DOCSLIB.ORG

The First Assess of the Haplotypes From

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The First Assess of the Haplotypes From The first assess of the haplotypes from COI gene sequences in species of spittlebugs (Cicadomorpha: Hemiptera) and aquatic true bugs (Gerromorpha and Nepomorpha: Hemiptera) in Brazil M.M.U. Castanhole1, S.R.C. Marchesin2, L.L.V. Pereira1, F.F.F. Moreira3, J.F. Barbosa3, J.R. Valério4 and M.M. Itoyama1 1Instituto de Biociências, Letras e Ciências Exatas, Universidade Estadual Paulista, Departamento de Biologia, São José do Rio Preto, SP, Brasil 2Universidade Paulista, São José do Rio Preto, SP, Brasil 3Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brasil 4EMBRAPA Gado de Corte, Campo Grande, MS, Brasil Corresponding author: M.M.U. Castanhole E-mail: [email protected] Genet. Mol. Res. 12 (4): 5372-5381 (2013) Received February 6, 2013 Accepted August 19, 2013 Published November 7, 2013 DOI http://dx.doi.org/10.4238/2013.November.7.12 ABSTRACT. We made the first analysis of the COI gene sequences of 22 species of spittlebugs and aquatic true bugs sampled in São Paulo State (Brazil) and used this information to determine the variability within these groups. Considering each codon position, we observed that the third base was the most variable, and the first base was the most conserved. Among species, Mahanarva fimbriolata and Deois flavopicta had the greatest genetic distance (0.181), and Notozulia entreriana and Mahanarva sp had the smallest distance (0.055), with an average variation of 0.119. In Gerromorpha, the Genetics and Molecular Research 12 (4): 5372-5381 (2013) ©FUNPEC-RP www.funpecrp.com.br Haplotypes from COI in spittlebugs and true bugs 5373 greatest distance occurred between Halobatopsis platensis and Rhagovelia zela (0.401), while between Cylindrostethus palmaris and Brachymetra albinervis albinervis, the distance was only 0.187; the average value observed for the Gerromorpha was 0.265. In the Nepomorpha, the species Buenoa antigone antigone and Belostoma micantulum had the greatest genetic distance (0.337), while Martarega brasiliensis and B. a. antigone had the smallest (0.154). The average value observed for Nepomorpha was 0.203. In Cicadomorpha (Auchenorrhyncha) and Nepomorpha (Heteroptera), the COI gene has been conserved; however, it is still useful for characterization of the different taxa. COI analysis was unable to resolve some of the Gerromorpha groups. Key words: Heteroptera; Auchenorrhyncha; Gerromorpha; Nepomorpha; MtDNA INTRODUCTION The order Hemiptera is currently classified into four suborders: Auchenorrhyncha, Coleorrhyncha, Sternorrhyncha, and Heteroptera (Carver et al., 1991; Forero, 2008). The sub- order Auchenorrhyncha (part of the paraphyletic clade Homoptera in former classifications) includes, among others, the spittlebugs, a group of hemipterans belonging to the superfamily Cercopoidea, which are important components of grass entomofauna. The family Cercopidae, an important member of this superfamily, is one of the largest groups of sucking insects, with representatives being phytophagous and feeding predominantly on xylem. Approximately 1500 species in 150 genera have so far been described in this family (Liang and Webb, 2002), where they are distributed mainly in tropical and subtropical regions. Of these, approximately 400 species are present in South America, with several important pests of forage grasses and sugar cane (Costes and Webb, 2004; Castanhole et al., 2010). In Brazil, these sharpshooters are also pests of sugar cane and pastures, and are therefore of great importance for biological control studies and systematics (Milanez et al., 1983; Zanol, 1996). Heteroptera, or true bugs, is the largest and most diverse group of insects with incomplete metamorphosis. This suborder has seven infraorders, including Gerromorpha and Nepomorpha, and approximately 80 families, which can be found on all continents except Antarctica and on some islands (Schuh and Slater, 1995). In the São José do Rio Preto region of Brazil, Heteroptera families that are commonly found include Belostomatidae, Coreidae, Gelastocoridae, Gerridae, Lygaeidae, Notonectidae, Pentatomidae, Phyrrocoridae, Reduviidae, Rhopalidae and Veliidae. They can be either phytophagous, predatory or hematophagous. Specifically, these insects can live as parasites of birds and mammals, feed on plants and fungi or capture other arthropods in spider webs or water. Also, a few Heteroptera species reside in the ocean (Schuh and Slater, 1995). Insects are extremely complex groups due to their great diversity of mitochondrial genomes with rearrangements and recombinations, related to substitution rates and nucleotide composition, suggesting the need for additional studies, including molecular approaches (Hua et al., 2008). Molecular analysis not only reveals the DNA sequence, but also polymorphisms Genetics and Molecular Research 12 (4): 5372-5381 (2013) ©FUNPEC-RP www.funpecrp.com.br M.M.U. Castanhole et al. 5374 whose genetic basis and particular modes of transmission can be precisely determined (Avise, 2004). Thus, the molecular data in several studies collected for different taxonomic groups have contributed to considerable advances in understanding the species’ biology, ecology, behavior, genetics and evolution (Sunnucks, 2000; Avise, 2004). Given the diverse characteristics of these suborders (Auchenorrhyncha and Heteroptera) and the evolutionary proximity of the groups, the use of molecular markers may be necessary for genetic characterization of these individuals. Such analyses could provide a better understanding of the group. The objective of this study was to carry out the first assessment of different haplotypes for 22 species belonging to spittlebugs and aquatic true bugs (Hemiptera) sampled in Brazil, using mitochondrial cytochrome c oxidase subunit 1 gene (COI) sequences, and to use this information to determine the variability within this group of insects. MATERIAL AND METHODS Taxon sampling A total of 22 species were used in this study, including four species belonging to the suborder Auchenorrhyncha (Cicadomorpha, Cercopidae) and 18 species of the aquatic and semi- aquatic infraorders (Gerromorpha and Nepomorpha) of the suborder Heteroptera (Table 1). Table 1. Species used in this study, broken down by family, suborder and infraorder. Suborder Infraorder Family Species Auchenorrhyncha Cicadomorpha Cercopidae Deois flavopicta (Stål, 1954) Mahanarva fimbriolata (Stål, 1854) Mahanarva sp (Stål, 1854) Notozulia entreriana (Berg, 1879) Heteroptera Gerromorpha Gerridae Brachymetra albinervis albinervis* (Amyot and Serville, 1843) Brachymetra albinervis albinervis** (Amyot and Serville, 1843) Cylindrostethus palmaris (Drake and Harris, 1934) Halobatopsis platensis (Berg, 1879) Limnogonus aduncus (Drake and Harris, 1933) Rheumatobates crassifemur crassifemur (Esaki, 1926) Veliidae Microvelia longipes (Uhler, 1894) Rhagovelia robusta (Gould, 1931) Rhagovelia tenuipes (Champion, 1898) Rhagovelia zela (Drake, 1959) Nepomorpha Belostomatidae Belostoma micantulum (Stål, 1858) Gelastocoridae Gelastocoris flavus flavus (Guérin-Méneville, 1835) Notonectidae Buenoa amnigenus (White, 1879) Buenoa antigone antigone (Kirkaldy, 1899) Buenoa unguis (Truxal, 1953) Martarega brasiliensis (Truxal, 1949) Martarega membranacea (White, 1879) Martarega uruguayensis (Berg, 1883) *Population 1 collected in São José do Rio Preto; **Population 2 collected in Jales. Auchenorrhyncha species were collected in Campo Grande, MS, Brazil (20°26ꞌS, 54°38ꞌW). Heteroptera species were collected in the cities of Américo de Campos (20°18ꞌS, 49°44ꞌW), Guaraci (20°30ꞌS, 48°56ꞌW), Jales (20°16ꞌS, 50°32ꞌW), Mirassol (20°49ꞌS, 49°30ꞌW), Sales (21°20ꞌS, 49°29ꞌW), and São José do Rio Preto (20°47ꞌS, 49°21ꞌW) in São Genetics and Molecular Research 12 (4): 5372-5381 (2013) ©FUNPEC-RP www.funpecrp.com.br Haplotypes from COI in spittlebugs and true bugs 5375 Paulo State, Brazil. Two populations of Brachymetra albinervis albinervis, population 1 (*) and population 2 (**), were collected in São José do Rio Preto and Jales, respectively. All samples were stored at -20°C in absolute ethanol at the Laboratory of Cytogenetic and Mo- lecular of Insects (LACIMI), Instituto de Biociências, Letras e Ciências Exatas, Universidade Estadual Paulista (UNESP), Campus São José do Rio Preto, SP, Brazil. Molecular data mtDNA was extracted using the protocol described by Tartarotti (2002) and the Ge- nomic DNA Extraction kit protocol from Machery Nagel Tissue. To obtain the sequence of the COI gene, we used two primers (1 and 2, Table 2) to first amplify the gene. The gene was amplified by PCR with the following conditions: denaturation at 94°C for 1 min; 35 cycles of denaturation (94°C for 30 s), annealing (temperature gradient 48 - 55°C for 1 min), extension (72°C for 1 min); and extension at 72°C for 7 min. The reaction consisted of 0.3 µL nucleo- tides (ATCG), 11.6 µL ddH2O, 0.44 µL MgCl2, 1.5 µL PCR buffer, 0.06 µL DNA Platinum Taq polymerase, and 0.3 µL primers (10 mM). Table 2. Primers used for the amplification and sequencing of theCOI gene. Primers Foward Reverse Measure (+-) Reference 1 TTTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA 700 bp Folmer et al. (1994) 2 CAACATTTATTTTGATTTTTTGG GAATACTGCTCCTATGGATA 500 bp Simon et al. (1994); Damgaard and Sperling (2001) After the amplification reactions, sequencing was performed, a total of 22 sequences were used for the species of the suborders Auchenorrhyncha (infraorder Cicadomorpha) and Heteroptera (infraorders Gerromorpha and Nepomorpha). The primers used for sequencing annealed to the 5ꞌ portion of the COI
Load more

Recommended publications
  • Morphology and Adaptation of Immature Stages of Hemipteran Insects
    © 2019 JETIR January 2019, Volume 6, Issue 1 www.jetir.org (ISSN-2349-5162) Morphology and Adaptation of Immature Stages of Hemipteran Insects Devina Seram and Yendrembam K Devi Assistant Professor, School of Agriculture, Lovely Professional University, Phagwara, Punjab Introduction Insect Adaptations An adaptation is an environmental change so an insect can better fit in and have a better chance of living. Insects are modified in many ways according to their environment. Insects can have adapted legs, mouthparts, body shapes, etc. which makes them easier to survive in the environment that they live in and these adaptations also help them get away from predators and other natural enemies. Here are some adaptations in the immature stages of important families of Hemiptera. Hemiptera are hemimetabolous exopterygotes with only egg and nymphal immature stages and are divided into two sub-orders, homoptera and heteroptera. The immature stages of homopteran families include Delphacidae, Fulgoridae, Cercopidae, Cicadidae, Membracidae, Cicadellidae, Psyllidae, Aleyrodidae, Aphididae, Phylloxeridae, Coccidae, Pseudococcidae, Diaspididae and heteropteran families Notonectidae, Corixidae, Belastomatidae, Nepidae, Hydrometridae, Gerridae, Veliidae, Cimicidae, Reduviidae, Pentatomidae, Lygaeidae, Coreidae, Tingitidae, Miridae will be discussed. Homopteran families 1. Delphacidae – Eg. plant hoppers They comprise the largest family of plant hoppers and are characterized by the presence of large, flattened spurs at the apex of their hind tibiae. Eggs are deposited inside plant tissues, elliptical in shape, colourless to whitish. Nymphs are similar in appearance to adults except for size, colour, under- developed wing pads and genitalia. 2. Fulgoridae – Eg. lantern bugs They can be recognized with their antennae inserted on the sides & beneath the eyes.
    [Show full text]
  • Luis Lenin Vicente Pereira Análise Dos Aspectos Ultraestruturais Da
    Campus de São José do Rio Preto Luis Lenin Vicente Pereira Análise dos aspectos ultraestruturais da espermatogênese de Heteroptera São José do Rio Preto 2017 Luis Lenin Vicente Pereira Análise dos aspectos ultraestruturais da espermatogênese de Heteroptera Tese apresentada como parte dos requisitos para obtenção do título de Doutor em Biociências, área de concentração em Genética, junto ao Programa de Pós- Graduação em Biociências, do Instituto de Biociências, Letras e Ciências Exatas da Universidade Estadual Paulista “Júlio de Mesquita Filho”, Campus de São José do Rio Preto. Financiadora: CAPES Orientador: Profª. Drª. Mary Massumi Itoyama São José do Rio Preto 2017 Pereira, Luis Lenin Vicente. Análise dos aspectos ultraestruturais da espermatogênese de Heteroptera / Luis Lenin Vicente Pereira. - São José do Rio Preto, 2017 119 f. : il. Orientador: Mary Massumi Itoyama Tese (doutorado) - Universidade Estadual Paulista “Júlio de Mesquita Filho”, Instituto de Biociências, Letras e Ciências Exatas 1. Genética dos insetos. 2. Espermatogênese. 3. Hemiptera. 4. Inseto aquático - Morfologia. 5. Testículos. 6. Mitocôndria. I. Universidade Estadual Paulista "Júlio de Mesquita Filho". Instituto de Biociências, Letras e Ciências Exatas. II. Título. CDU – 595.7:575 Ficha catalográfica elaborada pela Biblioteca do IBILCE UNESP - Campus de São José do Rio Preto Luis Lenin Vicente Pereira Análise dos aspectos ultraestruturais da espermatogênese de Heteroptera Tese apresentada como parte dos requisitos para obtenção do título de Doutor em Biociências, área de concentração em Genética, junto ao Programa de Pós- Graduação em Biociências, do Instituto de Biociências, Letras e Ciências Exatas da Universidade Estadual Paulista “Júlio de Mesquita Filho”, Campus de São José do Rio Preto.
    [Show full text]
  • <I>Tibraca Limbativentris</I> (Hemiptera: Pentatomidae)
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications: Department of Entomology Entomology, Department of 2018 Resistance in Rice to Tibraca limbativentris (Hemiptera: Pentatomidae) Influenced yb Plant Silicon Content Lincoln Luis França University of Goias State, Unidade Universitária de Ipameri, [email protected] Cássio Antonio Dierings Federal Goiano Institute, Campus Urutaí, Rodovia, [email protected] André Cirilo de Sousa Almeida Federal Goiano Institute, Campus Urutaí, Rodovia, [email protected] Marcio da Silva Araújo University of Goias State, Unidade Universitária de Ipameri Elvis Arden Heinrichs University of Nebraska-Lincoln, [email protected] See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/entomologyfacpub Part of the Agriculture Commons, and the Entomology Commons França, Lincoln Luis; Dierings, Cássio Antonio; de Sousa Almeida, André Cirilo; Araújo, Marcio da Silva; Heinrichs, Elvis Arden; da Silva, Anderson Rodrigo; Freitas Barrigossi, José Alexandre; and de Jesus, Flávio Gonçalves, "Resistance in Rice to Tibraca limbativentris (Hemiptera: Pentatomidae) Influenced yb Plant Silicon Content" (2018). Faculty Publications: Department of Entomology. 900. https://digitalcommons.unl.edu/entomologyfacpub/900 This Article is brought to you for free and open access by the Entomology, Department of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications:
    [Show full text]
  • Hymenoptera) of Meghalaya with Special Reference to Encyrtidae, Mymaridae and Aphelinidae
    Journal of Biological Control, 29(2): 49-61, 2015 Research Article Additions to the Chalcidoidea (Hymenoptera) of Meghalaya with special reference to Encyrtidae, Mymaridae and Aphelinidae A. RAMESHKUMAR*, J. POORANI and V. NAVEEN Division of Insect Systematics, ICAR-National Bureau of Agricultural Insect Resources, H. A. Farm post, Bellary road, Hebbal, Bangalore - 560024, Karnataka. *Corresponding author E-mail: [email protected] ABSTRACT: Encyrtidae, Mymaridae and Aphelinidae were surveyed from Ri-Bhoi, Jaintia hills, East Khasi hills, and West Khasi hills districts of Meghalaya in 2013. New distribution records of 55 genera and 61 species of encyrtids, mymarids aphelinids and eucharitids for Meghalaya state are documented. KEY WORDS: Encyrtidae, Mymaridae, Aphelinidae, distributional records, India, Meghalaya (Article chronicle: Received: 01-06-2015; Revised: 21-06-2015; Accepted: 23-06-2015) INTRODUCTION composite images were obtained from image stacks using Combine ZP. The images were arranged in plates in Adobe Studies on the Chalcidoidea fauna of Meghalaya are Photoshop Elements 11. very limited and the state has not been systematically sur- veyed for encyrtids, mymarids and aphelinids though they RESULTS AND DISCUSSION play an important role in natural and applied biological control. Hayat and his co-workers have contributed to the During the survey, 950 specimens of chalcidoids and known fauna of Meghalaya (Hayat, 1998; Hayat, 2006; Ka- other parasitoids were collected. Twenty two species repre- zmi and Hayat, 2012; Zeya and Hayat, 1995). We surveyed senting 16 genera of mymarids, 30 species representing 28 four districts of Meghalaya in 2013 for Chalcidoidea with genera of encyrtids, 10 genera and 8 species of aphelinids particular reference to Encyrtidae, Aphelinidae and My- and Orasema initiator Kerrich of eucharitid are reported maridae and documented several taxa new to the state.
    [Show full text]
  • The Planthopper Genus Trypetimorpha: Systematics and Phylogenetic Relationships (Hemiptera: Fulgoromorpha: Tropiduchidae)
    JOURNAL OF NATURAL HISTORY, 1993, 27, 609-629 The planthopper genus Trypetimorpha: systematics and phylogenetic relationships (Hemiptera: Fulgoromorpha: Tropiduchidae) J. HUANG and T. BOURGOINt* Pomological Institute of Shijiazhuang, Agricultural and Forestry Academy of Sciences of Hebei, 5-7 Street, 050061, Shijiazhuang, China t Mus#um National d'Histoire Naturelle, Laboratoire d'Entomologie, 45 rue Buffon, F-75005, Paris, France (Accepted 28 January 1993) The genus Trypetimorpha is revised with the eight currently recognized species described or re-described. Four new species are described and seven new synonymies are proposed. Within Trypetimorphini sensu Fennah (1982), evidences for the monophyly of each genus are selected, but Caffrommatissus is transferred to the Cixiopsini. Monophyly of Trypetimorphini, restricted to Trypetimorpha and Ommatissus, is discussed. A key is given for the following Trypetimorpha species: (1) T. fenestrata Costa ( = T. pilosa Horvfith, syn. n.); (2) T. biermani Dammerman (= T. biermani Muir, syn. n.; = T. china (Wu), syn. n.; = T. formosana Ishihara, syn. n.); (3) T. japonica Ishihara ( = T. koreana Kwon and Lee, syn. n.); (4) T. canopus Linnavuori; (5) T. occidentalis, sp. n. (= T. fenestrata Costa, sensu Horvfith); (6) T. aschei, sp. n., from New Guinea; (7) T. wilsoni, sp. n., from Australia; (8) T. sizhengi, sp. n., from China and Viet Nam. Study of the type specimens of T. fenestrata Costa shows that they are different from T. fenestrata sensu Horvfith as usually accepted, which one is redescribed here as T. occidentalis. KEYWORDS: Hemiptera, Fulgoromorpha, Tropiduchidae, Trypetimorpha, Ommatissus, Cafrommatissus, systematics, phylogeny. Downloaded by [University of Delaware] at 10:13 13 January 2016 Introduction This revision arose as the result of a study of the Chinese Fulgoromorpha of economic importance (Chou et al., 1985) and the opportunity for J.H.
    [Show full text]
  • Correlation of Stylet Activities by the Glassy-Winged Sharpshooter, Homalodisca Coagulata (Say), with Electrical Penetration Graph (EPG) Waveforms
    ARTICLE IN PRESS Journal of Insect Physiology 52 (2006) 327–337 www.elsevier.com/locate/jinsphys Correlation of stylet activities by the glassy-winged sharpshooter, Homalodisca coagulata (Say), with electrical penetration graph (EPG) waveforms P. Houston Joosta, Elaine A. Backusb,Ã, David Morganc, Fengming Yand aDepartment of Entomology, University of Riverside, Riverside, CA 92521, USA bUSDA-ARS Crop Diseases, Pests and Genetics Research Unit, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Ave, Parlier, CA 93648, USA cCalifornia Department of Food and Agriculture, Mt. Rubidoux Field Station, 4500 Glenwood Dr., Bldg. E, Riverside, CA 92501, USA dCollege of Life Sciences, Peking Univerisity, Beijing, China Received 5 May 2005; received in revised form 29 November 2005; accepted 29 November 2005 Abstract Glassy-winged sharpshooter, Homalodisca coagulata (Say), is an efficient vector of Xylella fastidiosa (Xf), the causal bacterium of Pierce’s disease, and leaf scorch in almond and oleander. Acquisition and inoculation of Xf occur sometime during the process of stylet penetration into the plant. That process is most rigorously studied via electrical penetration graph (EPG) monitoring of insect feeding. This study provides part of the crucial biological meanings that define the waveforms of each new insect species recorded by EPG. By synchronizing AC EPG waveforms with high-magnification video of H. coagulata stylet penetration in artifical diet, we correlated stylet activities with three previously described EPG pathway waveforms, A1, B1 and B2, as well as one ingestion waveform, C. Waveform A1 occured at the beginning of stylet penetration. This waveform was correlated with salivary sheath trunk formation, repetitive stylet movements involving retraction of both maxillary stylets and one mandibular stylet, extension of the stylet fascicle, and the fluttering-like movements of the maxillary stylet tips.
    [Show full text]
  • Planthopper and Leafhopper Fauna (Hemiptera: Fulgoromorpha Et Cicadomorpha) at Selected Post-Mining Dumping Grounds in Southern Poland
    Title: Planthopper and leafhopper fauna (Hemiptera: Fulgoromorpha et Cicadomorpha) at selected post-mining dumping grounds in Southern Poland Author: Marcin Walczak, Mariola Chruściel, Joanna Trela, Klaudia Sojka, Aleksander Herczek Citation style: Walczak Marcin, Chruściel Mariola, Trela Joanna, Sojka Klaudia, Herczek Aleksander. (2019). Planthopper and leafhopper fauna (Hemiptera: Fulgoromorpha et Cicadomorpha) at selected post-mining dumping grounds in Southern Poland. “Annals of the Upper Silesian Museum in Bytom, Entomology” Vol. 28 (2019), s. 1-28, doi 10.5281/zenodo.3564181 ANNALS OF THE UPPER SILESIAN MUSEUM IN BYTOM ENTOMOLOGY Vol. 28 (online 006): 1–28 ISSN 0867-1966, eISSN 2544-039X (online) Bytom, 05.12.2019 MARCIN WALCZAK1 , Mariola ChruśCiel2 , Joanna Trela3 , KLAUDIA SOJKA4 , aleksander herCzek5 Planthopper and leafhopper fauna (Hemiptera: Fulgoromorpha et Cicadomorpha) at selected post- mining dumping grounds in Southern Poland http://doi.org/10.5281/zenodo.3564181 Faculty of Natural Sciences, University of Silesia, Bankowa Str. 9, 40-007 Katowice, Poland 1 e-mail: [email protected]; 2 [email protected]; 3 [email protected] (corresponding author); 4 [email protected]; 5 [email protected] Abstract: The paper presents the results of the study on species diversity and characteristics of planthopper and leafhopper fauna (Hemiptera: Fulgoromorpha et Cicadomorpha) inhabiting selected post-mining dumping grounds in Mysłowice in Southern Poland. The research was conducted in 2014 on several sites located on waste heaps with various levels of insolation and humidity. During the study 79 species were collected. The paper presents the results of ecological analyses complemented by a qualitative analysis performed based on the indices of species diversity.
    [Show full text]
  • Hemiptera: Gerromorpha: Gerridae) from Tamil Nadu, India, with a Key to the Species
    Zootaxa 3186: 64–68 (2012) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2012 · Magnolia Press ISSN 1175-5334 (online edition) Lathriobates manohardasi sp. nov. (Hemiptera: Gerromorpha: Gerridae) from Tamil Nadu, India, with a key to the species KAILASH CHANDRA1 & E. EYARIN JEHAMALAR2 Zoological Survey of India, New Alipore, Kolkata- 700 053, India. E-mail: [email protected]; [email protected] Abstract Lathriobates manohardasi sp. nov. is described and compared with known congeners. A key to the species of the genus of world is included. Key words: Trepobatinae, Kannyakumari District, Tamil Nadu, India Introduction Gerridae comprises a group of semi-aquatic bugs that spend almost their entire lives skating above the water sur- face of lentic and lotic environments. Approximately 750 species are distributed among 60 genera and 9 subfami- lies of Gerridae (Moreira, 2011). Thirumalai (2002) reported one species each of Calyptobates, Gnomobates, Lathriobates, and Naboandelus of the subfamily Trepobatinae from India. The world fauna of Lathriobates includes four species: L. obscures Miyamoto, L. rufus Polhemus & Polhemus, L. johorensis Polhemus & Polhemus and L. raja Distant. A fifth species Lathriobates manohardasi sp. nov. is described here. The genus Cryptobates Esaki, 1929 (Gerridae: Heteroptera) is a junior homonym of Cryptobates Fairmaire, 1882 of the family Tenebrionidae (Coleoptera), so the name Lathriobates was proposed as a replacement name by Polhemus (2004), with type species Gerris raja Distant, 1910. Material and methods Study area: Kannyakumari is regarded as the southern most district of Tamil Nadu. The district lies between 77° 15` and 77° 36` E longitude and 8° 03` and 8° 35` N latitude.
    [Show full text]
  • Insect Orders
    CMG GardenNotes #313 Insect Orders Outline Anoplura: sucking lice, page 1 Blattaria: cockroaches and woodroaches, page 2 Coleoptera: beetles, page 2 Collembola: springtails, page 4 Dermaptera: earwigs, page 4 Diptera: flies, page 5 Ephemeroptera: mayflies, page 6 Hemiptera (suborder Heteroptera): true bugs, page 7 Hemiptera (suborders Auchenorrhyncha and Sternorrhyncha): aphids, cicadas, leafhoppers, mealybugs, scale and whiteflies, page 8 Hymenoptera: ants, bees, horntails, sawflies, and wasp, page 9 Isoptera: termites, page 11 Lepidoptera: butterflies and moths, page 12 Mallophaga: chewing and biting lice, page 13 Mantodea: mantids, page 14 Neuroptera: antlions, lacewings, snakeflies and dobsonflies, page 14 Odonata: dragonflies and damselflies, page 15 Orthoptera: crickets, grasshoppers, and katydids, page 15 Phasmida: Walking sticks, page 16 Plecoptera: stoneflies, page 16 Psocoptera: Psocids or booklice, page 17 Siphonaptera: Fleas, page 17 Thysanoptera: Thrips, page 17 Trichoptera: Caddisflies, page 18 Zygentomaa: Silverfish and Firebrats, page 18 Anoplura Sucking Lice • Feeds by sucking blood from mammals. • Some species (head lice and crabs lice) feed on humans. Metamorphosis: Simple/Gradual Features: [Figure 1] Figure 1. Sucking lice o Wingless o Mouthparts: Piercing/sucking, designed to feed on blood. o Body: Small head with larger, pear-shaped thorax and nine segmented abdomen. 313-1 Blattaria (Subclass of Dictyoptera) Cockroaches and Woodroaches • Most species are found in warmer subtropical to tropical climates. • The German, Oriental and American cockroach are indoor pests. • Woodroaches live outdoors feeding on decaying bark and other debris. Metamorphosis: Simple/Gradual Figure 2. American cockroach Features: [Figure 2] o Body: Flattened o Antennae: Long, thread-like o Mouthparts: Chewing o Wings: If present, are thickened, semi-transparent with distinct veins and lay flat.
    [Show full text]
  • A Check List of Gerromorpha (Hemiptera) from India
    Rec. zool. Surv. India: 100 (Part 1-2) : 55-97, 2002 A CHECK LIST OF GERROMORPHA (HEMIPTERA) FROM INDIA G. THIRUMALAI Zoological Survey of India, Southern Regional Station, Chennai 600 028. INTRODUCflON The Infraorder Gerromorpha comprises of semi-aquatic bugs characterised by long conspicuous antennae, longer than head and inserted in front of eyes. They are distributed in all kinds of climatic zones, except the coldest and driest parts. This infraorder contains 8 families namely, Gerridae, Veliidae, Hydrometridae, Mesoveliidae, Hebridae, Macroveliidae, Paraphrynoveliidae and Hennatobatidae (Andersen, 1982a). Knowledge of Indian semi-aquatic Hemiptera is limited to the taxonomic preliminaries, recording species from different parts of the country. (Distant, 1903a; 1910 a&b; Annandale, 1919; Bergroth, 1915a; Paiva, 1919a & b; Dover, 1928; Hafiz & Mathai, 1938; Hafiz & Riberio, 1939; Hafiz & Pradhan, 1947; Pradhan, 1950a, b& 1975; Gupta, 1981; Selvanayagam, 1981; Roy et al. 1988; Ghosh et al. 1989; Polhenlus & Starmuhlner, 1990; Bal & Basu, 1994 & 1997; Chen & Zettel, 1999). The revisionary work of Andersen (1975, 1980, 1990 & 1993); Den Boer (1969); Hungerford & Matsuda (1958a & b, 1960, 1962b & 1965); Herring (1961); Polhemus & Andersen (1984); Andersen & Foster (1992); Andersen & Chen (1993); Chen & Nieser (1993a & b); Polhemus & Karunaratne (1993); Polhemus (1994); Polhemus & Polhemus (1994 & 1995a) on a few genera of Gerridae; Lundblad (1936) on the genera Rhagovelia Mayr and Tetraripis Lundblad; Andersen (1981 b, 1983 & 1989); Polhemus
    [Show full text]
  • NOTES on WATER BUGS from SOUTH EAST ASIA and AUSTRALIA (Heteroptera: Nepomorpha & Gerromorpha)
    F. M. BUZZETTI, N. NIESER & J. DAMGAARD: Notes on water bugs ... 31 FILIPPO MARIA BUZZETTI, NICO NIESER & JAKOB DAMGAARD NOTES ON WATER BUGS FROM SOUTH EAST ASIA AND AUSTRALIA (Heteroptera: Nepomorpha & Gerromorpha) ABSTRACT - BUZZETTI F.M., NIESER N. & DAMGAARD J., 2006 - Notes on water bugs from South East Asia and Australia (Heteroptera: Nepomorpha & Gerromorpha). Atti Acc. Rov. Agiati, a. 256, 2006, ser. VIII, vol. VI, B: 31-45. Faunistical data on some Nepomorpha and Gerromorpha from South East Asia and Australia are given. Hydrometra greeni Kirk., Limnogonus (Limnogonoides) pecto- ralis Mayr and Halobates sp. are reported as new records for Myanmar. KEY WORDS - Faunistics. RIASSUNTO - BUZZETTI F.M., NIESER N. & DAMGAARD J., 2006 - Su alcuni Emitteri acquatici del Sud Est Asiatico e dellAustralia (Heteroptera: Nepomorpha & Gerro- morpha). Si riportano alcuni dati faunistici relativi a Nepomorfi e Gerromorfi dal Sud Est Asiatico e dallAustralia. Hydrometra greeni Kirk., Limnogonus (Limnogonoides) pecto- ralis Mayr e Halobates sp. sono per la prima volta citati per il Myanmar. PAROLE CHIAVE - Faunistica. INTRODUCTION In this publication the Nepomorpha and Gerromorpha from South East Asia and Australia presently in the F. M. B. private collection are reported. Some specimens transferred to the Nieser collection are indi- cated NCTN. Other data from the collection of the Zoological Muse- um of Copenhagen University are indicated as ZMUC. Some synony- my is abbraviated but can be found in the publications cited under the various species. When given, measurements are in mm. The collecting localities from Myanmar are shown in Map 1. 32 Atti Acc. Rov. Agiati, a. 256, 2006, ser.
    [Show full text]
  • Hemiptera: Gerromorpha: Veliidae) from Tamil Nadu, India: the First Species of the Genus Described from the Indian Subcontinent
    Zootaxa 4033 (2): 287–292 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Correspondence ZOOTAXA Copyright © 2015 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.4033.2.9 http://zoobank.org/urn:lsid:zoobank.org:pub:06E745FD-594D-4720-8E90-5F05FF87CE6E Strongylovelia lillyae sp. nov. (Hemiptera: Gerromorpha: Veliidae) from Tamil Nadu, India: the first species of the genus described from the Indian subcontinent E. EYARIN JEHAMALAR Zoological Survey of India, New Alipore, Kolkata- 700053, India. E-mail: [email protected] Abstract Strongylovelia lillyae sp. nov. is described from Kanyakumari district, Tamil Nadu, India and constitutes the first species of the genus from Indian subcontinent. The new species is closely related to Strongylovelia setosa Zettel & Tran and S. vasarhelyii Zettel & Tran from Vietnam. A distribution map and photographs of S. lillyae sp. nov. are presented here. Key words: Haloveliinae, taxonomy, Kanyakumari district Introduction Members of the limnic genus Strongylovelia Esaki (1924), are very small tear-shaped water striders, ranging in size between 0.89 mm and 1.80 mm, and belonging to the subfamily Haloveliinae of family Veliidae. The subfamily Haloveliinae contains five known genera, of which, three are marine - Halovelia Bergroth (1893), Xenobates Esaki (1927) and Haloveloides Andersen (1992) - and two are freshwater - Strongylovelia Esaki (1924) and Entomovelia Esaki (1930). The members of Strongylovelia are distributed across the Indomalayan (Sri Lanka, India, southern and southwest China, Vietnam, Thailand, Indonesia, Borneo, Malaysia and Philippines) and Australasian (New Britain and New Guinea) regions. Presently, 27 species and 2 subspecies are recognized, including the new species described here (Esaki, 1924, 1926, Lundblad, 1933, Polhemus, 1979, Lansbury, 1993, Lansbury & Zettel, 1997, Zettel, 2003a,b, Chen et al.
    [Show full text]