioning System

HE: expected heterozygosity

HO: observed heterozygosity HPDI: Highest Posterior Density Interval HVR: Hypervariable Regions HW: Hardy-Weinberg HWE: Hardy-Weinberg Equilibrium IBD: Isolation By Distance IUCN: International Union for the Conservation of Nature kya: thousand years ago LIG: Last Interglacial LNSR: Luando Nature Strict Reserve

FCUP xxvi Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

MCMC: Monte Carlo Markov Chain MCP: Minimum Convex Polygon MIS: Marine Isotopic Stage mtDNA: Mitochondrial DNA mya: million years ago NA: Number of Alleles NGS: Next-Generation Sequencing NHC: Natural History Collections NP: National Park NPA: Number of Private Alleles nuDNA: nuclear DNA PCA: Polymerase Chain Reaction PCA: Principal Component Analyses SCI: Scientific Citation Index SR: Strict Reserve TMRCA: Time for the Most Recent Common Ancestor UNITA: União Nacional para a Independência Total de Angola WWF: World Wildlife Fund

FCUP 1 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

CHAPTER 1

GENERAL INTRODUCTION

FCUP 2 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP 3 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

1.1 The giant sable antelope

The term antelope evolved from the Byzantine Greek word antholops, referring to a fabulous, elusive and very savage swift beast described by the Bishop of Antioch (AD c336) with saw-shaped horns capable of cutting down trees, that once haunted the banks of the Euphrates (Cuvier and Griffith 1832). Although this legend was likely inspired by earlier observations of the Arabian oryx (Oryx leucoryx), it is hard to ignore how befitting it would be if applied instead to another hippotragine, the giant sable antelope of Angola (Hippotragus niger variani) (Fig. 1.1). Arguably no other antelope than the giant sable has been so praised for its beauty and has sparked so much passion among naturalists, and yet remained framed by mystery and local myth, while becoming one of the most endangered mammals on earth.

Fig. 1.1 – A giant sable antelope bull, photographed in July 2013 from helicopter in Luando Nature Strict Reserve (Photo by author, 2013).

1.1.1 General description

The giant sable is one of four to five generally recognized subspecies of sable antelope (Ansell 1972; Estes 2013). It is a large heavily-built antelope with very long and strongly annulated horns, and narrow pointed ears (Blaine 1922). In giant sable the sexual dimorphism is exaggerated, with large-sized males displaying pitch black glossy coat and contrasting white underparts, while carrying remarkably long and powerful horns

FCUP 4 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

(Fig. 1.1, 1.2); females on the other hand are smaller, golden to chocolate-brown coloured and have shorter relatively straighter horns (Blaine 1922; Estes & Estes 1974). Giant sable are characterized by a long narrow foreface, and diagnostic dark facial mask lacking a white muzzle stripe to connect the pre-orbital white patch with the also white upper lip (Blaine 1922; Groves & Grubb 2011). The dark face is present in all adult giant sable bulls, but a more or less faint white line is not uncommon in giant sable females or in juvenile males (pers. obs.). Conversely, dark faces have also been occasionally recorded in bulls from populations in west Zambia (Ansell 1974) and west Tanzania.

Fig. 1.2 - Typical sable skull totally contained under a giant sable skull for comparison (Photo by F. Varian, 1953).

The most spectacular feature however is the horn development in giant sable bulls, which grow on average around 30cm longer than in any other known population (Blaine 1922; Walker 2002) (Fig. 1.2). Most typical sable horns from trophies rarely surpass 50 inches as measured along the curvature, but in giant sable they are consistently above that mark and often score over 60 inches (Fig. 1.3). The giant sable horns are strongly compressed laterally and grow perpendicularly to the frontals before curving backwards, crowning a comparatively long skull sustained by a massive, oval in section, and wedge- shaped neck (Blaine 1922). The very long spiralling horns and muscular build observed in bulls much contribute to a perceived “gigantism” of this population, even if there remaine conflicting views on how much larger they are when compared with other sable (e.g. Blaine 1922; Estes 2013).

FCUP 5 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 1.3 - Sizes of sable trophy horns as measured in inches along the main curvature, listed in the Rowland Ward’s Book of Records of Big Game (Halse 1998). The trophies were assigned to three groups, the eastern corresponding to sable from Kenya and northeastern Tanzania (N=12), the royal or giant sable corresponding to Hippotragus niger variani (N=52), and all remaining sable referred here as typical sable (N=1135). To be eligible as record, typical and giant sable had minimum thresholds of 42 and 56 inches respectively. The symbols above the chart represent the average and standard deviation for each group.

1.1.2 Discovery, hunting and the onset of conservation

The story of the giant sable’s exposure to the western world can tentatively be traced back to forty years before its formal scientific description. In 1873 one single, 61 inch- long curved horn of unknown provenance was added to the zoological collection of “La Specola” in Florence1. Interestingly, one of the most famous hunters and explorers of its time, Frederick Selous, visited the museum of Florence and was taken aback by this remarkable horn (Walker 2002) (Fig. 1.4). Perceptively he concluded that not only had to be a sable horn, but because it was so much larger than any other he had ever seen or heard of, this meant that somewhere in southern Africa existed a yet undiscovered and extraordinary breed of grand sable antelope (Walker 2002). Selous became obsessed by the quest for these sables for the rest of his life, but could not solve the horn-mystery.

1 An even older specimen with 51 inch horns was collected in Angola between 1853 and 1861 by Friedrich Welwitsch and sent to Lisbon where it was classified by Bocage as Hippotragus niger (Thomas 1916). Unfortunately the specimen was lost in the 1978 fire that destroyed the Museu Bocage, and was never compared with giant sable material.

FCUP 6 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 1.4 – The Florence horn, at the time tentatively ascribed to Hippotragus niger and the label referring the contributions from Frederick Selous in 1894 (Photo by P. Agnelli, 2010).

Instead, the scientific discovery followed the efforts of Mr. Frank Varian, a British engineer who was in Angola in the early twentieth century overseeing the construction of the Benguela railroad (Varian 1953; Walker 2002). In 1909 Varian came across with witness reports and photographs of a remarkably large sable trophy obtained in the Kwanza district, and a couple years later he saw and measured an equally impressive specimen shot by a missionary, but when he reported these observations in letters published in an English journal he was ridiculed by sceptics (Walker 2002). Few would believe that such a remarkable large ungulate could still be unknown in Africa, when even the okapi had been described a decade earlier from the most remote jungle patches of Congo. Undeterred, Varian obtained a series of skins and skulls, also brought from the north of the projected railway route between the Kwanza and Luando rivers, a confined region that for over 50 years would remain as the sole site where the sable could be found. But Varian then left to Europe to serve in the First World War, carrying the skins and skulls, which he dropped at the British Museum of Natural History. Much to the surprise of the mammal curator himself, Oldfield Thomas, the material received from Angola proved to be so distinctive that he even considered the possibility of awarding specific status to the giant sable, before proposing a new subspecies named in honour of Frank Varian in 1916, as Hippotragus niger variani THOMAS 1916 (Walker 2002) (Fig. 1.5). Both Varian and Thomas independently suggested that the Kwanza region in central Angola could have been the likely origin for the mysterious horn housed in Florence.

FCUP 7 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 1.5 – Head of giant sable antelope Hippotragus niger variani, adapted from the original description (Thomas 1916).

The news about the discovery of this magnificent novel race of sable antelope sparked much enthusiasm among naturalists and explorers, eager to resume adventurous trips to exotic locations after the end of the First World War. This led to an increase in the demand to obtain specimens, and many famous hunters offered their services to various natural history museums for the privilege of travelling to Angola and collect giant sables (Walker 2002). In the years following the discovery, numerous expeditions were organized and funded by museological institutions and private individuals, with specimens sent to London, Lisbon, Chicago, New York, Boston or Philadelphia, and notable collectors included the names of Gilbert Blaine, J. G. Millais, Col. J. C. B. Statham, J. Diespecker, Arthur Vernay, Major Powell-Cotton, Prentiss Gray, M. Luna de Carvalho, Cor. B. de Mello and Richard Curtis (Fig. 1.6). In the 1920s the giant sable had become one of the most sought after trophies, a sort of ultimate grail for game hunters (Walker 2002). These trophy hunting exercises were responsible for hundreds of animals shot in the following two decades, adding to subsistence harvesting with traps carried out by locals, and the work of Portuguese and Boer meat hunters. The latter in particular were a major cause of concern when commercial hunting parties organized by Boer hunters had already been credited for wiping out big game in other regions of Angola (Varian 1953; Walker 2002; Huntley 2017). Soon after being formally described, already the future of the giant sable seemed bleak. This scenario would be ameliorated during the Second World War, when organized hunting and foreign trips to Angola were forced to a halt. Once again human conflict had come to the rescue of the beasts.

But if the giant sable almost miraculously survived into the 40’s a lot of the credit is owed to the very same man whose name was used to christen the giant sable. Frank Varian not only took immense pride on his discovery, but he also assumed a proprietary attitude

FCUP 8 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) towards the species, becoming a guardian angel of sorts (Walker 2002). Being aware of the uniqueness of the giant sable, he would watch closely the hunting expeditions and often intervene against the bloodlust of famous hunters (Walker 2002). More importantly he took on an advisory role, and on several occasions approached Portuguese colonial administrators alerting them to the plight of the giant sable. In 1913, even before the first specimens had reached Europe but at a time when Varian was already on the trail of the new sables, he became alarmed at the news that a large and ruthless Boer meat-hunting expedition was about to move into the area. Reacting swiftly, Varian appealed to the Colonial Governor of Moxico who accompanied him on a ground visit, and as result a temporary hunting ban was issued for the upper-Kwanza district (Walker 2002). This remarkable decision, even if poorly enforced, may have been one of the first ever conservation measures taken on a Portuguese colony, and aimed at protecting a species that hadn’t even been formally described. Even more decisive was his approach in 1922 to the former governor-general and recently appointed high commissioner for the colony, General José Norton de Matos, in a meeting held in London. Varian then introduced to the commissioner what he claimed to be the rarest and most beautiful animal present in the territory of Angola and made a strong case for its protection. Norton de Matos was sympathetic to Frank Varian’s arguments, and on a visionary decision unheard of in Portuguese colonies, he decreed the giant sable as “royal game” and closed the Kwanza district for shooting and entry, except with a special license to be issued by the corresponding authorities (Walker 2002). Although the ban did not stop well-connected and well-funded hunters to apply for numerous special licenses, it managed to slow down the level of harvesting while preventing completely the Boer incursions. Varian himself credited Norton de Matos’ decision as the one decisive factor that saved the animal from extinction in those early days (Varian 1953). Importantly, it also laid the foundations to elevate the giant sable to its future iconic status.

Of further relevance was the international meeting held in London in 1933 and known as the “Convention Relative to the Preservation of Fauna and Flora in the Natural State”, which resulted in a broad agreement among African colonial powers to protect local animal and plant species, having also been termed as the Magna Carta of wildlife conservation (Boardman 1981). Portugal was one of the signatories and although wouldn’t ratify the convention until 1950, did react earlier by supporting the classification of the giant sable under formal absolute protection (Class A), and by designating a series of game reserves in Angola. It was under this framework that in 1938 was proclaimed the Reserva de Caça do Luando, defining the narrow strip of land confined between the rivers Kwanza and Luando – The Land Between Two Rivers, covering approximately

FCUP 9 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

8,000 km2 and designated specifically to protect the species (Huntley 2017). Gradually the importance of the giant sable was recognized by politicians, and special hunting licenses became rarer and harder to obtain after the Second World War. One notable exception was the Spaniard Count of Yébes who in 1949 was granted a special license to collect two specimens in Luando, including one for the National Museum of Natural Sciences in Madrid, and as result managed to shoot the largest ever sable trophy, measuring 64’’ 7/8 (Halse 1998; Walker 2002) (Fig. 1.6b).

Fig. 1.6 – Results of hunting trips to Angola, (a) Anita Curtis with a freshly killed giant sable bull in 1924, and (b) the Count of Yébes in 1949 with the largest sable trophy ever recorded (Photos in Walker 2004).

New game regulations approved in 1955 and 1957 under the freshly created Conselho de Protecção da Natureza de Angola, not only totally prohibited hunting of giant sable, but also criminalized and set very strict penalties for transgressors, including effective jail time adding to a fine worth of 100,000 escudos (Frade 1958, Frade & Sieiro 1960). Still in 1957, the Luando Game Reserve was elevated in status to a Nature Integral Reserve, in which even touristic visits would be seriously restricted. The unexpected discovery in the late fifties of an additional, albeit smaller, sable population near Malanje town, led to the creation of Cangandala Nature Reserve in 1962, subsequently elevated to a National Park in 1970. By then the species was well established as a national symbol and well protected, and killing one giant sable was seen as one of the most serious offenses against environment in Portuguese colonial Africa. Nevertheless one last authorized and exceptional hunt for a giant sable took place in 1961 by Dr. Teódulo Agundis, a wealthy and well-connected Mexican hunter who was granted the privilege after a long negotiation at the highest level between Mexico and Portugal (Agundis 1965; A. Moreira pers. comm.).

FCUP 10 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

1.1.3 Research under colonial rule

Following early morphological approaches (Thomas 1916, Blaine 1922), until the late 1950s the giant sable featured mostly in general studies of Angolan mammals (e.g. Monard 1935; Hill & Carter 1941; Newton da Silva 1958). The step-up of protective measures deriving from the game regulations approved in 1955 and 1957, and the increased interest by Portuguese authorities in stimulating scientific production in Angola, resulted in a series of studies led by Portuguese zoologists specifically addressing the giant sable (Frade 1958; Frade & Sieiro 1960; Crawford-Cabral 1965, 1966, 1969, 1970). Some of these efforts produced the first quantifiable data on the species biology (e.g. Frade & Sieiro 1960; Crawford-Cabral 1965, 1969) and prepared the ground for the year-long study carried out by the well-known American zoologist Richard Estes. Between 1969 and 1970, Richard Estes was based in Luando Nature Strict Reserve (LNSR) and conducted the first intensive study, monitoring several herds during a full annual cycle (Estes & Estes 1974) (Fig. 1.7).

Fig. 1.7 – A Government research vehicle in 1970 in LNSR, while monitoring a giant sable herd, including four young females being herded by a large bull (Photo by R. Estes, 1970).

The work done by Estes & Estes (1974) provided the most comprehensive data available on the biology of the species and set the baseline for all future efforts. Much of what is known today derives directly from their findings. In the early seventies, Brian Huntley the South-African ecologist responsible for the development of Angolan protected areas between 1971 and 1975, also took a natural interest on the giant sable, complementing

FCUP 11 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) some of the seminal biological studies performed by Frade, Crawford-Cabral and Estes, making specific conservation recommendations and advising on related strategic policies (Huntley 1972, 2017).

1.1.4 Historical distribution and population estimations

The giant sable is only known from Central Angola within the Atlantic-flowing Kwanza river basin. The meandering Luando River, one of the largest and oldest tributaries of the Kwanza, separates the two subpopulations present in LNSR and Cangandala National Park (CNP), and in total the historical distribution range covers around 10,000 km2. The LNSR constitutes the core area, being a narrow and depressed strip of land stretching for over 200 km in length and less than 70 km across at its widest (Estes & Estes 2014). The reserve lays between latitudes 10º S and 12º S, being well delimited by discrete natural boundaries such as the large rivers Kwanza and Luando, and by a series of swamps and cliffs in the southernmost range. CNP is 50 km to the north and much smaller in size covering roughly 630 km2, and unlike LNSR, lacking clear natural boundaries (Fig. 1.8). It is possible that historically, giant sable were more widely distributed in Angola, and witness accounts recorded the presence of animals in the region between the two reserves and even more than one hundred km away into neighbouring provinces, but such claims, often of isolated individuals, remained doubtful or inconclusive (Huntley 1972; Estes & Estes 1974; Crawford-Cabral & Veríssimo 2005). Dispersing males may often reach areas quite distant from the source regions as it has been documented in other sable populations (e.g. Butynski et al. 2016), however these offshoots tend to be exceptional so in practical terms the area defined by the boundaries of CNP and LNSR remain as the home of the giant sable.

FCUP 12 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 1.8 – Location of the two giant sable reserves, Cangandala National Park and Luando Nature Strict Reserve, within the context of Angola.

The remoteness of the region, the rarity and elusive character of the species, the vegetation thickness and the lacking of intensive surveys, prevented reliable censing methodologies, and estimations had to rely on extrapolating figures (Crawford-Cabral 1966, Estes & Estes 1974). Nevertheless, consensus among scientists suggested a total population from the 1950s until early 1970s, between 1,500 and 2,500 animals in LNSR and under a couple hundred in CNP (Crawford-Cabral 1966, 1970; Huntley 1972; Estes & Estes 1974). These numbers correspond roughly to 0.25 sables per km2, reflecting the fact that we’re dealing with a low density and patchily distributed species (Estes & Estes 1974; Estes 2013). The historical numbers of giant sable may have been affected by anthropogenic persecution and habitat destruction, but more likely they had remained rare and sparsely distributed for a much longer period, ecologically constrained as result of very particular habitat requirements (Blaine 1922; Huntley 1972; Estes & Estes 1974).

FCUP 13 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

1.1.5 Biology

Habitat

In a broader sense and similarly to all remaining sable populations, giant sables are specialists of miombo, a type of woodlands and mesic savannas that grow on poor dystrophic soils and dominated by trees from the genus Brachystegia, Julbernardia and Isoberlinia (Estes 2013). Giant sables are ecotone species, showing a preferential use of the edge between woodland and grassland (Estes & Estes 1974; Estes 2013). One peculiar feature of the giant sable regions is the alternation of more or less thick miombo woodlands in relatively flat or gently undulating terrain (Fig. 1.9a), with vast termite- infested clearings - known by the local name of anharas (Estes & Estes 1974). The anharas are covered by grasslands or fire-prone geoxyle vegetation, the latter consisting of dwarf shrubs also known as underground forests (Barbosa 1970; Huntley 1982; Maurin et al. 2014; Bond 2016; Finckh et al. 2016) (Fig. 1.9b). This mosaic of woodland and different types of anharas seems to constitute the prime habitat for giant sable herds both in LNSR and CNP (Estes & Estes 1974). Giant sables are also a water-dependant species, and the availability of water, in streams or water holes, during the dry season, is a key component determining the habitat value and can become a limiting factor affecting the distribution patterns (Estes & Estes 1974).

Fig. 1.9 – (a) Aerial view of LNSR, showing the Luando River and a mosaic of floodplain, woodlands and grassy anharas (Photo by author, 2004); (b) a detail of an anhara covered by geoxyle vegetation in CNP (Photo by author, 2015).

Food preferences

Giant sables are predominantly grazers (feeding on grasses) but also browse frequently on foliage (Estes & Estes 1974; Estes 2013; pers. obs.). They tend to be selective grazers, favoring palatable perennial grasses such as Brachiaria, Digitaria, Panicum or Setaria spp., and typically biting off only the tender outer portion of the plants (Estes & Estes 1974). The choice of the grass species varies throughout the year depending on

FCUP 14 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) the vegetation phenology, so that they are harvested at their peak of nutritious value (Estes & Estes 1974). Complementing the grazing, there is little doubt that giant sables also resort often to browsing (Fig. 1.10a). One particularly important shrub is Diplorhynchus condylocarpon, an abundant species in the woodlands of LNSR and CNP, which has been recorded by several authors as a preferential browse all year-round (Statham 1922; Crawford-Cabral 1970; Estes & Estes 1974) (Fig. 1.10a). Other relevant browsing species include the tree Julbernardia paniculata, and the dwarf shrubs Mucana stans, Cryptosepalum maraviense and Dolichus sp (Silva 1972; Estes & Estes 1974) (Fig. 1.10). Geophagy is another feeding behaviour often recorded in giant sable, likely as a mechanism that has evolved in poor soils to extract missing nutrients by eating soil in natural salt licks, usually located in ancient termite mounds (Estes & Estes 1974; Baptista et al. 2013).

Fig. 1.10 – Giant sable feeding sequences in CNP: (a) bull browsing on burnt leaves of Diplorhynchus condylocarpon (Photo by author, 2012); (b) females, juveniles and calves browsing on fresh sprouts of geoxyle dwarf shrubs (Photo by author, 2016).

Social behavior

Giant sables are gregarious and similarly to other social antelopes, display three different social classes, the breeding or nursery herds, bachelor groups and territorial bulls (Estes 2013). The main social unit is the matriarchal herd, composed of breeding cows, respective calves and young (Estes 2013). The total numbers and composition of giant sable breeding herds changes seasonally and sometimes even daily, and different average figures have been obtained ranging from 17 to 24 animals (Crawford-Cabral 1970; Estes & Estes 1974; Estes 2013) (Fig. 1.11). These sedentary nursery herds are led by one of the oldest breeding cows, and tend to perpetuate their home ranges across generations (Estes & Estes 1974; Estes 2013). Young males will be tolerated within the herd until around 3 years of age, when they disperse and may join other stray young males to form bachelor groups (Estes & Estes 1974). These small bachelor groups numbering less than 10 sub-adults, often share their origin from a given nursery herd

FCUP 15 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

(Estes & Estes 1974). As bulls mature and enter their sixth year of age, they tend to become territorial, patrolling and defending a particular locality, which they will demarcate by scrapping, defecating and bush-thrashing with their horns (Estes & Estes 1974). The same authors report on a complex territorial and dominating system in which younger or sub-dominant bulls may overlap within territories and even get temporary access to breeding herds. Dominant bulls display aggressive behaviour towards intruders, exerting domination by physical intimidation and chasing, and only exceptionally the confrontation leads to a serious fight (Estes & Estes 1974).

Fig. 1.11 – Aerial view in LNSR of a typical giant sable herd in the late dry season, comprising breeding females, juveniles and calves, and accompanied by a territorial bull (Photo by author, 2011).

Breeding

Giant sables are annual seasonal breeders. The rutting generally unfolds during the early rains (pers. obs.), in what can be called as miombo springtime, and Estes & Estes (1974) recorded this behaviour to start in late August. The gestation has been determined for sable antelopes to last for 8.5 to 9 months (Wilson & Hurst 1977), and therefore the calving season for giant sable matches the onset of the dry season, for a two month period between May and July (Estes & Estes 1972). Although the peak of calving is relatively well-defined, a certain number of calves are annually born off-season (Estes & Estes 1974). Females are fertile at two years of age and calve on their third year, and fertility rates are usually very high (Wilson & Hirst 1977; Martin 2003; Estes 2013). As the calving season approaches, the breeding herds tend to break and the most heavily pregnant cows will isolate themselves (Estes & Estes 1974). Giant sables are “hiders”, meaning that females will calve alone and hide their calves, attending them at irregular intervals for several days or weeks, before re-joining the herd with their offspring (Estes

FCUP 16 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

& Estes 1974; Estes 2013). Calves of similar age will usually stick together within breeding herds forming characteristic crèches (Estes 2013).

Spatial use

Giant sable herds make use of home ranges of varying size, with one of two giant sable herds monitored for one year in Luando reserve staying within 12 km2 while the other moved a distance of 15 km to use different areas in the dry and rainy seasons (Estes & Estes 1974). The movement patterns of herds are expected to change according to the annual breeding cycle and seasonal food availability, with the largest concentration of animals observed in the dry season when they congregate to the anharas, to feed on the post-burn flushes (Estes & Estes 1974). With the first rains the larger groups tend to break up, and the herds will leave the anharas and start to focus and feed more often inside the woodlands (Estes & Estes 1974). During the wettest periods, sables will avoid the waterlogged areas such as floodplains, and spend most of the time in high ground within the woodland (Crawford-Cabral 1970, Estes & Estes 1974). The daily movements of herds tend to be modest, typically varying from one to two km (Estes & Estes 1974). In general, herd movement patterns can be summarized as concentrations in open areas during the dry season, followed by group partition as the rain starts and confinement of smaller stable groups in wooded parts of their range, and then increased movements towards the end of the rains and further group fragmentation prior to the calving season (Estes & Estes 1974). Different herds will not overlap in home ranges and are frequently separated by several km of seemingly suitable habitat (Estes & Estes 1974). Sable bulls can hold relatively small territories separated from neighbours by 1-3 km apart, while spending most of their time within 3-4 km2 but are able expand their area to at least 10- 12 km2 when accompanying breeding herds (Estes & Estes 1974).

1.1.6 Cultural significance

The cultural relevance of the giant sable antelope should not be underestimated. Much before it came to be admired worldwide as one of the most impressive and beautiful African mammals, it seems likely that the giant sable already enjoyed some sort of totem status among the resident communities (Walker 2002). Known locally as “Côlô” or “Kolwah” by the Songo and “Sumbakaloko” by the Lwimbi tribes (Statham 1922; Frade e Sieiro 1960), the exact relationships established between the resident communities and their sacred animal are poorly understood but it has been suggested that locals

FCUP 17 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) repeatedly behaved in ways aimed to divert westerners from contacting with the giant sable (Estes & Estes 1974; Walker 2002). When Statham visited Cangandala in 1920 carrying a giant sable skull purchased from a Portuguese merchant, the villagers vehemently denied that it could have been obtained there while insisting that the species only occurred across the Luando River, when they evidently had to know otherwise (Statham 1922; Estes & Estes 1974; Walker 2004). Often local assistants would also perform awkwardly and in incompetent manner when guiding the foreign white hunters, thus alerting the animals and forcing failure or delay of the pursuit (Statham 1922; Walker 2004). Currently the giant sable is still very much a matter of local pride, and resident villagers feel a strong sense of ownership towards the species (pers. obs.). It is therefore no surprise that if the giant sable was already considered as a symbol for Angola during colonial rule, sooner after independence its status reached an even higher iconic level for the new-born country. A stylized giant sable head was used for the national airliner and the national football team is known as “the giant sables”, while the species features in the national currency and is used symbolically throughout the country. It is also a factor of unity in Angola. As result the giant sable is today unanimously recognized as the natural national symbol of Angola.

1.2 Conservation crisis

Large terrestrial mammals have been facing severe population declines and range contractions by anthropogenic causes, resulting in approximately 60% of species being currently threatened with extinction (Ripple et al. 2015). In particular, human conflict resulting in wars and civil unrest has been increasingly recognized as a major driver for environmental degradation and collapse of wildlife populations, either by direct harvesting of mammals for food, from habitat degradation, destruction of infrastructure and management, or by altering population movement patterns (Plumptre et al. 1997; Kanyamibwa 1998; Dudley et al. 2001; DeMerode et al. 2014). One insidious consequence is that the disrupting effects of civil unrest can be propagated and endure for generations, even long after the end of the conflict, and the resulting civil strife can much increase the pressure on wildlife (Dudley et al. 2001).

Following the proclamation of independence in 1975, Angola entered one of its darkest periods becoming the centre stage for a struggle involving foreign superpowers during the cold war. As result, a civil war ravaged the country for over 20 years, only to end with the death of UNITA leader Jonas Savimbi in 2002. As expected, the effects of civil war in local biodiversity were dramatic, even if different regions were being affected

FCUP 18 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) asymmetrically (Huntley & Matos 1992; Huntley 2017). Armed troops occupied the protected areas and destroyed all infrastructure. Local human populations suffered accordingly, often being forced as refugees into the cities or neighbouring countries. Simultaneously, agriculture, education and health services collapsed, and survival became the motto for rural communities (Huntley & Matos 1992). At the end of the conflict people relocated to rural areas but in disorganized manner and not necessarily to the same localities where they had left originally, and often moved into protected areas (Huntley 2017). This scenario frames the conservation crisis that so affected the giant sable antelope in Angola.

1.2.1 Population collapse and rediscovery

If the distant European world wars had had a beneficial effect on the giant sable by reducing the number of white hunters harvesting trophies, the long Angolan civil war resulted in a brutal opposite effect. In 1980 the land between two rivers, LNSR, had been fully occupied by UNITA, who had killed the few rangers left behind, destroyed the connecting bridges, and used the reserve headquarters in Mulundo as a military base camp. Although UNITA leadership claimed that the giant sable was sacred and should not be killed, few would vouch for the obedience of hungry soldiers in such remote locations (Walker 2002). In 1982 Richard Estes visited CNP on a IUCN mission, and in spite of growing insecurity he was able to observe and photograph giant sables (Estes 1983). Yet, a few months later the conflict spread to CNP, and over the next 20 years the park would be occupied by military contingents either from Government or UNITA as its strategic position at the outskirts of Malanje turned the area into a battlefield. A short peace that preceded the general elections of 1992 reverted quickly to a war that only grew in intensity in subsequent years. Anecdotal accounts would often refer massive killings of large ungulates, including giant sable, to feed hungry soldiers or as sporting exercises (Walker 2002). Although such records could not be consubstantiated or quantified, by the turn of the millennium it was clear that the giant sable populations had collapsed, possibly beyond recovery (East 1999).

When the conflict finally ended in 2002 the real question was knowing if the giant sable had survived or instead became just another casualty of war. Between 2002 and 2004 aerial surveys with helicopter and microlights over LNSR failed to locate any individuals, deepening the concerns about the extent of the population collapse. Because of the remoteness of LNSR it was also decided to invest ground-surveying efforts in CNP by placing a series of trap cameras in natural salt licks, where unconfirmed witness

FCUP 19 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) accounts reported the presence of roan or sable. Non-invasive samples of dung and hair were collected both in LNSR and CNP, hoping that mtDNA could prove the existence of sable. Sable spoor and dung can be almost undistinguishable from sympatric and congeneric roan antelope Hippotragus equinus (Estes & Estes 1974). The combination of adopted methodologies, soon would produce the desirable results by late 2004, when dung samples from both LNSR and CNP tested for Hippotragus niger, and the trap cameras in CNP obtained photographs of a breeding herd in CNP (Pitra et al. 2006) (Fig. 1.12). Still, poaching was by now very much out of control, thriving in this new scenario of destroyed infrastructure, freedom of movements from relocating peoples, poverty and total absence of law enforcement. If the obtained results proved beyond doubt the survival of giant sable, on the other hand also strongly suggested these had been much reduced in numbers and the population was likely more threatened than ever before.

Fig. 1.12 – One of a series of photographs from December 2004 in CNP, obtained with a trap camera monitoring a natural salt lick, and showing a herd of giant sable.

1.2.2 Interspecific hybridization in CNP

Over the next couple years following the giant sable rediscovery, the population in CNP was monitored through a network of trap cameras, and whenever possible the compiled data was complemented by ground observations. The most striking conclusion that soon emerged was that the population collapse in CNP had been severe and only one herd remained by 2006. Equally worryingly, a few anomalies were detected in the photographic record. First, no mature giant sable bull had been recorded in the numerous series of independent events, and it started to seem increasingly unlikely that such absence could be due to chance alone. We had to consider the possibility that there

FCUP 20 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) might not be any giant sable bull left in CNP. Second, a detailed analysis of the photographic record revealed that several animals showed abnormal morphological features. As result it was suggested the possibility that some of those animals could in fact be hybrids between congeneric sable and roan antelopes (Vaz Pinto 2006). The odd-looking animals included calves and young of both sexes and adult females, which unlike typical giant sable were characterized by long floppy ears, more contrasting facial mask, thicker coats, lighter colouration, longer legs and taller hindquarters (1.13a). Later in the same year, ground observations of the herd not only didn’t include a giant sable male but revealed a roan bull accompanying the sable females. This could hardly be ignored, and it was very strong circumstantial evidence in support of interspecific hybridization affecting for several years the last breeding herd of giant sable in CNP (Vaz Pinto 2006). To make matters worse, two of the younger putative hybrids seemed even more roan-like than the rest, very light coloured, with longer ears and with bizarre features such as abnormal horn growth. Subsequently, one putative hybrid cow was recorded by a trap camera attending a calf. These observations suggested ongoing introgression and the possibility of viable second generation hybrids in CNP.

Although hybridization, with or without introgression, has been established as an important mechanism in driving rare species to extinction (Wolf et al. 2001), this phenomenon is usually associated with introductions and habitat destruction or fragmentation, connecting previously isolated taxa (Rhymer and Simberloff 1996). In recent years it has become apparent that natural interspecific hybridization with introgression is not only more widespread in animal populations than previously recognized (Arnold 1997; Mallet 2005), but it can also play a relevant role in promoting evolution and speciation (Arnold 1997; Dowling & Secor 1997; Mallet 2008; Abbott et al. 2013). Well known examples of hybridization in mammals result from interbreeding between domestic species and their wild relatives, like domestic with wild cats (Oliveira et al 2008), dogs with wolves (Godinho et al. 2011), or cattle with bison (Hedrick 2009). Within African wild ungulates sympatric hybridization with introgression has been reported between zebra species (Cordingley et al. 2009), although equids have a relatively shallow evolutionary history estimated at less than 1 mya (Carbone et al. 2006). Examples of hybridization with gene flow among African bovids in non-captivity, usually involve closely related taxa that often have been artificially managed or introduced outside their natural range, like in the case of bontebok with blesbok (van Wyk et al. 2013), impalas (Green & Rothstein 1997; Lorenzen et al. 2004) or wildebeest (Grobler et al. 2011). One reported case that involved hybridization between antelope taxa estimated to have diverged for similar amount of time as sable and roan, was between

FCUP 21 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) blesbok Damaliscus dorcas and red hartebeest Alcephalus buselaphus, but also resulting from artificial secondary contact, and in this case introgression was not found and the hybrids were presumed infertile (Robinson & Morris 1991). In spite of the lack of cytogenetic variation between sable and roan (Robinson & Harley 1995), they are phenotypically very distinct, and have evolved in sympatry for a relatively long time (Estes 2013). As result, both species are expected to have developed efficient behavioral and ecological barriers that should prevent cross-breeding in most situations, and until now only one exceptional case of hybridization in the wild had been reported between sable and roan, dating from the 1980s in Kruger NP (Keet 1989; Robinson & Harley 1995) (1.13b). The hybrid cow from Kruger was captured and relocated to a fenced camp where it was kept in isolation, and it could never be determined if she was fertile (Keet 1989; Robinson & Harley 1995).

Fig. 1.13 – F1 hybrids sable X roan, (a) a putative hybrid female from CNP, recorded with a trap camera (2008); and (b) the female hybrid from Kruger NP (Photo by M. Hofmeyr, 2002).

The possibility of interspecific hybridization going on in CNP between giant sable and congeneric roan, with or without introgression, and following a severe population collapse, was an alarming scenario, requiring confirmation and eventually the adoption of an emergency rescue plan.

1.3 Horse-like antelopes

The tribe Hippotragini SUNDEVALL 1845, or the so-called horse-like antelopes, constitute an assemblage of large-bodied and highly specialized grazing antelopes with thick necks, erect manes, striking facial masks and broad strong hooves, with both sexes carrying horns (Kingdon 2013). The monophyly of this group is supported by overwhelming evidence from morphological, paleontological and genetic data (Ansell 1971; Groves & Grubb 2011; Bibi et al. 2013). Hippotragines are currently represented by seven extant

FCUP 22 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) species and three genera, but their origin can be traced to a common ancestor with the sister-tribes Alcelaphini and Caprini dating back to the middle Miocene (Hassanin et al. 2012; Bibi et al. 2013) (Fig. 1.14). The fact that the tribes Hippotragini and Caprini include several extant desert-adapted species provides support for attributing the causes of this early diversification to the development of more open habitats during the late Neogene (Hassanin et al. 2012).

Fig 1. 14. Cladogram exploring the phylogenetic relationships among modern hippotragine adapted from Kingdon (2013) and Hassanin et al. (2012), and incorporation of Hippotragus fossil species, following Vrba (1987) and Vrba & Gatesy (1994).

The geographical origin of the tribe is difficult to determine as the earliest fossils cannot be easily ascribed to the corresponding group (Gentry & Gentry 1978), but the existence of primitive Hippotragini fossils from Europe, Russia and India suggests they were once more widespread and may even have colonized Africa from a Eurasian source (Gentry & Gentry 1978; Dmitrieva & Serdyuk 2011; Kingdon 2013). Subsequently they evolved in the African continent where all the extant species can be found, except for one oryx restricted to the Arabian Peninsula. An adaptation to cooler drier climates and to a grazing diet may have facilitated the spread of the Hippotragini during global cooling and increased aridity periods in Africa (Flower et al. 1994; Zachos et al. 2001; Kingdon 2013). Even preceding the divergence into the current genera, the tribe had likely developed a series of physiological adaptations for desert or semi-arid conditions, such as increased grass component in food and larger body size to better cope with dissection (Kingdon 2013). Major diversification within Hippotragini may have started during the late Miocene (Hassanin et al. 2012; Bibi et al. 2013), possibly with the ancestors of the more arid-

FCUP 23 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) adapted Oryx and Addax evolving in northern Africa, and the precursor of Hippotragus preferring savanna-like environs in southern Africa (Kingdon 2013).

1.3.1 Evolution of the Genus Hippotragus

Hippotragus is one of the deepest-rooted bovid genus (Bibi 2013), representing large- bodied and savanna-adapted hippotragines. The comparison of teeth carbon profiles between early Hippotragus and contemporary species suggest the latter to be much more specialized grazers with predominantly C4 diets, while the former were mixed feeders, with a heavier component of foliage on a dominant C3 diet (Kingston & Harrison 2007; Estes & Kingdon 2013). This finding, showing a gradual specialization towards grass-eating, is a pattern shared with other bovid tribes, and may reflect past higher dietary diversity within the genus, or effects of climatic and habitat transformation, but is nevertheless evidence of a phylogenetic signature (Estes & Kingdon 2013).

Only two species of Hippotragus are alive today, the roan H. equinus and sable H. niger, while a third species, the bluebuck H. leucophaeus, became extinct in historical times. The split between sable and roan occurred at a very early stage of diversification within the genus, with the last common ancestor of both species estimated to have lived at the end of the Miocene (Fernández & Vrba 2005, Hassanin et al. 2012; Bibi et al. 2013). Nevertheless, and based on fossil beds, the genus seems to have been more abundant and diverse in the Pliocene and Pleistocene, and it has been suggested that Hippotragus followed a trend of progressive decline due to competition with more recently evolved grazers, possibly the Alcelaphini, thus being forced to occupy more extreme and specialized ecological niches (Kingston & Harrison 2007; Gentry 2010; Estes & Kingdon 2013).

African fossil taxa

The fossil record in eastern and southern Africa has provided plenty of hippotragine material and allowed the description of at least two extinct Hippotragus, which may have been contemporaneous to modern species (Vrba 1995; Vrba & Gatesy 1994). In spite of the much older splits estimated from molecular data (e.g. Fernández & Vrba 2005; Bibi et al. 2013), the bovid fossil record is sparsely sampled until the mid-Pliocene (Hill 1995), and the first identifiable Hippotragus date from the end of the Pliocene and beginning of the Pleistocene, with appearance of H. niger, H. equinus, H. gigas and H. cookei (Vrba 1995), while the first recorded H. leucophaeus is dated from 0.8 mya (Klein et al. 2007).

FCUP 24 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

H. gigas was first described from Olduvai Gorge fossil beds dating from around 1.3 to 1.8 mya, as a “Hippotragus of gigantic proportions” sharing characteristics of both sable and roan (Leakey 1965; Gentry & Gentry 1978). Skulls have longer horn cores than roan and less compressed than sable, and much larger teeth (Gentry & Gentry 1978; Klein & Cruz-Uribe 1991). Although the large size of this species was confirmed in some fossil beds, they may have been smaller elsewhere (Gentry 2010). Sequences from eastern Africa provide the oldest known fossils of H. gigas estimated at 2.8 mya, and spanning to around 1.6 mya in the Omo-Turkana basin (Bobe et al. 2002; Bobe 2007), and from 1.6 to around 1.0 mya in Olduvai (Gentry & Gentry 1978). The most recent fossils attributed to H. gigas were collected in Elandsfontein, South Africa and dated roughly from between 1.0 to 0.6 mya (Klein & Cruz-Uribe 1991; Klein et al. 2007).

H. cookei was also a large species possibly closely related to H. gigas, but with significant differences in teeth morphology, and with smaller and more compressed horn cores resembling roan (Vrba 1987). Similarly to the previous species the dentition suggested less specialized feeding habits than in extant Hippotragus species (Gentry 2010). The species was found in Makapansgat and Sterkfontein, South Africa and all known fossils are dated from the early Pleistocene (Vrba 1987; Vrba & Gatesy 1994).

Bluebuck

The bluebuck Hippotragus leucophaeus earned the infamous reputation of being the first African mammal species exterminated in historical times. It was described as Antilope leucophaeus PALLAS 1766 following initial encounters by travellers exploring the Cape region of South Africa in 1719, but even earlier mention of a blaue bocke had been published in a seventeenth century publication (Klein 1974, Rookmaaker 1992). It was never common but soon after discovery became increasingly rarer and the last confirmed specimen was reported around 1800 (Klein 1974). Ironically, the bluebuck was the first hippotragine that Europeans came across with and yet got extinct even before congeneric roan and sable had been described in 1804 and 1838 respectively (Klein 1974). Morphological affinities shared with roan led some earlier authors to question the specific status of bluebuck, but soon after became fully established as sister-species to roan (Sclater & Thomas 1899; Klein 1974; Estes & Kingdon 2013). Mitochondrial studies provided definitive evidence for the species status and clarified the phylogenetic relationships within the genus, suggesting a splitting date from the most recent common ancestor between roan and bluebuck at around 2.5 mya (Robinson et al. 1996; Fernandez & Vrba 2005).

FCUP 25 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Of much smaller size than roan or sable, three of four museum mounted specimens in existence, two males in Paris and Leiden and one female in Vienna, are short of 120 cm tall measured at withers (Sclater & Thomas 1899; van Bruggen 1959). The general colour was bluish-grey with brown forehead, lacking the neck mane and the facial patterns characteristic of sable and roan (Sclater & Thomas 1899; van Bruggen 1959) (Fig. 1.15). The skull was relatively longer but much smaller in size than H. equinus, with horns also shorter (Sclater & Thomas 1899). Little is known about the biology of bluebuck, other than they formed small social groups and showed a preference for grazing in open habitats inferred from dentition (Klein 1974), but the possibility of migratory behaviour and seasonal calving has also been suggested based on palaeocological data (Tyler Faith & Thompson 2013).

Fig. 1.15 – Head of extinct bluebuck Hippotragus leucophaeus, reconstructed from skins and witness accounts (Plate in Kingdon 2013).

All known specimens of bluebuck were found in a relatively small area of the southwest Cape region, but the species was frequently represented in late Pleistocene fossil records, an indication that it was once more common and widespread in South Africa (Klein 1974; Kerley et al. 2009; Tyler Faith & Thompson 2013). Although there is little doubt that the European hunters exterminated the bluebuck at the end of the eighteenth century (Sclater & Thomas 1899; Klein 1974), it has also been argued that they simply performed the coup de grâce, as the species may have been already a relic upon arrival of the first settlers, reduced to a few hundred individuals and a pale reflection of its former glory, possibly already trapped in an extinction vortex (Kerley et al. 2009).

FCUP 26 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

1.3.2 Roan and sable antelopes

The two extant representatives of the genus Hippotragus, roan and sable antelopes, have taken independent evolutionary paths probably since the end of the Miocene (Fernández & Vrba 2005, Hassanin et al. 2012; Bibi et al. 2013), and yet still share a remarkable number of features and adaptations. Understanding these similarities and differences may help to shed some light on the evolutionary forces that shaped the diversification patterns between and within both species.

Morphological differences

Both roan and sable are large-sized bovids, but particularly the former which is the second tallest and third heaviest African antelope species (Chardonnet & Crosmary 2013). An adult roan stands over 142 cm tall at the shoulder and average weights have been recorded around 260 and 280 kg for females and males respectively (Sclater & Thomas 1898; Chardonnet & Crosmary 2013). Sable are noticeable smaller with a shoulder height measured at 132 cm, and weighing between 200 and 260 kg (Sclater & Thomas 1898; Estes 2013). Contrasting with the body size, male sables have much longer arched horns, while roan horns are thick and evenly curved but much shorter (Chardonnet & Crosmary 2013; Estes 2013). If giant sable horns are known to have reached over 164 cm in length, the record for roan was set at 90 cm (Halse 1998). Roan has longer thicker hair and long floppy black-tufted ears, while sable has homogenous short hair and small pointed ears (Chardonnet & Crosmary 2013; Estes 2013) (Fig. 1.16).

Fig 1. 16 - Schematic representation of heads of male and female roan and sable antelopes. Note marked sexual dimorphism in sable antelope, contrasting with absence of sexual dimorphism in roan (Drawings made by Hugo Fernandes).

FCUP 27 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

The vernacular name of the two species refers to the dominant coat colouration, with roan antelope being mostly grizzly-grey to reddish brown (roan), while sable antelope males are mostly very dark, almost black (sable). Yet one of the most striking asymmetries derives from sexual dimorphism, which is very pronounced in sable, but modest in roan (Estes & Kingdon 2013) (Fig. 1.16). As a consequence, sable females can be much lighter or richly coloured than males, yet showing marked geographical variation. Roan and sable have very boldly marked masked faces, combining dark and white patches, but characteristic of each species and often displaying geographical variation.

Social and reproductive behaviour

Roan and sable are both gregarious species, sharing the same basic social structural units generally associated with sedentarism in ungulates, namely nursery herds, territorial bulls and bachelor male groups (Chardonnet & Crosmary 2013; Estes 2013). However in roan antelope the groups and herds tend to be smaller, with herds reportedly averaging around 5 to 15 animals versus 15 to 22 in the case of sable (Estes & Estes 1974; Smithers 1983; Chardonnet & Crosmary 2013; Estes 2013; Butynsky et al. 2016). The group size in roan seems to vary a lot more depending on season, animal density and climatic conditions, but temporary aggregations of over 100 individuals have been recorded in both species (Kingdon 1982; Ansell & Dowsett 1988; Kimanzi 2011; Chardonnet & Crosmary 2013; Estes 2013). Herds of roan and sable are led by hierarchical dominant females and include respective young and calves (Chardonnet & Crosmary 2013; Estes 2013). The sizes of home ranges are extremely variable, spanning from 2 to over 150 km2 depending on local resources and densities in either species (Jouber 1976; Kimanzi 2011; Chardonnet & Crosmary 2013; Estes 2013; Owen- Smith & Martin 2015; Havemann et al. 2016), but it is generally recognized that roan tend to forage larger areas.

Similarly to sable, young roan males get evicted from the respective herds at around three years of age, and may form bachelor groups until reaching maturity and establishing a territory (Chardonnet & Crosmary 2013; Estes 2013). However the territoriality behaviour seems more flexible in roan and it has been argued that in conditions of low density roan may not behave as strictly territorial but instead opt to defend a buffer zone around mobile female herds (Allsop 1979; Chardonnet & Crosmary 2013). Contrasting to numerous recent studies that have addressed resource use, feeding behaviour and seasonality based on remote tracking of sable (e.g. Owen-Smith

FCUP 28 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

& Cain 2007; Parrini & Owen-Smith 2010; Macandza et al. 2012, 2013; Owen-Smith & Goodall 2014; Owen-Smith & Martin 2015; Owen-Smith et al. 2015), comparatively little has been done with roan, and almost nothing focusing on territorial or dispersal behaviour of both species.

Roan and sable are prolific breeders, with females capable of conceiving at age two and having the first calf in their third year, following gestation periods of between eight to nine months (Kimanzi 2011; Chardonnet & Crosmary 2013; Estes 2013). Before calving, roan and sable females will isolate themselves and hide the calf in a secluded place before introducing the offspring to the group after a few weeks. One very important distinction is that sable, unlike roan, are clearly seasonal breeders displaying a well-marked calving peak that may last for 1-2 months usually coinciding with the end of the rains, and followed by a rutting season soon after the calves are weaned (Skinner & Chimbimba 2005; Estes 2013). Roan on the other hand don’t seem to have well defined calving seasons, though some populations may show one or two breeding peaks, and females are capable of producing a calf every 10.5 months (Kimanzi 2011; Chardonnet & Crosmary 2013). The observed less strict seasonality may result from roan being less specialized than sable, from having larger home ranges and use of more diverse habitats, and from the larger body size offering higher resilience against predators.

Adaptations and feeding habits

The evolutionary history of roan and sable, sharing a close ancestry with the arid- adapted Oryx and Addax (Kingdon 2013), and accompanying a temporal trend towards progressive rarity and higher specialization in the genus throughout the Pleistocene as inferred from the fossil record, provides a background to explain some of their adaptations. It seems likely that the explosive bovid radiation that resulted on a diverse array of ungulates exploring the expanding African semi-arid savannas throughout the Pliocene and Pleistocene (Fernández & Vrba 2005), pushed roan and sable towards nutrient-poor broad-leafed mesic savannas, a niche that was being used by few large ungulates (Kingston & Harrison 2007; Gentry 2010; Estes & Kingdon 2013). One consequence of this specialization may have been a dependency on fixed water sources and the adoption of a sedentary lifestyle and male territoriality (Estes 2013). When comparing both species, sable appears to be more niche-specialized and closely associated with mesic woodlands, while roan has a wider distribution and higher toleration for open and drier habitats (Estes 2013). Interestingly, it has been suggested that sexual selection may have driven sexual dimorphism as a by-product of

FCUP 29 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) sedentarism, and the sable populations that live in somewhat drier habitats seem to be less sexually dimorphic than the ones exposed to wetter conditions (Estes 2013).

Roan and sable are highly evolved feeders and predominantly grazers, but also very selective in their grazing habits and will take variable amounts of browse depending on the conditions observed (Chardonnet & Crosmary 2013; Estes 2013). Both species appear to be quite specific in their food choices in a given area, preferring tall grasses and tender shoots, yet sable may take a greater proportion of foliage and woody parts (Estes & Estes 1974; Wilson & Hirst 1977; Knoop & Owen-Smith 2005; Estes 2013). Although sables, like most grazers, will be attracted to the higher nutritional value of green flush after burnings (Estes & Estes 1974; Parrini & Owen-Smith 2010), they also seem to cope well feeding on tall fibrous grass species that grow on poor soils, even in the dry season (Macandza et al. 2013; Hensmann et al. 2014). Roan studies in South Africa have suggested that the browse component may account for less than 20% of the intake (Joubert 1976; Wilson & Hirst 1977; Chardonnet & Crosmary 2013). However, it has been shown that in other regions where roan is more common they may browse more often (Schuette et al. 1998; Chardonnet & Crosmary 2013). As a rule of thumb both species thrive in areas with few other grazers present, and are scarce when they overlap with large numbers of other ungulates. It is likely that the particular feeding habits and spatial use patterns of roan and sable are simply opportunistic, reflecting the adaptation to nutrient-poor woodlands growing on dystrophic soils, and the avoidance of local competitors and predators (Chardonnet & Crosmary 2013; Chirima et al. 2013; Estes 2013; Havemann et al. 2016).

Distribution ranges

Historically, both roan and sable antelopes used to be widely distributed in Africa, occupying the savanna belt that surrounds the tropical forest zone of central Africa. This statement however is a very rough over-simplification, and fails to recognize some peculiar patterns on each species’ distribution. They do overlap extensively in southern Africa, yet sable is absent north of the equator (Fig. 1.17). The differences in distribution are likely rooted in a combination of climatic, geological and topographic factors and how these shape local vegetation, and may be interpreted overlaying the classifications of African Phytocoria and Ecoregions (White 1983; WWF 1999; Timberlake & Chidumayo 2011) (Fig. 1.17).

FCUP 30 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 1.17 - Representation as shaded areas of the main phytochorias of the African savanna biome, adapted from White (1983), and subdividing the Angolan and Eastern miombo ecoregions within the Zambezian region (after WWF, 1999). The solid lines correspond to the distribution ranges of (a) roan (Hippotragus equinus), and (b) sable (H. niger), adapted from IUCN (2008).

The vegetation of Africa defines as major units the Phytochoria as centres of endemism, and each include a series of vegetation subunits according to plant composition and vegetation structure (White 1983). Of relevance here are Phytochorias II and III, respectively the Zambezian regional centre of endemism and the Sudanian regional centre of endemism (White 1983). The Zambezian region occupies the central African plateau and includes various types of dry forest, woodlands, savannas and thickets, corresponding to the miombo zone (WWF 2001; Timberlake & Chidumayo 2011). The main feature in the miombo zone is the vegetation being dominated by deciduous trees of the genera Brachystegia, Julbernardia or Isoberlinia (Huntley 1982; Timberlake & Timberlake et al. 2010; Chidumayo 2011). The miombo thrives in poor-nutrient soils and is centred on the Zambezian plateau generally above 900 m, being highest and wettest on the Angolan plateau, and lowest and driest in eastern Tanzania and Mozambique where it can be present down to the coastal plain (White 1983; Timberlake et al. 2010; Timberlake & Chidumayo 2011). The Sudanian region extends from west to east Africa forming a belt trapped between the African rainforests and the semi-arid Sahel. The vegetation in the Sudanian region includes various types of woodlands and savannas, often with species belonging to the genera Acacia, Commiphora or Isoberlinia (White 1983). Unlike the former region, the Sudanian savannas are present mostly below 1,000 m on comparatively richer soils. Both regions experience a similar rainfall pattern of one dry and one wet season annually, though the dry season tends to be much hotter and drier in the Sudanian region (White 1983).

FCUP 31 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

The roan is present at low densities and often patchily, throughout most savannas and grasslands across west and south-central Africa (Skinner & Smithers 1990; Chardonnet & Crosmary 2013). The historical distribution of roan matches almost perfectly the Phytochorias II and III (Fig. 1.17a). Yet, and in spite of a couple unconfirmed records in the nineteenth century from the Mozambican banks of lake Nyasa (Sclater & Thomas 1898; Ansell 1972), roan remains conspicuously absent to the east of the axle formed by the eastern arc mountains (EAM), southern Tanzanian highlands and the southern extension of the eastern African rift system (EARS) (East 1999; Chardonnet & Crosmary 2013). Even though the importance of the EAM and EARS constituting a major physical and climatic faunal barrier is well recognized (Grubb 1999; Cotterill 2003; Badgley 2010; Faulkes 2010), the reason why roan is excluded from the lower altitude Eastern Miombo Woodlands Terrestrial Ecoregion (WWF 1999), while present across remaining miombo and all other types of African savannas, remains puzzling.

With the possible exception of the Lichtenstein’s hartebeest Alcephalus buselaphus lichtensteini, no other large mammal is more closely associated with the miombo woodlands then the sable antelope (Estes 2013). It is therefore not surprising that the distribution corresponds well to the Zambezian regional centre of endemism defined as Phytochoria II (White 1983), while absent from the Sudanian zone (Fig. 1.17b). The one noticeable mismatch is the anomalous non-occurrence of sable across most of the Angolan miombo, effectively isolating the giant sable in a western “island”. The Angolan miombo woodlands have been recognized as a subunit within the Zambezian region corresponding to the higher western plateau, and defined as a unique Terrestrial Ecoregion (WWF 1999). Present at relatively higher altitudes, growing on extremely acidic and leached soils and subject to some of the wettest conditions within the Zambezian region, the Angolan miombo woodlands are prone to constant fires and the availability and quality of food sources may thus be constrained (Huntley 1974; WWF 2001; Timberlake & Chidumayo 2011). Interestingly such extreme conditions appear to function as an efficient barrier for many ungulates including sable, the ultimate miombo specialist, but not for roan antelope which is the most common and widely distributed large antelope across the Angolan plateau (Crawford-Cabral & Veríssimo 2005).

1.3.3 Intraspecific taxonomy

Traditionally, sable and roan taxonomy has relied on morphological approaches. Such studies were carried out by European or American taxonomists based on large numbers of skulls and skins obtained in Africa but often representing geographically incomplete

FCUP 32 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) series. Although the advent of modern molecular tools has dramatically increased the resolution and can effectively be seen as a game changer, still the results and knowledge obtained from decades of morphometric analyses and careful documentation, constitute priceless baseline data that often stand on its own merit. Here I present the traditional approach and results to the subspecies discussion within the genus Hippotragus, while the findings from modern molecular initiatives will be introduced in the following section.

Roan subspecies

Intraspecific taxonomy of roan antelope has always been problematic, partly due to the difficulty in tackling a wide-range low density species, and most studies have relied on few samples and modest geographical representation. Morphological approaches started by recognizing three subspecies (Sclater & Thomas 1898), but eventually a more consensual classification that is still widely used was proposed by Ansell, defining six units: a western population H. e. koba, two central populations H. e. charicus and H. e. bakeri, an eastern population H. e. langheldi, and two southern populations H. e. cottoni and the typical H. e. equinus (Ansell 1972; Chardonnet & Crosmary 2013) (Fig. 1.18a). However, Ansell himself recognized the paucity of evidence available and cautioned that the validity and range limits of subspecies remained unclear (Ansell 1972). Phenotypic differences among populations can be subtle and subject to intergradation, and some races have been claimed to be virtually undistinguishable (Ansell 1972; Chardonnet & Crosmary 2013), leading some authors to not recognize subspecific divisions (Martin 2003; Groves & Grubb 2011).

Sable subspecies

Contrasting with roan, sable taxonomy suggests a much better defined structure, making the published classifications, at least until recently, relatively unambiguous (Ansell 1972; Groves 1983; Estes & Kingdon 2013) (Fig. 1.18b). Following the discovery and description of H. niger HARRIS 1838 from South Africa, the first split led to the description of

H. n. kirkii GRAY 1872, named after the famous explorer Sir John Kirk, who while exploring the Batoka hills was struck by how different sable looked on both sides of the Zambezi river (Harper 1940; Ansell 1974). Unlike the very dark females characteristic of the typical race, to the north of the Zambezi the females are reddish to chestnut-brown, while males tend to have darker faces (Harper 1940; Ansell 1972; Groves & Grubb 2011).

Subsequently, a third subspecies was described from Kenya, H. n. roosevelti HELLER 1910,

FCUP 33 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) corresponding to the smallest body-sized sable, also carrying noticeably shorter horns, with a broader white muzzle line, and females being light to chestnut-brown (Groves & Grubb 2011). In 1912 another subspecies was described from the Caprivi Strip, Namibia,

H. n. kaufmanni MATSCHIE 1912, characterized by relatively lighter-coloured females, but it has remained obscure and was eventually synonymized with H. n. niger following observations of individuals with intergrading features (Harper 1945; Ansell 1972, 1974).

Fig. 1.18 - Subspecies boundaries for (a) roan (Hippotragus equinus) following Ansell (1972) e adapted to the species distribution range from IUCN (2008), and for (b) sable (H. niger), following Ansell (1972) and Ansell & Dowsett (1988), adapted to the species distribution range from IUCN (2008).

The year of 1916 marks the formal description of the giant sable H. n. variani in Angola, characterized by much larger horns and corresponding skull measurements, and by complete obliteration of white muzzle line in bulls (Thomas 1916; Blaine 1922). Female giant sables are golden to chocolate-brown, often with dark faces. Possibly even more than Roosvelt’s sable and on morphological grounds alone, the giant sable may be the most distinctive sable subspecies, as reflected by significant larger size not only of its enormous horns but also skull, and with teeth that often compare to roan measurements (Thomas 1916; Blaine 1922; Klein 1974; Groves & Grubb 2011). As result, not only Thomas (1916) hesitated, but actually Blaine (1922) proposed elevating the giant sable to specific status. However Blaine’s suggestion was not followed by most subsequent authors (but see Harper 1945), and a four sable subspecies classification would remain undisputed for almost 70 years. In 1983, a comparative morphological study on museum specimens resulted on the description of a fifth subspecies, H. n. anselli, corresponding

FCUP 34 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) to sable from Malawi and eastern Zambia (Groves 1983). Reportedly, this race was of average body size but with narrow skulls, with females of red-golden colour, and having a distinctive facial mask with very broad white muzzle line (Groves 1983). This study was based on a small sample size, and often H. n. anselli has been ignored or overlooked by subsequent authors, but it is nevertheless a geographically coherent population and is here considered (Fig. 1.18b).

If some subspecies boundaries seemed to have clear-cut geographical definition, others warranted clarification because of under-sampling of critical locations, leading to several “grey areas” of uncertain correspondence or possible intergradation (Ansell 1972, 1974; Estes & Kingdon 2013). Specifically, with H. n. variani isolated in an Angolan “island”, H. n. niger has been the only race claimed for southern Africa south of the Zambezi and H. n. roosevelti for Kenya, while H. n. kirkii occupies most of Zambia and extends into the Democratic Republic of Congo (Ansell 1972, 1978; Estes & Estes 1974; Estes 2013; Butynski et al. 2015). Conversely sable populations from east Zambia and Malawi, from west Tanzania, east Tanzania and northern Mozambique, have been historically difficult to ascribe to subspecies. Regarding the geographic region of east Zambia and Malawi between the dry corridor of Muchinga/ Luangwa valley (Groves & Grubb 1999) and the southern extension of the EARS, Sweeney (1959) separated those sable from the rest of Zambia and attributed them to the typical race, but this statement was considered doubtful by Ansell (1972) who temporarily ascribed them to H. n. kirkii as in the rest of Zambia, before they were later proposed as H. n. anselli (Ansell 1972, 1974; Groves 1983; Ansell & Dowsett 1988; Groves & Grubb 2011). The status of Tanzanian sables has often been confusing, and more frequently referred to as H. n. kirkii or H. n. roosevelti (Swynnerton & Hayman 1951). However there seems to be two distinct populations in Tanzania, separated by the Somali arid corridor that runs along the rain shadow of the EAM (Ansell 1972; Grubb 1999). The west Tanzanian sables have been relatively less studied and are poorly represented in museum collections, and were suggested to be H. n. kirkii simply by exclusion of other races (Ansell 1972). Eastern Tanzania sable have been more often classified as H. n. roosevelti, while northern Mozambican sable were occasionally assigned to H. n. kirkii or H. n. niger, but without clear justification. One key factor is determining the southern extension of H. n. roosevelti, and although it has been suggested a southern limit defined by river Rufiji (Estes 2013), mounting evidence suggest a continuum distribution and phenotypical gradation of H. n. roosevelti along the coastal eastern regions southwards and into northern Mozambique (Siege & Baldus 1999; Booth 2002), although an intergradation with H. n. anselli has also been suggested (Groves 1983).

FCUP 35 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

1.4 Modern tools for Hippotragus evolutionary biology

The development of modern molecular tools has revolutionized biological studies, much improving our understanding of the evolutionary inter-relationships among and within different species and the processes underlying speciation (Avise et al. 1987; Avise 1994). While phylogenetics focuses on determining relationships between species or sister-clades, population genetics elaborates on the differences within or between populations (Avise 1994). Phylogeography emerged from the opportunity of combining phylogenetics and population genetics under a biogeographical framework (Avise et al. 1987; Avise 1994), and deals with the spatial and temporal patterns of genetic diversity within or among closely related species (Avise 2009; Knowles 2009). These related and often overlapping approaches have blossomed in recent years with the discovery and refinement of new technological approaches, which are increasingly more efficient and less costly.

The two extant members of the genus Hippotragus, roan and sable, are probably among the best mammal candidate species in Africa for ongoing and future molecular studies within the various fields of genetic research. In particular their wide yet patchy distribution, often but not always in sympatry across African savanna biomes, makes them excellent models to test for phylogeographic signatures and population structure. In addition, they both are low-density and high-valued commercial species (Lindsey et al. 2013; Taylor et al. 2016), and include some of the rarest and more threatened African mammal populations (East 1998; Estes 2013), therefore much increasing the need for an improved and in-depth knowledge, that is expected to have a direct positive impact in conservation and economic terms.

1.4.1 Molecular markers

A crucial milestone in the development of DNA-based molecular markers was driven by the invention of Polymerase Chain Reaction (PCR), which allowed amplification and analyses of specific loci for many individuals simultaneously (Schloterer 2004). Ensuing phylogeographic studies relied for several years on a single-locus approach, often mitochondrial DNA (mtDNA), until its shortcomings became evident. For example it was shown both analytically and empirically, that gene trees can differ significantly depending on the type of markers used (Avise 1994), and this genealogical discordance should be taken into account for it provides relevant information to understand the evolutionary

FCUP 36 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) histories (Avise 1994; Knowles 2009). Therefore, the use of different molecular markers to infer population and species histories has become the baseline in conservation genetic studies (Wan et al. 2004; Knowles 2009; McCormack et al. 2013). More recently, a new revolution has stemmed from Next Generation Sequencing (NGS) allowing a much more efficient development of loci and a genomic approach to address evolutionary biology.

Mitochondrial DNA

For over 30 years mtDNA sequences have been the marker of choice for phylogeographic studies (Avise 2009; Brito & Edwards 2009). The mitochondrial genome in animals is small and highly compact without non-coding sequences, consisting of a closed circular molecule about 17,000 nucleotide pairs in length, which can be present in hundreds or thousands of copies on the cytoplasm of a given cell (Avise 2009). It also displays a very high mutation rate possibly due to inefficient mechanisms of DNA repair (Wan et al. 2004; Avise 2009). In addition, mtDNA does not recombine and is characterized by a unique inheritance pattern, exclusively by maternal transmission (Avise 2009). The small size, simplicity, abundance, fast-evolution, smaller effective population size and uniparental transmission, make it a relatively easy task to genotype mitochondrial fragments, which are highly informative at species-level or lower, and suitable to address most phylogeographic questions.

The fact that Hippotragus species are typically matrilocal with sedentary breeding herds and male-mediated dispersal (Chardonnnnet & Crosmary 2013; Estes 2013), makes the mtDNA especially sensitive to detect genealogical structure (Avise 2009). Another important advantage of using the relatively easier-to-extract mtDNA to study Hippotragus, derives from the rarity of many wild populations of roan and sable, and scarcity of good-quality samples, contrasting with the availability of lower-quality samples from museums or obtained non-invasively.

Nuclear DNA - Microsatellites

Unlike mtDNA, the DNA present within the cell nucleus, known as nuclear DNA (nuDNA), is by-parentally inherited, going through a recombination process that can garble what would otherwise be a clear genealogical signature from the nuclear genome (Avise 2009). Although most nuDNA sequences tend to be conservative, some portions and more specifically microsatellites, display a high evolutionary rate and have been employed successfully and increasingly in phylogeographical analyses (Wan et al. 2004;

FCUP 37 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Avise 2009; Brito & Edwards 2009; Kalia et al. 2011), and constitute the cornerstone for studies addressing population genetics structure and dynamics (Zhang et al. 2003; Schlotterer 2004; Cutter 2013; Defaveri et al. 2013; Hodel et al. 2016).

Microsatellites are dispersed throughout the nuclear genome and consist of short tandemly repeated DNA motifs, of generally one to six nucleotides (Hancock 1999). These repetitive sequences experience high mutation rates possibly caused by replication slippage and are codominantly inherited (Ellegren 2010). The popularity of microsatellites is largely because they are single-locus markers, polymorphic with high allelic diversity, can be tested for neutrality and follow Mendelian inheritance rules, features that make them powerful tools in assessing genetic similarities between individuals or closely related taxa (Zang et al. 2003; Kimberley et al. 2006; Guichoux et al. 2011; Hodel 2016). These markers should preferably be developed specifically for each species or derived from a closely related species, because an increase of amplification failure and a sharp decrease in polymorphism of loci is expected with higher genetic divergence (Wan et al. 2004).

The development of species-specific nuclear markers such as microsatellites, for Hippotragus, is of critical importance to elucidate intraspecific evolutionary relationships (Avise 1994; Godinho et al. 2008), to test phylogeographical assumptions (Avise 1994, 2009), and to address conservation genetics issues such as interspecific hybridization (Palumbi & Cipriano 1998; Wan et al. 2004; Godinho et al. 2011; Miralles et al. 2013).

Genomes

Technological advancements in the speed, cost and accuracy of NGS are allowing huge improvements in our capacity to generate genome-wide molecular data (Hemmer- Hansen et al. 2014). This genomic revolution is having a massive impact on evolutionary genetics and giving rise to new fields such as phylogenomics or population genomics (Cutter 2013; McCormack et al. 2013). The novel complex genetic data obtained under this framework is sweeping across existing disciplines and providing a much improved understanding of biodiversity from micro- to macro-evolutionary scales (Cutter 2013).

The mitochondrial genome corresponds to a relatively small but critical component of the total DNA on a eukaryotic cell, with the study of nucleotide sequences from complete mitochondrial genomes being commonly referred to as mitogenomics. Among mammals the field of mitogenomics has mainly focused on phylogenetic analyses, providing valuable information on group interrelationships at various levels (Arnason et al. 2008).

FCUP 38 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Some of the critical contributions of analysing complete mitochondrial sequences, as opposed to shorter mitochondrial fragments, in a phylogenetic approach, result from better resolution and stronger statistical support for the phylogenetic trees and a narrowing-down of divergence time credibility intervals (Moore 2000; Rokas & Carroll 2005; Yu et al. 2007; Chan et al. 2010; DeFilippis & Duchene et al. 2011; Vilstrup et al. 2011; Zinner et al. 2013). The study of deep-rooted phylogenetic relationships has been further enhanced by the use of palaeontological material to calibrate extant mitogenomes (Donoghue et al. 2007; Bibi 2013), and by incorporating ancient DNA genomic sequences obtained from museum specimens (Cooper et al. 2001; Briggs et al. 2009; Ho & Gilbert 2010; Rohland et al. 2010; Pajimans et al. 2013; Meyer et al. 2014).

Relatively less studies have resorted to mitogenomics to address shallower divergence in mammals and phylogeographic questions, but some specific examples have already demonstrated how the increased resolution of complete genomic sequences have disentangled unclear phylogeographic patterns based on shorter mitochondrial fragments (Alexander et al. 2003; Foote et al. 2011; Knaus et al. 2011).

Unlike the mitochondria that is sequenced in full, a nuclear genome sequence corresponds to a variable proportion of that genome being assembled (Ellegren 2014). In any case, modern sequencing tools are allowing the discovery, sequencing and genotyping of thousands of polymorphic markers across an entire nuclear genome in one single trial (Davey et al. 2011). These novel genomic approaches, by simply increasing the number of neutral loci, are much improving the power and accuracy of diverse important parameters for biodiversity conservation (Allendorf et al. 2010), and particularly having a significant impact on phylogeographic studies (Cutter 2013; McCormack et al. 2013) and population genetics (Cutter 2013; Ellegren 2014; Hammer- Hansen et al. 2014). Applying genomics to the study of Hippotragus in the near future, will be a giant leap forward on the current knowledge of the group.

1.4.2 Molecular research on Hippotragus

In spite of the economic and conservation value associated with roan and sable, relatively little molecular research has been carried out on these two species, constrained by incomplete sampling efforts and mostly based on small fragments of mtDNA. The results obtained have uncovered some very interesting patterns, but also raised intriguing questions, and haven’t yet been able to clarify outstanding themes such as the evolutionary history of both species, and their intraspecific taxonomy.

FCUP 39 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Roan antelope genetics

Following early efforts using allozymes (Grobler & Van der Bank 1993; Grobler & Nel 1996), molecular studies focusing on roan antelope relied on small mitochondrial fragments and cattle-cloned microsatellites, and were constrained by small sample sizes (Mathee & Robinson 1999; Alpers et al. 2004). These efforts presented some genetic diversity measures and provided strong support for separating a western cluster corresponding to H. e. koba (Mathee & Robinson 1999; Alpers et al. 2004) (Fig. 1.19a). The western cluster was recommended as an Evolutionary Significant Unit, and the authors suggested a phylogeographical interpretation deriving from a west/ east- southern split in Africa resulting from climatic oscillations during the Pleistocene (Alpers et al. 2004). In spite of the deeper split of the western cluster validating H. e. koba, and a polyphyletic result for the samples from three other putative subspecies, H. e. equinus, H. e. cottoni and H. n. langheldi (Alpers et al. 2004), a more comprehensive sampling effort and additional markers are warranted to clarify the intraspecific taxonomy of roan.

Fig. 1.19 - Intraspecific phylogenetic relatioships represented in schematic cladograms for (a) roan (Hippotragus equinus) adapted from Alpers et al. (2004), and for (b) sable (H. niger) adapted from Pitra et al. (2006). The colours correspond to the putative subspecies as named by the respective authors.

Sable antelope genetics

Similarly to the roan antelope, the first genetic approaches on sable were simple assessments of genetic variability and comparisons based on allozyme divergence (Grobler & Van der Bank 1993, 1994). Subsequent studies on sable genetics have all been based on mitochondrial fragments, (Mathee & Robinson 1999; Pitra et al. 2002; Pitra et al. 2006; Jansen van Vuuren et al. 2010).

Mathee and Robinson (1999) analysed mtDNA control region sequences to determine geographic structure and patterns of genetic variation in H. niger. This phylogeographical

FCUP 40 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) approach included sable samples from Angola, west Tanzania, Malawi, Zambia, and South Africa, and was the first study to reveal a deep divergence separating two matrilineal clades, well delineated geographically. The split separated west Tanzanian from all remaining samples scoring an average 17.0% sequence divergence, and was interpreted as evidence of a phylogeographic break between eastern and southern Africa (Mathee & Robinson 1999). In contrast, the samples from southern Africa revealed no discernible regional structuring, and showed minor divergence compared to the deep Tanzanian split, with the highest value of divergence of 4.1% scored for the Angolan sample (Mathee & Robinson 1999). Southern African samples were polyphyletic but interestingly, and although poorly supported, the Angolan and Malawian samples grouped together. The authors claimed that the results clearly supported the eastern taxa H. n. roosevelti represented by the west Tanzanian sable, and questioned the validity of H. n. kirkii and H. n. variani, although recognizing low sampling size as a major limitation. One inconsistency on this study was the assumption of west Tanzanian sable as Roosevelt’s sable, when based on previous taxonomic research (Ansell 1972; Groves 1983) H. n. roosevelti may actually have been the only subspecies not included in their dataset.

A subsequent phylogeographic effort used cytochrome b gene sequences in addition to the control region and pooled samples from Kenya, west and east Tanzania, west and east Zambia, Botswana, Zimbabwe and Namibia (Pitra et al. 2002). All recognized subspecies were supposedly included in this dataset except the giant sable. The results confirmed the very deep split of west Tanzanian sables scoring 18.2% sequence divergence, and two distinct clades among remaining populations, separating southern sables and the true eastern sables from Kenya and east Tanzania (Pitra et al. 2002). One unexpected finding was the observation on the same sable populations of west Tanzania, of haplotypes from both the highly divergent and the southern clade. This mitochondrial pattern was explained by the authors as resulting from an ancient allopatric fragmentation in eastern Africa, followed by a subsequent split between eastern and southern African populations, and finally by a recent long distance colonization event from southern Africa into west Tanzania. In addition they interpreted this sequence of events within the framework of an exceptional historical outbreeding episode (Pitra et al. 2002), but it is unclear the justification for the outbreeding scenario. In terms of intraspecific taxonomy Pitra et al. (2002) found good grounds to support H. n. roosevelti in eastern Africa, but not enough differences within southern Africa to justify more than one taxa H. n. niger, and therefore not recognizing H. n. anselli and H. n. kirkii, while

FCUP 41 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) stressing that the introgressed nature of west Tanzania sable prevented clarification until more extensive sampling, additional loci and morphological data, were added.

The addition of a few giant sable samples obtained from dung and museums, with the main objective of demonstrating that it had survived the Angolan civil war, allowed a new phylogenetic analyses using the same mitochondrial fragments as previously (Pitra et al. 2006). While increasing the resolution of the previous efforts, this study confirmed the three main evolutionary clades, in which the Angolan samples are a monophyletic group within southern sable but nested closely with the southern-like set of haplotypes from west Tanzania (Pitra et al. 2006) (Fig. 1.19b). The authors proposed a scenario in which both the Angolan and west Tanzanian sable had been subjected in the recent past to episodic long-distance colonisations from a common-source population. In terms of taxonomic assignment Pitra et al. (2006) found good support for H. n. kirkii, H. n. roosevelti and H. n. niger and raised some questions regarding H. n. variani, which could be synonymized with H. n. niger yet pending on further studies. It should be cautioned that the assignment of H. n. kirkii to west Tanzania, while ascribing Zambian sable to H. n. niger, violates taxonomic rules as the former name had been initially described for Zambian sable (Gray 1872; Ansell 1972). The authors also claimed not to be able to test the validity of H. n. anselli for lack of material, but did include in their dataset one sample from Luangwa east Zambia, which should have be assigned to that taxa (Ansell 1972; Groves 1983; Groves & Grubb 2011). Nevertheless, the Luangwa sample had been mislabelled and should instead read Lusaka (Hans Siegesmund, pers. comm.).

In 2010, Jansen van Vuuren et al., investigated further the phylogenetic relationships among sable adding more samples from Zambia but still following the same methodological approach. The results obtained were consistent with previous findings but led the authors to sustain H. n. variani as a distinct evolutionary lineage and well differentiated from the geographically closest populations in west Zambia. Similarly to the previous study the taxonomy proposed is difficult to interpret (Pitra et al. 2006; Jansen van Vuuren et al. 2010), as violates taxonomic rules and makes subspecific names correspond to clades rather than to geographically defined populations, which would lead to subspecies sympatry in west Tanzania.

Although these molecular studies have contributed to our current knowledge on the phylogeography of the species and its intraspecific relationships, the conclusions were constrained by limited sampling and methodology, and further blurred by a number of inconsistencies. As result, the intraspecific taxonomy has become irreconcilable with phenotypical and geographical knowledge. Of particular concern is the enigmatic west

FCUP 42 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Tanzanian sable (Groves & Grubb 2011), which has been assigned to different subspecies or suggested to be a hybrid taxon (Pitra et al. 2006; Groves & Grubb 2011;Estes 2013). Critical questions also apply to the iconic giant sable antelope, as its phenotypical uniqueness and geographical isolation have not necessarily been reflected on the various molecular studies published, resulting in conflicting conclusions, and contributing poorly to unravel its evolutionary history.

More advanced molecular tools, a multi-locus approach and a more comprehensive sampling effort are expected to play a decisive role in unveiling the evolutionary history of sable antelope in the near future.

1.5 Objectives and organization of the thesis

This thesis focuses primarily on the critically endangered giant sable antelope, providing answers to important questions related to the past or currently affecting its conservation status. On a wider scale, our work has been expanded to address the evolutionary history of the whole species, framing the giant sable within a broader context, and discriminating the various sable populations with much increased taxonomic clarification. The following specific objectives have been set:

i) assess the current genetic diversity of giant sable and establish a comparison with other extant and historical populations; ii) determine ongoing interspecific hybridization between H. n. variani and H. equinus in Cangandala, and explore the possibility of introgression; iii) elaborate on the evolutionary history of H. niger, providing a coherent explanation for the origin of H. n. variani and investigate past introgression in west Tanzania; iv) study all known populations of H. niger with a panel of microsatellites, looking at population genetic parameters and population structure, and make a decisive contribution to the intraspecific taxonomy of sable; v) determine the origin of a mysterious nineteenth century horn housed in the Museum of the University of Florence, suspected to be the oldest available material of H. n. variani; vi) investigate the past demography of H. n. variani since historical times, by including specimens from museums and private collections and resorting to ancient DNA techniques.

FCUP 43 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

This dissertation is organized in five main chapters and contains five scientific papers. Chapter 1 is the present chapter corresponding to the General Introduction, and presents a summary of the most significant knowledge on the natural history of the giant sable, exploring aspects of conservation concern; in addition, an overview of the genus Hippotragus is included, with a brief description of molecular tools used and what is currently known based on genetics. This introductory chapter provides an appropriate background for the various research lines presented as scientific papers in Chapter 2, Chapter 3 and Chapter 4, and preceding a General Discussion in Chapter 5.

In Chapter 2 we focus on the critically endangered giant sable antelope following the development of a comprehensive panel of species-specific microsatellites. These newly developed markers were applied to infer for the first time genetic diversity levels within H. n. variani, and to address a suspected episode of introgressive interspecific hybridization with congeneric roan antelope in CNP. The results are organized in two scientific papers already published in SCI (Scientific Citation Index) journals:

Paper I Vaz Pinto, P., Lopes, S., Mourão, S., Baptista, S., Siegismund, H. R., Jansen van Vuuren, B., Beja, P., Ferrand, N., & Godinho, R. (2015). First estimates of genetic diversity for the highly endangered giant sable antelope using a set of 57 microsatellites. European Journal of Wildlife Research, 61(2): 313-317.

Paper II Vaz Pinto, P., B., Beja, P., Ferrand, N., & Godinho, R. (2016). Hybridization following population collapse in a critically endangered antelope. Scientific Reports, 6, 18788.

In Paper I we report on the development of a panel of 57 sable species-specific microsatellites which are further tested successfully on Hippotragus equinus. The results obtained for giant sable and compared with other two sable populations, reveal very low levels of genetic diversity, consistent with an evolutionary history marked by recent bottlenecks. Paper II explores a remarkable case of ongoing hybridization between roan and sable antelopes, which followed a severe population crash at the end of the Angolan civil war. Hybridization and introgression are confirmed with the use of molecular markers, and documented in detail by a seven year effort combining ground observations

FCUP 44 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) and camera trapping. We further discuss the chain of events that led to the hybridization crisis, and the conservation implications.

In Chapter 3 we investigate the evolutionary history of sable antelope throughout the Pleistocene and interrelationships among extant populations. For this purpose we build on a most comprehensive dataset covering the entire species range and including museum specimens to fill in information gaps, and we combine ancient DNA techniques, mitogenomes and nuclear markers. The findings are presented in two manuscripts in the final stages of preparation before submission:

Paper III Rocha, J., Vaz Pinto, P., Siegismund, H. R., Meyer, M., Jansen van Vuuren, B., Veríssimo, L., Ferrand, N., & Godinho, R. Phylogeography of sable antelope shaped by geomorphology and climate. In preparation.

Paper IV Vaz Pinto, P., Siegismund, H. R., Jansen van Vuuren, B., Ferrand, N., & Godinho, R. Population structure and patterns of differentiation of sable antelope. In preparation.

Paper III uses Hippotragus niger as a model species to study evolutionary patterns of African ungulates during the Pleistocene, and how these may have been framed by the continent’s complex geomorphological dynamics and quaternary climatic oscillations. By applying mitochondrial genomic sequences on a wide dataset that covers the whole species range, we unveil a series of vicariance episodes that shaped the phylogeographic patterns observed. In particular we explain the existence of a highly divergent mitochondrial lineage in west Tanzania, we provide a coherent scenario for the origin of H. n. variani, and we highlight the importance of the Zambezi River in driving speciation in southern Africa. In Paper IV we focus on a population genetics approach using microsatellites, extended to all known populations of H. niger. The results obtained allow us to recognize discrete population units, to explore the interrelationships among the various populations, and to propose a subspecific taxonomic revision and define management units.

FCUP 45 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Chapter 4 underlines the importance of natural history collections, by addressing one problematic specimen. The results are presented in one manuscript in the final stages of preparation before submission.

Paper V Vaz Pinto, P., Rocha, J., Agnelli, P., Ferrand, N., & Godinho, R. Molecular contribution to resolve the origin of the mysterious Florence horn. In preparation.

In Paper V we offer a solution for a nineteenth century old mystery by demonstrating that a remarkable horn of unknown provenance which had puzzled famous naturalists and features in the zoological collections of the Natural History Museum of the University of Florence, is the oldest known specimen of giant sable, predating the formal taxonomic description in over 40 years. We can also determine that the mitochondrial lineage in the Florence horn represents a once common but apparently now extinct lineage within giant sable.

Finally, Chapter 5 consists on a General Discussion highlighting the most relevant findings obtained in this work, before concluding the dissertation with final considerations, presenting the main ongoing research lines focusing on the ecology and conservation of giant sable antelope, and prospects for future work.

1.6 References

Abbott, R., Albach, D., Ansell, S., Arntzen, J. W., Baird, S. J., Bierne, N., ... & Butlin, R. K. (2013). Hybridization and speciation. Journal of Evolutionary Biology, 26(2), 229-246.

Agundis T. M. (1965). El llamado de la montaña, viajes de cacería, Angola-Tanzania- Alaska. Rustica editorial, Mexico.

Alexander, A., Steel, D., Slikas, B., Hoekzema, K., Carraher, C., Parks, M., ... & Baker, C. S. (2013). Low diversity in the mitogenome of sperm whales revealed by next- generation sequencing. Genome biology and evolution, 5(1), 113-129.

Allendorf, F. W., Hohenlohe, P. A., & Luikart, G. (2010). Genomics and the future of conservation genetics. Nature reviews genetics, 11(10), 697-709.

FCUP 46 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Allsopp, R. (1979). Roan antelope population in the Lambwe Valley, Kenya. Journal of Applied Ecology, 109-115.

Alpers, D. L., van Vuuren, B. J., Arctander, P., & Robinson, T. J. (2004). Population genetics of the roan antelope (Hippotragus equinus) with suggestions for conservation. Molecular ecology, 13(7), 1771-1784.

Ansell, W. F. H. (1972). Part 15: Order Artiodactyla. In: Meester J. A. J. & Setzer H. W. (eds). The Mammals of Africa: an identification manual, 1-93. Smithsonian Institution Press: Washington DC.

Ansell, W. F. H. (1974). Some mammals from Zambia and adjacent countries. National Parks and Wildlife Service, Zambia.

Ansell, W. F. H. (1978). The mammals of Zambia (No. 1). National Parks & Wildlife Service.

Ansell, W. F. H., & Dowsett, R. J. (1988). Mammals of Malawi. Trendrine.

Arnason, U., Adegoke, J. A., Gullberg, A., Harley, E. H., Janke, A., & Kullberg, M. (2008). Mitogenomic relationships of placental mammals and molecular estimates of their divergences. Gene, 421(1), 37-51.

Arnold, M. L. (1997). Natural hybridization and evolution. Oxford University Press.

Avise, J. C. (1994). Molecular markers, natural history and evolution. Springer Science & Business Media.

Avise, J. C. (2009). Phylogeography: retrospect and prospect. Journal of biogeography, 36(1), 3-15.

Avise, J. C., Arnold, J., Ball, R. M., Bermingham, E., Lamb, T., Neigel, J. E., ... & Saunders, N. C. (1987). Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Annual review of ecology and systematics, 18(1), 489-522.

Badgley, C. (2010). Tectonics, topography, and mammalian diversity. Ecography, 33(2), 220-231.

Baptista, S. L., Pinto, P. V., Freitas, M. D. C., Cruz, C., & Palmeirim, J. M. (2013). Geophagy by African ungulates: the case of the critically endangered giant sable antelope of Angola (Hippotragus niger variani). African Journal of Ecology, 51(1), 139-146.

FCUP 47 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Barbosa, L. A. G. (1970). Carta fitogeográfica de Angola. Instituto de Investigação Científica de Angola. Oficinas Gráficas de Angola, Luanda.

Bibi, F. (2013). A multi-calibrated mitochondrial phylogeny of extant Bovidae (Artiodactyla, Ruminantia) and the importance of the fossil record to systematics. BMC Evolutionary Biology, 13(1), 166.

Blaine, G. (1922). Notes on the Zebras and some Antelopes of Angola. In Proceedings of the Zoological Society of London 92(2): 317-339. Blackwell Publishing Ltd.

Boardman, R. (1981). International organization and the conservation of nature. Springer.

Bobe, R., Behrensmeyer, A. K., & Chapman, R. E. (2002). Faunal change, environmental variability and late Pliocene hominin evolution. Journal of human evolution, 42(4), 475-497.

Bobe, R., Behrensmeyer, A. K., Eck, G. G., & Harris, J. M. (2007). Patterns of abundance and diversity in late Cenozoic bovids from the Turkana and Hadar basins, Kenya and Ethiopia. In Bobe, R., Alemseged, Z, & Behrensmeyer, A. K. (eds). Hominin environments in the East African Pliocene – An assessment of the faunal evidence. Ch 7, 159-182.

Bond, W. J. (2016). Ancient grasslands at risk. Science, 351(6269), 120-122.

Booth, V. (2002). Current status of sable antelope classification in the Niassa National Reserve, Northern Mozambique. Unpublished report. Fauna and Flora International.

Briggs, A. W., Good, J. M., Green, R. E., Krause, J., Maricic, T., Stenzel, U., ... & Gušić, I. (2009). Targeted retrieval and analysis of five Neandertal mtDNA genomes. Science, 325(5938), 318-321.

Brito, P. H., & Edwards, S. V. (2009). Multilocus phylogeography and phylogenetics using sequence-based markers. Genetica, 135(3), 439-455.

Butynski, T. M., Parker, I., & Jong, Y. A. D. (2015). Historic and Current Distribution, Abundance, and Habitats of Roosevelt's Sable Antelope Hippotragus niger roosevelti (Heller, 1910) (Cerartiodactyla: Bovidae) in Kenya. Journal of East African Natural History,104(1-2), 41-77.

FCUP 48 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Carbone, L., Nergadze, S. G., Magnani, E., Misceo, D., Cardone, M. F., Roberto, R., ... & Raudsepp, T. (2006). Evolutionary movement of centromeres in horse, donkey, and zebra. Genomics, 87(6), 777-782.

Chan, Y. C., Roos, C., Inoue-Murayama, M., Inoue, E., Shih, C. C., Pei, K. J. C., & Vigilant, L. (2010). Mitochondrial genome sequences effectively reveal the phylogeny of Hylobates gibbons. PLoS One, 5(12), e14419.

Chardonnet & Crosmary (2013). Hippotragus equinus Roan Antelope. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 548-556. A&C Black.

Chirima, G. J., Owen‐Smith, N., Erasmus, B. F., & Parrini, F. (2013). Distributional niche of relatively rare sable antelope in a South African savanna: habitat versus biotic relationships. Ecography, 36(1), 68-79.

Cooper, A., Lalueza-Fox, C., Anderson, S., Rambaut, A., Austin, J., & Ward, R. (2001). Complete mitochondrial genome sequences of two extinct moas clarify ratite evolution. Nature, 409(6821), 704-707.

Cordingley, J. E., Sundaresan, S. R., Fischhoff, I. R., Shapiro, B., Ruskey, J., & Rubenstein, D. I. (2009). Is the endangered Grevy's zebra threatened by hybridization?. Animal Conservation, 12(6), 505-513.

Cotterill, F. P. D. (2003, February). Geomorphological influences on vicariant evolution in some African mammals in the Zambezi Basin: some lessons for conservation. In Proceedings of the Ecology and Conservation of Mini-antelope: An International Symposium on Duiker and Dwarf Antelope in Africa. Filander Verlag, Fürth (pp. 11-58).

Crawford-Cabral J. (1965). A palanca preta gigante, sua situação e medidas a adoptar. Luanda.

Crawford-Cabral J. (1967). Alguns aspectos da ecologia da palanca real (Hippotragus niger variani Thomas). Boletim do Instituto de Investigação Científica de Angola, 7: 5-38.

Crawford-Cabral J. (1969). A study of the giant sable. The Zoological Society of Southern Africa. News Bulletin, 10(2): 1-7.

Crawford-Cabral J. (1970). Alguns aspectos da ecologia da palanca real (Hippotragus niger variani Thomas). Boletim do Instituto de Investigação Científica de Angola, 7: 5-38.

FCUP 49 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Crawford-Cabral, J., & Veríssimo, L. N. (2005). The ungulate fauna of Angola: systematic list, distribution maps, database report. Ministério da Ciência, Tecnologia e Ensino Superior, Instituto de Investigação Científica Tropical.

Cutter, A. D. (2013). Integrating phylogenetics, phylogeography and population genetics through genomes and evolutionary theory. Molecular phylogenetics and evolution, 69(3), 1172-1185.

Cuvier, G. B., & Griffith, E. (1832). The Animal Kingdom Arranged in Conformity with Its Organization: By Baron Cuvier, with Supplementary Additions to Each Order, by Edward Griffith and Others (Vol. 4). Whittaker, Treacher, and Company.

Davey, J. W., Hohenlohe, P. A., Etter, P. D., Boone, J. Q., Catchen, J. M., & Blaxter, M. L. (2011). Genome-wide genetic marker discovery and genotyping using next- generation sequencing. Nature Reviews Genetics, 12(7), 499-510.

DeFaveri, J., Viitaniemi, H., Leder, E., & Merilä, J. (2013). Characterizing genic and nongenic molecular markers: comparison of microsatellites and SNPs. Molecular ecology resources, 13(3), 377-392.

DeFilippis, V. R., & Moore, W. S. (2000). Resolution of phylogenetic relationships among recently evolved species as a function of amount of DNA sequence: An empirical study based on woodpeckers (Aves: Picidae). Molecular phylogenetics and evolution, 16(1), 143-160.

De Merode, E., Smith, K. H., Homewood, K., Pettifor, R., Rowcliffe, M., & Cowlishaw, G. (2007). The impact of armed conflict on protected-area efficacy in Central Africa. Biology letters, 3(3), 299-301.

Donoghue, P. C., & Benton, M. J. (2007). Rocks and clocks: calibrating the Tree of Life using fossils and molecules. Trends in Ecology & Evolution, 22(8), 424-431.

Dmitrieva, E. L., & Serdyuk, N. V. (2011). Hippotraginae (Bovidae, Artiodactyla, Mammalia) from the Late Miocene of Tuva. Paleontological Journal, 45(6), 665- 673.

Dowling, T. E., & Secor, A. C. L. (1997). The role of hybridization and introgression in the diversification of animals. Annual review of Ecology and Systematics, 28(1), 593-619.

Duchêne, S., Archer, F. I., Vilstrup, J., Caballero, S., & Morin, P. A. (2011). Mitogenome phylogenetics: the impact of using single regions and partitioning schemes on

FCUP 50 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

topology, substitution rate and divergence time estimation. PLoS One, 6(11), e27138.

Dudley, J. P., Ginsberg, J. R., Plumptre, A. J., Hart, J. A., & Campos, L. C. (2002). Effects of war and civil strife on wildlife and wildlife habitats. Conservation Biology, 16(2), 319-329.

East, R. (1999). IUCN/SSC Antelope Specialist Group. African antelope database 1998. 21: 434. Ellegren, H. (2004). Microsatellites: simple sequences with complex evolution. Nature reviews genetics, 5(6), 435-445.

Estes, R. D. (2013). Hippotragus niger Sable Antelope. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 556-565. A&C Black.

Estes, R. D., & Estes, R. K. (1974). The biology and conservation of the giant sable antelope, Hippotragus niger variani Thomas, 1916. Proceedings of the academy of natural sciences of Philadelphia, 73-104.

Estes, R. D., & Kingdon, J. (2013). Genus Hippotragus. Roan and sable antelopes. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 547. A&C Black.

Faulkes, C. G., Mgode, G. F., Le Comber, S. C., & Bennett, N. C. (2010). Cladogenesis and endemism in Tanzanian mole‐rats, genus Fukomys:(Rodentia Bathyergidae): a role for tectonics?. Biological Journal of the Linnean Society, 100(2), 337-352.

Fernández, M. H., & Vrba, E. S. (2005). A complete estimate of the phylogenetic relationships in Ruminantia: a dated species‐level supertree of the extant ruminants. Biological reviews, 80(2), 269-302.

Finckh, M., Revermann, R., & Aidar, M. P. (2016). Climate refugees going underground– a response to Maurin et al.(2014). New Phytologist, 209(3), 904-909.

Flower, B. P., & Kennett, J. P. (1994). The middle Miocene climatic transition: East Antarctic ice sheet development, deep ocean circulation and global carbon cycling. Palaeogeography, palaeoclimatology, palaeoecology, 108(3-4), 537- 555.

Foote, A. D., Morin, P. A., Durban, J. W., Willerslev, E., Orlando, L., & Gilbert, M. T. P. (2011). Out of the Pacific and back again: insights into the matrilineal history of Pacific killer whale ecotypes. PLoS One, 6(9), e24980.

FCUP 51 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Frade F. (1958). Mesure adoptées pour la protection de l’Hippotrague géant en Angola. Mammalia, 22(3): 476-477.

Frade, F., & Sieiro, D. (1960). Palanca preta gigante de Angola. Junta de Investigações do Ultramar, Lisboa, Garcia de Orta, 8: 21-38.

Gentry, A. W. (2010). Bovidae. In: Werdelin L. W., & Sanders, W. J. (eds). Cenozoic Mammals of Africa, 744-796. University of California Press, Berkeley, California.

Gentry, A. W., & Gentry, A. (1978). Fossil Bovidae (Mammalia) of Olduvai Gorge, Tanzania. British Museum (Natural History).

Godinho, R., Abáigar, T., Lopes, S., Essalhi, A., Ouragh, L., Cano, M., & Ferrand, N. (2012). Conservation genetics of the endangered Dorcas gazelle (Gazella dorcas spp.) in Northwestern Africa. Conservation Genetics, 13(4), 1003-1015.

Godinho, R., Llaneza, L., Blanco, J. C., Lopes, S., Alvares, F., Garcia, E. J., ... & Ferrand, N. (2011). Genetic evidence for multiple events of hybridization between wolves and domestic dogs in the Iberian Peninsula. Molecular Ecology, 20(24), 5154- 5166.

Green, W. C., & Rothstein, A. (1998). Translocation, hybridization, and the endangered black‐faced impala. Conservation Biology, 12(2), 475-480.

Grobler, J. P., & Nel, G. P. (1996). Lack of allozyme heterogeneity at eight loci studied in a roan antelope Hippotragus equinus population from the Percy Fyfe Nature reserve. South African Journal of Wildlife Research, 26(1), 34-35.

Grobler, J. P., & Van der Bank, F. H. (1993). Genetic diversity and differentiation of the three extant southern African species of the subfamily Hippotraginae (Family: Bovidae). Biochemical systematics and ecology, 21(5), 591-596.

Grobler, J. P., & Van der Bank, F. H. (1994). Genetic heterogeneity in sable antelope (Hippotragus niger Harris 1838) from four southern African regions. Biochemical Systematics and Ecology, 22(8), 781-789.

Grobler, J. P., Rushworth, I., Brink, J. S., Bloomer, P., Kotze, A., Reilly, B., & Vrahimis, S. (2011). Management of hybridization in an endemic species: decision making in the face of imperfect information in the case of the black wildebeest— Connochaetes gnou. European journal of wildlife research, 57(5), 997.

Groves, C. P. (1983). A new subspecies of sable antelope, Hippotragus niger (Harris 1838). Revue de zoologie africaine, 97(4), 821-828.

FCUP 52 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Groves, C., & Grubb, P. (2011). Ungulate taxonomy. JHU Press.

Grubb, P., Sandrock, O., Kullmer, O., Kaiser, T. M., & Schrenk, F. (1999). Relationships between eastern and southern African mammal faunas. African biogeography, climate change, and human evolution, 253-267.

Guichoux, E., Lagache, L., Wagner, S., Chaumeil, P., Léger, P., Lepais, O., ... & Petit, R. J. (2011). Current trends in microsatellite genotyping. Molecular ecology resources, 11(4), 591-611.

Halse A. R. D. (ed.) (1998). Rowland Ward’s records of big game (XXV Edition). Hartam, South Africa.

Hancock, J. M. (1999) Microsatellites and other simple sequences: genomic context and mutational mechanisms. In: Goldstein D. B., & Schlötterer C. (eds). Microsatellites: Evolution and Applications, 1-9. Oxford University Press.

Harper, F. (1940). The nomenclature and type localities of certain Old World mammals. Journal of Mammalogy, 21(2), 191-203.

Harper, F. (1945). Extinct and vanishing mammals of the Old World. Extinct and Vanishing Mammals of the Old World.

Hassanin, A., Delsuc, F., Ropiquet, A., Hammer, C., van Vuuren, B. J., Matthee, C., ... & Couloux, A. (2012). Pattern and timing of diversification of Cetartiodactyla (Mammalia, Laurasiatheria), as revealed by a comprehensive analysis of mitochondrial genomes. Comptes rendus biologies, 335(1), 32-50.

Havemann, C.P., Retief, T.A., Tosh, C.A. and Bruyn, P.J., 2016. Roan antelope Hippotragus equinus in Africa: a review of abundance, threats and ecology. Mammal Review, 46(2), pp.144-158.

Hedrick, P. W. (2009). Conservation genetics and North American bison (Bison bison). Journal of Heredity, 100(4), 411-420.

Hemmer-Hansen, J., Therkildsen, N. O., & Pujolar, J. M. (2014). Population genomics of marine fishes: next-generation prospects and challenges. The Biological Bulletin, 227(2), 117-132.

Hensman, M. C., Owen‐Smith, N., Parrini, F., & Bonyongo, C. M. (2014). Resource use and the nutritional status of sable antelope in the Okavango Delta region of northern Botswana. African journal of ecology, 52(3), 265-273.

FCUP 53 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Hill, A. (1995). Faunal and environmental change in the Neogene of East Africa: evidence from the Tugen Hills sequence, Baringo District, Kenya. In Vrba, E. S., Denton G. H., Partridge T. C., & Buckle L. H. (eds). Paleoclimate and evolution with emphasis on human origins, 178-193. Yale University Press, New Haven.

Hill, J. E., & Carter, T. D. (1941). The mammals of Angola, Africa. Bulletin of the AMNH, 78(1).

Ho, S. Y., & Gilbert, M. T. P. (2010). Ancient mitogenomics. Mitochondrion, 10(1), 1-11.

Hodel, R. G., Segovia-Salcedo, M. C., Landis, J. B., Crowl, A. A., Sun, M., Liu, X., ... & Soltis, D. E. (2016). The report of my death was an exaggeration: A review for researchers using microsatellites in the 21st century. Applications in Plant Sciences, 4(6), 1600025.

Huntley B. J. (1972). Plano para o futuro da palanca real de Angola. Relatório do ecologista, serviços de protecção da fauna, Luando, Angola.

Huntley, B. J. (1982). Southern African savannas. In Ecology of tropical savannas (pp. 101-119). Springer Berlin Heidelberg.

Huntley, B. J. (2017). Wildlife at war in Angola, the rise and fall of an African eden. Protea Book House. Pretoria, South Africa.

Huntley, B. J., & Matos, E. M. (1992). Biodiversity: Angolan environmental status quo assessment report. IUCN Regional Office for Southern Africa, Harare, Zimbabwe.

Jansen van Vuuren, B. J., Robinson, T. J., Vaz Pinto, P., Estes, R., & Matthee, C. A. (2010). Western Zambian sable: Are they a geographic extension of the giant sable antelope?. South African Journal of Wildlife Research, 40(1), 35-42.

Joubert, S. C. J. (1970). The population ecology of the roan antelope Hippotragus equinus equinus (Desmarest, 1804), in the Kruger National Park. PhD thesis. University of Pretoria, South Africa.

Joubert, S. C. J. (1976). A study of the social behaviour of the roan antelope, Hippotragus equinus equinus (Desmarest, 1804), in the Kruger National Park. University of Pretoria, South Africa.

Kalia, R. K., Rai, M. K., Kalia, S., Singh, R., & Dhawan, A. K. (2011). Microsatellite markers: an overview of the recent progress in plants. Euphytica, 177(3), 309- 334.

FCUP 54 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Kanyamibwa, S. (1998). Impact of war on conservation: Rwandan environment and wildlife in agony. Biodiversity and Conservation, 7(11), 1399-1406.

Keet, D. (1989). Roan and sable cross-breed? Custos 18:18.

Kerley, G. I., Sims-Castley, R., Boshoff, A. F., & Cowling, R. M. (2009). Extinction of the blue antelope Hippotragus leucophaeus: modeling predicts non-viable global population size as the primary driver. Biodiversity and Conservation, 18(12), 3235.

Kimanzi, J. K. (2011). Mapping and modelling the population and habitat of the roan antelope (Hippotragus equinus langheldi) in Ruma National Park, Kenya. Ph.D. diss. Newcastle University, UK.

Kingdon, J. (1984). East African Mammals: an Atlas of Evolution in Africa. University of Chicago Press.

Kingdon, J. (2013). Tribe Hippotragini. Horse-like antelopes. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 544-546. A&C Black.

Kingston, J. D., & Harrison, T. (2007). Isotopic dietary reconstructions of Pliocene herbivores at Laetoli: Implications for early hominin paleoecology. Palaeogeography, Palaeoclimatology, Palaeoecology, 243(3), 272-306.

Klein, R. G. (1974). On the taxonomic status, distribution and ecology of the blue antelope, Hippotragus leucophaeus Pallas 1766. Annals of the South African Museum. 65(4): 99-143.

Klein, R. G., & Cruz-Uribe, K. (1991). The bovids from Elandsfontein, South Africa, and their implications for the age, palaeoenvironment, and origins of the site. African Archaeological Review, 9(1), 21-79.

Klein, R. G., Avery, G., Cruz-Uribe, K., & Steele, T. E. (2007). The mammalian fauna associated with an archaic hominin skullcap and later Acheulean artifacts at Elandsfontein, Western Cape Province, South Africa. Journal of Human Evolution, 52(2), 164-186.

Knaus, B. J., Cronn, R., Liston, A., Pilgrim, K., & Schwartz, M. K. (2011). Mitochondrial genome sequences illuminate maternal lineages of conservation concern in a rare carnivore. BMC ecology, 11(1), 10.

FCUP 55 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Knoop, M. C., & Owen‐Smith, N. (2006). Foraging ecology of roan antelope: key resources during critical periods. African Journal of Ecology, 44(2), 228-236.

Knowles, L. L. (2009). Statistical phylogeography. Annual Review of Ecology, Evolution, and Systematics, 40, 593-612.

Leakey, L. S. (1965). Olduvai Gorge 1951-1961 Volume 1: Fauna and Background. Cambridge.

Lindsey, P. A., Barnes, J., Nyirenda, V., Pumfrett, B., Tambling, C. J., Taylor, W. A., & Rolfes, M. T. S. (2013). The Zambian wildlife ranching industry: Scale, associated benefits, and limitations affecting its development. PloS one, 8(12), e81761.

Lorenzen, E. D., & Siegismund, H. R. (2004). No suggestion of hybridization between the vulnerable black‐faced impala (Aepyceros melampus petersi) and the common impala (A. m. melampus) in Etosha National Park, Namibia. Molecular Ecology, 13(10), 3007-3019.

Macandza, V. A., Owen‐Smith, N., & Cain, J. W. (2012a). Habitat and resource partitioning between abundant and relatively rare grazing ungulates. Journal of Zoology, 287(3), 175-185.

Macandza, V. A., Owen‐Smith, N., & Cain III, J. W. (2012b). Dynamic spatial partitioning and coexistence among tall grass grazers in an African savanna. Oikos, 121(6), 891-898.

Macandza, V., Owen‐Smith, N., & Roux, E. (2013). Faecal nutritional indicators in relation to the comparative population performance of sable antelope and other grazers. African journal of ecology, 52(3), 300-307.

Mallet, J. (2005). Hybridization as an invasion of the genome. Trends in ecology & evolution, 20(5), 229-237.

Mallet, J. (2008). Hybridization, ecological races and the nature of species: empirical evidence for the ease of speciation. Philosophical Transactions of the Royal Society B: Biological Sciences, 363(1506), 2971-2986.

Martin, R. B. (2003). Roan, Sable and Tsessebe – transboundary species project. Unpublished report. Windhoek: Ministry of Environment & Tourism and Namibia Nature Foundation: 96pp.

FCUP 56 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Matthee, C. A., & Robinson, T. J. (1999). Mitochondrial DNA population structure of roan and sable antelope: implications for the translocation and conservation of the species. Molecular Ecology, 8(2), 227-238.

Maurin, O., Davies, T. J., Burrows, J. E., Daru, B. H., Yessoufou, K., Muasya, A. M., ... & Bond, W. J. (2014). Savanna fire and the origins of the ‘underground forests’ of Africa. New Phytologist, 204(1), 201-214.

McCormack, J. E., Hird, S. M., Zellmer, A. J., Carstens, B. C., & Brumfield, R. T. (2013). Applications of next-generation sequencing to phylogeography and phylogenetics. Molecular Phylogenetics and Evolution, 66(2), 526-538.

Meyer, M., Fu, Q., Aximu-Petri, A., Glocke, I., Nickel, B., Arsuaga, J. L., ... & Pääbo, S. (2014). A mitochondrial genome sequence of a hominin from Sima de los Huesos. Nature, 505(7483), 403-406.

Miralles, L., Lens, S., Rodríguez-Folgar, A., Carrillo, M., Martín, V., Mikkelsen, B., & Garcia-Vazquez, E. (2013). Interspecific introgression in cetaceans: DNA markers reveal post-F1 status of a pilot whale. PloS one, 8(8), e69511.

Monard, A. (1935). Contribution à la mammologie d'Angola et prodrome d'une faune d'Angola. Arquivos do Museu Bocage, Lisboa.

Newton da Silva S. (1958). A caça e a protecção da fauna em Angola. Lisboa.

Oliveira, R., Godinho, R., Randi, E., & Alves, P. C. (2008). Hybridization versus conservation: are domestic cats threatening the genetic integrity of wildcats (Felis silvestris silvestris) in Iberian Peninsula?. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 363(1505), 2953-2961.

Owen-Smith, N., & Cain, J. W. (2007). Indicators of adaptive responses in home range utilization and movement patterns by a large mammalian herbivore. Israel Journal of Ecology & Evolution, 53(3-4), 423-438.

Owen-Smith, N., & Martin, J. (2015). Identifying space use at foraging arena scale within the home ranges of large herbivores. PloS one, 10(6), e0128821.

Owen‐Smith, N., & Goodall, V. (2014). Coping with savanna seasonality: comparative daily activity patterns of African ungulates as revealed by GPS telemetry. Journal of Zoology, 293(3), 181-191.

Paijmans, J. L., Gilbert, M. T. P., & Hofreiter, M. (2013). Mitogenomic analyses from ancient DNA. Molecular phylogenetics and evolution, 69(2), 404-416.

FCUP 57 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Palumbi, A. R., & Cipriano, F. (1998). Species identification using genetic tools: the value of nuclear and mitochondrial gene sequences in whale conservation. Journal of Heredity, 89(5), 459-464.

Parrini, F., & Owen‐Smith, N. (2010). The importance of post‐fire regrowth for sable antelope in a Southern African savanna. African Journal of Ecology, 48(2), 526- 534.

Pitra, C., Hansen, A. J., Lieckfeldt, D., & Arctander, P. (2002). An exceptional case of historical outbreeding in African sable antelope populations. Molecular Ecology, 11(7), 1197-1208.

Pitra, C., Vaz Pinto, P., O’Keeffe, B. W., Willows-Munro, S., van Vuuren, B. J., & Robinson, T. J. (2006). DNA-led rediscovery of the giant sable antelope in Angola. European Journal of Wildlife Research, 52(3), 145-152.

Plumptre, A. J., Bizumuremyi, J. B., Uwimana, F., & Ndaruhebeye, J. D. (1997). The effects of the Rwandan civil war on poaching of ungulates in the Parc National des Volcans. Oryx, 31(4), 265-273.

Rhymer, J. M., & Simberloff, D. (1996). Extinction by hybridization and introgression. Annual Review of Ecology and Systematics, 27(1), 83-109.

Ripple, W. J., Newsome, T. M., Wolf, C., Dirzo, R., Everatt, K. T., Galetti, M., ... & Macdonald, D. W. (2015). Collapse of the world’s largest herbivores. Science Advances, 1(4), e1400103.

Robinson, T. J., & Harley, E. H. (1995). Absence of geographic chromosomal variation in the roan and sable antelope and the cytogenetics of a naturally occurring hybrid. Cytogenetic and Genome Research, 71(4), 363-369.

Robinson, T. J., Morris, D. J., & Fairall, N. (1991). Interspecific hybridization in the Bovidae: sterility of Alcelaphus buselaphus X Damaliscus dorcas F1 progeny. Biological conservation, 58(3), 345-356.

Rohland, N., Reich, D., Mallick, S., Meyer, M., Green, R. E., Georgiadis, N. J., ... & Hofreiter, M. (2010). Genomic DNA sequences from mastodon and woolly mammoth reveal deep speciation of forest and savanna elephants. PLoS Biol, 8(12), e1000564.

Rokas, A., & Carroll, S. B. (2005). More genes or more taxa? The relative contribution of gene number and taxon number to phylogenetic accuracy. Molecular biology and evolution, 22(5), 1337-1344.

FCUP 58 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Rookmaker, L. C. (1992). Additions and revisions to the list of specimens of the extinct blue antelope (Hippotragus leucophaeus). Annals of the South African Museum. 102(3): 131-141.

Schlötterer, C. (2004). The evolution of molecular markers—just a matter of fashion?. Nature Reviews Genetics, 5(1), 63-69.

Schuette, J. R., Leslie, D. M., Lochmiller, R. L., & Jenks, J. A. (1998). Diets of hartebeest and roan antelope in Burkina Faso: support of the long-faced hypothesis. Journal of Mammalogy, 79(2), 426-436.

Sclater, P. L., & Thomas, O. (1899). The book of antelopes. RH Porter.

Selkoe, K. A., & Toonen, R. J. (2006). Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecology letters, 9(5), 615-629.

Siege L., & Baldus R. D. (1999). Phylogenetische Differenzierung von Subpopulationen der Rappenantilope (Hippotragus niger) in Ostafrika. Tanzania Wildlife Discussion paper No 25. Deutsche Gasellschaft fuer Technische Zusammenarbeit, Dar es Salaam.

Silva J. A. (1972). A palanca real - contribuição para o estudo bioecológico da palanca real (Hippotragus niger variani). Junta de Investigações do Ultramar. Lisboa.

Skinner, J. D., & Chimimba, C. T. (2005). The mammals of the southern African sub- region. Cambridge University Press.

Smithers, R. H. N. (1983). The mammals of the Southern African subregion. University of Pretoria, Pretoria.

Statham, J. C. B. (1922). Through Angola: a coming colony. W. Blackwood & sons. London.

Sweeney, R. C. H. (1959). A preliminary annotated check list of the mammals of Nyasaland. The Nyasaland Society, Blantyre.

Swynnerton, G. H. & Hayman, R. W. (1951). A checklist of the land mammals of the Tanganyika Territory and the Zanzibar Protectorate, journal of the East Afr'ican Natural History Society, 20, 274-392.

Taylor, A., Lindsey, P., Davies-Mostert, H., & Goodman, P. (2016). An assessment of the economic, social and conservation value of the wildlife ranching industry and its potential to support the green economy in South Africa. Department of Environmental Affairs, Republic of South Africa.

FCUP 59 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Thomas, O. (1916). A new sable antelope from Angola. In Proc. Zool. Soc. London. Part 1: 298-301.

Timberlake, J., & Chidumayo, E. (2011). Miombo ecoregion vision report. Biodiversity Foundation for Africa, Famona, Bulawayo, Zimbabwe, 20, 1-76.

Timberlake, J., Goyder, D., Crawford, F., Burrows, J., Clarke, G. P., Luke, Q., ... & Alves, T. (2011). Coastal dry forests in northern Mozambique. Plant Ecology and Evolution, 144(2), 126-137.

Tyler Faith, J., & Thompson, J. C. (2013). Fossil evidence for seasonal calving and migration of extinct blue antelope (Hippotragus leucophaeus) in southern Africa. Journal of Biogeography, 40(11), 2108-2118. van Bruggen, A. C. (1959). Illustrated notes on some extinct South African ungulates. South African Journal of Science, 197-200. van Wyk, A. M., Kotzé, A., Randi, E., & Dalton, D. L. (2013). A hybrid dilemma: a molecular investigation of South African bontebok (Damaliscus pygargus pygargus) and blesbok (Damaliscus pygargus phillipsi). Conservation Genetics, 14(3), 589-599.

Varian, H. F. (1953). Some African Milestones. G. Ronald.

Vaz Pinto, P. (2006). Hybridization in giant sable. A conservation crisis in a critically endangered Angolan icon. IUCN/ SSC Antelope Specialist Group. Gnusletter 26, 47-58.

Vilstrup, J. T., Ho, S. Y., Foote, A. D., Morin, P. A., Kreb, D., Krützen, M., ... & Willerslev, E. (2011). Mitogenomic phylogenetic analyses of the Delphinidae with an emphasis on the Globicephalinae. BMC evolutionary biology, 11(1), 65.

Vrba, E. S. (1987). New species and a new genus of Hippotragini (Bovidae) from Makapansgat Limeworks. Paleontol Afr, 31: 55-72

Vrba, E. S. (1995). The fossil record of African antelopes (Mammalia, Bovidae) in relation to human evolution and paleoclimate. In Vrba, E. S., Denton G. H., Partridge T. C., & Buckle L. H. (eds). Paleoclimate and evolution with emphasis on human origins, Ch 27, 385-424. Yale University Press, New Haven.

Vrba, E. S., & Gatesy, J. (1994). New Hippotragine antelope fossils from the Middle Awash, Ethiopia, in the context of the phylogeny of Hippotragini (Bovidae: Mammalia). Paleontol Afr, 31: 55-72.

FCUP 60 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Walker, J. F. (2004). A certain curve of horn: the hundred-year quest for the giant sable antelope of Angola. Grove/Atlantic, Inc.

Wan, Q. H., Wu, H., Fujihara, T., & Fang, S. G. (2004). Which genetic marker for which conservation genetics issue?. Electrophoresis, 25(14), 2165-2176.

White, F. (1983). The vegetation of Africa: a descriptive memoir to accompany the UNESCO/AETFAT/UNSO Vegetation Map of Africa. Paris, 356pp.

Wilson, D. E., & Hirst, S. M. (1977). Ecology and factors limiting roan and sable antelope populations in South Africa. Wildlife Monographs, (54), 3-111.

Wolf, D. E., Takebayashi, N., & Rieseberg, L. H. (2001). Predicting the risk of extinction through hybridization. Conservation Biology, 15(4), 1039-1053.

WWF (1999). Map of Terrestrial Ecoregions of Africa (revised). Conservation Science Program, WWF-US, Washington.

WWF SARPO (2001). Conserving the Miombo Ecoregion: Reconnaissance summary. Booklet, WWF-SARPO, Harare.

Yu, L., Li, Y. W., Ryder, O. A., & Zhang, Y. P. (2007). Analysis of complete mitochondrial genome sequences increases phylogenetic resolution of bears (Ursidae), a mammalian family that experienced rapid speciation. BMC Evolutionary Biology, 7(1), 198.

Zachos, J. C., Shackleton, N. J., Revenaugh, J. S., Pälike, H., & Flower, B. P. (2001). Climate response to orbital forcing across the Oligocene-Miocene boundary. Science, 292(5515), 274-278.

Zhang, D. X., & Hewitt, G. M. (2003). Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Molecular ecology, 12(3), 563- 584.

Zinner, D., Wertheimer, J., Liedigk, R., Groeneveld, L. F., & Roos, C. (2013). Baboon phylogeny as inferred from complete mitochondrial genomes. American journal of physical anthropology, 150(1), 133-140.

FCUP 61 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

CHAPTER 2

CONSEQUENCES OF A POPULATION COLLAPSE

Paper I Vaz Pinto, P., Lopes, S., Mourão, S., Baptista, S., Siegismund, H. R., Jansen van Vuuren, B., Beja, P., Ferrand, N., & Godinho, R. (2015). First estimates of genetic diversity for the highly endangered giant sable antelope using a set of 57 microsatellites. European Journal of Wildlife Research, 61(2): 313-317.

Paper II Vaz Pinto, P., B., Beja, P., Ferrand, N., & Godinho, R. (2016). Hybridization following population collapse in a critically endangered antelope. Scientific Reports, 6, 18788.

FCUP 62 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP 63 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

First estimates of genetic diversity for the highly endangered giant sable antelope using a set of 57 microsatellites

Pedro Vaz Pinto1,2,3,4,6, Susana Lopes1, Sofia Mourão1, Sendi Baptista4, Hans Siegismund5, Bettine Jansen van Vuuren6, Pedro Beja1,2,3, Nuno Ferrand1,2,3,6, & Raquel Godinho1,2,3,6

1CIBIO/InBIO – Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Campus Agrário de Vairão, 4485-661 Vairão, Portugal

2Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto, Portugal

3ISCED – Instituto Superior de Ciências da Educação da Huíla, Rua Sarmento Rodrigues, Lubango, Angola

4The Kissama Foundation, Rua Joaquim Capango nº49, 1ºD, Luanda, Angola

5Department of Biology, University of Copenhagen, Ole Maaloes Vej 5, 2200 Copenhagen N, Denmark

6Department of Zoology, Faculty of Sciences, University of Johannesburg, Auckland Park 2006, South Africa

Abstract

Confined to a small region in central Angola, the giant sable antelope (Hippotragus niger variani) experienced a dramatic decline in numbers and is currently one of the most endangered African mammals. In spite of its iconic status, conservation efforts have been hindered by unsustainable hunting and lack of adequate tools to promote its recovery. In this work, we developed a set of 57 microsatellites specific for the giant sable, which revealed depleted levels of genetic diversity and an allele frequency spectrum consistent with a recent evolutionary history characterized by severe population crashes. In contrast, the high number of private alleles exhibited by other H. niger populations from Zimbabwe and Tanzania may suggest the occurrence of reduced

FCUP 64 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) levels of gene flow among sable populations. Our microsatellite panel was successfully tested on the roan antelope, Hippotragus equinus, and will prove highly applicable on the characterization of different Hippotragus populations, but in particular for the conservation of the Angolan giant sable antelope.

Keywords: nuclear markers, bottleneck, conservation genetics, Angola, Hippotragus niger variani, Hippotragus equinus.

Introduction

The giant sable Hippotragus niger variani is an emblematic antelope restricted to an isolated population in central Angola and critically endangered (IUCN 2008). It is characterized by a dark facial mask, retention of brown hocks in bulls, and much longer sweeping horns that can grow on average ca. 30 cm longer than in other sable populations (Estes 2013). The giant sable was feared extinct until a combined effort with camera traps and molecular tools led to its rediscovery (Pitra et al. 2006) but remains on the brink of extinction and reduced to a few dozen individuals.

The sable species H. niger ranges from coastal Kenya to southern Africa and is often sympatric with the congeneric roan antelope Hippotragus equinus, although the latter has a wider distribution extending to the savannas of western Africa (East 1999). Naturally occurring in low densities, both species are rare outside managed areas (East 1999). In recent years, the sable in particular has become one of the most highly prized trophy hunting species, boosting its commercial value and leading to widespread introductions on private land in southern Africa (East 1999; Bothma & Van Royen 2005).

In spite of the conservation importance and significant investment channeled for intensive conservation programs dedicated to both species, including breeding efforts, genetic research has, until now, mainly relied on mitochondrial DNA (mtDNA) analysis. Matthee and Robinson (1999) provided a first comprehensive mtDNA phylogeography of sable and roan antelopes, and subsequently the genetic structuring of H. niger was further refined and introgression events were inferred from populations in eastern Africa (Pitra et al. 2002). More recent mtDNA studies have focused specifically on the giant sable antelope and have established its monophyletic status (Pitra et al. 2006; Jansen van Vuuren et al. 2010).

FCUP 65 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Notwithstanding this, the use of specific nuclear markers could be critical to understand intraspecific evolutionary relationships (Avise 1994; Godinho et al. 2008), to assist ongoing conservation initiatives (Frankham 2008) and to the implementation of breeding programs (Robert 2009) for both sable and roan antelope (Chardonnet & Crosmary 2013; Estes 2013). In particular, the giant sable antelope is currently being subjected to an intensive management program in situ (Vaz Pinto 2009; Estes 2013), and its conservation could benefit directly from the development of such novel molecular tools. Here, using next-generation sequencing, we developed and characterized 57 microsatellite markers for sable, and further tested them on roan antelope. In addition, we provide a first assessment of nuclear genetic diversity within the giant sable of Angola and compared it with two other conspecific populations, evaluating preliminary gene flow and demographic patterns.

Material and methods

We analyzed a total of 80 tissue samples, 20 from each of three presumably different populations of H. niger, collected in Angola, Tanzania, and Zimbabwe, plus 20 from H. equinus collected in Namibia and South Africa.

Total genomic DNA was isolated from a pool of ten H. niger individuals with different geographic origins using the QIAGEN DNeasy Blood & Tissue Kit and sent to Genoscreen, France, for microsatellite development through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries (Malausa et al. 2011). Total DNA was enriched for AG, AC, AAC, AAG, AGG, ACG, ACAT, and ATCT repeat motifs. Briefly, GS-FLX libraries were constructed following manufacturer’s protocols (Roche Diagnostics) and sequenced on a GsFLX-PTP. The bioinformatics program QDD (Meglécz et al. 2010) was used to filter for redundancy, resulting in a final set of 8224 sequences from which 652 primers pairs were designed. Fifty-seven out of 80 tested loci had specific and reliable amplifications and were genotyped for the 80 samples in nine multiplex reactions using M13-primer genotyping protocol (Schuelke 2000) with four different dye-labeled tails and forward primer concentration of 1/10 of reverse and tail primers (Online Resource Table S1). PCR amplifications were conducted using the Multiplex PCR Kit (QIAGEN) following the manufacturer’s instructions in a final 10-μl volume, always in the presence of a negative control. Annealing temperatures were adjusted to each multiplex (Table S1). Amplicons were separated by size on an ABI3130xl Genetic Analyser. Allele sizes were scored against the GeneScan 500 LIZ Size Standard, using the GENEMAPPER 4.0 (Applied Biosystems) and manually checked twice independently.

FCUP 66 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

We used GENALEX 6.501 (Peakall & Smouse 2012), to test for Hardy-Weinberg (HW) proportions, to estimate observed and expected heterozygosities (HO and HE) for all loci in each population and to calculate the mean number of alleles (NA) and the number of private alleles (NPA) within populations. GENEPOP 4.2 (Raymond & Rousset 1995) was used to test for genotypic linkage disequilibrium (GLD) among loci within populations. The presence of null alleles was tested using MICROCHECKER 2.2.3 (van Oosterhout et al. 2004). The distribution of allele frequencies at all loci was determined and visualized in a histogram with ten frequency classes as an allele frequency spectrum (AFS; Chakraborty et al. 1988). The shape of the AFS is influenced by long-term demography, being a recent population expansion detected by an excess of rare alleles, while a recent population collapse results in a deficit of rare alleles and an excess of common alleles (Maruyama & Fuerst 1985). This analysis was conducted to determine whether current levels of genetic diversity in the giant sable antelope may reflect a demographic history different from other sable populations

Results

All 57 loci proved polymorphic for H. niger, but populations exhibited very different diversity patterns. While 51 and 52 polymorphic loci were observed in Zimbabwe and Tanzania, respectively, only 37 polymorphic loci were scored for the Angolan giant sable. The total number of alleles detected for all loci ranged from 2 to 16, and the expected heterozygosity ranged from 0.05 to 0.87 (Online Resource Table S2). We found no significant deviations from HW proportions after Bonferroni corrections, except at loci HN60 and HN101 in Tanzania, with an excess of detected homozygotes most likely due to the presence of null alleles (Online Resource Table S2). Only two significant GLD tests were observed after Bonferroni corrections in H. niger populations (Online Resource Table S3). As expected, the Angolan giant sable exhibited the lowest genetic diversity parameters (HE =0.306; mean NA=2.3; NPA=9), compared to Tanzania (HE

=0.524; mean NA=4.4; NPA=54) and Zimbabwe (HE =0.489; mean NA=4.2; NPA=53), which did not experience significant demographic events (Table 1).

FCUP 67 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table 1 - Genetic diversity measures for three populations of Hippotragus niger and one of H. equinus based on 57 and 54 microsatellite loci, respectively (three loci did not amplify for H. equinus)

Number of samples HO HE NA NPA FIS

H. niger

Angola 20 0.315 (0.038) 0.306 (0.035) 2.3 (0.2) 9 −0.023 (0.024)

Tanzania 20 0.485 (0.038) 0.524 (0.033) 4.4 (0.3) 54 0.081 (0.035)

Zimbabwe 20 0.474 (0.036) 0.489 (0.035) 4.2 (0.3) 53 0.023 (0.028)

H. equinus

Namibia/S. Africa 20 0.359 (0.041) 0.407 (0.044) 4.5 (0.5) 145 0.106 (0.026)

Standard error values are given in parenthesis. HO observed heterozygosity, HE expected heterozygosity, NA mean number of alleles per locus, NPA number of private alleles, FIS inbreeding coefficient

The AFS chart produced typical L-shaped distributions for populations from Tanzania and Zimbabwe, consistent with populations in mutation-drift equilibrium (Fig. 1a). In contrast, the giant sable exhibits a rugged allelic distribution profile predictable in populations that have undergone recent bottlenecks (Fig. 1a).

For H. equinus, all but three loci (HN89, HN110, and HN116) were successfully amplified, and 41 loci proved polymorphic, with a total number of alleles ranging from 2 to 17 and expected heterozygosity between 0.05 and 0.91.

Loci HN11 and HN17 deviated from HW proportions, with an excess of homozygotes most likely due to the presence of null alleles (Online Resource Table S2). Significant GLD after Bonferroni corrections was detected for 17 pairs of loci (Online Resource Table S3). Average heterozygosity for the H. equinus population was 0.407, and the average number of alleles per locus was 4.5 (Table 1). The AFS for this species is a typical L-shaped distribution (Fig. 1b).

FCUP 68 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 1 – Allele frequency spectrum (AFS) obtained from 57 and 54 microsatellite loci, respectively, for A the three Hippotragus niger populatons and B the H. equinus sample.

Discussion

Since 2009, the giant sable antelope is under a conservation program that includes breeding efforts aimed to rescue the remnant population in Angola. Our results clearly show a depletion of genetic diversity in this population relative to Tanzanian and Zimbabwean populations and highlight the utility of the large number of loci developed in this work for the implementation of more effective conservation measures. As expected, patterns of genetic diversity are consistent with documented observations of recent and severe bottlenecks and further reflected on the very distinct AFS exhibited by the giant sable. Our results are in line with the low levels of genetic diversity observed in other remnant and bottlenecked populations of African ungulates such as the black rhino

FCUP 69 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

(Harley et al. 2005), the dorcas gazelle (Lerp et al. 2011; Godinho et al. 2012), the dama gazelle (Senn et al. 2014), or the addax (Armstrong et al. 2011).

In contrast, much higher albeit similar genetic diversity values were found for the two other H. niger populations included in this study (Tanzania & Zimbabwe). Additionally, the number of private alleles found in these two populations is remarkably high, suggesting reduced levels of gene flow on a larger scale. This pattern is consistent with both the geographical distance between Tanzania and Zimbabwe and the fact that the two populations exhibit distinct mitochondrial clades (Jansen van Vuuren et al. 2010).

As no genus-specific nuclear markers were available to date for population genetic analyses within Hippotragus species (but see Alpers et al. 2004 and Eblate et al. 2011 for cross-genus amplification of microsatellites on roan antelope), this new panel can provide a decisive tool to be applied in evolutionary, conservation, and management practices. In particular, it may prove to be particularly useful to address relatedness and parentage analyses with direct application in breeding programs for these species. Furthermore, the fact that some of the surviving giant sables are being closely managed in semi-captivity (Vaz Pinto 2009; Estes 2013) offers a unique opportunity to apply these findings directly on the conservation of one of the most endangered and iconic African mammals.

Acknowledgments

The Giant Sable Conservation Project is coordinated by the Ministry of Environment of the Republic of Angola, in collaboration with the Kissama Foundation. We thank Cardoso Bebeca, Joaquim Manuel, and General João Traguedo for support during the animal capture and handling, and the Angolan Air Force for heavy logistics made available. We also thank Bruce Fivaz for providing additional samples from Zimbabwe. We thank two anonymous reviewers for helpful comments on a previous version of this manuscript. The research was partly funded by the ExxonMobil Foundation. RG is supported by a IF2012 Research contract from FCT (Portuguese Science Foundation, IF/ 564/2012). This is scientific paper no. 1 from the Portuguese-Angolan TwinLab established between CIBIO/InBIO and ISCED/Huíla, Lubango.

Supplementary material

Supplementary tables S1, S2 and S3 appended to the current document

FCUP 70 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

References

Alpers, D. L., Jansen van Vuuren, B., Arctander, P., & Robinson, T. J. (2004) Population genetics of the roan antelope (Hippotragus equinus) with suggestions for conservation. Molecular Ecology 13(7):1771–1784.

Armstrong, E., Leizagoyen, C., Martinez, A. M., Gonzalez, S., Delgado, J. V., & Postiglioni, A. (2011) Genetic structure analysis of a highly inbred captive population of the African antelope Addax nasomaculatus. Conservation and management implications. Zoo Biology 30:399–411.

Avise, J. C. (1994) Molecular markers, natural history and evolution. Springer.

Bothma, J. D. P., & Van Royen, N. (2005) Intensive wildlife production in Southern Africa. Van Schaik Publishers, Pretoria.

Chakraborty, R., Smouse, P. E., & Neel, J. V. (1988) Population amalgamation and genetic variation: observations on artificially agglomerated tribal populations of Central and South America. American Journal of Human Genetics 43:709–725.

Chardonnet, P., Crosmary, W. (2013) Hippotragus equinus Roan Antelope. In: Kingdon, J., Happold, D., Butynski, T., Hoffmann, M., Happold, M., & Kalina, J. (eds) Mammals of Africa. Bloomsbury, London, pp 548–556, Vol 6.

East, R. (1999) African antelope database 1998. IUCN/SSC antelope specialist group. IUCN, Gland.

Eblate, E. M., Lughano, K. J., Sebastian, C. D., Peter, M. L., & Knut, R. H. (2011) Polymorphic microsatellite markers for genetic studies of African antelope species. African Journal of Biotechnology 10:11817–11820.

Estes, R. D. (2013) Hippotragus niger sable antelope. In: Kingdon, J., Happold, D., Butynski, T., Hoffmann, M., Happold, M., & Kalina, J. (eds) Mammals of Africa. Bloomsbury, London, pp 556–565, Vol 6.

Frankham, R. (2008) Genetic adaptation to captivity in species conservation programs. Molecular Ecology 17:325–333.

Godinho, R., Abáigar, T., Lopes, S., Essalhi, A., Ouragh, L., Cano, M., & Ferrand, N. (2012) Conservation genetics of the endangered Dorcas gazelle (Gazella dorcas spp.) in Northwestern Africa. Conservation Genetics 13: 1003–1015.

FCUP 71 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Godinho, R., Crespo, E. G., & Ferrand, N. (2008) The limits of mtDNA phylogeography: complex patterns of population history in a highly structured Iberian lizard are only revealed by the use of nuclear markers. Molecular Ecology 17:4670–4683.

Harley, E. H., Baumgarten, I., Cunningham, J., & O’Ryan, C. (2005) Genetic variation and population structure in remnant populations of black rhinoceros, Diceros bicornis, in Africa. Molecular Ecology 14:2981–2990.

IUCN (2008). Hippotragus niger ssp. variani. SSC Antelope Specialist Group, The IUCN Red List of Threatened Species. Version 2014.2.

Jansen van Vuuren, B., Robinson, T. J., Vaz Pinto, P., Estes, R., & Matthee, C. (2010) Western Zambian sable: are they a geographic extension of the giant sable? South African Journal of Wildlife Resources 40:35–42.

Lerp, H., Wronski, T., Pfenninger, M., & Plath, M. (2011) A phylogeographic framework for the conservation of Saharan and Arabian Dorcas gazelles (Artiodactyla: Bovidae). Organisms Diversity & Evolution 11:317–329.

Malausa, T., Gilles, A., Meglecz, E., Blanquart, H., Duthoy, S., Costedoat, C., ... & Feau, N. (2011). High‐throughput microsatellite isolation through 454 GS‐FLX Titanium pyrosequencing of enriched DNA libraries. Molecular Ecology Resources, 11(4), 638-644.

Maruyama, T., & Fuerst, P. A. (1985) Population bottlenecks and nonequilibrium models in population genetics. II. Number of alleles in a small population that was formed by a recent bottleneck. Genetics 111: 675–689.

Matthee, C. A., & Robinson, T. J. (1999) Mitochondrial DNA population structure of roan and sable antelope: implications for the translocation and conservation of the species. Molecular Ecology 8: 227–238.

Meglécz, E., Costedoat, C., Dubut, V., Gilles, A., Malausa, T., Pech, N., & Martin, J. F. (2009). QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics, 26(3), 403-404. Peakall R, Smouse PE (2012) GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research - an update. Bioinformatics 28:2537–2539.

Pitra, C., Hansen, A. J., Lieckfeldt, D., Arctander, P. (2002) An exceptional case of historical outbreeding in African sable antelope populations. Molecular Ecology 11:1197–1208.

FCUP 72 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Pitra, C., Vaz Pinto, P., O’Keeffe, B. W., Willows-Munro, S., van Vuuren, B. J., & Robinson, T. J. (2006). DNA-led rediscovery of the giant sable antelope in Angola. European Journal of Wildlife Research, 52(3), 145-152.

Raymond, M., & Rousset, F. (1995) GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249.

Robert, A. (2009) Captive breeding genetics and reintroduction success. Biological Conservation 142:2915–2922.

Schuelke, M. (2000) An economic method for the fluorescent labelling of PCR fragments. Nature Biotechnology 18:233–234.

Senn, H., Banfield, L., Wacher, T., Newby, J., Rabeil, T., Kaden, J., ... & Ogden, R. (2014). Splitting or lumping? A conservation dilemma exemplified by the critically endangered Dama Gazelle (Nanger dama). PloS one, 9(6), e98693.

Van Oosterhout, C., Hutchinson, W. F., Wills, D. P. M., & Shipley, P. (2004) MICRO- CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4:535–538

Vaz Pinto, P. (2009) Giant sable rescue and translocation. Gnusletter 28(1): 8–10

FCUP 73 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S1. GeneBank accession number, primer sequences, repeat motif, dye and multiplex PCR conditions of 57 microsatellite loci from Hippotragus niger.

Locus GeneBank Primer Sequence Repeat motif Fluorescent Multiplex PCR accession Dye MIX T. (°C) [Primers] number (nM) HN1 F: AAATGTTAAATCAGCCTTGC (TG)19 6-FAM 2 54 320 R: AGCAGTTCAAACTCCTTCAA HN2 F: CAATTCCCTGGGGATAAG (AC)23 PET 1 54 600 R: CTGTCCAGACCACCAAATAC HN3 F: TCCCCTAATCAAAAGATAAAAA (TG)24 NED 4 56/50 280 R: ACCGCCACCTAAGATCA HN5 F: AGCATAGGTGCTGCTACAGT (AC)13(AG)20 VIC 2 54 120 R: GGTGCAACTTCATCTAGACC HN6 F: ATTCAAGCCTTGGTCAGG (TG)26 PET 4 56/50 200 R: ACAATGTTGTGTTAGTTTCAGGT HN7 F: TGCCAATTACACAGACAGAG (CA)11G(CA)4 NED 2 54 480 R: TGCAGTAGTCTGTCGTTCAG HN8 F: TTTTGAGCAGCATACTCTGT (GT)20 6-FAM 3 54 400 R: ACTTTTGCTTACCAGCATTG HN9 F: TGTGAACAGCTGTGATGC (GT)20 NED 1 54 240 R: TCTCCTGCCCTAGGATATT HN10 F: CTGTAGAATCCCAAGGACAG (CG)4 (CA)10 PET 3 54 320 R: AATGTCCATCAAGGAATGAG HN11 F: AAGGAGGCAGGAAAGGAT (GT)42 6-FAM 4 56/50 400 R: GGCGGAGATATGTTCTTTG HN12 F: AAGACTTTGAGCTTCCATTG (GT)24 VIC 3 54 200 R: AATGGTTTTGTCCATCTCTG HN13 F: TATCCTTTCATCTCGGTGAC (GT)22 PET 2 54 480 R: GAAGAATCCCATCAACAGAG HN16 F: AGGGGCTGTTGTGCTTA (CA)24 NED 3 54 320 R: CACTGGAGTTAGACCAATGG

FCUP 74 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Locus GeneBank Primer Sequence Repeat motif Fluorescent Multiplex PCR accession Dye MIX T. (°C) [Primers] number (nM) HN17 F: TCTTACCCCCACTTCACTAA (CA)20 VIC 1 54 200 R: TATTCCTCCCTTTTCTCCTC HN20 F: CTCTCAGAAAGACATAGAATCA (GT)14T2(GT)15 VIC 4 56/50 360 R: CCTGCTATTAACCTCAGATG HN21 F: TGCCAATTTAAAAATCTTAGC (GT)9T2(GT)8(GA)9 6-FAM 1 54 140 R: TGAACCAtGCTTAAAGATAACA HN22 F: TTCATGAAGTTGGCTGAGCA (CATC)6 PET 9 60/55 100 R: TTGATGCCTGAATGGATGAC HN23 F: GGGCAAGTATGAAAGGCAT (TACA)5 6-FAM 5 60/55 160 R: CACTCATCCTGGTACCGCTT HN24 F: CCTTTCAAGATGACTCCACATT (CCAT)8 6-FAM 6 60/55 440 R: GGCTGGATGAAGAGATGGAT HN25 F: GACACGACTGAGCGACTTCA (TCTA)5 6-FAM 5 60/55 120 R: TGCACCTCTTCAGTTTGGTT HN27 F: CCTCGGATAGGAGGAACAGG (GATA)5 6-FAM 8 60/55 160 R: TGGAGAAACCATTTTCCCAG HN28 F: TTTCAGGTGAACACTGAAGGG (ATGT)11 PET 8 60/55 200 R: CAGCCTGGATGAGAGGAGAG HN29 F: GGTCATAGGCCTTGGACTCA (TTCA)5 NED 8 60/55 160 R: AGATGAGAAGATGGATGAGGG HN31 F: AAGGGAGGGGAGAGCTGATA (GTTT)5 VIC 5 60/55 200 R: CGCTTGTGTTCTTTCTACAGTGA HN36 F: CCACTGTTACCTCCACCCAT (TGGA)10 VIC 8 60/55 320 R: TTTCATCAATCCATGCATCC HN37 F: TCCATCCACTTAGACACTCCC (CCAT)11 VIC 9 60/55 80 R: GTAGGTGAGGGATGGATGTG HN38 F: TATGTATCCATCCACCCACC (CCAT)6 PET 5 60/55 160 R: TCAGATGATAGAGATAGATGATAGGCA HN39 F: GTTTGCCCCTTTTGAATCCT (TTCT)5 NED 5 60/55 240 R: AACTCTAGAACCCTCAAGGCG

FCUP 75 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Locus GeneBank Primer Sequence Repeat motif Fluorescent Multiplex PCR accession Dye MIX T. (°C) [Primers] number (nM) HN41 F: TGGAGGATCTATTCCAGGGG (AAC)8 NED 5 60/55 240 R: CACTCCCACTCTAGTCACTCCC HN45 F: AAGCAAGTAGAGTGCATTAAATAAAA (CAA)8 6-FAM 5 60/55 440 R: GATTGTTGGCTGCTTTGCTA HN46 F: CATAGGGACAATGCTGAAGAA (AGA)7 6-FAM 8 60/55 520 R: CCATGGAGTCCCAAAGAGTC HN47 F: CATCAAGTGCACCCTAACCC (GTT)8 NED 9 60/55 70 R: CGATGGCTGGGCCTTAAT HN48 F: TTTTGTTCTAGATGTGTTGGATACTTG (AAC)8 VIC 6 60/55 280 R: GCGTGTTACAGTCACAGCCTA HN50 F: AGTCCATGGGGTCACAAAGA (AAC)8 PET 6 60/55 280 R: AGAACATTCGCTCGCAAACT HN52 F: GCAGTCCACAGGATCACAAA (CAA)8 PET 5 60/55 160 R: ACGAACTTTCATTTGGCACC HN57 F: TCTTTACACACGTGGGAGCA (CA)18 VIC 7 64/55 180 R: CAGGATTCACAAGATAAAGAACCA HN58 F: ATGTCTTCTTTGGCCTTCCC (AC)13 VIC 9 60/55 120 R: TGAATAGCATTTCTCAGGTATGTG HN60 F: GGGAGATTTTGAGAGGGGTT (TG)10 6-FAM 6 60/55 160 R: GAGGCTGCAGGATCATAGTG HN61 F: CAGATCAGATTCACCAGTATGGA (CA)8 VIC 7 64/55 160 R: AAGTGCTTTGGGAATCTTGG HN64 F: GGGCTACACAAGTTCAGGGA (AC)10 NED 8 60/55 280 R: AAGGAACTCAGGGAGCTTTC HN68 F: TCCCAGTTCAGTCTCCACCT (AC)13 6-FAM 6 60/55 200 R: TGGATAAAACTTTTGACTAATAGAGCC HN72 F: AGGTGTGCTTCCATATTTTTCTC (CA)10 NED 7 64/55 240 R: TATGTATGTGCTTGTGGGCA HN75 F: TCAATCTCAGGACTTAGTTTGCAT (AC)18 PET 9 60/55 340 R: CTTTAAAAGTACAAACACAAGACAATG

FCUP 76 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Locus GeneBank Primer Sequence Repeat motif Fluorescent Multiplex PCR accession Dye MIX T. (°C) [Primers] number (nM) HN79 F: AAGGAGTTGTAGGAGTTTTGTAGCTC (TG)15 VIC 9 60/55 360 R: GGAAGAAATAGGGCTTGGGA HN80 F: GGTTTGAAGGAAGCATGGTG (GT)8 NED 6 60/55 400 R: GCTCTGCGACATACACATCC HN81 F: GGAGAGGGCAATTGATGAAC (TG)11 VIC 6 60/55 240 R: TCCAACATTCAGTTTTAATGTCTAA HN86 F: GCTTCTTAGAGGAGCCTGGA (AC)14 PET 7 64/55 200 R: GCTAGGACATGGAAGCAACC HN89 F: ACATGAGAGGAGCTATGGAAGTT (CA)15 PET 7 64/55 400 R: GGAGTCTAGTAACCAGAGGCCA HN91 F: CCTCCCTCCCTCTTCCCT (AC)16 NED 6 60/55 1000 R: AATTGGGATGCAAAGACGAG HN92 F: TCATAGGGGAAGAGGAGAAGG (AC)14 VIC 8 60/55 320 R: TCTTGATCCCTGATGAGCAA HN93 F: AGGGAGAACAGATAAACATCCC (TG)18 6-FAM 7 64/55 160 R: GGACTAGGAAATAGGCAGTCCC HN101 F: TCATGCGTAGAGTTCTGGTGA (GT)10 VIC 9 60/55 280 R: GCAACCACTGATGTCAAAGAAG HN110 F: CGATACCTGGGTCAGGAAG (AC)17 PET 8 60/55 480 R: GCTTAGTTTGTAGTCCCTTCTCTGCT HN111 F: GTCGGACACAACTGAACCAC (CA)11 PET 6 60/55 240 R: GCAGCTAGTTATTCTGAAATGGG HN112 F: TACATGGAGTTGAAGGATATTATGTT (AC)8 6-FAM 7 64/55 160 R: ATCTGATCAGTTGGGAGGCA HN113 F: TGGGGCATTTATCTTGAGAAC (TG)14 PET 9 60/55 100 R: GGTTGCAAAGAGTCGGACAT HN116 F: CAAGCATTGCCTCTGTCAAC (AC)16 VIC 9 60/55 360 R: TCCCACGAAGCACCTAGATT

FCUP 77 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S2. Genetic diversity measures for three populations of Hippotragus niger and for H. equinus. NA: number of alleles, Ho: observed heterozygosity, He: expected heterozygosity, -: no amplification; M: Locus monomorphic; * Locus deviating from Hardy-Weinberg equilibrium; # signs of null alleles

Locus Hippotragus niger Hippotragus equinus

Ho/He Ho/He Ho/He Ho/He Total size Total size Angola Tanzania Zimbabwe Southern Africa range (NA) range (Na) (n=20) (n=20) (n=20) (n=20) HN1 178-196 (9) 0.650/0.591 0.650/0.679 0.400/0.341 184-202 (7) 0.650/0.746 HN2 199-223 (12) 0.700/0.509 0.450/0.741# 0.950/0.838 201-235 (8) 0.550/0.826# HN3 131-159 (9) 0.350/0.399 0.900/0.793 0.550/0.479 149-293 (17) 0.600/0.908# HN5 152-180 (13) 0.550/0.578 0.550/0.751# 0.700/0.786 185-217 (10) 0.850/0.853 HN6 176-184 (2) M 0.300/0.320 M 166-190 (8) 0.700/0.725 HN7 190-210 (12) M 0.650/0.786 0.500/0.785# 195-229 (6) 0.579/0.657 HN8 167-205 (14) 0.611/0.486 0.550/0.660 0.950/0.813 165-191 (6) 0.412/0.552 HN9 152-172 (6) 0.700/0.571 0.800/0.713 0.700/0.615 162-180 (5) 0.550/0.644 HN10 184-200 (7) 0.050/0.049 0.700/0.595 0.500/0.595 188-196 (4) 0.235/0.431# HN11 174-198 (9) 0.150/0.289 0.600/0.824# 0.412/0.621 186-354 (16) 0.474/0.903*# HN12 180-200 (6) 0.550/0.574 0.450/0.574 0.750/0.789 188-208 (5) 0.353/0.398 HN13 174-210 (10) 0.400/0.339 0.600/0.594 0.850/0.665 196-204 (5) 0.550/0.540 HN16 129-179 (16) 0.833/0.790 0.950/0.813 1.000/0.873 141-173 (7) 0.750/0.790 HN17 201-209 (5) 0.650/0.591 0.700/0.706 0.750/0.539 203-221 (7) 0.450/0.520* HN20 164-194 (8) 0.400/0.445 0.450/0.709# 0.500/0.608 176-204 (7) 0.800/0.760 HN21 207-213 (3) M 0.050/0.049 0.125/0.117 217-219 (2) 0.056/0.054 HN22 249-269 (2) 0.167/0.153 M 0.200/0.180 273 (1) M HN23 154-190 (7) M 0.700/0.710 0.400/0.375 158-182 (6) 0.500/0.719# HN24 325-333 (3) 0.421/0.488 0.250/0.226 0.368/0.373 313-317 (2) 0.056/0.054 HN25 105-113 (2) M 0.350/0.349 0.200/0.180 117 (1) M HN27 118-126 (3) 0.450/0.374 0.500/0.495 0.450/0.555 114-130 (4) 0.200/0.186 HN28 136-160 (6) 0.600/0.584 0.950/0.801 0.100/0.095 128-168 (7) 0.850/0.739 HN29 111-115 (2) M M 0.050/0.049 115 (1) M HN31 180-184 (2) M 0.300/0.255 M 179-183 (2) 0.250/0.349 HN36 129-137 (3) M 0.300/0.464 0,471/0.637 129 (1) M HN37 118-146 (5) M 0.650/0.611 0.400/0.511 138-166 (5) 0.500/0.610 HN38 155-159 (2) M 0.150/0.139 M 143-147 (2) 0.200/0.180 HN39 104-112 (2) M M 0.300/0.320 104 (1) M HN41 161-167 (3) 0.737/0.644 0.150/0.219 M 164-167 (2) 0.200/0.180 HN45 198-210 (5) 0.316/0.499 0.550/0.516 0.250/0.229 207 (1) M HN46 258-273 (6) M 0.650/0.626 0.550/0.569 255-270 (3) 0.700/0.620 HN47 159-171 (5) 0.500/0.480 0.500/0.709# 0.700/0.605 159-168 (2) 0.100/0.095 HN48 201-216 (6) M 0.650/0.571 0.650/0.644 207-213 (3) 0.308/0.447 HN50 186-201 (6) 0.474/0.547 0.150/0.329# 0.750/0.724 189-198 (2) 0.125/0.305 HN52 127-136 (3) M 0.200/0.329 0,300/0.320 121 (1) M HN57 99-125 (10) 0.500/0.525 0.800/0.814 0,650/0.641 91 (1) M HN58 149-177 (13) 0.500/0.529 0.950/0.870 0.650/0.758 149-169 (5) 0.579/0.695 HN60 108-132 (7) 0.526/0.465 0.000/0.650*# 0.750/0.624 122 (1) M

FCUP 78 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Locus Hippotragus niger Hippotragus equinus

Ho/He Ho/He Ho/He Ho/He Total size Total size Angola Tanzania Zimbabwe Namibia/ range (NA) range (Na) South Africa (n=20) (n=20) (n=20) (n=20) HN61 173-175 (2) 0.050/0.049 M M 173-175 (2) 0.300/0.255 HN64 168-172 (3) 0.500/0.420 0.450/0.486 0.650/0.611 170-172 (2) 0.050/0.049 HN68 160-180 (9) 0.368/0.361 0.800/0.729 0.850/0.806 160-184 (10) 0.850/0.859 HN72 108-110 (2) M 0.350/0.499 M 112-124 (6) 0.500/0.546 HN75 98-116 (8) 0.400/0.640# 0.950/0.756 0.579/0.584 94-96 (2) 0.158/0.224 HN79 113-127 (7) 0.200/0.180 0.750/0.606 0.650/0.655 113-119 (3) 0.429/0.579 HN80 117-119 (2) M M 0.350/0.289 119 (1) M HN81 164-180 (5) M 0.250/0.301 0.550/0.561 174-194 (7) 1.000/0.790 HN86 169-185 (8) 0.550/0.526 0.700/0.654 0.600/0.721 167-189 (7) 0.700/0.796 HN89 287-297 (6) M 0.800/0.696 0.579/0.593 - - HN91 261-291 (11) 0.778/0.730 0.700/0.744 0.789/0.830 271-301 (11) 0.571/0.834# HN92 208-214 (4) 0.350/0.349 0.300/0.301 0.550/0.615 212-246 (10) 0.900/0.848 HN93 202-226 (12) 0.700/0.604 0.600/0.731 0.350/0.569# 198-244 (11) 0.900/0.834 HN101 322-324 (2) M 0.000/0.495*# 0.056/0.239# 332-344 (3) 0.333/0.500 HN110 251-261 (5) 0.600/0.591 0.550/0.599 0.700/0.606 - - HN111 147-171 (9) 0.632/0.539 0.700/0.664 0.550/0.455 149 (1) M HN112 108-112 (3) 0.200/0.255 0.450/0.399 0.550/0.615 108 (1) M HN113 193-207 (8) 0.850/0.699 0.600/0.620 0.550/0.545 195-205 (5) 0.632/0.633 HN116 202-218 (8) M 0.600/0.604 0.313/0.756# - . TOTAL 0.315/0.306 0.485/0.524 0.474/0.489 0.359/0.407

FCUP 79 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S3. Loci exhibiting genotypic linkage disequilibrium (GLD) for each of the three populations of Hippotragus niger and for H. equinus

Species (Population) Locus 1 Locus 2

H. niger (Tanzania) HPN16 HPN20

H. niger (Angola) HPN1 HPN2

HPN1 HPN5 HPN17 HPN11 HPN1 HPN20 HPN20 HPN6 HPN1 HPN9 HPN20 HPN9 HPN5 HPN23 HPN9 HPN23 H. equinus (Namibia/South Africa) HPN2 HPN86 HPN1 HPN86 HPN9 HPN86 HPN1 HPN28 HPN86 HPN28 HPN1 HPN92 HPN12 HPN113 HPN9 HPN113 HPN58 HPN113

FCUP 80 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP 81 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Hybridization following population collapse in a critically endangered antelope

Pedro Vaz Pinto1,2,3,*, Pedro Beja1,2,*, Nuno Ferrand1,2,4,*, & Raquel Godinho1,2,4,*

1CIBIO/InBIO – Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Campus Agrário de Vairão, 4485-661 Vairão, and Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169- 007 Porto, Portugal

2ISCED – Instituto Superior de Ciências da Educação da Huíla, Rua Sarmento Rodrigues, Lubango, Angola

3The Kissama Foundation, Rua Joaquim Capango nº49, 1ºD, Luanda, Angola

4Department of Zoology, Faculty of Sciences, University of Johannesburg, Auckland Park 2006, South Africa

*These authors contributed equally to this work

Abstract

Population declines may promote interspecific hybridization due to the shortage of conspecific mates (Hubb’s ‘desperation’ hypothesis), thus greatly increasing the risk of species extinction. Yet, confirming this process in the wild has proved elusive. Here we combine camera-trapping and molecular surveys over seven years to document demographic processes associated with introgressive hybridization between the critically endangered giant sable antelope (Hippotragus niger variani), and the naturally sympatric roan antelope (H. equinus). Hybrids with intermediate phenotypes, including backcrosses with roan, were confirmed in one of the two remnant giant sable populations. Hybridization followed population depletion of both species due to severe wartime poaching. In the absence of mature sable males, a mixed herd of sable females and hybrids formed and grew progressively over time. To prevent further hybridization and recover this small population, all sable females were confined to a large enclosure, to which sables from the other remnant population were translocated. Given the large

FCUP 82 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) scale declines in many animal populations, hybridization and introgression associated with the scarcity of conspecific mates may be an increasing cause of biodiversity conservation concern. In these circumstances, the early detection of hybrids should be a priority in the conservation management of small populations.

Introduction

Human-mediated hybridization is increasing worldwide, and contributes to species extinctions through direct and indirect means (Rhymer & Symberloff 1996; Allendorf et al. 2001; Vonlanthen et al. 2012). In mammals, anthropogenic hybridization often results from interbreeding between domestic species and their wild relatives (Oliveira et al. 2008; Hedrick 2009; Godinho et al. 2011), but it may also involve related taxa that are artificially managed or introduced outside their natural range (Green & Rothstein 1998; Grobbler et al. 2011; van Wyk et al. 2011). Hybridization between naturally sympatric species is much less common, though it may occur when a rare species interbreeds with a common species due to the shortage of conspecific mates (Willis et al. 2004; Lancaster et al. 2006; Cordingley et al. 2009; Cabria et al. 2011), in what is often referred to as the Hubb’s principle or “desperation hypothesis” (Hubbs 1955). Confirmation of this hypothesis in wild populations, however, is hindered by difficulties in detecting the moment when reproductive isolation is disrupted and identifying its underlying demographic causes. Yet, further testing this idea and evaluating its consequences for biodiversity conservation is important due to the complexity of policies and management decisions involving hybrids (Allendorf et al. 2001; Ellstrand et al. 2010; Stronen & Paquet 2013; Trouwborst 2014).

The giant sable is a distinct monophyletic group confined to central Angola, and isolated from much larger sable populations living elsewhere in eastern and southern Africa (Jansen van Vuuren et al. 2010) (Fig. 1). Giant sables are critically endangered (IUCN 2008), with a small natural range comprising only the protected areas of Cangandala National Park (hereafter Cangandala) and Luando Integral Nature Reserve (hereafter Luando) (Estes & Estes 1974). The subspecies was feared extinct for over a decade, but it was rediscovered in Cangandala in 2005, where preliminary evidence suggested that they had suffered a marked decline from historical levels during the Angolan civil war (1975–2002) (Pitra et al. 2006). Ensuing camera-trap monitoring to determine population status allowed the detection of individuals with unusual morphological features, which led to the suspicion that hybridization could be occurring between giant sable and roan antelopes (Vaz Pinto 2006). The possibility of hybridization between

FCUP 83 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) these two phenotypically distinct antelopes was unexpected because they have evolved in sympatry for a relatively long time (Estes & Kingdon 2013), following divergence from the most recent common ancestor estimated to have occurred in the late Miocene (Fernández & Vrba 2005; Bibi 2013). Therefore, both species were expected to have developed efficient barriers that prevent interbreeding in most situations (Robinson & Harley 1995). Nevertheless, a single case of hybridization had already been reported from the Kruger National Park in South Africa (Robinson & Harley 1995).

Fig. 1 - Distribution of sable (Hippotragus niger) and roan (H. equinus) antelopes in Africa and location of the study area. The giant sable antelope (H. niger variani) has a very small range, which is far apart from the species core distribution in eastern Africa. Giant sables only occur in Angola (inset), where they are restricted to the Cangandala National Park and the Luando Integral Nature Reserve. Geographic ranges are adapted from IUCN (2008a. Hippotragus niger. The IUCN Red List of Threatened Species. Version 2014.3) and IUCN (2008b. Hippotragus equinus. The IUCN Red List of Threatened Species. Version 2014.3). The Figure was produced by Luís Verissimo.

Given the conservation implications of these initial results, we started a study combining field and molecular methods (see Methods) to (1) census the population and estimate demographic trends; (2) confirm hybridization and introgression events; (3) identify maternal and paternal ancestry of hybrids; and (4) estimate the demographic processes underlying the putative hybridization events. The intensive monitoring of this population

FCUP 84 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) over seven years provided a unique opportunity to test Hubb’s desperation hypothesis, by evaluating whether the putative hybridization events could be linked to the shortage of conspecific mates. Results from this study were also used to trigger emergency conservation action to avoid further hybridization and promote population recovery.

Material and methods

Study design

The study was based on intensive surveys of the giant sable antelope in Cangandala National Park (North-central Angola, Fig. 1), following the rediscovery therein of a remnant population that had been feared extinct (Pitra et al. 2006). Cangandala (> 1,000 m a.s.l.) covers roughly 63,000 ha of gently undulating terrain, with nutrient-poor and extremely leached sandy soils, and dominated by dense and mature Brachystegia woodlands, interspersed by grasslands along a few drainage lines. A formal sampling procedure could not be established to survey sables, due to difficulties of regularly accessing this remote region and the extremely hard logistic conditions to develop field work, particularly in the first years after the end of the civil war. To overcome these problems, we used a combination of camera-trapping, aerial surveys, and molecular methods, aiming to census all the animals present in the region. Surveys benefited from the behaviour displayed by sables and other herbivores in Cangandala of regularly visiting some old termite mounds that the animals used as natural salt licks (Baptista et al. 2013), and where they could be predictably recorded. At the end of the study period, intensive efforts were developed to capture and confine in enclosures all phenotypically pure sables and putative hybrids, providing support to the results of censuses carried out in previous years. Tissue samples from animals captured were used in genetic analysis. This study was approved by the Unidade de Gestão e Coordenação da Estratégia da Biodiversidade, of the former Ministério do Urbanismo e Ambiente of Angola, and was carried out in accordance with the approved guidelines.

Field methods

Between January 2005 and August 2011 we set camera traps in 18 sites, corresponding to natural salt licks (termite mounds) that were suspected to be visited by giant sables. Sites were identified with the help of local rangers, based on the presence of spoor and

FCUP 85 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) witness accounts of visual observations. Due to access and logistic difficulties, the number and type of cameras, as well as their operating period, varied greatly in space and over time. Until the end of 2007 we used six TrailMaster infrared trail monitors TM1500 and TM1550 connected to external photography film cameras or digital video. In October 2007 we introduced up to 12 passive digital cameras Stealth Prowler DVIR5. Due to variation in sampling effort and demographic changes, the number of photos recorded for sable and putative hybrids varied greatly from < 25 (2005) to > 9,000 (2010) (Supplementary Table S1). The large number of photos taken distributed over many independent events (i.e., visits by herd or individuals to salt licks in different days) (Supplementary Table S1), allowed a detailed recording of all animals and their individual identification (see below).

In July and August of 2009 and 2011, we conducted extensive aerial surveys and capture sessions that involved darting animals from a helicopter, aiming to capture all sables and putative hybrids remaining in Cangandala. The aerial surveys were maintained for several days after the last animal had been spotted and captured in 2011. Although dense canopy cover in most of the area makes it impossible to guarantee that all animals were indeed captured, it is very unlikely that any giant sable or hybrid remaining outside enclosures would be missed, as the Cangandala region is relatively small and has been visited regularly during field work carried out to the present day.

Population estimates

Each year, the minimum number of sable, roan and putative hybrids present in Cangandala was estimated from the number of individually recognizable animals detected in photos and videos obtained through camera-trapping. Assignment of individuals to gender and age class further allowed the estimate of sex-ratio, age structure and annual number of births. To obtain these estimates, we first screened all photos and videos for the presence of sable, roan and putative hybrids. Each animal recorded in a photo or video was then identified to species-level, and ascribed to gender and age class. Species identification was straightforward, given the marked morphological differences between sable and roan. The individuals with intermediate morphology, or showing unusual phenotypes, were classified as putative hybrids. (Fig. 3). Gender was determined based on sexually dimorphism features displayed by both species. Approximate age was estimated from body size and horn development (size and number of natural annulations) of individuals; horns are useful in age determination because they show continuous growth throughout the life of sables (Grobbler 1980). In

FCUP 86 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Cangandala we found that sable consistently developed seven horn annulations per year and these could be reliably counted from photographs in animals at least up to the age of four, when the annulations grew thinner and become increasingly harder to discriminate. Using these characteristics and by following the same animals over an extended period, from juvenile to maturity, we are confident that estimates of age class were accurate for animals under five years old. Animals were also identified individually based on a combination of species, gender, age and unique morphological features. In particular, we noted differences in facial mask pattern, including presence or absence of muzzle stripe and the extent of black and white patches. Occasionally there were horn abnormalities and other particular features that aided in individual identification. Individual identification of roan was difficult because animals are apparently less distinctive, and so roan population size in Cangandala could not be accurately estimated when more animals were recorded in 2009–2011.

The annual number of births of sable and putative hybrids was estimated by combining information on females with evidence of pregnancy, and the number and estimated age of calves, juveniles and young adults. Specifically, calves were assumed to be born either in the year when they were first observed or in the previous year, based on the timing of observations, body size and horn development (Grobbler 1980). Individuals < 5 years old detected at the beginning of the study (2005–2006) were ascribed whenever possible to an approximate birth year, based on their estimated age (Grobbler 1980). Estimating the year of birth in Cangandala was made harder because calving occurred throughout the year, rather than showing the well-defined birth season in May-June as reported in studies carried out in the 1970s (Estes & Estes 1974). Also, the number of births each year should be taken as minimum estimates, because at least some individuals may have been born in 2002–2004 but died before camera-trapping started in 2005. It is not possible to exclude the possibility of a newborn dying before being recruited into the herd and subsequently photographed, even during the periods when camera-trapping was most intensive. Despite these problems, we believe that the minimum annual birth estimates presented in our study are sufficiently accurate to illustrate the temporal variation in the annual production of pure sable and hybrid calves by the population between 2002–2011.

The information obtained through camera trapping was complemented by aerial surveys and the capture sessions carried out in 2009 and 2011. Aerial surveys confirmed that a single sable herd was present in Cangandala during the entire study period, and the number of individuals spotted was compatible with camera-trapping data. Also, we never recorded a mature sable male during the aerial surveys, which matches the results from

FCUP 87 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) camera trapping. This was in contrast with similar surveys carried out in Luando, where a comparable sampling effort allowed the detection of 16 mature males and at least 4 herds. The animals captured in 2009 and 2011 in Cangandala, totalling nine giant sable females and nine hybrids, were the same recorded through camera trapping in previous years. No new animals were found, and we confirmed the individual identifications previously made using facial mask patterns and other unique features. Overall, close matching between data obtained through camera trapping, aerial surveys and capture sessions suggest that population parameters were accurately estimated.

Genetic samples

During the capture operations carried out in 2009 and 2011, we collected 18 ear tissue samples, representing the whole lot of giant sable and putative hybrids surviving in Cangandala. During the concurrent capture operations carried out in Luando we collected ear tissue samples from another 26 giant sables and four roans. To allow comparisons with other sable and roan populations, we obtained 22 sable samples collected in Etosha National Park and Waterberg National Park in Namibia, both descendent from an original population translocated from the Caprivi Strip of Namibia (Martin 2003). We also obtained 20 roan samples collected in Caprivi (n = 5) Namibia, and in Percy Fyfe Nature Reserve (n = 2), Nylsvlei Nature Reserve (n = 11) and Marakele National Park (n = 2) in South Africa. The South African roans are presumed to be a mixed gene pool between indigenous animals and roans translocated from Namibia and Botswana (Barrie 2009).

Molecular procedures

Genomic DNA was extracted from tissue samples using the DNeasy Blood & Tissue Kit (QIAGEN), following manufacturer instructions. Individual multilocus genotypes were scored using a set of 51 sable-specific microsatellites, which all proved to be polymorphic in one or both species (Vaz Pinto et al. 2015). Amplification of loci followed the methodology and conditions as in Vaz Pinto et al. (2015), always using negative controls to monitor for possible contaminants. PCR products were separated by size on an ABI3130xl Genetic Analyzer. Allele sizes were scored against the GeneScan 500 LIZ Size Standard, using GENEMAPPER 4.0 (Applied Biosystems) and manually checked twice. The accuracy of genotypes was confirmed through re-amplification and re- analysis of 20% of random selected samples for each locus (Pompanon et al. 2005),

FCUP 88 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) resulting in complete concordance among replicates. The microsatellite data were deposited in the Dryad Repository: http://dx.doi.org/10.5061/dryad.g615h.

To address the direction of hybridization, all individuals were scored for mitochondrial (mtDNA) lineage using primers LS-1 (5′ -AATATACTGGTCTTGTAAACC [15305]) and HS -3 (5′-AGGCATTTTCAGTGCCTTGC [20]) to amplify 1100bp of the mtDNA control region (Okumura 2004). Numbers in square brackets after the primer refer to the 5 ′ position of the primer, as localized on the nucleotide sequence of the Hippotragus niger complete mitochondrial DNA (KM245339) (Themudo et al. 2015). Additionally, males were scored for the Y-linked haplotype using primers FY1 (5′ - AAACAGTGCAGTCGTATGCTTCTGC) and RY1 (5′ - GCCTTTGTTAGCGAGAGTAAGGAAG) to amplify 690bp of the SRY gene (Kikkawa et al. 2013). Amplifications were performed using the MyTaq™ Mix (Bioline) following manufacturer’s instructions, 0.5 μ M of each primer and approximately 10 ng of genomic DNA in a total volume of 10 μ l. PCR was performed over 38 cycles with the annealing temperature set to 56 °C (mtDNA) or using a touchdown profile with 13 cycles of annealing temperature of 58 °C, decreasing 0.5 °C per cycle, followed by 27 cycles with annealing temperature set to 52 °C (SRY). Successful amplifications for mtDNA and SRY were sequenced for both strands following the BigDye Terminator v3.1 Cycle sequencing protocol (Applied Biossystems) and sequenced in an ABI 3130xl Genetic Analyzer. Sequences were aligned using SEQSCAPE 2.5 (Applied Biosystems) and checked manually. mtDNA and SRY sequences were deposited in GenBank (Accession numbers KU146571 to KU146574).

Molecular data analysis

Microsatellite diversity was evaluated separately for sable from Angola and Namibia, and roan, excluding putative hybrids, based on mean number of alleles per locus (Na) and observed (HO) and expected (HE) heterozygosities for each locus/population using GENETIX 4.05 (Belkhir et al. 2004). The same software was used to evaluate deviations from Hardy–Weinberg equilibrium. To test pairwise linkage disequilibrium between genotypes for all loci we used FSTAT 2.9.3.2 (Goudet 2001). Significance levels were adjusted using the sequential method of Bonferroni for multiple comparisons in the same data set (Rice 1989). Population differentiation was assessed by Fisher’s analogues of pairwise mean FST (estimator θ) (Weir et al. 1984) using also FSTAT. This software was also used to perform pairwise tests of differentiation for populations using the significance value of p < 0.001.

FCUP 89 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

The occurrence of admixture among the nine putative hybrid individuals was investigated using the model-based Bayesian clustering analysis implemented in STRUCTURE 2.3.4 (Pritchard et al. 2000; Falush et al. 2003). The 90 individuals in the dataset were assigned to two populations (K = 2) without any prior for population identification and using the admixture model with correlated allele frequencies. The analysis was performed 10 times for 106 MCMC steps following a burn-in period of 105 steps. Posterior probabilities of the data in each run were compared to ascertain confidence in the model fit. To corroborate inferences from the STRUCTURE analysis without making assumptions regarding data structure, we used a centred, scaled PCA to cluster individual microsatellite genotypes. PCA clusters individuals only based on genotypes and has no assumptions regarding Hardy–Weinberg or linkage equilibrium. The PCA was conducted using adegenet package (Jombart 2014) in R 3.1.2 (R Development Core Team 2014). Additionally, NEWHYBRIDS 1.1 (Andersson & Thompson 2002) was used to achieve a more detailed analysis of the hybrids’ ancestry, by inferring the posterior probability assignment (q) of each individual to six genotype frequency classes: sable, roan, F1, F2 and first generation backcrosses to both parental.

Maternity inference of the nine hybrid individuals was determined using a likelihood- based approach implemented in CERVUS 3.0 (Marshall et al. 1998). Parentage inference was carried out using allele frequencies at the 51 microsatellite loci across all sable and roan individuals genotyped (hybrids were excluded). A threshold determined empirically by simulation (based in the log- likelihood ratio, LOD score) set the proportion of maternity tests that could be resolved with a strict confidence level of 90% and 99%. The number of candidate mothers was set at nine and the proportion of sampled candidate mothers was set at 90%. This simulates the chance that an unknown female may be the mother. We assumed that an average of 80% of loci per individual was typed and that an average of 1% of loci was mistyped. Critical LOD scores were calculated for the assignment of maternity to the nine females for the seven F1 hybrids. The same procedure was used to infer maternity of backcross individuals using as candidate mothers all the F1 females.

Results

Intensive camera-trapping revealed that shortly after the end of the Angolan civil war only one giant sable herd was present in Cangandala (Supplementary Fig. S1). In 2005, the herd comprised adult females, calves, and young animals estimated to have been born within the previous three years (Fig. 2), all of which displayed the typical

FCUP 90 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) morphological features of giant sables (Fig. 3). The herd also included calves and young individuals with phenotypic features intermediate between sable and roan, the oldest of which were estimated to have been born in 2002. These individuals could be distinguished from sable by their larger size, paler mane coloration, and differences in facial mask and ear shape (Fig. 3). The number of roan detections through camera- trapping was nil in 2005 but then increased over time (Supplementary Table S1), though most records until the end of 2008 corresponded to a single juvenile female (2006) and two solitary males (2006–2008). The first roan herd was recorded only in the second half of 2008, and then the number of herd detections increased during 2009–2011.

Fig. 2 - Temporal variation in estimated population size and births of giant sable antelopes and sable x roan hybrids in Cangandala National Park, Angola. The number of hybrids recorded grew progressively over time (red line), while the number of sable observed increased up to 2006 and declined thereafter (blue line). We recorded births of male (dark blue bars) and female sables (light blue bars) between 2002 and 2005, and then again in 2010–2011, when all sables in Cangandala were taken to a large outdoor enclosure, to where sables captured in Luando National Park were translocated. Male (dark orange bars) and female (light orange bars) putative hybrids were estimated to be born each year until 2010, when access of roan to sable females was prevented. Arrow indicates the first introduction of a giant sable bull translocated from the Luando Integral Nature Reserve.

Births of phenotypically pure sable calves were not observed after 2005 and were only recorded again in 2010, following the translocation to Cangandala of a sable bull captured in Luando. Births of putative hybrid calves were estimated to have occurred every year since 2002, but they were not detected again after 2010 when all phenotypically pure female sables were physically separated from putative hybrids and roan males. The number of putative hybrids recorded grew steadily over time, equalling sables in 2009 (Fig. 2). Two individuals born in 2007 and 2009 appeared morphologically

FCUP 91 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) different from the other putative hybrids, as they showed features more closely resembling roan (Fig. 3).

In contrast, the last putative hybrid born in 2010 resembled sable. The presence of these three calves, plus the observation of a putative hybrid female with udders and attending two of them in 2009 and 2010 (Supplementary Fig. S1e), strongly suggested the occurrence of second generation hybrids. No mature sable bull indigenous to Cangandala was ever observed throughout the study, though a young male was present in 2005 but disappeared thereafter. Four sable male calves born in 2005 also disappeared subsequently before maturing. Between 2005 and 2009 the herd was dominated in succession by three different putative hybrid bulls, and was often in close proximity to a solitary roan bull.

Fig. 3 - Schematic representation of diagnostic field characteristics of giant sable antelopes, roan antelopes, and their F1 hybrids and backcrosses observed in Cangandala National park, Angola. Drawings are based on photographs taken during camera trapping and animal capture sessions carried out in 2009–2011. The hybrids and backcrosses represented were confirmed through genetic analysis. The sable x roan hybrids (robles) are phenotypically intermediate between the parental species, while the hybrids x roan backcrosses have features more closely resembling roan. The female backcross shows the abnormal horns observed in a single individual.

Genetic diversity based on microsatellites was significantly lower (p < 0.05) in giant sables from Angola (2.47 alleles per locus; HE = 0.329; N = 35), compared to Namibian sables (3.41 alleles per locus; HE = 0.450; N = 22), and particularly roan (5.63 alleles per locus; HE = 0.488; N = 24) (Supplementary Table S2). Divergence between Angolan and

Namibian sables was statistically significant (FST = 0.438, p < 0.001), and between these

FCUP 92 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

and roan (FST = 0.523 and FST = 0.467, respectively, p < 0.001). In the biplot of a Principal Components Analysis (29.0% of overall genetic variation), there were three clear clusters corresponding to Angolan and Namibian sables, and roan, whereas the nine putative hybrids genotyped from Cangandala showed an intermediate position between roan and giant sable (Fig. 4a).

Fig. 4 - Genetic evidence for sable x roan hybridization in Cangandala National Park, Angola. (a) First and second components of a principal components analysis (PCA) of 51 microsatellite genotypes from 90 Hippotragus spp. samples; ovals are 95% inertia ellipses; the inset shows the distribution of eigenvalues for all principal components. (b) Individual assignment to genetic clusters (K = 2) inferred by Bayesian analyses (STRUCTURE); arrows indicate first generation backcrosses to roan confirmed by NewHybrids analysis. Phenotypically intermediate individuals are located between roan and sable in the PCA biplot, and they are partially assigned to both species in the STRUCTURE analysis.

STRUCTURE analysis for K = 2 clearly differentiated sable from roan (Fig. 4b), with mean posterior probability of individual assignment to correct species of qi> 0.99. All morphologically intermediate individuals were partially assigned to both species, with individual qi ranging from 0.21 to 0.79. Bayesian clustering analysis to detail hybrids ancestry ascribed all putative hybrids to strict hybrid classes with posterior probabilities above 99%, including the confirmation of two individuals as backcrosses to roan

FCUP 93 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

(Supplementary Table S3). All hybrids had the giant sable mitochondrial haplotype previously identified in Cangandala (Pitra et al. 2006), and the Y chromosome of the three hybrid males was typical of roan (Supplementary Table S3). In maternity analysis, each of the seven F1 hybrids analysed were ascribed to one of four sable females with a strict confidence level of 99% (Supplementary Table S3). The two backcrosses were assigned to a single hybrid female (Supplementary Table S3). The results of paternity analysis were compatible to the view that a single roan bull sired all hybrids (Supplementary Table S3), but this could not be further explored due to the few genetic data for Angolan roans.

Discussion

Our results confirmed the occurrence of introgressive hybridization between giant sable and roan antelopes, which was associated with the presence of a solitary male roan in the home range of an isolated sable herd, at least temporarily unattended by mature sable bulls. Individuals with hybrid morphology had never been reported before in Cangandala, though this population was well studied in the 1970s, when both sable and roan were common in the area (Estes & Estes 1974). In contrast, during our study we found a single sable herd in Cangandala, whereas roan herds appeared to be absent until the end of 2008. Population depletion of both species was probably a consequence of heavy wartime poaching since at least the early 1980s, which may well have intensified after the war ceased in 2002. Evidence of illegal hunting during our study included encounters with poachers, apprehension of shotguns and AK-47’s, finding and dismantling of hundreds of traps, and severe leg wounds caused by snares observed in several sables and roans handled. As observed in other African antelopes (Goldspink et al. 1998; Holmern et al. 2006), poaching possibly had a particularly strong effect on sable males, because their contrasting coloration, solitary behaviour and long-range movements may make them more vulnerable to poachers than females. Systematic elimination of sable bulls may have resulted in the lack of conspecific mates for sable females, thus favouring heterospecific mating with a male roan. Although the birth of pure sables between 2002 and 2005 suggested that mature male sables were still in the area, these may have been young and inexperienced individuals with a weak control of the herd, which were presumably killed by poachers. This idea is supported by the detection on two occasions in 2005 of a young adult (about 2.5 years old) sable male accompanying the herd, which soon disappeared. Mature roan females appeared very

FCUP 94 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) scarce or even absent in Cangandala before 2008, and so the shortage of conspecific mates could also have promoted the initial heterospecific mating by the male roan.

Karyological uniformity of sable and roan antelopes may have facilitated the production of viable hybrids (Robinson & Harley 1995), suggesting that current reproductive isolation between the two species is maintained mainly via prezygotic barriers. However, there was some evidence for reduced viability and fertility of hybrids, though results should be interpreted with caution due to small sample sizes. First, there was a tendency for more females (≈ 70%) than males in the group of confirmed F1 hybrids (n = 7), which is in line with the reduced viability for the heterogametic sex predicted by Haldane’s rule. Second, hybrid males appeared to be sterile, as no offspring was produced by the two confirmed and one putative hybrid bull that had access to breeding sable and F1 females for several years in succession. Third, reduced fertility was also apparent in F1 females, as only one out of five showed signs of pregnancy and produced calves. Finally, fitness of backcrosses was unknown, but is noteworthy than one of the two roan backcrosses had physical abnormalities, while the suspected sable backcross died at young age for unknown reasons. It is unlikely, therefore, that this mixed herd of sable females, F1 and backrosses would develop into a hybrid swarm with long-term viability (Rhymer and Symberloff 1996; Allendorf et al. 2001). Instead, it is likely that without conservation intervention this hybridization event would represent a dead end for the local sable population, culminating a long term population decline. Nevertheless we can’t exclude the possibility that some sable genes could eventually introgress further into the local roan population.

Although there is increasing recognition of the evolutionary and ecological roles of hybrids (Ellstrand et al. 2010; Stronen & Paquet 2013), human-mediated hybridization is considered undesirable and something to be eliminated if possible (Rhymer & Symberloff 1996; Allendorf et al. 2001). If a population has not become a hybrid swarm and still contains a number of parental individuals, management recommendations include removal of hybrids or captive-breeding programs (Allendorf et al. 2001). In our case, conservation action was taken in 2009–2011, when all surviving hybrids and sable females were captured and confined in large enclosures, and three sable bulls and six adult females from Luando were translocated into Cangandala (Supplementary Fig. S2). The decision to intervene was taken because the local population was considered technically extinct, with a single herd including nine old pure females and several F1 and backcross hybrids, with low genetic diversity and no prospects for a male sable to be naturally recruited into the population. Birth of three sables from two old females that previously mothered hybrids occurred in 2010–2011, providing the first signs of

FCUP 95 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) population recovery. To the best of our knowledge this is the first example of successful management action taken in response to the detection of introgressive hybridization in the wild between two naturally sympatric species, reinforcing the importance of early detection of admixed individuals in conservation programs of endangered species (Oliveira et al. 2008; Cabria et al. 2011; Godinho et al. 2013).

By catching hybridization in flagrante delicto, this study provided support for the operation in the wild of Hubb’s ‘desperation’ hypothesis (Hubbs 1955), though in our case interbreeding occurred between two rare species, rather than between a rare and a common species. Other studies have reported hybridization events between naturally sympatric species that are compatible with Hubb’s principle, though with limited information on the underlying demographic processes. For instance, a population decline in harbor porpoises Phocoena phocoena was hypothesised to have resulted in reduced male discrimination of mates and hybridization with Dall’s porpoises Phocoenoides dalli (Willis et al. 2004); hybridization in African cercopithecine monkeys was associated with habitat fragmentation and small population sizes (Detwiler et al. 2005); local extinction due to overexploitation followed by recolonization was considered to have resulted in hybridization among three species of fur seal Arctocephalus spp. (Lancaster et al. 2006); males of the endangered Grevy’s zebra Equus grevyi at the edge of the species range were hypothesised to have difficulties in finding conspecifc mates and thus to interbreed with locally abundant plain’s zebra Equus quagga females (Cordingley et al. 2012). In all these cases, evidence suggest that hybridization was preceded by reductions in population size or isolation/expansion events on local populations, which resulted in the scarcity of conspecific mates. Considering that severe population declines and fragmentation processes are affecting an increasing number of species (Dirzo et al. 2014), hybridization and introgression associated with the scarcity of conspecific mates may be an increasing cause of biodiversity conservation concern. Addressing this problem should involve efforts for the early detection of hybrids in small populations, which could then prompt rapid conservation management action.

Aknowledgements

The Giant Sable Conservation Project is coordinated by the Ministry of Environment of the Republic of Angola, in collaboration with the Kissama Foundation. We thank Sendi Baptista, Cardoso Bebeca, Vladimir Russo, Abias Huongo, Joaquim Manuel, and Generals João Traguedo and Afonso Hanga for support during the animal captures, and the Angolan Air Force for heavy logistics made available. The contributions from Dr Peter

FCUP 96 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Morkel and Barney O’Hara were decisive for the success of the capture exercises and animal handling in Angola. We are grateful to Bettine Jansen van Vuuren and the University of Johanesburg for contributing with roan samples from Southern Africa. The Namibian sable samples were kindly provided by the Ministry of Environment and Tourism of the Republic of Namibia. We gratefully acknowledge Marco Festa-Bianchet and an anonymous reviewer for commentaries that improved the quality of this manuscript. We also thank Susana Lopes and Sofia Mourão for lab assistance, Luis Veríssimo and Hugo Fernandes for the art figures, and Filippo Nardin for supervising the Giant Sable Fund. Financial support to this research was provided by ExxonMobil Foundation and by the Projects “Biodiversity, Ecology and Global Change” and “Genomics Applied To Genetic Resources” cofinanced by North Portugal Regional Operational Programme 2007/2013 (ON.2 – O Novo Norte), under the National Strategic Reference Framework (NSRF), through the European Regional Development Fund (ERDF). RG is supported by an IF2012 Research contract from FCT (Portuguese Science Foundation, IF/564/2012). This is scientific paper no. 3 from the Portuguese- Angolan TwinLab established between CIBIO/InBIO and ISCED/Huíla, Lubango.

Supplementary material

Supplementary Figures (Fig.S1 and S2) and Tables (Table S1, S2 and S3) are appended to the current document.

References

Allendorf, F. W., Leary, R. F., Spruell, P., & Wenburg, J. K. (2001). The problems with hybrids: setting conservation guidelines. Trends in ecology & evolution, 16(11), 613-622.

Baptista, S. L., Pinto, P. V., Freitas, M. D. C., Cruz, C., & Palmeirim, J. M. (2013). Geophagy by African ungulates: the case of the critically endangered giant sable antelope of Angola (Hippotragus niger variani). African Journal of Ecology, 51(1), 139-146.

Barrie, A. (2003). Translocation of roan antelope in South Africa and the effect this has had on the genetic diversity of the species (Doctoral dissertation).

FCUP 97 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Belkhir, K., Borsa, P., Chikhi, L., Raufaste, N., & Bonhomme, F. (2004). GENETIX 4.05, Population genetics software for Windows TM. Université de Montpellier II. Montpellier.

Bibi, F. (2013). A multi-calibrated mitochondrial phylogeny of extant Bovidae (Artiodactyla, Ruminantia) and the importance of the fossil record to systematics. BMC Evolutionary Biology, 13(1), 166.

Cabria, M. T., Michaux, J. R., GÓMEZ‐MOLINER, B. J., Skumatov, D., Maran, T., Fournier, P., ... & Zardoya, R. (2011). Bayesian analysis of hybridization and introgression between the endangered european mink (Mustela lutreola) and the polecat (Mustela putorius). Molecular Ecology, 20(6), 1176-1190.

Cordingley, J. E., Sundaresan, S. R., Fischhoff, I. R., Shapiro, B., Ruskey, J., & Rubenstein, D. I. (2009). Is the endangered Grevy's zebra threatened by hybridization?. Animal Conservation, 12(6), 505-513.

Detwiler, K. M., Burrell, A. S., & Jolly, C. J. (2005). Conservation implications of hybridization in African cercopithecine monkeys. International Journal of Primatology, 26(3), 661-684.

Dirzo, R., Young, H. S., Galetti, M., Ceballos, G., Isaac, N. J., & Collen, B. (2014). Defaunation in the Anthropocene. Science, 345(6195), 401-406.

Ellstrand, N. C., Biggs, D., Kaus, A., Lubinsky, P., McDade, L. A., Preston, K., ... & Schierenbeck, K. A. (2010). Got hybridization? A multidisciplinary approach for informing science policy. BioScience, 60(5), 384-388.

Estes, R. D., & Estes, R. K. (1974). The biology and conservation of the giant sable antelope, Hippotragus niger variani Thomas, 1916. Proceedings of the academy of natural sciences of Philadelphia, 73-104.

Estes, R. D., & Kingdon, J. (2013). Genus Hippotragus. Roan and sable antelopes. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 547. A&C Black.

Fernández, M. H., & Vrba, E. S. (2005). A complete estimate of the phylogenetic relationships in Ruminantia: a dated species‐level supertree of the extant ruminants. Biological reviews, 80(2), 269-302.

Falush, D., Stephens, M., & Pritchard, J. (2003). Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics, 164: 1567-1587.

FCUP 98 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Godinho, R., Llaneza, L., Blanco, J. C., Lopes, S., Alvares, F., Garcia, E. J., ... & Ferrand, N. (2011). Genetic evidence for multiple events of hybridization between wolves and domestic dogs in the Iberian Peninsula. Molecular Ecology, 20(24), 5154- 5166.

Goldspink, C. R., Holland, R. K., Sweet, G., & Stjernstedt, R. (1998). A note on the distribution and abundance of puku, Kobus vardoni Livingstone, in Kasanka National Park, Zambia. African journal of ecology, 36(1), 23-33.

Goudet, J. (2001). FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3.2). Available at: http://www2.unil. ch/popgen/softwares/fstat.htm.

Green, W. C., & Rothstein, A. (1998). Translocation, hybridization, and the endangered black‐faced impala. Conservation Biology, 12(2), 475-480.

Grobler, J. H. (1980). Body growth and age determination of the Sable Hippotragus niger niger (Harris, 1838). Koedoe, 23(1), 131-156.

Grobler, J. P., Rushworth, I., Brink, J. S., Bloomer, P., Kotze, A., Reilly, B., & Vrahimis, S. (2011). Management of hybridization in an endemic species: decision making in the face of imperfect information in the case of the black wildebeest— Connochaetes gnou. European journal of wildlife research, 57(5), 997.

Hedrick, P. W. (2009). Conservation genetics and North American bison (Bison bison). Journal of Heredity, 100(4), 411-420.

Holmern, T., Mkama, S., Muya, J., & Røskaft, E. (2006). Intraspecific prey choice of bushmeat hunters outside the Serengeti National Park, Tanzania: a preliminary analysis. African Zoology, 41(1), 81-87.

Hubbs, C. L. (1955). Hybridization between fish species in nature. Systematic zoology, 4(1), 1-20.

IUCN (2008). SSC Antelope Specialist Group. Hippotragus niger ssp. variani. The IUCN Red List of Threatened Species. Version 2014.1. (2008)

Jansen van Vuuren, B. J., Robinson, T. J., Vaz Pinto, P., Estes, R., & Matthee, C. A. (2010). Western Zambian sable: Are they a geographic extension of the giant sable antelope?. South African Journal of Wildlife Research, 40(1), 35-42.

FCUP 99 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Kikkawa, Y., Takada, T., Nomura, K., Namikawa, T., Yonekawa, H., & Amano, T. (2003). Phylogenies using mtDNA and SRY provide evidence for male‐mediated introgression in Asian domestic cattle. Animal Genetics, 34(2), 96-101.

Lancaster, M. L., Gemmell, N. J., Negro, S., Goldsworthy, S., & Sunnucks, P. (2006). Ménage à trois on Macquarie Island: hybridization among three species of fur seal (Arctocephalus spp.) following historical population extinction. Molecular Ecology, 15(12), 3681-3692.

Martin, R. B. (2003). Roan, Sable and Tsessebe – transboundary species project. Unpublished report. Windhoek: Ministry of Environment & Tourism and Namibia Nature Foundation: 96pp.

Okumura, H. (2004). Complete sequence of mitochondrial DNA control region of the Japanese serow Capricornis crispus (Bovidae: Caprinae). Mammal Study, 29(2), 137-145.

Oliveira, R., Godinho, R., Randi, E., & Alves, P. C. (2008). Hybridization versus conservation: are domestic cats threatening the genetic integrity of wildcats (Felis silvestris silvestris) in Iberian Peninsula?. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 363(1505), 2953-2961.

Pitra, C., Vaz Pinto, P., O’Keeffe, B. W., Willows-Munro, S., van Vuuren, B. J., & Robinson, T. J. (2006). DNA-led rediscovery of the giant sable antelope in Angola. European Journal of Wildlife Research, 52(3), 145-152.

Pompanon, F., Bonin, A., Bellemain, E., & Taberlet, P. (2005). Genotyping errors: causes, consequences and solutions. Nature Reviews Genetics, 6(11), 847-846.

Pritchard, J. K., Stephens, M., & Donnelly, P. (2000). Inference of population structure using multilocus genotype data. Genetics, 155(2), 945-959.

Rhymer, J. M., & Simberloff, D. (1996). Extinction by hybridization and introgression. Annual Review of Ecology and Systematics, 27(1), 83-109.

Rice, W. R. (1989). Analyzing tables of statistical tests. Evolution, 43(1), 223-225.

Robinson, T. J., & Harley, E. H. (1995). Absence of geographic chromosomal variation in the roan and sable antelope and the cytogenetics of a naturally occurring hybrid. Cytogenetic and Genome Research, 71(4), 363-369.

Stronen, A. V., & Paquet, P. C. (2013). Perspectives on the conservation of wild hybrids. Biological conservation, 167, 390-395.

FCUP 100 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Themudo, G. E., Rufino, A. C., & Campos, P. F. (2015). Complete mitochondrial DNA sequence of the endangered giant sable antelope (Hippotragus niger variani): Insights into conservation and taxonomy. Molecular phylogenetics and evolution, 83, 242-249.

Trouwborst, A. (2014). Exploring the Legal Status of Wolf‐Dog Hybrids and Other Dubious Animals: International and EU Law and the Wildlife Conservation Problem of Hybridization with Domestic and Alien Species. Review of European, Comparative & International Environmental Law, 23(1), 111-124. van Wyk, A. M., Kotzé, A., Randi, E., & Dalton, D. L. (2013). A hybrid dilemma: a molecular investigation of South African bontebok (Damaliscus pygargus pygargus) and blesbok (Damaliscus pygargus phillipsi). Conservation Genetics, 14(3), 589-599.

Vaz Pinto, P. (2006). Hybridization in giant sable. A conservation crisis in a critically endangered Angolan icon. IUCN/ SSC Antelope Specialist Group. Gnusletter 26, 47-58.

Vaz Pinto, P., Lopes, S., Mourão, S., Baptista, S., Siegismund, H. R., Van Vuuren, B. J., ... & Godinho, R. (2015). First estimates of genetic diversity for the highly endangered giant sable antelope using a set of 57 microsatellites. European Journal of Wildlife Research, 61(2), 313-317.

Vonlanthen, P., Bittner, D., Hudson, A. G., Young, K. A., Müller, R., Lundsgaard-Hansen, B., ... & Seehausen, O. (2012). Eutrophication causes speciation reversal in whitefish adaptive radiations. Nature, 482(7385), 357-362.

Weir, B. S., & Cockerham, C. C. (1984). Estimating F-statistics for the analysis of population structure. evolution, 1358-1370.

Willis, P. M., Crespi, B. J., Dill, L. M., Baird, R. W., & Hanson, M. B. (2004). Natural hybridization between Dall's porpoises (Phocoenoides dalli) and harbour porpoises (Phocoena phocoena). Canadian Journal of Zoology, 82(5), 828-834.

FCUP 101 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

SUPPLEMENTARY FIGURES

Supplementary Fig. S1 - Example of photos obtained from camera trapping during the study period. (a) Pure sable females and F1 hybrid calves; (b) Territorial roan bull; (c) Several hybrids; (d) Dominant F1 hybrid bull; (e) Female F1 hybrid attending her calf; (f) Male and female backcrosses in the foreground, and two F1 females in the background. All photos were obtained from camera traps set by one of the authors (Pedro Vaz Pinto).

FCUP 102 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Supplementary Fig. S2 - Different stages of a giant sable translocation program to avoid local population extinction. (a) Giant sable bull in Luando Nature Integral Reserve prior to translocation; (b) Female sable being offloaded by helicopter; (c) Female F1 hybrid marked and collared; (d) Giant sable bull with young females in temporary enclosure; (e) Translocated giant sable bull in Cangandala National Park with female in background; (f) Sable females and first pure calf born in Cangandala after the translocation operations. Photo 3a was taken by Sendi Lara Baptista, and photos 3b-f were taken by one of the authors (Pedro Vaz Pinto).

FCUP 103 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

SUPPLEMENTARY TABLES

Supplementary Table S1 - Quantification of camera-trapping data obtained during the study period. Photos and video footage of sable, roan and their hybrids were obtained in Cangandala National Park through photographic and video cameras placed at natural salt licks (termite mounds) regularly visited by the animals. Access to this remote area involved major logistic difficulties particularly during the first years, and so the number and type of cameras used, as well as their operating periods, varied greatly in space and over time.

Sable Putative Hybrids Roan P V E P V E P V E 2005 19 0 2 4 0 1 0 0 0 2006 16 9782 12 3 7383 6 4 376 3 2007 1413 2773 10 639 3202 8 43 0 2 2008 2579 0 11 3068 0 12 1670 0 13 2009 1358* 0 12 2534 0 21 629 0 16 2010 81* 0 2 9856 0 46 1167 0 37 2011 2037 0 15 735 0 11 1707 0 34 TOTAL 7503 12555 64 16839 10585 105 5219 376 108

P, number of photos; V, seconds of video footage; E, number of independent events (i.e., visits by herd or individuals to salt licks in different days). * Between Sep 09 and Aug 10 pure sable were contained and without access to salt licks.

Supplementary Table S2 - Genetic diversity measures for populations of Hippotragus niger and of H. equinus based on 51 microsatellite loci. Values for Angola are presented for the overall sample and considering separately the Cangandala and Luando subpopulations. N: Number of individuals, HO: observed heterozygosity, HE: expected heterozygosity, Na: mean number of alleles per locus, NPA: number of private alleles, FIS: inbreeding coefficient. Standard error values are given in parenthesis.

N HO HE Na NPA H. niger (overall) 57 0.360 (0.031) 0.520 (0.036) 4.31 (0.35) 2.49 (0.28)

Angola 35 0.309 (0.036) 0.329 (0.037) 2.47 (0.19) 0.51 (0.12)

Cangandala 9 0.253 (0.037) 0.228 (0.032) 1.82 (0.11) 0.02 (0.02)

Luando 26 0.330 (0.039) 0.332 (0.038) 2.45 (0.19) 0.12 (0.05)

Namibia 22 0.440 (0.038) 0.450 (0.038) 3.41 (0.27) 1.06 (0.17)

H. equinus (overall) 24 0.399 (0.043) 0.488 (0.047) 5.80 (0.64) 3.98 (0.58)

Angola 4 0.418 (0.053) 0.492 (0.050) 3.96 (0.25) 0.61 (0.12)

Namibia 5 0.495 (0.051) 0.504 (0.050) 3.26 (0.26) 0.53 (0.13)

South Africa 15 0.359 (0.044) 0.396 (0.046) 4.96 (0.42) 1.02 (0.31)

FCUP 104 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Supplementary Table S3 - Inferred ancestry of sable x roan hybrids in Cangandala National Park, Angola. Ancestry analysis was performed on nine individuals with phenotypically intermediate characteristics between sable and roan antelopes which were born in Cangandala between 2003 and 2009. For each individual we estimated the maternal lineage based on mitochondrial DNA (mtDNA), and for the males the paternal lineage based on the SRY gene (Y). We used NEWHYBRIDS to estimate the posterior probability of assignment of each individual to sable, roan, their F1 and F2 hybrids, and the backcrosses to sable (BxSable) and roan (BxRoan). Maternity inference used a likelihood-based analysis implemented in CERVUS 3.0 and hybrids were ascribed to mothers with a strict confidence level of 99%.

Inferred Ancestry Individual Sex Birth mtDNA Y year Sable Roan F1 F2 BxSable BxRoan Mother HYB-1 F 2003 Sable - 0 0 1 0 0 0 FEM-1 HYB-2 F 2004 Sable - 0 0 1 0 0 0 FEM-9 HYB-3 F 2004 Sable - 0 0 1 0 0 0 FEM-1 HYB-4 M 2006 Sable Roan 0 0 1 0 0 0 FEM-3 HYB-5 M 2006 Sable Roan 0 0 1 0 0 0 FEM-9 HYB-6 F 2007 Sable - 0 0 0 0.006 0 0.994 HYB-3 HYB-7 F 2007 Sable - 0 0 1 0 0 0 FEM-7 HYB-8 F 2008 Sable - 0 0 1 0 0 0 FEM-9 HYB-9 M 2009 Sable Roan 0 0 0 0 0 1 HYB-3

FCUP 105 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

CHAPTER 3

SABLE PHYLOGEOGRAPHIC PATTERNS AND POPULATION STRUCTURING

Paper III Rocha, J., Vaz Pinto, P., Siegismund, H. R., Meyer, M., Jansen van Vuuren, B., Veríssimo, L., Ferrand, N., & Godinho, R. Phylogeography of sable antelope shaped by geomorphology and climate. In preparation.

Paper IV Vaz Pinto, P., Siegismund, H. R., Jansen van Vuuren, B, Ferrand, N., & Godinho, R. Population structure and differentiation patterns of sable antelope. In preparation.

FCUP 106 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP 107 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Phylogeography of sable antelope shaped by geomorphology and climate

Joana Rocha1,2*, Pedro Vaz Pinto1,2,3,4*, Hans Siegismund5, Matthias Meyer6, Bettine Jansen van Vuuren7, Luis Veríssimo4, Nuno Ferrand1,2,3,7, & Raquel Godinho1,2,3

1CIBIO/InBIO – Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Campus Agrário de Vairão, 4485-661 Vairão, Portugal

2Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto, Portugal

3ISCED – Instituto Superior de Ciências da Educação da Huíla, Rua Sarmento Rodrigues, Lubango, Angola

4The Kissama Foundation, Rua Joaquim Capango nº49, 1ºD, Luanda, Angola

5Department of Biology, University of Copenhagen, Ole Maaloes Vej 5, 2200 Copenhagen N, Denmark

6Department of Evolutionary Genetics, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig, Germany

7Department of Zoology, Faculty of Sciences, University of Johannesburg, Auckland Park 2006, South Africa

*Co-first authorship

Abstract

Understanding the processes that shaped the African continent is crucial for studying species evolution. In turn, disentangling species evolutionary patterns can help elucidate key events in the continent’s history. African ungulates have been mostly studied under the light of Pleistocene climate shifts, neglecting the fact that the continent persisted tectonically active throughout the Pleistocene, severely modifying its geomorphology and, consequently, species phylogeographic patterns. A range-wide

FCUP 108 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) analysis of sable antelope complete mitogenomes was used to address, for the first time, the role of both Pleistocene climate and geomorphological changes in shaping the genetic diversity of an African ungulate. Our results supported a previously described striking divergence found among sables from west Tanzania, which we attribute to an introgressive hybridization event with an extinct population. The population dynamics seen in sable lineages, englobing eastern (E), central (C) and southern (S) African populations, can only be partially explained by climate oscillations, where sables expanded their range during cool arid periods, in accordance with the expansion of savanna habitats, and became isolated in small patches of habitat when forests displaced savannas during warm, wet periods. In interplay with climate, the patterns of vicariance and history of some sable groups seem to have resulted from clear geomorphological changes, namely the split between eastern and southern lineages, where the East Arc Mountains acted as geological barriers, and a split in two southern sable haplogroups, linked to rearrangements in the Zambezi system, and possibly framing the most recent time when the river attained its current drainage profile.

Keywords: Hippotragus niger, mitogenome, Pleistocene, phylogeography, climate, geomorphology

Introduction

The African savanna biome, including most tropical grasslands, woodlands and scrublands of southcentral and eastern Africa, harbors the richest diversity of ungulate species on earth (DuToit & Cumming 1999; Mayaux et al. 2004). The evolutionary patterns of such diversity has been largely explained by habitat fluctuations associated to Pleistocene climate changes (deMenocal 2004; Lorenzen et al. 2012). Yet, the African continent has remained highly dynamic in terms of geomorphology, experiencing drastic landmass configuration changes in recent geological times (Plio-Pleistocene) (Doucouré & de Wit 2003; Goudie 2005; Moore et al. 2009) but the role of geomorphological changes has received far less attention in the literature (Cotterill 2003a,b,c). Furthermore, the interplay of climatically determined habitat fluctuations and geological features on shaping species evolutionary patterns is still poorly understood and remains a challenge (Stankiewicz & de Wit 2006). African climates shifted towards cooler temperatures and greater aridity around 2.8 million years ago (deMenocal 1995, 2004). This allowed the expansion of the savanna biome across southcentral and eastern Africa and the first appearance of many ungulate

FCUP 109 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) taxa (Vrba 1995). Such was the case of the explosive radiation within the Bovidae family, which includes around 80% of African ungulates (Vrba 1995; DuToit & Cumming 1999). Throughout the Pleistocene, marked oscillations between cold dry and moist warm periods led to the successive expansion and contraction of savannas and woodlands (Dupont 2011). As a general rule, during dry periods savannas expanded and displaced tropical rainforests, allowing for savanna-adapted species to expand their range accordingly. During moist periods the scenario reversed (Trauth et al. 2009; Dupont 2011), leading to the fragmentation of the savanna biome and isolation of formerly contiguous populations in refugia (Hewitt 2000, 2004). Such dynamics are thought to be currently reflected in the patterns of vicariance and diversity of many ungulate species (Lorenzen et al. 2012). The regions of southcentral and eastern Africa have remained tectonically active throughout the Pleistocene, being subjected to huge uplifting forces, rifting and volcanism that violently and repeatedly modified landscapes, fragmenting and reconnecting habitats and populations (Grubb et al. 1999; Cotterill 2003a,b; Chorowicz 2005; Goudie 2005; Moore et al. 2009; Badgley 2010). One of the most striking geological features of the African continent is the East African rift system (EARS), a series of several thousand kilometers long aligned successions of adjacent individual tectonic basins or rift valleys, comprising a western and an eastern branch (Chorowicz 2005). Independently or in association with the rifting processes in eastern Africa, mountains and highlands were formed by uplift, volcanism and doming. Some uplands like the eastern arc mountains (EAM) can bear a strong influence over local climates and on the distribution of different habitats in the region (Grubb et al. 1999; Faulkes et al. 2010; Livingstone & Kingdon, 2013). For example, an arid corridor has been proposed to connect the arid horn of Africa with the Namib desert in the southwest, still partially present in Tanzania inland along the EAM, before crisscrossing the EARS and the Zambezi basin further south (Coe & Skinner 1993; Grubb et al. 1999; Livingstone & Kingdon 2013). These complex geologic features can therefore result in barriers or corridors to dispersal, promoting hotspots for endemism and shaping speciation, owing to its geomorphological dynamism, topographic heterogeneity and environmental sensitivity (Grubb et al. 1999; Cotterill 2003a; Chorowicz 2005; Scholz et al. 2007; Taylor & Maree 2009; Faulkes et al. 2010; Trauth et al. 2010; Goodier et al. 2011). Drainage systems in south-central Africa also underwent major reorganizations (Moore & Larkin 2001; Goudie 2005; Moore et al. 2008). In particular, the most important east flowing drainage in southcentral Africa, the Zambezi, reflects a turbulent history of geomorphological events including a series of river captures and sharp course changes, some of which occurring during the Pleistocene (Moore & Larkin 2001; Moore et al.

FCUP 110 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

2008, 2012). As new river basins developed across Africa, they were closely entwined with contemporaneous changes in global and local climate (Stankiewicz & de Wit 2006). Although the combined role of both Pleistocene refugia and rivers in structuring species distribution ranges and genetic diversity has been recognized for many African forest mammals (Anthony 2007; Nicolas et al. 2011; Mitchell et al. 2015), fewer are the studies that have assessed the impact of river barriers in shaping the patterns of vicariance and diversity for savanna species (but see Cotterill 2003b,c).

The complex interplay between climate change and geomorphological features in shaping the evolutionary history of the savanna biome fauna is still not fully recognized (Taylor & Maree 2009), hampering the understanding of mechanisms behind phylogeographic patterns observed in many African antelopes. Moreover, comparative studies on antelope’s phylogeography have also been limited by the use of different molecular markers, the model assumptions employed, and the lack of comprehensive datasets covering species full geographic ranges (e.g. Lorenzen et al. 2012). This has led to inconsistent results in estimating divergence times and establishing general phylogeographic patterns across species. The development of target-enrichment strategies for high throughput sequencing makes now possible to obtain whole mitochondrial genomes from large numbers of individuals for population genetic analyses (Pakendorf & Stoneking 2005). This approach allows solving complex within- species relationships (Stiller et al. 2009), interpreting accurately phylogeographic patterns in species with very rapid radiations (Morin et al. 2010; Foote et al. 2011; Shamblin et al. 2012) and increasing reliability in divergence times estimates (Rokas & Carroll 2005; Duchêne et al. 2011; Liedigk et al. 2012; Zinner et al. 2013). Yet, very few studies have made use of fully sequenced mitogenomes to provide insights on the evolutionary history of ungulate species across central, southern and eastern Africa (but see Heller et al., 2012).

The sable antelope, Hippotragus niger (Harris 1838), is one of the two surviving members of the African endemic genus Hippotragus (Bovid subfamily Hippotraginae). It is a low density species with sedentary habits, found widely scattered throughout the mesic savannas of southcentral and eastern Africa, including an isolated population in northern Angola (East 1999, 2013). The combination of being one of Africa’s most habitat-dependent antelopes strongly associated to miombo woodlands (Skinner & Chimimba 2005; Estes 2013), and its wide distribution ranging across some of Africa’s most relevant geomorphological features, such as the EARS, EAM and the southcentral African plateau centered on the Zambezi drainage system (Ansell 1972; Groves 1983; Estes 2013), makes the species a good candidate to investigate signatures of the

FCUP 111 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) interplay between climate shifts and changes in Africa’s geomorphology. Geographical variation in morphological features allowed the description of four to five subspecies (Ansell 1972; Groves 1983; Estes 2013) although the intraspecific taxonomy of the sable remains unresolved. Geological barriers like the EAM, Lake Malawi, Muchinga escarpment or the Zambezi River have been suggested to define different sable populations (Ansell 1972; Groves 1983; Groves & Grubb 2011; Estes 2013), but the proposed boundaries were often inconsistent. The most isolated and morphologically distinct of subspecies is the critically endangered and iconic giant sable (H. n. variani; Thomas 1916), restricted to two protected areas in northern Angola (Estes 2013; Vaz Pinto et al. 2016). As in other ungulate assessments, the lack of geographically representative samples, together with the low phylogenetic resolution associated to analyzing only one or few mtDNA fragments (Matthee & Robinson 1999; Pitra et al. 2002, 2006; Jansen van Vuuren et al. 2010), has limited the ability to fully understand the evolutionary history of the species.

This study aims to investigate evolutionary patterns and timings of vicariance and dispersal of sable populations and to use that information to give insights into the timeframe of Pleistocene climatic and geomorphological events that shaped sable current genetic signatures. To accomplish this we generated hundreds of complete mitochondrial genomes covering the species whole geographic range, combining modern and historic samples. With this approach we also aim to give insights in the events that might be on the origin of other ungulate evolutionary histories in central, southern and eastern Africa.

Material and methods

Sample collection, DNA extraction and library preparation

A total of 233 modern and 33 museum samples were collected from 22 populations covering the whole geographic range of H. niger in Africa (Fig. 1 and supplementary Tables S1, S2). Four Hippotragus equinus were included to outgroup H. niger in data analysis. For modern samples, DNA was extracted using the Qiagen DNeasy Blood and Tissue Kit following manufacturer’s instructions. Historic (museum) samples were subjected to Dabney et al. (2013) method for DNA extraction in a dedicated laboratory for ancient DNA. Double stranded DNA library preparation followed Meyer & Kircher (2010), with the modifications described in Kircher et al. (2012), using the regular Ilumina

FCUP 112 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) multiplex adaptors. Four blank controls were carried through all steps. Libraries were amplified and purified as described in Dabney & Meyer (2012) (see supplementary Text S1).

MtDNA capture, Sequencing and Assembly of mitochondrial genomes

Four overlapping biotinylated PCR products encircling H. niger whole mitochondrial genome were produced and used as probes for capture, using the Expand Long Range dNTPack kit (Roche) in a 25 ul PCR reaction (see details on supplementary Text S2). For modern samples, multiplexed capture of mtDNA sequences was performed as in Maricic et al. (2010). For historic samples, mtDNA capture was performed using a protocol updated from Fu et al. (2013) (see supplementary Text S3). DNA enriched libraries were sequenced on the MiSeq platform in a single lane with 76+7 cycles, following manufacturer’s instructions for Illumina Multiplex sequencing, and using recipes for double-indexed paired-end sequencing (Kircher et al. 2012). Base calling was performed with Bustard (Illumina Inc.). Reads from 233 modern and 33 historic samples longer than 35bp, after adapter trimming and merging, were mapped against H. niger complete mitochondrial genome (Genbank JN632648.1) using the mapper BWA v.0.5.10 (Li & Durbin 2009). A customized mapping workflow was used for mapping to a circular reference (see supplementary Text S4). Reads of outgroup samples were mapped against H. equinus complete mitochondrial genome (Genbank NC_020712.1). For each sample, the consensus sequence was subsequently called using schmutzi (Renaud et al. 2015) (see supplementary Text S5).

Data analysis

The full set of 262 H. niger and four H. equinus complete mitochondrial genomes were aligned using MUSCLE v3.8.31 (Edgar 2004) and Mafft v.7.017b (Katoh & Standley 2013). Alignments were tested for the maximum likelihood-tree and for the most parsimonious tree using Phangorn R-package (Schliep 2011) to select the best multiple sequence alignment. Individuals with masked bases (N) or poor quality were removed from downstream analyses (see supplementary Text S6). The final dataset of 214 sequences was imported to DnaSP v.5.10 (Librado & Rozas 2009) and translated to proteins. No stop codons were found in unexpected positions of the mitochondrial genome. We constructed a Neighbor-Net network (Bryant & Moulton 2004) based on uncorrected patristic distances and bootstrap analysis with 1000 replicates using Split

FCUP 113 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Tree v.4.13.1 (Huson & Bryant 2006), using H. equinus as outgroup. For this, and for all analyses using H. equinus, gaps were excluded and a total of 429bp from the hypervariable regions (HVR) were removed, due to unresolved alignment between H. niger and H. equinus sequences. Bayesian phylogenetic trees and estimates of the time of divergence were performed using BEAST v1.8.0 (Drummond & Rambaut 2007). Best-fit substitution models were estimated with JMODELTEST v.2.1.5 (Darriba et al. 2012). Posterior distributions for divergence times of members of the tribes Hippotragini and Alcelaphini (Bibi 2013) were used to estimate the time to the most recent common ancestor (TMRCA) of Hippotragus using a set of samples representative of each of the different H. niger haplogroups. The posterior distributions from this first analysis were then used as priors on a second phase to estimate divergence times for H. niger using our generated dataset (see supplementary Table S3 and supplementary Text S7). We then explored a dataset made exclusively of H. niger complete mitochondrial sequences (including the HVR). We estimated DNA polymorphism and genetic diversity parameters for the whole dataset, and for each of the haplogroups with ARLEQUIN v.3.11 (Excoffier et al. 2005). We constructed a median-joining network for each haplogroup using PopART v.1 software (http://popart.otago.ac.nz/links.shtml) to assess the relationships between the different haplotypes at a population level. Haplotype sharing in the different H. niger populations were estimated in ARLEQUIN. This software was also used to test for signatures of demographic expansion in H. niger, by estimating Tajima’s D (Tajima 1989) and Fu’s Fs (Fu 1997) and performing the Ewens-Watterson test (Watterson 1978; Slatkin 1996). Mismatch distribution analyses were also carried on DnaSP.

Results

Mitogenome Diversity and Divergence We found 77 haplotypes among 212 complete mitochondrial sequences, revealing the existence of four main mitochondrial lineages in H. niger (Fig. 2). One of these lineages, here named Relic (R), corresponds to a previously described and remarkably divergent group of haplotypes found in sables from west Tanzania (Pitra et al. 2002). The remainder three lineages, here named niger-like, exhibited a remarkably strong geographic structure comprising an eastern lineage (E) found in eastern Africa, a southern lineage (S) present across the Zambian plateau to southern Africa, and a central lineage (C) found in west Tanzania, Malawi and northern Angola. The niger-like lineages can be divided in six haplogroups (E1, E2 for eastern; C1, C2 for central; and

FCUP 114 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

S1, S2 for southern), and further subdivided in six sub-haplogroups (C1a, C1b for haplogroup C1; and S1a and S1b, S2a and S2b for haplogroups S1 and S2, respectively) with high bootstrap support (Fig. 2). Bayesian phylogenetic analyses and the Neighbor-Net network based on uncorrected patristic distances retrieved the same intraspecific relationships with high support (see Fig. 2 and supplementary Fig. S1).

Fig. 1 – Distribution range of Hippotragus niger in shaded grey, and origin of samples. The size of the pie diagrams are proportional to the sample size, and numbers correspond to localities (country of origin between brackets). The colours represent the various mitochondrial haplogroups and subhaplogroups found.

The average number of nucleotide substitutions between the Relic and the niger-like lineages supports a strong and significant separation between them (Dxy = 0.03436 ± 0.00140; 406 fixed differences for the whole mitogenome; supplementary Table S4). Genetic differentiation among niger-like mitogenomes were much smaller though notably high (Dxy = 0.00729 ± 0.00253; 86 fixed differences; supplementary Table S4).

FCUP 115 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 2 – Neighbor-Net network based on uncorrected patristic distances implemented in SplitsTree, excluding sites with insertion/deletions and missing data (N). Hippotragus equinus was used as outgroup. A highly divergent lineage of sables from Tanzania was labeled Relic. No concrete taxonomic category was attributed given its high divergence from all other Eastern, Central and Southern lineages (labeled as niger-like). Numbers next to branches indicate bootstrap values. Numbers in bold above branches (percentages) indicate the average number of nucleotide substitutions (Dxy). Branch lengths are proportional to genetic distance. Scale bars represent sequence divergence. Haplogroups and sub- haplogroups are highlighted in bold and labeled accordingly to the respective African region sub structuring: East Africa 1, East Africa 2, Central Africa 1 (containing sub-haplogroups from Tanzania –C1a- and Malawi – C1b), Central Africa 2 (Angola), Southern Africa 1 and Southern Africa 2 (each containing sub-haplogroups a and b).

Remarkably, the 46 Relic mitogenomes exhibited higher haplotype diversity (H) than the 166 niger-like mitogenomes altogether, though presenting about 30% lower nucleotide diversity (π) (Table 1). For niger-like lineages, we observed a decrease in nucleotide and haplotype diversity from southern to central and eastern lineages (Table 1). Yet, within each African subregion northern populations showed higher levels of genetic diversity

FCUP 116 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) than southern populations (see supplementary Table S5). The lowest genetic diversity was unveiled by haplogroups E1 and C2, restricted to Kenya and Angola respectively, the former exhibiting a complete lack of diversity among six mitogenomes (Table 1).

Table 1- Genetic diversity summary statistics based on complete mtDNA genome sequences Lineages/Haplogroups N S h Hd π MPD Relic-lineage 46 126 27 0.963 ± 0.013 0.00166 ± 0.00082 27.384 ± 12.213 niger-like lineages 166 526 50 0.949 ± 0.008 0.00550 ± 0.00263 90.817 ± 39.237 Eastern lineage 12 105 5 0.727 ± 0.113 0.00332 ± 0.00174 54.818 ± 25.526 E1 6 0 1 0.000 ± 0.000 0.00000 ± 0.00000 0.000 ± 0.000 E2 6 25 4 0.800 ± 0.172 0.00065 ± 0.00040 10.800 ± 5.739 Central lineage 44 117 8 0.601 ± 0.078 0.00143 ± 0.00071 23.646 ± 10.598 C1 8 83 5 0.857 ± 0.108 0.00275 ± 0.00152 45.357 ± 22.064 C1a 4 11 3 0.833 ± 0.222 0.00043 ± 0.00031 7.167 ± 4.258 C1b 4 1 2 0.500 ± 0.265 0.00003 ± 0.00004 0.500 ± 0.519 C2 36 2 3 0.408 ± 0.086 0.00003 ± 0.00003 0.494 ± 0.433 Southern lineages 110 255 37 0.949 ± 0.009 0.00344 ± 0.00166 56.762 ± 24.706 S1 36 124 17 0.917 ± 0.027 0.00235 ± 0.00116 38.854 ± 17.285 S1a 23 70 11 0.881 ± 0.048 0.00118 ± 0.00060 19.494 ± 8.954 S1b 13 32 6 0.718 ± 0.128 0.00081 ± 0.00044 13.487 ± 6.487 S2 74 131 20 0.906 ± 0.016 0.00200 ± 0.00098 33.034 ± 14.565 S2a 35 57 8 0.803 ± 0.044 0.00134 ± 0.00067 22.185 ± 10.013 S2b 39 64 12 0.816 ± 0.045 0.00087 ± 0.00044 14.310 ± 6.554 north Zambezi (S1+S2 a) 58 163 19 0.911 ± 0.020 0.00319 ± 0.00155 52.644 ± 23.096 south Zambezi (S1+S2 b) 52 144 18 0.881 ± 0.028 0.00247 ± 0.00121 40.704 ± 17.960

Abbreviations as follows: N, number of samples; S, number of polymorphic (segregating) sites; h, number of haplotypes; Hd, Haplotype diversity (and respective standard deviation); π, nucleotide diversity (and respective standard deviation); MPD, mean pairwise distance (and respective standard deviation). All parameters were estimated accounting for insertion/deletions and allowing 5% of missing data. Haplogroups are labeled as in Figure 1.

Geographical partition of diversity The distribution and frequency of each lineage, haplogroup and sub-haplogroup was depicted to understand the geographic context of the sable evolutionary history (Fig. 1). Median-joining networks were also generated per haplogroup and for the Relic lineage to understand population partition of genetic diversity (Fig. 3). The Relic lineage was found exclusively in west Tanzania and exhibited consistently predominant frequencies over the niger-like sub-haplogroup C1a that is also exclusive from the region (Fig. 1). The 29 haplotypes found for the Relic lineage are sparsely connected in the median- joining network, having similar frequencies and no apparent geographical structure among the seven west Tanzanian locations sampled (Fig. 3 and supplementary Table S6).

FCUP 117 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 3 – Median-joining networks based on complete mtDNA sequences for each of the different geographic genetic groups. All the networks were generated using PopART. Lineages and haplogroup names are highlighted in bold. Mutations separating the different haplotypes are presented as hatch marks on top of the branches. Haplotypes labeled Zambia correspond to museum specimens with unknown exact origin. These haplotypes provide additional representativeness for S1 and S2.

For niger-like haplogroups, we observed that E1 and C2 show very strong geographic specificity, the former restricted to one population in Kenya (Shimba-Hills) and the latter to Angola (Fig. 2). Haplogroups S1 and S2 are widespread among southern populations without an apparent geographical structure (Fig. 2). However, this is in sharp contrast with the pattern found within each of these haplogroups, as we found a strong geographical segregation relatively to the Zambezi River: S1a and S2a were only present north of the Zambezi River, while S1b and S2b were only observed south of the river (Fig. 2 and Fig. 3). In general, Eastern and Central haplogroups exhibited neighbor- joining networks with a very low number of haplotypes (between one and five) and no haplotype sharing among populations, while southern haplogroups show a high number of haplotypes highly dispersed along the networks with some haplotype shared among populations (Fig. 3). In accordance with the very low interpopulation haplotype sharing and the high genetic diversity and divergence among haplotypes, values for all neutrality tests were non-significant and mismatch analysis showed multimodal distributions in

FCUP 118 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) most haplogroups (data not shown), reflecting a stable demographic history for the sable antelope.

Divergence Time Analyses The divergence between the Relic lineage and all niger-like lineages was estimated to have occurred at 1.4 mya (1.2-1.8 mya 95% highest posterior density intervals [HPDI]), tracing back to the early Pleistocene. Within niger-like lineages, the oldest split occurred between eastern and southcentral lineages in the mid-Pleistocene, with an estimated median time to the most recent common ancestor of 349,200 years (269,300-432,100 years 95% HPDI), followed by the split leading to central and southern lineages around 202,600 years (155,400-253,700 years 95% HPDI). We estimated that split into haplogroups of Eastern and Southern lineages occurred contemporarily, around 154,500 years for E1 and E2, and 149,800 years for S1 and S2. Later, also the Central lineage split into C1 and C2 which occurred around 119,200 years (Table 2).

Table 2. Median time to the most recent common ancestor (TMRCA) and 95% highest posterior density intervals (HPDI) in million years (mya) and thousands of years (kya). TMRCA and 95% HPDI H. niger/H. equinus 5.9 [4.9, 6.9] mya niger-like/Relic 1.4 [1.2, 1.8] mya Eastern/ Southcentral 349.2 [269.3, 432.1] kya Southern/ Central 202.6 [155.4, 253.7] kya E1 / E2 154.5 [111.6, 201.4] kya S1 /S2 149.8 [113.6, 189.5] kya C1/C2 119.2 [88.0, 155.7] kya C1a/C1b 94.8 [68.4, 125.5] kya S1a/S1b 104.6 [75.4, 135.5] kya S2a/S2b 75.4 [53.3, 98.0] kya Relic 80.1 [56.1, 106.5] kya

Interestingly, each of the southern haplogroups (S1 and S2) further split into two distinct sub-haplogroups approximately at the same time, around 104,600 and 75,400 years, respectively. Such sub-haplogroups have a geographical range restricted to north of the Zambezi river in Zambia and Congo (S1a and S2a) and to south of the Zambezi in Zimbabwe, southern Mozambique, Namibia and Botswana (S1b and S2b). The emergence of these sub-haplogroups seems also contemporaneous to the split of the central haplogroup C1 into C1a, present in west Tanzanian sables, and C1b found in Malawian sables, which happened around 94,800 years (Table 2).

FCUP 119 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Discussion

Owing to our extensive dataset, we were able to draw the most complete picture of the evolutionary history of the sable antelope to date. The use of complete mitochondrial genomes allowed us to produce accurate inferences of divergence times for the mtDNA lineages, haplogroups and sub-haplogroups observed. Such findings can both contribute to the debate of possible driving forces explaining patterns of vicariance and diversity observed for African organisms, such as climate and geomorphological features, but also help on further debates trying to date geomorphological changes in Africa, especially associated with river basins.

Introgressive hybridization with a Relic population Our results confirmed the existence of a strikingly divergent and diverse mtDNA sable lineage, here named Relic , confined to the Tanzanian plateau (Pitra et al. 2002). We date back the TMRCA between Relic and niger-like lineages to the early Pleistocene around 1.2-1.8 Ma (Table 2). Pitra et al. (2002) tentatively explained this lineage as the result of the first allopatric fragmentation among sables, between west Tanzanian and the remainder sable populations. They further hypothesized that the sympatric presence of two distinct sable lineages in western Tanzanian populations (here named R and C1a; Fig. 1-3) was justified by a later unidirectional long-distance colonization from southern Africa to Tanzania. Such hypothesis failed to explain i) how the extreme divergence of more than one million years between these different sable populations (Table 2) is not reflected in any obvious morphological feature, and ii) why the second group of haplotypes present in West Tanzanian sables (C1a sub-haplogroup; Fig. 1) do not share its most recent common ancestor with southern haplogroups (S1-S2; Fig. 1). In fact, they are more closely related to sables currently found in Malawi (haplogroup C1b) and Angola (haplogroup C2; Fig. 1 and Fig. 2). Alternatively, we hypothesize that the presence of the Relic lineage in west Tanzanian sables is the result of a mitochondrial introgression event with a relic and extinct population. This relic population may have evolved isolated in the rift region for more than one million years before being swamped in the late Pleistocene by an expanding sable population carrying the C1 haplogroup. In other words, some of the sables presently inhabiting the Tanzanian plateau inherited their mitochondrial genome from a now extinct divergent population. We estimated that the genetic diversity exhibited by the relic lineage coalesce in a most recent common ancestor about 80,000 years ago (Table 2), thus providing an upper limit for the introgression event. The introgression of mitochondrial

FCUP 120 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) genomes from currently extinct lineages, or species, into the gene pool of extant lineages, or species, has been very well documented in mammals (Roca et al. 2005; Achilli et al. 2008; Alves et al. 2008; Hailer et al. 2012). Interestingly, a recent work documented the early stages of an introgressive hybridization case between the endangered Angolan giant sable and the sympatric roan antelope, thus evidencing the mechanism for mitochondrial transfer within Hippotragus antelopes (Vaz Pinto et al. 2016). Furthermore, results for the single population study using nuclear DNA in H. niger, and analyzing some of the same samples used in this work, are clearly consistent with a pattern of mutation-drift equilibrium in the west Tanzanian sable population (Vaz Pinto et al. 2015). The absence of a nuclear R lineage in the genome of those same individuals provides compelling evidence for a mitochondrial introgressive hybridization event in west Tanzanian sables.

Geomorphology and patterns of vicariance One of the most spectacular features of the African continent is the East African rift system (EARS), shaped by intense tectonic activity and volcanism that persisted throughout the Quaternary (Chorowicz 2005) and progressively modified the ecological environment for many species, creating physical barriers that resulted in population fragmentation and speciation (Trauth et al. 2007). Both the western branch of the EARS and the eastern arc mountains (EAM) are known to form major biogeographic barriers promoting divergence in vertebrates (e.g. Flagstad et al. 2001; Miller et al. 2011; Colangelo et al. 2013; Menegon et al. 2014). Much of the modern topography in the region was generated throughout the last two million years (Denys et al. 1986; Delvaux et al. 2012). The increase in tectonic activity may have contributed to the isolation of the R lineage in the Tanzanian plateau, estimated to have a TMRCA of 1.4 mya (Fig. 4A, Table 2).

FCUP 121 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 4 – Evolutionary history of sable antelope lineages across the species distribution range: A- Eastern (E), Central (C), Southern (S) and Relic (R) lineages; B- Split of Eastern and Southern lineages into haplogroups 1 and 2 (E1-E2, S1-S2); C- Split of the central lineages into haplogroups 1 and 2 (C1-C2), likely accompanied by secondary contact of southern and eastern haplogroup, and possible bridging of the C1 haplogroup across the EARS. D- Split of central and southern haplogroups into a and b (S1a-S1b, S2a-S2b and C1a-C1b).

The Eastern African biogeography is also shaped by the rain shadow effect that allows the presence of a persistent arid corridor along the western edge of the EAM (Coe & Skinner 1993; Grubb et al. 1999). The combined effect of contiguous lakes, mountain chains and an arid corridor must constitute a formidable barrier for certain mammals, particularly those, like sable, that are adapted to mesic savannas and woodlands but avoid arid habitats and open grasslands (Estes 2013). It is thus not surprising that the deepest split found in our work for niger-like lineages dating from 269,300 - 432,100

FCUP 122 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) years ago led to the diversification of the eastern versus southcentral lineages, reflecting a clear geographical signature, when both the EAM and the EARS along Lake Malawi seem to define the limit (Fig. 1 and Table 2; see also Fig.4A). Notably, the roan antelope, sable’s closest living relative, is widely distributed in Africa and sympatric with sable, yet it is conspicuously absent to the east of EAM and Lake Malawi (East 1999). More recently, the split around 94,800 years of the haplogroup C1 may have resulted from a temporary dispersal corridor that allowed sable to move across the rift likely between lakes Rukwa and Malawi, originating the sub-haplogroups currently present in west Tanzania (C1a) and Malawi (C1b) (Fig. 1, Fig. 3, and Table 1).

The Zambezi river system is the most important drainage feature in southern Africa, having been radically modified and disrupted by river capture events as result of recent tectonic activity. In particular the connection between the Upper and Mid-Zambezi has been broken and reestablished several times (Moore & Larkin 2001; Cotterill 2003c; Moore et al. 2009, 2012), and this has been associated with vicariance episodes. The most compelling evidence for river capture events is based on phylogeographic differences found in the fish faunas of the Upper and Mid-Zambezi (Goodier 2010; Goodier et al. 2011). Also, Pleistocene speciation in antelopes of the genus Kobus and Damaliscus appears to be tightly linked to key events in the recent evolution of the Zambezi River (Cotterill 2003a, 2003c, 2005). Notwithstanding, the precise timing and sequence of these key events awaits better resolution (Cotterill 2003c). In our work we found two pairs of southern sub-haplogroups clearly geographically separated on either side of the Zambezi River (S1a, S2a in the north versus S1b, S2b in the south; Fig.1). We estimated the splitting times to have occurred at 104,600 (75,400 – 135,500) and 75,400 (53,300 – 98,000) years ago for the S1 and S2 haplogroups respectively (Table 2; Fig. 4D). We think that this result reflects one single episode associated with the Zambezi River, and is consistent with the extensive overlap observed in the confidence intervals. Such pattern of vicariance provides sound biological evidence for a significant Zambezi event in splitting sable populations, which could possibly frame the most recent time when the river attained its current drainage profile.

Species ecosystem dynamics modelled by climate changes In sub-Saharan Africa marked oscillations of warm wet periods with cold dry periods allowed the repeated expansion and contraction of savanna habitats and tropical rainforests (Dupont 2011). During dry periods savanna habitats displaced tropical forests, while in moist periods the scenario reversed. The distribution of savanna-

FCUP 123 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) adapted species would have then shifted according to changes in vegetation (Arctander et al. 1999; Flagstad et al. 2001; Lorenzen et al. 2006a,b, 2007, 2008, 2010). The presence of savanna habitat refugia during moist periods would enable the persistence of savanna-adapted species, resulting in species divergence and strong genetic structure among populations (Lorenzen et al. 2012). This may however be an oversimplification, as on a finer scale the savanna biome includes for example edaphic grasslands, semi-arid savannas, mesic woodlands and deciduous forests (White 1983), which may respond differently to climatic changes. Two sable antelope lineages have split in eastern and southern Africa, estimated at around 111,600 – 201,400 years for haplogroups E1 and E2, and 113,600 – 189,500 years for haplogroups S1 and S2 (Table 2).This contemporaneous fragmentation in two geographically distant regions is best explained by a climatic event, and our dating coincides perfectly with the extreme period of dry cold climate defined by Marine Isotopic Stage (MIS) 6 (Maley 1996). We therefore propose that the separation of these two lineages occurred during a glacial period. Although it is usually assumed that dry cold climates will promote expanding ranges for savanna species, this fails to recognize the specific habitat requirements of different species. Sable in particular are specialists of miombo woodland, a type of mesic savanna associated with relatively high rainfall. We suggest that during the MIS 6 cold dry phase most of the eastern coastal plain became too dry for sable, which may have found refugia in moister woodland patches either at higher altitude along the EAM or closer to the Indian ocean. This would be in accordance to expansions of arid habitats in eastern Africa, and the persistence of moister refugia along the eastern coastline during glacial periods (Hamilton and Taylor 1991), and to recent expanding woodlands, as the rainfall increased since the last glacial maximum (Ivory et al. 2012). Similarly southern sables may have found distinct refugia within the Zambian plateau (Fig. 4B), consistent with the highest genetic diversity observed in this region (Table 1). Both the eastern and the southern haplogroups reconnected following range expansions when conditions improved (Fig. 4C). The decrease in genetic diversity in southern sables from north to south of the Zambezi river (Table 1), seems to support a southward range expansion, while a similar expansion is likely for eastern sables but cannot be supported by lack of samples (supplementary Table S5).

The central lineage (C) revealed a surprising link between sable present in Angola, Malawi and western Tanzania (Fig. 2) and the geographic origin and dynamics of these populations are puzzling. Angolan sables are separated from those found in western Tanzania and Malawi, by extensive lowland rainforests and the Congo and Zambezi drainage systems. Yet, none of them shares a recent ancestry with current Zambian

FCUP 124 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) sables, thus making unlikely a link through Zambia or southern Africa. We hypothesize that the C lineage, whose split resulted in the haplogroups C1 (west Tanzania and Malawi) and C2 (Angola), may have been centered on the Congo basin during the MIS 6, when the same dry cold conditions that contracted eastern woodlands may have greatly expanded central African mesic woodlands at the expense of Congo rainforests (Fig.4B). The subsequent warmer period that began at around 128 000 years led to the re-establishment of rainforests (Maley 1996), thus fragmenting the range occupied by the C lineage and forcing its split estimated at around 119,000 years (Table 2). Sables would then have disappeared from the Congo basin and found dispersal corridors that allowed them to colonize more suitable areas, with one lineage (C1) eventually reaching the western branch of the EARS, and the other (C2) being forced southwards into Angola (C2) (Fig.4C). The divergence found on the C1 lineage, was estimated to around 94,800 years (Table 2), when some sables carrying this haplogroup were able to move across the EARS into western Tanzania, while the remaining sable evolved in eastern Zambia and Malawi (Fig. 4D). A dispersal across the western branch of the EARS may have been facilitated by heightened climatic variability, which is reflected by pronounced reductions in the water volumes of the rift lakes (Scholz et al. 2007; Trauth et al. 2007). In contrast with the central sables that were able to expand their range on both sides of the EARS, Angolan sables are highly restricted in range and critically endangered. Species that are trapped in suboptimal habitats are likely to experience increased selection and subsequent genetic and morphological change, which is of particular concern in already-threatened small populations (Blois & Hadly 2009). When sables carrying haplogroup C2 reached northern Angola they might have become fragmented and isolated in small patches of sub-optimal habitat, with the current population being the last remnant of an older and richer genetic diversity.

General diversity patterns across Africa Despite range expansions and contractions, sable antelope populations exhibit diversity patterns compatible with a stable demographic history, supported by mismatch analysis, neutrality tests and high levels of genetic diversity (Table 1). This is also particularly evident in the structure of the median-joining network for the Southern haplogroups, with long separate branches and many unique haplotypes (Fig. 3). Overall, we observed a decrease in genetic diversity from the Southern to the Central and Eastern lineages, with Angolan and Eastern haplogroups exhibiting the lowest genetic diversity (Table 1). Interestingly, a similar pattern was observed for the eland and the wildebeest, both presenting higher genetic diversity and less pronounced geographic structure in

FCUP 125 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) southern compared to eastern populations (Arctander et al. 1999; Lorenzen et al. 2010). For the impala and the greater kudu it was also observed that nucleotide diversities decrease from south towards the east (Lorenzen et al. 1998, 2012). A similar pattern was also observed in non-ungulate species such as the mesic four-striped grass rat Rhabdomys dilectus, suggesting colonization from southern to eastern Africa (Castiglia et al. 2012). The fact that most of the genetic diversity and lack of among-population structuring found in these ungulate species lies in the southern lineages suggests a large, long-standing population in the region centered on the Zambezi drainage system. Patches of refugial populations are essentially found northwards, easterly and westerly, possibly representing periods of retraction and fragmentation that gave rise to differentiation in spatial and temporal refugia, and are therefore responsible for an increase in intraspecific diversity. This general pattern mirrors the well-studied and highly supported evolutionary histories of Boreal and Temperate species of Europe and North America, where southern refugia are mosaics of ancient and highly structured populations, while the north harbors large and less structured populations (Hewitt 2000, 2004). This similarity is further emphasized by the distribution of genetic diversity within Southern haplogroups S1 and S2, both exhibiting higher values north of the Zambezi river (S1a and S2a; Table 1). This observation mirrors the Northern hemisphere distribution of diversity, where diversity decreases towards the north (Hewitt 2000, 2004).

Perspectives for future work To the best of our knowledge this study provides the most comprehensive population analysis using fully sequenced mitochondrial genomes of a non-human species at a continental scale. By analyzing sequence divergence and diversity in sable antelope over the Pleistocene we were able to observe lineages that have survived the complex interplay between climate changes and Africa’s geomorphology. This allowed us to provide explanations for long-standing questions about the species evolutionary history. First, we were able to provide a convincing explanation for the origin of a strikingly divergent lineage from west Tanzanian sables. Secondly, we were able to explain the paraphyly and differentiation in southern African lineages, as the result of isolation, reconnection and later fragmentation by the Zambezi River, and by doing so, we refine dates for when the river may have last attained the current profile. Finally we were able to formulate a hypothesis elucidating the origin of the critically endangered Giant sable antelope of Angola. Our results enforce the principle that a sound understanding of African fauna evolution can only be achieved when both climatic and geological histories are considered. Although intraspecific patterns are ideal to assess the signs of the impact of climate and geomorphology in African ungulates, it is important to look beyond

FCUP 126 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) isolated or single-process responses. We expect this study to represent a milestone in understanding key events in southcentral and eastern Africa that could ultimately elucidate the evolutionary history of other species in these regions. Future large-scale comparative efforts may very much benefit from the insights here provided.

Supplementary material

Supplementary information incudes Text (S1-S7), Tables (S1-S6), and Figures (S1, S2), and are appended to the current document.

References

Achilli, A., Olivieri, A., Pellecchia, M., & Uboldi, C. (2008). Mitochondrial genomes of extinct aurochs survive in domestic cattle. Current Biology. 18(4): 157–158. Alves, P. C., Melo-Ferreira, J., Freitas, H., & Boursot, P. (2008). The ubiquitous mountain hare mitochondria: multiple introgressive hybridization in hares, genus Lepus. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 363(1505), 2831-2839. Ansell, W. F. H. (1972). Part 15: Order Artiodactyla. In: Meester J. A. J. & Setzer H. W. (eds). The Mammals of Africa: an identification manual, 1-93. Smithsonian Institution Press: Washington DC. Anthony, N. M., Johnson-Bawe, M., Jeffery, K., Clifford, S. L., Abernethy, K. A., Tutin, C. E., ... & Bruford, M. W. (2007). The role of Pleistocene refugia and rivers in shaping gorilla genetic diversity in central Africa. Proceedings of the National Academy of Sciences, 104(51), 20432-20436. Arctander, P., Johansen, C., & Coutellec-Vreto, M. A. (1999). Phylogeography of three closely related African bovids (tribe Alcelaphini). Molecular Biology and Evolution, 16(12), 1724-1739. Badgley, C. (2010). Tectonics, topography, and mammalian diversity. Ecography, 33(2), 220-231. Bibi, F. (2013). A multi-calibrated mitochondrial phylogeny of extant Bovidae (Artiodactyla, Ruminantia) and the importance of the fossil record to systematics. BMC Evolutionary Biology, 13(1), 166. Blois, J. L., & Hadly, E. A. (2009). Mammalian response to Cenozoic climatic change. Annual Review of Earth and Planetary Sciences, 37, 181-208. Bryant, D., & Moulton, V. (2004). Neighbor-net: an agglomerative method for the

FCUP 127 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

construction of phylogenetic networks. Molecular Biology and Evolution, 21(2), 255-265. Castiglia, R., Solano, E., Makundi, R. H., Hulselmans, J., Verheyen, E., & Colangelo, P. (2012). Rapid chromosomal evolution in the mesic four‐striped grass rat Rhabdomys dilectus (Rodentia, Muridae) revealed by mtDNA phylogeographic analysis. Journal of Zoological Systematics and Evolutionary Research, 50(2), 165-172. Chorowicz, J. (2005). The east African rift system. Journal of African Earth Sciences, 43(1), 379-410. Coe, M. J., & Skinner, J. D. (1993). Connections, disjunctions and endemism in the eastern and southern African mammal faunas. Transactions of the Royal Society of South Africa, 48(2), 233-255. Colangelo, P., Verheyen, E., Leirs, H., Tatard, C., Denys, C., Dobigny, G., ... & Lecompte, E. (2013). A mitochondrial phylogeographic scenario for the most widespread African rodent, Mastomys natalensis. Biological Journal of the Linnean Society, 108(4), 901-916. Cotterill, F. P. D. (2003a). A biogeographic review of tsessebe antelopes Damaliscus lunatus (Bovidae: Alcelaphini) in south-central Africa. Durban Museum Novitates, 28, 45-55. Cotterill, F. P. D. (2003b). Insights into the taxonomy of tsessebe antelopes Damaliscus lunatus (Bovidae: Alcelaphini) with the description of a new evolutionary species in south-central Africa. Durban Museum Novitates, 28(1), 11-30. Cotterill, F. P. D. (2003c). Geomorphological influences on vicariant evolution in some African mammals in the Zambezi Basin: some lessons for conservation. In Proceedings of the Ecology and Conservation of Mini-antelope: An International Symposium on Duiker and Dwarf Antelope in Africa. Filander Verlag, Fürth (pp. 11-58). Cotterill, F. P. D. (2005). The Upemba lechwe, Kobus anselli: an antelope new to science emphasizes the conservation importance of Katanga, Democratic Republic of Congo. Journal of Zoology, 265(2), 113-132. Dabney, J., & Meyer, M. (2012). Length and GC-biases during sequencing library amplification: a comparison of various polymerase-buffer systems with ancient and modern DNA sequencing libraries. Biotechniques, 52(2), 87-94. Dabney, J., Knapp, M., Glocke, I., Gansauge, M. T., Weihmann, A., Nickel, B., ... & Meyer, M. (2013). Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proceedings of the National Academy of Sciences, 110(39), 15758-

FCUP 128 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

15763. Darriba, Diego, et al. "jModelTest 2: more models, new heuristics and parallel computing." Nature Methods 9.8 (2012): 772-772. Delvaux, D., Kervyn, F., Macheyeki, A. S., & Temu, E. B. (2012). Geodynamic significance of the TRM segment in the East African Rift (W-Tanzania): active tectonics and paleostress in the Ufipa plateau and Rukwa basin. Journal of Structural Geology, 37, 161-180. Demenocal, P. B. (1995). Plio-Pleistocene African climate. Science (New York, NY), 270(5233), 53-59. deMenocal, P. B. (2004). African climate change and faunal evolution during the Pliocene–Pleistocene. Earth and Planetary Science Letters, 220(1-2), 3-24. Denys, C., Chorowicz, J., & Tiercelin, J. J. (1986). Tectonic and environmental control on rodent diversity in the Plio-Pleistocene sediments of the African Rift System. Geological Society, London, Special Publications, 25(1), 363-372. Doucouré, C. M., & de Wit, M. J. (2003). Old inherited origin for the present near-bimodal topography of Africa. Journal of African Earth Sciences, 36(4), 371-388. Drummond, A. J., & Rambaut, A. (2007). BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology, 7(1), 214. Duchêne, S., Archer, F. I., Vilstrup, J., Caballero, S., & Morin, P. A. (2011). Mitogenome phylogenetics: the impact of using single regions and partitioning schemes on topology, substitution rate and divergence time estimation. PLoS One, 6(11), e27138. Dupont, L. (2011). Orbital scale vegetation change in Africa. Quaternary Science Reviews, 30(25), 3589-3602. Du Toit, J. T., & Cumming, D. H. (1999). Functional significance of ungulate diversity in African savannas and the ecological implications of the spread of pastoralism. Biodiversity and Conservation, 8(12), 1643-1661.

East, R. (1999). IUCN/SSC Antelope Specialist Group. African antelope database 1998. 21: 434. Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32(5), 1792-1797. Estes, R. D. (2013). Hippotragus niger Sable Antelope. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 556-565. A&C Black. Excoffier, L., Laval, G., & Schneider, S. (2005). Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 1:47–50.

FCUP 129 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Faulkes, C. G., Mgode, G. F., Le Comber, S. C., & Bennett, N. C. (2010). Cladogenesis and endemism in Tanzanian mole‐rats, genus Fukomys: (Rodentia Bathyergidae): a role for tectonics? Biological Journal of the Linnean Society, 100(2), 337-352. Flagstad, Ø., Syversten, P. O., Stenseth, N. C., & Jakobsen, K. S. (2001). Environmental change and rates of evolution: the phylogeographic pattern within the hartebeest complex as related to climatic variation. Proceedings of the Royal Society of London B: Biological Sciences, 268(1468), 667-677.. Foote, A. D., Morin, P. A., Durban, J. W., Willerslev, E., Orlando, L., & Gilbert, M. T. P. (2011). Out of the Pacific and back again: insights into the matrilineal history of Pacific killer whale ecotypes. PLoS One, 6(9), e24980. Fu, Q., Meyer, M., Gao, X., Stenzel, U., Burbano, H. A., Kelso, J., & Pääbo, S. (2013). DNA analysis of an early modern human from Tianyuan Cave, China. Proceedings of the National Academy of Sciences, 110(6), 2223-2227. Fu, Y. X. (1997). Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147(2), 915-925. Goodier, S. A. M. (2010). Evolution of the African Tigerfish (Genus Hydrocynus). Phylogeographic insights into drainage evolution MSc Thesis, University of Cape Town, Rondebosch. Goodier, S. A., Cotterill, F. P., O'Ryan, C., Skelton, P. H., & de Wit, M. J. (2011). Cryptic diversity of African tigerfish (Genus Hydrocynus) reveals palaeogeographic signatures of linked Neogene geotectonic events. PloS one, 6(12), e28775. Goudie, A. S. (2005). The drainage of Africa since the Cretaceous. Geomorphology, 67(3), 437-456. Groves, C. P. (1983). A new subspecies of sable antelope, Hippotragus niger (Harris 1838). Revue de Zoologie Africaine, 97(4), 821-828.

Groves, C., & Grubb, P. (2011). Ungulate taxonomy. JHU Press.

Grubb, P., Sandrock, O., Kullmer, O., Kaiser, T. M., & Schrenk, F. (1999). Relationships between eastern and southern African mammal faunas. African Biogeography, Climate Change, and Human Evolution, 253-267. Hailer, F., Kutschera, V. E., Hallström, B. M., Klassert, D., Fain, S. R., Leonard, J. A., ... & Janke, A. (2012). Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage. Science, 336(6079), 344-347. Hamilton, A. A., & Taylor, D. (1991). History of climate and forests in tropical Africa during the last 8 million years. In Tropical forests and climate (pp. 65-78). Springer Netherlands.

FCUP 130 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Heller, R., Brüniche-Olsen, A., & Siegismund, H. R. (2012). Cape buffalo mitogenomics reveals a Holocene shift in the African human–megafauna dynamics. Molecular Ecology, 21(16), 3947-3959. Hewitt, G. (2000). The genetic legacy of the Quaternary ice ages. Nature, 405(6789), 907-913. Hewitt, G. M. (2004). Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 359(1442), 183-195. Huson, D. H., & Bryant, D. (2005). Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution, 23(2), 254-267. Ivory, S. J., Lézine, A. M., Vincens, A., & Cohen, A. S. (2012). Effect of aridity and rainfall seasonality on vegetation in the southern tropics of East Africa during the Pleistocene/Holocene transition. Quaternary Research, 77(1), 77-86. Jansen van Vuuren, B. J., Robinson, T. J., Vaz Pinto, P., Estes, R., & Matthee, C. A. (2010). Western Zambian sable: Are they a geographic extension of the giant sable antelope?. South African Journal of Wildlife Research, 40(1), 35-42. Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution, 30(4), 772-780. Kircher, M., Sawyer, S., & Meyer, M. (2011). Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic Acids Research, 40:e3. Li, H., & Durbin, R. (2009). Fast and accurate short read alignment with Burrows– Wheeler transform. Bioinformatics, 25(14), 1754-1760. Librado, P., & Rozas, J. (2009). DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25(11), 1451-1452. Liedigk, R., Yang, M., Jablonski, N. G., Momberg, F., Geissmann, T., Lwin, N., ... & Yongcheng, L. (2012). Evolutionary history of the odd-nosed monkeys and the phylogenetic position of the newly described Myanmar snub-nosed monkey Rhinopithecus strykeri. PLoS One, 7(5), e37418. Livingstone, D., & Kingdon, J. (2013). The evolution of a continent: Geography and geology. In Kingdon, J., Happold, D. C. D., Butynski, T. M., Hoffmann, M., Happold, M., Kalina, J., (eds). Mammals of Africa. 1:27-42 A&C Black. Lorenzen, E. D., Arctander, P., & Siegismund, H. R. (2006a). Regional genetic structuring and evolutionary history of the impala Aepyceros melampus. Journal of Heredity, 97(2), 119-132. Lorenzen, E. D., Arctander, P., & Siegismund, H. R. (2008). High variation and very low differentiation in wide ranging plains zebra (Equus quagga): insights from mtDNA

FCUP 131 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

and microsatellites. Molecular Ecology, 17(12), 2812-2824. Lorenzen, E. D., Heller, R., & Siegismund, H. R. (2012). Comparative phylogeography of African savanna ungulates. Molecular Ecology, 21(15), 3656-3670. Lorenzen, E. D., Masembe, C., Arctander, P., & Siegismund, H. R. (2010). A long‐ standing Pleistocene refugium in southern Africa and a mosaic of refugia in East Africa: insights from mtDNA and the common eland antelope. Journal of Biogeography, 37(3), 571-581. Lorenzen, E. D., De Neergaard, R., Arctander, P., & Siegismund, H. R. (2007). Phylogeography, hybridization and Pleistocene refugia of the kob antelope (Kobus kob). Molecular Ecology, 16(15), 3241-3252. Lorenzen, E. D., Simonsen, B. T., Kat, P. W., Arctander, P., & Siegismund, H. R. (2006b). Hybridization between subspecies of waterbuck (Kobus ellipsiprymnus) in zones of overlap with limited introgression. Molecular Ecology, 15(12), 3787-3799. Maley, J. (1996). The African rain forest–main characteristics of changes in vegetation and climate from the Upper Cretaceous to the Quaternary. Proceedings of the Royal Society of Edinburgh. Section B. Biological Sciences, 104, 31-73. Matthee, C. A., & Robinson, T. J. (1999). Mitochondrial DNA population structure of roan and sable antelope: implications for the translocation and conservation of the species. Molecular Ecology, 8(2), 227-238. Mayaux, P., Bartholomé, E., Fritz, S., & Belward, A. (2004). A new land‐cover map of Africa for the year 2000. Journal of Biogeography, 31(6), 861-877. Menegon, M., Loader, S. P., Marsden, S. J., Branch, W. R., Davenport, T. R. B., & Ursenbacher, S. (2014). The genus Atheris (Serpentes: Viperidae) in East Africa: Phylogeny and the role of rifting and climate in shaping the current pattern of species diversity. Molecular Phylogenetics and Evolution, 79, 12-22. Meyer, M., & Kircher, M. (2010). Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harbor Protocols, 2010(6), pdb-prot5448. Miller, J. M., Hallager, S., Monfort, S. L., Newby, J., Bishop, K., Tidmus, S. A., ... & Fleischer, R. C. (2011). Phylogeographic analysis of nuclear and mtDNA supports subspecies designations in the ostrich (Struthio camelus). Conservation Genetics, 12(2), 423-431. Mitchell, M. W., Locatelli, S., Clee, P. R. S., Thomassen, H. A., & Gonder, M. K. (2015). Environmental variation and rivers govern the structure of chimpanzee genetic diversity in a biodiversity hotspot. BMC Evolutionary Biology, 15(1), 1. Moore, A. E., Blenkinsop, T., & Cotterill, F. P. D. (2012). Dynamic evolution of the Zambezi-Limpopo watershed, central Zimbabwe. South African Journal of

FCUP 132 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Geology, 115(4), 551-560. Moore, A., Blenkinsop, T., & Cotterill, F. W. (2009). Southern African topography and erosion history: plumes or plate tectonics? Terra Nova, 21(4), 310-315. Moore, A. E., & Larkin, P. A. (2001). Drainage evolution in south-central Africa since the breakup of Gondwana. South African Journal of Geology, 104(1), 47-68. Moore, A. E., Cotterill, F. P., Main, M. P., & Williams, H. B. (2008). The Zambezi River. Large rivers: geomorphology and management, Chichester, UK. John Wiley & Sons, Ltd, p. 311-332. Morin, P. A., Archer, F. I., Foote, A. D., Vilstrup, J., Allen, E. E., Wade, P., ... & Bouffard, P. (2010). Complete mitochondrial genome phylogeographic analysis of killer whales (Orcinus orca) indicates multiple species. Genome research, 20(7), 908- 916. Nicolas, V., Missoup, A. D., Denys, C., Kerbis Peterhans, J., Katuala, P., Couloux, A., & Colyn, M. (2011). The roles of rivers and Pleistocene refugia in shaping genetic diversity in Praomys misonnei in tropical Africa. Journal of Biogeography, 38(1), 191-207. Pakendorf, B., & Stoneking, M. (2005). Mitochondrial DNA and human evolution. Annu. Rev. Genomics Hum. Genet., 6, 165-183. Pitra, C., Hansen, A. J., Lieckfeldt, D., & Arctander, P. (2002). An exceptional case of historical outbreeding in African sable antelope populations. Molecular Ecology, 11(7), 1197-1208.

Pitra, C., Vaz Pinto, P., O’Keeffe, B. W., Willows-Munro, S., van Vuuren, B. J., & Robinson, T. J. (2006). DNA-led rediscovery of the giant sable antelope in Angola. European Journal of Wildlife Research, 52(3), 145-152. Renaud, G., Slon, V., Duggan, A. T., & Kelso, J. (2015). Schmutzi: estimation of contamination and endogenous mitochondrial consensus calling for ancient DNA. Genome biology, 16(1), 224. Roca, A. L., Georgiadis, N., & O'Brien, S. J. (2005). Cytonuclear genomic dissociation in African elephant species. Nature Genetics, 37(1), 96-100.

Rokas, A., & Carroll, S. B. (2005). More genes or more taxa? The relative contribution of gene number and taxon number to phylogenetic accuracy. Molecular Biology and Evolution, 22(5), 1337-1344. Schliep, K. P. (2011). phangorn: phylogenetic analysis in R. Bioinformatics, 27(4), 592- 593. Scholz, C. A., Johnson, T. C., Cohen, A. S., King, J. W., Peck, J. A., Overpeck, J. T., ... & Lyons, R. P. (2007). East African megadroughts between 135 and 75 thousand

FCUP 133 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

years ago and bearing on early-modern human origins. Proceedings of the National Academy of Sciences, 104(42), 16416-16421. Shamblin, B. M., Bjorndal, K. A., Bolten, A. B., Hillis-Starr, Z. M., Lundgren, I., Naro‐ Maciel, E., & Nairn, C. J. (2012). Mitogenomic sequences better resolve stock structure of southern Greater Caribbean green turtle rookeries. Molecular Ecology, 21(10), 2330-2340. Skinner, J. D., & Chimimba, C. T. (2005). The mammals of the southern African sub- region. Cambridge University Press. Slatkin, M. (1996). A correction to the exact test based on the Ewens sampling distribution. Genetical Research, 68(03), 259-260. Stankiewicz, J., & de Wit, M. J. (2006). A proposed drainage evolution model for Central Africa—Did the Congo flow east? Journal of African Earth Sciences, 44(1), 75- 84. Stiller, M., Knapp, M., Stenzel, U., Hofreiter, M., & Meyer, M. (2009). Direct multiplex sequencing (DMPS)—a novel method for targeted high-throughput sequencing of ancient and highly degraded DNA. Genome Research, 19(10), 1843-1848. Tajima, F. (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123(3), 585-595. Taylor, P. J., Maree, S., Van Sandwyk, J., Peterhans, K., Julian, C., Stanley, W. T., ... & Bennett, N. C. (2009). Speciation mirrors geomorphology and palaeoclimatic history in African laminate‐toothed rats (Muridae: Otomyini) of the Otomys denti and Otomys lacustris species‐complexes in the ‘Montane Circle’of East Africa. Biological Journal of the Linnean Society, 96(4), 913-941. Trauth, M. H., Larrasoaña, J. C., & Mudelsee, M. (2009). Trends, rhythms and events in Plio-Pleistocene African climate. Quaternary Science Reviews, 28(5), 399-411. Trauth, M. H., Maslin, M. A., Deino, A. L., Junginger, A., Lesoloyia, M., Odada, E. O., ... & Tiedemann, R. (2010). Human evolution in a variable environment: the amplifier lakes of Eastern Africa. Quaternary Science Reviews, 29(23), 2981-2988. Trauth, M. H., Maslin, M. A., Deino, A. L., Strecker, M. R., Bergner, A. G., & Dühnforth, M. (2007). High-and low-latitude forcing of Plio-Pleistocene East African climate and human evolution. Journal of Human Evolution, 53(5), 475-486. Vaz Pinto, P., Beja, P., Ferrand, N., & Godinho, R. (2016). Hybridization following population collapse in a critically endangered antelope. Scientific Reports, 6, 18788. Vrba, E. S. (1995). The fossil record of African antelopes (Mammalia, Bovidae) in relation to human evolution and paleoclimate. In Vrba, E. S., Denton G. H., Partridge T. C., & Buckle L. H. (eds). Paleoclimate and evolution with emphasis on human

FCUP 134 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

origins, Ch 27, 385-424. Yale University Press, New Haven. Watterson, G. A. (1978). The homozygosity test of neutrality. Genetics, 88(2), 405-417. White, F. (1983). The vegetation of Africa: a descriptive memoir to accompany the UNESCO/AETFAT/UNSO Vegetation Map of Africa. Paris, 356pp. Zinner, D., Wertheimer, J., Liedigk, R., Groeneveld, L. F., & Roos, C. (2013). Baboon phylogeny as inferred from complete mitochondrial genomes. American Journal of Physical Anthropology, 150(1), 133-140.

FCUP 135 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Supplementary Information SI Text S1. Library amplification. DNA double stranded libraries were amplified using the AccuPrime Pfx Polymerase (Invitrogen) with the following reaction set up: 1x AccuPrime Pfx buffer, 1 uM P5 indexing primer, 1uM of P7 indexing Primer (primers synthesized by Sigma-Aldrich, RPC-purified, dissolved in TE – 10 mM Tris-HCL, 1mM EDTA, pH 8.0 - at 100uM and diluted 10-fold in water), and 1.25 units AccuPrime Pfx polymerase (Life Technologies). The thermocylcing conditions were the following: 2 min at 95ºC, 20 cycles of 20 sec at 95ºC, 30s at 60ºC, and 1 min at 68ºC, with a final extension of 5 min at 68ºC. Reactions were purified using MinElute PCR purification kit (Qiagen) and eluted in 15uL TE buffer.

S2. Bait Production. Four overlapping long-range PCR products were produced with the following primer pairs: Hn1377F (CTATGTGGCAAAATAGTGAG) and Hn6895R (TATGGTGTTGGCTTG AAACC), Hn6538F (ATAACATGAGCCAAAATCC) and Hn12024R (TATGATGGATCATGTGACG), Hn10583F (AACGTCTAAACGCCGGTCT) and Hn14756R (CCTGTGGGGTTGTTGGAG), Hn14637F (TGAGGGGGATTCTCCGTA) and Hn3305R (TGCTCGGTTTGTTTCTGC). These primers allowed the amplification of four long range PCR fragments of 5537 bp, 5504 bp, 4191 bp and 5193 bp, respectively. PCR cyclic conditions were different for each pair of primers. The thermal cycler program for primer pair Hn1377F-Hn6895R consisted in an initial denaturation step of 2 min at 92°C, followed by a touchdown program with 9 cycles of a denaturation step at 92°C for 10s, annealing at 60°C for 20s, decreasing 0.5°C in each cycle, and extension at 68°C for 6min, followed by 21 cycles of 92°C for 10s, 56°C for 20s and 68ºC for 6min. The same cycling conditions were applied to the primer pair Hn6538F-Hn12024R, but using a total number of 37 cycles instead (9+28). PCR conditions for primer pair Hn10583F-Hn14756R consisted in an initial denaturation step of 2min at 92°C, followed by 9 cycles of a denaturation step at 92°C for 10s, annealing at 66°C for 20s, and extension at 68°C for 6min, followed by 21 cycles of 92°C for 10s, 62ºC for 20s and 68ºC for 6min. PCR conditions for primer pair Hn14637F-Hn3305R consisted in an initial denaturation step of 2min at 92°C, followed by 9 cycles of a denaturation step at 92°C for 10s, annealing at 63°C for 20s, and extension at 68°C for 6min, followed by 21 cycles of 92°C for 10s, 59ºC for 20s and 68ºC for 6min. The final extension was at 68°C for 6 min for all primers. The PCR fragments were purified using carboxyl-coated magnetic beads, NanoDrop quantified (NanoDrop ND-1000, Thermo Scientific) and pooled in equimolar amounts to a total of 3 ug for modern samples, and

FCUP 136 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) to a total of 100 ug for historical samples. The pooled products were sheared in M220 Focused-ultrasonicator (Covaris) to produce fragments around 350 base-pairs in size. The products were ligated with Bio-T/B adapters, purified with the Qiaquick PCR purification Kit (Qiagen), NanoDrop quantified, made single stranded and immobilized on streptavidin-coated magnetic beads, exactly as described in Maricic et al. (2010).

S3. mtDNA capture and Sequencing. Bait and library pool preparation for capture were performed differently than Fu et al. (2013). Briefly, 800 uL (the equivalent of 20 uL per capture reaction) of Dynabeads MyOneC1 (Life Technologies) were pelleted in a magnet rack, and washed twice in 1000 uL of BWT buffer (1M NaCl, 10mM Tris-HCL, 1mM EDTA, pH 8.0, 0.05 % Tween-20). Then the beads were resuspended in 800 uL of BWT (the correspondent volume required for each capture reaction), and 47 uL of bait were added to the tube containing the beads (volume of bait necessary to obtain 500 ng of bait per capture reaction). The tube containing the beads/bait mixture was rotated for 15 minutes at room temperature. The beads were pelleted in a magnetic rack and washed with 1 mL TT buffer (1mM Tris-HCl pH 8.0, 0.01 % Tween-20). Then the beads were twice resuspended in 1 mL of melt solution (prepared fresh: 125 mM NaOH, 0.01% Tween-20), rotated for 5 min at room temperature and pelleted again using a magnetic rack. Finally, the beads were washed with 1mL TT buffer, resuspended in 800 uL of BWT buffer (volume correspondent to 20 uL times the number of capture reactions), dispensed in aliquots of 20 uL to wells of a 96-well semi-skirted PCR plate (ABI) and stored in the fridge. For each capture/hybridization reaction a sample library pool was created by combining 3.42 uL of sample library (~2 ug), 14.58 uL of nuclease-free water, 0.5 uL 500 uM BO4 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-Phosphate), 0.5 uL 500 uM BO6 (CAAGCAGAAGACGGCATACGAGAT-Phosphate), 0.5 uL 500 uM BO8 (GTGTAGATCTCGGTGGTCGCCGTATCATT-Phosphate), 0.5 uL 500 uM BO10 (AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-Phosphate), 5 uL of Agilent blocking agent and 25 uL of 2x HI-RPM hybridization buffer (Agilent). The sample library pool was incubated for 3 min at 95 ºC and held at 37ºC for 5 min. Meanwhile, the beads were pelleted on a magnetic rack, discarding the supernatant. Then, the entire library pool was added to the beads and incubated for 2 days at 65 ºC in a hybridization oven, with a rotation of 12 rpm. Post hybridization washes and elution (equivalent to the third day of capture) were performed exactly as described in Fu et al. (2013). In order to check the successful retrieval of library molecules, 1 uL of each capture eluate was quantified by qPCR. The remaining eluate (29 uL) was then amplified as described by Fu et al. (2013) but using the primers IS5 (10uM) and IS6 (10uM) instead of the genomic primers R1 and multiplex R2, and using 30 cycles instead of the 29 cycles described in the paper

FCUP 137 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) for the thermal cycling conditions. Amplified libraries were purified exactly as described in Fu et al. (2013). The amplified capture eluates were eluted in 20 uL EB (10 mM Tris- HCl, pH 8) and their concentrations measured by NanoDrop. After the capture round, libraries were prepared for sequencing also as described by Fu et al. (2013). No second round of capture was required.

S4. mtDNA Sequence processing, mapping and removal of duplicates. Raw sequences were demultiplexed separated by sample using their index read. Adapter trimming and merging of overlapping sequence stretches were processed using leehom (Renaud et al. 2014), with the “–ancientDNA” option for historic samples. Unmerged reads were discarded from downstream analyses. For paired-end reads merged into a single sequence, only those with length greater than 35bp were retained. All reads were mapped using a customized version (see https://github.com/udo-stenzel/network-aware- bwa) of the BWA v.0.5.10 mapper (Li and Durbin 2009). The reads of modern samples were mapped with the seeding turned off, allowing a 0.00001 missing probability and 2 gap opening events (options "-n 0.00001 -o 2 -l 16500"). The reads of historic samples were also mapped with the same parameters but with a 0.01 missing probability instead as reads were shorter and the probability of incorrectly mapping molecules was higher. As BWA does not recognize that the mitochondrion is a circular molecule, the first 1200 base pairs of the reference genome were copied to the end of the sequence to obtain an even coverage across the mitochondrial genome. Reads landing within the junction where then split in two and reads falling entirely within the last copied segment were repositioned within the first 1200 bp. Putative PCR duplicates were removed and a consensus was called for each set of duplicated reads. Both aforementioned tasks were performed using in-house scripts (bam-rewrap and bam-rmdup respectively from https://github.com/udo-stenzel/biohazard).

S5. Consensus Calling. Given the alignment to the mitochondrial reference, a consensus call was required for downstream analyses. To minimize the contribution of deaminated bases in historic samples, the probability of certain nucleotide substitutions at a given position in the sequence was incorporated. The frequency of nucleotide substitution at given positions in the sequence was computed. This frequency was turned into a position specific substitution matrix which in turn, was used as input for the mitochondrial consensus caller. As residual deamination enriches for transitions rather than transversions, the ratio of transitions over total mutations was plotted for both historic and modern samples (Fig. S2). No significant enrichment for historic samples was evidenced by these plots. A threshold on the base error probability of 3.16e-13

FCUP 138 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

(approximately 125 on the PHRED scale) was used to mask low quality or low coverage bases. Such a confidence threshold is usually achieved after having at least 3 high- quality reads supporting a position. The resulting consensus was used in downstream analyses.

S6. Data analysis. Individuals with masked bases (N) or poor quality were removed from downstream analyses using the following elimination criteria: 1) individuals with masked bases in more than 25% of the complete mitochondrial genome length were removed; 2) individuals with masked bases at polymorphic sites were removed, if did not compromise the representativeness of the species geographic distribution. The alignment with most parsimonious and higher log likelihood scored trees was the one generated by MUSCLE v3.8.31 (Edgar 2004). Such alignment was used in all subsequent analysis. From a total of 266 full-length mitochondrial genomes, including 262 H. niger sequences (231 modern and 31 historic) and 4 sequences of H. equinus (2 modern and 2 historic), 53 were eliminated according to the previously described criteria for individuals with masked bases (N). These 53 sequences included 50 H. niger sequences (43 modern and 7 historic) and 3 H. equinus sequences (1 modern and 2 historic). Since the outgroup species was reduced to only one individual, the H. equinus complete mitochondrial genome, downloaded from Genbank (NC_020712.1), was added to our dataset. In the end, our final dataset to be analyzed included 212 H. niger sequences (corresponding to 191 modern and 24 historic samples) and 2 H. equinus sequences (one from our original dataset and the reference genome downloaded from Genbank).

S7. Molecular Dating. For phase I analysis we created a dataset of almost complete mitochondrial genomes (excluding the control region), from a representative set of sequences belonging to the different H. niger haplogroups (37 sequences, including the Hippotragus niger reference genome JN632648.1) and H. equinus generated in this study, and 9 sequences imported from the Bovidae dataset published by Bibi (2013), belonging the following species: Damaliscus pygarus, Alcephalus busephalus lichtensteinii, Connochaetes gnou, Addax nasomasculatus, Oryx beisa, Oryx gazella, Oryx leucocoryx, Oryx dammah and Hippotragus equinus (sequences available on the TreeBase repository: http://treebase.org/treebase- web/search/study/summary.html?id=14132). This dataset was analyzed as a single partition, using the GTR+G substitution model, as determined by Akaike’s information criterion (AIC) in JMODELTEST, uncorrelated relaxed log-normal molecular clock with a Yule speciation process, as several distinct species were being considered. For the

FCUP 139 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) second phase of analysis we used the GTR+G+I substitution model, as determined by Akaike’s information criterion (AIC) in JMODELTEST, but with a strict molecular clock and a coalescent tree prior. We used a strict molecular clock as preliminary analyses suggested it fits the data better than relaxed clock models (we run our dataset with both relaxed and strict molecular clock models, using either coalescent tree prior and Yule process speciation for each clock model, and found little difference between models after using the model comparison tools provided in Tracer v.1.5.0. and Tracer v.1.6.0., as suggested by Drummond and Rambaut, 2007). We used 100 million total MCMC steps, with samples taken every 1000 steps in both steps. Acceptable mixing and convergence to the stationary distribution were checked with Tracer v.1.6.0. Effective sample sizes were all above 1000 in all clades for the two sequential analyses. After inspection with Tracer, we discarded appropriate number of steps as burn-in (20%), and combined the resulting tree samples for subsequent estimation of posteriors. Finally, maximum clade credibility (MCC) trees were estimated for each phase of analysis, using median-heights and a posterior probability limit of 0.5, with TreeAnnotator v.1.8.0.

References

Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32:1792–7.

Fu Q, Meyer M, Gao X, Stenzel U, Burbano H a, Kelso J, Pääbo S. 2013. DNA analysis of an early modern human from Tianyuan Cave, China. Proc. Natl. Acad. Sci. U. S. A. 110:2223–7.

Li H, Durbin R. 2009. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25:1754–60.

Renaud G, Stenzel U, Kelso J. 2014 Aug 6. leeHom: adaptor trimming and merging for Illumina sequencing reads. Nucleic Acids Res.:1–7.

FCUP 140 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S1. Sample information: list of all modern samples with respective country and population of origin, subspecies according to the classification proposed by Ansell (1972), sex, material and downer.

Sample ID Country Local Population Subspecies Sex Material Sent by: PA10 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto PA11 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto PA12 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto PA14 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto PA16 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto PA17 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto PA18 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto PA19 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto PA20 Angola Cangandala Hippotragus niger variani F Tissue Pedro Vaz Pinto HN145 Angola Cangandala Hippotragus niger variani - Hair Pedro Vaz Pinto PA02 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto PA03 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto PA04 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto PA05 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto PA06 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto PA07 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto PA08 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto PA09 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto PA13 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto HN143 Angola Luando Hippotragus niger variani - Hair Pedro Vaz Pinto HN144 Angola Luando Hippotragus niger variani - Hair Pedro Vaz Pinto HN146 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN147 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN148 Angola Luando Hippotragus equinus F Tissue Pedro Vaz Pinto HN151 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN152 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN153 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto HN154 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto FCUP 141 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sample ID Country Local Population Subspecies Sex Material Sent by: HN158 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto HN159 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN160 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN163 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN164 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN166 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN167 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto HN168 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN169 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN170 Angola Luando Hippotragus niger variani F Tissue Pedro Vaz Pinto HN171 Angola Luando Hippotragus niger variani M Tissue Pedro Vaz Pinto HN323 Kenya Shimba Hills Hippotragus niger roosevelti F Tissue Hans Siegismund HN325 Kenya Shimba Hills Hippotragus niger roosevelti M Tissue Hans Siegismund HN320 Kenya Shimba Hills Hippotragus niger roosevelti M Tissue Hans Siegismund HN268 Kenya Shimba Hills Hippotragus niger roosevelti F Tissue Hans Siegismund HN269 Kenya Shimba Hills Hippotragus niger roosevelti F Tissue Hans Siegismund HN270 Kenya Shimba Hills Hippotragus niger roosevelti F Tissue Hans Siegismund HN276 Kenya Shimba Hills Hippotragus niger roosevelti F Tissue Hans Siegismund HN347 Mozambique Niassa Hippotragus niger roosevelti - Skin Marco Silva HN348 Mozambique Niassa Hippotragus niger roosevelti - Skin Marco Silva HN349 Mozambique Niassa Hippotragus niger roosevelti - Skin Marco Silva HN83 Malawi Liwonde National Park Hippotragus niger kirkii F Blood Andre Uys HN84 Malawi Liwonde National Park Hippotragus niger kirkii F Blood Andre Uys HN85 Malawi Liwonde National Park Hippotragus niger kirkii F Blood Andre Uys HN86 Malawi Liwonde National Park Hippotragus niger kirkii F Blood Andre Uys G018 Zambia Masebe, Mkushi Hippotragus niger kirkii M Tissue Bettine van Vuuren G075 Zambia Masebe, Mkushi Hippotragus niger kirkii M Tissue Bettine van Vuuren G076 Zambia Masebe, Mkushi Hippotragus niger kirkii M Tissue Bettine van Vuuren G077 Zambia Masebe-Mkushi Hippotragus niger kirkii M Tissue Bettine van Vuuren G079 Zambia Masebe-Mkushi Hippotragus niger kirkii M Tissue Bettine van Vuuren G124 Zambia Masebe-Mkushi Hippotragus niger kirkii F Tissue Bettine van Vuuren

FCUP 142 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sample ID Country Local Population Subspecies Sex Material Sent by: G138 Zambia Masebe-Mkushi Hippotragus niger kirkii M Tissue Bettine van Vuuren G180 Zambia Masebe-Mkushi Hippotragus niger kirkii F Tissue Bettine van Vuuren G182 Zambia Masebe-Mkushi Hippotragus niger kirkii F Tissue Bettine van Vuuren G230 Zambia Masebe-Mkushi Hippotragus niger kirkii M Tissue Bettine van Vuuren G241 Zambia Masebe-Mkushi Hippotragus niger kirkii F Tissue Bettine van Vuuren G244 Zambia Masebe-Mkushi Hippotragus niger kirkii F Tissue Bettine van Vuuren G030 Zambia Mufumbwe Hippotragus niger kirkii F Tissue Bettine van Vuuren G064 Zambia Mufumbwe Hippotragus niger kirkii M Tissue Bettine van Vuuren G065 Zambia Mufumbwe Hippotragus niger kirkii M Tissue Bettine van Vuuren G067 Zambia Mufumbwe Hippotragus niger kirkii M Tissue Bettine van Vuuren G273 Zambia Mufumbwe Hippotragus niger kirkii F Tissue Bettine van Vuuren G196 Zambia Mulobezi Hippotragus niger kirkii F Tissue Bettine van Vuuren G203 Zambia Mulobezi Hippotragus niger kirkii F Tissue Bettine van Vuuren G208 Zambia Mulobezi Hippotragus niger kirkii F Tissue Bettine van Vuuren G211 Zambia Mulobezi Hippotragus niger kirkii F Tissue Bettine van Vuuren G236 Zambia Mulobezi Hippotragus niger kirkii M Tissue Bettine van Vuuren HN208 Zambia Lusaka-Kafue Hippotragus niger kirkii F Tissue Hans Siegismund HN213 Zambia Lusaka-Kafue Hippotragus niger kirkii F Tissue Hans Siegismund HN215 Zambia Lusaka-Kafue Hippotragus niger kirkii F Tissue Hans Siegismund HN216 Zambia Lusaka-Kafue Hippotragus niger kirkii M Tissue Hans Siegismund HN217 Zambia Lusaka-Kafue Hippotragus niger kirkii F Tissue Hans Siegismund HN312 Zambia Mulobezi Hippotragus niger kirkii M Tissue Hans Siegismund HN313 Zambia Mulobezi Hippotragus niger kirkii M Tissue Hans Siegismund HN273 Zambia Mulobezi Hippotragus niger kirkii M Tissue Hans Siegismund HN282 Zambia Lusaka-Kafue Hippotragus niger kirkii F Tissue Hans Siegismund HN283 Zambia Lusaka-Kafue Hippotragus niger kirkii F Tissue Hans Siegismund HN286 Zambia Lusaka-Kafue Hippotragus niger kirkii F Tissue Hans Siegismund HN290 Zambia Lusaka-Kafue Hippotragus niger kirkii M Tissue Hans Siegismund HN291 Zambia Lusaka-Kafue Hippotragus niger kirkii F Tissue Hans Siegismund V04 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V05 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren

FCUP 143 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sample ID Country Local Population Subspecies Sex Material Sent by: V06 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V07 Zambia Kafue National Park Hippotragus niger kirkii M Tissue Bettine van Vuuren V08 Zambia Kafue National Park Hippotragus niger kirkii M Tissue Bettine van Vuuren V09 Zambia Kafue National Park Hippotragus niger kirkii M Tissue Bettine van Vuuren V10 Zambia Kafue National Park Hippotragus niger kirkii M Tissue Bettine van Vuuren V12 Zambia Kafue National Park Hippotragus niger kirkii M Tissue Bettine van Vuuren V13 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V14 Zambia Kafue National Park Hippotragus niger kirkii M Tissue Bettine van Vuuren V15 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V16 Zambia Kafue National Park Hippotragus niger kirkii M Tissue Bettine van Vuuren V17 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V18 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V19 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V20 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V30 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren V31 Zambia Kafue National Park Hippotragus niger kirkii F Tissue Bettine van Vuuren HN44 Tanzania Wembere Hippotragus niger kirkii M Tissue Hans Siegismund HN45 Tanzania Wembere Hippotragus niger kirkii M Tissue Hans Siegismund HN77 Tanzania Wembere Hippotragus niger kirkii M Tissue Hans Siegismund HN263 Tanzania Wembere Hippotragus niger kirkii M Tissue Hans Siegismund HN264 Tanzania Wembere Hippotragus niger kirkii M Tissue Hans Siegismund HN304 Tanzania Mlele Hippotragus niger kirkii M Tissue Hans Siegismund HN37 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN51 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN52 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN53 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN54 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN55 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN56 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN57 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN74 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund

FCUP 144 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sample ID Country Local Population Subspecies Sex Material Sent by: HN75 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN81 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN329 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN331 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN334 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN335 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN327 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN328 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN199 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN200 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN306 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN302 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN303 Tanzania Kigosi Hippotragus niger kirkii M Tissue Hans Siegismund HN38 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN39 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN40 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN48 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN49 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN72 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN73 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN78 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN79 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN190 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund HN319 Tanzania Kizigo Hippotragus niger kirkii M Tissue Hans Siegismund HN265 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund HN277 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund HN279 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund HN295 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund HN296 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund HN297 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund HN298 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund

FCUP 145 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sample ID Country Local Population Subspecies Sex Material Sent by: HN299 Tanzania Rungwa Hippotragus niger kirkii M Tissue Hans Siegismund HN32 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN33 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN58 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN62 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN64 Tanzania Ugalla Hippotragus niger kirkii F Tissue Hans Siegismund HN65 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN66 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN67 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN70 Tanzania Ugalla Hippotragus niger kirkii - Tissue Hans Siegismund HN80 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN82 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN330 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN332 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN184 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN185 Tanzania Niensi Hippotragus niger kirkii M Tissue Hans Siegismund HN186 Tanzania Niensi Hippotragus niger kirkii M Tissue Hans Siegismund HN187 Tanzania Niensi Hippotragus niger kirkii M Tissue Hans Siegismund HN188 Tanzania Niensi Hippotragus niger kirkii M Tissue Hans Siegismund HN189 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN201 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN318 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN275 Tanzania Niensi Hippotragus niger kirkii M Tissue Hans Siegismund HN278 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN292 Tanzania Niensi Hippotragus niger kirkii M Tissue Hans Siegismund HN305 Tanzania Ugalla Hippotragus niger kirkii M Tissue Hans Siegismund HN202 Botswana Chobe Hippotragus niger niger M Tissue Hans Siegismund HN257 Botswana Chobe Hippotragus niger niger M Tissue Hans Siegismund HN258 Botswana Chobe Hippotragus niger niger M Tissue Hans Siegismund HN259 Botswana Chobe Hippotragus niger niger M Tissue Hans Siegismund HN260 Botswana Chobe Hippotragus niger niger M Tissue Hans Siegismund

FCUP 146 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sample ID Country Local Population Subspecies Sex Material Sent by: HN284 Botswana Chobe Hippotragus niger niger M Tissue Hans Siegismund HN17 Namibia Mahango Hippotragus niger niger - Tissue Mark Jago HN18 Namibia Mahango Hippotragus niger niger F Tissue Mark Jago HN222 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN223 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN224 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN225 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN226 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN227 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN228 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN229 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN230 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN231 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN248 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN249 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN250 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN251 Namibia Mahango Hippotragus niger niger F Tissue Hans Siegismund HN252 Namibia Mahango Hippotragus niger niger M Tissue Hans Siegismund HN253 Namibia Mahango Hippotragus niger niger M Tissue Hans Siegismund HN254 Namibia Mahango Hippotragus niger niger M Tissue Hans Siegismund SUN30 Namibia Mahango Hippotragus equinus F Tissue Bettine van Vuuren SUN652 Namibia Mahango Hippotragus niger niger M Tissue Bettine van Vuuren HN25 Zimbabwe Matetsi Hippotragus niger niger F Hair Bruce Fivaz HN26 Zimbabwe Matetsi Hippotragus niger niger F Hair Bruce Fivaz HN27 Zimbabwe Matetsi Hippotragus niger niger F Hair Bruce Fivaz HN28 Zimbabwe Matetsi Hippotragus niger niger F Hair Bruce Fivaz HN29 Zimbabwe Matetsi Hippotragus niger niger F Hair Bruce Fivaz HN30 Zimbabwe Matetsi Hippotragus niger niger F Hair Bruce Fivaz HN31 Zimbabwe Matetsi Hippotragus niger niger F Hair Bruce Fivaz HN31-2 Zimbabwe Matetsi Hippotragus niger niger F Hair Bruce Fivaz HN218 Zimbabwe Triangle Hippotragus niger niger M Tissue Hans Siegismund

FCUP 147 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sample ID Country Local Population Subspecies Sex Material Sent by: HN219 Zimbabwe Triangle Hippotragus niger niger M Tissue Hans Siegismund HN220 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN221 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN232 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN233 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN234 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN235 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN236 Zimbabwe Triangle Hippotragus niger niger M Tissue Hans Siegismund HN237 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN238 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN239 Zimbabwe Triangle Hippotragus niger niger M Tissue Hans Siegismund HN240 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN241 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN242 Zimbabwe Triangle Hippotragus niger niger M Tissue Hans Siegismund HN243 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN244 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN245 Zimbabwe Triangle Hippotragus niger niger F Tissue Hans Siegismund HN246 Zimbabwe Triangle Hippotragus niger niger M Tissue Hans Siegismund HN247 Zimbabwe Triangle Hippotragus niger niger M Tissue Hans Siegismund

FCUP 148 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S2. Sample information: list of all historic samples, with respective age, country and population of origin, museum where the sample was collected, or the donorr of the samples, type of sample material and subspecies according to the classification proposed by Ansell (1971). Sample Year Country Population Museum information Type Subspecies HnNI33 1992 Congo Katanga provided by Mike Buser Tooth Hippotragus niger kirkii HnNI131 1975-1985 Congo Katanga provided by Michael Hasson Tooth Hippotragus niger kirkii HnNI132 1975-1985 Congo Katanga provided by Michael Hasson Tooth Hippotragus niger kirkii HnNI133 1975-1985 Congo Katanga provided by Michael Hasson Skin Hippotragus niger kirkii HnNI145 1911 Zambia undetermined Peabody Museum of Natural History, Yale USA Bone Hippotragus niger kirkii HnNI146 1911 Zambia undetermined Peabody Museum of Natural History, Yale USA Bone Hippotragus niger kirkii HnNI149 undetermined Zambia undetermined Peabody Museum of Natural History, Yale USA Bone Hippotragus niger kirkii HnNI162 1900-1975 Mozambique Gorongosa NP Museum of Vila Viçosa, Portugal Skin Hippotragus niger niger HnNI163 1900-1975 Mozambique Gorongosa NP Museum of Vila Viçosa, Portugal Skin Hippotragus niger niger HnNI164 1900-1975 Mozambique Gorongosa NP Museum of Vila Viçosa, Portugal Skin Hippotragus equinus HnNI165 1900-1975 Mozambique Gorongosa NP Museum of Vila Viçosa, Portugal Skin Hippotragus equinus HnNI169 1955 Mozambique Gorongosa NP Museum of Vila Viçosa, Portugal Skull Hippotragus niger niger HnNI170 1955 Mozambique Gorongosa NP Museum of Vila Viçosa, Portugal Skull Hippotragus niger niger HnNI172 1913 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii HnNI173 1913 Kenya Shimba Hills Smithsonian Institution; Washington DC, USA Bone Hippotragus niger roosevelti HnNI174 1913 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii HnNI175 undetermined Mozambique Sofala-Manica Smithsonian Institution; Washington DC, USA Bone Hippotragus niger niger HnNI177 1913 Kenya Shimba Hills Smithsonian Institution; Washington DC, USA Bone Hippotragus niger roosevelti HnNI178 undetermined Mozambique Sofala-Manica Smithsonian Institution; Washington DC, USA Bone Hippotragus niger niger HnNI179 undetermined Mozambique Sofala-Manica Smithsonian Institution; Washington DC, USA Bone Hippotragus niger niger HnNI180 undetermined Mozambique Sofala-Manica Smithsonian Institution; Washington DC, USA Bone Hippotragus niger niger HnNI181 undetermined Kenya Shimba Hills Smithsonian Institution; Washington DC, USA Bone Hippotragus niger roosevelti HnNI182 undetermined Mozambique Sofala-Manica Smithsonian Institution; Washington DC, USA Bone Hippotragus niger niger HnNI183 1913 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii HnNI184 1914 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii HnNI185 undetermined Mozambique Sofala-Manica Smithsonian Institution; Washington DC, USA Bone Hippotragus niger niger HnNI186 1913 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii

FCUP 149 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sample Year Country Population Museum information Type Subspecies HnNI187 undetermined Kenya Shimba Hills Smithsonian Institution; Washington DC, USA Bone Hippotragus niger roosevelti HnNI188 1913 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii HnNI189 1913 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii HnNI190 undetermined Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii HnNI191 1913 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii HnNI192 1913 Zambia undetermined Smithsonian Institution; Washington DC, USA Bone Hippotragus niger kirkii Abbreviations: NP – National Park;

Table S3. Prior distributions used for Bayesian analyses of divergence times. Posterior distributions from Bibi (2013) were used as priors in the first phase of analyses (Phase I). The priors used for the second phase of analyses (Phase II) came from Phase I posteriors on the genus Hippotragus and on the highly divergent lineage from Tanzania/remainder H. niger. Mya=million years ago.

Priors Posteriors

Phase Taxa median (Mya) 95% HPDI Mean s.d. median (Mya) 95% HPDI I Alcelaphinae + Hippotraginae 11.5 10.6-12.5 11.2428 0.7074 11.2 9.8-12.6 I Alcelaphini 6.3 5.4-7.2 6.2902 0.4174 6.3 5.5- 7.1 I Addax + Oryx 3.2 2.6-3.9 2.8352 0.1996 2.8 2.4- 3.2 I Alcephalus +Damaliscus 4.2 3.2-5.1 4.5198 0.3138 4.5 3.9-5.1 I Hippotraginae 6.6 5.6-7.6 6.9199 0.4523 6.9 6.0-7.8 III Hippotragus - - 5.9968 0.4098 6.0 5.2-6.8 III All H. niger lineages + Relic lineage - - 1.666 0.1287 1.7 1.4-1.9

FCUP 150 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S4 - Genetic distances between different H. niger lineages, in comparison to the outgroup (H. equinus), and the highly divergent lineage from Tanzania (Relic) based on mtDNA genome sequences, excluding 429 bp of the HVR.

Comparisons Dxy (JC) Da (JC) Fd.

Mean all H. niger 0.00729 ± 0.00253 0.00631 ± 0.00272 86 H. niger vs Relic 0.03436 ± 0.00140 0.03157 ± 0.00141 406 H. niger vs H. equinus 0.09134 ± 0.01550 0.08764± 0.01552 1211 Relic vs H. equinus 0.09342 ± 0.01987 0.09121 ± 0.01988 1350 Abbreviations as follows: Average number of nucleotide substitutions (Dxy) and Number of net nucleotide substitutions (Da) per site between populations, with Jukes and Cantor correction (JC); Fd. Number of fixed differences.

Table S5- Genetic diversity summary statistics, and respective standard deviations, for the different populations sampled, based on complete mtDNA genome sequences of H. niger Population N S h Hd π MPD Luando (AGO) 27 0 1 0.000 ± 0.000 0.00000 ± 0.00000 0.000 ± 0.000 Cangandala (AGO) 9 1 2 0.389 ± 0.164 0.00002 ± 0.00003 0.389 ± 0.399 Shimba Hills (KEN) 10 100 3 0.600 ± 0.130 0.00322 ± 0.00172 53.200 ± 25.186 Rungwa (TZA) 1 0 1 1.000 ± 0.000 0.00000 ± 0.00000 0.000 ± 0.000 Niensi (TZA) 2 0 1 0.000 ± 0.000 0.00000 ± 0.00000 0.000 ± 0.000 Kizigo (TZA) 1 0 1 1.000 ± 0.000 0.00000 ± 0.00000 0.000 ± 0.000 Liwonde NP (MWI) 4 1 2 0.500 ± 0.265 0.00003 ± 0.00004 0.500 ± 0.519 Niassa (MOZ) 2 14 2 1.000 ± 0.500 0.00085 ± 0.00088 14.000 ± 10.247 Sofala-Manica (MOZ) 5 16 2 0.400 ± 0.237 0.00039 ± 0.00026 6.400 ± 3.651 Gorongosa NP (MOZ) 2 1 2 1.000 ± 0.500 0.00006 ± 0.00009 1.000 ± 1.000 Katanga (COD) 4 42 4 1.000 ± 0.177 0.00154 ± 0.00103 25.500 ± 14.289 Mufumbwe (ZMB) 1 0 1 1.000 ± 0.000 0.00000 ± 0.00000 0.000 ± 0.000 Lusaka-Kafue (ZMB) 9 21 3 0.639 ± 0.125 0.000592 ± 0.00034 9.778 ± 4.948 Mulobezi (ZMB) 6 118 4 0.867 ± 0.129 0.00367 ± 0.00214 60.600 ± 30.648 Kafue (ZMB) 16 19 4 0.350 ± 0.148 0.00021 ± 0.00012 3.425 ± 1.847 Masebe-Mkushi (ZMB) 12 4 2 0.545 ± 0.061 0.00013 ± 0.00009 2.1818 ± 1.297 Matesi (ZWE) 6 81 3 0.600 ± 0.215 0.00260 ± 0.00153 43.000 ± 21.847 Triangle (ZWE) 18 118 8 0.830 ± 0.064 0.00296 ± 0.00151 48.922 ± 22.228 Mahango (NAM) 17 24 3 0.3235 ± 0.136 0.00027 ± 0.00015 4.412 ± 2.290 Chobe (BWA) 4 20 3 0.8333 ± 0.222 0.00065 ± 0.00045 10.667 ± 6.176 Abbreviations as follows: N, number of samples; S, number of polymorphic (segregating) sites; h, number of haplotypes; Hd, Haplotype diversity; π, nucleotide diversity; MPD, mean pairwise distance. All parameters were estimated accounting for insertion/deletions and allowing 5% of missing data. Individuals from undetermined populations (10 museum specimens from Zambia) are not represented. Given the lack of representativeness in each population within Tanzania, summary statistics were not calculated.

FCUP 151 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S6. Genetic Diversity summary statistics, and respective standard deviations, for the highly divergent complete mtDNA sequences from Tanzania Population N S h Hd π MPD All populations 46 136 29 0.966 ± 0.013 0.00166 ± 0.00082 27.370 ± 12.207 (TZA) Kigosi 15 69 6 0.800 ± 0.071 0.00161 ± 0.00084 26.571 ± 12.348 Kizigo 6 67 5 0.933 ± 0.122 0.00167 ± 0.00099 27.600 ± 14.146 Mlele 1 0 1 1.000 ± 0.000 0.00000 ± 0.00000 0.000 ± 0.000 Niensi 3 1 2 0.667 ± 0.314 0.00004 ± 0.00005 0.667 ± 0.667 Rungwa 6 33 6 1.000 ± 0.096 0.00085 ± 0.00051 14.000 ± 7.342 Ugalla 12 86 10 0.970 ± 0.044 0.00139 ± 0.00074 22.924 ± 10.867 Wembere 3 43 3 1.000 ± 0.272 0.00174 ± 0.00132 28.667 ± 17.486 Abbreviations as follows: N, number of samples; S, number of polymorphic (segregating) sites; h, number of haplotypes; Hd, haplotype diversity; π, nucleotide diversity; MPD, mean pairwise distance. Note: all parameters were estimated accounting for insertion/deletions and allowing 5% of missing data.

FCUP 152 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. S1. Bayesian phylogenetic tree of 215 H. niger and 2 H. equinus whole mitochondrial genomes (excluding 429 bp of the HVR). The four main mitochondrial lineages are highlighted in branches with different colors, in accordance with Figure 2. Clades corresponding to niger-like haplogroups are also highlighted, followed by the respective label. Posterior probabilities are indicated for nodes of interest. FCUP 153 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. S2- Ratio of transitions per samples for a subset of both modern and historic samples. Historic samples are underlined in blue, while modern samples are underlined in red. The plots show that there are no significant differences between the transitions/transversions ratio of historic and modern samples. From these observations it is possible to infer that there is not a bias towards transitions in historic samples as a result of deamination.

FCUP 154 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP 155 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Population structure and differentiation patterns of sable antelope

Pedro Vaz Pinto1,2,3,4, Hans Siegismund5, Bettine Jansen van Vuuren6, Nuno Ferrand1,2,3,6, & Raquel Godinho1,2,3

1CIBIO/InBIO – Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Campus Agrário de Vairão, 4485-661 Vairão, Portugal

2Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto, Portugal

3ISCED – Instituto Superior de Ciências da Educação da Huíla, Rua Sarmento Rodrigues, Lubango, Angola

4The Kissama Foundation, Rua Joaquim Capango nº49, 1ºD, Luanda, Angola

5Department of Biology, University of Copenhagen, Ole Maaloes Vej 5, 2200 Copenhagen N, Denmark

6Department of Zoology, Faculty of Sciences, University of Johannesburg, Auckland Park 2006, South Africa

Abstract

Dramatic landscapes and ecological heterogeneity are known to influence the biogeography of Africa, but surprisingly few studies to date have implemented a population genetics approach to investigate intraspecific relationships in African bovids. The sable antelope (Hippotragus niger) is one of the most emblematic antelopes, being an economically important species in Southern Africa, and includes populations of global conservation concern. As a highly specialized species widely distributed across the continent, it is an ideal candidate for a population study, and here we report on results obtained by applying a panel of 57 autosomal microsatellites on a comprehensive dataset of 369 contemporary and 31 historical sable samples. We found sable to be

FCUP 156 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) strongly structured into five geographical clusters delimited by well-defined physical barriers. We also explore patterns of genetic diversity, differentiation and substructuring. The critically endangered giant sable antelope proved to be the most differentiated population, but also showed high levels of genetic depletion, suggesting that genetic drift may have contributed to the differentiation values. We conclude that the five clusters have been maintained with relatively low levels of gene flow, but two contact zones were identified in eastern Zambia and central Mozambique. The results of this study support a five subspecies classification, partially concordant with traditional taxonomy based on morphometrics, but suggesting the existence of a yet undescribed taxon in west Tanzania.

Introduction

African bovids experienced an explosive radiation starting in the Miocene, when most of the extant antelope tribes are thought to have originated in response to a cooling climate and subsequent adaptation to spreading grasslands, savannas and drier habitats (Vrba 1995; Hassanin & Douzery 1999; Fernandéz & Vrba 2005; Hassanin 2012). Based on the fossil record, the tribe Hippotragini shows a marked proliferation of species from the middle to the late Pliocene onwards, but only eight species and three genera survived to historical times, while being restricted to Africa and the Arabian Peninsula (Vrba 1994; Kingdon 2013). Extant hippotragine are large-bodied grazing antelopes in which species belonging to genus Addax and Oryx present some remarkable adaptations to desert or semi-desert environs, while the genus Hippotragus has evolved linked to savannas and woodlands (Kingdon 2013). The climatic fluctuations of the Pleistocene are expected to have influenced the intraspecific variation within the tribe, similarly to what has been reported in other ungulates, as result of speciation in refugia (Flagstad et al. 2001; Lorenzen et al. 2010, 2012; Hewitt 2004), and shaped by the effects of physeogeographic features such as rivers and mountain chains (Cotterill 2003a).

First described in South Africa, the sable antelope Hippotragus niger HARRIS 1838 is one of the two existing members of the genus and has specialized to the mesic conditions of the miombo woodlands, a type of broad-leafed deciduous open woodlands dominated by Brachystegia/ Julbernardia spp. trees growing on poor dystrophic soils (Estes 2013). Although sable can marginally occur in different types of savannas in the south of their range, they are one of the larger mammal species more strongly associated with the miombo zone (Estes 2013), and its distribution closely matches the occurrence of this ecotype across eastern and south-central Africa. Generally present in low densities,

FCUP 157 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) sable is typically an ecotone species, utilizing the edges between the woodland and grassland while avoiding very open or waterlogged areas (Estes 2013). As in all remaining hippotragine both male and females grow horns, but sable are unique in exhibiting a marked sexual dimorphism, with bulls being larger in size, much darker in coloration and developing much longer and curved horns (Estes 2013). Sable antelopes are gregarious, forming strongly phylopatric matriarchal herds composed of cows, calves and young, while males disperse before maturing and may temporarily form bachelor groups before eventually establishing their own territories (Estes 2013). Generally sable occupies niches that minimize interspecific competition and it has been suggested that the pronounced sexual dimorphism and social behaviour makes sable the most sedentary in habits and specialized hippotragine species (Estes 2013).

Morphological differences such as body size, coloration patterns, or skull and horn measurements, observed in geographically separated populations, led to the description of four subspecies of sable (Ansell 1972; East 1999; Estes 2013). The typical race or southern sable H. n. niger is characterized by females becoming almost as dark as bulls and is widely distributed across southern Africa to the south of the Zambezi (Groves & Grubb 2011; Estes 2013). A smaller sable with relatively shorter horns from eastern Africa was described as Roosevelt’s sable H. n. roosevelti (Groves & Grubb 2011; Estes 2013). Originally found in Kenya, it was subsequently suggested that Roosevelt’s sable would likely include populations found further south into south-eastern Tanzania and northern Mozambique (Siege & Baldus 1999; Booth 2002). Kirk’s sable H. n. kirkii was first described from south-western Zambia, having different facial mask pattern, males growing longer horns on average and females of brown-reddish colour (Ansell 1972; Groves & Grubb 2011; Estes 2013). Known to Zambia to the north of the Zambezi, the distribution range for the latter subspecies has remained unclear, although Ansell (1972) suggested that it could extend to Malawi, Democratic Republic of Congo (DRC) and western Tanzania. The giant sable H. n. variani is the most geographically distant and isolated population, restricted to a small region in central Angola, and is characterized by a very dark face, and larger skull and horn development in males (Blaine 1922; Ansell 1972; Groves & Grubb 2011; Estes 2013). After comparing a series of sable skulls and skins obtained in museums, Groves (1983) suggested another subspecies H. n. anselli, to be confined to the rift region of Malawi and eastern Zambia, between lake Malawi and the Muchinga escarpment/ Luangwa river, albeit this fifth subspecies has been rarely considered by subsequent authors. More disruptive proposals have also been made, recommending specific status to giant sable (Blaine 1922) or to Roosevelt’s sable (Groves & Grubb, 2011). However, the four subspecies classification remains the most

FCUP 158 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) widely used, even if strictly based on phenotypic traits and lacking well defined boundaries, as critical populations from the DRC, Tanzania, northern Mozambique, Malawi and eastern Zambia, are yet either untackled or problematic.

The first molecular studies to focus on sable antelope made use of one or few mitochondrial fragments and revealed the existence of surprisingly deep maternal lineages within the species (Mathee & Robinson 1999; Pitra 2002). However, these and subsequent results were based on limited sampling efforts and proved difficult to interpret and reconcile with previous taxonomic considerations (Mathee & Robinson 1999; Pitra 2002, 2005; Jansen Van Vuuren et al. 2010; Groves & Grubb 2011). A recent mitogenomic study analysing a much more comprehensive dataset provides some critical insights into the evolutionary history of the species, unveiling a strong association to geomorphological and climatic events, and suggests the possibility of past introgression in Tanzania to clarify previous inconsistencies (Rocha et al. in prep). This study reveals three main maternal sable lineages that subsequently split into nine haplogroups and sub-haplogroups, evolving during the middle to late Pleistocene, and resulted in six geographical groupings, one being the isolated giant sable and the remaining well demarcated by geological features, namely the eastern arc rift system (EARS), the eastern arc mountains (EAM), the Muchinga escarpment and the Zambezi river (Rocha et al. in prep). Five of these mitochondrial groupings would be largely concordant with a five subspecies classification, while leaving a sixth and unresolved grouping in western Tanzania. The co-existence of an additional and much more ancient maternal lineage dating from the early Pleistocene in western Tanzanian animals, has been tentatively explained as resulting from long distance intraspecific outbreeding (Pitra et al. 2002) or from mitochondrial capture following an interspecific hybridization event with an extinct taxon (Rocha et al. in prep).

Once widely distributed across the subcontinent, habitat destruction and consumption use throughout the twentieth century, caused local extinctions and fragmentation of surviving sable populations, leading to the confinement of natural populations mostly isolated in protected areas (East 1999; Estes 2013). Currently, several populations are threatened, including the relic giant sable which regarded as a national icon in Angola and yet listed as critically endangered (IUCN 2008), with a total population estimated at less than 200 animals and managed in situ. Other fragmented sable populations in protected areas have been steadily declining (Ogutu & Owen-Smith 2005; Dunham 2012; Crosmary et al. 2015), and may in the future require drastic conservation measures including restocking from source populations.

FCUP 159 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Contrasting to decreasing wild populations, the numbers have been recently expanding on private land across southern Africa where the sable ranks as a high value species destined for trophy hunting or breeding purposes, and is one of the most widely represented large ungulates in private game farms (Bothma et al. 2010; Taylor et al. 2016). In South Africa alone, wildlife ranching is a multi-billion rand industry with sable antelope generally regarded as the “glamour” breed, and where game auction prices for breeding bulls have been escalating, and reached a record value of US$ 1.9 million paid for one sable bull in 2015 (Lindsay et al. 2013; Pitman et al. 2016; Taylor et al. 2016). As result of its high economic value, sable are currently bred and managed intensively in many game ranches, and often translocated or introduced outside their historical distribution range (Bothma et al. 2010; Taylor et al. 2016). Some regional variants are more highly prized by the hunting industry for producing better trophies, usually a function of larger horn development in bulls (Crosmary et al. 2013). Although countries may have strict regulations in place to prevent the introduction of exotic subspecies to avoid contamination of the indigenous gene pools, those can prove hard to enforce when dealing with a high value species whose intraspecific taxonomy remains unresolved (Cousins et al. 2010). A better understanding of indigenous sable populations and clarification of their genetic relationships will prove crucial as a conservation tool for a rare species that include endangered wild populations, and to influence government policy making and private ranch owners on the management of such an economically important species.

In this study we present the first population genetic analyses on sable antelope with a comprehensive dataset obtained across the entire species geographic range, combining recent and historical samples. All putative subspecies were included in the sampling effort, as well as geographically intermediate and previously unresolved populations. By using a set of autosomal microsatellites we explore the main contemporary geographic patterns and genetic relationships between sable populations. We predicted sable to display clear patterns of population structure shaped by existing geomorphological barriers and by demographic processes. Specifically we aimed to 1) define the main groups or meta-populations of sable antelope; 2) estimate genetic diversity and relationships among the main groups; 3) explore substructuring at a finer scale within each cluster; 4) test the hypothesis of mitochondrial introgression following hybridization in western Tanzania; 5) provide taxonomic insights. We expect the definition of discrete conservation units will constitute an invaluable tool in designing future policies for management and conservation of the sable antelope.

FCUP 160 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Materials and Methods

Sample collection

We used a total of 369 modern samples (dating from 1993 to 2015) and 31 historical samples (from 1913 to 1964), from 64 sampling localities covering the whole species native distribution range (Supplementary Table S1). All recognized subspecies from the 11 countries where sable are known to occur, are represented in this dataset.

DNA extraction and amplification

Total genomic DNA was extracted from tissue samples using the QIAGEN DNeasy Blood & Tissue Kit, and following manufacture instructions. Individual multilocus genotypes were scored for a set of 57 species-specific polymorphic microsatellites. The amplification of loci followed the methodology and conditions described in Vaz Pinto et al. (2015), always using negative controls to monitor for possible contaminants. PCR products were separated by size on an ABI3130xl Genetic Analyzer. Allele sizes were scored against the GeneScan 500 LIZ Size Standard, using GENEMAPPER 4.0 (Applied Biosystems) and manually checked twice. The accuracy of genotypes was confirmed through re-amplification and re-analyses of 20% of random selected samples from each locus (Pompanon et al. 2005), resulting in complete concordance among replicates.

For historical samples, DNA extractions followed the procedures of Dabney et al. (2013) and were performed in a dedicated room for low quality DNA using negative controls to monitor for contamination. Individual multilocus genotypes were scored for a set of 57 species-specific polymorphic microsatellites following Vaz Pinto et al. (2015). Multiplex reactions to amplify historical samples were split from the original ones to contain few loci per reaction. Amplification of historical samples were replicated four times for each sample and were performed in a dedicated PCR room maintaining conditions to reduce the risk of contamination. PCR products were separated by size in an ABI3130xl genetic analyzer. Allele sizes were scored against the GeneScan 500 LIZ Size Standard, using GENEMAPPER 4.0 (Applied Biosystems) and manually checked twice. The accuracy of genotypes was confirmed through re-amplification and re-analyses of 20% of randomly selected samples from each locus (Pompanon et al. 2005), resulting in complete concordance among replicates. A threshold of 33% of missing data was assumed ending up with a 400 sample final dataset.

FCUP 161 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Genetic diversity and population structure

Preliminary analyses using the Bayesian clustering software STRUCTURE 2.3.4 (Pritchard et al, 2000; Falush et al. 2003) allowed the identification of main groups, and these were further subdivided into coherent geographical subgroups.

We used the software ARLEQUIN 3.5 (Excoffier & Lischer 2010) to evaluate deviations from Hardy-weinberg equilibrium (HWE) and to test for pairwise linkage disequilibrium (LD) for all loci in the main groups previously identified. Microsatellite diversity was evaluated separately for each main group and geographical subgroup, based on the expected heterozygosity (He), the inbreeding coefficient Fis (Weir & Cockerham 1984), mean number of alleles per locus (Na) and number of private alleles (Npa) for each locus and population, also using ARLEQUIN 3.5, while the allelic richness (AR) was computed with the program FSTAT ver. 2.9.3.2 (Goudet 2001). Significant levels for all tests were adjusted using the sequential method of Bonferroni for multiple comparisons in the same data set (Rice 1989).

We tested sable population structure using the software STRUCTURE with the admixture model and correlated allele frequencies and no prior geographic information. Analyses was performed on 10 independent runs for each K with 1,000,000 MCMC iterations following a burn-in period of 500,000 steps, and number of clusters (K) estimated for 1 to 10. This methodology was firstly used on the whole data set to identify the main populations. Subsequently we applied the same analyses on each of the main groups separately to look at substructuring on a finer scale, with 10 independent runs of 1,000,000 MCMC iterations following a burn-in of 250,000 steps for each K, and number of clusters (K) set from 1 to 7. The software STRUCTURE HARVESTER (Earl 2012) was used to plot the likelihood across the various values of K determined by STRUCTURE, using the mean likelihood L(K) and ΔK (Evanno et al. 2005). Population structure was also tested by model-independent multivariate analyses, carrying out a discriminant analyses of principal components (DAPC) with ADEGENET v1.2.8 in R (Jombart et al. 2010). Unlike STRUCTURE, the software ADEGENET does not make assumptions based on HWE or LD, and is not sensible to relatedness among individuals, being therefore less prone to produce clusters influenced by family groups. We also generated a neighbour-joining network tree with the program POPULATIONS v1.2.32 using Cavalli- Sforza and Edwards chord distance Dc (Cavalli-Sforza & Edwards, 1967).

To assess the levels of genetic differentiation between groups and populations considered, we carried out Fisher’s exact test, analogues of pairwise mean Fst (Weir & Cockerham 1984), and we tested for significance using analyses of molecular variance

FCUP 162 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) among and within groups and populations (AMOVA, Michalakis & Excoffier 1996) with 1,000 permutations on ARLEQUIN 3.5. A Mantel test (Mantel 1967) was performed to evaluate isolation by distance within the main groups, using software GENEPOP 4.2 (Raymond & Rousset 1995; Rousset 2008) with 1,000 permutations for significance.

Results

In total 400 sables were genotyped for 57 autosomal polymorphic microsatellites. The preliminary results for population structure revealed five different geographically- clustered groups separated by well-defined physical boundaries, hereafter named Southern, Eastern, Zambian, West Tanzanian and Angolan (Fig. 1). On a finer scale and using a hierarchical approach, a total of 12 geographically defined subgroups were further identified (Fig. 2).

Fig. 1 – Population structure in pie charts and sample location for sable antelope. The size of each pie is scaled according to the number of individuals sampled at each locality. Pie chart colours depict different genetic clusters as identified by STRUCTURE, and the size of each pie slice shows the average probability of assignment of individuals to various clusters. (a) Representation of clustering analyses of 400 individuals performed by STRUCTURE, for which K=5 had the highest credibility. Vertical bars show the membership of each individual to a given cluster, and different colours correspond to separate clusters. (b) The shaded colour represent sable distribution in Africa assigned to five different geographically coherent populations, and according to the highest assignment probability, calculated with STRUCTURE.

FCUP 163 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Genetic diversity of sable antelope

Consistent deviations from HWE (P < 0.05 and P < 0.01) after Bonferroni correction, led to the exclusion of seven loci, while all 400 samples in the dataset were still kept below the threshold of 33% of missing data for the final 50 microsatellite markers. Subsequently we found deviations from HWE in nine of 250 tests, but in no case did one marker deviated from HWE on more than one main group (Supplementary Table S2). Significant linkage disequilibrium (P < 0.05) after Bonferroni correction was only observed for one pair of loci (HpN24 – HpN91) for more than one main sable group (results not shown).

Fig.2 – Population structure in pie charts and sample location for sable antelope for the main groups Southern, Eastern, Zambian and Angolan. The West Tanzania group was excluded because it showed no substructure. The size of each pie is scaled according to the number of individuals sampled at each locality. Pie chart colours depict different genetic clusters as identified by STRUCTURE, and the size of each pie slice shows the average probability of assignment of individuals to various clusters. Representation of clustering analyses performed by STRUCTURE, with the K value with the highest credibility for each subgroup. Vertical bars show the membership of each individual to a given cluster, and different colours correspond to separate clusters. The historical samples are signaled with a red diamond symbol.

We observed even values of genetic diversity among Southern, Eastern, Zambian and West Tanzanian sable populations, while the Angolan population consistently exhibited lower diversity for all parameters measured. Statistical T-Tests performed on the five main groups for the genetic diversity parameters were highly significant when involving the Angolan group, and always non-significant for all combinations comparing the

FCUP 164 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) remaining groups (results not shown). The expected heterozygosity (He) ranged from 0.33 (Angolan) to 0.56 (Eastern), while the average number of alleles per locus (Na) ranged from 2.54 (Angolan) to 5.44 (Southern). Number of private alleles (Npa) and allelic richness (AR) were also lowest for the Angolan population (2 and 2.32 respectively) and highest for the Eastern group (26 and 5.05 respectively) (Table 1). The analyses carried out for the 12 subgroups revealed all indexes of genetic diversity to be lowest for the Cangandala population in Angola. The highest He was found on the Mid- Southern population, while Na, Npa and AR scored highest for the West Tanzanian sables for which no subpopulations were observed (Table 1). The results for the inbreeding coefficient Fis were only significant for the subpopulations Mid-Eastern (0.071; P≤0.01), West Zambia (0.038; P≤0.05) and West Tanzanian group (0.031; P≤0.05).

Table 1 - Measures of genetic diversity by main group and subgroups of sable

N He s.d. Fis Na s.d. Npa AR Southern Sable 104 0.500 0.265 - 5.44 3.76 22 4.33 West-Southern 41 0.438 0.260 0.002 3.68 2.08 1 2.78 Mid-Southern 48 0.502 0.257 0.019 4.76 3.11 7 3.25 East-Southern 15 0.465 0.282 0.035 3.58 2.08 2 3.01 Eastern Sable 37 0.562 0.287 - 5.52 3.26 26 5.05 North-Eastern 9 0.453 0.285 0.052 2.80 1.44 2 2.66 Mid-Eastern 20 0.551 0.290 0.071** 4.78 2.71 16 3.67 West-Eastern 8 0.475 0.298 -0.123 3.24 1.66 3 - Zambian Sable 112 0.534 0.254 - 5.52 3.80 14 4.55 Central Zambia 13 0.412 0.258 -0.000 2.66 1.30 1 2.44 South Zambia 38 0.518 0.262 -0.015 4.64 2.68 5 3.38 West Zambia 61 0.527 0.254 0.038* 5.06 3.30 2 3.36 West Tanzanian Sable 89 0.532 0.239 0.031* 5.24 2.83 27 4.33 Angolan Sable 58 0.326 0.260 - 2.54 1.33 2 2.32 Cangandala 9 0.237 0.235 -0.088 1.80 0.76 0 1.70 Luando 49 0.322 0.264 -0.006 2.50 1.34 1 2.03 N, sample size; He, expected heterozygosity; s.d., standard deviation; Fis, inbreeding coefficient with *P ≤ 0.05 and ** P ≤ 0.01; Na, average number of alleles per locus; Npa, number of private alleles; AR, allelic richness. The Inbreeding coefficient was not considered for the four major groups that showed substructuring. The allelic richness was based on 23 individuals for the major groups, and on seven individuals for the subgroups. The East Zambian population was excluded for the allelic richness calculations because of missing data.

Population clustering

The Bayesian clustering results indicated that K=5 had the highest support across all 10 runs of K=1-10, both for ΔK and for the mean log-likelihood L(K) (Fig. 1). This result was

FCUP 165 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) geographically coherent (Fig. 1), with the five clusters corresponding to the groups Southern (sable found south and southwest of the Zambezi river); Eastern (sable present in lowland eastern Africa from Kenya to central Mozambique, and sable found in Malawi and east Zambia); Zambian (sable present across most of Zambia to the east and north of the Zambezi River and west of the Luangwa valley, and including sable from the Katanga province of DRC); West Tanzanian (sable found in western Tanzania between the western branch of the eastern African rift system and the eastern Arc mountains); and Angolan (sable from central Angola). Overall 92% of individuals showed a very clear individual assignment (qi > 0.90) to a given population, with the proportion of individuals being highest for the groups Angolan (100%), West Tanzanian (97.75%) and Zambian (94.64%), and lowest for Southern (84.62%) and Eastern (78.38%) (Supplementary Table S3). Only 18 individuals from either central Mozambique or eastern Zambia, showed an individual assignment qi < 0.75 to the most likely population, of which the lowest scores of probabilistic assignment, obtained in six of those individuals, was 0.56

< qi < 0.60 (Supplementary Table S3). When higher values of K=5 were tested these resulted in a sharp decrease of log probabilities and unstable partitioning of the data (Supplementary Fig. S1).

Further Bayesian clustering analyses for each main cluster, revealed substructure patterns in every groups except West Tanzanian (Fig. 2 and Supplementary Fig. S2-6). In the Southern group K=3 was supported by the highest value of ΔK, defining the subgroups hereafter named West-Southern (sable from the Caprivi Strip in Namibia, south-eastern Angola and Zambia souhwest of the Zambezi); Mid-Southern (sable in Zimbabwe, Botswana, South Africa and southern Mozambique); and East-Southern (sable in central Mozambique to the south of the Zambezi) (Fig. 2 and Supplementary Fig. S2). For the Eastern group K=2 had the highest value of ΔK, however the log- likelihood increased sharply between K=2 and K=3 before decreasing. We therefore partitioned the Eastern group into three geographical coherent subgroups, hereafter named North-Eastern (sable from coastal Kenya and northeastern Tanzania); Mid- Eastern (sable present in southeastern Tanzania, and Mozambique north of the Zambezi); and West-Eastern (sable from eastern Zambia and Malawi, between the Luangwa valley and Malawi Lake) (Fig. 2 and Supplementary Fig. S3). In the Zambian group, the highest value of ΔK was reached at K=3 and although the L(K) never really plateaued, it showed a clear increase from K=2 to K=3. The three defined subgroups lacked clear geographical boundaries but were named as Central, South and West Zambia, with the latter including sable present in Congo (Fig. 2 and Supplementary Fig. S4). The West Tanzanian group showed no partitioning, with immediate decrease in ΔK

FCUP 166 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) and L(K) and all individuals splitting up uniformly for every value of K (Supplementary Fig. S5). For the Angolan group the best fit was obtained with K=2, reflecting a sharper increase of L(K) between K=1 and K=2, and corresponding to the subgroups originated in the two protected areas named Cangandala and Luando (Fig. 2 and Supplementary Fig. S6). Both for the main group analyses and for the various subgroups, the historical samples proved fully concordant in clustering with the recent samples obtained in the same localities, and when these were not available they clustered with the geographically closest recent samples (results not shown).

Population structure performed with multivariate analyses provided additional support for the five main clusters, largely coinciding with previous results obtained with the Bayesian clustering results. Only one individual, from eastern Zambia (HnNI 237), was assigned to a different population (Zambian) than using posterior membership probability (Eastern) with Bayesian analyses, although its assignment score was low.

The discriminant analyses of principal components (DAPC), assuming a priori existence of the main five groups, unambiguously separated the Angolan and West Tanzanian groups while Southern, Eastern and Zambian grouped together (Fig. 3).

Fig. 3 – Scatterplot of the first two principal components of DAPC, evidencing the five genetic clusters considered (S – Southern; Z – Zambian; E – Eastern; T – West Tanzanian; A – Angolan). Each point represents one sample, and ellipses around clusters represent 95% confidence.

FCUP 167 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

When the same analyses was performed excluding the two most distinctive main groups to increase discriminant power, the DAPC was able to isolate all subgroups within the Southern, Eastern and Zambian groups, except the South and West Zambia (Fig. 4). Nevertheless some overlapping was also observed between subgroups West-Southern and Mid-Southern, while the subgroup West-Eastern was plotted in a central position in the graphic relative to the remaining subgroups.

Fig. 4 – Scatterplot of the first two principal components of DAPC, for all the subgroups considering excluding the West Tanzanian sable and the two Angolan subpopulations (1 – West-Southern; 2 – Mid-Southern; 3 – East-Southern; 4 – North-Eastern; 5 – Mid-Eastern; 6 – West-Eastern; 7 – Central-Zambian; 8 – South-Zambian; 9 – West-Zambian). Each point represents one sample, and ellipses around clusters represent 95% confidence.

The neighbour-joining network based on Cavalli-Sforza and Edwards chord distance was also largely consistent with the previous clustering results, yet isolated the East Zambian subgroup as a possible additional cluster, while providing little discrimination among the remaining subgroups (Supplementary Fig. 5).

FCUP 168 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5 – Genetic subdivision in 12 populations. Cavalli-Sforza network based on 50 microsatellites.

Genetic differentiation

The pairwise comparisons measured by Fst showed very significant genetic differentiation (P≤0.001) between all pairs of main groups (average Fst=0.21), with values found consistently higher between Angolan sable and remaining groups (0.27

Table 2 - Genetic differentiation (Pairwise Fst values) among the five main groups of sable

SOUTHERN EASTERN ZAMBIAN W TANZANIA EASTERN 0.11549*** 0 ZAMBIAN 0.11830*** 0.11161*** 0 W TANZANIA 0.17207*** 0.11548*** 0.17708*** 0 ANGOLAN 0.37589*** 0.31482*** 0.27166*** 0.35032*** *** All pairwise Fst values were highly significant (P<0.001) when testing with 1,000 permutations

FCUP 169 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

The AMOVA results showed significant structuring among groups (P<0.000001) and indicated that 15.84% of the total variation occurred at the group level and 73.62% at individual level. Within each main group the differentiation was only significant for subgroups of Southern sable, but not for subgroups within Eastern, Zambian and Angolan sable (Table 3).

Table 3 - Hierarchical analyses of molecular variance (AMOVA) examining the partinioning of genetic variation

Source of Variation d.f. s.s. Variance % Total P

Total Population Among groups (N=5) 4 1398.122 1.67364 15.84 <0.000001 Among populations (N=12) within groups 7 353.017 0,89347 8.46 <0.000001 Among individuals within populations 388 3187.519 0.21950 2.08 <0.000001 Within individuals 400 3110.500 7.77625 73.62 <0.000001

Southern Sable Among populations (N=3) 2 137.758 0.93915 9.37 <0.000001 Among individuals within populations 101 931.684 0.14595 1.46 0.17791 Within individuals 104 929.000 8.93269 89.17 <0.000001

Eastern Sable Among populations (N=3) 2 54.338 0.90232 11.91 0.01466 Among individuals within populations 34 240.526 0.40202 5.31 <0.000001 Within individuals 37 232.000 6,27027 82.78 <0.000001

Zambian Sable Among populations (N=3) 2 107.563 0.69913 7.49 0.01662 Among individuals within populations 109 972.855 0.29523 3.16 <0.000001 Within individuals 112 933.500 8.33482 89.34 <0.000001

Angolan Sable Among populations (N=2) 1 49.677 1.40595 16.90 0.52590 Among individuals within populations 56 387.357 0.00596 0.07 <0.000001 Within individuals 58 400.500 6.50517 83.02 0.00568 d.f., degrees of freedom; s.s. sums of squares; P values are based on 1,000 permutations. The West Tanzanian group was not included for within group calculations because it showed no substructuring

Mantel tests revealed a significant pattern of isolation by distance (IBD) within the Southern and Eastern groups, but not within Zambian or West Tanzanian groups (Supplementary Table S5). The Angolan sable was excluded because all animals had been sampled from only two geographical locations.

FCUP 170 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Discussion

To our knowledge this study is the most comprehensive effort to date focusing on an African antelope at population level. Our results based on Bayesian clustering and non- model multivariance analyses of microsatellites provided high support for sable antelopes to be genetically structured into five different clusters showing congruent spatial distribution and discrete geographical boundaries, defining the groups Angolan, Southern, Zambian, Eastern and West Tanzanian (Fig. 1). This partition largely conforms to the results from a previous phylogeographic work based on mitogenomics, which found nine sable haplogroups to have evolved and clustered according to six geographical groupings (Rocha et al. in prep.). Four of our main clusters (Groups Angolan, West Tanzanian, Zambian and Southern) coincided spatially with four mitochondrial groupings, while only the Eastern Group was not biogeographically fully concordant with the mtDNA, as it encompassed the haplogroups from the two remaining groupings. The highly significant differentiation estimates found for pairwise comparisons between all main clusters, adding to the mitochondrial concordance and geographical coherence, provides a robust pattern to discriminate the five groups considered. The strong genetic structure signals revealed for the species are globally unique, yet sharing recurrent geographical features, such as the Zambezi drainage basin, the EARS or the EAM, in defining the boundaries in eastern and southern Africa as has been found for species of rodents (Faulkes et al. 2004, 2010, 2011; Van Daele et al. 2013; McDonough et al. 2015; Mikula et al. 2016) and ungulates (Grubb et al. 1999; Flagstad et al. 2001; Cotteril 2003a,b; Moodley & Bruford 2007; Lorenzen et al. 2012).

Except for the Angolan giant sable, all main sable populations displayed moderate and even genetic diversity for all parameters analysed. The contrasting low levels of genetic diversity found in Angola were already expected, consistent with preliminary findings and reflecting the fact that this is a relic, endangered and bottlenecked population (Estes 2013; Vaz Pinto et al. 2015, 2016). Depletion of genetic diversity measured by microsatellites has been recorded for highly bottlenecked African antelopes (El Alqami et al. 2012, Armstrong et al. 2011, Godinho et al. 2012, van Wyk et al. 2013). For instance the values of expected heterozygosity scored for the Angolan sable are lower than results obtained for addax (Armstrong et al. 2011) and most subpopulations analysed of Arabian oryx and Dorcas gazelles (El Alqami et al. 2012, Godinho et al. 2012) while higher only than scores from the blesbok study (van Wyk et al. 2013), though the use of different microsatellites hinders conclusions to be drawn from such direct comparisons. Among the 12 subgroups, Cangandala exhibited the lowest scores of He, Na, Npa and RA (Table 1), a likely consequence of the most recent bottleneck that left this population

FCUP 171 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) on the brink of extinction (Vaz Pinto et al. 2016). Other subpopulations exhibiting relatively low genetic diversity were the West-Southern, North-Eastern and Central Zambia, and to a lesser extent, East-Southern and West-Eastern, which may reflect recent demographic processes. In contrast, the highest scores of genetic diversity found for the West Tanzanian, Mid-Eastern, South and West Zambia subpopulations, likely reflect the largest, healthiest and vastly free-ranging wild populations of sable antelope, currently present in these regions (East et al. 1998).

The Angolan “island”

The Angolan giant sable, currently confined to the Atlantic-flowing Kwanza drainage basin and separated from the closest sable populations by several hundreds of kilometres, has likely maintained an independent evolutionary history geographically isolated and with limited gene flow. Although climatic fluctuations may have cyclically promoted range expansion and contraction of sable range in Angola, the remoteness and complex physiography of central Angola must have kept contacts with other populations and migration rates at relatively low levels. It is possible that such an evolutionary history characterized by prolonged isolation and several bottlenecks may have contributed to the higher differentiation values recorded in Angola. In particular the well documented bottleneck that has affected the Angolan populations during the recent civil war, could also have much amplified the observed clustering signal, as mating becomes non-random and genetic drift tends to increase the genetic variance between populations (Nei et al. 1975; Maruyama & Fuerst 1985). However, the inclusion in our data set of three pre-war historical samples dating from the early twentieth century, which resulted in a similar genetic signature to the modern samples, confirms the Angolan cluster as an evolutionary unit well established before modern anthropogenic influence. The existence of a speciation “island” in the north-western range of Angolan miombo woodlands, confined to the Kwanza river drainage, is somewhat puzzling and equivalent biogeographic examples are lacking. Although one of the least studied countries in Africa, Angola is known for high faunal endemism rates associated with escarpment forests, highlands and coastal thickets (Mills 2010; Clark et al. 2011; Bersacola et al. 2015), but very few studies have focused on the extensive miombo woodlands of central Angola. It has been shown that phases of climatic variability which included periods of extreme aridity or “megadroughts”, affected southern Africa during the late Pleistocene (Cohen et al. 2007), thus impacting the vegetation cover and in particular the extent of miombo woodlands (Beuning et al. 2011). The woodlands in central Angola currently

FCUP 172 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) include some of the moister miombo in Africa often in sharp transition towards more forested environments (Barbosa 1970; Huntey 1982; Burgess et al. 2004), and this could contribute to a higher resilience when subjected to drier conditions. We hypothesize that the Kwanza basin may have constituted a refuge for miombo associated species during arid climatic phases during the late Pleistocene and into the Holocene. Therefore we predict that future genetic studies addressing mammal species occurring within the Kwanza drainage system may uncover similar biogeographic patterns. Interestingly two speciose Kob antelopes Kobus lechwe and Kobus vardoni (Ansell 1972; Cotterill 2000; Cotterill 2005) used to occur within the Luando sub-basin, consisting of the westernmost populations of either species, however their relationships with other conspecific populations have never been investigated. At the finer scale, substructuring of the Angolan group into two significantly differentiated subpopulations, Cangandala and Luando, was not unexpected. These two areas have been separated by the large River Luando which is likely to constrain gene flow, in addition to an expected genetic drift enhancement in the tiny Cangandala subpopulation. In any case intense poaching during the Angolan civil war caused the extirpation of all bulls and imminent extinction of Cangandala subpopulation, which in turn led to a restocking program, and forced the giant sable to be currently conserved as one single management unit (Vaz Pinto et al. 2016).

The Zambezi break

The upper and middle Zambezi River split two well differentiated clusters corresponding to the groups Zambian and Southern (pairwise Fst=0.118), and in spite of an extensive sampling effort on both sides of the river, we found no signs of admixture. The role of the Zambezi River and its main tributaries in promoting and shaping differentiation in southern Africa has been addressed in various studies (Flagstad et al. 2001; Cotterill 2003a,b; McDonough et al. 2015; Mikula et al. 2016). Delimited to the south and west by the Zambezi, the Zambian group extends across most of Zambia into DRC, to be blocked in the north by tropical forest habitats and the East African Rift System, and does not penetrate into Tanzania. Eastwards the Zambian cluster seems to be constrained by the combination of Muchinga escarpment and the arid corridor that runs parallel along the Luangwa valley, linking the Zambezi to the EARS (Grubb et al. 1999). The importance of Muchinga escarpment and Luangwa valley to function both as a corridor for arid- adapted species and as a barrier for ungulate dispersal has been noted in various phylogeographic studies (Grubb et al. 1999; Cotteril 2003a,b; Moodley & Bruford 2007;

FCUP 173 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Timberlake & Chidumayo 2011; Fennessy et al. 2013; McDonough et al. 2015; Rocha et al. in prep.), but seems at least partially permeable at population level. It is likely that occasional dispersing males can maintain some gene flow across Luangwa and Muchinga, enough for an admixture signal to be recorded across northern and eastern Zambia. On a hierarchical approach, it was possible to differentiate the Zambian group into three clusters, though these subpopulations lacked a strong geographical context and the Mantel test was not significant. The subgroups West Zambia and South Zambia could not be discriminated in DAPC analyses (Supplementary Fig. S8) and produced the least pairwise genetic differentiation in our study (Fst=0.04), while the Central Zambia subgroup represents a tiny population founded by few individuals (Don Stacey, pers. comm.). This, together with the lack of geographical features associated with the range boundaries of these subgroups, suggest that genetic drift is likely to explain the recorded differentiation signal captured by Bayesian and DAPC analyses. The majority of Zambia’s topography comprises plateaus and relatively flat terrain, and most of the nuances affecting the evolutionary history of the regional biodiversity can be better explained by changes in the drainage evolution (Cotterill 2003a). The Bangwelu swamps and the Kafue river are two geophysical features known to influence local speciation (Cotterill 2003b, 2006; McDonough et al. 2015; Mikula et al. 2016), and they may partially constrain sable movements. It is possible that such barriers have contributed to periodic isolation of sable subpopulations, but recent secondary contact may have blurred the geographical signal. It is also likely that the observed substructuring in the Zambian group has been further influenced by demographic processes that took place during the twentieth century, as result of local extinctions and population fragmentation, followed by recovery in protected areas and private properties. The lack of a clear geographical signature in the substructuring patterns in Zambia and DRC, prevent us from identifying discrete management units within the Zambian group.

The Southern group is well confined to the south of the Zambezi extending from the Okavango drainage basin in Namibia and south-eastern Angola eastwards across to the Indian Ocean. A striking observation was a clear signal of admixture with the Eastern group, detected in south-central Mozambique around Marromeu (probabilistic assignment of QMARROMEU=0.36) and to a lesser extent into Gorongosa

(QGORONGOSA=0.13). Although contact zones between genetic subdivisions often coincide with geographical barriers (Emerson & Hewitt 2005), this result was surprising considering that the Zambezi River proved to be a strong barrier throughout most of its course, and yet allowed for gene flow at the mouth of the river, where it is wider. This we believe can be explained by the unstable nature of the lower Zambezi, relatively shallow

FCUP 174 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) and poorly defined in channels, and subject to frequent alternation of flooding and drought conditions, and discharging at the delta through numerous active channels (Davies et al. 2001; Ronco et al. 2010). Only in recent times following the construction of several Zambezi dams, the course has been regularized to attain a more stable physiography. Occasional river channel changes in the Zambezi delta could provide the mechanism to explain the admixture observed in region. The inclusion in the dataset of two historical samples from Gorongosa from pre-dam times which showed similar admixture signal (Q=0.18), rules out this result as being a recent artefact caused by anthropogenic-driven landscape changes or sable translocations. The Southern group was substructured and significantly differentiated into three geographically coherent subpopulations, West-Southern, Mid-Southern and East-Southern, with significant isolation by distance. However the boundaries separating these three Southern clusters are not clearly defined. The West-Southern subpopulation proved to be the more differentiated, being mostly confined around the Caprivi Strip region, delimited to the west by the Kuito and Okavango Rivers and to the east by the Kwando, Linyanti and Savuti Rivers. The inclusion of one historical sample from the same region in south- eastern Angola scoring very high probabilistic assignment to the same cluster (qi=0.98) provides a robust additional support for this subpopulation. Presently a narrow corridor exists through the Mababe depression and the Kalahari, between the Okavango delta and the Zambezi drainage system allowing gene flow and contact with remaining Southern populations. However, it has been established that the Mababe depression was once part of a system of large Kalahari palaeolakes, connecting the Okavango and Zambezi basins in multiple phases during post-glacial and Holocene periods (Shaw, 1985; Burrough & Thomas 2008; Burrough et al. 2009). Such palaeolake system could have easily isolated sable populations during the Holocene, thus providing a mechanism to explain the differentiation signal currently found in the nuclear genome of sable from the West-Southern subpopulation. The East-Southern subpopulation, which includes animals from Marromeu and Gorongosa, has possibly evolved in south-central coastal Mozambique to the north of the Pungwe River and delimited in the west by the escarpment ridge of Chimanimani-Nyanga highlands. This region is unique by containing miombo woodlands contiguous to the coastal biome (Timberlake 2000; Cotterill 2007; Timberlake et al. 2011), and has been recognized as a biodiversity hotspot, with high endemism and benefiting from the combination of highly productive lowlands and the altitudinal gradients associated with the Gorongosa mountain (Tinley 1977). The area used to represent a Mozambican stronghold for reduncine species, which included a localized allopatric waterbuck population (Cotterill 2000). In spite of detected gene flow across into the Mid-Southern subpopulation, we believe that the independent

FCUP 175 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) evolutionary histories inferred should conservatively recommend the recognition of these three subpopulations as separate management units.

Eastern Rift and Mountain barriers

Eastern Africa holds some of the most spectacular physiographic features in the continent, including rift valleys, highlands and volcanos, and has remained tectonically active throughout the Pleistocene (Chorowicz 2005; Livingstone & Kingdon 2013). The EARS in particular has played a crucial role in shaping speciation patterns of many taxa, by creating isolating barriers and promoting diversity and fragmentation of habitats, and vicariance (Grubb et al. 1999; Cotterill 2003a; Badgley 2010; Faulkes et al. 2010). Two sable clusters, corresponding to groups Eastern and West Tanzanian, are also strongly influenced by the EARS and the associated uplands that intersect the rift between lakes Tanganyika and Malawi, having influenced the local climate by creating a rain shadow and defined an arid corridor that extends southwards the Somali-Masai arid biotic zone (Happold & Lock 2013; Livingstone & Kingdon 2013). The importance of these uplands, which include the EAM, the southern Tanzanian highlands and the Muchinga escarpment, acting both as a connecter and a divider for eastern African faunal elements is such, that it has been termed as “Kingdon’s line” by analogy to the Wallace’s line (Grubb et al. 1999; Livingstone & Kingdon 2013). Our findings suggest that the Eastern group encompasses all the sable present to the north of the Zambezi and to the east of the Kingdon’s line. Not only the sables from Kenya, eastern Tanzania and northern Mozambique clustered together, but it also includes animals present across the rift into Malawi and eastern Zambia, albeit the latter showing some admixture with the Zambian group. The region that includes eastern Zambia and most of Malawi is situated to the west of the EARS and has been shown to correspond to an independent sable evolutionary unit based on mtDNA (Rocha et al. in prep.). Such type of mito-nuclear discordance with a clear geographical context is best explained by hybridization and introgression (Toews & Brelsford 2012). We suggest a scenario of south-westward expansion of Eastern sable, eventually colonizing Malawi and eastern Zambia. At the southern tip of the EARS, the Malawi Lake connects to the Zambezi via the Shire River, the latter being likely permeable to sable dispersal, and therefore allowing the rift crossing. The original population that evolved in eastern Zambia and Malawi may have been absorbed by expanding Eastern sable and their signal lost in microsatellites while retaining the local mitochondria. Female phylopatry and male-biased dispersal may also have contributed to the resulting pattern. On the other hand the current admixture pattern

FCUP 176 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) in eastern Zambia in which the animals sampled displayed an average probabilistic assignment to the Zambian cluster of QWEST-EASTERN=0.31, must reflect some sable connectivity across the Luangwa valley/ Muchinga escarpment barriers. On a hierarchical approach, the most differentiated subpopulations defined within the Eastern cluster, corresponded to the subgroups North-Eastern and West-Eastern, while lesser pairwise values of differentiation were found when involving the Mid-Eastern subgroup. The North-Eastern and West-Eastern subpopulations are located at sable ecological and range extremes for this Eastern cluster, with the former confined to a narrow belt of coastal mixed woodlands in Kenya near the equator, and the latter utilizing more typical miombo at higher altitude and latitude. If the West-Eastern subgroup seems to be relatively well delimited between Lake Malawi and Muchinga escarpment, in the case of the North-Eastern subgroup the isolation may be currently maintained by human landscape transformations. Nevertheless, the differentiation signal for the North-Eastern subpopulation is not an artefact caused by recent genetic drift, as the three historical samples tested showed an average probabilistic assignment of QNORTH-EASTERN=0.99 to the corresponding cluster. And a similar result of QMID-EASTERN=0.98 of average assigment was found for the four historical samples from southeastern Tanzania. The highly significant correlation found between divergence and distance, the absence of admixture, the geographical context and the good clustering of historical and contemporary samples, provides support to recognize the three subpopulations as management units.

The fifth cluster corresponding to the West Tanzanian group, is geographically confined between the western branch of the EARS and the arid corridor along the EAM and southern Tanzanian highlands, while showing no admixture across these boundaries with either the Zambian or the Eastern group. The combination of rift lakes, volcanos and highlands, and an extensive arid corridor along the western edge of the ancient EAM (Grubb et al. 1999; Livingstone & Kingdon 2013), proves to be a very efficient barrier to prevent sable gene flow, and had been previously found to leave a deeper phylogeographic signature (Rocha et al. in prep.). The West Tanzanian group in terms of differentiation (average pairwise Fst=0.204) is second only to the Angolan group (average pairwise Fst=0.329). The divergence observed, compared to other sable populations, is not deep enough to explain the presence of a relic maternal lineage estimated to have diverged at 1.4 mya but would be compatible with the more recent haplogroup found in the same West Tanzanian population (Rocha et al. in prep.). Therefore our results provide further support to an introgression scenario in western Tanzania following a late Pleistocene secondary contact when sables may have moved

FCUP 177 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) across the rift and swamped the relic taxon (Rocha et al. in prep.). At a finer scale analyses, the fact that no evidence of substructuring could be detected in this cluster is not conformant with a currently active hybrid zone and confirms the existence of one single meta-population without significant barriers to gene flow within western Tanzania.

Taxonomic and conservation considerations

Our study provides compelling support for a five subspecies classification according to the main clusters here defined. This conclusion is concordant with previously described four subspecies yet providing for the first time discrete geographical boundaries, while identifying two contact zones, and suggesting the existence of one additional undescribed unit in western Tanzania. The subspecies H. n. niger and H. n. variani are a perfect match to the Southern and Angolan groups, while H. n. kirkii and H. n. roosevelti correspond to the Zambian and Eastern groups respectively. The West Tanzanian group however is genetically well differentiated and geographically isolated, and may not correspond to any described taxa. Ansell (1972) suggested that western Tanzanian sables could be H. n. kirkii but his statement didn’t derive from evidence and rather by simply ruling out H. n. roosevelti on biogeographical grounds. More recently Groves & Grubb (2011) in a morphometric analyses of sable, were able to include one single skull from western Tanzania which they termed as enigmatic, and suggested could result from hybridization. We believe sable from western Tanzania has been consistently overlooked in taxonomic studies and we predict there will be enough phenotypical differences in this population to justify the description of a new subspecies. On the other hand our results don’t provide enough genetic evidence to support the taxon H. n. anselli and instead we suggest that sable present in eastern Zambia and Malawi should be included into H. n. roosevelti, even if likely representing a distinct evolutionary unit within the taxon. We can also define two hybrid zones, one in eastern Zambia between H. n. roosevelti and H. n. kirkii, and another in central Mozambique between H. n. niger and H. n. roosevelti. Nevertheless in both cases, all individuals tested clustered within the boundaries of each respective geographical group with probabilistic assignment qi>0.56 and no mitochondrial introgression has yet been detected between groups (results not shown), strongly suggesting male-mediated dispersal as the mechanism promoting gene flow. Geographical barriers such as rivers and mountains in mammal contact zones have been found to be more efficient in containing phylopatric females as opposed to dispersing males (Arora et al. 2010; Straka et al. 2012; Toews & Brelsford 2012; McDonough et al. 2015). The observed patterns of cluster differentiation and the inferred evolutionary and

FCUP 178 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) spatial dynamics, which include contact zones between populations and subpopulations, are consistent with the recognition of four described subspecies and one additional undescribed taxon in western Tanzania, and we further recommend that three distinct management units should be recognized both in H. n. niger and in H. n. roosevelti.

Translocations involving sable antelopes have increased dramatically in recent years to the point of becoming routine. Various environmental protected areas have been coping with small or dangerously reducing sable populations and restocking programs have been implemented or may be considered in the future (Martin 2003; Ogutu & Owen- Smith 2005; Dunham 2012; Crosmary et al. 2015; Vaz Pinto et al. 2016). Nevertheless the vast majority of sable translocations are currently driven by the South African wildlife ranching industry and fuelled by an increasing demand for sable as a game trophy or a prize breed. Sables from different origins have been introduced in private game farms where they are often managed intensively and mixed before being sold in auction and translocated to different farms. Both as a rare flagship species being conserved in protected areas and as a high valued species for the wildlife ranching industry in southern Africa, our findings defining five different population clusters or subspecies, geographically and coherently structured, may prove invaluable as a management tool. Until now management decisions have been hampered by poor or incomplete information, but by here providing powerful means to discriminate among the various sable populations we hope to boost conservation practices, breeding management and policy making for one the rarest, most emblematic and economically relevant African mammals.

Supplementary material

Supplementary information includes Tables (S1-S5), and Figures (S1–S6), and are appended to the current document.

References

Ansell, W. F. H. (1972). Part 15: Order Artiodactyla. In: Meester J. A. J. & Setzer H. W. (eds). The Mammals of Africa: an identification manual, 1-93. Smithsonian Institution Press: Washington DC.

Armstrong, E., Leizagoyen, C., Martinez, A. M., Gonzalez, S., Delgado, J. V., & Postiglioni, A. (2011). Genetic structure analysis of a highly inbred captive

FCUP 179 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

population of the African antelope Addax nasomaculatus. Conservation and management implications. Zoo biology, 30(4), 399-411.

Arora, N., Nater, A., van Schaik, C. P., Willems, E. P., van Noordwijk, M. A., Goossens, B., ... & Kuze, N. (2010). Effects of Pleistocene glaciations and rivers on the population structure of Bornean orangutans (Pongo pygmaeus). Proceedings of the National Academy of Sciences, 107(50), 21376-21381.

Badgley, C. (2010). Tectonics, topography, and mammalian diversity. Ecography, 33(2), 220-231.

Barbosa, L. A. G. (1970). Carta fitogeográfica de Angola. Instituto de Investigação Científica de Angola. Oficinas Gráficas de Angola, Luanda.

Bersacola, E., Svensson, M. S., & Bearder, S. K. (2015). Niche partitioning and environmental factors affecting abundance of strepsirrhines in Angola. American journal of primatology, 77(11), 1179-1192.

Beuning, K. R., Zimmerman, K. A., Ivory, S. J., & Cohen, A. S. (2011). Vegetation response to glacial–interglacial climate variability near Lake Malawi in the southern African tropics. Palaeogeography, Palaeoclimatology, Palaeoecology, 303(1), 81-92.

Blaine, G. (1922). Notes on the Zebras and some Antelopes of Angola. In Proceedings of the Zoological Society of London 92(2): 317-339. Blackwell Publishing Ltd.

Booth, V. (2002). Current status of sable antelope classification in the Niassa National Reserve, Northern Mozambique. Unpublished report. Fauna and Flora International.

Bothma, J. du P., du Toit, J. G., & van Rooyen, J. (2010). Buying and selling wild animals. In: Game Ranch Management. 619-639. Van Schaik.

Burgess, N., Hales, J. A., Underwood, E., Dinerstein, E., Olson, D., Itoua, I., ... & Newman, K. (2004). Terrestrial ecoregions of Africa and Madagascar: a conservation assessment. Island Press.

Burrough, S. L., & Thomas, D. S. G. (2008). Late Quaternary lake-level fluctuations in the Mababe Depression: Middle Kalahari palaeolakes and the role of Zambezi inflows. Quaternary Research, 69(3), 388-403.

FCUP 180 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Burrough, S. L., Thomas, D. S., & Bailey, R. M. (2009). Mega-Lake in the Kalahari: a Late Pleistocene record of the Palaeolake Makgadikgadi system. Quaternary Science Reviews, 28(15), 1392-1411.

Cavalli-Sforza, L. L., & Edwards, A. W. (1967). Phylogenetic analysis. Models and estimation procedures. American journal of human genetics, 19(3 Pt 1), 233.

Chorowicz, J. (2005). The east African rift system. Journal of African Earth Sciences, 43(1), 379-410.

Clark, V. R., Barker, N., & Mucina, L. (2011). Taking the scenic route–the southern Great Escarpment (South Africa) as part of the Cape to Cairo floristic highway. Plant Ecology & Diversity, 4(4), 313-328.

Cohen, A. S., Stone, J. R., Beuning, K. R., Park, L. E., Reinthal, P. N., Dettman, D., ... & Brown, E. T. (2007). Ecological consequences of early Late Pleistocene megadroughts in tropical Africa. Proceedings of the National Academy of Sciences, 104(42), 16422-16427.

Cotterill, F. P. D. (2000). Reduncine antelope of the Zambezi basin. In: Timberlake, J. R. (ed.). Biodiversity of the Zambezi basin wetlands, 145-149. Bulawayo, Biodiversity Foundation for Africa, and Harare Zambezi Society.

Cotterill, F. P. D. (2003a). Geomorphological influences on vicariant evolution in some African mammals in the Zambezi Basin: some lessons for conservation. In Proceedings of the Ecology and Conservation of Mini-antelope: An International Symposium on Duiker and Dwarf Antelope in Africa. Filander Verlag, Fürth (pp. 11-58).

Cotterill, F. P. D. (2003b). A biogeographic review of tsessebe antelopes Damaliscus lunatus (Bovidae: Alcelaphini) in south-central Africa. Durban Museum Novitates, 28, 45-55.

Cotterill, F. P. D. (2005). The Upemba lechwe, Kobus anselli: an antelope new to science emphasizes the conservation importance of Katanga, Democratic Republic of Congo. Journal of Zoology, 265(2), 113-132.

Cotterill, F. P. (2006). The Evolutionary History and Taxonomy of the Kobus leche species complex of south-central Africa in the context of Palaeo-Drainage Dynamics (Doctoral dissertation, Stellenbosch: Stellenbosch University).

FCUP 181 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Crosmary, W. G., Chamaillé‐Jammes, S., Mtare, G., Fritz, H., & Côté, S. D. (2015). Decline of sable antelope in one of its key conservation areas: the greater Hwange ecosystem, Zimbabwe. African Journal of Ecology, 53(2), 194-205.

Crosmary, W. G., Loveridge, A. J., Ndaimani, H., Lebel, S., Booth, V., Côté, S. D., & Fritz, H., (2013). Trophy hunting in Africa: long-term trends in antelope horn size. Animal Conservation, 16, 648-660.

Cousins, J., Sadler, J., & Evans, J. (2010). The challenge of regulating private wildlife ranches for conservation in South Africa. Ecology and Society, 15(2).

Dabney, J., Knapp, M., Glocke, I., Gansauge, M. T., Weihmann, A., Nickel, B., Valdiosera, C., García, N., … & Meyer, M. (2013). Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proceedings of the National Academy of Sciences, 110(39), 15758-15763.

Davies, B. R., Beilfuss, R. D., & Thoms, M. C. (2001). Cahora Bassa retrospective, 1974- 1997: effects of flow regulation on the lower Zambezi River. In Verh. Int. Ver. Theor. Angew. Limnol./Proc. Int. Assoc. Theor. Appl. Limnol 27(4), 2149-2157.

Dunham, K. M. (2012). Trends in populations of elephant and other large herbivores in Gonarezhou National Park, Zimbabwe, as revealed by sample aerial surveys. African Journal of Ecology, 50(4), 476-488.

Earl, D. A. (2012). STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources, 4(2), 359-361.

East, R. (1999). IUCN/SSC Antelope Specialist Group. African antelope database 1998. 21: 434.

El Alqamy, H., Senn, H., Roberts, M. F., McEwing, R., & Ogden, R. (2012). Genetic assessment of the Arabian oryx founder population in the Emirate of Abu Dhabi, UAE: an example of evaluating unmanaged captive stocks for reintroduction. Conservation Genetics, 13(1), 79-88.

Emerson, B. C., & Hewitt, G. M. (2005). Phylogeography. Current biology, 15(10), R367- R371.

Estes, R. D. (2013). Hippotragus niger Sable Antelope. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 556-565. A&C Black.

FCUP 182 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Evanno, G., Regnant, S., & Goudet, J. (2005). Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology. 14, 2611-2620.

Excoffier, L., & Lischer, H. E. (2010). Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular ecology resources, 10(3), 564-567.

Falush, D., Stephens, M., & Pritchard, J. (2003). Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics, 164: 1567-1587.

Faulkes, C. G., Bennett, N. C., Cotterill, F. P. D., Stanley, W., Mgode, G. F., & Verheyen, E. (2011). Phylogeography and cryptic diversity of the solitary‐dwelling silvery mole‐rat, genus Heliophobius (family: Bathyergidae). Journal of Zoology, 285(4), 324-338.

Faulkes, C. G., Mgode, G. F., Le Comber S. C., & Bennett, N. C. (2010). Cladogenesis and endemism in Tanzanian mole-rats, genus Fukomys (Family: Bathyergidae): a role for tectonics? Biological Journal of the Linean Society. 100, 337-352.

Faulkes, C. G., Verheyen, E., Verheyen, W., Jarvis, J. U. M., & Bennett, N. C. (2004). Phylogeographical patterns of genetic divergence and speciation in African mole‐ rats (Family: Bathyergidae). Molecular Ecology, 13(3), 613-629.

Fennessy, J., Bock, F., Tutchings, A., Brenneman, R., & Janke, A. (2013). Mitochondrial DNA analyses show that Zambia's South Luangwa Valley giraffe (Giraffa camelopardalis thornicrofti) are genetically isolated. African Journal of Ecology, 51(4), 635-640.

Fernández, M. H., & Vrba, E. S. (2005). A complete estimate of the phylogenetic relationships in Ruminantia: a dated species‐level supertree of the extant ruminants. Biological reviews, 80(2), 269-302.

Flagstad, Ø., Syversten, P. O., Stenseth, N. C., & Jakobsen, K. S. (2001). Environmental change and rates of evolution: the phylogeographic pattern within the hartebeest complex as related to climatic variation. Proceedings of the Royal Society of London B: Biological Sciences, 268(1468), 667-677.

Godinho, R., Abáigar, T., Lopes, S., Essalhi, A., Ouragh, L., Cano, M., & Ferrand, N. (2012). Conservation genetics of the endangered Dorcas gazelle (Gazella dorcas spp.) in Northwestern Africa. Conservation Genetics, 13(4), 1003-1015.

FCUP 183 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Goudet, J. (2001). FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3.2). Available at: http://www2.unil. ch/popgen/softwares/fstat.htm.

Groves, C. P. (1983). A new subspecies of sable antelope, Hippotragus niger (Harris 1838). Revue de zoologie africaine, 97(4), 821-828.

Groves, C., & Grubb, P. (2011). Ungulate taxonomy. JHU Press.

Grubb, P., Sandrock, O., Kullmer, O., Kaiser, T. M., & Schrenk, F. (1999). Relationships between eastern and southern African mammal faunas. African biogeography, climate change, and human evolution, 253-267.

Happold, D., & Lock, M. (2013). The biotic zones of Africa. In Kingdon, J., Happold, D. C. D., Butynski, T. M., Hoffmann, M., Happold, M., Kalina, J., (eds). Mammals of Africa. 1:57-74 A&C Black.

Hassanin, A., Delsuc, F., Ropiquet, A., Hammer, C., van Vuuren, B. J., Matthee, C., ... & Couloux, A. (2012). Pattern and timing of diversification of Cetartiodactyla (Mammalia, Laurasiatheria), as revealed by a comprehensive analysis of mitochondrial genomes. Comptes rendus biologies, 335(1), 32-50.

Hassanin, A., & Douzery, E. J. (1999). The tribal radiation of the family Bovidae (Artiodactyla) and the evolution of the mitochondrial cytochrome b gene. Molecular phylogenetics and evolution, 13(2), 227-243.

Hewitt, G. M. (2004). Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 359(1442), 183-195.

Huntley, B. J. (1982). Southern African savannas. In Ecology of tropical savannas (pp. 101-119). Springer Berlin Heidelberg.

IUCN (2008). Hippotragus niger ssp. variani. SSC Antelope Specialist Group, The IUCN Red List of Threatened Species. Version 2014.2.

Jansen van Vuuren, B. J., Robinson, T. J., Vaz Pinto, P., Estes, R., & Matthee, C. A. (2010). Western Zambian sable: Are they a geographic extension of the giant sable antelope? South African Journal of Wildlife Research, 40(1), 35-42.

Jombart, T., Devillard, S., & Balloux, F. (2010). Discriminant analysis of principal components: a new method for the analysis of genetically structured populations. BMC genetics, 11(1), 94.

FCUP 184 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Kingdon (2013). Tribe Hippotragini, the horse like antelopes. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 544-545. A&C Black.

Lindsey, P. A., Barnes, J., Nyirenda, V., Pumfrett, B., Tambling, C. J., Taylor, A., & Rolfes, M. (2013). The Zambian wildlife ranching industry: scale, associated benefits, and limitations affecting its development. PLos ONE 8(12): e81761.doi:10.1371/journal.pone.0081761.

Livingstone, D., & Kingdon, J. (2013). The evolution of a continent: Geography and geology. In Kingdon, J., Happold, D. C. D., Butynski, T. M., Hoffmann, M., Happold, M., Kalina, J., (eds). Mammals of Africa. 1:27-42 A&C Black.

Lorenzen, E. D., Heller, R., & Siegismund, H. R. (2012). Comparative phylogeography of African savannah ungulates. Molecular Ecology, 21(15), 3656-3670.

Lorenzen, E. D., Masembe, C., Arctander, P., & Siegismund, H. R. (2010). A long‐ standing Pleistocene refugium in southern Africa and a mosaic of refugia in East Africa: insights from mtDNA and the common eland antelope. Journal of Biogeography, 37(3), 571-581.

Martin, R. B. (2003). Roan, Sable and Tsessebe – transboundary species project. Unpublished report. Windhoek: Ministry of Environment & Tourism and Namibia Nature Foundation: 96pp.

McDonough, M. M., Šumbera, R., Mazoch, V., Ferguson, A. W., Phillips, C. D., & Bryja, J. (2015). Multilocus phylogeography of a widespread savanna–woodland‐ adapted rodent reveals the influence of Pleistocene geomorphology and climate change in Africa's Zambezi region. Molecular ecology, 24(20), 5248-5266.

Maruyama, T., & Fuerst, P. A. (1985). Population bottlenecks and nonequilibrium models in population genetics. II. Number of alleles in a small population that was formed by a recent bottleneck. Genetics, 111(3), 675-689.

Matthee, C. A., & Robinson, T. J. (1999). Mitochondrial DNA population structure of roan and sable antelope: implications for the translocation and conservation of the species. Molecular Ecology, 8(2), 227-238.

Michalakis, Y., & Excoffier, L. (1996). A generic estimation of population subdivision using distances between alleles with special reference for microsatellite loci. Genetics, 142(3), 1061-1064.

FCUP 185 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Mikula, O., Šumbera, R., Aghová, T., Mbau, J. S., Katakweba, A. S., Sabuni, C. A., & Bryja, J. (2016). Evolutionary history and species diversity of African pouched mice (Rodentia: Nesomyidae: Saccostomus). Zoologica Scripta, 45(6), 595-617.

Mills, M. S. (2010). Angola’s central scarp forests: patterns of bird diversity and conservation threats. Biodiversity and Conservation, 19(7), 1883-1903.

Moodley, Y., Bruford, M. W. (2007). Molecular biogeography: towards an integrated framework for conserving pan-African biodiversity. PLoS ONE 2, e454. doi: 10.1371/journal.pone.0000454.

Nei, M., Maruyama, T., & Chakraborty, R. (1975). The bottleneck effect and genetic variability in populations. Evolution, 1-10.

Ogutu, J. O., & Owen‐Smith, N. (2005). Oscillations in large mammal populations: are they related to predation or rainfall? African Journal of Ecology, 43(4), 332-339.

Pitman, R. T., Fattebert, J., Williams, S. T., Williams, K. S., Hill, R. A., Hunter, L. T. B., … & Balme, G. (2016). The conservation costs of game ranching. Conservation Letters, 1-11.

Pitra, C., Hansen, A. J., Lieckfeldt, D., & Arctander, P. (2002). An exceptional case of historical outbreeding in African sable antelope populations. Molecular Ecology, 11(7), 1197-1208.

Pitra, C., Vaz Pinto, P., O’Keeffe, B. W., Willows-Munro, S., van Vuuren, B. J., & Robinson, T. J. (2006). DNA-led rediscovery of the giant sable antelope in Angola. European Journal of Wildlife Research, 52(3), 145-152.

Pritchard, J. K., Stephens, M., & Donnelly, P. (2000). Inference of population structure using multilocus genotype data. Genetics, 155(2), 945-959.

Raymond, M., & Rousset, F. (1995). An exact test for population differentiation. Evolution, 49(6), 1280-1283.

Rice, W. R. (1989). Analyzing tables of statistical tests. Evolution, 43(1), 223-225.

Ronco, P., Fasolato, G., Nones, M., & Di Silvio, G. (2010). Morphological effects of damming on lower Zambezi River. Geomorphology, 115(1), 43-55.

Rousset, F. (2008). genepop’007: a complete re‐implementation of the genepop software for Windows and Linux. Molecular ecology resources, 8(1), 103-106.

FCUP 186 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Shaw, P. A. (1985). Late quaternary landforms and environmental change in Northwest Botswana: the evidence of Lake Ngami and the Mababe depression. Transaction of the Institute of British Geographers, 10(3), 333-346.

Siege L., & Baldus R. D. (1999). Phylogenetische Differenzierung von Subpopulationen der Rappenantilope (Hippotragus niger) in Ostafrika. Tanzania Wildlife Discussion paper No 25. Deutsche Gasellschaft fuer Technische Zusammenarbeit, Dar es Salaam, Tanzania.

Straka, M., Paule, L., Ionescu, O., Štofík, J., & Adamec, M. (2012). Microsatellite diversity and structure of Carpathian brown bears (Ursus arctos): consequences of human caused fragmentation. Conservation genetics, 13(1), 153-164.

Taylor, A. W., Lindsey, P., & Davies-Mostert, H. (2016). An assessment of the economic, social and conservation value of the wildlife ranching industry and its potential to support the green economy of South Africa. Department of Environmental Affairs. Republic of South Africa.

Timberlake 2000 Biodiversity of the zambezi basin. Biodiversity Foundation for Africa. Bulawayo, Zimbabwe.

Timberlake, J., & Chidumayo, E. (2011). Miombo ecoregion vision report. Biodiversity Foundation for Africa, Famona, Bulawayo, Zimbabwe, 20, 1-76.

Timberlake, J., Goyder, D., Crawford, F., Burrows, J., Clarke, G. P., Luke, Q., ... & Alves, T. (2011). Coastal dry forests in northern Mozambique. Plant Ecology and Evolution, 144(2), 126-137.

Tinley, K. (1977). Framework of the Gorongosa ecosystem. Wildlife management. University of Pretoria (Doctoral dissertation, Thesis).

Toews, D. P., & Brelsford, A. (2012). The biogeography of mitochondrial and nuclear discordance in animals. Molecular Ecology, 21(16), 3907-3930.

Van Daele, P. A., Blonde, P., Stjernstedt, R., & Adriaens, D. (2013). A new species of African mole-rat (Fukomys, Bathyergidae, Rodentia) from the Zaire-Zambezi watershed. Zootaxa, 3636(1), 171-189.

Van Wyk, A. M., Kotzé, A., Randi, E., & Dalton, D. L. (2013). A hybrid dilemma: a molecular investigation of South African bontebok (Damaliscus pygargus pygargus) and blesbok (Damaliscus pygargus phillipsi). Conservation Genetics, 14(3), 589-599.

FCUP 187 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Vaz Pinto, P., Beja, P., Ferrand, N., & Godinho, R. (2016). Hybridization following population collapse in a critically endangered antelope. Scientific Reports, 6, 18788.

Vaz Pinto, P., Lopes, S., Mourão, S., Baptista, S., Siegismund, H. R., Van Vuuren, B. J., ... & Godinho, R. (2015). First estimates of genetic diversity for the highly endangered giant sable antelope using a set of 57 microsatellites. European Journal of Wildlife Research, 61(2), 313-317.

Vrba, E. S. (1995). The fossil record of African antelopes (Mammalia, Bovidae) in relation to human evolution and paleoclimate. In Vrba, E. S., Denton G. H., Partridge T. C., & Buckle L. H. (eds). Paleoclimate and evolution with emphasis on human origins, Ch 27, 385-424. Yale University Press, New Haven.

Vrba, E. S., & Gatesy, J. (1994). New Hippotragine antelope fossils from the Middle Awash, Ethiopia, in the context of the phylogeny of Hippotragini (Bovidae: Mammalia). Paleontol Afr, 31: 55-72.

Weir, B. S., & Cockerham, C. C. (1984). Estimating F-statistics for the analysis of population structure. evolution, 1358-1370.

FCUP 188 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

SI Sample Collection

The bulk of the sampling effort comprised 369 recent samples, dating from 1993 to 2015 (Table S1), compiled opportunistically and including fresh tissue, dried tissue, hair or blood samples. Most of the samples were collected as part of conservation or research efforts in protected areas, or obtained from animals killed in hunting concessions with in situ populations. Nevertheless a few samples attributed to Namibia and Zambia are or descend from translocated animals of known history, and were thus ascribed to their assumed ancestral origins. In most cases both individual relationships and recent local demography were unknown, making it possible that members of family groups are included in the data set. In order to fill in sampling gaps and to provide extra analytical detail from critical localities and/or perceived populations we added 31 historical samples from 15 different localities and obtained in museums (Table S1). The historical samples were dated between 1913 and 1964, and result from dry skin or bone fragments collected in US at the National Museum of Natural History, Washington; in Zimbabwe at the Natural History Museum of Zimbabwe, Bulawayo; in England at the Powell-Cotton Museum, Kent; in Belgium at the Royal Museum for Central Africa, Tervuren; in Portugal at the Museu da Caça e Arqueologia, Vila Viçosa, and at Instituto de Investigação Científica Tropical, Lisbon.

Table S1 - Geographic origins, assignment to groups and subgroups, and sample sizes

Origin Assignment Sample Size Locality Country Group Subgroup Historical Recent Total Kuando Kubango Angola Southern West-Southern 1 0 1 Mahango Namibia Southern West-Southern 0 18 18 Etosha/ Waterberg Namibia Southern West-Southern 0 22 22 Sioma N'Gwezi Zambia Southern West-Southern 0 1 1 Moremi Botswana Southern Mid-Southern 0 1 1 Linyanti Botswana Southern Mid-Southern 0 1 1 Chobe Botswana Southern Mid-Southern 0 8 8 Matetsi Zimbabwe Southern Mid-Southern 0 10 10 Triangle Zimbabwe Southern Mid-Southern 0 15 15 Mashonaland Zimbabwe Southern Mid-Southern 0 4 4 Kruger - Punda Maria South Africa Southern Mid-Southern 0 3 3 Kruger - Pretoriuskop South Africa Southern Mid-Southern 0 2 2 Limpopo Mozambique Southern Mid-Southern 0 1 1 Sofala/ Manica Mozambique Southern Mid-Southern 2 0 2 Gorongosa Mozambique Southern East-Southern 2 2 4 Marromeu - Coutada 10 Mozambique Southern East-Southern 0 5 5 Marromeu - Coutada 12 Mozambique Southern East-Southern 0 6 6 Mahimba Mozambique Eastern Mid-Eastern 0 4 4 Cabo Delgado Mozambique Eastern Mid-Eastern 0 1 1

FCUP 189 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Origin Assignment Sample Size Locality Country Group Subgroup Historical Recent Total Lugenda - Niassa Mozambique Eastern Mid-Eastern 0 2 2 Majune - Niassa Mozambique Eastern Mid-Eastern 0 4 4 Selous Tanzania Eastern Mid-Eastern 0 1 1 Chera Tanzania Eastern Mid-Eastern 2 0 2 Nenura Tanzania Eastern Mid-Eastern 2 0 2 Shimba Hills Kenya Eastern North-Eastern 3 6 9 Liwonde Malawi Eastern West-Eastern 0 4 4 Mawene Zambia Eastern West-Eastern 1 0 1 Chipingali Zambia Eastern West-Eastern 7 0 7 Mukungule Zambia Zambian West Zambia 0 1 1 Zambesi SC Zambia Zambian South Zambia 0 8 8 Lusaka District Zambia Zambian West Zambia 0 7 7 Lusaka-Kafue Zambia Zambian South Zambia 0 12 12 Sichifulo Zambia Zambian South Zambia 0 2 2 Mulobezi Zambia Zambian South Zambia 0 9 9 Nkala-Bili Zambia Zambian West Zambia 0 1 1 Kafue NP Zambia Zambian West Zambia 0 23 23 Mumbwa Zambia Zambian West Zambia 0 1 1 Lubungu Zambia Zambian West Zambia 0 2 2 Mufumbwe Zambia Zambian West Zambia 0 15 15 Zambesi NW Zambia Zambian West Zambia 0 8 8 West Lunga Zambia Zambian West Zambia 2 0 2 Nchila Zambia Zambian West Zambia 0 2 2 Mkushi Zambia Zambian Central Zambia 0 13 13 Lunkufi DR Congo Zambian West Zambia 1 0 1 Luombwa DR Congo Zambian West Zambia 1 0 1 Mulando DR Congo Zambian West Zambia 1 0 1 Kapiri DR Congo Zambian West Zambia 2 0 2 Moliro-Pweto DR Congo Zambian West Zambia 1 0 1 Chunya Tanzania West Tanzanian West Tanzanian 0 1 1 Ruaha Tanzania West Tanzanian West Tanzanian 0 1 1 Lukwati Tanzania West Tanzanian West Tanzanian 0 2 2 Rungwa Tanzania West Tanzanian West Tanzanian 0 11 11 Kizigo Tanzania West Tanzanian West Tanzanian 0 12 12 Wembere Tanzania West Tanzanian West Tanzanian 0 3 3 Mlele Tanzania West Tanzanian West Tanzanian 0 4 4 Ugalla Tanzania West Tanzanian West Tanzanian 0 18 18 Ugalla East Tanzania West Tanzanian West Tanzanian 0 6 6 Ugalla West Tanzania West Tanzanian West Tanzanian 0 3 3 Niensi Tanzania West Tanzanian West Tanzanian 0 7 7 Luganzo Tanzania West Tanzanian West Tanzanian 0 2 2 Moyowosi Tanzania West Tanzanian West Tanzanian 0 1 1 Kigosi Tanzania West Tanzanian West Tanzanian 0 18 18 Cangandala Angola Angolan Cangandala 0 9 9 Luando Angola Angolan Luando 3 46 49 Localities refer to the collecting site, except in cases where animals were previously translocated from a known origin; Assignment to Group and Subgroup resulted from average likelihood assignment tests performed with the program Structure; Old samples were collected between 1913 and 1964; Recent samples were collected between 1993 and 2015.

FCUP 190 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S2 - Hardy Weinberg calculations performed with ARLEQUIN 3.5 for 50 final loci, applied to the 400 individuals samples clustered into five main populations according to results obtained with STRUCTURE. Levels of significance (after Bonferroni correction: * P<0.05; ** P<0.001

GROUPS LOCI SOUTHERN EASTERN ZAMBIAN W TANZANIAN ANGOLAN

HPN17 0.00001** 0.45766 0.36823 0.00251 0.68253 HPN2 0.00000** 0.12373 0.00138 0.00040 0.02585 HPN10 0.37202 0.06588 0.13804 0.30426 1.00000 HPN12 0.02286 1.00000 0.00385 0.03743 0.90825 HPN8 0.05330 0.03904 0.00256 0.22900 0.05211 HPN1 0.04040 0.12712 0.00898 0.12479 0.92850 HPN13 0.00009* 0.23892 0.08551 0.45922 1.00000 HPN11 0.00000** 0.04810 0.00023 0.02325 0.02676 HPN20 0.07044 0.08468 0.95195 0.14162 0.41828 HPN6 0.19220 1.00000 1.00000 0.06393 monomorphic: HPN9 0.64438 0.33481 0.10276 0.45299 0.59152 HPN3 0.10655 0.14724 0.39007 0.02036 0.02729 HPN16 0.12029 0.00422 0.00000** 0.00937 0.03286 HPN23 0.47724 0.00102 0.14768 0.50689 1.00000 HPN25 0.32955 0.05463 0.01795 0.26138 1.00000 HPN31 monomorphic: monomorphic: 0.44422 0.63346 monomorphic: HPN38 monomorphic: 0.10403 monomorphic: 0.59196 monomorphic: HPN39 1.00000 1.00000 monomorphic: monomorphic: monomorphic: HPN41 monomorphic: 0.00123 0.00801 0.25167 0.75572 HPN45 0.16019 0.00012* 0.28440 0.50329 0.04615 HPN52 0.09746 1.00000 0.00683 0.31021 1.00000 HPN111 0.89030 0.61626 0.00743 0.71382 0.95762 HPN24 1.00000 0.32411 0.85297 0.75480 0.01721 HPN48 0.66542 1.00000 0.12239 0.98007 monomorphic: HPN50 0.93139 0.13782 0.38971 0.00315 0.18132 HPN60 0.06572 0.45389 0.00058 0.00000** 1.00000 HPN68 0.55825 0.42462 0.02895 0.87169 0.66858 HPN80 1.00000 1.00000 0.47083 1.00000 monomorphic: HPN81 0.65353 0.00237 0.00936 0.00459 monomorphic: HPN91 0.18883 0.70924 0.01097 0.96252 0.60369 HPN112 0.64932 0.12717 0.57940 1.00000 1.00000 HPN57 0.26282 0.09328 0.02595 0.40525 0.64406 HPN61 monomorphic: monomorphic: 0.05084 1.00000 1.00000 HPN72 monomorphic: monomorphic: monomorphic: 0.66733 monomorphic: HPN86 0.00201 0.10929 0.01163 0.31611 0.76139 HPN89 0.06147 0.32466 0.26887 0.98699 0.12587 HPN110 0.00014* 0.32616 0.73924 0.35432 0.29058 HPN27 0.08257 0.27041 0.22198 0.66565 0.28489 HPN28 0.62344 0.56234 0.39292 0.02629 0.37417 HPN29 1.00000 monomorphic: 1.00000 monomorphic: monomorphic: HPN36 0.26566 0.74473 0.00864 0.00035 monomorphic:

FCUP 191 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

GROUPS LOCI SOUTHERN EASTERN ZAMBIAN W TANZANIAN ANGOLAN HPN46 0.70225 0.09690 0.79507 0.38159 monomorphic: HPN64 0.83194 0.05869 0.00219 0.69526 1.00000 HPN92 0.00001** 0.80429 0.32176 1.00000 0.33268 HPN79 0.00230 0.04198 0.58502 0.66889 0.06824 HPN58 0.00070 0.05529 0.08817 0.88230 0.69782 HPN47 0.14213 0.09061 0.62695 0.04950 1.00000 HPN37 0.00308 0.29561 0.04811 0.07717 0.00079 HPN22 1.00000 monomorphic: 1.00000 0.01701 1.00000 HPN113 0.67928 0.38851 0.00066 0.14717 0.25101

Table S3 – List of localities and average likelihood of individual assignments (Qi) by origin to the five main populations, calculated with software STRUCTURE.

LOCALITY N SOUTHERN EASTERN ZAMBIAN W TANZANIA ANGOLAN Kwando Kubango 1 0,979 0,005 0,01 0,002 0,004 Mahango 18 0,993 0,002 0,003 0,001 0,001 Ancestry from Caprivi 22 0,992 0,001 0,004 0,002 0,001 Sioma Ngwezi 1 0,939 0,003 0,045 0,002 0,011 Moremi 1 0,932 0,003 0,049 0,007 0,009 Linyanti 1 0,981 0,008 0,003 0,005 0,003 Chobe 8 0,973 0,005 0,009 0,01 0,003 Matetsi 10 0,982 0,002 0,003 0,011 0,002 Triangle 15 0,98 0,009 0,007 0,001 0,003 Mashonaland 4 0,956 0,022 0,009 0,01 0,003 Punda Maria - Kruger NP 3 0,969 0,003 0,023 0,003 0,002 Pretoriuskop - Kruger NP 2 0,975 0,005 0,009 0,007 0,004 Limpopo NP 1 0,974 0,009 0,002 0,014 0,001 Sofala/ Manica 2 0,932 0,005 0,006 0,03 0,027 Gorongosa 4 0,845 0,127 0,007 0,009 0,012 Marromeu Cout. 11- 12 5 0,643 0,349 0,004 0,001 0,003 Marromeu Cout. 10 6 0,589 0,361 0,044 0,002 0,004 Mahimba 4 0,062 0,929 0,003 0,004 0,002 Cabo Delgado 1 0,006 0,985 0,002 0,005 0,002 Lugenda - Niassa 2 0,016 0,95 0,008 0,009 0,017 Majune - Niassa 4 0,002 0,985 0,002 0,009 0,002 Selous 1 0,003 0,99 0,002 0,003 0,002 Chera 2 0,01 0,979 0,002 0,008 0,001 Nenura 2 0,006 0,978 0,006 0,007 0,003 Shimba Hills 9 0,001 0,988 0,002 0,007 0,002 Liwonde 4 0,004 0,988 0,003 0,004 0,001 Mawene 1 0,003 0,568 0,422 0,002 0,005 Chipangali 7 0,029 0,671 0,289 0,007 0,004

FCUP 192 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

LOCALITY N SOUTHERN EASTERN ZAMBIAN W TANZANIA ANGOLAN Mukungule - Muchinga 1 0,01 0,228 0,757 0,001 0,004 Zambezi SC 8 0,035 0,004 0,957 0,001 0,003 Lusaka District 7 0,005 0,006 0,983 0,002 0,004 Lusaka - Kafue 12 0,02 0,012 0,96 0,003 0,005 Sichifulo 2 0,029 0,007 0,962 0,001 0,001 Mulobezi 9 0,031 0,014 0,944 0,005 0,006 Nkala-Bili 1 0,014 0,003 0,979 0,001 0,003 Kafue NP 23 0,006 0,003 0,984 0,003 0,004 Mumbwa 1 0,024 0,007 0,953 0,014 0,002 Lubungu 2 0,002 0,002 0,987 0,006 0,003 Mufumbwe 15 0,004 0,002 0,987 0,002 0,005 Zambezi NW 8 0,005 0,004 0,973 0,009 0,009 Lunga 2 0,002 0,004 0,983 0,008 0,003 Nchila 2 0,002 0,002 0,982 0,004 0,01 Mkushi 13 0,003 0,002 0,992 0,002 0,001 Lunkufi River 1 0,003 0,002 0,988 0,002 0,005 Luombwa River 1 0,005 0,28 0,707 0,002 0,006 Mulando 1 0,023 0,005 0,903 0,012 0,057 Kapiri 2 0,017 0,006 0,965 0,004 0,008 Moliro - Pweto 1 0,004 0,016 0,976 0,003 0,001 Chunya 1 0,003 0,002 0,002 0,992 0,001 Ruaha 1 0,002 0,004 0,002 0,99 0,002 Lukwati 2 0,002 0,005 0,025 0,962 0,006 Rungwa 11 0,005 0,003 0,007 0,983 0,002 Kizigo 12 0,004 0,007 0,012 0,975 0,002 Wembere 3 0,002 0,003 0,002 0,987 0,006 Mlele 4 0,002 0,007 0,003 0,986 0,002 Ugalla 18 0,008 0,005 0,015 0,97 0,002 Ugalla East 6 0,001 0,003 0,002 0,992 0,002 Ugalla West 3 0,001 0,003 0,002 0,993 0,001 Niensi 7 0,006 0,019 0,01 0,959 0,006 Luganzo 2 0,003 0,012 0,004 0,979 0,002 Moyowosi 1 0,002 0,003 0,002 0,992 0,001 Kigosi 18 0,003 0,003 0,004 0,989 0,001 Cangandala 9 0,001 0,001 0,001 0,001 0,996 Luando 46 0,001 0,002 0,005 0,001 0,991 Localities refer to the collecting site, except in cases where animals were previously translocated from a known origin. N=number of samples.

FCUP 193 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Table S4 Genetic differentiation (Pairwise Fst values) among the 12 subgroups of sable

ESO MSO WSO NEA MEA WEA CZA SZA WZA WTA CAN

MSO 0.09501 0

WSO 0.13160 0.07891 0

NEA 0.28536 0.23085 0.20988 0

MEA 0.19339 0.14398 0.13631 0.12889 0

WEA 0.17704 0.12673 0.13330 0.21989 0.11011 0

CZA 0.26107 0.25171 0.25051 0.30171 0.23977 0.23812 0

SZA 0.16063 0.14626 0.12150 0.20179 0.14504 0.11015 0.15384 0

WZA 0.16394 0.14989 0.13445 0.20976 0.15160 0.11451 0.12922 0.03544 0

WTA 0.20455 0.18454 0.19747 0.21633 0.11787 0.15990 0.26388 0.19526 0.17879 0

CAN 0.45746 0.41315 0.41460 0.39376 0.33447 0.45591 0.47190 0.31697 0.31483 0.36541 0

LUA 0.44674 0.40281 0.40940 0.40677 0.34880 0.42598 0.44271 0.30706 0.28450 0.34946 0.18387 WSO, West-Southern; MSO, Mid-Southern; ESO, East-Southern; NEA, North-Eastern; MEA, Mid-Eastern; WEA, West- Eastern; CZA, Central Zambia; SZA, South Zambia; WZA, West Zambia; WTA, West Tanzanian; CAN, Cangandala; LUA, Luando. All pairwise Fst values were highly significant (P<0.001) when testing with 1,000 permutations

Table S5 - Results for the Mantel Test to determine Isolation by Distance within the five main sable groups. The values of P were tested for 1,000 permutations.

Groups P Southern sable (Norigins=17) P<0.001 Eastern sable (Norigins=11) P<0.001 Zambian sable (Norigins=20) P=0.052 W. Tanzanian sable (Norigins=14) P=0.824

Fig. S1 – (a) Posterior likelihood [L(K)] values from 10 independent STRUCTURE runs of the whole dataset for with different K; (b) ΔK is based on the rate of change of log probability. The data suggests five genetic clusters.

FCUP 194 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. S2 – Hierarchical analyses for the Southern population, with (a) Posterior likelihood [L(K)] values from 10 independent STRUCTURE runs with different K; (b) ΔK is based on the rate of change of log probability.

Fig. S3 – Hierarchical analyses for the Eastern population, with (a) Posterior likelihood [L(K)] values from 10 independent STRUCTURE runs with different K; (b) ΔK is based on the rate of change of log probability.

Fig. S4 – Hierarchical analyses for the Zambian population, with (a) Posterior likelihood [L(K)] values from 10 independent STRUCTURE runs with different K; (b) ΔK is based on the rate of change of log probability.

FCUP 195 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. S5 – Hierarchical analyses for the West Tanzanian population, with (a) Posterior likelihood [L(K)] values from 10 independent STRUCTURE runs with different K; (b) ΔK is based on the rate of change of log probability.

Fig. S6 – Hierarchical analyses for the Angolan population, with (a) Posterior likelihood [L(K)] values from 10 independent STRUCTURE runs with different K; (b) ΔK is based on the rate of change of log probability.

FCUP 196 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP 197 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

CHAPTER 4

THE GIANT SABLE IN NATURAL HISTORY COLLECTIONS

Paper V Vaz Pinto, P., Rocha, J., Agnelli, P., Ferrand, N., & Godinho, R. Molecular contribution to resolve the origin of the mysterious

Florence horn. In preparation

FCUP 198 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP 199 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Molecular contribution to resolve the origin of the mysterious Florence Horn

Pedro Vaz Pinto1,2,3,4, Joana Rocha1,2, Agnelli, P5., Nuno Ferrand1,2,3,6, & Raquel Godinho1,2,3

1CIBIO/InBIO – Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Campus Agrário de Vairão, 4485-661 Vairão, Portugal

2Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 4169-007 Porto, Portugal

3ISCED – Instituto Superior de Ciências da Educação da Huíla, Rua Sarmento Rodrigues, Lubango, Angola

4The Kissama Foundation, Rua Joaquim Capango nº49, 1ºD, Luanda, Angola

5Natural History Museum of Florence, via Romana 17, 50125 Florence, Italy

6Department of Zoology, Faculty of Sciences, University of Johannesburg, Auckland Park 2006, South Africa

Abstract

Museums have remained a crucial repository of Natural History Collections for centuries, but its value has often been constrained by incomplete data particularly in relation to old specimens. With the advent of modern molecular tools the importance of such collections can be much enhanced. Here we address a remarkable museum specimen housed in the Natural History Museum of the University of Florence since 1873, a 61 inch-long scimitar-shaped horn that aroused the imagination of notable scientists and explorers for decades and known as The Florence horn. By analysing complete mitochondrial sequences from the Florence horn and an array of giant sable samples from various museums, and comparing with other sable sequences, we were able to confirm suspicions that the Florence horn could well be the earliest known specimen of

FCUP 200 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Hippotragus niger variani. We were also able to determine that the Florence horn carried a haplotype representative of a divergent mitochondrial lineage that may have survived until recently. This study resolves a long-standing mystery, providing accurate taxonomic identification and likely origin for an old puzzling specimen of unknown provenance, and adds a contribution to interpret historical demographic processes, that may have future application on the conservation of one of the most iconic and critically endangered antelopes in the world.

Introduction

Biological collections housed in natural history museums compile long-term data and total billions of specimens worldwide, representing an invaluable repository of biodiversity with direct application on scientific research and society (Boessenkool et al. 2010; Suarez & Tsutsui 2004). Recent developments in molecular tools, in particular genomics and ancient DNA techniques, have opened up natural history collections to a whole new array of studies (Barnett et al. 2007; Bi et al. 2013; Hartnup et al. 2011; Wandeler et al. 2007). Nevertheless, labelling inaccuracy or lack of supporting biological information and geographical origin can severely hinder the usefulness of museum specimens, although in some cases a genetic approach might bring clarification to otherwise doubtful interpretations (Barbanera et al. 2016; Boessenkool et al. 2010; Capellini et al. 2013). For example, the use of mitochondrial DNA has successfully revealed misidentifications of cryptic species (Barbanera et al. 2016), differentiation among similar species based on archaeological assemblages (Barnes & Young 2000; Yang et al. 2004), or identification of undetermined specimens of unknown provenance (Hartnup et al. 2011; Shepherd et al. 2013). A remarkable case saw a syntype specimen of Asian elephant Elaphas maximus dated from the eighteenth century and housed in the Swedish Natural History Museum in Stockholm, to be reappraised as an African elephant Loxodonta africana, while an even older specimen of undetermined origin, a well preserved elephant skeleton at the Natural History Museum of the University of Florence, was reclassified as a lectotype of E. maximus (Capellini et al. 2013).

The Natural History Museum of the University of Florence is the oldest public museum in Europe. Among its vast mammal collections, one mysterious specimen stand out and eventually came to be known as the Florence horn. This specimen consists of a 61 inch- long curved horn with a fragment of bone core, having arrived at the zoological collection in 1873 from uncertain provenance, with the origin simply catalogued as Africa Australe – southern Africa (Fig. 1a). The horn puzzled naturalists for years and could not be

FCUP 201 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) ascribed to a species, until the famous British hunter and explorer Frederick Courteney Selous visited the Museum and suggested that it could belong to a gigantic and yet undescribed form of sable antelope (Walker 2002). By the end of the eighteenth century few sable horns had been measured to surpass 40 inches, but the specimen could not be fitted to any other known species. Mesmerized by the Florence horn and as an avid and experienced African hunter who regarded sable as the most noble of antelopes, for the remaining of his active life Frederick Selous searched in vain for the special breed of grand sables (Walker 2002). Selous eventually died in Tanzania in 1917 while serving in action during the First World War, and apparently unaware that in the previous year a new sable subspecies had been described from Angola and which could provide answers to one of his long-life quests (Walker 2002).

The giant sable antelope Hippotragus niger variani, was described in 1916 by the mammal curator for the Natural History Museum of London, Oldfield Thomas, and honours Frank Varian, a British engineer working on the Benguela Railway who sent a series of skins and skulls specimens from the remoteness of central Angola (Thomas 1916; Walker 2002). Larger skulls, much longer horns and lack of facial stripes were among the phenotypical features (Fig. 1b) used to justify the new subspecies and were considered so strikingly different that a specific status was also considered (Blaine 1922; Thomas 1916). The existence of these sable provided a possible explanation to the origin of the Florence horn, and Thomas himself noted that “To this species there presumably belonged the 61-inch horn in the Florence museum, which had long been a wonder to all sportsmen…” (Thomas 1916).

Fig. 1 – (a) The Florence horn (Photo by P. Agnelli, 2010); and (b) Large giant sable bull in Luando Reserve (Photo by author, 2013).

Often praised as the most magnificent of all antelopes and regarded in Angola as the natural national symbol, the giant sable is also one of the most endangered African

FCUP 202 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) mammals (East 1999; Estes 2013). Only known from the Atlantic-flowing Kwanza river basin in central Angola, the giant sable was included in the Red List of Threatened Species as early as 1933, and in the late 1960’s its numbers were estimated to range from 1,000 to 2,500 individuals, and confined to two protected areas, Cangandala National Park and Luando Nature Strict Reserve (Estes & Estes 1974; Huntley 1972). Following the country independence from Portuguese colonial rule in 1975, a civil war lasted for over twenty years and led to the collapse of wildlife populations (Huntley 2017). Currently less than 200 giant sable survive and are subject of a conservation program in situ (Vaz Pinto et al. 2016).

In this paper we sought to establish the phylogenetic position of the Florence horn within H. niger using ancient DNA techniques, and further test the hypothesis that it could be the oldest known specimen of giant sable antelope, predating its formal description in more than forty years. In addition we discuss its mitochondrial haplotype within the context of the genetic diversity known for the subspecies.

Materials and Methods

Sampling

A sample from the horn of Florence was obtained by extracting a little piece of bone core from inside the horn base.

Complete mitochondrial sequences from all four traditionally recognized subspecies of sable antelope are featured in this work (Ansell 1972; Estes 2013) (Table 1), including representatives of the various populations identified in previous studies (Rocha et al. in prep.; Vaz Pinto et al. in prep.). Three extant giant sable sequences were chosen for corresponding to the only known extant haplotypes for the subspecies (Rocha et al. in prep). In addition, 12 historical samples were used to cover a maximum of past mitochondrial diversity available for the giant sable. The historical samples consisted of small pieces of bone material extracted from skulls that had been collected as hunting trophies, dating from 1920 to 1982, and housed in museums and private collections (Table 2). All historical samples of giant sable were originally collected in the southern range of LNSR.

FCUP 203 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) mtDNA extraction, amplification and sequencing

The Florence horn sample was extracted together with the additional 12 historic samples. DNA extractions were carried twice in two different dedicated laboratories for ancient DNA (first at the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany and then at the Research Center in Biodiversity and Genetic Resources in Porto, Portugal), using the extraction method proposed by Dabney et al., (2013). Double stranded DNA library preparation followed Meyer and Kircher (2010), with the modifications described in Kircher et al. (2012), using the regular Illumina multiplex adaptors. Four blank controls were added during both DNA extraction and library preparation, and were carried alongside the sample libraries through all subsequent steps. Libraries were amplified and purified as described in Dabney and Meyer (2012). Four overlapping biotinylated PCR products encircling H. niger whole mitochondrial genome were produced and used as probes for capture, using the Expand Long Range dNTPack kit (Roche) in a 25 uL PCR reaction, as described in Rocha et al. (in prep). MtDNA capture was performed using as in Fu et al. (2013) with modifications described in Rocha et al. (in prep).

Table 1. List of contemporary samples, with country of origin, population, information on provider of sample, and subspecies according to the classification proposed by Ansell (1972, 1988). Sample Country Population Provided by Subspecies HnNI131 Angola Cangandala NP The authors Hippotragus niger variani PA14 Angola Cangandala NP The authors Hippotragus niger variani HnN143 Angola Luando NSR The authors Hippotragus niger variani HnN85 Malawi Liwonde NP Andre Uys Hippotragus niger anselli HnN86 Malawi Liwonde NP Andre Uys Hippotragus niger anselli HnN186 Tanzania Ugalla GR Hans Siegismund Hippotragus niger kirkii HnN187 Tanzania Ugalla GR Hans Siegismund Hippotragus niger kirkii HnN268 Kenya Shimba Hills NP Hans Siegismund Hippotragus niger roosevelti HnN269 Kenya Shimba Hills NP Hans Siegismund Hippotragus niger roosevelti HnN347 Mozambique Nyasa Jorge Carriço Hippotragus niger roosevelti HnN250 Namibia Mahango NP Hans Siegismund Hippotragus niger niger HnN259 Botswana Chobe NP Hans Siegismund Hippotragus niger niger HnN31-2 Zimbabwe Matetsi Bruce Fivaz Hippotragus niger niger HnN219 Zimbabwe Triangle Hans Siegismund Hippotragus niger niger HnN240 Zimbabwe Triangle Hans Siegismund Hippotragus niger niger G138 Zambia Mkushi Bettine Jansen van Vuuren Hippotragus niger kirkii G196 Zambia Nchila GR Bettine Jansen van Vuuren Hippotragus niger kirkii G211 Zambia Nchila GR Bettine Jansen van Vuuren Hippotragus niger kirkii HnN213 Zambia Lusaka Hans Siegismund Hippotragus niger kirkii V6 Zambia Kafue NP Bettine Jansen van Vuuren Hippotragus niger kirkii Abbreviations: NP – National Park; NSR – Nature Strict Reserve; GR – Game Reserve

FCUP 204 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Sequencing and assembly followed the procedures of Rocha et al. (in prep). No evidence for contamination with H. niger exogenous DNA was observed. The complete mitochondrial consensus sequences were aligned using Mafft v.7.017b (Katoh and Standley, 2013). DNA extraction replicates were compared to confirm the authenticity of the determined consensus sequence and check for errors. After ensuring congruency of sequences, replicates were excluded from downstream analyses. Preliminary analysis did not show bias in the transition/transvertion ratio of historic samples compared to that of modern samples from the dataset of Rocha et al. (in prep).

Table 2. List of historical samples, with respective age, country of origin, information on provider of sample, and subspecies according to the classification proposed by Ansell (1972, 1988). Sample Year Country Provided by Subspecies HnNI126 1873 Unknown Nat. His. Museum, Florence Hippotragus niger variani HnNI142 1982 Angola The authors Hippotragus niger variani HnNI154 1925-1935 Angola Museu da Caça, Vila Viçosa Hippotragus niger variani HnNI155 1920-1960 Angola Museu da Caça, Vila Viçosa Hippotragus niger variani HnNI156 1920-1960 Angola Museu da Caça, Vila Viçosa Hippotragus niger variani HnNI158 1920-1960 Angola Museu da Caça, Vila Viçosa Hippotragus niger variani HnNI194 1922 Angola Powell-Cotton Museum, Kent Hippotragus niger variani HnNI195 1922 Angola Powell-Cotton Museum, Kent Hippotragus niger variani HnNI196 1922 Angola Powell-Cotton Museum, Kent Hippotragus niger variani HnNI197 1922 Angola Powell-Cotton Museum, Kent Hippotragus niger variani HnNI198 1922 Angola Powell-Cotton Museum, Kent Hippotragus niger variani HnNI203 1922 Angola Powell-Cotton Museum, Kent Hippotragus niger variani HnNI230 1964 Angola Raul de Sousa Machado Hippotragus niger variani

Data analyses

The total set of 33 complete mitochondrial genome sequences was aligned with Mafft v.7.017b and imported to DnaSP v.5.10 (Librado and Rozas, 2009) where it was translated to proteins. As no stop codons were found in unexpected positions of the mitochondrial genome, best-fit substitution models were estimated with JMODELTEST v.2.1.5 (Darriba et al. 2012) and the dataset was analyzed as a single partition in MEGA7 (Kumar et al. 2015). Specifically, the phylogenetic relationship of the different haplotypes was inferred by using the Maximum Likelihood method based on the Hasegawa-Kishino- Yano model as determined by Akaike’s information criterion (AIC) in JMODELTEST. The bootstrap consensus tree was inferred from 1000 replicates.Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Joining and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. A

FCUP 205 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 0.0500)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 48.5637% sites).

Results and Discussion

Complete mitochondrial sequences were successfully generated for the Florence horn and 12 historical giant sable samples, adding to the contemporary sequences present in our dataset. In total, ten different giant sable haplotypes were revealed and clustered in two separate lineages (GS1 and GS2) in the maximum likelihood tree (Fig. 2). The contemporary samples all nest within one of those lineages (GS1) while historical samples nest within both. The complete mitochondrial sequence of the Florence horn clearly nested within the GS2 lineage of giant sable with high level of support.

Fig. 2 - Maximum Likelihood tree of the Florence horn and 32 sable antelope (H. niger) whole mitochondrial genomes (12 newly sequenced H. n. variani and 20 samples from the reminder H. niger lineages distributed throughout the species geographic range). The bootstrap consensus tree was inferred from 1000 replicates. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test are shown next to the branches.Sample names are labelled in front of the tree tip and are based on the respective origin and date, and the two main giant sable lineages are signalled (GS1 and GS2). The red arrow signals the Florence horn. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated consisting in a final dataset of 16501 bp.

Our results provide robust evidence that the Florence horn is indeed from a giant sable antelope and must have been obtained in Angola. The fact that the collector is unknown and the entry date of 1873 may postdate the actual collecting by many years, much constrains our ability to infer how the specimen was obtained in Angola and sent to

FCUP 206 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Florence. The Angolan plateau was very poorly and irregularly surveyed up to mid- nineteenth century, when the first scientific expeditions sent a vast array of specimens to Europe (Crawford-Cabral & Mesquitela 1989). Although a few explorers criss-crossed the country and may have been close to the giant sable areas, they seem to have remained unaware of its existence (e.g. Pinto 1881; Capello & Ivens 1886). On the other hand, it has been documented that in the early twentieth century the giant sable was opportunistically killed by Portuguese settlers and targeted by Boer hunting parties (Blaine 1922; Varian 1953; Walker 2004), and likely such practices were long established, even if undocumented. Interestingly, there is one nineteenth century record of Hippotragus niger from Angola, having been catalogued by the famous Portuguese zoologist Barbosa du Bocage and consisting in a skull sent by the no less famous Austrian botanist Friederich Welwitsch (Bocage 1890; Thomas 1916). As Welwitsch made his Angolan collecting between 1853 and 1860 (Crawford-Cabral & Mesquitela 1989), it is possible that the skull was from a giant sable and even older than the Florence horn. However, the specimen was lost in the fire that tragically destroyed most of the Natural History Collections housed in the Museu Bocage in 1978. Considering that the haplotypes currently present in CNP have not been found in the historical samples, and that the lineage GS2 was recovered from several historical individuals from LNSR, the Florence horn may have also likely been obtained in LNSR.

The historical mitochondrial diversity of giant sable unveiled in this study, which includes eight haplotypes, contrasts sharply with the lack of diversity in contemporary samples. The Florence horn, not only contains a lost haplotype, but it represents the divergent lineage (GS2) that became extinct, probably as result of a recent bottleneck coinciding with the civil war that ravaged the country between 1975 and 2002 and much affected wildlife populations (Walker 2004; Huntley 2017). A pronounced loss of mitochondrial diversity is not unexpected in populations subjected to strong bottlenecks and has been often documented (e.g. Flagstad et al. 2003; Mondol et al. 2013). The most recent historical sample in particular, obtained from a trophy poached during the civil war in 1982 and carrying lineage GS2, provides further support for the bottleneck as the lineage has never been recorded since.

To the best of our knowledge, the Florence horn is the oldest confirmed specimen of Hippotragus niger variani and predating the taxon description by more than forty years (Thomas 1916). The resolution of this more than one century-old mystery was possible by applying ancient DNA techniques, highlighting the importance of Natural History Collections and how they can be enhanced by modern molecular tools. In particular, it also provides us with additional and important information to reconstruct the evolutionary

FCUP 207 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) history and past demography of one of the most iconic and critically endangered mammals in Africa.

Acknowledgements

The authors would like to thank the Powell-Cotton Museum, in Kent UK, and Casa de Bragança - Museu da Caça, in Vila Viçosa Portugal, for allowing access to old museum samples of giant sable; and to Raul Sousa Machado for kindly donating a sample from his private collection. We also thank Bettine Jansen van Vuuren, Hans Siegismund, Andre Uys, Bruce Fivaz and Jorge Carriço for providing additional samples from sable antelope. We thank Vladimir Russo and Abias Huogo for support in Angola. Financial support for this research was provided by the ExxonMobil Foundation. RG is supported by an IF2012 Research contract from FCT (Portuguese Science Foundation, IF/564/2012). This is scientific paper no. XX from the Portuguese-Angolan TwinLab established between CIBIO/InBIO and ISCED/Huíla, Lubango.

References

Ansell, W. F. H. (1972). Part 15: Order Artiodactyla. In: Meester J. A. J. & Setzer H. W. (eds). The Mammals of Africa: an identification manual, 1-93. Smithsonian Institution Press: Washington DC.

Barbanera, F., Moretti, B., Guerrini, M., Al-Sheikhly, O. F., & Forcina, G. (2016). Investigation of ancient DNA to enhance natural history museum collections: misidentification of smooth-coated otter (Lutrogale perspicillata) specimens across multiple museums. Belgian Journal of Zoology, 146(2), 101-112.

Barnes, I., & Young, J. P. W. (2000). DNA-based identification of goose species from two archaeological sites in Lincolnshire. Journal of Archaeological Science, 27(2), 91-100.

Barnett, R., Yamaguchi, N., Shapiro, B., & Nijman, V. (2007). Using ancient DNA techniques to identify the origin of unprovenanced museum specimens, as illustrated by the identification of a 19th century lion from Amsterdam. Contributions to Zoology, 76(2).

FCUP 208 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Bi, K., Linderoth, T., Vanderpool, D., Good, J. M., Nielsen, R., & Moritz, C. (2013). Unlocking the vault: next‐generation museum population genomics. Molecular ecology, 22(24), 6018-6032.

Blaine, G. (1922). Notes on the Zebras and some Antelopes of Angola. In Proceedings of the Zoological Society of London 92(2): 317-339. Blackwell Publishing Ltd.

Bocage de 1890: "Mammiferes d'Angola e du Congo (suite)". Jorn. Sci. math. phys. nat., (2) 2:1-33.

Boessenkool, S., Star, B., Scofield, R. P., Seddon, P. J., & Waters, J. M. (2009). Lost in translation or deliberate falsification? Genetic analyses reveal erroneous museum data for historic penguin specimens. Proceedings of the Royal Society of London B: Biological Sciences, rspb20091837.

Boessenkool, S., Star, B., Seddon, P. J., & Waters, J. M. (2010). Temporal genetic samples indicate small effective population size of the endangered yellow-eyed penguin. Conservation genetics, 11(2), 539-546.

Capelo, H., Ivens, R. (1886). De Benguela às Terras de Iaca: Descrição de uma viagem na África Central e Ocidental. Mem Martins, Portugal.

Cappellini, E., Gentry, A., Palkopoulou, E., Ishida, Y., Cram, D., Roos, A. M., ... & Barbagli, F. (2014). Resolution of the type material of the Asian elephant, Elephas maximus Linnaeus, 1758 (Proboscidea, Elephantidae). Zoological Journal of the Linnean Society, 170(1), 222-232.

Crawford-Cabral, J., & Mesquitela, L. (1989). Índice toponímico de colheitas zoológicas em Angola (Mammalia, Aves, Reptilia e Amphibia). Estudos, ensaios e doc./Inst. de investigacao ci tropical.

Dabney, J., Knapp, M., Glocke, I., Gansauge, M. T., Weihmann, A., Nickel, B, Valdiosera, C.,… et al. (2013). Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Procedings of the National Academy of Sciences of the United States of America 110:15758–63.

Dabney, J., & Meyer, M. (2012). Length and GC-biases during sequencing library amplification: a comparison of various polymerase-buffer systems with ancient and modern DNA sequencing libraries. Biotechniques 52:87–94.

FCUP 209 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Darriba, D., Taboada, G. L., Doallo, R., & Posada, D. (2012). jModelTest 2: more models, new heuristics and parallel computing. Nat. Methods 9:772.

East, R. (1999). IUCN/SSC Antelope Specialist Group. African antelope database 1998. 21: 434.

Estes, R. D. (2013). Hippotragus niger Sable Antelope. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 556-565. A&C Black.

Estes, R. D., & Estes, R. K. (1974). The biology and conservation of the giant sable antelope, Hippotragus niger variani Thomas, 1916. Proceedings of the academy of natural sciences of Philadelphia, 73-104.

Flagstad, Ø., Syversten, P. O., Stenseth, N. C., & Jakobsen, K. S. (2001). Environmental change and rates of evolution: the phylogeographic pattern within the hartebeest complex as related to climatic variation. Proceedings of the Royal Society of London B: Biological Sciences, 268(1468), 667-677.

Fu, Q., Meyer, M., Gao, X., Stenzel, U., Burbano, H., Kelso, J., & Pääbo, S. (2013). DNA analysis of an early modern human from Tianyuan Cave, China. Procedings of the National Academy of Sciences of the United States of America 110:2223–7.

Gippoliti, S., Amori, G., Castiglia, R., Colangelo, P., & Capanna, E. (2014). The relevance of Italian museum collections for research and conservation: the case of mammals. Rendiconti Lincei, 25(3), 351-357.

Hartnup, K., Huynen, L., Te Kanawa, R., Shepherd, L. D., Millar, C. D., & Lambert, D. M. (2011). Ancient DNA recovers the origins of Māori feather cloaks. Molecular biology and evolution, 28(10), 2741-2750.

Huntley B. J. (1972). Plano para o future da palanca real de Angola. Relatório do ecologista, serviços de protecção da fauna, Luando, Angola.

Huntley, B. J. (2017). Wildlife at war in Angola, the rise and fall of an African eden. Protea Book House. Pretoria, South Africa.

Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biolology Evol. 30:772–80.

Kircher, M., Sawyer, S., & Meyer, M. (2012). Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic Acids Resources 40:e3.

FCUP 210 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7):1870–1874.

Librado, P., & Rozas, J. (2009). DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451–2.

Meyer, M., & Kircher, M. (2010). Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harbor Protocol 2010:pdb.prot5448.

Mondol, S., Bruford, M. W., & Ramakrishnan, U. (2013). Demographic loss, genetic structure and the conservation implications for Indian tigers. Proceedings of the Royal Society of London B: Biological Sciences, 280(1762), 20130496.

Pinto, S. (1881). Como eu atravessei Africa. 2 Bde.

Suarez, A. V., & Tsutsui, N. D. (2004). The value of museum collections for research and society. BioScience, 54(1), 66-74.

Thomas, O. (1916). A new sable antelope from Angola. In Proc. Zool. Soc. London. Part 1: 298-301.

Varian, H. F. (1953). Some African Milestones. G. Ronald.

Vaz Pinto, P., Beja, P., Ferrand, N., & Godinho, R. (2016). Hybridization following population collapse in a critically endangered antelope. Scientific Reports, 6, 18788.

Walker, J. F. (2004). A certain curve of horn: the hundred-year quest for the giant sable antelope of Angola. Grove/Atlantic, Inc.

Wandeler, P., Hoeck, P. E., & Keller, L. F. (2007). Back to the future: museum specimens in population genetics. Trends in ecology & evolution, 22(12), 634-642.

Yang, D. Y., Cannon, A., & Saunders, S. R. (2004). DNA species identification of archaeological salmon bone from the Pacific Northwest Coast of North America. Journal of Archaeological Science, 31(5), 619-631.

FCUP 211 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

CHAPTER 5

GENERAL DISCUSSION

FCUP 212 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

FCUP 213 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

5.1 Evolutionary history of Hippotragus niger

One of the main objectives of this thesis was to address the evolutionary history of sable antelope, exploring the phylogeographic patterns that shaped the species lineage diversification throughout the Pleistocene to the present. The particular case of the giant sable antelope was instrumental as a catalyst for several of the research lines adopted, being explored in more detail and interpreted into specific context. The results obtained and here discussed may provide much clarification on outstanding questions raised in previous studies.

5.1.1 Evidence for an extinct taxon

The existence of a highly divergent mitochondrial lineage in west Tanzania was first revealed by Mathee & Robinson (1999), subsequently shown to be co-distributed with other lineages, and explained as resulting from long-distance colonization events and intraspecific hybridization between two extant sable subspecies (Pitra et al. 2002). However, our study using mitogenomes, nuclear markers, and a more extensive dataset, offers an alternative scenario, in which the presence of the divergent (relic) mitochondria in west Tanzania is hypothesized as a signature of past introgressive hybridization between sable and an extinct Hippotragus species (Paper III). The increased resolution in divergence time estimates expected to result from the use of full mitochondrial sequences (Rokas & Carroll 2005; Duchêne et al. 2011; Liedigk et al. 2012; Zinner et al. 2013) provides support to our claim, as the TMRCA (time to the most recent common ancestor) between the relic and niger-like lineages was estimated at 1.2 – 1.8 mya and the genetic diversity found within the relic mitochondria suggested a coalescence time of 0.080 mya (Paper III). This period was characterized by increased climate variability in the early Pleistocene, thought to have much affected vegetation and promoted bursts of biotic change (deMenocal 2004), and leading to species diversification in African mammals (Fernandéz & Vrba 2005; Moodley & Bruford 2007; Johnston et al. 2012; Jónsson et al. 2014; Fennessy et al. 2016). The overall time frames estimated for divergence and coalescence of the relic lineage cannot be explained by one recent intraspecific hybridization event.

More importantly, the use of microsatellites revealed the west Tanzanian sables to be a homogenous and discrete unit within H. niger, and well differentiated from remaining sable populations (Paper IV), thus providing compelling evidence for the relic

FCUP 214 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) mitochondria to be a ghost from the past. Conflicting results obtained from mitochondrial and nuclear markers, also known as mitonuclear discordance, have been increasingly reported and its primary causes are generally attributed to hybridization followed by mitochondrial capture or incomplete lineage sorting (Funk & Omland 2003; Toews & Brelsford 2012). The latter occurs when the different lineages haven’t been able to fully sort out at the time of speciation (Maddison 1997), and it may be difficult to distinguish from hybridization as the two processes can generate similar phylogenetic trees (Funk & Omland 2003; Meng & Kubatko 2009; McKay & Zink 2010). However, the high phylogenetic divergence of the two mitochondria present in west Tanzania and the very clear geographical pattern, are what would be expected to result from hybridization, and not from incomplete lineage sorting (Funk & Omland 2003; Toews & Brelsford 2012). Theoretical and empirical studies have shown how the mtDNA from a native “donor” species can be captured via hybridization and introgression, by an initially rarer invading species, leading to the native mitochondria effectively surfing the wave of the expanding invasive genome (Currat et al. 2008; Excoffier et al. 2009; Wielstra et al. 2012) (Fig. 5.1). Equivalent mitonuclear discordant patterns found in mammals were shown to have been caused by ancient mitochondrial introgression events involving closely-related species (Melo-Ferreira et al. 2005; Roca et al. 2005; Alves et al. 2008; Hailer et al. 2012). One remarkably similar case of mitochondrial introgression between bovid species also estimated to have occurred in the early Pleistocene (1.34±0.45 mya) was uncovered in southeast Asia, was equally misinterpreted and initially led to a blurred taxonomic definition (Hassanin & Ropiquet 2007; Galbreath et al. 2006). We therefore conclude that the genetic patterns obtained in west Tanzania are evidence of a former contact zone with gene flow between sable and a sister-species that subsequently became extinct. Interestingly, the possibility of introgression between sympatric and relatively less closely-related H. niger and H. equinus was demonstrated in Angola during this study, and will be discussed in Section 5.2.

FCUP 215 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5.1 – Schematic representation of mitochondrial capture following hybridization and introgression. (a) illustrates the transfer of mtDNA across a species boundary through introgressive hybridization. Colours correspond to different species, large circles represent nuclear genomes and the small circles the mtDNA. (b) depicts the red species getting swamped by an expanding green species, and yet resulting in asymmetric mitochondrial introgression. This Figure is adapted from Wielstra et al. (2012).

The assignment of the relic lineage to a known fossil species is tempting, yet seriously constrained by both temporally and geographically incomplete fossil record series (Patterson et al. 2014). Although bovids, including hippotragine, tend to be well represented among African fossil mammal assemblages (Gentry 1978; Vrba & Gatesy 1994; Peart 2015), large gaps remain and records can be further blurred by taphonomic biases (Patterson et al. 2014). In contrast with Southern Africa, where five Hippotragus species have been identified from fossil records spanning from the late Miocene to the present (Luyt et al. 2000; de Ruiter 2003; Klein et al. 2007; Reynolds & Kibii 2011; Patterson et al. 2014; Peart 2015), in eastern Africa only H. gigas and H. equinus have been recorded (Vrba & Gatesy 1994; Patterson et al. 2014; Bibi et al. 2015; Peart 2015; Rowan et al. 2015), and only the latter species was present since 0.5 mya (Peart 2015; Rowan et al. 2015). The oldest known fossils of H. niger were estimated at 1.4 mya and collected in South Africa (de Ruiter 2003; Sutton et al. 2009; Gibbon et al. 2014; Peart 2015), where they seem to have been contemporaneous with H. equinus, H. leucophaeus and H. gigas, but the species remains conspicuously absent in fossil beds from eastern Africa. Therefore the only candidate Hippotragus fossil species known from eastern Africa is H. gigas, but both their First Appearance Date (FAD) in the fossil record (FAD=2.8 mya) and analyses of morphological characters (Vrba & Gatesy 1994; Peart

FCUP 216 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

2015), indicate that the most recent common ancestor with H. niger much predates the origin of the relic lineage. More likely, the relic mitochondria evolved in allopatry following an early colonization of the precursor of H. niger from southern into eastern Africa. It is reasonable to expect that future palaeontological research will unearth H. niger-like fossils in eastern Africa dating from the middle to late Pleistocene, and these possibly may correspond to the relic, sister-species of sable antelope.

5.1.2 Diversification and structuring

The genetic findings are not incompatible with the fossil record in suggesting a southern African origin for the sable antelope, and both full mitochondrial sequences and nuclear markers indicate an extensive and well-defined genetic structure within the species, having diversified during the middle and late Pleistocene (Papers III and IV). We interpret the various episodes of lineage divergence as derived by vicariant allopatric speciation. The use of an extensive data set that covers the entire species’ range distribution, and the inclusion of historical samples that predate recent human-induced bottlenecks and animal translocations, provided additional resolution power to interpret the patterns of diversification and differentiation.

Phylogeographic patterns

Our mitogenomic approach provides strong evidence for a diversification of sable antelope lineages (hereafter excluding the relic lineage) throughout the middle to late Pleistocene, during which at least nine distinct haplogroups have survived to modern days and are coherently clustered in six geographical regions, namely eastern Africa (haplogroups E1 + E2), most of southern Africa north of the Zambesi (S1a + S2a), southern Africa south of the Zambesi (S1b + S2b), west Tanzania (C1a), Malawi and east Zambia (C1b) and Angola (C2) (Figure 5.2). The first diversification event that we can trace within H. niger, split an eastern (E) and a south-central (SC) lineages, estimated to have occurred at around 0.35 mya (95% CI, 0.27 - 0.43) (Paper III). An early phylogeographic break separating eastern from southern sable populations is not surprising and follows a well-established biogeographic pattern in African mammals longitudinally oriented south – east (Arctander et al. 1999; Grubb 1999; Flagstad et al. 2001; Girman et al. 2001; Muwanika et al. 2003; Lorenzen et al. 2008, 2010, 2012; Kingdom 2013; Fennessy et al. 2016). A contemporaneous separation was found for example between eastern and southern lineages of wild dog (Girman et al. 2001). It is

FCUP 217 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) likely that this deeper split resulted from a vicariance event after the colonization by sable of the relatively lower altitude savannas present to the east of the EARS and eastern arc mountains, interestingly a region where congeneric roan has never been recorded. The next split at approximately 0.20 mya (95% CI, 0.16 - 0.25), gave origin to a southern (S) and central (C) lineages, with the former likely evolving in the southernmost regions of the continent and the latter possibly occupying the central African plateau. A vicariance signature, inferred to have occurred around 0.15 mya (95% CI, 0.11 - 0.20 mya), when both the eastern and the southern lineages originated the E1 and E2, and S1 and S2, respectively, was preserved even though both sub-lineages subsequently reconnected (E1+E2; S1+S2). Such pattern of diversification with two contemporaneous splits followed by reconnection can be better explained by temporary isolation in refugia in response to environmental stress. Interestingly, the southern lineage (S1+S2) subsequently underwent another vicariance episode in the late Pleistocene, at around 0.075 to 0.098 mya, to attain the modern configuration, with different sets of haplogroups (S1a+S2a; S1b+S2b) separated by the Zambezi river (Paper III). Previous studies based on mitochondrial fragments and limited data sets lacked resolution power, and misinterpreted the apparent paraphyly within southern African sable as evidence for the absence of coherent structure (Mathee & Robinson 1999; Pitra et al. 2002, 2006; Jansen van Vuuren et al. 2010). The central lineage (C) experienced at least two consecutive diversification episodes between 0.07 and 0.16 mya that originated three haplogroups that are currently present in two regions delimited by the EARS (C1a and C1b), and in central Angola (C2). This phylogeographic pattern linking central Angola to the rift region is notably challenging to interpret, when similar biogeographical examples are lacking. As the most direct corridor through the Angolan and Zambian plateaus was likely to have been occupied by sables from the southern lineages and there is no evidence suggesting secondary contact, we hypothesize that the central population must have evolved in the Congo basin before diversifying into lineages that were environmentally pushed southwards into Angola and eastwards into the rift region.

FCUP 218 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5.2 – Schematic representation of the mitochondrial diversification within sable and the extinct Hippotragus taxon, based on full mitochondrial genomes. The mitochondrial main lineages are represented by capital letters, the haplogroups are highlighted in different colours, and the introgression event that led to the capture of the Relic mitochondria in west Tanzania is represented by the dashed vertical line. The haplogroups are distributed according to five geographical populations recognized by nuclear DNA.

Population structure

The results obtained with Bayesian clustering and non-model multivariance analyses using microsatellites provided additional support for a well-defined geographical structure of sable populations. We found sables to cluster into five highly significantly differentiated populations or clusters, namely Eastern, Southern, Zambian, West Tanzanian and Angolan (Paper IV). The Angolan cluster displayed the highest values of differentiation (average pairwise Fst=0.33) but it is likely that historical bottlenecks affecting the giant sable population may have promoted genetic drift, and such effect is known to increase the genetic variance detected between populations (Nei et al. 1975; Maruyama & Fuerst 1985). With the exception of the Eastern group which included sables from two geographical mitochondrial clusters (carrying mitochondrial haplogroups E1+E2 and C1b respectively), the remaining four populations matched one geographical cluster each (Fig. 5.3). Evidence of admixture was found in two regions, in central Mozambique between the Eastern and Southern clusters, and in east Zambia between the Eastern and Zambian clusters. Nevertheless in both cases the amount of admixture

FCUP 219 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) recorded from neighbouring geographic regions had relatively low average probabilistic assignments (Qi≤0.36) and there was no mitochondrial introgression detected, suggesting that gene-flow is moderate, and likely sex-biased and mediated by male dispersal (Paper IV).

Fig. 5.3 – Sable distribution and clustering inferred from (a) mitochondrial DNA showing the various haplogroups clustered in six main geographical regions; and (b) nuclear DNA depicting the main five populations or clusters. Note the mito- nuclear discordance in the regions of east Zambia and Malawi.

At a finer scale and within all main five clusters except West Tanzanian, we were able to detect significant differentiation across subpopulations. Within the Eastern cluster, we found three subpopulations that showed significant genetic isolation by distance and appear to be geographically separated and subject to different environmental conditions. The northernmost and smaller Eastern subpopulation is currently confined to Shimba Hills in Kenya where it is found in a mosaic of coastal forests and woodlands, while the largest subpopulation ranges from eastern Tanzania to northern and central Mozambique and its distribution matches the eastern miombo woodlands ecoregion. The Shimba sable seems to be a relic subpopulation, evidencing low nuclear genetic diversity, yet interestingly still holding the two mitochondrial eastern haplogroups (E1 and E2). The third eastern subpopulation corresponds to sable present in Malawi and East Zambia. This latter subgroup is geographically isolated by the EARS and inhabits higher altitude miombo. More importantly, the fact that these sable carry a mitochondria (C1b) more closely related to West Tanzanian and Angolan haplogroups, suggest that this subpopulation may have resulted from a relatively recent expansion of eastern sable

FCUP 220 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) across the rift, eventually swamping the local sable population. Within the Southern group, also three subpopulations evidenced a significant correlation between divergence and geographical distance, although the distribution boundaries seem more diffuse. The westernmost subpopulation includes sable from the Caprivi Strip in Namibia and southeastern Angola, in a region defined by the Okavango basin. The easternmost subpopulation is found in coastal Mozambique south of the Zambesi, and the third subpopulation corresponds to the remaining southern sable found in Botswana, Zimbabwe, South Africa and southern Mozambique. The relatively low genetic diversity of Namibian sable may reflect a recent bottleneck, and interestingly the nuclear DNA of sables from Zambia and Botswana between the Zambesi and the Okavango delta, showed admixture between subpopulations, suggesting that barriers that may have promoted incipient diversification are no longer active. The three subpopulations in the Zambian group inferred from Bayesian clustering analyses could not be correlated with isolation by distance and also lacked discernible and coherent geographical boundaries. The most divergent subgroup, in central Zambia, was also the non-Angolan population with the least genetic diversity tested, but this is a confined subpopulation with a known history of human-induced bottlenecks (Don Stacey pers. comm.), and genetic drift may explain the divergence observed. The remaining two subpopulations tentatively ascribed to southern and western Zambia had the lowest score of divergence between any sable subpopulations (pairwise Fst=0.035) and overlapped in distribution. Possibly these latter two subpopulations reflect a past vicariance episode in Zambia, but the signal has since been blurred due to landscape transformations, population expansions or even by translocations. In Angola the existence of two clearly defined and significantly divergent subpopulations was expected, considering that Cangandala and Luando reserves are separated by a large river but mostly because of the dramatic bottlenecks that have affected these subpopulations in recent years, which in the case of Cangandala led to the survival of one single and highly inbred herd (Papers I & II).

5.1.3 Factors shaping the evolution of sable since the Pleistocene

The evolutionary history of sable unfolding in southern, central and eastern Africa within the last 0.4 million years shows obvious similarities with overall patterns of diversification of mammals in subtropical Africa (Hewitt 2004a), including rodents (McDonough et al. 2015), and medium to large-sized antelopes such as the woodland-browsing bushbuck (Moodley & Bruford 2007), the arid-adapted oryx (Osmers et al. 2012) or the savanna- dwelling hartebeest (Flagstad et al. 2001), suggesting that they may have been caused

FCUP 221 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) by common drivers. On the other hand, such factors affecting local environmental conditions, by creating and eliminating barriers to gene flow that promote vicariance episodes and secondary contacts, may be still active and shaping current population structure as observed. It is likely that various bovid populations will respond differently to the complex interplay between climatic oscillations reflected on local vegetation and physical barriers, depending on their own adaptations, degree of specialization and dispersal capabilities. Here we tackle separately the two main abiotic factors presumably underlying sable diversification processes.

Climate

It is generally assumed that climatic oscillations during the Pleistocene have been a main driver for African faunal speciation, a function of the expansion of grasslands and savannas at the expense of moist forests during glacial periods, in tandem with contraction of drier habitats during interglacials (DeMenocal 2004; Hewitt 2004b; Dupont 2011), leading to frequent species isolation in refugia (Hewitt 2000; Flagstad et al. 2001; Lorenzen et al. 2012; Osmers et al. 2012). However, this may be an oversimplification that does not reflect properly the complexity of poorly understood processes across heterogeneous landscapes (Bonnefille 2006; Cowling et al. 2008; Moorley & Kingdon 2013). It has also been argued that periods of intense Pleistocene climate instability promoted the diversification and lineage turnover of mammal taxa, including bovids, by stimulating variability and natural selection (Trauth et al. 2007; Potts 2013). Moreover, the last period of extreme climatic variability, alternating intense droughts with wet phases, was associated with a marked eccentricity of the earth’s orbit which lasted approximately from 0.356 to 0.050 mya (Potts 2013), and it can hardly be ignored that this period encompasses all major diversification events estimated to have occurred within sable antelope (Fig. 5.4). This time frame correlation makes it likely that the last climate instability period was instrumental in originating the various sable lineages, by influencing the vegetation diversification and distribution, establishing new barriers, and forcing local populations to adapt to fast changing conditions.

FCUP 222 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Figure 5.4 - Reconstruction of Southern hemisphere palaeoclimates adapted from Cotterill (2006) and EPICA (2004). The marine isotopic stages are listed in (a) and the blue shade represents cold periods; (b) represents values of marine oxygen isotopic records, used as indicator of temperature change; (c) depicts the various splitting events with 95% HPD boxes inferred by the mitochondrial genomes, that originated the various sable haplogroups; (d) represents the values of dust mass accumulation as a measure of aridification.

Tracing vegetation changes over time at habitat scale in the highly heterogeneous savanna biome (Du Toit & Cumming 1999) has been much dependant on pollen records (Dupont et al. 2000; Beauning et al. 2011; Dupont 2011). The frequently changing assemblages of savanna tree communities (Du Toit & Cumming 1999; Kruger 2015) adding to high climate instability during critical periods and the low chronological resolution of splitting times, makes it virtually impossible to link with precision sable diversification episodes to specific climatic events. Most splitting date estimates have confidence intervals that span across several cold periods and interglacials (Fig. 5.4). To complicate matters further, the general assumption that savanna-adapted populations of grazing bovids will expand during cold periods and contract into refugia during interglacials (Flagstad et al. 2001; Bobe & Behrensmeyer 2004; Lorenzen et al. 2010, 2012), may well not apply to sable antelope, a species highly specialized to mesic woodlands. It is possible that the same dry conditions that have promoted grasslands and the expansion of most large-sized grazing bovids in Africa, may also have caused vicariance in sable, while the wet and warmer conditions that are thought to have led to

FCUP 223 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) isolation in refugia of many bovids, may have provided opportunities for sable expansion into new regions. Dry conditions generally associated with glacial periods may not only have contracted the African rain forest belt but also mesic woodlands, when most of the central Zambesian plateau became occupied by arid savannas and the Kalahari dunes were formed (Thomas & Shaw 1991; Cotterill 2006; Moore et al. 2008). Miombo may have been severely constrained during late Pleistocene droughts (Scott 1999; Beuning et al. 2011; Kruger 2015), and in regions where it has disappeared in the warmer Holocene, it may have subsisted in altitudinal refugia (Kruger 2015). Dry environmental conditions could have pushed sable populations into moister refugia, along coastal areas, at higher altitude, or into the Congo basin. Specifically the Elster glaciation, corresponding to the Marine Isotopic Stage (MIS) 10, estimated to have peaked between 0.334 and 0.364 mya (Lisiecki & Raymo 2005; Cotterill 2006;) and known to have led to pronounced glacial formation in eastern African mountains (Shanahan & Zreda 2000; Osmaston & Harissson 2005), may have set the stage for the earliest sable intraspecific diversification event with southern populations bridging across the EARS to colonize the warmer lowlands of eastern Africa.

The period between 0.221 and 0.195 mya has been suggested as one of the warmest and wettest periods of the last 0.3 my, when the palynological record found in Angolan marine sediments indicate a southward expansion of miombo woodlands (Ning & Dupont 1997). It is not clear how climate may have induced the segregation of the central and southern lineages at around 0.203 mya, but this apparently benign period for Brachystegia-dominated vegetation was immediately followed by inferred sharp climatic fluctuation between 0.195 and 0.185 mya. It is likely that glacial periods that much constrained rain forests and miombo woodlands (Hamilton & Taylor 1991; Maley 1996; Ning & Dupont 1997), drove eastern and southern sable populations to become isolated into coastal or altitudinal moister refugia, while pushing central African sables towards the Congo basin. One of the most severe climatic periods was the Illinoian glaciation corresponding to the MIS 6, when prolonged dry and cold conditions lasting from 0.185 to 0.130 mya, matched perfectly the estimated contemporaneous splitting dates that originated two mitochondrial lineages both in eastern (E1 and E2) and southern (S1 and S2) Africa. The diversification episodes that originated the various central African sable lineages are not obviously associated with climatic events, although suggesting they may have occurred during interglacials. Sable populations evolving in the moister conditions of central Africa closer to the equator, may have expanded during dry colder periods but would be forced into refugia under warmer and wetter climates. Global climate may have also entered an extreme period of instability at the end of the Pleistocene caused by

FCUP 224 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) orbital eccentricity (Scholz et al. 2007), when a series of intense and brief megadroughts severely impacted African vegetation patterns between 0.135 and 0.075 mya (Cohen et al. 2007; Scholz et al. 2007; Beuning et al. 2011), intensifying after an initial recovery of rainforests and expansion of miombo at the onset of the last interglacial (LIG) between 0.128 – 0.118 mya (Maley 1996; Shi & Dupont 1997; Dupont et al. 2000). Abrupt forest expansion during the LIG may have forced sable populations that had spread into the Congo basin during MI 6 to seek refuge in more temperate regions, thus originating the rift valley and Angolan maternal lineages (C1a, C1b, C2), and this is congruent with a sharp southern shift of miombo after 0.130 mya inferred from pollen records obtained off the Angolan coast (Shi & Dupont 1997). One megadrought between 0.105 and 0.093 mya was especially severe (Cohen et al. 2007), and may have drastically contracted Brachystegia woodlands (Shi & Dupont 1997), coinciding with known mammal diversification events in the Zambesi region (Moodley & Bruford 2007; McDonough et al. 2015). Some climatic instability forcing adjustment of local vegetation was inferred from marine and lacustrine pollen cores between 0.075 and 0.052 mya (Shi & Dupont 1997; Dupont et al. 2000; Beuning et al. 2011), but the date of 0.070 mya also marks the start of a general transition towards moister and more stable conditions (Scholz et al. 2007). Since 0.030 mya till present the miombo woodland component as measured by Brachystegia and Uapaca pollen deposition in Malawi lake remained evenly balanced even during the Last Glacial Maxima (LGM) (Beuning et al. 2011), although the core site off the coast of Angola indicated reduced traces of miombo between the LGM and the beginning of the Holocene before increasing to current levels (Shi & Dupont 1997; Dupont et al. 2000). Also a relatively stable community composition of large mammals has been suggested for the end of the Pleistocene into the Holocene, based on fossil records from the Cape region of South Africa (Vector & Verrelli 2010).

Our findings strongly suggest that climatic oscillations throughout the mid and late Pleistocene can be used to explain diversification episodes within sable antelope populations, but also highlight the difficulty of pinpointing specific events and location of refugia, particularly in regions so geologically diverse and experiencing such highly unstable climate (Potts 2013). The relative period of climate and vegetation stability in subtropical Africa over the last 0.050 my (Beuning et al. 2011; Dupont 2011; Potts 2013) also suggests that other types of abiotic factors such as geomorphological features may be currently shaping population structure and diversification within sable. This will be analysed in detail in the next section.

FCUP 225 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Geophysical barriers

The importance of geomorphological barriers in shaping patterns of vicariance in large African mammals has been recognized but is often underestimated (Cotterill 2003a), and its role is difficult to isolate because it can leave a subtle signal that tends to be inextricably linked with climatic change (Cotterill 2003a, 2006; Moore et al. 2008). Although our findings suggest that climatic fluctuations must have played a decisive role in promoting diversification within sable populations by affecting the distribution of vegetation, the current geographically discrete structure revealed in this work is remarkably well-framed by only a few geomorphological boundaries. These physical features may not have been the main or the only factor triggering isolation events, but effectively constitute extrinsic barriers to gene flow. With the exception of the giant sable which is an outlier that will be dealt separately in following sections, all remaining phylogeographic units and extant populations are constrained by the Zambezi drainage and/or by the complex system of rifts, faults and mountain ranges that characterizes eastern and south-central Africa. The spatial arrangement of these features can be loosely caricaturized as a gigantic X-shaped structure with one arm representing the western branch of the Eastern African Rift System (EARS) and the other the Eastern Arc Mountains (EAM) linking to the Muchinga escarpment and Luangwa valley (Fig. 5.5).

Figure 5.5 – Main African geomorphological features that may have influenced diversification and determine current population distribution of Hippotragus niger, with the exception of the outlier giant sable antelope. 1 – Western Branch of the EARS; 2 – The ancient EAMs and southern Tanzanian highlands; 3 – Luangwa valley running in parallel with the Muchinga escarpment; 4 – Zambezi River. The arid corridor is defined by the axle 2 and 3.

FCUP 226 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

The EARS is one of the most spectacular geological features in the African continent, broadly defined as a huge fracture zone, forming a series of several thousand kilometres long aligned succession of adjacent tectonic graben basins (Chorowicz 2005). The western branch of the EARS runs for over 2,100 km roughly oriented N-S or NW-SE, and includes massive continental lakes that put together contain about 25% of the world’s unfrozen surface fresh water. The EARS is of relatively recent origin having remained tectonically active throughout the Pleistocene (Chorowicz 2005), experiencing frequent volcanism and rifting episodes, and subject to lake level fluctuations as result of tectonic realignments and climate instability (Delvaux et al. 1998; Branchu et al. 2005; Maslin & Christensen 2007; Mortimer et al. 2007). Unlike the physical barrier of the EARS which mostly consist of rift lakes and a mosaic of tectonically active landscapes, the axle defined by the EAM and Luangwa-Muchinga, is mostly an ecological barrier determined by both topography and local climate. The EAM is of much older origin than the EARS but, most importantly, has maintained a long-term climatic stability characterized by moist highlands under the influence of the Indian Ocean (Burgess et al. 2007) and pronounced aridity on the western slopes caused by the rain shadow effect (Coe & Skinner 1993; Fjeldsa & Lovett 1996; Grubb 1999). The xeric conditions to the west of the EAM have led to the southward extension of the Somalia arid zone or centre of endemism (Huntley 1982; White 1983), demarcating a broad region dominated by semi- arid grasslands and savannas (White 1983; Burgess et al. 2004). Similarly, the deep middle-Zambezi and Luangwa valleys are also characterized by much drier conditions than the surrounding plateaus, as evidenced by arid savannas replacing miombo in the river valleys (Huntley 1982). This long-established drought corridor is thought to have facilitated faunal exchange between Somalia and South-west arid zones, while at the same time constraining the E-W connectivity among taxa adapted to forests or mesic- woodland habitats (Ansell 1978; Huntley 1982; White 1983; Grubb et al. 1999; Cotterill 2003a). The biogeographical significance of this axle led Grubb et al. (1999) to refer to it as Kingdon’s line, in analogy to the Wallace’s line (Fig. 5.5). A number of topographic features add to the barrier effect of the arid corridor, such as the Muchinga escarpment framing the western ridge of the Luangwa valley, and a combination of volcanoes and highlands at the junction with the EARS and connecting to the EAM (Cotterill 2003a; Branchu et al. 2005).

Many African mammal taxa have evolved and are currently present in disjunct distributions in relation to the Kingdon’s line and EARS, with some of the best examples found among rodents (Faulkes et al. 2004, 2011; Verheyen et al. 2011; Colangelo et al.

FCUP 227 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

2013; McDonough et al. 2015) and ungulates (Arctander et al. 1999; Van Hooft et al. 2002; Cotterill 2003a,b; Muwanika et al. 2003; Moodley & Bruford 2007; Lorenzen et al. 2010; Fennessy et al. 2013, 2016; Stoffel et al. 2015). Nevertheless, the sable antelope may provide one of the best illustrative cases of diversification framed by these geomorphological barriers.

It is possible that intense tectonic and volcanic activity in the region between lakes Rukwa and Malawi during the early Pleistocene were implicated in the earliest splitting event that led to the evolution of sable and Hippotragus sp. on either side of the EARS. The frequent geological activity between Rukwa and Malawi grabens has been termed as a tectonic valve for biodiversity evolution (Cotterill 2003a,c), and may have been breached again only once by modern sable, around 0.095 mya, triggering the separation of central lineages (C1a and C1b) and the subsequent swamping of the relic lineage (R). The central lineages C1a and C1b evolved during the late Pleistocene on opposite relative sides of both the EARS and the Kingdon’s line and separated from southern and eastern lineages, and results from nuclear DNA show that these geomorphological features have constituted effective and long-term barriers to gene flow, especially in maintaining the isolation of west Tanzanian sable. However these barriers proved to be less effective in isolating sable present in east Zambia and Malawi, as they seem to have been recently swamped by eastern sable probably moving across the Shire River around the southern tip of EARS. Nuclear DNA also suggest porosity across the relatively narrow arid corridor that runs along the Luangwa valley and Muchinga escarpment.

The Zambezi basin is the most relevant draining river system in south-central Africa, having remained tectonically active into geological modern times and subjected to frequent rearrangements (Moore & Larkin 2001; Cotterill 2003a). The current configuration of the Zambezi and its tributaries reflects a complex history of capture events of formerly endorheic river courses (Cotterill 2003a; Moore et al. 2008). The upper Zambezi, Kafue and Cuando rivers used to flow into the Kalahari to feed Paleolake Makgadikgadi and associated basins, and are thought to have been captured by the middle Zambezi in the mid-Pleistocene (Thomas & Shaw 1992; Moore & Larkin 2001), but linkages may have been subsequently broken and unbroken several times leading to reversals and temporary re-establishment of Kalahari paleolakes (Moore & Larkin 2001; Cotterill 2003a; Moore et al. 2008; Burrough et al. 2009a,b). Burrough et al. (2009a,b) identified at least seven high-stands for megalake Makgadikgadi throughout the late Pleistocene and although these stages mostly coincide with high lake phases in eastern Africa, the amount of water necessary to keep the water balance rules out climatic and environmental causes as the sole or main driver behind the promotion of

FCUP 228 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) these lakes (Nugent 1990; Burrough et al. 2009a). Interestingly the reestablishment of Paleolake Makgadikgadi in two stages between around 0.112 and 0.089 mya was asynchronous with rift lake levels and may have overlapped with megadrought periods (Burrough et al. 2009a; Scholz et al. 2007). Lake Makgadikgadi may have had a surface area between 90,000 and 120,000 km2, far larger than any other freshwater body surface today (Moore et al. 2008; Podgorski et al. 2013) (Fig. 5.6), and the analyses of river profile just above and below Victoria Falls has been interpreted as possible evidence of two distinct episodes of Zambezi diversion towards the Kalahari and tentatively estimated to have occurred in the mid-Pleistocene (Cotterill 2006; Moore et al. 2008).

Fig. 5.6 - Distribution of five major sable populations by grading colour scheme and 12 subpopulations represented by letter codes, as inferred from nuclear DNA (W-S West-Southern; M-S Mid-Southern; E-S East-Southern; N-E North-Eastern; M-E Mid-Eastern; W- E West-Eastern; C-Z Central Zambia; S-Z South Zambia; W-Z West Zambia; WTA West Tanzania; PNC Cangandala; LSR Luando). Directionality of male-mediated introgression is depicted by arrows. The major rift and fault lines associated with the EARS were adapted from Goudie (2005); approximate high flood line of palaeolake Magkadikgadi is represented by dashed blue line, and adapted from Burrough & Thomas (2008).

The role of the Zambezi drainage evolution in shaping diversification of African mammals is well known, with examples spanning from rodents (Van Daele et al. 2004, 2007; Verheyen et al. 2011; McDonough et al. 2015) to antelopes (Cotterill 2003a,b, 2005, 2006). The two pairs of sable haplogroups from the southern lineage that cluster on each side of the Zambezi river (S1a+S2a; S1b+S2b) (Fig. 5.3a) suggest the occurrence of at

FCUP 229 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) least one discrete Zambezi event in the late Pleistocene between 0.075 and 0.098 mya, maybe linked to a river diversion towards the Kalahari lakes before regression to attain its modern profile. If the high-stand of Paleolake Makgadikgadi centred around 0.112- 0.092 mya (Burrough et al. 2009a) had derived from a Zambezi diversion into the Kalahari, and if the environmental conditions were adequate this could have promoted the expansion of haplogroups S1+S2 on both sides before becoming isolated when the Zambezi regained its former channel. A model has also been proposed suggesting that overtopping of Lake Makgadikgadi around the peak of the LIG period caused the middle Zambezi to recapture the upper Zambezi, yet this process would not have been completed in one single stage, but rather through a lengthy mechanism of repeated switching of drainage governed in a complex way by rifting (Nugent 1990). Such scenario would be consistent with southern sable populations evolving on opposite sides of the Zambezi since around 0.075-0.098 mya and thus defining a possible date for when the Zambezi adopted last hisits current configuration.

It seems possible that also the diversification of most sable subpopulations identified in this study have to some degree been influenced by geomorphological barriers. Three well-differentiated populations were found south of the Zambezi (Paper IV). The west- southern population is centred in the Caprivi strip and southeastern Angola and seemed distinct from remaining southern sable, although several individuals from the Okavango delta region and one sampled in the region between the Cuando and Zambezi rivers proved to be intermediate (Paper IV). This can be likely explained by population isolation and re-expansion driven by temporary reestablishment of Kalahari lakes and the intermittent rearrangement of the Chobe river into the Holocene (Kramer et al. 2003; Nash et al. 2006; Burrough & Thomas 2008). The east-southern population is known from Gorongosa National Park and Marromeu Game Reserve in central Mozambique and is apparently confined to a coastal area between the Urema rift valley - a southernmost extension of the EARS (Chorowicz 2005), and the coast and lower Zambezi. The eastern sable comprises also three populations, of which the north-eastern is only present in the coastal areas of southern Kenya and northern Tanzania - to the north of the volcanic and fault belt of northern Tanzania (Chorowicz 2005), while the west-eastern population occurs in eastern Zambia and Malawi between the Kingdon’s line and the EARS, and has been addressed earlier. On the Zambian plateau three populations showed varying degrees of differentiation although lacking a clear geographical pattern. Nevertheless it seems possible that at least the south-Zambian and west-Zambian may reflect incipient diversification triggered by Kafue River rearrangements, similarly to what has been detected in rodents (Van Daele et al. 2007;

FCUP 230 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

McDonough et al. 2015). Finally, the two Angolan subpopulations are separated by one large river, but these will be discussed in a subsequent section.

5.1.4 Insights into the intraspecific taxonomy

The use of subspecies as a taxonomic tool to characterize intraspecific diversity can be a controversial topic, but the discussion is beyond the scope of this study. Infraspecific taxa may represent the evolutionary potential within a species and can prove important in assisting biological conservation policy (Haig et al. 2006; Mallet 2007), and have been routinely applied on sable antelope.

Intraspecific sable taxonomy traditionally relied on a few morphometric traits applied to different geographical regions, but the efforts were based on incomplete sampling and results were often inconsistent. Most widely used classifications reported four to five subspecies of sable (Ansell 1972, 1978; Groves 1983; Ansell & Dowsett 1988; East 1998; Skinner & Chimimba 2005; Estes & Kingdon 2013). In spite of its shortcomings, the classic four-to-five subspecies taxonomy was a broadly coherent classification and remained relatively undisputed until the advent of the first molecular approaches. Several genetic studies on the sable antelope have been published since, but these relied on small mitochondrial fragments (Mathee & Robinson 1999; Pitra et al. 2002, 2006; Jansen van Vuuren et al. 2010). These studies based on incomplete sampling efforts may also have misinterpreted some phylogeographic patterns, and these limitations severely hampered their contribution for the intraspecific sable taxonomy, which ironically became more confusing. Our current study based on a very extensive and comprehensive sampling effort, resorting to full mitochondrial genomes and adding highly informative autosomal markers on a population genetics approach, much improves the understanding of how different sable populations are differentiated and geographically distributed.

The population genetics results based on Bayesian clustering and non-model multivariance analyses clearly defined the existence of five well-differentiated clusters, and were broadly conformant with both the phylogeographic approach based on mitogenomics which identified six geographically discrete mitochondrial groupings, and with the traditional five subspecies taxonomy. All six sable populations as geographically defined in relation to the various main geophysical boundaries (EARS, Kingdon’s line, Zambezi River) plus the Angolan isolate, corresponded perfectly to six mitochondrial groupings (Fig. 5.3a), but were shown by nuclear DNA to represent five genetic populations (Fig. 5.3b) yet not coinciding with the traditional five subspecies (Fig. 5.7).

FCUP 231 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

When compared against the mitogenomics results, traditional taxonomy fails to recognize as a discrete unit the west Tanzanian population confined between the EARS and the arid corridor to the west of the EAM, which has been suggested by Ansell (1972) and followed by subsequent authors as likely H. n. kirkii. However, our findings based in an extensive microsatellite approach, prove that they constitute a genetic unit that must have evolved with relatively low levels of gene flow with neighbouring populations from northern Zambia or eastern Tanzania. The only incongruence between mtDNA and microsatellites was found in eastern Zambia and Malawi, between the Luangwa valley and lake Nyasa, a region where one single and unique haplogroup has been found (C1b) and whose sable had been suggested to correspond to the fifth subspecies H. n. anselli, although many authors conservatively ascribed them to H. n. kirkii. Our population genetics results suggest that these sable do not display enough differentiation to be accepted as a main unit, and are instead part of the eastern cluster. Alltogether, our results strongly support the recognition five sable subspecies (Fig. 5.7), namely H. n. niger south of the Zambezi in northeastern Namibia, southwestern Zambia, Botswana, Zimbabwe, northern South Africa and southern Mozambique; H. n. kirkii north of the Zambezi and west of the EARS and Kingdon’s line, in Zambia and southern DRC; H. n. variani isolated in central Angola; H. n. roosevelti to the east of EAM and lake Nyasa in southeastern Kenya, eastern Tanzania and northern Mozambique, and to the west of lake Nyasa in Malawi and eastern Zambia; and an undescribed taxa H. n. ssp. in western Tanzania confined between the EARS and the EAM. Introgression and possible intergradation among subspecies was only detected across two contact zones, one along the Luangwa valley between H. n. roosevelti and H. n. kirkii, and the other near the mouth of the Zambezi River, between H. n. roosevelti and H. n. niger. However, in both hybrid zones, all individuals tested clustered within the boundaries of each respective geographical group and no mitochondrial introgression has yet been detected between these groups, strongly suggesting male-mediated dispersal as the mechanism promoting gene flow.

FCUP 232 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5-7 - Graphic representation of: (a) Bayesian phylogenetic reconstruction based on whole mitochondrial genomes with the various haplogroups identified and highlighted in different colours. All nodes represented in the tree had 100% posterior probability, and 95% HPD intervals for node ages are shown by horizontal grey boxes; (b) Geographical clusters of haplogroups; (c) Traditional intraspecific taxonomy based on a five subspecies classification, following Ansell (1978) and Ansell & Dowsett (1988), and highlighted by colours. Boxes were defined by geographical populations, separating regions that more often have been classified differently. Subspecific names are given, and within brackets are alternative nomenclature given by different authors; (d) Proposed taxonomy as suggested by our studies, with each coloured box corresponding to a major genetic group and representing one subspecies; (e) Geographical populations derived from the populations genetics results; (f) Average values of differentiation Fst, represented by horizontal bars for each population considered, and by vertical bars for each major genetic group.

At a finer scale, our results also unveiled substructuring patterns suggesting a total of twelve well-differentiated populations, some of which we believe may represent incipient subspeciation events, and we thus recommend they should be considered as management units. This is the case for three populations identified within H. n. niger, including a west-southern population that may have been isolated during the Holocene by the Kalahari lakes, which interestingly has even been suggested based on a few phenotypic characters to represent the subspecies H. n. kaufmanni (but see Harper 1945; Ansell 1974); and an east-southern population occurring between the Urema rift valley and the lower Zambezi river, being also a population that shows some nuclear introgression from H. n. roosevelti. The boundaries between these and the mid-southern population are no longer present in the Kalahari and are likely very porous across the Urema rift, but there may be conservation value in recognizing them as management

FCUP 233 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) units. We can also distinguish three populations within H. n. roosevelti, which could be regarded as discrete management units. A north-eastern population is present in southeastern Kenya and northeastern Tanzania to the north of the volcanic belt of northern Tanzania and corresponding to the most ecologically extreme sable population - closest to the equator and adapted to a non-typical transitional habitat; a mid-eastern lowland population spanning across eastern Tanzania and northern Mozambique; and the west-eastern population across the rift in the plateau of eastern Zambia and Malawi. Within H. n. kirkii even though we identified three genetically differentiated populations it may not make sense to make them correspond to management units. The most differentiated unit is likely an artefact of a very recent bottleneck in a captive population in central Zambia, while the other two showed relatively lower levels of differentiation and lacked coherent geographical boundaries. For the H. n. ssp. in west Tanzania no subpopulations were detected, and for H. n. variani two were identified corresponding to both protected areas where they occur on either side of the Luando River. However, as one giant sable population had recently been rescued with individuals from the other population, they now both effectively constitute one single management unit.

5.1.5 Explaining H. n. variani

The evolutionary history of the giant sable, its origin, relationships with other populations and isolation in central Angola is puzzling for a number of reasons and lacks adequate comparative biogeographical examples. In a previous section we have suggested the giant sable ancestor to have originated in the central Congo basin, before entering Angola accompanying a southward expansion of woodlands that followed a transition from a dry to a moister climatic phase, and constrained by Congo tributaries. Eventually the ancestral population would have reached the Kwanza basin where they are found today, but the factors keeping them isolated and preventing subsequent expansion eastwards and southwards have never been explained. The current giant sable range is to a large extent confined within geomorphological barriers such as the large rivers Kwanza and Luando, by hills and swamps to the south, and mountain ranges to the west and northeast. While these boundaries must exert a powerful effect in constraining the extant populations, it seems unlikely that they could explain a long-standing isolation. Furthermore, the Cangandala population present to the north of Luando River and a few scattered records of animals reported outside the two protected areas, suggest that sable can, at least occasionally, cross those putative barriers. The absence of sable antelopes throughout most of the Angolan plateau coinciding with the Angolan Miombo Woodlands

FCUP 234 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Ecoregion (AMWE) (Burgess et al. 2004) is intriguing, as sable are miombo specialists and other than in Angola its global distribution matches almost perfectly that of the miombo (Fig. 5.8). This apparently incongruent distribution of giant sable raised questions about its long-term isolation (Crawford-Cabral & Veríssimo 2005; Wessels 2007), as it could be an artefact caused by anthropomorphic-driven extinctions or reflecting the lack of faunal surveys across eastern Angola (Estes & Estes 1974; Wessels 2007). Our genetic results not only provide compelling evidence for a giant sable independent evolutionary path rooted back in late Pleistocene, but also could not detect a signal of recent gene flow with other subspecies, thus supporting the long-term isolation hypothesis.

It is unknown when the ancestral giant sable reached the Kwanza basin for the first time after their split from the central African lineages, and if the region has been colonized more than once, or where have they expanded or taken refuge in response to climatic fluctuations. Again, a northern corridor seems the most parsimonious scenario. Periods of colder and drier climatic conditions than today could have pushed sables further north in Angola into the Congo basin, but once conditions reversed it would be hard for them to move elsewhere because of the massive Congo tributaries oriented S-N and would likely force a return to the Kwanza basin. Conversely, if warmer and moister climatic conditions would have caused giant sables to move southwards or eastwards across the Bié plateau and into the Zambezi and Okavango drainages, then once conditions reversed, they would just as likely have continued a south-easterly route and eventually meet southern sable populations, but we have no genetic signal in support of such scenario. Finally, a further western refuge seems extremely unlikely as the region is bordered by the Angolan highlands and separated from the semi-arid coastal plain by the great Angolan escarpment. We therefore hypothesize that the Kwanza basin has represented a southern and stable refugia for giant sable in periods of relatively warm and wet climate, while during spells of cold drier climate they may have expanded to the north. Drought periods may have been frequent in Angola, and there is evidence suggesting reduced rainfall in the Okavango headwaters even during the Holocene (Nash et al. 2006), thus further contributing to the north-western isolation of giant sable.

In any case, these evolutionary dynamics don’t fully explain why the giant sable remains confined to the Kwanza basin, and apparently unable to expand into the vast and contiguous miombo woodlands of eastern and southeastern Angola. The key probably lies in the very particular local ecological conditions present in the Kwanza basin, to which the giant sable has adapted (Huntley 1972). Although most of the Angolan plateau is covered with miombo woodlands and it can be roughly all included within the

FCUP 235 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) subcomponent AMWE, there may well be regional differences at a finer scale sufficiently important to render vast stretches of woodland unsuitable to even the ultimate miombo- specialist herbivore. The interaction among topography, precipitation and temperature are important factors in defining the overall distribution boundaries of the miombo woodlands (Timberlake & Chidumayo 2011), but they can vary extensively across its range according to local and specific floristic, structural, edaphic, climatic and topographic conditions (Huntley 1982; Timberlake & Chidumayo 2011).

In terms of abiotic features, the AMWE lies at relatively high altitude, relatively warm temperatures and subject to a high rainfall regime (Burgess et al. 2004; Huntley 1982) (Appendix Fig. Ap1-2). Situated at the extreme northwest of the AMWE, the giant sable region stands out as a narrow strip of depressed land, consisting of smooth plains at elevations between 1,000 and 1,200 m, and almost completely surrounded by hilly terrain at higher ground (Appendix Fig. Ap3). The geological processes that originated this depressed enclave are not obvious and it has even been suggested that could have resulted from an ancient paleolake (Barbosa 1970). In any case, the geology profoundly affected the local edaphic conditions, the area consisting of alisols, characterized by fine- textured sedimentary soils originated from clayish-schists, and contrasting sharply with the arenosols, named after the aeolian Kalahari sands that cover the surrounding areas and most of the remaining AMWE (Diniz 2002; Jones et al. 2013) (Fig. 5.8a). The soil type appears to constitute a fundamental distinctive feature, being richer in nutrients and holding more organic matter in the giant sable region, and more acutely leached and dystrophic on the surrounding plateau (Diniz 2002), therefore these characteristics should be reflected on the local vegetation (Appendix Ap. 4). Detailed studies on the vegetation of the Kwanza basin are lacking, but Barbosa (1970) distinguished seven subunits of miombo woodlands in Angola, with one type specific to the Keve and Kwanza basins, characterized by open woodland floristically dominated by Brachystegia spiciformis, B. wangermaneeana, B. boehmii and Julbernardia paniculata (Fig. 5.8 and Fig. Ap4). Interestingly, the same author commented on the peculiar ecological conditions in the giant sable region and in particular the extensive and unusual open areas in well-drained soils, known as anharas (Barbosa 1970). Two structurally divergent types of anharas are present and may be equally important as food source for sable: the grassy-anharas, forming extensive open grassland patches; and the woody-anharas, dominated by geoxyle vegetation, providing fresh browse in the dry season immediately after the seasonal fires (Blaine 1922; Estes & Estes 1974).

FCUP 236 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5.8 – Representation of the two protected areas, Cangandala National Park and Luando Nature Strict Reserve, where giant sable occurs, overlaying: (a) major distribution of soils, adapted from Jones et al. (2013), showing a striking correspondence of giant sable distribution and alisoils; (b) landcover displaying the percentage of tree cover, adapted from Hansen et al. (2013), and inbox showing the correspondence between the giant sable reserves and one very specific type of miombo woodland, extracted from an ongoing study on Angolan biotopes (Veríssimo, unpublished)

At a finer scale, it has been shown that sable distribution can be affected by vegetation features and underlying geology (Chirima et al. 2013). We hypothesize that most of the Angolan miombo present on extremely leached aeolian Kalahari sands at relatively high altitude may not be suitable for sable antelope. Sables are currently confined to a narrow strip of depressed plains with relatively richer soils of different geological origin with particular ecological conditions, in habitats characterized by a mosaic of woodland and anharas (Estes & Estes 1974). Habitat heterogeneity at the landscape level and higher availability of nutrients in the vegetation during critical times of the year, adding to a few geomorphological features that act as physical barriers, may provide the best explanation for the insular-like distribution of extant giant sable.

5.2 Managing the conservation crisis in Cangandala NP

The incidence of natural hybridization in animals and the role of interspecific gene flow in shaping evolutionary processes has been frequently underestimated (Arnold 1997; Dowling & Secor 1997; Mallet 2005, 2008), even though it is widely recognized that species can be incompletely reproductively isolated for millions of years after their formation (Mallet 2005). However, by promoting the breakdown of isolating mechanisms, introgressive hybridization challenges the biological concept of species that assumed it

FCUP 237 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) to be rare (Mayr 1963), and this may have had a psychological effect in downplaying the process (Mallet 2005, 2008). Hybridization may contribute to speciation by creating hybrid taxa, or by facilitating adaptive divergence following introgression of a few loci (Abbott et al. 2013), but the mechanisms underlying introgressive hybridization remain poorly understood (Currat et al. 2008). In fact it has been suggested that adaptation and diversification of organisms better fits a model of reticulate evolution depicted by a metaphoric web-of-life, than a pure isolation-driven evolution represented by the traditional tree-of-life (Arnold 1997; Arnold & Fogarty 2009). Evidence of past gene flow episodes have often been inferred as result of mito-nuclear discordance in extant species, when the maternally-inherited mitochondria displays a divergent phylogeny compared to the one obtained with nuclear genes (Avise 1994). Many such examples are known for mammals, including bats (Larsen et al. 2010; Mao et al. 2013), rodents (Good et al. 2008; Lack et al. 2012), hares (Melo-Ferreira et al. 2005; Alves et al. 2008), elephants (Roca et al. 2005, 2015), bears (Hailer et al. 2012; Miller et al. 2012) and primates (Keller et al. 2010; Zinner et al. 2011). Hybridization may originate in naturally occurring hybrid zones or resulting from secondary contact following habitat disturbance or range expansions (Abbot et al. 2013). In cases where a rare local species is confronted with a more abundant species the introgression patterns tend to be assymetric, leading to a predominant introgression of non-dispersing markers into the invasive species’ genome (Currat et al. 2008; Excoffier et al. 2009; Petit & Excoffier 2009) (Fig. 5.1), and often these unbalanced demographic processes may result in the local extinction of one taxa and mitochondrial transfer into the surviving species (Alves et al. 2008; Currat et al. 2008; Larsen et al. 2010). In addition, when species involved in hybridization display strong female philopatry, this is expected to contribute to the mito- nuclear discordance patterns by further restraining mitochondrial dispersal (Alves et al. 2008; Currat et al. 2008; Petit & Excoffier 2009; Zinner et al. 2011; Roca et al. 2015). Such a scenario of nuclear swamping and mitochondrial capture in ancestral Hippotragus populations was revealed in this work and discussed in Section 5.1.1, as explanation for the existence of a relic mitochondrial lineage.

Although several examples of interspecific and intraspecific cases of introgressive hybridization have been reported in African antelopes (Green & Rothstein 1998; Grobler et al. 2011; Van Wyk et al. 2013, 2017), they mostly refer to contemporary human- induced processes due to habitat transformation or species introductions, and not to long-standing natural causes. It is likely that as the use of increasingly powerful genetic tools on more extensive datasets becomes widespread and routinely applied to antelope studies, these will reveal many traces of hybridization events. In our study, patterns of

FCUP 238 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) phylogenetic discordance found in west Tanzanian sable provide a very compelling case for genetic swamping by hybridization and introgression between expanding ancient sable populations and a now extinct and closely-related Hippotragus sp. (see Section 5.1.1; Paper III). As per modern observations, H. niger are strongly matrilocal, which may also contribute to explain the unveiled intraspecific hybridization dynamics, driven by male-mediated dispersal, such as the mitochondrial capture in east Zambia and Malawi by eastern sable, and the maintenance of a few intraspecific hybrid zones in southern Africa.

5.2.1 Introgressive hybridization between giant sable and roan

The confirmation of natural introgressive hybridization in CNP between congeneric and sympatric sable and roan (Paper II), led to the documentation of a most remarkable case among mammals, considering the long independent evolutionary histories of both species, estimated to have diverged in the late Miocene (Fernández & Vrba 2005, Hassanin et al. 2012; Bibi et al. 2013). Equally remarkably, the hybridization narrative was not inferred indirectly, but recorded on the ground for several years as it developed, thus allowing for detailed documentation of the underlying mechanisms causing the breakdown of isolating barriers (Paper II).

Throughout the two decades of civil strife, the giant sable was subjected to intensive hunting pressure, resulting in a steep population crash (Huntley & Matos 1992; Walker 2004). Reconstructing the demographic trends based on field observations and anecdotal accounts, we conclude that by the end of the civil war, the giant sable population in CNP was likely reduced to one single surviving herd and a very limited number of breeding males which soon after disappeared, while a few roan subsisted in the park and neighboring areas. Hunting activities did not subside however, and may even have intensified in the region well after the war. During the study period, abundant evidence of illegal hunting has been recorded and poaching was initially carried out predominantly with automatic weapons, and later and increasingly more, resorting to snare traps. Observations both from CNP and LNSR suggest that roan are more resilient to poaching pressure, having survived in areas where they used to be outnumbered by sable and where the latter are now absent. This finding is consistent with the roan’s ability to withstand illegal hunting pressures better than most other large herbivores (Chardonnet & Crosmary 2013), probably resulting from their unique alertness behavior (Estes 1991), in sharp contrast with the confiding nature of giant sables (Estes & Estes 1974). Poachers tend to shoot more males than females of antelopes (Holmern et al.

FCUP 239 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

2006), and sable bulls are also known for fearless behavior when facing predators (Grobler 1974) and are prone to lonely long-distance movements, factors which may have increased their vulnerability, and aggravated the situation by extirpation of the last breeding giant sable males.

It seems that hybridization in CNP at the end of the civil war derived from an unusual set of events, initially triggered by severe population crashes, more pronounced in sable than in roan, and skewed sex-ratios. In the absence of giant sable breeding bulls, the remaining females may not have had better options than mating with a roan bull. Animal hybridization in naturally overlapping species caused by lack of conspecific mates is a well-known phenomenon reported in several recent cases of birds (Randler 2002; Vali et al. 2010; McCracken & Wilson 2011), fishes (Horreo et al. 2011; Miralles et al. 2014) and mammals (Willis et al. 2004; Lancaster et al. 2006; Cordingley et al. 2009). It usually involves a rarer species breeding with a closely related and more common species, in what is often referred to as the Hubb’s principle or “desperation hypothesis” (Hubbs 1955). In CNP, hybridization may have been facilitated by both species being locally rare in the same area, and lacking conspecific mates. Hybridization would probably not have happened if there were territorial sable bulls established, or if the roan bulls had more access to roan females. Apparently, and based in parentage analysis, not all sable females resorted to interspecific breeding, and only four out of at least ten cows did produce hybrids, even though the roan bull must have been available to all of them. This may have resulted from sub-optimal and unbalanced breeding, while suggesting that not all females may have been equally “desperate”.

The possibility of gene flow is usually the critical question when addressing interspecific hybridization events (Rhymer & Simberloff 1996; Allendorf et al. 2001; Mallet 2005). The fact that two hybrid individuals tested are backcrosses to roan demonstrates that introgression is possible between the two species (Fig. 5.9). As at least four different sable and one F1 females have interbred with a roan male, this suggests a relatively high degree of compatibility for such two divergent lineages, and particularly when hybrid unviability is known to have evolved quicker in mammals than in other groups such as birds (Fitzpatrick 2004). It is also likely that reproductive isolation between sable and roan tends to be maintained by pre-zygotic barriers, such as behavioral. Nevertheless, our observations of sex ratios and modest introgression breeding records were consistent with Haldane’s rules for hybrid F1 reduced viability and fertility associated with the heterogametic sex (Haldane 1922; Coyne & Orr 2004), making it unlikely that the giant sable population in CNP would have evolved into a hybrid swarm. Instead, and without intervention, giant sables in CNP would have likely hybridized to extinction.

FCUP 240 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Extinction through hybridization, with or without introgression, has been recognized as a serious threat to biodiversity, and it usually derives from increasing human-related activities that promote risk factors such as habitat destruction or fragmentation, and species introductions (Rhymer & Simberloff 1996). Few cases, however, have been reported in which extinction by hybridization is locally affecting naturally sympatric species such as giant sable and roan. In an evolutionary perspective it is conceivable that many species on the verge of extinction may have gone through equivalent demographic processes that led them to hybridize before recovering or disappearing. The pros and cons of natural interspecific hybridization are several and probably of complex and conflicting nature. The desperate action taken by females who, in the absence of conspecific males, choose to cross the species boundary has been described as making the best of a bad job (Baker 1996), while it is also often viewed as costly and a waste of reproductive effort (Rhymer & Simberloff 1996; Kanda 2002, Vali et al. 2010). On the other hand, hybridization has been recognized as a mechanism that could not only help rescuing a nearly extinct population (Allendorf et al. 2001; Pimm et al. 2006), but also incorporate new genetic material that may prove crucial in the long term (Arnold 1997; Dowling & Secor 1997). In birds, Randler (2002) considered that interspecific crosses could be advantageous only if hybrids are fertile, otherwise breeding costs will outweigh the alternative of remaining unpaired. However, it has also been established in mammals that long periods without breeding are associated with several pathologies that may cause lower fertility and premature reproductive senescence of females (Hermes 2004). It could therefore be preferable for a giant sable female to produce an infertile or even inviable interspecific hybrid than not breeding at all. This is consistent with empirical evidence in CNP where the only females that got pregnant in subsequent years following the introduction of a new sable bull were two of the three surviving females that had produced at least one hybrid calf in the previous three years. Rather than a waste of reproductive effort, hybridization for those sable females may have signified a breeding opportunity not to be wasted. Conversely, the production of hybrids, particularly F1 sterile males, had a complex behavioral and presumably negative social impact that could have compromised further the recovery of the population.

One final and intriguing possibility to consider would be the expansion of genetic introgression into the local roan population. As later generation hybrids can be easier to form (Mallet 2005), there’s a reasonable chance that genetic material would continue to flow towards roan even if most hybrids maintained reduced fitness (Arnold et al. 2001; Allendorf & Luikart 2007), and eventually this could have had evolutionary consequences as an influx of novel traits into the roan population. Hybridization can play a creative role

FCUP 241 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) as a source of genetic variation and speciation (Grant & Grant 1992, Mallet 2005; Abbott et al. 2013), and reticulate origins have been identified in several mammal taxa which display characteristic genetic patterns (Arnold & Meyer 2006; Melo-Ferreira et al. 2009; Hailer et al. 2012). The hybridization in CNP exemplifies one of many ways in which a species can go extinct through natural hybridization, but may also illustrate the incipient stages of a reticulate evolution event similar to the one uncovered between Hippotragus niger and H. sp. in west Tanzania.

Fig. 5.9 – Sable X roan hybrid confirmed as F2 backcrosses to roan, chemically immobilized in CNP (Photos by author, 2011). (a) two-year-old male backcross, and (b) four-year-old female backcross.

5.2.2 Population recovery

At the onset of the new millennium the giant sable was virtually extinct in CNP, where the population had been reduced to one single herd with a few aged or non-breeding females and interspecific hybrid offspring (Paper II). In order to revert the extinction vortex in CNP, an emergency plan was devised and implemented, starting in 2009, and is still presently unfolding. This plan followed sound management policies to deal with endangered hybridized populations, based on the removal of hybrids and development of a breeding program (Allendorf et al. 2001).

The first component required intervention on the hybrids. Between 2009 and 2011 all nine surviving hybrids, including the seven F1s and two backcrosses, were darted and chemically immobilized by an experienced veterinarian. The three hybrid males were castrated by surgically removing their testicles. The six females were intervened for a surgical excision of their nipples, an experimental methodology devised to ensure mortality of future backcrosses in case some were to be produced. The last hybrid, a putative-backcross, was born and died naturally in 2010, and by August 2011 all hybrids in CNP had been “neutralized”, no longer posing a contaminating threat to the giant sable

FCUP 242 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) gene pool. The second component involved the demarcation of a 4,300 hectare in-situ fenced-off breeding camp to contain the nine surviving pure giant sable females, and the re-introduction of additional animals sourced from LNSR. In 2009, one first mature bull was captured in LNSR and relocated to the sanctuary in CNP, followed by two more males and six young females introduced in 2011 to further boost population recovery.

Breeding performance was initially very poor as only two of the original pure females seemed to have retained good fertility potential and remain the only ones to have produced calves since the re-introduction of sable bulls. Breeding only increased after the introduction of the new six females in 2011, and have picked-up momentum ever since. Before the breeding season of 2017, the population was estimated at around 50 giant sable inside the sanctuary in CNP (Fig. 5.10).

Fig. 5.10 - Recent demography of pure giant sable and hybrids in Cangandala NP, since the end of the civil war in 2002. The red arrows mark the introduction of giant sable from Luando NSR, namely (a) one mature bull in 2009, and (b) two males and six young females in 2011. The dashed lines represent projections for the giant sable demography if one or both introductions hadn’t taken place.

The introduction of giant sable in the sanctuary conformed an extreme case of genetic rescue allowing the species to persist in CNP even when they had lost one of the sexes, by bringing in males and additional females from LNSR, but at the unavoidable cost of mixing both gene pools in CNP. Although giant sable populations from CNP and LNSR have always maintained some levels of gene flow and were essentially just two subcomponents of H. n. varianii, still they were separated by the Luando River and must

FCUP 243 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) have gone through different demographic processes and, at least in theory, they could have been kept separate as two management units. Guidelines for genetic rescue as a management tool advocate for the introduction of the most closely related donor, in cases where there is clear evidence of fitness reduction and imminent risk extinction (Hedrick 1995; Hedrick & Fredrickson 2010). Although it is generally recommended to keep the influx of donor gene flow within a moderate proportion to avoid genetic swamping of the most endangered population (Hedrick & Fredrickson 2010; Harrisson et al. 2016), this proved impractical when the giant sable in CNP could no longer be managed as an independent management unit. When the population was intervened, two mitochondrial haplotypes were present among the nine surviving females. By contrast only one unique haplotype survived the civil war in LNSR and had become fixed in the local population. As the only two fertile females from CNP carried the same mitochondria, one haplotype from CNP has already been definitively lost and the second haplotype risks a similar fate as the local genome might get swamped by Luando ancestry. In a sense, the Cangandala subpopulation is now effectively extinct, and may only subsist as a relatively minor component on the genome of the fast-recovering population of giant sable antelope in CNP.

5.3 Demographic trends in giant sable

Since its formal description a mere one hundred years ago in 1916, the giant sable experienced 60 years of relative stability and protection, followed by the last 40 years exposed to political turmoil, civil war and neglect. A very recent population collapse in CNP is obvious and was empirically documented in detail, but it may only reflect the last stages of a demographic bottleneck leading to the extinction of the smaller subpopulation, which historically represented less than 10% of the total giant sable population. A steep decline in LNSR, the stronghold for the giant sable, derives from field observations by which the distribution range may have contracted to less than 25% of the original area, but it also left a clear genetic signature evident when comparing historical and contemporary samples. The historical numbers of giant sable in LNSR was estimated to range between 1,500 and 2,500 up until the seventies (Crawford-Cabral 1966, 1970; Huntley 1972; Estes & Estes 1974), corresponding to about 0.25 animals/ km2, but recent surveys suggest that figures have currently plummeted to less than 200 individuals, which roughly conforms to a 90% population decline over the last few decades. However, such a dramatic overall population crash appears to have asymmetrically affected the distribution areas in the LNSR, leading to the extinction of

FCUP 244 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) giant sable across most of its former range, and yet allowing the persistence of a population pocket, cornered in the northern block of the reserve. Field records indicate that the giant sable population has not been increasing in LNSR since the end of the war due to poaching pressure (pers. obs.; unpublished data), but also suggest that the northern block where a few herds survived, may have functioned as a relatively safe haven during the war.

5.3.1 Unravelling the giant sable population crash

Demographic patterns associated with severe reductions in population size may lead to genetic signatures such as the loss of diversity due to genetic drift and changes in allele frequencies. Lowered genetic diversity, and an increase of linkage disequilibrium are some of the expected consequences of bottlenecks (Amos & Balmford 2001; Allendorf & Luikart 2007). The inclusion of historical samples allowed temporal comparisons of genetic variability, functioning as a reference to interpret current patterns and producing a more detailed genetic record. Some of the historical giant sable samples lacked accurate geographical reference, but all are presumed to have been obtained in the south of LNSR, where they subsequently became extinct. The absence of geographical overlap between historical and contemporary samples was unfortunate as the possibility of population structure and unbalanced sampling scheme could blur interpretations (Busch et al. 2007; Broquet et al. 2010; Chikhi et al. 2010). However, this limitation is counterbalanced by the fact that the contemporary sampling was a remarkably intensive effort, and the results obtained seemed to confirm the occurrence of past population bottlenecks, while unveiling asymmetric genetic patterns.

Collapse in Luando NSR

Our data revealed a striking demographic signature in LNSR, in which a severe historical loss of mtDNA genotypes wasn’t matched by a noticeable reduction of genetic diversity at the nuclear level as measured by microsatellites. A total of 11 different haplotypes were identified in historical samples (N=23) obtained between 1920 and 1964, but only one of these haplotypes survived and became fixed (N=63) in the current population, thus corresponding to a 91% loss (Fig. 5.11). Interestingly, one single sample from a skull recovered from poachers during the war in 1982, carried one of the lost haplotypes and illustrates the crash of genetic diversity during the bottleneck. In sharp contrast, there was no significant loss (P<0.01) of nuclear genetic diversity in terms of average number

FCUP 245 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

of alleles (NaMODERN=2.55; NaHISTORICAL=2.66) and observed heterozygosity

(HoMODERN=0.32; HoHISTORICAL=0.32), and only a very slight yet significant loss (P<0.01) in terms of expected heterozygosity (HeMODERN=0.32; HeHISTORICAL=0.35) (Table 5.1).

However, the small difference in terms of HE can be best explained by the heterogeneous historical sampling across time and space. The loss of autosomal genetic diversity caused by bottlenecks depends on the population size reduction and the duration measured in generation times (Allendorf & Luikart 2007). Although heterozygosity levels were already low in historical times, they seem to have remained relatively unaffected by the bottleneck in LNSR, which may reflect a not so severe bottleneck in the northern block of LNSR and the short generational time approximately equivalent to a maximum of three generations.

Fig. 5.11 - Range for (a) historical and (b) current distribution of giant sable. Haplotype network (c) based on whole mitochondrial genomes showing diversity for historical and modern samples, according to area of origin and proportional to sampling size.

Differences in genetic diversity calculated with different loci are expected a priori, as the effective population size should be one fourth for mtDNA compared to autosomal loci. A fourfold ratio results from a twofold reduction in mtDNA due to haploidy and a further twofold reduction due to uniparental transmission (Storz et al. 2001). Still, apparent incongruent signatures of low mitochondrial diversity and relatively higher levels of autosomal variability attributed to bottlenecks have been recorded in various mammal species, and have been explained by the dynamics of colonization history and sex- biased philopatry (Flagstad et al. 2003; Nystrom et al. 2006; Chen et al. 2008; Mondol et

FCUP 246 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) al. 2013). It seems unlikely that an extreme bottleneck could have erased most of the mitochondrial diversity in the northern block while maintaining nuclear diversity, particularly as field observations proved the persistence of several matriarchal herds in the north. In addition, the similar values of HE and HO in the modern population, rather than a recent bottleneck, are indicative of a population in mutation-drift equilibrium (Cornuet & Luikart 1996). Therefore, the patterns of genetic diversity observed in LNSR suggest that the southern and central areas must have functioned as the repository of genetic diversity for the giant sable, as evidenced by the numerous haplotypes present in historical times, while the northern block may have been relatively recently re- colonized by one maternal lineage. Similar genetic signatures following a founding-effect have been detected in another matrilocal bovid (Epps et al. 2010). The wartime persecution caused the extinction of giant sable herds in the south and central regions, coincidently the areas in LNSR where UNITA camps were based for longer, while the northern block had less military presence and may have been subjected to a relatively mild bottleneck. Such scenario would explain the existence of one single haplotype in the northern block contrasting with the historical rich diversity recorded in the southern areas, and an overall comparable autosomal diversity that may have been kept in the past by gene flow mediated by male dispersal (Fig. 5.12).

FCUP 247 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5.12 - Suggested core areas of historical distribution of giant sable with highest density and various established herds confirmed, and peripheral areas, where giant sable was known to occur but in lower densities. The red arrows represent male dispersal routes from the core areas.

Collapse in Cangandala NP

The very extreme and well documented bottleneck in CNP with only nine surviving individuals, all included in the dataset, and the complete absence of historical samples from the region, very much hampers our efforts to infer pre-bottleneck dynamics. However, and contrasting to the patterns observed in LNSR, the population in CNP was severely and significantly (P<0.01) impoverished when compared to the other populations, in terms of number of microsatellite alleles (NaPNC=1.82) and heterozygosity

(HoPNC=0.25; HePNC=0.22), but surprisingly it still included two unique mtDNA haplotypes (Table 5.1). Such genetic depletion as measured by the autosomal markers is consistent with a very steep bottleneck and probably sustained for several generations. It is likely that the giant sable population in CNP crashed early on during the war and may have lingered for many years reduced to a few animals. The difference beteween HO and HE

FCUP 248 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

in CNP was only barely significant (P<0.1), but the higher value of HO may reflect a predicted excess of observed heterozygosity that follows a recent bottleneck event, as allelic diversity is reduced at a faster pace than heterozygosity (Cornuet & Luikart 1996). The persistence of two mtDNA haplotypes possibly reflects an ancient diversity when a much larger population may have been centred in northern Angola, but this cannot be explored further due to lack of historical samples. Isolated to the north of the Luando River in a densely human-populated region and estimated to total a mere 150 individuals when it was first discovered in the 1950’s, the giant sable in CNP must have been a long- standing relic population even before they became exposed to wartime poaching.

Table 5.1 - Values of genetic diversity in giant sable, as measured by mitochondrial DNA, and nuclear DNA with 56 microsatellites.

mtDNA nuDNA N Hap. N He s.d. Ho s.d. Luando Historical 23 10 18 0.345 0.035 0.318 0.034 Luando Modern 27 1 63 0.318 0.036 0.320 0.037 Cangandala Modern 10 2 9 0.220 0.029 0.248 0.035 Cangandala Post-Rescue* 5 2 5 0.244 0.033 0.334 0.047 N, sample size; Hap., number of mitochondrial haplotypes; He, expected heterozygosity; Ho, observed heterozygosity; s.d., standard deviation. *These include individuals sired by the first bull introduced from Luando in 2009, and whose mothers for four of them were two old original females, and for the fifth the mother was an introduced female.

5.3.2 Consequences of the bottleneck

Untangling the relative roles of demographic and genetic factors that influence the resilience of endangered populations is crucial for the conservation and management of those taxa (Boessenkol et al. 2010). The first thing to bear in mind is that small relic populations are inherently more vulnerable to external environmental perturbations and random fluctuations in local survival and fecundity, known as stochasticity (Keller & Waller 2002; Frankham 2005) that may tip an endangered population over the edge. Often, addressing the risks of stochastic fluctuations and the direct causes of mortality, should be considered as a higher management priority than tackling the implications of genetic diversity loss (Woodroffe et al. 2007), even though the latter can have pervasive long-term effects that may hinder population recovery (Frankham 2005). On the other hand, isolating stochastic events that affect small populations from genetic factors may not be possible (Frankham 1995). It has been well established that isolation and steep demographic declines affect the ability of populations to maintain genetic diversity over time, as alleles are randomly fixed or lost in a mechanism known as genetic drift (Keller

FCUP 249 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

& Waller 2002; Frankham 2005). Drift causes populations to lose genetic diversity at a rate proportional to the inverse of their effective population size (Frankham 1996), meaning that the loss can accelerate dangerously in very small populations. The reduction of genetic diversity is thought to influence population viability in two different ways, firstly by a decrease in fitness, and secondly by the loss of evolutionary potential (Reed & Frankham 2003; Bouzat 2010). A decrease in fitness derives from inbreeding depression, or from the accumulation of deleterious recessive alleles, known as genetic load (Charlesworth & Willis 2009; Bouzat 2010; Hedrick & Fredrickson 2010). In addition, the reduction of genetic diversity affects the evolutionary potential by eroding the adaptive variability and compromising future adaptation to changing environments (Frankham 1995, 2005; Bouzat 2010). Although the central role played by genetics in driving populations to extinction is unquestionable and empirically tested (Frankham 2005; Hedrick & Fredrickson 2010), certain populations seem to thrive and persist with depauperate levels of genetic diversity (Johnson et al. 2009; Reed 2010; Dobrynin et al. 2015). It has also been argued that genetic purging, the process by which deleterious alleles are expressed and eliminated from the population through natural selection, may counteract inbreeding depression and seems to render an increased resilience to some populations that may have previously undergone serial bottlenecks (Groombridge et al. 2009; Bouzat 2010).

The current levels of genetic diversity in giant sable, reduced to two mitochondrial haplotypes and impoverished heterozygosity, rank among the lowest recorded in mammals (Gebremedhin et al. 2009), raising concerns about the future of H. n. variani. It should be stressed that neutral genetic variation does not necessarily correlate well to quantitative traits under natural selection (Reed & Frankham 2001; Knopp et al. 2007; Reed 2010), meaning that the evolutionary potential of a population may not be accurately reflected by those non-coding regions of the genome (Reed 2010). It is also quite possible that a life history characterized by long-term isolation and demographic fluctuations may have exposed in the past the giant sable to the effects of purging, making it better prepared to cope with the latest bottlenecks. Nevertheless, the extirpation of giant sable from what used to be its core area in LNSR, and the loss of most of the mitochondrial diversity, are especially worrying elements that may compromise future recovery. Predicting population viability is extremely difficult and should not be judged on the basis of genetic data alone (Reed 2010). Current population size, population trend and habitat quality, likely still remain as the best indicators for the viability of a given population (O’Grady et al. 2004). A combination of increased protection measures securing the herds and expanding the habitats, coupled with

FCUP 250 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) genetic and ecological monitoring for the management of both populations in CNP and LNSR, probably delivers the highest hopes for the future of the giant sable antelope.

5.4 The role of natural history collections

Natural history collections (NHC), housed in museums and private sources, comprise many different sorts of biological materials spanning from preserved whole organisms to body fragments, fossils, DNA libraries and cell lines, and totalling billions of specimens worldwide (Pennisi 2000; Suarez & Tsutsui 2004; Wandeler et al. 2007). With an origin dating as far back as the XVI century, NHC have progressively grown in relevance as authentic scientific collections by supporting research in a wide range of fields, including systematics, conservation, ecology and evolutionary biology (Brooke 2000; Barbanera et al. 2016). In particular, NHC have proved invaluable in assisting scientific research focusing on those taxa which are rare, endangered, too difficult or costly to sample, or even extinct (Wandeler et al. 2007; Besnard et al. 2016). As human pressure keeps building on wild populations over the past 200 years, specimens deposited in collections worldwide are attaining greater value as representatives of a biological past (Burrell et al. 2015). With the advent of molecular approaches starting with the development of polymerase chain reaction in the eighties, a further dimension was awarded to the collections by allowing researchers to obtain molecular data from old samples (Barnabera et al. 2016; Besnard et al. 2016), and the most recent advances in DNA sequencing technology, genomics and associated statistical tools is opening new exciting avenues for research (Wandeler et al. 2007; Bi et al. 2013; Burrell et al. 2015; Barnabera et al. 2016).

By providing samples to compare between ancient or historical, and contemporary specimens, NHC allow the description of many specific evolutionary and biogeographic patterns, much contributing to the fields of phylogenetics and phylogeography (Bi et al. 2013; Besnard et al. 2016). Still, the most decisive and widespread contribution might be to the population genetics of endangered and extinct taxa, by looking into the demographic history and genetic changes over time (Shaffer et al. 1998; Ramakrishnan et al. 2005; Wandeler et al. 2007; Burrell et al. 2015; Besnard et al. 2016). Recent examples of the use of NHC to elucidate the evolutionary genetics of threatened mammal populations include hamsters (La Haye et al. 2012), arctic foxes (Nystrom et al. 2006; Ploshnitsa et al. 2012), wolf (Flagstad et al. 2003), brown bear (Miller & Waits 2003; Xenikoudakis et al. 2015), puma (Culver et al. 2008; Holbrook et al. 2012) and tiger (Mondol et al. 2013). Additional outputs can be the delimitation of historical boundaries

FCUP 251 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) in areas where a given taxa has been extirpated (Rusello et al. 2010; Paplinska et al. 2011), or the contribution to the identification of problematic specimens (e.g. Barnes & Young 2000; Barnett et al. 2007; Shepherd et al. 2013).

5.4.1 Contribution of NHC to sable molecular studies

For this thesis we obtained sable samples from African, European and American museums, and a few additional samples from private collections. Sampling effort was aimed primarily at complementing the extensive preliminary dataset based on contemporary samples, but which had left some geographical regions and putative populations unsampled. By adding material from NHC we were able to include sable samples from eastern Zambia, DRC and southeastern Angola, areas where sable is rare or currently hard to survey, and from which we had not been able to obtain any modern samples (Papers III, IV). Secondly, we also added old samples from better surveyed regions in order to compile time series, such as from Kenya, eastern Tanzania, central Mozambique, western Zambia and central Angola. Not only the sable phylogeographic assessment depended on the extensive dataset covering the entire species distribution range (Paper III), but the inclusion of older samples from various origins allowed us to address genetic composition over time, which proves instrumental to enhance the power of population genetics approaches (Paper IV). Because populations subject to bottlenecks lose genetic diversity and may accumulate changes by means of genetic drift (Keller & Waller 2002; Frankham 2005), the genetic signal picked by neutral markers might suggest a higher differentiation degree between populations than what should correspond to their pre-bottleneck status (Nei et al. 1975; Maruyama & Fuerst 1985). On the other hand, cases of mitonuclear discordance or of potential hybrid zones between populations, could either result from natural processes or be anthropogenically induced artefacts caused by animal translocations or landscape transformation. By including old samples to investigate these questions, we were able for example to strengthen the explanation of mitochondrial introgression in Malawi and eastern Zambia (Paper III), and to establish that the significant population differentiation found in the subpopulations of west-southern and north-eastern could not be fully explained by a recent bottleneck (Paper IV). Also, hybrid zones in eastern Zambia and south-central Mozambique were shown to be already in place during historical times, thus ruling out translocations as a direct cause (Paper IV).

However, a crucial contribution deriving from the use of NHC was to assist the studies investigating the evolutionary history of Hippotragus niger variani. We were successful

FCUP 252 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) in assembling and integrating historical giant sable samples ranging across a time series that covered the first 40 years since H. n. variani was first described (Fig. 5.13), to compare with the contemporary, post-bottleneck specimens. One important conclusion was that the same differentiation signal detected for the extant giant sable was already present in historical times. In other words this means that the genetic uniqueness of giant sable, is not an artefact caused by a recent bottleneck and genetic drift, but rather has deeper roots and likely reflects long-term isolation (Paper IV). By comparing the sample series and addressing the loss of genetic diversity, both in the mitochondria and in nuclear markers, we were able to document the population collapse in LNSR and infer the dynamics in different regions (Section 5.3.1).

Fig. 5.13 – Giant sable specimens feature in various museums and private collections, from which DNA samples were extracted for the purpose of this thesis. (a) The author posing next to the largest known collection of giant sable skulls, in Museu da Caça at Vila Viçosa, Portugal (Photo by J. Bugalho, 2005); and (b) Dr. Richard Estes (second from left) at the dentist assisting on a tooth extraction from a trophy shot by Richard Curtis in 1921 (Photo by R. Estes, 2010).

5.4.2 The remarkable case of the Florence horn

The existence in the Florence Museum of Natural History of a mysterious sable antelope horn dating from 1873 – known as the horn of Florence, of large proportions and from undescribed locality (Walker 2004), provided a unique opportunity to apply ancient DNA extraction tools, and by comparing mitochondrial fragments we were able to confirm the hypothesis that it belonged to a giant sable antelope, although predating the type specimen in more than 40 years. The identification of species present on the archaeological record based on ancient DNA evidence is not unusual (e.g. Barnes & Young 2000; Yang et al. 2004; Mulligan 2005; Hou et al. 2014; Birks & Birks 2016), and such tools have also been increasingly applied to correctly identify material housed in museum collections, particularly for specimens inadequately labelled (Boessenkool et al.

FCUP 253 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

2009; Cappellini et al. 2013; Barbanera et al. 2016) or of unknown provenance (Barnett et al. 2007, 2014; Hartnup et al. 2011; Shepherd et al. 2013). Although no useful information accompanied the label of the horn of Florence referring to the origin other than Africa Australe – Southern Africa, the mitochondrial haplotype uncovered can be attributed to giant sable with high confidence as it is within the mtDNA variation reported for other historical samples obtained from LNSR in the twentieth century. By the mid- nineteenth century the Angolan plateau had a relatively poor European colonist implantation but it was regularly crisscrossed by explorers and missionaries, and several commerce routes linked the interior to the coastal cities, by which not only slaves, but also ivory, rubber and other natural products were traded to fuel the demand in America and Europe. It may well never be possible to trace back the route that took this extraordinary horn from the heart of Angola to Italy, but for the following 40 years the giant sable remained hidden to scientists, and one hundred years more passed before the horn of Florence could be attributed to a species and population, beyond reasonable doubt. This research highlights the importance of NHC as repositories of biodiversity, and illustrates the potential of modern genetic analyses in solving long-standing mysteries related to doubtful identifications or unprovenanced specimens.

5.5 Final Considerations

The work presented in this thesis aims to contribute to a better understanding of the processes that have shaped the evolutionary history of sable antelope, providing a coherent interpretation of the phylogeographic patterns observed, and a framework to disentangle the population relationships with insights to the intraspecific taxonomy. Central to the efforts developed, was the particular case of Hippotragus niger variani, featured either as the main focus, or in the background as inspiration for all lines of research here explored. We were able to document an episode of interspecific introgressive hybridization that has affected the giant sable, and explore the origins and past demography of this highly threatened taxon, while implementing specific conservation measures for the recovery of its populations. Instrumental for the success of the various lines of research pursued was the access to increasingly more ambitious molecular tools, ranging from sequencing of full mitochondrial genomes to the development of a panel of species-specific nuclear markers, and the adoption of ancient DNA extracting techniques, in conjunction with a very extensive sampling effort of both modern and historical samples.

FCUP 254 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

As a spin-off from these genetic-based efforts, new avenues of molecular research are expected to be followed in coming years and applied on sable and related species. Finally, it must also be stressed that this thesis originated within the context of the plight for survival of one of the most critically endangered mammals on earth, the giant sable antelope, framing several non-molecular studies and initiatives of crucial importance for the future of this taxon, which have been running in parallel but not independently, and may produce abundant and relevant outputs in the near future.

5.5.1 Conservation of giant sable

Specific conservation initiatives are being implemented, aiming to promote the recovery of giant sable populations in situ. In CNP, efforts have stemmed from addressing the hybridization crisis and managing the surviving population inside a fenced camp (Section 5.2.2). The animals in CNP are relatively well protected inside the 4,300 ha sanctuary, and the breeding in the park boosted as result of the translocations from LNSR (Fig. 5.14a). All animals in CNP are being closely monitored by VHF tracking and by a network of trap cameras in use since 2004 that has resulted in approximately 420,000 photos featuring wildlife, including about one third with Hippotragus (results not shown).

Poaching has had also a dramatic effect on the giant sable populations in LNSR, and remains the main cause of concern in terms of conservation by directly eliminating a potentially unsustainable number of individuals. Currently, poaching in LNSR is linked to the bush meat trade and results either from night stalking on foot with flashlights and rifles, or from trapping around grazing patches and water holes. Field observations and remote tracking (Fig 5.14b) suggest that solitary males are vulnerable to armed poachers and especially in the rainy season. Nevertheless, the most prevalent and insidious form of poaching directly affecting giant sable, is achieved by placing foot snares and gin traps around water holes in the dry season. Approximately 20% of all Hippotragus handled between 2009 and 2016 had either previously survived a snaring incident or subsequently fell victim to a trap (Fig. 5.14c), and field data suggest young animals and lactating females to be the most vulnerable. Sable antelope has been found to be constrained by the availability of surface water, often willing to approach waterholes to drink even when facing a much higher risk of predation or hunting (Crosmary et al. 2012), and individuals more constrained by resource requirements are less likely to change their behaviour in response to disturbance (Beale & Monaghan 2004; Crosmary et al. 2012).

FCUP 255 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5.14 – Between 2009 and 2016, four aerial capture operations allowed chemical immobilization and handling of giant sable, and translocations. (a) One giant sable female air lifted by helicopter and being relocated in CNP, in 2009 (Photo by J. Andersen); (b) a giant sable bull in LNSR released after being marked with ear tags and a GPS collar in 2016 (Photo by author); (c) A young female in LNSR, chemically immobilized and showing an amputated foreleg, an injury caused by snare traps, in 2011 (Photo by author).

Four aerial surveys were completed between 2009 and 2016, in which a total of 63 individuals were marked in LNSR and all herds were photographed in several occasions, In addition to the ground data collected by trap cameras, these exercises allowed for individual identification of most animals. Preliminary results point to a much skewed age ratio in LNSR, in which an hourglass-shaped age pyramid reflect scarcity of young and middle-aged classes, attributed to poaching (Fig. 5.15). High resolution satellite imagery has been acquired and was complemented with ground-truthing, allowing the production of detailed vegetation maps and the characterization of all natural water holes present within the giant sable home ranges and territories in LNSR. These tools integrated with regular ground monitoring and remote animal tracking are proving invaluable to assist management and conservation initiatives. In order to maximize the impact, an innovative model is being implemented in LNSR in collaboration with the Angolan authorities, by training and empowering local residents as law enforcement agents, better equipped with transport and survival means and linked to an external base via satellite communications, so that permanent security can be ensured for every surviving herd.

FCUP 256 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5.15 - Comparison between age pyramids from a theoretical sable model population constructed with data adapted from Martin (2003), and the population data collected during aerial surveys in LNSR between 2009 and 2016.

5.5.2 Ecology and spatial use by giant sable

The use of global positioning system (GPS) transmitters has revolutionized wildlife research in recent years by becoming an increasingly important tool in animal ecology studies (Cagnacci et al. 2010; Hebblewhite & Haydon 2010; Tomkiewicz et al. 2010; Jung et al. 2015). Four capture operations allowed the handling and collaring of several dozen giant sable, including with 32 GPS satellite collars employed since 2011 in LNSR and one in CNP (Fig. 5.14b). These GPS collars provide the ability to collect fine-scale spatio-temporal location data about animal presence and movements, to a much higher degree than with other non-invasive methods such as camera-trapping or landscape genetics (Hebblewhite & Haydon 2010). The GPS collars were placed primarily in adult females (N=19) representing the five existing herds in LNSR, but 13 collars were deployed on mature bulls and one on an immature pre-dispersing male. Most collars have been employed with a fixed 4-hour rate schedule. By June 2017 more than 60,000 GPS locational fixes had been collected, corresponding to approximately 10,000 day- sable of monitoring effort (results not shown).

The use of GPS collars in combination with GIS information to study sable antelope populations in southern Africa, has been remarkably prolific in recent years, much contributing to our current knowledge on the ecology of the species. These studies, carried out in populations of Hippotragus niger niger in South Africa, Zimbabwe and Botswana, have focused on spatial use (Owen-Smith & Cain 2007; Dabengwa 2009; Capon 2011; Chirima et al. 2013; Hensmann et al. 2014a; Asner et al. 2015; Owen-Smith & Martin 2015), resource use and feeding habits (Owen-Smith et al. 2013; Hensmann et al. 2014b), interspecific competition (Macandza et al. 2012a,b) or activity patterns and seasonality (Rahimi & Owen-Smith 2007; Owen-Smith & Goodall 2014). Typically these

FCUP 257 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) studies relied on placing a GPS collar on one adult female to represent a given matriarchal herd, yet none has deployed collars on sable bulls, and to the best of our knowledge issues pertaining to sable male behaviour, dispersal, resource use or territoriality with remote tracking, remain conspicuously untackled.

Fig. 5.16 – Schematic giant sable spatial use inferred by GPS collars, and represented as MCP’s (Minimum Convex Polygons) integrating the totality of fixes obtained from a minimum of four (herd 5, 2016) to a maximum of 29 months of data (herd 1, 2013 – 2015). Herds comprise a minimum of one (herds 4 and 5, 2016-2017) to five females collared (herd 1, 2013 – 2016). Data presented for the periods (a) 2013 – 2015, and (b) 2016-2017.

Our preliminary results are consistent with research showing sable to occupy spatially discrete home ranges with marginal overlap among herds (Estes & Estes 1974; Hensmann et al. 2014a; Asner et al. 2015) (Fig. 5.16), but unlike other studies (Estes & Estes 1974; Rahimi & Owen-Smith 2007; Dabengwa 2009; Capon 2011; Estes 2013) we found relatively little seasonal variation (results not shown). Based on limited field observations alone the size of sable home ranges had in the past been estimated at a few dozen or hundred hectares (Estes & Estes 1969, 1974; Grobler 1974; Joubert 1974; Wilson & Hirst 1977), while recent figures calculated by remote tracking show huge variation depending on methodology used, seasonality and which herd analysed, and span from 14.1 km2 to 115 km2 (Rahimi & Owen-Smith 2007; Dabengwa 2009; Capon 2011; Hensmann et al. 2014a). Our preliminary data suggest that giant sable herds are very conservative in the use of space year after year, but the size of home ranges as measured by the Minimum Convex Polygon (MCP) in two herds was approximate 100 km2, while on a third herd averaged 280 km2 (results not shown).

FCUP 258 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. 5.17 – Graphic representation of average bi-weekly movements performed by bulls and females, as measured by the total distance between consecutive fixes obtained every four hours. Males consistently move more than the females and display a remarkable, yet previously unreported, increase in activity that coincides with the peak of the mating season. The females show less dramatic changes, but seem to move more in the dry season and less in the rainy season.

Interestingly, the data obtained by tracking the sable bulls suggest that the territoriality and male behaviour is still poorly understood and might require revision. Old studies reported bulls defending territories from as small as 0.25-0.4 km2 (Grobler 1974) to 4-9 km2 (Sekulic 1978), and it has been generally assumed that the territories are mutually exclusive with boundaries maintained by agonistic behaviour and separated by several km (Estes & Estes 1974). However our preliminary findings suggest that giant sable bulls utilize much larger areas than previously reported and with extensive overlap with neighbouring bulls, and often entering home ranges of more than one herd (Fig. 5.16). Bull territory, as defined by MCP have ranged from 198 km2 to 391 km2 (results not shown). It is possible that males are more prone to abnormal movement patterns caused by reactive or opportunistic incursions driven by interaction with other individuals and this may inflate calculations based on MCP, but it seems hardly enough to justify the differences observed. It is more likely that bulls maintain a large degree of plasticity in defining their territories, and cover larger areas probably influenced by frequent direct or indirect interaction with herds and other bulls. Another striking result were the differences observed in seasonal movement patterns of bulls, with a clear 3-4 week activity peak in September/ October (Fig. 5.17). During a three-week period bulls more than double the average daily movement pattern (results not shown). This unique pattern, to our knowledge previously unreported, is likely reflecting the height of the giant sable mating season in September and October, when most females will go through synchronized oestrus. The mating season must be a highly demanding period for mature bulls seeking

FCUP 259 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani) a breeding opportunity, and may also explain the subsequent sharp decrease in activity as males become exhausted.

Other aspects of giant sable ecology being explored with GPS and GIS data, are the resource use in relation to season, and to rainfall and burning regimes, and also studies involving female calving. For example, females don’t seem to change the average values of movement patterns during mating and calving seasons, but they do seem to move around 50% more in the dry season when compared to the rainy season /results not shown; but see Fig. 5.17). Finally it is also proving extremely important for the ongoing conservation efforts, by identifying critically important waterholes and other hotspots, and by enhancing security. A total of 16 collars have exhausted their battery life or stopped transmitting for unknown reasons. Three animals have died by undetermined causes while transmitting, while one bull was confirmedly shot by poachers. A compelling case was one female, which by the GPS locations pattern, was deduced to have become injured in a trap and subsequently motivated a successful veterinarian intervention.

5.5.3 Future prospects

Although the studies here presented in this thesis may have contributed significantly to improve the current biological knowledge about Hippotragus niger, and especially of the giant sable antelope, it also raises new problems and questions, and presents opportunities for follow-up research.

The phylogeographic study offered a novel insight into the evolutionary history of sable antelope, suggesting a series of Pleistocene vicariance episodes explained by climatic fluctuations and geomorphological features. These results may be very relevant to help us understand processes that may have shaped many other biogeographical patterns in Africa, and we recommend that similar efforts should be extended to other widely distributed ungulates, especially those closely related to sable and sharing similar habitat requirements. In particular roan antelope Hippotragus equinus was chosen as a model for being a sister-species vastly sympatric with sable and sharing many of the polymorphic microsatellites already developed. Our lab has already initiated an ambitious sampling and sequencing effort to replicate the methodologies applied on sable. It is likely that the results obtained with roan will share some patterns with sable but also reveal novel signals that may provide additional insights for the evolutionary history of African savanna and woodland mammals. Another antelope species that would be interesting to address with the same molecular tools is the hartebeest Alcephalus busalaphus, and especially the Lichtenstein’s hartebeest A. b. lichtensteinii, for being a

FCUP 260 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

miombo woodland specialist antelope, like sable, and vastly overlapping in distribution range.

One of the outputs of the population genetics study was revealing that the sable population from west Tanzania are a discrete genetic unit that must have evolved in isolation since the beginning of the late Pleistocene. It would be unlikely not to have accumulated enough phenotypic traits to be measurable, and therefore we believe it may constitute a valid even if cryptic subspecies, that have been overlooked by taxonomists. A study is being designed to look into the morphometrics and ecology of this population.

The population studies unveiled the existence of five sable populations that can be made to correspond to subspecies. In order to further explore each of these units, our lab is using a Next-Gen platform to sequence one high resolution genome from each of these populations. We expect this will make a huge contribution to the conservation of this rare antelope, and especially by using the giant sable as a model for conservation genomics. The much improved capabilities deriving from genomic outputs may improve further our understanding of the population genetic structure and the evolutionary history of sable at various levels, but may also have direct application on breeding programs.

The ecology of the giant sable population in Angola is still relatively poorly studied, despite its cultural importance and being critically endangered, but the advent of modern technologies present new opportunities for research. In addition to the ongoing efforts based on remote tracking, three important lines of research that could be pursued would be a detailed study on feeding habits and requirements and how it relates to seasonality; an assessment of epidemiological risk particularly related to tick-borne pathologies and a disease monitoring program; and an empirical study on burning programs and how different fire regimes might affect the habitat and the giant sable populations.

5.6 References

Abbott, R., Albach, D., Ansell, S., Arntzen, J. W., Baird, S. J., Bierne, N., ... & Butlin, R. K. (2013). Hybridization and speciation. Journal of Evolutionary Biology, 26(2), 229-246.

Allendorf, F. W., Leary, R. F., Spruell, P., & Wenburg, J. K. (2001). The problems with hybrids: setting conservation guidelines. Trends in ecology & evolution, 16(11), 613-622.

Allendorf, F. W., and G. Luikart (2007). Conservation and the genetics of populations. Malden, MA: Blackwell Publishing.

FCUP 261 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Alves, P. C., Melo-Ferreira, J., Branco, M., Suchentrunk, F., Ferrand, N., & Harris, D. J. (2008). Evidence for genetic similarity of two allopatric European hares (Lepus corsicanus and L. castroviejoi) inferred from nuclear DNA sequences. Molecular phylogenetics and evolution, 46(3), 1191-1197.

Amos, W., & Balmford, A. (2001). When does conservation genetics matter?. Heredity, 87(3), 257-265.

Ansell, W. F. H. (1972). Part 15: Order Artiodactyla. In: Meester J. A. J. & Setzer H. W. (eds). The Mammals of Africa: an identification manual, 1-93. Smithsonian Institution Press: Washington DC.

Ansell, W. F. H. (1974). Some mammals from Zambia and adjacent countries. National Parks and Wildlife Service, Zambia.

Ansell, W. F. H. (1978). The mammals of Zambia (No. 1). National Parks & Wildlife Service.

Ansell, W. F. H., & Dowsett, R. J. (1988). Mammals of Malawi. Trendrine.

Arctander, P., Johansen, C., & Coutellec-Vreto, M. A. (1999). Phylogeography of three closely related African bovids (tribe Alcelaphini). Molecular biology and evolution, 16(12), 1724- 1739.

Arnold, M. L. (1997). Natural hybridization and evolution. Oxford University Press.

Arnold, M. L., & Fogarty, N. D. (2009). Reticulate evolution and marine organisms: the final frontier?. International journal of molecular sciences, 10(9), 3836-3860.

Arnold, M. L., Kentner, E. K., Johnston, J. A., Cornman, S., & Bouck, A. C. (2001). Natural hybridisation and fitness. Taxon, 93-104.

Arnold, M. L., & Meyer, A. (2006). Natural hybridization in primates: one evolutionary mechanism. Zoology, 109(4), 261-276.

Asner, G. P., Owen‐Smith, N., Loarie, S. R., Davies, A. B., Le Roux, E., & Levick, S. R. (2015). Habitat differences do not explain population declines of sable antelope in an African savanna. Journal of Zoology, 297(3), 225-234.

Avise, J. C. (1994). Molecular markers, natural history and evolution. Springer Science & Business Media.

Baker, M. C. (1996). Female buntings from hybridizing populations prefer conspecific males. The Wilson Bulletin, 771-775.

FCUP 262 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Barbanera, F., Moretti, B., Guerrini, M., Al-Sheikhly, O. F., & Forcina, G. (2016). Investigation of ancient DNA to enhance natural history museum collections: misidentification of smooth- coated otter (Lutrogale perspicillata) specimens across multiple museums. Belgian Journal of Zoology, 146(2), 101-112.

Barbosa, L. A. G. (1970). Carta fitogeográfica de Angola. Instituto de Investigação Científica de Angola. Oficinas Gráficas de Angola, Luanda.

Barnes, I., & Young, J. P. W. (2000). DNA-based identification of goose species from two archaeological sites in Lincolnshire. Journal of Archaeological Science, 27(2), 91-100.

Barnett, R., Yamaguchi, N., Shapiro, B., Ho, S. Y., Barnes, I., Sabin, R., ... & Larson, G. (2014). Revealing the maternal demographic history of Panthera leo using ancient DNA and a spatially explicit genealogical analysis. BMC Evolutionary Biology, 14(1), 70.

Barnett, R., Yamaguchi, N., Shapiro, B., & Nijman, V. (2007). Using ancient DNA techniques to identify the origin of unprovenanced museum specimens, as illustrated by the identification of a 19th century lion from Amsterdam. Contributions to Zoology, 76(2).

Beale, C. M., & Monaghan, P. (2004). Behavioural responses to human disturbance: a matter of choice?. Animal Behaviour, 68(5), 1065-1069.

Besnard, G., Bertrand, J. A., Delahaie, B., Bourgeois, Y. X., Lhuillier, E., & Thébaud, C. (2016). Valuing museum specimens: high‐throughput DNA sequencing on historical collections of New Guinea crowned pigeons (Goura). Biological Journal of the Linnean Society, 117(1), 71-82.

Beuning, K. R., Zimmerman, K. A., Ivory, S. J., & Cohen, A. S. (2011). Vegetation response to glacial–interglacial climate variability near Lake Malawi in the southern African tropics. Palaeogeography, Palaeoclimatology, Palaeoecology, 303(1), 81-92.

Bi, K., Linderoth, T., Vanderpool, D., Good, J. M., Nielsen, R., & Moritz, C. (2013). Unlocking the vault: next‐generation museum population genomics. Molecular ecology, 22(24), 6018-6032.

Bibi, F. (2013). A multi-calibrated mitochondrial phylogeny of extant Bovidae (Artiodactyla, Ruminantia) and the importance of the fossil record to systematics. BMC Evolutionary Biology, 13(1), 166.

Bibi, F., & Kiessling, W. (2015). Continuous evolutionary change in Plio-Pleistocene mammals of eastern Africa. Proceedings of the National Academy of Sciences, 112(34), 10623- 10628.

FCUP 263 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Birks, H. J. B., & Birks, H. H. (2016). How have studies of ancient DNA from sediments contributed to the reconstruction of Quaternary floras?. New Phytologist, 209(2), 499- 506.

Blaine, G. (1922). Notes on the Zebras and some Antelopes of Angola. In Proceedings of the Zoological Society of London 92(2): 317-339. Blackwell Publishing Ltd.

Bobe, R., & Behrensmeyer, A. K. (2004). The expansion of grassland ecosystems in Africa in relation to mammalian evolution and the origin of the genus Homo. Palaeogeography, Palaeoclimatology, Palaeoecology, 207(3), 399-420.

Boessenkool, S., Star, B., Scofield, R. P., Seddon, P. J., & Waters, J. M. (2009). Lost in translation or deliberate falsification? Genetic analyses reveal erroneous museum data for historic penguin specimens. Proceedings of the Royal Society of London B: Biological Sciences, rspb20091837.

Boessenkool, S., Star, B., Seddon, P. J., & Waters, J. M. (2010). Temporal genetic samples indicate small effective population size of the endangered yellow-eyed penguin. Conservation genetics, 11(2), 539-546.

Bonnefille, R. (2010). Cenozoic vegetation, climate changes and hominid evolution in tropical Africa. Global and Planetary Change, 72(4), 390-411.

Bouzat, J. L. (2010). Conservation genetics of population bottlenecks: the role of chance, selection, and history. Conservation Genetics, 11(2), 463-478.

Branchu, P., Bergonzini, L., Delvaux, D., De Batist, M., Golubev, V., Benedetti, M., & Klerkx, J. (2005). Tectonic, climatic and hydrothermal control on sedimentation and water chemistry of northern Lake Malawi (Nyasa), Tanzania. Journal of African Earth Sciences, 43(4), 433-446.

Brooke, M. de L. (2000). Why museums matter. Trends in Ecology & Evolution, 15(4), 136-137.

Broquet, T., Angelone, S., Jaquiery, J., Joly, P., LENA, J. P., Lengagne, T., ... & Perrin, N. (2010). Genetic bottlenecks driven by population disconnection. Conservation Biology, 24(6), 1596-1605.

Burgess, N. D., Butynski, T. M., Cordeiro, N. J., Doggart, N. H., Fjeldså, J., Howell, K. M., ... & Menegon, M. (2007). The biological importance of the Eastern Arc Mountains of Tanzania and Kenya. Biological conservation, 134(2), 209-231.

FCUP 264 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Burgess, N., Hales, J. A., Underwood, E., Dinerstein, E., Olson, D., Itoua, I., ... & Newman, K. (2004). Terrestrial ecoregions of Africa and Madagascar: a conservation assessment. Island Press.

Burrell, A. S., Disotell, T. R., & Bergey, C. M. (2015). The use of museum specimens with high- throughput DNA sequencers. Journal of human evolution, 79, 35-44.

Burrough, S. L., & Thomas, D. S. G. (2008). Late Quaternary lake-level fluctuations in the Mababe Depression: Middle Kalahari palaeolakes and the role of Zambezi inflows. Quaternary Research, 69(3), 388-403.

Burrough, S. L., Thomas, D. S., & Bailey, R. M. (2009a). Mega-Lake in the Kalahari: a Late Pleistocene record of the Palaeolake Makgadikgadi system. Quaternary Science Reviews, 28(15), 1392-1411.

Burrough, S. L., Thomas, D. S., & Singarayer, J. S. (2009b). Late Quaternary hydrological dynamics in the Middle Kalahari: forcing and feedbacks. Earth-Science Reviews, 96(4), 313-326.

Busch, J. D., Waser, P. M., & DeWOODY, J. A. (2007). Recent demographic bottlenecks are not accompanied by a genetic signature in banner‐tailed kangaroo rats (Dipodomys spectabilis). Molecular Ecology, 16(12), 2450-2462.

Cagnacci, F., Boitani, L., Powell, R. A., & Boyce, M. S. (2010). Animal ecology meets GPS- based radiotelemetry: a perfect storm of opportunities and challenges. Philosophical Transactions of the Royal Society B: 365, 2157-2162.

Cappellini, E., Gentry, A., Palkopoulou, E., Ishida, Y., Cram, D., Roos, A. M., ... & Barbagli, F. (2014). Resolution of the type material of the Asian elephant, Elephas maximus Linnaeus, 1758 (Proboscidea, Elephantidae). Zoological Journal of the Linnean Society, 170(1), 222-232.

Capon, S. D. (2012). The ecology and potential factors limiting the success of Sable antelope in south eastern Zimbabwe: implications for conservation (Doctoral dissertation, Stellenbosch: Stellenbosch University).

Chardonnet & Crosmary (2013). Hippotragus equinus Roan Antelope. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 548-556. A&C Black.

Charlesworth, D., & Willis, J. H. (2009). The genetics of inbreeding depression. Nature Reviews Genetics, 10(11), 783-796.

FCUP 265 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Chen, S. F., Jones, G., & Rossiter, S. J. (2008). Sex‐biased gene flow and colonization in the Formosan lesser horseshoe bat: inference from nuclear and mitochondrial markers. Journal of Zoology, 274(3), 207-215.

Chikhi, L., Sousa, V. C., Luisi, P., Goossens, B., & Beaumont, M. A. (2010). The confounding effects of population structure, genetic diversity and the sampling scheme on the detection and quantification of population size changes. Genetics, 186(3), 983-995.

Chirima, G. J., Owen‐Smith, N., Erasmus, B. F., & Parrini, F. (2013). Distributional niche of relatively rare sable antelope in a South African savanna: habitat versus biotic relationships. Ecography, 36(1), 68-79.

Chorowicz, J. (2005). The east African rift system. Journal of African Earth Sciences, 43(1), 379- 410.

Coe, M. J., & Skinner, J. D. (1993). Connections, disjunctions and endemism in the eastern and southern African mammal faunas. Transactions of the Royal Society of South Africa, 48(2), 233-255.

Cohen, A. S., Stone, J. R., Beuning, K. R., Park, L. E., Reinthal, P. N., Dettman, D., ... & Brown, E. T. (2007). Ecological consequences of early Late Pleistocene megadroughts in tropical Africa. Proceedings of the National Academy of Sciences, 104(42), 16422- 16427.

Colangelo, P., Verheyen, E., Leirs, H., Tatard, C., Denys, C., Dobigny, G., ... & Lecompte, E. (2013). A mitochondrial phylogeographic scenario for the most widespread African rodent, Mastomys natalensis. Biological Journal of the Linnean Society, 108(4), 901- 916.

Cotterill, F. P. D. (2003a). Geomorphological influences on vicariant evolution in some African mammals in the Zambezi Basin: some lessons for conservation. In Proceedings of the Ecology and Conservation of Mini-antelope: An International Symposium on Duiker and Dwarf Antelope in Africa. Filander Verlag, Fürth (pp. 11-58).

Cotterill, F. P. D. (2003b). A biogeographic review of tsessebe antelopes Damaliscus lunatus (Bovidae: Alcelaphini) in south-central Africa. Durban Museum Novitates, 28, 45-55.

Cotterill, F. P. D. (2003c). Insights into the taxonomy of tsessebe antelopes Damaliscus lunatus (Bovidae: Alcelaphini) with the description of a new evolutionary species in south-central Africa. Durban Museum Novitates, 28(1), 11-30.

FCUP 266 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Cotterill, F. P. D. (2005). The Upemba lechwe, Kobus anselli: an antelope new to science emphasizes the conservation importance of Katanga, Democratic Republic of Congo. Journal of Zoology, 265(2), 113-132.

Cotterill, F. P. (2006). The Evolutionary History and Taxonomy of the Kobus leche species complex of south-central Africa in the context of Palaeo-Drainage Dynamics (Doctoral dissertation, Stellenbosch: Stellenbosch University).

Cordingley, J. E., Sundaresan, S. R., Fischhoff, I. R., Shapiro, B., Ruskey, J., & Rubenstein, D. I. (2009). Is the endangered Grevy's zebra threatened by hybridization?. Animal Conservation, 12(6), 505-513.

Cornuet, J. M., & Luikart, G. (1996). Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics, 144(4), 2001-2014.

Cowling, S. A., Cox, P. M., Jones, C. D., Maslin, M. A., Peros, M., & Spall, S. A. (2008). Simulated glacial and interglacial vegetation across Africa: implications for species phylogenies and trans‐African migration of plants and animals. Global Change Biology, 14(4), 827-840.

Coyne, J. A., & Orr, H. A. (2004). Speciation. Sunderland, MA.

Crawford-Cabral J. (1966). A palanca preta gigante, aditamentos e correcções ao relatório do ano anterior. Luanda.

Crawford-Cabral J. (1970). Alguns aspectos da ecologia da palanca real (Hippotragus niger variani Thomas). Boletim do Instituto de Investigação Científica de Angola, 7: 5-38.

Crawford-Cabral, J., & Veríssimo, L. N. (2005). The ungulate fauna of Angola: systematic list, distribution maps, database report. Ministério da Ciência, Tecnologia e Ensino Superior, Instituto de Investigação Científica Tropical.

Crosmary, W. G., Makumbe, P., Côté, S. D., & Fritz, H. (2012). Vulnerability to predation and water constraints limit behavioural adjustments of ungulates in response to hunting risk. Animal Behaviour, 83(6), 1367-1376.

Culver, M., Hedrick, P. W., Murphy, K., O'Brien, S., & Hornocker, M. G. (2008). Estimation of the bottleneck size in Florida panthers. Animal Conservation, 11(2), 104-110.

Currat, M., Ruedi, M., Petit, R. J., & Excoffier, L. (2008). The hidden side of invasions: massive introgression by local genes. Evolution, 62(8), 1908-1920.

Dabengwa, A. N. (2010). Assessing the role of woody cover in resource selection by sable antelope (Hippotragus niger) in northern Kruger National Park (Doctoral dissertation).

FCUP 267 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Delvaux, D., & Khan, M. A. (1998). Tectonics, sedimentation and volcanism in the East African Rift System: introduction. Journal of African Earth Sciences, 26(3), 343-346. deMenocal, P. B. (2004). African climate change and faunal evolution during the Pliocene– Pleistocene. Earth and Planetary Science Letters, 220(1-2), 3-24.

De Ruiter, D. J. (2003). Revised faunal lists for Members 1-3 of Swartkrans, South Africa. Annals of the Transvaal Museum, 40(1), 29-41.

Diniz, A. C. (2002). Grandes bacias hidrográficas de Angola: Recursos em terras com aptidão para regadio: Cuanza, Noroeste Angolano, Sudoeste Angolano.

Dobrynin, P., Liu, S., Tamazian, G., Xiong, Z., Yurchenko, A. A., Krasheninnikova, K., ... & Kuderna, L. F. (2015). Genomic legacy of the African cheetah, Acinonyx jubatus. Genome biology, 16(1), 277.

Dowling, T. E., & Secor, A. C. L. (1997). The role of hybridization and introgression in the diversification of animals. Annual review of Ecology and Systematics, 28(1), 593-619.

Duchêne, S., Archer, F. I., Vilstrup, J., Caballero, S., & Morin, P. A. (2011). Mitogenome phylogenetics: the impact of using single regions and partitioning schemes on topology, substitution rate and divergence time estimation. PLoS One, 6(11), e27138.

Dupont, L. (2011). Orbital scale vegetation change in Africa. Quaternary Science Reviews, 30(25), 3589-3602.

Dupont, L. M., Jahns, S., Marret, F., & Ning, S. (2000). Vegetation change in equatorial West Africa: time-slices for the last 150 ka. Palaeogeography, Palaeoclimatology, Palaeoecology, 155(1), 95-122.

Du Toit, J. T., & Cumming, D. H. (1999). Functional significance of ungulate diversity in African savannas and the ecological implications of the spread of pastoralism. Biodiversity and Conservation, 8(12), 1643-1661.

East, R. (1999). IUCN/SSC Antelope Specialist Group. African antelope database 1998. 21: 434.

Epps, C. W., Wehausen, J. D., Palsbøll, P. J., & McCullough, D. R. (2010). Using genetic tools to track desert bighorn sheep colonizations. Journal of Wildlife Management, 74(3), 522- 531.

Estes, R. D. (1991). The behavior guide to African mammals (Vol. 64). Berkeley: University of California Press.

FCUP 268 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Estes, R. D. (2013). Hippotragus niger Sable Antelope. In: Kingdon J. & Hoffmann M. (eds). Mammals of Africa 6: 556-565. A&C Black.

Estes, R. D., & Estes, R. K. (1974). The biology and conservation of the giant sable antelope, Hippotragus niger variani Thomas, 1916. Proceedings of the academy of natural sciences of Philadelphia, 73-104.

Excoffier, L., Foll, M., & Petit, R. J. (2009). Genetic consequences of range expansions. Annual Review of Ecology, Evolution, and Systematics, 40, 481-501.

Faulkes, C. G., Bennett, N. C., Cotterill, F. P. D., Stanley, W., Mgode, G. F., & Verheyen, E. (2011). Phylogeography and cryptic diversity of the solitary‐dwelling silvery mole‐rat, genus Heliophobius (family: Bathyergidae). Journal of Zoology, 285(4), 324-338.

Faulkes, C. G., Verheyen, E., Verheyen, W., Jarvis, J. U. M., & Bennett, N. C. (2004). Phylogeographical patterns of genetic divergence and speciation in African mole‐rats (Family: Bathyergidae). Molecular Ecology, 13(3), 613-629.

Fennessy, J., Bock, F., Tutchings, A., Brenneman, R., & Janke, A. (2013). Mitochondrial DNA analyses show that Zambia's South Luangwa Valley giraffe (Giraffa camelopardalis thornicrofti) are genetically isolated. African Journal of Ecology, 51(4), 635-640.

Fennessy, J., Bidon, T., Reuss, F., Kumar, V., Elkan, P., Nilsson, M. A., ... & Janke, A. (2016). Multi-locus analyses reveal four giraffe species instead of one. Current Biology, 26(18), 2543-2549.

Fernández, M. H., & Vrba, E. S. (2005). A complete estimate of the phylogenetic relationships in Ruminantia: a dated species‐level supertree of the extant ruminants. Biological reviews, 80(2), 269-302.

Fitzpatrick, B. M. (2004). Rates of evolution of hybrid inviability in birds and mammals. Evolution, 58(8), 1865-1870.

Fjeldsa, J., & Lovett, J. C. (1997). Geographical patterns of old and young species in African forest biota: the significance of specific montane areas as evolutionary centres. Biodiversity & Conservation, 6(3), 325-346.

Flagstad, Ø., Syversten, P. O., Stenseth, N. C., & Jakobsen, K. S. (2001). Environmental change and rates of evolution: the phylogeographic pattern within the hartebeest complex as related to climatic variation. Proceedings of the Royal Society of London B: Biological Sciences, 268(1468), 667-677.

FCUP 269 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Flagstad, Ø., Walker, C. W., Vila, C., Sundqvist, A. K., Fernholm, B., Hufthammer, A. K., ... & Ellegren, H. (2003). Two centuries of the Scandinavian wolf population: patterns of genetic variability and migration during an era of dramatic decline. Molecular Ecology, 12(4), 869-880.

Frankham, R. (1995). Conservation genetics. Annual review of genetics, 29(1), 305-327.

Frankham, R. (1996). Relationship of genetic variation to population size in wildlife. Conservation Biology, 10(6), 1500-1508.

Frankham, R. (2005). Genetics and extinction. Biological conservation, 126(2), 131-140.

Funk, D. J., & Omland, K. E. (2003). Species-level paraphyly and polyphyly: frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annual Review of Ecology, Evolution, and Systematics, 34(1), 397-423.

Galbreath, G. J., Mordacq, J. C., & Weiler, F. H. (2006). Genetically solving a zoological mystery: was the kouprey (Bos sauveli) a feral hybrid?. Journal of Zoology, 270(4), 561-564.

Gebremedhin, B., Ficetola, G. F., Naderi, S., Rezaei, H. R., Maudet, C., Rioux, D., ... & Taberlet, P. (2009). Combining genetic and ecological data to assess the conservation status of the endangered Ethiopian walia ibex. Animal Conservation, 12(2), 89-100.

Gentry, A. W., & Gentry, A. (1978). Fossil Bovidae (Mammalia) of Olduvai Gorge, Tanzania. British Museum (Natural History).

Gibbon, R. J., Pickering, T. R., Sutton, M. B., Heaton, J. L., Kuman, K., Clarke, R. J., ... & Granger, D. E. (2014). Cosmogenic nuclide burial dating of hominin-bearing Pleistocene cave deposits at Swartkrans, South Africa. Quaternary Geochronology, 24, 10-15.

Girman, D. J., Vila, C., Geffen, E., Creel, S., Mills, M. G. L., McNutt, J. W., ... & Wayne, R. K. (2001). Patterns of population subdivision, gene flow and genetic variability in the African wild dog (Lycaon pictus). Molecular Ecology, 10(7), 1703-1723.

Good, J. M., Hird, S., Reid, N., Demboski, J. R., Steppan, S. J., MARTIN‐NIMS, T. R., & Sullivan, J. (2008). Ancient hybridization and mitochondrial capture between two species of chipmunks. Molecular Ecology, 17(5), 1313-1327.

Grant, P. R., & Grant, R. (1992). Hybridization of bird species. Science, 256(5054), 193.

Green, W. C., & Rothstein, A. (1998). Translocation, hybridization, and the endangered black‐ faced impala. Conservation Biology, 12(2), 475-480.

FCUP 270 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Grobler, J. H. (1974). Aspects of the biology, population ecology, and behaviour of the sable Hippotragus niger niger,(Harris, 1838) in the Rhodes Matopos National Park, Rhodesia. Salisbury: National Museums and Monuments of Rhodesia.

Grobler, J. P., Rushworth, I., Brink, J. S., Bloomer, P., Kotze, A., Reilly, B., & Vrahimis, S. (2011). Management of hybridization in an endemic species: decision making in the face of imperfect information in the case of the black wildebeest—Connochaetes gnou. European journal of wildlife research, 57(5), 997.

Groombridge, J. J., Dawson, D. A., Burke, T., Prys-Jones, R., Brooke, M. D. L., & Shah, N. (2009). Evaluating the demographic history of the Seychelles kestrel (Falco araea): genetic evidence for recovery from a population bottleneck following minimal conservation management. Biological Conservation, 142(10), 2250-2257.

Groves, C. P. (1983). A new subspecies of sable antelope, Hippotragus niger (Harris 1838). Revue de zoologie africaine, 97(4), 821-828.

Groves, C., & Grubb, P. (2011). Ungulate taxonomy. JHU Press.

Grubb, P., Sandrock, O., Kullmer, O., Kaiser, T. M., & Schrenk, F. (1999). Relationships between eastern and southern African mammal faunas. African biogeography, climate change, and human evolution, 253-267.

Haig, S. M., Beever, E. A., Chambers, S. M., Draheim, H. M., Dugger, B. D., Dunham, S., ... & Lopes, I. F. (2006). Taxonomic considerations in listing subspecies under the US Endangered Species Act. Conservation Biology, 20(6), 1584-1594.

Hailer, F., Kutschera, V. E., Hallström, B. M., Klassert, D., Fain, S. R., Leonard, J. A., ... & Janke, A. (2012). Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage. Science, 336(6079), 344-347.

Haldane, J. B. (1922). Sex ratio and unisexual sterility in hybrid animals. Journal of genetics, 12(2), 101-109.

Hamilton, A. A., & Taylor, D. (1991). History of climate and forests in tropical Africa during the last 8 million years. In Tropical forests and climate (pp. 65-78). Springer Netherlands.

Hansen, M. C., Potapov, P. V., Moore, R., Hancher, M., Turubanova, S. A., Tyukavina, A., ... & Kommareddy, A. (2013). High-resolution global maps of 21st-century forest cover change. Science, 342(6160), 850-853.

Harper, F. (1945). Extinct and vanishing mammals of the Old World. Extinct and Vanishing Mammals of the Old World.

FCUP 271 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Harrisson, K. A., Pavlova, A., Gonçalves da Silva, A., Rose, R., Bull, J. K., Lancaster, M. L., ... & Sunnucks, P. (2016). Scope for genetic rescue of an endangered subspecies though re‐establishing natural gene flow with another subspecies. Molecular ecology.

Hartnup, K., Huynen, L., Te Kanawa, R., Shepherd, L. D., Millar, C. D., & Lambert, D. M. (2011). Ancient DNA recovers the origins of Māori feather cloaks. Molecular biology and evolution, 28(10), 2741-2750.

Hassanin, A., Delsuc, F., Ropiquet, A., Hammer, C., van Vuuren, B. J., Matthee, C., ... & Couloux, A. (2012). Pattern and timing of diversification of Cetartiodactyla (Mammalia, Laurasiatheria), as revealed by a comprehensive analysis of mitochondrial genomes. Comptes rendus biologies, 335(1), 32-50.

Hassanin, A., & Ropiquet, A. (2007). Resolving a zoological mystery: the kouprey is a real species. Proceedings of the Royal Society of London B: Biological Sciences, 274(1627), 2849-2855.

Hebblewhite, M., & Haydon, D. T. (2010). Distinguishing technology from biology: a critical review of the use of GPS telemetry data in ecology. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 365(1550), 2303-2312.

Hedrick, P. W. (1995). Gene flow and genetic restoration: the Florida panther as a case study. Conservation Biology, 9(5), 996-1007.

Hedrick, P. W., & Fredrickson, R. (2010). Genetic rescue guidelines with examples from Mexican wolves and Florida panthers. Conservation genetics, 11(2), 615-626.

Hensman, M. C., Owen‐Smith, N., Parrini, F., & Bonyongo, C. M. (2014a). Home range occupation and habitat use of sable antelope in the Okavango Delta region of northern Botswana. African journal of ecology, 52(2), 237-245.

Hensman, M. C., Owen‐Smith, N., Parrini, F., & Bonyongo, C. M. (2014b). Resource use and the nutritional status of sable antelope in the Okavango Delta region of northern Botswana. African journal of ecology, 52(3), 265-273.

Hermes, R., Hildebrandt, T. B., & Göritz, F. (2004). Reproductive problems directly attributable to long-term captivity–asymmetric reproductive aging. Animal reproduction science, 82, 49-60.

Hewitt, G. (2000). The genetic legacy of the Quaternary ice ages. Nature, 405(6789), 907-913.

Hewitt, G. M. (2004). The structure of biodiversity–insights from molecular phylogeography. Frontiers in zoology, 1(1), 4.

FCUP 272 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Hewitt, G. M. (2004). Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 359(1442), 183-195.

Holbrook, J. D., DeYoung, R. W., Tewes, M. E., & Young, J. H. (2012). Demographic history of an elusive carnivore: using museums to inform management. Evolutionary applications, 5(6), 619-628.

Holmern, T., Mkama, S., Muya, J., & Røskaft, E. (2006). Intraspecific prey choice of bushmeat hunters outside the Serengeti National Park, Tanzania: a preliminary analysis. African Zoology, 41(1), 81-87.

Hórreo, J. L., Ayllón, F., Perez, J., Beall, E., & Garcia-Vazquez, E. (2011). Interspecific hybridization, a matter of pioneering? Insights from Atlantic salmon and brown trout. Journal of Heredity, esq130.

Hou, X. D., Sheng, G. L., Yin, S., Zhu, M., Du, M., Jin, C. Z., & Lai, X. L. (2014). DNA analyses of wild boar remains from archaeological sites in Guangxi, China. Quaternary International, 354, 147-153.

Hubbs, C. L. (1955). Hybridization between fish species in nature. Systematic zoology, 4(1), 1- 20.

Huntley B. J. (1972). Plano para o future da palanca real de Angola. Relatório do ecologista, serviços de protecção da fauna, Luando, Angola.

Huntley, B. J. (1982). Southern African savannas. In Ecology of tropical savannas (pp. 101-119). Springer Berlin Heidelberg.

Huntley, B. J., & Matos, E. M. (1992). Biodiversity: Angolan environmental status quo assessment report. IUCN Regional Office for Southern Africa, Harare, Zimbabwe.

Jansen van Vuuren, B. J., Robinson, T. J., Vaz Pinto, P., Estes, R., & Matthee, C. A. (2010). Western Zambian sable: Are they a geographic extension of the giant sable antelope?. South African Journal of Wildlife Research, 40(1), 35-42.

Johnson, J. A., Tingay, R. E., Culver, M., Hailer, F., Clarke, M. L., & Mindell, D. P. (2009). Long‐ term survival despite low genetic diversity in the critically endangered Madagascar fish‐ eagle. Molecular Ecology, 18(1), 54-63.

Johnston, A. R., & Anthony, N. M. (2012). A multi-locus species phylogeny of African forest duikers in the subfamily Cephalophinae: evidence for a recent radiation in the Pleistocene. BMC evolutionary biology, 12(1), 120.

FCUP 273 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Jones, A., Breuning-Madsen, H., Brossard, M., Dampha, A., Deckers, J., Dewitte, O., ... & Le Roux, P. (2013). Soil atlas of Africa. European Commission.

Jónsson, H., Schubert, M., Seguin-Orlando, A., Ginolhac, A., Petersen, L., Fumagalli, M., ... & Lear, T. (2014). Speciation with gene flow in equids despite extensive chromosomal plasticity. Proceedings of the National Academy of Sciences, 111(52), 18655-18660.

Joubert, S. C. J. (1974). The management of rare ungulates in the Kruger National Park. South African Journal of Wildlife Research-24-month delayed open access, 4(1), 67-69.

Jung, T. S., & Kuba, K. (2015). Performance of GPS collars on free-ranging bison (Bison bison) in north-western Canada. Wildlife Research, 42(4), 315-323.

Keller, C., Roos, C., Groeneveld, L. F., Fischer, J., & Zinner, D. (2010). Introgressive hybridization in southern African baboons shapes patterns of mtDNA variation. American Journal of Physical Anthropology, 142(1), 125-136.

Keller, L. F., & Waller, D. M. (2002). Inbreeding effects in wild populations. Trends in Ecology & Evolution, 17(5), 230-241.

Kingdon, J. (2013). Mammalian evolution in Africa. In: Kingdon J., Happold, D., Hoffmann M., Butynski, T., Happold, M., & Kalina, J. (eds). Mammals of Africa 1: 75-100. A&C Black.

Klein, R. G., Avery, G., Cruz-Uribe, K., & Steele, T. E. (2007). The mammalian fauna associated with an archaic hominin skullcap and later Acheulean artifacts at Elandsfontein, Western Cape Province, South Africa. Journal of Human Evolution, 52(2), 164-186.

Knopp, T., Cano, J. M., Crochet, P. A., & Merilä, J. (2007). Contrasting levels of variation in neutral and quantitative genetic loci on island populations of moor frogs (Rana arvalis). Conservation Genetics, 8(1), 45-56.

Kramer, B., Van der Bank, H., Flint, N., Sauer-Gürth, H., & Wink, M. (2003). Evidence for parapatric speciation in the Mormyrid fish, Pollimyrus castelnaui (Boulenger, 1911), from the Okavango–Upper Zambezi River Systems: P. marianne sp. nov., defined by electric organ discharges, morphology and genetics. Environmental Biology of Fishes, 67(1), 47- 70.

Kruger, F. (2015). Palaeobiology of the South African savanna and lessons for modern ecologists. Transactions of the Royal Society of South Africa, 70(2), 117-125.

Lack, J. B., Greene, D. U., Conroy, C. J., Hamilton, M. J., Braun, J. K., Mares, M. A., & Van Den Bussche, R. A. (2012). Invasion facilitates hybridization with introgression in the Rattus rattus species complex. Molecular Ecology, 21(14), 3545-3561.

FCUP 274 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

La Haye, M. J. J., Neumann, K., & Koelewijn, H. P. (2012). Strong decline of gene diversity in local populations of the highly endangered Common hamster (Cricetus cricetus) in the western part of its European range. Conservation Genetics, 13(2), 311-322.

Lancaster, M. L., Gemmell, N. J., Negro, S., Goldsworthy, S., & Sunnucks, P. (2006). Ménage à trois on Macquarie Island: hybridization among three species of fur seal (Arctocephalus spp.) following historical population extinction. Molecular Ecology, 15(12), 3681-3692.

Larsen, P. A., Marchán-Rivadeneira, M. R., & Baker, R. J. (2010). Natural hybridization generates mammalian lineage with species characteristics. Proceedings of the National Academy of Sciences, 107(25), 11447-11452.

Liedigk, R., Yang, M., Jablonski, N. G., Momberg, F., Geissmann, T., Lwin, N., ... & Yongcheng, L. (2012). Evolutionary history of the odd-nosed monkeys and the phylogenetic position of the newly described Myanmar snub-nosed monkey Rhinopithecus strykeri. PLoS One, 7(5), e37418.

Lisiecki, L. E., & Raymo, M. E. (2005). A Pliocene‐Pleistocene stack of 57 globally distributed benthic δ18O records. Paleoceanography, 20(1).

Lorenzen, E. D., Arctander, P., & Siegismund, H. R. (2008). High variation and very low differentiation in wide ranging plains zebra (Equus quagga): insights from mtDNA and microsatellites. Molecular ecology, 17(12), 2812-2824.

Lorenzen, E. D., Heller, R., & Siegismund, H. R. (2012). Comparative phylogeography of African savanna ungulates. Molecular Ecology, 21(15), 3656-3670.

Lorenzen, E. D., Masembe, C., Arctander, P., & Siegismund, H. R. (2010). A long‐standing Pleistocene refugium in southern Africa and a mosaic of refugia in East Africa: insights from mtDNA and the common eland antelope. Journal of Biogeography, 37(3), 571-581.

Luyt, J., Lee-Thorp, J. A., & Avery, G. (2000). New light on Middle Pleistocene west coast environments from Elandsfontein, Western Cape Province, South Africa. South African Journal of Science, 96(7).

Macandza, V. A., Owen‐Smith, N., & Cain III, J. W. (2012a). Dynamic spatial partitioning and coexistence among tall grass grazers in an African savanna. Oikos, 121(6), 891-898.

Macandza, V. A., Owen‐Smith, N., & Cain, J. W. (2012b). Habitat and resource partitioning between abundant and relatively rare grazing ungulates. Journal of Zoology, 287(3), 175-185.

Maddison, W. P. (1997). Gene trees in species trees. Systematic biology, 46(3), 523-536.

FCUP 275 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Maley, J. (1996). The African rain forest–main characteristics of changes in vegetation and climate from the Upper Cretaceous to the Quaternary. Proceedings of the Royal Society of Edinburgh. Section B. Biological Sciences, 104, 31-73.

Mallet, J. (2005). Hybridization as an invasion of the genome. Trends in ecology & evolution, 20(5), 229-237.

Mallet, J. (2007). Subspecies, semispecies, superspecies. Encyclopaedia of biodiversity, 5, 1- 5.

Mallet, J. (2008). Hybridization, ecological races and the nature of species: empirical evidence for the ease of speciation. Philosophical Transactions of the Royal Society B: Biological Sciences, 363(1506), 2971-2986.

Mao, X., He, G., Hua, P., Jones, G., Zhang, S., & Rossiter, S. J. (2013). Historical introgression and the persistence of ghost alleles in the intermediate horseshoe bat (Rhinolophus affinis). Molecular ecology, 22(4), 1035-1050.

Maruyama, T., & Fuerst, P. A. (1985). Population bottlenecks and nonequilibrium models in population genetics. II. Number of alleles in a small population that was formed by a recent bottleneck. Genetics, 111(3), 675-689.

Maslin, M. A., & Christensen, B. (2007). Tectonics, orbital forcing, global climate change, and human evolution in Africa: introduction to the African paleoclimate special volume. Journal of human evolution, 53(5), 443-464.

Matthee, C. A., & Robinson, T. J. (1999). Mitochondrial DNA population structure of roan and sable antelope: implications for the translocation and conservation of the species. Molecular Ecology, 8(2), 227-238.

Mayr, E. (1963). Animal species and evolution. Harvard University Press, Cambridge, Mass.

McCracken, K. G., & Wilson, R. E. (2011). Gene flow and hybridization between numerically imbalanced populations of two duck species in the Falkland Islands. PLoS One, 6(8), e23173.

McDonough, M. M., Šumbera, R., Mazoch, V., Ferguson, A. W., Phillips, C. D., & Bryja, J. (2015). Multilocus phylogeography of a widespread savanna–woodland‐adapted rodent reveals the influence of Pleistocene geomorphology and climate change in Africa's Zambezi region. Molecular ecology, 24(20), 5248-5266.

McKay, B. D., & Zink, R. M. (2010). The causes of mitochondrial DNA gene tree paraphyly in birds. Molecular Phylogenetics and Evolution, 54(2), 647-650.

FCUP 276 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Melo‐Ferreira, J., Boursot, P., Suchentrunk, F., Ferrand, N., & Alves, P. C. (2005). Invasion from the cold past: extensive introgression of mountain hare (Lepus timidus) mitochondrial DNA into three other hare species in northern Iberia. Molecular Ecology, 14(8), 2459- 2464.

Meng, C., & Kubatko, L. S. (2009). Detecting hybrid speciation in the presence of incomplete lineage sorting using gene tree incongruence: a model. Theoretical population biology, 75(1), 35-45.

Miller, W., Schuster, S. C., Welch, A. J., Ratan, A., Bedoya-Reina, O. C., Zhao, F., ... & Tomsho, L. P. (2012). Polar and brown bear genomes reveal ancient admixture and demographic footprints of past climate change. Proceedings of the National Academy of Sciences, 109(36), E2382-E2390.

Miller, C. R., & Waits, L. P. (2003). The history of effective population size and genetic diversity in the Yellowstone grizzly (Ursus arctos): implications for conservation. Proceedings of the National Academy of Sciences, 100(7), 4334-4339.

Miralles, L., Machado-Schiaffino, G., & Garcia-Vazquez, E. (2014). Genetic markers reveal a gradient of hybridization between cape hakes (Merluccius capensis and Merluccius paradoxus) in their sympatric geographic distribution. Journal of Sea Research, 86, 69- 75.

Mondol, S., Bruford, M. W., & Ramakrishnan, U. (2013). Demographic loss, genetic structure and the conservation implications for Indian tigers. Proceedings of the Royal Society of London B: Biological Sciences, 280(1762), 20130496.

Moodley, Y., Bruford, M. W. (2007). Molecular biogeography: towards an integrated framework for conserving pan-African biodiversity. PLoS ONE 2, e454. Doi:10.1371/journal.pone.0000454.

Moore, A. E., & Larkin, P. A. (2001). Drainage evolution in south-central Africa since the breakup of Gondwana. South African Journal of Geology, 104(1), 47-68.

Moore, A. E., Cotterill, F. P., Main, M. P., & Williams, H. B. (2008). The Zambezi River. Large rivers: geomorphology and management, 311-332.

Moorley, R. J., & Kingdon, J. (2013). Africa’s environmental and climatic past. In: Kingdon J., Happold, D., Hoffmann M., Butynski, T., Happold, M., & Kalina, J. (eds). Mammals of Africa 1: 43-56. A&C Black.

FCUP 277 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Mortimer, E., Paton, D. A., Scholz, C. A., Strecker, M. R., & Blisniuk, P. (2007). Orthogonal to oblique rifting: effect of rift basin orientation in the evolution of the North basin, Malawi Rift, East Africa. Basin Research, 19(3), 393-407.

Mulligan, C. J. (2005). Isolation and analysis of DNA from archaeological, clinical, and natural history specimens. Methods in enzymology, 395, 87-103.

Muwanika, V. B., Nyakaana, S., Siegismund, H. R., & Arctander, P. (2003). Phylogeography and population structure of the common warthog (Phacochoerus africanus) inferred from variation in mitochondrial DNA sequences and microsatellite loci. Heredity, 91(4), 361- 372.

Nash, D. J., Meadows, M. E., & Gulliver, V. L. (2006). Holocene environmental change in the Okavango Panhandle, northwest Botswana. Quaternary Science Reviews, 25(11), 1302-1322.

Nei, M., Maruyama, T., & Chakraborty, R. (1975). The bottleneck effect and genetic variability in populations. Evolution, 1-10.

Nugent, C. (1990). The Zambezi River: tectonism, climatic change and drainage evolution. Palaeogeography, Palaeoclimatology, Palaeoecology, 78(1-2), 55-69.

Nyström, V., Angerbjörn, A., & Dalén, L. (2006). Genetic consequences of a demographic bottleneck in the Scandinavian arctic fox. Oikos, 114(1), 84-94.

O'Grady, J. J., Reed, D. H., Brook, B. W., & Frankham, R. (2004). What are the best correlates of predicted extinction risk?. Biological Conservation, 118(4), 513-520.

Osmaston, H. A., & Harrison, S. P. (2005). The Late Quaternary glaciation of Africa: A regional synthesis. Quaternary International, 138, 32-54.

Osmers, B., Petersen, B. S., Hartl, G. B., Grobler, J. P., Kotze, A., Van Aswegen, E., & Zachos, F. E. (2012). Genetic analysis of southern African gemsbok (Oryx gazella) reveals high variability, distinct lineages and strong divergence from the East African Oryx beisa. Mammalian Biology-Zeitschrift für Säugetierkunde, 77(1), 60-66.

Owen-Smith, N., & Cain, J. W. (2007). Indicators of adaptive responses in home range utilization and movement patterns by a large mammalian herbivore. Israel Journal of Ecology & Evolution, 53(3-4), 423-438.

Owen‐Smith, N., & Goodall, V. (2014). Coping with savanna seasonality: comparative daily activity patterns of African ungulates as revealed by GPS telemetry. Journal of Zoology, 293(3), 181-191.

FCUP 278 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Owen-Smith, N., & Martin, J. (2015). Identifying space use at foraging arena scale within the home ranges of large herbivores. PloS one, 10(6), e0128821.

Owen‐Smith, N., Le Roux, E., & Macandza, V. (2013). Are relatively rare antelope narrowly selective feeders? A sable antelope and zebra comparison. Journal of Zoology, 291(3), 163-170.

Paplinska, J. Z., Taggart, D. A., Corrigan, T., Eldridge, M. D., & Austin, J. J. (2011). Using DNA from museum specimens to preserve the integrity of evolutionarily significant unit boundaries in threatened species. Biological Conservation, 144(1), 290-297.

Patterson, D. B., Faith, J. T., Bobe, R., & Wood, B. (2014). Regional diversity patterns in African bovids, hyaenids, and felids during the past 3 million years: the role of taphonomic bias and implications for the evolution of Paranthropus. Quaternary Science Reviews, 96, 9- 22.

Peart, D. C. (2015). Continuous or pulse? Simulating speciation and extinction from East and South African fauna at Plio-Pleistocene fossil sites (Doctoral dissertation, The Ohio State University).

Pennisi, E. (2000). Taxonomic revival. Science 289(29): 2306-2308.

Petit, R. J., & Excoffier, L. (2009). Gene flow and species delimitation. Trends in Ecology & evolution, 24(7), 386-393.

Pimm, S. L., Dollar, L., & Bass, O. L. (2006). The genetic rescue of the Florida panther. Animal Conservation, 9(2), 115-122.

Pitra, C., Hansen, A. J., Lieckfeldt, D., & Arctander, P. (2002). An exceptional case of historical outbreeding in African sable antelope populations. Molecular Ecology, 11(7), 1197-1208.

Pitra, C., Vaz Pinto, P., O’Keeffe, B. W., Willows-Munro, S., van Vuuren, B. J., & Robinson, T. J. (2006). DNA-led rediscovery of the giant sable antelope in Angola. European Journal of Wildlife Research, 52(3), 145-152.

Ploshnitsa, A. I., Goltsman, M. E., Macdonald, D. W., Kennedy, L. J., & Sommer, S. (2012). Impact of historical founder effects and a recent bottleneck on MHC variability in Commander Arctic foxes (Vulpes lagopus). Ecology and evolution, 2(1), 165-180.

Podgorski, J. E., Green, A. G., Kgotlhang, L., Kinzelbach, W. K., Kalscheuer, T., Auken, E., & Ngwisanyi, T. (2013). Paleo-megalake and paleo-megafan in southern Africa. Geology, 41(11), 1155-1158.

FCUP 279 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Potts, R. (2013). Hominin evolution in settings of strong environmental variability. Quaternary Science Reviews, 73, 1-13.

Rahimi, S., & Owen-Smith, N. (2007). Movement patterns of sable antelope in the Kruger National Park from GPS/GSM collars: a preliminary assessment. South African Journal of Wildlife Research, 37(2), 143-151.

Ramakrishnan, U. M. A., Hadly, E. A., & Mountain, J. L. (2005). Detecting past population bottlenecks using temporal genetic data. Molecular Ecology, 14(10), 2915-2922.

Randler, C. (2002). Avian hybridization, mixed pairing and female choice. Animal behaviour, 63(1), 103-119.

Rector, A. L., & Verrelli, B. C. (2010). Glacial cycling, large mammal community composition, and trophic adaptations in the Western Cape, South Africa. Journal of human evolution, 58(1), 90-102.

Reed, D. H. (2010). Albatrosses, eagles and newts, Oh My!: exceptions to the prevailing paradigm concerning genetic diversity and population viability?. Animal Conservation, 13(5), 448-457.

Reed, D. H., & Frankham, R. (2001). How closely correlated are molecular and quantitative measures of genetic variation? A meta-analysis. Evolution, 55(6), 1095-1103.

Reed, D. H., & Frankham, R. (2003). Correlation between fitness and genetic diversity. Conservation biology, 17(1), 230-237.

Reynolds, S. C., & Kibii, J. M. (2011). Sterkfontein at 75: review of palaeoenvironments, fauna and archaeology from the hominin site of Sterkfontein (Gauteng Province, South Africa).

Rhymer, J. M., & Simberloff, D. (1996). Extinction by hybridization and introgression. Annual Review of Ecology and Systematics, 27(1), 83-109.

Roca, A. L., Georgiadis, N., & O'Brien, S. J. (2005). Cytonuclear genomic dissociation in African elephant species. Nature genetics, 37(1), 96-100.

Roca, A. L., Ishida, Y., Brandt, A. L., Benjamin, N. R., Zhao, K., & Georgiadis, N. J. (2015). Elephant natural history: a genomic perspective. Annu. Rev. Anim. Biosci., 3(1), 139- 167.

Rokas, A., & Carroll, S. B. (2005). More genes or more taxa? The relative contribution of gene number and taxon number to phylogenetic accuracy. Molecular biology and evolution, 22(5), 1337-1344.

FCUP 280 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Rowan, J., Faith, J. T., Gebru, Y., & Fleagle, J. G. (2015). Taxonomy and paleoecology of fossil Bovidae (Mammalia, Artiodactyla) from the Kibish Formation, southern Ethiopia: Implications for dietary change, biogeography, and the structure of the living bovid faunas of East Africa. Palaeogeography, Palaeoclimatology, Palaeoecology, 420, 210- 222.

Russello, M. A., Poulakakis, N., Gibbs, J. P., Tapia, W., Benavides, E., Powell, J. R., & Caccone, A. (2010). DNA from the past informs ex situ conservation for the future: an “extinct” species of Galápagos tortoise identified in captivity. PLoS One, 5(1), e8683.

Scholz, C. A., Johnson, T. C., Cohen, A. S., King, J. W., Peck, J. A., Overpeck, J. T., ... & Lyons, R. P. (2007). East African megadroughts between 135 and 75 thousand years ago and bearing on early-modern human origins. Proceedings of the National Academy of Sciences, 104(42), 16416-16421.

Scott, L. (1999). Vegetation history and climate in the Savanna biome South Africa since 190,000 ka: a comparison of pollen data from the Tswaing Crater (the Pretoria Saltpan) and Wonderkrater. Quaternary International, 57, 215-223.

Sekulic, R. (1978). Seasonality of reproduction in the sable antelope. African Journal of Ecology, 16(3), 177-182.

Shaffer, H. B., Fisher, R. N., & Davidson, C. (1998). The role of natural history collections in documenting species declines. Trends in ecology & evolution, 13(1), 27-30.

Shanahan, T. M., & Zreda, M. (2000). Chronology of quaternary glaciations in East Africa. Earth and Planetary Science Letters, 177(1), 23-42.

Shepherd, L. D., Tennyson, A. J. D., & Lambert, D. M. (2013). Using ancient DNA to enhance museum collections: a case study of rare kiwi (Apteryx spp.) specimens. Journal of the Royal Society of New Zealand, 43(3), 119-127.

Shi, N., & Dupont, L. M. (1997). Vegetation and climatic history of southwest Africa: a marine palynological record of the last 300,000 years. Vegetation History and Archaeobotany, 6(2), 117-131.

Skinner, J. D., & Chimimba, C. T. (2005). The mammals of the southern African sub-region. Cambridge University Press.

Stoffel, C., Dufresnes, C., Okello, J., Noirard, C., Joly, P., Nyakaana, S., ... & Fumagalli, L. (2015). Genetic consequences of population expansions and contractions in the common hippopotamus (Hippopotamus amphibius) since the Late Pleistocene. Molecular ecology, 24(10), 2507-2520.

FCUP 281 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Storz, J. F., Ramakrishnan, U., & Alberts, S. C. (2001). Determinants of effective population size for loci with different modes of inheritance. Journal of Heredity, 92(6), 497-502.

Suarez, A. V., & Tsutsui, N. D. (2004). The value of museum collections for research and society. BioScience, 54(1), 66-74.

Sutton, M. B., Pickering, T. R., Pickering, R., Brain, C. K., Clarke, R. J., Heaton, J. L., & Kuman, K. (2009). Newly discovered fossil-and artifact-bearing deposits, uranium-series ages, and Plio-Pleistocene hominids at Swartkrans Cave, South Africa. Journal of Human Evolution, 57(6), 688-696.

Thomas, D., & Shaw, P. A. (1991). The Kalahari Environment. Cambridge University Press.

Thomas, D. S., & Shaw, P. A. (1992). The Zambezi River: tectonism, climatic change and drainage evolution—is there really evidence for a catastrophic flood? A discussion. Palaeogeography, Palaeoclimatology, Palaeoecology, 91(1-2), 175-178.

Timberlake, J., & Chidumayo, E. (2011). Miombo ecoregion vision report. Biodiversity Foundation for Africa, Famona, Bulawayo, Zimbabwe, 20, 1-76.

Toews, D. P., & Brelsford, A. (2012). The biogeography of mitochondrial and nuclear discordance in animals. Molecular Ecology, 21(16), 3907-3930.

Tomkiewicz, S. M., Fuller, M. R., Kie, J. G., & Bates, K. K. (2010). Global positioning system and associated technologies in animal behaviour and ecological research. Philosophical Transactions of the Royal Society B: Biological Sciences, 365(1550), 2163-2176.

Trauth, M. H., Maslin, M. A., Deino, A. L., Strecker, M. R., Bergner, A. G., & Dühnforth, M. (2007). High-and low-latitude forcing of Plio-Pleistocene East African climate and human evolution. Journal of Human Evolution, 53(5), 475-486.

Väli, Ü., Dombrovski, V., Treinys, R., Bergmanis, U., Daroczi, S. J., Dravecky, M., ... & Mizera, T. (2010). Widespread hybridization between the Greater spotted eagle Aquila clanga and the Lesser spotted eagle Aquila pomarina (Aves: Accipitriformes) in Europe. Biological Journal of the Linnean Society, 100(3), 725-736.

Van Daele, P. A. A. G., Dammann, P., Meier, J. L., Kawalika, M., Woestijne, C., & Burda, H. (2004). Chromosomal diversity in mole‐rats of the genus Cryptomys (Rodentia: Bathyergidae) from the Zambezian region: with descriptions of new karyotypes. Journal of Zoology, 264(3), 317-326.

Van Daele, P. A., Verheyen, E., Brunain, M., & Adriaens, D. (2007). Cytochrome b sequence analysis reveals differential molecular evolution in African mole-rats of the

FCUP 282 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

chromosomally hyperdiverse genus Fukomys (Bathyergidae, Rodentia) from the Zambezian region. Molecular phylogenetics and evolution, 45(1), 142-157.

Van Hooft, W. F., Groen, A. F., & Prins, H. H. T. (2002). Phylogeography of the African buffalo based on mitochondrial and Y‐chromosomal loci: Pleistocene origin and population expansion of the Cape buffalo subspecies. Molecular Ecology, 11(2), 267-279.

Van Wyk, A. M., Kotzé, A., Randi, E., & Dalton, D. L. (2013). A hybrid dilemma: a molecular investigation of South African bontebok (Damaliscus pygargus pygargus) and blesbok (Damaliscus pygargus phillipsi). Conservation Genetics, 14(3), 589-599.

Van Wyk, A. M., Dalton, D. L., Hoban, S., Bruford, M. W., Russo, I. R. M., Birss, C., ... & Kotzé, A. (2017). Quantitative evaluation of hybridization and the impact on biodiversity conservation. Ecology and Evolution, 7(1), 320-330.

Verheyen, W., Hulselmans, J., Wendelen, W., Leirs, H., & Corti, M. (2011). Contribution to the systematics and zoogeography of the East-African Acomys. Zootaxa, 3059, 1-35.

Vrba, E. S., & Gatesy, J. (1994). New Hippotragine antelope fossils from the Middle Awash, Ethiopia, in the context of the phylogeny of Hippotragini (Bovidae: Mammalia). Paleontol Afr, 31: 55-72.

Walker, J. F. (2004). A certain curve of horn: the hundred-year quest for the giant sable antelope of Angola. Grove/Atlantic, Inc.

Wandeler, P., Hoeck, P. E., & Keller, L. F. (2007). Back to the future: museum specimens in population genetics. Trends in ecology & evolution, 22(12), 634-642.

Wessels, J. (2007). Western Zambian sable: a giant sable look-alike or the real thing. Game & Hunt November, 32-36.

White, F. (1983). The vegetation of Africa: a descriptive memoir to accompany the UNESCO/AETFAT/UNSO Vegetation Map of Africa. Paris, 356pp. Wielstra, B., & Arntzen, J. W. (2012). Postglacial species displacement in Triturus newts deduced from asymmetrically introgressed mitochondrial DNA and ecological niche models. BMC Evolutionary Biology, 12(1), 161.

Willis, P. M., Crespi, B. J., Dill, L. M., Baird, R. W., & Hanson, M. B. (2004). Natural hybridization between Dall's porpoises (Phocoenoides dalli) and harbour porpoises (Phocoena phocoena). Canadian Journal of Zoology, 82(5), 828-834.

Wilson, D. E., & Hirst, S. M. (1977). Ecology and factors limiting roan and sable antelope populations in South Africa. Wildlife Monographs, (54), 3-111.

FCUP 283 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Woodroffe, R., Davies-Mostert, H., Ginsberg, J., Graf, J., Leigh, K., McCreery, K., ... & Somers, M. (2007). Rates and causes of mortality in endangered African wild dogs Lycaon pictus: lessons for management and monitoring. Oryx, 41(02), 215-223.

Xenikoudakis, G., Ersmark, E., Tison, J. L., Waits, L., Kindberg, J., Swenson, J. E., & Dalén, L. (2015). Consequences of a demographic bottleneck on genetic structure and variation in the Scandinavian brown bear. Molecular ecology, 24(13), 3441-3454.

Yang, D. Y., Cannon, A., & Saunders, S. R. (2004). DNA species identification of archaeological salmon bone from the Pacific Northwest Coast of North America. Journal of Archaeological Science, 31(5), 619-631.

Zinner, D., Arnold, M. L., & Roos, C. (2011). The strange blood: natural hybridization in primates. Evolutionary Anthropology: Issues, News, and Reviews, 20(3), 96-103.

Zinner, D., Wertheimer, J., Liedigk, R., Groeneveld, L. F., & Roos, C. (2013). Baboon phylogeny as inferred from complete mitochondrial genomes. American journal of physical anthropology, 150(1), 133-140.

FCUP 284 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Appendix I

Fig. Ap1 - The giant sable reserves relative to the annual average rainfall (a) adapted from USGS/EROS 2015, and average temperature in Angola (b), adapted from Min. da Energia e Águas (2015).

FCUP 285 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. Ap2 - The giant sable reserves showing its confinement to the Kwanza drainage and neighbouring main river basins (a); and the same areas relation to overall orography (b). The hill-shaded relief of Angola in both maps were derived from Shuttle Radar Topography Mission (NASA).

FCUP 286 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. Ap3 - Distribution of landforms in Angola as adapted from Sayre et al. (2014), where the giant sable reserves are restricted to smooth plains.

FCUP 287 Evolutionary history of the critically endangered giant sable antelope (Hippotragus niger variani)

Fig. Ap4 - Vegetation map and categories, adapted from Barbosa (1970), and showing the giant sable absent from the most widespread miombo and savanna types.