Chapter I: Introduction

Home , Carboxypeptidase D, Histidinol dehydrogenase, Homoserine dehydrogenase, Oligopeptidase A, PRPF40A, Shikimate dehydrogenase

DOCTORAL SCHOOL IN BIOLOGY Biology Applied to Human Health

XXVII Cycle

DUAL RNA-SEQUENCING APPROACH FOR DISSECTING NONTYPEABLE HAEMOPHILUS INFLUENZAE AND HOST CELL TRANSCRIPTOMES

Presented by: Buket Baddal

Supervisors: Dr. Alfredo Pezzicoli

Dr. Marco Soriani

Director: Prof. Paolo Visca

I dedicate this thesis to my beloved parents who inspired and supported me unconditionally in countless ways.

ABSTRACT

Characterization of host-pathogen interactions is critical for the development of next-generation therapies and vaccines. Classical approaches involve the use of transformed cell lines and/or animal models which may not reflect the complexity and response of the human host. The Gram-negative bacterium nontypeable Haemophilus influenzae (NTHi) commonly resides as a commensal in the human nasopharynx from where it can disseminate to local organs to cause a wide spectrum of diseases including otitis media, chronic obstructive pulmonary disease, cystic fibrosis and bronchitis. Successful colonization by NTHi depends on its ability to adhere and adapt to the respiratory tract mucosa, which serves as a frontline defense against respiratory pathogens. In opportunistic infections, colonization is followed by either a paracellular route across the epithelial barrier or invasion of non-phagocytic and epithelial cells. However, the temporal events associated to a successful colonization are far from being fully characterized.

Recent improvements in tissue engineering techniques including the development of differentiated primary cell cultures and organotypic 3D cellular models have significantly increased our understanding of microbial pathogenesis by providing physiologically relevant representations of human upper airway tissue. Bridging of these techniques with the currently available next-generation sequencing technologies is a conceptually novel approach for studying infection-linked transcriptome alterations in such systems. Massively parallel cDNA sequencing (RNA-seq) offers the possibility of comprehensive and simultaneous whole genome transcriptional profiling of both host and invading pathogen, and overcomes the existing technical and economical limitations of probe-dependent methods.

Taking advantage of the technological advances, we reconstituted the ciliated human bronchial epithelium in vitro using primary bronchial epithelial cells to simultaneously monitor the infection-linked global changes in NTHi and infected host epithelia gene expression by dual RNA-seq. Acquisition of a total of nearly 2,5 billion sequences allowed construction of high-resolution strand-specific transcriptome maps of NTHi during infection of host mucosal surface, and monitoring of metabolic as well as stress-induced host-adaptation strategies of this pathogen. The initial stage of colonization was characterized by the binding of NTHi to cilia. Temporal analysis of host mRNA signatures revealed consequent remodeling of target cell cytoskeleton and junction complexes elicited by bacterial infection, with a profound effect on intermediate filament network of bronchial epithelium. At later stage of infection when bacteria start to internalize, NTHi down-regulated the central metabolism and increased the expression of transporters indicating alterations in the bacterial metabolic regime due to the evolving substrate availability. Concurrently, the oxidative environment generated by infected cells instigated bacterial expression of stress-induced defense mechanisms including the transport of exogenous glutathione and the activation of the toxin-antitoxin system.

Notably, as part of our screening for novel signatures of infection, we identified a global profile of noncoding transcripts that are candidate small RNAs regulated during human host infection in Haemophilus species. Our data by providing a robust and comprehensive catalogue of regulatory and adaptive responses reflecting the complex crosstalk between the host and invading pathogen, may provide important insights into NTHi pathogenesis and the development of efficacious preventive strategies.

tissue engineering | host-pathogen interaction | dual RNA-seq | NTHi transcriptome | host response

III

RIASSUNTO

La caratterizzazione delle interazioni ospite-patogeno è fondamentale per lo sviluppo di nuove terapie e vaccini di ultima generazione. Approcci classici prevedono l'utilizzo di linee cellulari trasformate e/o modelli animali che non possono riflettere la complessità e la risposta dell'ospite umano. Il batterio Gram-negativo nontypeable Haemophilus influenzae (NTHi) risiede comunemente come commensale nel rinofaringe umano da dove può diffondere ai tessuti adiacenti provocando un ampio spettro di malattie, tra cui otite media, COPD, fibrosi cistica e bronchite. La capacità di colonizzazione di NTHi dipende dalla sua abilità di aderire ed adattarsi alla mucosa delle vie respiratorie, che ha la funzione di prima linea difensiva contro gli agenti patogeni del tratto respiratorio. Durante le infezioni opportunistiche, la colonizzazione è seguita da un attraversamento paracellulare della barriera epiteliale o dall’invasione di cellule non fagocitiche ed epiteliali. Tuttavia gli eventi temporali associati ad una colonizzazione produttiva non sono stati ancora completamente caratterizzati.

Recenti miglioramenti delle tecniche di ingegneria tissutale in vitro, tra cui lo sviluppo di colture cellulari primarie differenziate e modelli cellulari 3D organotipici, hanno aumentato significativamente la nostra comprensione della patogenesi microbica fornendo rappresentazioni fisiologicamente rilevanti di tessuto delle vie aeree superiori umani. La combinazione di queste tecniche con le tecnologie di sequenziamento di nuova generazione è un approccio concettualmente innovativo per studiare le alterazioni del trascrittoma durante un’infezione. Il sequenziamento tramite RNA-seq offre la possibilità di analizzare simultaneamente il trascrittoma di ospite e patogeno, superando le limitazioni tecniche relative alla separazione dei campioni eucariotici da quelli procariotici.

In questo studio l'epitelio ciliato bronchiale umano è stato ricostituito in vitro utilizzando cellule epiteliali bronchiali primarie ed usato come modello di infezione per NTHi. Successivamente, tramite dual-RNA sequencing, sono state analizzate le variazioni dell’espressione genica di entrambi ospite e patogeno. L’acquisizione di un totale di quasi 2,5 miliardi di sequenze ha permesso la costruzione di mappe ad alta risoluzione del trascrittoma di NTHi durante l'infezione dell’epitelio, la caratterizzazione dell’adattamento metabolico nonché dei pathways di adattamento allo stress cellulare. Nella fase iniziale della colonizzazione è stata osservata l’adesione di NTHi alle cellule ciliate. L’analisi temporale del trascrittoma dell’epitelio ha evidenziato il rimodellamento del citoscheletro, in particolare come riarrangiamento della rete dei filamenti intermedi. Nelle fasi successive dell’infezione, quando i batteri iniziano ad essere internalizzati, NTHi down- regola il metabolismo centrale e aumenta l'espressione di trasportatori specifici per alcuni substrati disponibili nel nuovo ambiente. Contemporaneamente l'ambiente ossidativo generato dalle cellule infettate induce l’espressione batterica di meccanismi di difesa dallo stress fra cui il trasporto di glutatione esogeno e l'attivazione dei sistemi tossina/anti-tossina.

Abbiamo inoltre identificato una serie di nuovi small RNAs batterici fortemente regolati durante l'infezione. Questo lavoro fornisce la caratterizzazione dei trascrittomi dell’ospite e del patogeno nelle prime fasi d’infezione, e suggerisce lo sviluppo di strategie mirate per prevenire le infezioni di NTHi.

ingegneria tissutale | interazione ospite-patogeno | dual RNA-seq | NTHi trascrittoma | risposta dell'ospite

ACKNOWLEDGEMENTS

This work was conducted at Novartis Vaccines, Siena in In Vitro Cell Biology Group, headed by Dr. Marco Soriani. I am very thankful for his welcoming in the lab, providing me with the opportunity to work at the frontier of current vaccine development and cutting-edge technologies, but most importantly for always being there to help. I equally thank Prof. Christoph Tang who has awarded me with Marie Curie Fellowship and allowed me to perform my thesis project under the framework of European Community's Seventh Framework Programme “EIMID ITN” [European Institute of Microbiology and Infectious Diseases Initial Training Network, FP7-PEOPLE-2010-264388], as well as his enriching collaboration and hosting me in this laboratory in University of Oxford.

I am extremely grateful to my supervisor, Dr. Alfredo Pezzicoli for his guidance over the course of my PhD, for his never-wavering optimism, giving me the initiative to grow as an independent research scientist and above all, for teaching me how much fun microscopy can be. I also thank Prof. Paolo Visca from University of Roma Tre for all the support and valuable advice he has given me during my PhD.

I would like to acknowledge all my lab members (past and present) of the In Vitro Cell Biology group at Novartis, particularly Lucia Lapazio, Maria Valeri, Pasquale Marrazzo, Silvia Rossi Paccani and Alessandra Greco for the friendly atmosphere they created in the lab, their scientific feedback, and moral support during tough days. I am especially grateful to my precious friends Christina Merakou, Tanja Dapa, Cristina Faralla, Magdalena Kasendra, Riccardo Barrile and Giacomo Golfieri for their kindhearted help and care, all the fun we had together, keeping me company in the lab at the weekends and over summer, and for making my PhD experience thoroughly enjoyable. Special thanks to Giuseppe Lofano for his valuable support, as for his inestimable encouragement to me and my work.

I would like to equally thank to my doctoral schools at University Roma Tre and PhD Academy at Novartis Vaccines for their active drive to provide a dynamic, interdisciplinary and stimulating science education. I also feel the urge to thank Rino Rappuoli for being such a pioneering and inspiring leader, for the constructive discussions we had, and his encouragements to improve my scientific approaches.

To the members of my thesis defense committee, I am thankful for kindly accepting to spend your precious time to judge my work.

Lastly, I really want to thank my special family; my father Zafer, my mother Nevres, and my sister Nukhet, for their continuous and unconditional support, starting from the beginning of my studies to the end of my PhD, for making me to believe in myself and for teaching to give always the best of me.

TABLE OF CONTENTS

ABSTRACT ...... III ACKNOWLEDGEMENTS ...... V LIST OF ABBREVIATIONS ...... X LIST OF FIGURES ...... VIII LIST OF TABLES ...... IX RIASSUNTO ...... IV TABLE OF CONTENTS ...... VI

1 INTRODUCTION ...... 1

1.1 HAEMOPHILUS INFLUENZAE ...... 1 1.1.1 NTHi: emergence of a significant human pathogen ...... 2 1.1.2 Otitis Media (OM) ...... 4 1.1.3 Chronic Obstructive Pulmonary Disease (COPD) ...... 5 1.1.4 NTHi: host-pathogen interactions ...... 6

1.2 TISSUE ENGINEERING FOR RECONSTITUTING IN VITRO CORRELATES OF HUMAN TISSUE ...... 11 1.2.1 Structure and cellular organization of human tracheo-bronchial epithelium ...... 12 1.2.2 In vitro tissue culture systems to study pathogen interactions with human airway epithelium ... 14

1.3 HOST-PATHOGEN INTERACTIONS ...... 16 1.3.1 Monitoring interactions at host-pathogen interface: an emerging theme ...... 16 1.3.2 Transcriptomic approaches for studying host-pathogen cross-talk ...... 17 1.3.2.1 Array-based methodologies ...... 18 1.3.2.2 Next-generation sequencing ...... 22

AIMS OF THE STUDY ...... 25

2 EXPERIMENTAL PROCEDURES ...... 26

2.1 CALU-3 CELL-LINE ...... 26

2.2 PRIMARY AIRWAY EPITHELIAL CELLS ...... 27

2.3 BACTERIAL CULTURE AND TIME-COURSE INFECTION OF CALU-3 AND WD-NHBE CELLS...... 28

2.4 ISOLATION OF TOTAL RNA FROM INFECTED CELLS ...... 29

2.5 CDNA LIBRARY CONSTRUCTION AND ILLUMINA SEQUENCING ...... 29

2.6 READ MAPPING AND DATA ANALYSIS ...... 33 2.6.1 Bioinformatics ...... 34 2.6.2 Clustering and Enrichment Analysis ...... 34

2.7 REAL-TIME QUANTITATIVE REVERSE-TRANSCRIPTION-PCR ...... 34

2.8 IMMUNOFLUORESCENCE MICROSCOPY...... 35

2.9 ELECTRON MICROSCOPY ...... 35

2.10 WESTERN BLOTTING ...... 35

2.11 DETERMINATION OF CYTOKINE/CHEMOKINE CONCENTRATION ...... 36

2.12 STATISTICAL ANALYSIS ...... 36

3 RESULTS ...... 37

3.1 NTHI INTERACTIONS WITH HUMAN BRONCHIAL EPITHELIUM IN VITRO ...... 37 3.1.1 NTHi forms biofilms on airway epithelia ...... 37 3.1.2 NTHi preferentially targets ciliated cells of primary human bronchial epithelium ...... 38

3.2 DUAL RNA-SEQUENCING OF NTHI-INFECTED WD-NHBE CELLS ...... 41

3.3 TRANSCRIPTOME ANALYSIS OF BRONCHIAL EPITHELIUM DURING NTHI INFECTION ...... 42 3.3.1 The human host cell response to NTHi infection ...... 42 3.3.2 Functional characterization of host transcriptome signatures ...... 49

3.4 NTHI WHOLE-TRANSCRIPTOME ANALYSIS DURING INFECTION OF BRONCHIAL EPITHELIUM ...... 53 3.4.1 Genome-wide NTHi transcriptome map during infection ...... 53 3.4.2 Gene repertoire of NTHi during host infection ...... 54

4 DISCUSSION ...... 62

5 CONCLUDING REMARKS ...... 65

6 BIBLIOGRAPHY...... 66

7 APPENDICES ...... 78

VII

LIST OF FIGURES

FIGURE 1. MORPHOLOGICAL CHARACTERISTICS OF NONTYPEABLE HAEMOPHILUS INFLUENZAE...... 2 FIGURE 2. EPIDEMIOLOGY AND DISTRIBUTION OF H. INFLUENZAE SEROTYPES POST TYPE B VACCINATION...... 3 FIGURE 3. SIGNALING PATHWAYS BY WHICH NTHI INDUCES INFLAMMATORY RESPONSES FROM EPITHELIAL CELLS...... 8 FIGURE 4. MODEL OF NTHI COLONIZATION AND INVASION OF EPITHELIAL CELLS...... 10 FIGURE 5. CELL TYPES COMPRISING THE HUMAN TRACHEAL AND BRONCHIAL AIRWAY EPITHELIUM...... 13 FIGURE 6. A COMMON HOST-TRANSCRIPTIONAL RESPONSE TO PATHOGENS...... 21 FIGURE 7. COMPARISON BETWEEN PROBE-BASED TECHNIQUES AND RNA-SEQ APPROACH FOR TRANSCRIPTOMICS...... 23 FIGURE 8. ESTIMATION OF MINIMAL SEQUENCING DEPTH REQUIRED FOR DUAL HOST-PATHOGEN RNA-SEQ. .... 24 FIGURE 9. IN VITRO CALU-3 MODEL OF POLARIZED EPITHELIUM...... 26 FIGURE 10. DIFFERENTIATION SCHEDULE OF PRIMARY NHBE CELLS AT AIR-LIQUID INTERFACE...... 27 FIGURE 11. MUCOCILIARY PHENOTYPE MARKERS ARE PRESENT IN THE RECONSTITUTED IN VITRO HUMAN BRONCHIAL EPITHELIUM...... 28 FIGURE 12. OVERVIEW OF THE SCRIPTSEQ V2 RNA-SEQ LIBRARY PREPARATION METHOD...... 30 FIGURE 13. ILLUMINA'S SOLEXA SEQUENCING TECHNOLOGY...... 32 FIGURE 14. DATA ANALYSIS STRATEGY FOR DUAL RNA-SEQ...... 33 FIGURE 15. POLARIZED AIRWAY EPITHELIAL CULTURES INFECTED WITH NTHI SHOW PROGRESSIVE BIOFILM FORMATION OVER TIME...... 37 FIGURE 16. SEM ANALYSIS REVEALS THE PRESENCE OF A MATRIX STRUCTURE EMBEDDING BIOFILM- ASSOCIATED BACTERIA...... 38 FIGURE 17. NTHI PREFERENTIALLY TARGETS CILIATED CELLS OF PRIMARY HUMAN BRONCHIAL EPITHELIUM. . 39 FIGURE 18. ELECTRON MICROSCOPY ANALYSIS CONFIRMS NTHI CILIARY BINDING...... 40 FIGURE 19. CELLULAR FITNESS DECREASES IN A TIME-DEPENDENT MANNER DURING NTHI INFECTION...... 40 FIGURE 20. MAPPING ANALYSIS OF NON-RRNA READS OBTAINED FROM RNA-SEQ AGAINST NTHI AND HUMAN GENOMES...... 41 FIGURE 21. ANALYSIS OF HOST MRNA CHANGES DURING NTHI INFECTION...... 43 FIGURE 22. SEM MICROGRAPHS REVEAL MORPHOLOGICAL CHANGES IN INFECTED HOST CELL AS INDICATED BY TRANSCRIPTOME SIGNATURES...... 46 FIGURE 23. HEAT-MAP PROFILES OF NOVEL SNORNAS, MICRORNAS AND SCARNAS IDENTIFIED TO BE DIFFERENTIALLY EXPRESSED DURING NTHI INFECTION IN HOST CELLS ...... 48 FIGURE 24. FUNCTIONAL CHARACTERIZATION OF HOST TRANSCRIPTOME SIGNATURES...... 50 FIGURE 25. BASOLATERAL CYTOKINE/CHEMOKINE SECRETIONS INDUCED FOLLOWING NTHI INFECTION...... 51 FIGURE 26. VALIDATION OF COMPARATIVE RNA-SEQ ANALYSIS...... 52 FIGURE 27. GENOME-WIDE NTHI TRANSCRIPTOME MAP DURING 72 H OF HOST INFECTION...... 53 FIGURE 28. TEMPORAL EXPRESSION DYNAMICS OF NTHI DURING HOST INFECTION...... 55 FIGURE 29. EXPRESSION PROFILE OF SELECTED VIRULENCE FACTORS AND VACCINE CANDIDATES...... 57 FIGURE 30. EXPRESSION DYNAMICS OF SELECTED NTHI TRANSPORT MACHINERIES...... 58 FIGURE 31. INCREASED EXPRESSION OF STRESS-INDUCED BACTERIAL FACTORS DURING INFECTION...... 60 FIGURE 32. ARTEMIS VIEWER OF HIS LEADER ELEMENT AND GCVB...... 61 FIGURE 33: PER BASE SEQUENCE ILLUMINA QUALITY CONTROL ...... 93 FIGURE 34: FIGURE OF MERIT (FOM) ANALYSIS OF GENE CLUSTERS...... 94

VIII

LIST OF TABLES

TABLE 1. PREDOMINANT DISEASES AND THEIR BURDEN CAUSED BY NTHI ...... 4 TABLE 2. COMMON CELL TYPES USED IN THE GENERATION OF LUNG TISSUE MODELS ...... 14 TABLE 3. EXPERIMENTAL APPROACHES FOR MICROARRAY ANALYSIS ...... 19 TABLE 4. SUMMARY OF ILLUMINA RNA-SEQ MAPPING DATA...... 42 TABLE 5. INGENUITY PATHWAY ANALYSIS – TOP MOLECULAR AND CELLULAR FUNCTIONS SUMMARY ...... 44 TABLE 6. INGENUITY PATHWAY ANALYSIS – TOP CANONICAL PATHWAYS SUMMARY ...... 45 TABLE 7. SELECTED PAIRED INGENUITY PATHWAY ANALYSIS OF HOST FUNCTIONS SHOWING CHANGES IN CELLULAR ASSEMBLY AND ORGANIZATION MODULE...... 46 TABLE 8. SELECTED NTHI CANDIDATE SMALL NON-CODING REGULATORY RNAS WITH HIGH TRANSCRIPTIONAL ACTIVITY DURING HOST INFECTION IDENTIFIED BY RNA-SEQ ...... 61 TABLE 9. PRIMER SEQUENCES USED IN QRT-PCR ...... 78 TABLE 10. ANTIBODIES USED IN CLSM AND WB ANALYSIS ...... 79 TABLE 11. ILLUMINA HISEQ FLOWCELL DESIGN, 2-LANE RAPID RUN ...... 89 TABLE 12. ILLUMINA HISEQ FLOWCELL DESIGN, 8-LANE FLOWCELL FULL-RUN ...... 89 TABLE 13. SEQUENCE ANALYSIS PRIMARY RUN METRICS- ILLUMINA SEQUENCING RAW DATA (FULL RUN) ...... 91 TABLE 14. SEQUENCE ANALYSIS PRIMARY RUN METRICS- ILLUMINA SEQUENCING RAW DATA (RAPID RUN) ..... 92 TABLE 15. RAW DATA FOR EUKARYOTIC ANALYSIS ...... 95 TABLE 16. RAW DATA FOR PROKARYOTIC ANALYSIS ...... 129

LIST OF ABBREVIATIONS

AECII alveolar epithelial cells type II ALI air-liquid interface AOM acute otitis media AP1 activator protein-1 ARPC2 actin related protein 2/3 complex ATCC american type culture collection BAL bronchoalveolar lavage BEBM bronchial epithelial basal growth medium BH Benjamini-Hochberg BHI brain heart infusion Bis-Tris 2,2-Bis(hydroxymethyl)-2,2',2"-nitrilotriethanol BSA bovine serum albumin CAM cell-adhesion molecule cAMP cyclic adenosine monophosphate CDH cadherin CEACAM1 carcinoembryonic antigen family 1 CF cystic fibrosis ChoP phosphorylcholine CILP cartilage intermediate layer protein CK cytokeratin CLDN claudin CLSM confocal laser scanning microscopy

CO2 carbon dioxide COL7A1 collagen type VII COPD chronic obstructive pulmonary Disease CRP C-reactive protein CXCL chemokine (C-X-C motif) ligand DAPI 4',6-diamidino-2-phenylindole DAVID database for annotation, visualization and integrated discovery DE differentially expressed DMEM Dulbecco's modified Eagle's medium DNABII DNA-binding family II ECL enhanced chemiluminescence ECM extracellular matrix EEA1 early endosomal antigen 1 ENaC epithelial sodium channel EPPK epiplakin ER endoplasmic reticulum Erk extracellular-signal-regulated kinases ET eustachian tube FBN2 fibrillin 2 FBS fetal bovine serum FLG filaggrin FoM Figure of Merit GAPDH glyceraldehyde 3-phosphate dehydrogenase GCSF granulocyte-colony stimulating factor GEO gene expression omnibus GO gene ontology H hour HARV high-aspect rotating vessel Hib Haemophilus influenzae type b HLA human leukocyte antigen HMCN1 hemicentin HMW high-molecular-weight protein ICAM-1 intercellular adhesion molecule-1 IF intermediate filaments IFN interferon IgA immunoglobulin A Ihf integration host factor X

IL interleukin IPA Ingenuity Pathway Analysis K-cells Kulchitsky’s cells kDa kilodaltons KEGG Kyoto encyclopedia of genes and genomes KRT keratin LAMB3 laminin β3 LAMP lysosomal-associated membrane protein3 LDH lactate dehydrogenase LOS lipooligosaccharide LPS lipopolysaccharide MAPK mitogen activated protein kinase MEV multiexperiment viewer MMP matrix metalloproteinase mRNA messenger RNA MUC mucin MYL myosin light chain NAD+ nicotinamide adenine dinucleotide Neu5Ac N-acetylneuraminic acid NGS next generation sequencing NHBE normal human bronchial epithelial NTHi nontypeable Haemophilus influenzae OAS oligoadenylate synthetase OD optical density OMP outer membrane protein OMV outer membrane vesicle O/N overnight ORF open reading frame PCR polymerase chain reaction Pg picogram PKCϵ protein kinase C epsilon PKR protein kinase R PML promyelocytic leukaemia protein PRP polyribitol ribose phosphate PTS fructose-specific phosphotransferase system qRT-PCR quantitative real-time PCR RNA-seq RNA (deep) sequencing RPKM kilobase of target per million mapped reads RPTN repetin rRNA ribosomal RNA RSV respiratory syncytial virus RWV rotating wall vessel scaRNA small Cajal-body specific RNA SEM scanning electron microscopy SMS single-molecule sequencing snoRNA small nucleolar RNA SPON2 spondin 2 SPRR small proline rich protein sRNA small RNA STLV slow- turning lateral vessel TA toxin-antitoxin TEER transepithelial electrical resistance TEM transmission electron microscopy TGF-β transforming growth factor-beta TJs tight junctions TLR toll-like receptor TNF-α tumour necrosis factor-alpha TRAP tripartite ATP-independent periplasmic tRNA transfer RNA TTSS type III secretion system TUNEL terminal transferase-mediated dUTP nick end labeling ZO-I zonula occludens I

CHAPTER I: INTRODUCTION

1 INTRODUCTION

1.1 Haemophilus influenzae

H. influenzae is a Gram-negative, coccobacillary, facultatively anaerobic bacterium belonging to the Pasteurellaceae family (Fig. 1). The name of the genus, Haemophilus is derived from the Greek words meaning ‘blood-loving’ and refers to the fastidious nature of this organism with specific dependence on haeme-related molecules for growth under aerobic conditions. Indeed, laboratory in vitro growth requires the availability of nicotinamide adenine dinucleotide (NAD+) and haemin provided through lysed blood cells. H. influenzae strains are serologically classified on the basis of their distinct polysaccharide capsular antigens. These include encapsulated strains a, b, c, d, e, f and the non-encapsulated strain, nontypeable H. influenzae (NTHi). This bacterium commonly resides in the nasopharynx of most of the healthy human population as a part of the commensal flora, however under certain circumstances such as underlying viral infections, secondary bacterial infections or where host mucosal clearance mechanisms are compromised or impaired, it can disseminate to local organs to cause a wide spectrum of diseases. Of the capsulated strains, H. influenzae type b (Hib) is clinically the most important. In infants and young children, Hib is responsible for life- threatening conditions including pneumonia, bacteremia and acute bacterial meningitis. Prior to the development and use of Hib conjugate vaccines, Hib was the most common cause of invasive bacterial infection and bacterial meningitis in children in the United States. 20-30% of children who suffer from these devastating infections have permanent sequelae, ranging from mild hearing loss to mental retardation. Although the majority of cases of Hib-related morbidity and mortality are due to meningitis and pneumonia, other severe invasive infections caused by Hib include epiglottitis, osteomyelitis, septic arthritis, septicaemia, cellulitis, and pericarditis [1].

Hib conjugate vaccine was introduced in the late 1980s, the routine use being established in 1985. Hib vaccination has been largely effective as the widespread use have nearly eradicated invasive Hib disease in children in countries where the vaccine is widely used. The conjugate vaccines induce bactericidal antibodies to capsular polysaccharide [polyribitol ribose phosphate [(PRP)], a critical virulence factor that facilitates hematogenous dissemination. Like other polysaccharides, the PRP of the Hib capsule shares the common immunological property of T-independent B-cell activation, which is associated with poor or absent immunogenicity when administered as a vaccine in infancy and a failure to induce immunological memory at any age. Therefore, a key step in the development of the vaccine was the conjugation of PRP to a protein carrier, facilitating T-cell recruitment and enabling the induction of antibody responses in infants at the peak age incidence of Hib infection [2]. As well as inducing protective humoral immune responses, vaccination also markedly reduced circulating strains of Hib in the population by reducing nasopharyngeal carriage. The reduction of circulating strains in the population results in a herd effect, contributing significantly to the

CHAPTER I: INTRODUCTION efficacy of the vaccine. However, these alterations in the nasopharyngeal colonization patterns had a profound impact on the ecology of respiratory tract colonization by H. influenzae and the epidemiology of related infections.

A B

Figure 1. Morphological characteristics of nontypeable Haemophilus influenzae. A) Scanning electron micrograph showing coccobacillary cells, scale bar = 0.5 µm and B) transmission electron micrograph demonstrating the biofilm formed by H. influenzae, scale bar = 2 µm (Sources: Ohio State University Center for Clinical and Translational Science; Gallaher et al, 2006).

1.1.1 NTHi: emergence of a significant human pathogen

In recent years, a large number of surveys have focused on monitoring invasive H. influenzae disease in the Hib conjugate vaccine era by means of different study designs throughout the world. During these studies, infections caused by encapsulated non-type b serotypes, especially serotypes a and f, have been observed in selected geographic regions such as Canada, Germany and Sweden [4-12]. Of high importance, these surveys have revealed a shift in the distribution of capsular serotypes with nontypeable strains replacing type b strains as the most common bloodstream isolates, identifying NTHi strains as the predominant cause of invasive infection in the post vaccination era (Fig. 2). The shift in serotype distribution resulting from prevention of Hib disease in infants and children was accompanied by a shift in the peak age incidence. This was reflected in the cases of most common disease manifestation of invasive H. influenzae infection being bacteremia caused by nontypeable strains in adult population.

The heightened surveillance of NTHi have also led to the understanding of the increasing importance of NTHi as a pathogen in infections of the upper and lower respiratory tract. Considering the niche replacement taking place, continued surveillance procedures to carefully track the incidence, strain distribution, and clinical manifestations of H. influenzae disease remains critical to health intervention strategies.

CHAPTER I: INTRODUCTION

1000

900

800 700

600 b 500 NTHi 400

300 a, c, d, e, f

200

Number of cases for Number 100,000 population of cases 100 0

Figure 2. Epidemiology and distribution of H. influenzae serotypes post type b vaccination. NTHi is replacing H. influenzae type b niche in the post vaccination era - all cases (Source: Health Protection Agency, UK. September 2011)

NTHi is a common commensal of the human respiratory tract mucosa and occupies this niche as its natural habitat. The rate of nasopharyngeal colonization increases from approximately 20% during the first year of life to over 50% by the age of 5-6 years, and remains high through adulthood. The mechanism of pathogenesis of infection by NTHi is predominantly by contiguous spread, with migration of bacteria from the nasopharynx to adjacent structures, including sinuses, the middle ear, the trachea, and lower airways. NTHi is responsible for a wide spectrum of diseases including sinusitis, otitis media, exacerbations of chronic obstructive pulmonary disease (COPD), cystic fibrosis and bronchitis. The global burden of these non- invasive infections with NTHi and non-bacteraemic pneumonia is reported to be very high (Table 1). Transmission generally occurs by airborne droplets or by direct contact with respiratory secretions. Colonization and infection are mediated by multiple virulence factors, including adhesins, nutrient uptake systems, molecules that resist host factors, and others. Biofilm formation by NTHi in the middle ear and the airways of cystic fibrosis patients is important for the pathogenesis of infection, particularly chronic and recurrent infections that characterize these clinical settings.

CHAPTER I: INTRODUCTION

Table 1. Predominant diseases and their burden caused by NTHi (Modified from: Van Eldere et al, 2014) )

BURDEN Non-invasive disease Otitis media 55-95% cases in children

Bacterial conjunctivitis 44-68% of cases in children, 25% of cases in adults

Bacterial sinusitis 41% of cases

Exacerbations of COPD >90% during an acute exacerbation

Persistent bacterial bronchitis 81% of cases in children

Cystic fibrosis Up to 30% of sputum samples

Lower respiratory infections BAL: 20–94% of cases with community-acquired pneumonia*; lung aspirate: 15–40% of cases with pneumonia; blood culture: 2–10% of cases with bacteraemic pneumonia

Invasive disease†

Neonatal infections (sepsis and meningitis) 1.6-4.9 per 100 live births

Epiglottis and bone, joint, skin, and soft tissue infections have been reported but at a low incidence. BAL= bronchoalveolar lavage.*Geographically variable. †Usually associated with underlying comorbidity (40–70% in children; 60–80% in adults).

1.1.2 Otitis Media (OM)

Otitis media is the most frequently diagnosed childhood disease requiring medical assistance and clinic visits, affecting more than 75% of children younger than 3 years [14]. Acute otitis media (AOM) is the inflammation of the middle ear (the cavity between the eardrum and the inner ear), and episodes are characterized by fever, ear pain, and in severe cases, discharge from the ear. The disease presents as AOM or chronic infections, depending on the host’s ability to thoroughly clear the infection. Pathogenesis is a result of pathogen-induced inflammatory damage of the middle ear which can lead to significant or in some cases total hearing loss. The gold standard for an etiologic diagnosis is culture of middle ear fluid and requires tympanocentesis which is an invasive procedure and therefore is not routinely performed.

OM is a complex, multifactorial and polymicrobial disease caused by a number of viruses and bacteria [15]. Three bacteria are isolated in the majority of clinically-presented cases of OM: Streptococcus pneumoniae is isolated from approximately 40% of cases, NTHi from approximately 20-30% of cases, and Moraxella catarrhalis from 10-20% of cases. Based on results of middle ear fluid cultures obtained by tympanocentesis as part of clinical trials, NTHi is one of the most common causes of otitis media, accounting for 25 to 35% of episodes of acute OM [16]. Globally, up to 330 million people suffer from recurrent and chronic otitis media, and in developing countries complications, including chronic suppurative OM, are commonly observed [17].

CHAPTER I: INTRODUCTION

Biofilms are increasingly recognized as contributing factors to various disease pathogenesis including OM, cystic fibrosis and other respiratory tract diseases associated with chronic bacterial infections. The hypothesis that NTHi grows as biofilms emerged from the initial observations in which monthly sputum cultures from COPD patients revealed intermittent negative cultures despite continuous colonization by the same isolate proven by molecular typing, suggesting that the organism is present despite the negative sputum cultures [18]. Similarly, Rayner and colleagues have reported the presence of H. influenzae mRNA in a significant percentage of culturally sterile middle ear aspirates of children with OM, establishing the presence of viable, metabolically active, intact organisms in some cases of culture-negative OM with effusion [19]. These observations indicated that the culture methods designed to detect planktonic growth may be less sensitive for detecting slow-growing bacteria in biofilms. Indeed, in later studies NTHi biofilms were reported to be directly visualized in middle ear aspirates from children with OM [20], and additionally biofilms structures were demonstrated to form in the middle-ear chamber of experimentally infected chinchillas [21]. Biofilms serve as an immune evasion mechanism of pathogenic bacteria confirming protection against antibody- mediated targeting as well as protection from antibiotic therapy, hence promoting persistent and chronic infections. Interestingly, there are several lines of evidence that indicate that these biofilms are polymicrobial and are constituted by the bacterial communities colonizing the airway mucosal surfaces [22].

1.1.3 Chronic Obstructive Pulmonary Disease (COPD)

NTHi is the most common bacterial pathogen associated with airway infection in COPD, both in stable disease and during exacerbations. COPD is characterized by the progressive development of airflow limitation that is not fully reversible [23]. The term COPD encompasses chronic obstructive bronchitis, with obstruction of small airways, and emphysema, with enlargement of air spaces and destruction of lung parenchyma, loss of lung elasticity, and closure of small airways [24]. The airflow limitation is usually progressive and is associated with an abnormal inflammatory response of the lungs to noxious particles and gases, most frequently cigarette smoke, as well as to infecting respiratory pathogens. COPD is commonly observed in adults aged 40 years or older, particularly in the smoking population. It is the second most prevalent respiratory illness after asthma, and the fourth leading cause of mortality in the USA.

As one of the leading aetiological agents, NTHi is the predominant bacterium colonizing the airways in COPD patients and is found in the lower respiratory tract of ~30% of individuals with COPD at any time [25- 28]. In addition to colonization during clinically stable periods, acquisition of new strains of NTHi is an important cause of lower respiratory tract infection, resulting in exacerbations of COPD [29]. Together, these findings suggest that persistent or repetitive exposure of the airway to NTHi may contribute to airway inflammation in COPD. Defective immune responsiveness and impaired phagocytosis by alveolar macrophages might provide an immunologic basis for persistence in the airways of adults with COPD [30]. Cigarette smoke induces mucus dysfunction by several mechanisms such as shortening of the airway cilia,

CHAPTER I: INTRODUCTION impaired respiratory epithelial ciliogenesis and ciliary abnormalities [31-33], ultimately increasing mucin production, reducing mucus hydration, and decreasing mucus clearance, which might also contribute to airway colonization in COPD patients [34]. Several other mechanisms may also allow the infection to persist in the lower airways of patients including tissue invasion [35], antigenic alteration [36] and biofilm formation [37]. On the other hand, NTHi can contribute to COPD progression by inducing neutrophilic influx into the airways, neutrophil necrosis with release of neutrophil elastase and other matrix metalloproteinases, and production of oxygen radicals [38,39]. These mediators can overwhelm the anti-proteinase barrier of the lung and damage airway and alveolar structures, thereby amplifying smoking-induced lung damage.

1.1.4 NTHi: host-pathogen interactions

Successful colonization by NTHi depends on its ability to adhere and adapt to the respiratory tract mucosa, which serves as a frontline defense against respiratory pathogens. Upon entering the respiratory tract, NTHi interacts initially with mucus and are largely eliminated by the mucociliary escalator, which consists of ciliated respiratory epithelial cells and the associated mucus layer. Studies using chinchilla eustachian tube (ET) and middle ear mucosa sections demonstrate that NTHi mediates ascension of the ET from the nasopharynx primarily via adherence to and growth in mucus overlying the floor region of the tubal lumen. The outer membrane protein (OMP) P5-homologous fimbriae were shown to contribute to this binding as mutants lacking P5 exhibit reduced binding to respiratory mucus [40]. Interestingly, OMPs P2 and P5 were reported to mediate bacterial attachment to a complement of sialylated oligosaccharides within respiratory mucins [41]. More recently, it has been established that P5 binds to a member of the carcinoembryonic antigen family (CEACAM1), a glycoprotein expressed by respiratory epithelial cells and up-regulated during inflammation [42]. In vitro studies using isolated epithelial cells indicate that a range of other bacterial factors contribute to NTHi adherence. These include type IV pilus, expressed by selected NTHi isolates and in particular the major pilin subunit protein, PilA, which mediates adherence to respiratory epithelium [43,44]. Surface-exposed high-molecular-weight proteins HMW1 and HMW2 are major factors involved in facilitating the colonization of cultured human epithelial cells and the expression of HMW proteins is regulated by phase variation suggesting the ability of the organism to vary between states associated with efficient adherence versus effective immune evasion [45,46]. Experiments involving modification of the surface of Chang conjunctival cells indicate that HMW1 recognizes a glycoprotein receptor containing N- linked oligosaccharide chains with terminal sialic acid in an α-2,3 configuration, whereas the receptor of HMW2 remains uncharacterized [47]. Approximately 25% of nontypeable strains lack proteins belonging to the HMW1/HMW2 family of adhesins, however, nearly all such strains remain capable of efficient adherence to cultured human epithelial cells. This binding is commonly mediated by Hia protein which has sequence similarity to another H. influenzae adhesin, Hsf, associated with the formation of short pilus-like structures termed fibrils [48]. On the other hand, mutants deficient in expression of HMW1 and HMW2 or Hia still

CHAPTER I: INTRODUCTION remain capable of low-level adherence to cultured epithelial cells, and this is attributed to the presence of Hap protein. Hap is an autotransporter protein that undergoes autoproteolytic cleavage, with release of the adhesive passenger domain, Hap(s), from the bacterial cell surface. Hap has been demonstrated to promote bacterial adherence to extracellular matrix proteins fibronectin, laminin, and collagen IV and Hap-mediated adherence is enhanced by inhibition of autoproteolysis [49].

The molecular mechanisms underlying the pathogenesis of NTHi-induced infections involve activation of NF-κβ, a transcriptional activator of multiple host defense genes involved in immune and inflammatory responses (Fig. 3). This is mediated by binding of OMP P6 to cell surface TLR2 (Toll Like Receptor 2) and lipooligosaccharide (LOS) to the LPS receptor TLR4 (Toll Like Receptor 4) [50,51]. TLR ligation activates the transcription factor to translate various cytokine and mucin genes [52]. NTHi strongly activates NF-κβ in human epithelial cells via two distinct signaling pathways; NF-κβ translocation-dependent and -independent pathways. The NF-κβ translocation-dependent pathway involves activation of NIK (NF-κβ Inducing Kinase)- IKKα/β (I-κβ Kinases)-complex leading to I-κβ-α phosphorylation and degradation, whereas the NF-κβ translocation-independent pathway involves activation of MKK3/6-p38MAPK (Mitogen Activated Protein Kinase) pathway. MKK6 is a common activator of p38-αa and p38-β, whereas MKK3 activates only p38-α [53]. Bifurcation of NTHi-induced NIK-IKK-α/β- I-κβ-α and MKK3/6-p38MAPK signaling may occur at TAK1 (TGF-Beta Activated Kinase-1). TLR2 is required for NTHi-induced NF-κβ activation. In addition, several key inflammatory mediators including IL-β, IL-8, and TNF-α (Tumor Necrosis Factor-β) are upregulated by NTHi.

NTHi utilizes the TGF-β (Transforming Growth Factor-Beta)-SMAD signaling pathway together with the TLR2-MyD88-TAK1-NIK-IKK-β/ɣ-I-κβ-α pathway to mediate NF-κβ-dependent Muc2, mucin transcription. TGF-β initiates signaling through the ligand-dependent activation of a heteromeric complex of TGF-β RII and TGF-β RI (Type-II and Type-I Receptors). The TGF-β RII kinase then phosphorylates the TGF-β RI in a conserved GS domain (Glycine-Serine domain), resulting in activation of the TGF-β RI. The activated Type-I receptor subsequently recognizes and phosphorylates the R-SMAD (Receptor-activated SMADs), including SMAD3. This causes dissociation of R-SMAD from the receptor, stimulates the assembly of a heteromeric complex between the phosphorylated R-SMAD and the Co-SMAD, SMAD4, and consequently induces the translocation of the SMAD complex to the nucleus, where the SMAD complex regulates the expression of target genes by direct interaction and functional cooperation with other transcription factors, such as NF-κβ [54]. The functional cooperation of NF-KappaB (p65/p50) with SMAD3/4 positively mediates NF-κβ- dependent Muc2 transcription. Overproduction of mucin and the strong inflammatory response induced by NTHi damage the epithelium, and highly contribute to the airway pathology observed in COPD and otitis media.

CHAPTER I: INTRODUCTION

Figure 3. Signaling pathways by which NTHi induces inflammatory responses from epithelial cells. Schematic representation of NTHi-induced signal transduction pathways involved in NF-kB activation in human epithelial cells (Source: Pathway Central, Qiagen)

As a pathogen colonizing the ciliated respiratory epithelium, NTHi is capable of inducing ciliotoxicity on mucosal surfaces. At least two H. influenzae factors are known to influence ciliotoxicity and these include lipopolysaccharide (referred to as lipooligosaccharide or LOS in H. influenzae due to lacking O-side chains) and protein D. Purified LOS has been reported to causes ciliostasis, loss of cilia, and eventual sloughing of cells [55]. On the other hand, protein D is a highly conserved, surface-exposed 42 kDa lipoprotein. Interestingly, Janson and coworkers compared isogenic protein D-expressing and protein D-deficient strains in assays with human adenoid tissue in culture and demonstrated that protein D was essential for maximal impairment of ciliary activity and damage to ciliated cells [56]. Recently, with the use primary cultures of ciliated bovine bronchial epithelial cells Bailey and colleagues have shown that NTHi decreases cilia beating via protein kinase C epsilon (PKCϵ) activation and auto-down-regulation of PKCϵ leads to detachment of ciliated cells [57].

CHAPTER I: INTRODUCTION

Once established on the host mucosal surface, bacteria face the challenge of persisting. Persistence requires evasion of the immune system, including both non-specific and specific host responses. The predominant immunoglobulin produced by mucosal tissues is IgA, a molecule that participates in host defense by inhibiting microbial adherence and invasion, inactivating bacterial toxins, and mediating antibody dependent cytotoxicity [58]. Along with several other bacterial species, NTHi harbors an extracellular endopeptidase called IgA1 protease, which cleaves the hinge region of the serum and secretory forms of IgA1, and releases the antigen-binding Fab domains from the Fc portion of the molecule. As a result of cleavage, the agglutination activity of both free and antigen-bound IgA1 is eliminated [59,60]. As previously described in Section 1.1.2, formation of bacterial aggregates and microcolonies that mature into a biofilm is an important and intensely studied form of NTHi persistence in vitro and in vivo [61-64]. Biofilm state of growth is considered to be a significant virulence factor, conferring resistance to natural bacteriostatic compounds such as lactoferrin, lysozyme, and peroxidases, which are present in human respiratory secretions and are important components of the innate immune system. In addition, bacterial aggregates block the access of antibodies to individual organisms, thereby hindering antibody-dependent killing and clearance by phagocytosis.

Although initially considered as an extracellular pathogen, numerous studies suggest that NTHi is able to pass between cells and invade the subepithelial space [65,66]. In opportunistic infections, colonization is followed by either a paracellular route across the epithelial barrier or invasion of non-phagocytic and epithelial cells (Fig. 4). Indeed, wild-type NTHi clinical isolates have been demonstrated in vitro and in vivo to adhere and invade a number of cell types mainly by macropinocytosis [67-72]. Garmendia and colleagues have demonstrated that NTHI in mouse alveolar macrophages, in human alveolar epithelial cells, and in primary normal human bronchial epithelial cells were trafficked by the endolysosomal pathway [73,74]. NTHi was detected within vesicles positive for early endosomal antigen 1 (EEA1), a marker of early endosomes, and in vesicles positive for LAMP1, LAMP2, or CD63, which are markers of late endosomes and lysosomes. In addition, few studies have examined the role of autophagy in NTHi infection. These studies suggest that NTHi does not co-localize with autophagy marker LC3 in alveolar epithelial cells, or in cells treated with rapamycin, a known autophagy inducer. Eukaryotic secretion is the pathway by which proteins and lipids are modified and packaged through the endoplasmic reticulum (ER) and Golgi for intracellular or extracellular destinations. Certain bacterial pathogens engage this pathway to reach their destination or to form a replicative intracellular niche [75]. Although little is known about the role of eukaryotic secretion in NTHi infections, Morey et al. has shown that NTHi do not co-localize with resident Golgi proteins GM130 and TGN46 in alveolar epithelial cells.

CHAPTER I: INTRODUCTION

Figure 4. Model of NTHi colonization and invasion of epithelial cells. NTHi adheres to mucus and unidentified epithelial cells. NTHi aggregates mature into a biofilm composed of bacterial and host components. Bacteria are observed within, between, and beneath epithelial cells in vitro and ex vivo. NTHi is internalized by macropinocytosis and is trafficked to vesicles that are positive for endolysosomal markers. It is unclear what role(s) other host internalization and trafficking pathways (indicated by question marks) play, or how these pathways affect NTHI viability (Source: Clementi and Murphy, 2011).

On the other hand, H. influenzae has evolved to employ maximal phase variation, commonly involving structures that facilitate the pathogenesis of disease and serve as targets of the immune response such as LOS, pili, HMW1 and HMW2, and heme receptors. The biosynthesis of LOS involves multiple enzymatic steps and a number of genes, of which lic1A, lic2A, lic3A, lex-2, and lgtC contain long stretches of four-base-pair repeats within their 5’ coding region, that undergo frameshift mutation. Such frame shifts result in production of a protein with a different N-terminus or eliminate protein production altogether. Changes in lic2A and lic3A influence glycotransferase activity hence altering the reactivity with monoclonal antibodies directed against specific LOS oligosaccharide epitopes [77]. Variation in the number of repeat units in lic1A by slipped-strand mispairing alters the alignment of initiation codons with the licA open reading frame creating a translational switch that results in spontaneous phase variation in expression of the choline kinase responsible for addition of phosphorylcholine (ChoP) to the LOS molecule [78]. Variations in the ChoP epitope contributes to persistence, in which ChoP+ variants of NTHi are more sensitive to the bactericidal activity of human serum through binding of C-reactive protein (CRP). Therefore, the ability of NTHi to vary expression of ChoP epitopes is considered as an immune evasion mechanism through which the bacterium can persist on the mucosal surface (ChoP+ phenotype) and to cause invasive infection by evading innate immunity mediated by CRP (ChoP− phenotype) [79]. Added complexity comes from variable expression and availability of certain host cell receptors and matrix proteins. These bacterial and host variations likely promote bacterial evasion of host clearance mechanisms. The Sap transporter and LOS ChoP appear to protect NTHi against

CHAPTER I: INTRODUCTION human antimicrobial peptides β-defensin and cathelicidin LL-37, respectively, which are important respiratory defense molecules [80,81]. NTHi LOS glycosyltransferase Lic2B activity and the ability to bind host complement inhibitors C4 binding protein, factor H, and vitronectin promote NTHi evasion of complement-mediated killing [82-84].

On the host side, the respiratory epithelium is capable of expression a range of inflammatory mediators which stimulate the activation and influx of immune cells including neutrophils, monocytes, macrophages and eosinophils. Mucosal inflammation is beneficial to the host, limiting the spread and facilitating the clearance of pathogenic invading organisms. Yet, this response can also have detrimental effects in certain conditions. For example, influx of neutrophils results in release of neutrophil elastase which can damage epithelial cells, impairing of opsonophagocytosis and stimulating the production of mucus. This can also lead to the impairment of the mucociliary clearance allowing further replication and persistence of colonizing bacteria with a further flux of inflammatory cells [85].

1.2 Tissue engineering for reconstituting in vitro correlates of human tissue

To understand fully how tissues form and function, as well as their pathophysiology, it is crucial to study how cells and tissues behave as parts of whole living organs that are composed of multiple, tightly opposed tissue types that are highly dynamic and variable in terms of their 3D structure, mechanical properties and biochemical microenvironment [86]. Tissue engineering has evolved from the field of biomaterials development and refers to the practice of combining scaffolds, cells, and biologically active molecules into functional tissues. The goal of tissue engineering is to assemble functional constructs that restore, maintain, or improve damaged tissues or whole organs. In recent years, this approach has been applied by various fields of scientific research including pharmaceutical studies for drug development, regenerative medicine and importantly to the study of infectious diseases.

Animal models are undoubtedly indispensable tools in the current scientific setting, in particular for microbiology and immunobiology studies as they provide an in vivo milieu and an immune cell repertoire that significantly enhance our understanding in the context of clinical background and therapeutical interventions. Yet, animal models usually fail to reflect the complexity and response of the human host, and majority of the pre-clinical data produced in animal models are usually not supported by efficacy/clinical trials. In addition, animal models have the disadvantages of related ethical issues and high costs. In the last decade, there has been a plethora of studies with various cellular models with the unique aim of recapitulating the in vivo microenvironment of the modeled organ system to study microbial pathogenesis and ultimately reduce dependency on animal testing. Depending on the pathogen and the stage of pathogenesis under investigation, this can be a skin model, an intestinal, lung, liver, vaginal, nasopharyngeal or neuronal tissue. Most of these studies have relied on analysis of cells, usually transformed/immortalized cell-lines, grown in 2D cell culture

CHAPTER I: INTRODUCTION models which involve growing cells as monolayers on solid, impermeable surfaces (plastic or glass) or in uniform suspension. Indeed, 2D monolayers have contributed greatly to our understanding of infectious- disease processes, including the host immune and physiological mechanisms used to defend against viral, bacterial, fungal and parasitic infections [87-93]. Despite these tremendous efforts, it is becoming increasingly evident that the ‘flat biology’ approach with conventional 2D cell culture, in which key phenotypic and functional characteristics are often lost, is not predictive of in vivo tissue responses [94]. One key reason for the loss of differentiation that occurs in monolayers is the dissociation from the native in vivo 3D structure to 2D propagation on flat, impermeable substrates in vitro, which also prevents cells responding to chemical and molecular gradients in three dimensions; reflecting the apical, basal and lateral cell surfaces. Due to the lack of the complexity, and often physiological relevance, of the tissues that are encountered by a pathogen during the natural course of infection in vivo, 2D monolayers may fail to predict the course of infection.

To overcome the inherent limitations associated with 2D monolayers, there has been a shift towards the use of 3D tissue models as high fidelity tools to facilitate the transition from basic cellular research to clinical applications, given that tissues and organs are 3D structures. In contrast to 2D monolayers, 3D cell culture models are modular, and adaptable biomedical systems that range in complexity from a monotypic (single cell type), representing the minimum unit of undifferentiated in vivo tissue, to complex co-culture models that recapitulate both 3D architecture and the multicellular complexity of the parental tissue. The establishment of complex 3D tissue equivalents is principally based on primary (untransformed) cells and organ cultures which retain the ability to differentiate into different cell types when grown in in vitro conditions, and their establishment can be achieved via several methodologies, including spontaneous aggregation in a suspension culture, implantation into 3D matrix scaffolds and culture in transwell systems or in a rotating culture bioreactors [95].

1.2.1 Structure and cellular organization of human tracheo-bronchial epithelium

The human airway epithelium represents a primary site for contact between microbes and their hosts. It is the prime target of various respiratory bacterial pathogens e.g. H. influenzae, S. pneumoniae, M. catarrhalis, N. meningitides, particularly during colonization, as well many viruses such as influenzae viruses and respiratory syncytial virus (RSV). Several morphologically distinct and specialized cell types comprise the human trachea-bronchial epithelium, which represents as a pseudo-stratified columnar epithelium. Ciliated cells are terminally differentiated columnar cells and as a component of the mucociliary escalator system, their main function is to remove inhaled particulate matter, including viruses and bacteria which have been trapped in the mucus layer. With a smaller percentage, there are also ciliated-secretory cells that bear fully developed cilia and contain mucus granules. Secretory cells comprise 15-25% of the bronchial epithelium and are present in several types including goblet cells, the main producers of airway mucus and predominant

CHAPTER I: INTRODUCTION secretory cell type in the larger airways and neuroendocrine cells (Kulchitsky’s cells or K-cells) that contain amines and peptide hormones. Clara cells are the predominant cell type in the bronchioles and produce the surfactant apoproteins A and B, as well as secretory leukoprotease inhibitors. Whereas all the mentioned cell types form the epithelial surface of the airways, basal cells reside deep in the trachea-epithelium and are considered as the stem cell or progenitor cells of the bronchial epithelium (Fig. 5).

A B

Figure 5. Cell types comprising the human tracheal and bronchial airway epithelium. A) Graphical representation of the structure and cellular organization of bronchial epithelium, constituted by highly specialized cell types including ciliated cells with beating activity and goblet cells which secrete mucus, and is decorated by junction complexes that exhibit host defense activities (Source: Wadsworth et al, 2012) B) Light microscopy of hematoxylin and eosin stained bronchial airway epithelium showing the abundance of goblet cells (G), ciliated cells (C), basal cells (B). Bar = 50 µm (Source: Oakland et al, 2012).

Bronchial epithelial cells constitute part of the non-specific immune system by accomplishing a physical barrier with secretory and ciliary functions, and hence the integrity of the epithelial function is crucial for host defense. In term of integrity, the bronchial epithelium forms a continuous later, with distinct apical and basolateral surfaces maintained by several cell-cell adhesion mechanisms. The desmosomes (macula adherens) and the intermediate junctions (adherence junctions, AJs or zonula adherens) are involved in cell-cell adhesion. The tight junctions, TJs (zonula occludens, ZO) located at the apical-most region of the lateral surface and define the boundary between the apical and basolateral domains. Tight junctions play pivotal roles in tissue integrity and maintenance of cell polarity, regulating the paracellular passage of molecules as well as pathogens [97]. The epithelial cells are anchored to the basement membrane by hemidesmosomes and other focal adhesion molecules (e.g. integrins, vinculin, talin, radixin) that form focal-adhesion complexes. Inhaled particles and pathogens transmitted via secreted air droplets are cleared from airways through trapping in mucus upon deposition and subsequent clearance of the trapped particles mediated by propelling of the coordinated beating of cilia, termed mucociliary escalator system. In addition to these defense factors, the bronchial epithelium secretes a large number of mediators including antibacterial substances (lactoferrin,

CHAPTER I: INTRODUCTION lysozyme), anti-proteases (α1-protease inhibitor, α1-anti-chymotrypsin, α2-macroglobulin, tissue inhibitors of metalloproteinases) and anti-oxidant/redox-regulatory molecules (glutathione, superoxide dismutase, transferrin and catalase). Bronchial epithelial cells are also capable of transporting secretory immunoglobulin A into the bronchial lumen.

1.2.2 In vitro tissue culture systems to study pathogen interactions with human airway epithelium

Throughout the years, various models have been developed to study physiological responses of the lungs and pathological changes in lung disease and infections. The differences between models depend upon what region of the lungs the engineering system is attempting to mimic, and the pathological condition and infectious agents being studied. Although there exists a broad range of lung tissue models used, the most commonly used systems in generation of bronchial tissue are summarized in Table 2, indicating advantages and disadvantages of each model.

Table 2. Common cell types used in the generation of lung tissue models (Modified from Nichols et al, 2014)

Cell type Derivation Advantages Disadvantages

Calu-3 [99,100] Submucosal adeno- - Readily available and well - Variation in TJ formation carcinoma of the characterized bronchus - Forms confluent monolayer of polarized cells - Immortalized - Express mucin gene - Develop cilia & microvilli BEAS-2B [101,102] Transformed - Immortalized - No mucin secretion bronchial epithelium - Forms confluent monolayers - Lack TJs - Secrete cytokines - Express antioxidants 16HBE14o- [103-105] Transformed - Immortalized - No mucin secretion bronchial epithelium - Differentiated & multilayered - Develop cilia & microvilli - Secrete cytokines A549 [106,107] Human lung - Immortalized - Monolayers lack TJs adenocarcinoma - Produce confluent monolayers - Exhibit very low trans- alveolar basal cell line with AECII morphology and epithelial electrical lamellar bodies present resistance values - Consistent AECII metabolic/transport properties Primary AECs Human alveolar - Accurately demonstrate in vivo - Time consuming [108,109] epithelial type I and II behavior isolation

CHAPTER I: INTRODUCTION

mix (primary cells) - Controllable cell division - High risk for bacterial or - Capable of TGF-β1 induced fungal contamination epithelial mesenchymal - Cells cannot be passaged transition in culture repeatedly - Harbor necessary cell surface - High cost for reagents receptors for signaling used in isolation

NHBE [92,110-112] Normal human - Not transformed and long - Can be used up to bronchial epithelium lifespan maximum passage 3 (not (primary cells) - Differentiated and multilayered immortal) - Form cilia, TJs, secrete mucus - Labour intensive - Availability of various donors - Potential for microbial e.g. pediatric, COPD, CF contamination - Serum-free medium

MatTek Human - Commercially available for - Not immortal EpiairwayTM [66,113] tracheal/bronchial purchase in differentiated form - Cost to purchase epithelium (primary - Not transformed and long cells) lifespan - Differentiated and multilayered - Form cilia, TJs, secrete mucus - Serum-free medium

As previously mentioned, organotypic 3D tissue culture systems are becoming increasingly recognized as human tissue equivalents in replacement of 2D cultures. Various systems are available as tools for engineering 3D models. Rotating wall vessel (RWV) is one of these platforms that has been used for studying the cellular and molecular responses of both hosts and pathogens. There are two different RWV designs, the high-aspect rotating vessel (HARV) and the slow-turning lateral vessel (STLV), which differ mainly in aeration source. The design of RWV bioreactor is highly physiological as it provides a low-fluid-shear growth environment similar to that encountered by pathogens in certain regions of the body (such as the part between the brush border microvilli of epithelial cells and in utero); which represents a biomechanical force known to influence cellular differentiation and development in mammals. The dynamic culture conditions in RWV allows cells to grow in 3D, to aggregate based on natural cellular affinities and to differentiate into 3D tissue- like assemblies. The spinner flask is also a cost-effective method used for generation of suspension cultures of 3D spheroids, with the disadvantage of having very high levels of fluid shear in culture which can damage cells and interfere with differentiation schedule.

Another common technique involved implanting cells into a 3D matrix scaffold composed of collagen, extract of extracellular matrix, synthetic or semi-synthetic materials (such as hyaluronan hydrogels), or a combination of these materials. This approach has been proven successful in recapitulating the 3D architecture of various tissue types and has been particularly beneficial in cancer and stem cell research. However, the major challenge for studying host-pathogen interactions using this system is the hindering of host cell exposure to pathogens due to the matrix in a non-physiologically relevant manner. These systems are thoroughly reviewed in [114]. Finally, the next wave of 3D cell-culture models relies on micro- engineering techniques and microfluidics. Microfluidics is the manipulation of small amounts of fluids (10-9

CHAPTER I: INTRODUCTION to 10-8 L) in micro-fabricated hollow channels, a core microsystem technology which is used to generate and precisely tune dynamic fluid flows and spatio-temporal gradients, deliver nutrients and other chemical cues to cells in a controlled manner. Also referred to as ‘organs-on-chips’, this technology integrated microfluidics with living cells cultured within 3D devices (microchips), to create tissue-tissue interfaces to mimic organ microarchitecture and to study human physiology in an organ-specific context (Reviewed in detail in [86]). Although still in a preliminary phase, the implementation of ‘organs-on-chips’ to biomedical research carry the potential to serve as replacements for animals used in drug development and toxin testing.

1.3 Host-pathogen interactions

1.3.1 Monitoring interactions at host-pathogen interface: an emerging theme

In recent years, it is becoming increasingly clear that bacterial pathogens have evolved complex functional interfaces with their hosts, particularly during long-standing associations allowing evolutionary forces to shape the molecular machines and strategies that can be characterized by their refinement. The study of the cell biology and immunobiology of these interactions is a fruitful area of research, as they not only yield remarkable aspects of the host-pathogen functional interface but also provide a unique window into the basic aspects of cellular functions and the innate immune system. This approach is no longer restricted to few model organisms but rather is applicable to diverse group of pathogens with unique and diverse mechanisms to engage their hosts.

Modulation of the host-cell actin cytoskeleton by bacterial pathogens to enter into cells, to move within the cells and spread from cell to cell, avoid uptake by phagocytic cells, and to promote intimate attachment is a well-known phenomenon of host-pathogen interaction field. The main focus of this spatial and temporal coordination of actin dynamics is a subset of small molecular weight GTP-binding proteins of the Rho family, in particular Cdc42, Rac1 and Rho. Various pathogens have evolved the capability to modulate the activity of these proteins as a means to subvert the actin nucleating machinery to mediate their own uptake into host cells. Examples include; Yersinia spp protein invasin which binds α5-β1 integrins in a tight manner, generating signals from the receptor that lead to the activation of Rac1, misregulation promoted by translocation of YopE and YopT proteins into target cell [115]; Salmonella enterica effector proteins (SopE/E2, SopB, SipA, SipC and SptP) delivered to host cells via type III secretion system (TTSS) which can activate Cdc42 and Rac1, leading to profuse actin cytoskeleton rearrangements and membrane ruffling [116]; and enteropathogenic E. coli which utilizes a TTSS to deliver a number of bacterial effector proteins whose coordinated action results in the formation of well-organized actin ‘pedestals’ facilitating the intimate attachment of bacteria to mucosal surfaces. Similarly, many other pathogens such as Listeria, Shigella, Rickettsia, Clostridium, and mycobacterial species such as Mycobacterium marinum and Burkholderia pseudomallei evolved different strategies to subvert the actin cytoskeleton to move within and between cells [117].

CHAPTER I: INTRODUCTION

The interface with the innate immune system – from stimulation of cytokine production to the modulation of vesicular trafficking interactions, involvement of surface and intracellular receptors such as Toll-like and Nod receptors is also an exhausted element of microbial pathogenesis. For example, the role of peptidoglycan in bacterial pathogenesis has been thoroughly studied and its adjuvant properties have been long known, however the immunostimulatory properties largely due to its ability to stimulate Nod family of intracellular innate receptors has provided a molecular explanation for this activity. Another emerging theme is the interplay or synergy between specific bacterial molecular machines such as fimbriae, type III or type IV secretion systems and conserved innate immunity agonists such as lipopolysaccharide (LPS) and peptidoglycan. For instance, Kau et al. describe how uropathogenic E. coli utilizes specific adaptations such as pili to mediate colonization of the urinary tract, and in turn the stimulation of TLRs by bacterial agonists results in host inflammatory responses to control infection [118]. On the other hand, many pathogens have evolved a functional interface with their hosts to modulate a variety of vital processes. Oswald et al. studies diverse mechanisms evolved by bacterial pathogens to modulate cell cycle progression [119]. Since the cell cycle has a profound impact on responses that are central to the ability of pathogens to colonize a host, it is expected that pathogens evolved multiple strategies to hijack this event. Residence within host cells gives unique advantages to pathogens as a mechanism of avoiding host defense mechanisms, such as modulating the vesicular trafficking to avoid delivery to lysosomes and modulating the eukaryotic secretory pathway to secure a safe intracellular niche [75].

Last but not the least, mitogen activated protein (MAP) kinases which are central to many cellular processes due to their modulating activity of vital processes, ranging from cell cycle progression to programmed cell death, are also targets of microbial pathogens. Numerous bacterial determinants have specifically evolved to interfere with or inactivate kinases. A well-known example is Anthrax toxin, composed of two enzymatically active subunits, lethal and edema factors and a subunit essential for their delivery into cells. Edema factor is an adenylate cyclase and lethal factor is a protease that specifically inactivates Mek, the activating kinase of Erk, one of the members of the MAP kinase family of proteins [120]. The strategies of enteroinvasive pathogens including Shigella, Yersinia and Salmonella highlighting host-pathogen cross-talk and interactions e.g. alteration of the epithelial cell actin cytoskeleton, modulation of trafficking of cellular vesicles and inducement of changes in intracellular compartments they reside in to favor survival, and dealing with other components of the epithelial barrier such as macrophages have also been extensively described [121].

1.3.2 Transcriptomic approaches for studying host-pathogen cross-talk

All bacterial pathogens encounter changes in the environmental milieu within different anatomical sites of the host, which makes rapid adaptation a crucial factor for survival. The course of infection initiates a dynamic cascade of events that culminates in alterations in gene expression patterns in both interacting organisms. To this end, transcriptional reprogramming of respiratory tract epithelial cells is considered to be central to the

CHAPTER I: INTRODUCTION host defense. Deciphering this complex interplay is the main aim of host-pathogen interaction studies and serves the basis of the development of novel therapies and preventative strategies. Whole genome transcriptional profiling of bacterial pathogens and host cells offers insights into the complex interactions at the interface. The physiological state of infecting bacteria and the mechanisms required by bacteria to successfully survive infection can be used as tools to define novel drug development strategies [122]. The possibility to exploit the intracellular bacterial transcriptome can also be used as a bioprobe, to describe the microenvironments and particular niches encountered by bacteria through the course of infection [123,124]. The ability to successfully monitor temporal changes in transcript abundance therefore makes RNA profiling a promising tool for identification of novel vaccine candidates [125]. In addition, the transcriptional response of host cells to invading bacterial pathogen enables the exploration of the intracellular and intercellular interactions throughout disease progression, facilitating the discovery of bacterial immunomodulatory actions. Furthermore, the transcriptional signatures of human non-invasive samples also promise to reveal novel diagnostic or predictive applications [126].

1.3.2.1 Array-based methodologies

The first transcriptomic studies became possible with the development of cDNA microarrays [126,127], and microarrays are undoubtedly the gold standard of studies exploiting transcriptional profiling. Microarray- based studies provided the first global analyses of gene expression changes in pathogens such as Vibrio cholera [128], Borrelia burgdorferi [129], Chlamydia trachomatis [130], Chlamydia pneumoniae [131] and Salmonella enterica [132], revealing the strategies that are used by these microorganisms for host adaptation. Tiling arrays uncovered the gene expression changes in Listeria monocytogenes grown under various in vitro and in vivo conditions [133], as well as identifying the small noncoding RNA transcriptomes and new virulence genes in streptococci [134]. The transcriptional profiling of host-intracellular pathogen interactions has also been very enlightening being applied to obligate intracellular bacteria such as Coxiella burnetii, Ehrlichia chaffeensis, Rickettsia prowazekii and Tropheryma whipplei, revealing alterations in the expression profile of the pathogens throughout their lifecycle as well as under environmental stress [135]. DNA microarrays have also allowed monitoring of the effects of pathogens on host-cell gene expression programmes in great depth and on a broad scale. The studies of Der and colleagues [136], who identified

INTERFERON (IFN)-induced genes, and Zhu and co-workers [137], who analyzed the transcriptional response to human cytomegalovirus, were the first attempts to harness the power of microarray technology to investigate the transcriptional changes in the host that accompany infection. These experimental approaches can be divided into eight types, each of which addresses different aspects of the host-pathogen interaction and are summarized in Table 3.

CHAPTER I: INTRODUCTION

Table 3. Experimental approaches for microarray analysis (Modified from Jenner and Young, 2005)

Wild-type pathogen The application of whole pathogens to host cells in vitro and subsequent analysis with microarrays present a global overview of the host transcriptional response. Performing a time-course provides valuable information about the temporal nature of the response and the regulatory processes that underlie it Many different pathogens A comparison of the gene expression patterns that are produced in response to infection with many different pathogens helps to distinguish common host responses from species- or pathogen-subtype-specific responses that might underlie a specific disease Mutant or inactivated pathogens The exposure of cells to pathogens that are deficient in a specific component or gene can identify those components that are necessary for generating the host transcriptional response, or which alter the host response. Killed, inactivated or avirulent pathogens provide information on the effect of pathogen activity on gene expression – as opposed to pathogen contact alone Pathogen components An alternative approach is to expose cells to specific pathogen proteins to identify those that generate the host response. The components can be applied extracellularly or expressed in the host cell. This approach can also be used to investigate whether pathogenic proteins alter the host response Mutant hosts The use of cells or animal that are deficient in a specific protein or cellular process can help to identify the cellular mechanisms that generate the host response Treatment with small molecules The activation or inhibition of specific transcriptional signatures by small molecules allows the identification of component signaling pathways of the host response In vitro latency Gene expression profiling of cells that were infected in vivo, but subsequently grown in vitro, defines misregulated genes that might have a role in chronic viral diseases In vivo diseases Using clinical samples or animal models allows expression profiling of mixed cell populations and whole organs, and identifies gene expression patterns that might underlie clinical disease

In their review, Jenner and colleagues collected data from 32 published studies which used microarrays, representing 785 experiments and 77 different host-pathogen interactions (macrophages, dendritic cells, blood cells, T and B cells, endothelial and epithelial cells). Although the magnitudes of expression cannot be directly compared due to the fact that the datasets were generated independently via different technologies and experimental designs, using cluster analysis genes that share a common expression pattern across several samples could be grouped. This analysis resulted in identification of several functional groups of gene products that were clustered according to the part of the cell in which they function, to provide an overview of the cellular physiology that is involved in the common host response (Fig. 6). These functional groups can be

CHAPTER I: INTRODUCTION summarized as: 1) genes that mediate inflammation such as those encoding pro-inflammatory mediators such as TNF, IL1β, IL6, IL8, GCSF; 2) IFN-stimulated genes including those encoding protein kinase R (PKRK), promyelocytic leukaemia protein (PML), 2’,5’-oligoadenylate synthetase (OAS) 1, OAS2 and OASI, MX1, MX2 and IFN-inducible chemokine genes (CCL8, CXCL9, CXCL10, CXCL11); 3) genes that activate the immune response such as those common host-response-cluster encoding transcriptional regulators and components of signal-transduction pathways including NF-ĸB family members and their co-activator BCL3, the activator protein-1 (AP1) components (JUN, JUNB, FOSL2), factors that mediate the effects of IFN (IRF1, IRF4, IRF7, ISGF3G, STAT1, STAT4, STAT5A), cAMP-response-element binders (ATF3, ATF4, BATF, CREM), components of cytoplasmic signal-transduction cascades such as MYD88, TRADD, TRAF1, TRAF6; 4) genes that limit the immune response such as Iĸβ-α and Iĸβ-ε which sequester NF-ĸB poteins in the cytoplasm, TANK, which inhibits recruitment of TRAFs to the TNF receptor, MAP2K3, MAP3K4, MAP3K8 as well as phosphatases DUSP1, DUSP2, DUSP4, DUSP5, DUSP6, DUSP8; and 5) other common host-response-genes including those involved in lymphocyte activation (CD80, CD83, TNFRSF5), antigen presentation (HLA-E, HLA-F, HLA-G, PSMA4, PSMB8, PSMB9, PSMB10, PSME2, TAP1, TAP2), cell adhesion (ADRM1, CD6, CD38, CD44, CD53, ICAM1, ITGA5, ITGAX, ITGB8, LGALS9, LGALS3BP) and tissue invasion (MMP1, MMP7, MMP10, MMP12, MMP14, MMP19) [138].

In spite of the power of array-based analyses, there are there are some major caveats to this approach. The most important disadvantage of this technique is the cross-reactivity between host and pathogen cDNAs which brings out the necessity for elimination of cross-hybridization clones or separate analysis of each species. This in return requires physiological separation of RNA from the two species before gene expression analysis. Nonetheless, in order to obtain RNA from one of the two interacting organisms, RNA of the other is usually sacrificed; for instance the eukaryotic RNA is lost during the lysis of the host cells during the isolation of RNA from intracellular bacteria. Another drawback is the high cost of tiling arrays. Until recently, our understanding of the transcriptome was limited to mRNAs, tRNAs and rRNAs being the well-known classes of transcripts monitored during most of the studies, whose profiling could easily be performed using low cost arrays. However, these RNA classes constitute only part of the functional transcriptome and analysis of the full transcriptome at high resolution, including many transcripts from non-coding regions of the genome requires arrays with hundreds of probes, which increases the cost of the experiment to a range that may exceed that of a next-generation sequencing (NGS) experiment.

CHAPTER I: INTRODUCTION

Figure 6. A common host-transcriptional response to pathogens. A comparison of data from 32 published studies using cluster analysis. A cluster of genes is shown, the expression of which is stimulated in several different cell types by a diverse range of pathogens. Gene expression is shown as a matrix with rows representing genes and columns representing experiments. An experiment represents a single two-colour microarray, the ratio of two single sample arrays or the average of several arrays. Experiments are grouped by the study from which the data were taken and then by cell type. In each study, control experiments are presented first, followed by pathogen-treated cells. The types of stimuli applied in each experiment are shown above the gene expression matrix. Gene expression is analyzed relative to a control (which is uninfected cells, time 0, or the average expression across that specific dataset) and is represented by colour, with red indicating up-regulation and green indicating down-regulation. Black indicates no change, and grey represents missing data (Source: Jenner and Young, 2005).

CHAPTER I: INTRODUCTION

1.3.2.2 Next-generation sequencing

During the last decade, the disadvantages of array-based methodologies has increased the demand for cheaper, more comprehensive and high-throughput sequencing methods for transcriptional profiling. The development of the probe-independent RNA sequencing or deep sequencing (RNA-seq or deep-seq) approach has recently begun to revolutionize transcriptomics. RNA-seq is essentially massively parallel sequencing of RNA (or, in fact, the corresponding cDNA) and it is based on NGS platforms that were initially developed for high-throughput sequencing of genomic DNA. It involves reverse transcription of all the RNA molecules in a sample into cDNA, and depending on the platform to be used, the cDNA molecules may (amplification-based sequencing) or may not [single-molecule sequencing (SMS)] be amplified before deep sequencing. After the sequencing reaction has taken place, the obtained sequence stretches (reads) are mapped onto a reference genome to deduce the structure and/or expression state of any given transcript in the sample. RNA-seq offers a massive advantage over microarray methodologies for transcriptomics, and this is mainly attributed to the possibility of simultaneous profiling of host and pathogen transcriptomes from the same sample, and hence enables different organisms to be analyzed collectively. In this approach, the discrimination between host and pathogen takes place only at the bioinformatics stage in silico (Fig. 7). RNA-seq also offers the possibility of deeper analysis, if required to detect all RNA species including non-coding small RNAs extending the coverage to whole-genome. In addition to providing full-genome coverage, it provides a digital quantification and therefore has a high (theoretically infinite) dynamic range. The high sensitivity allows identification of novel transcripts. Furthermore, the single-nucleotide resolution provided by RNA-seq allows gene structure to be refined through accurate determination of transcript borders, alternative splicing and processing events. An important step was the development of strand-specific RNA-seq, which preserves information about the directionality of a transcript. This is particularly important given the prevalence of non-coding and antisense transcripts throughout both the pathogen and host genomes, and for the characterization of operons in bacteria [139].

The deep-sequencing platforms that are currently available can be divided into two groups: most commonly, cDNA samples need to be amplified by PCR before sequencing, but some platforms are sufficiently sensitive to omit the amplification step and sequence cDNA directly. The most widely used sequencing platforms for genome-wide transcriptome studies include Illumina (Solexa), Life Technologies (SOLiD) and Roche (454) and all are amplification-based methods. SOLiD and 454 sequencing rely on emulsion-based PCR, whereas the Illumina platform using Solexa chemistry makes use of solid-phase amplification to generate the cDNA library [140]. The benefits of RNA-seq over hybridization-based methods suggest that this approach has the potential to revolutionize the study of changes in gene expression during host–pathogen interactions, and that it is likely to provide the basis for new molecular insights into the mechanisms of pathogenesis and the corresponding immune response.

CHAPTER I: INTRODUCTION

Figure 7. Comparison between probe-based techniques and RNA-seq approach for transcriptomics. The substantial host background levels and the potential for cross-hybridization when using probe-based methods (such as microarrays) typically require that the host and pathogen be physically separated. The launch of a species-independent platform such as RNA sequencing (RNA-seq) is therefore highly promising, as it could enable the different organisms to be analyzed collectively, and discrimination is performed at bioinformatics stage (Source: Westermann et al., 2012)

However, like all scientific approaches, RNA-seq has some potential limiting factors and can be a very challenging task. To establish the feasibility of dual RNA-seq and to estimate the sequencing depth that would be required for the accurate representation of both bacterial pathogen and the mammalian host, one needs to consider these limiting factors. The most important factor is the difference between the RNA contents. The human genome is 3,000 Mb in size, whereas the genomes of typical pathogens such as E. coli or S. enterica are ~5 Mb. This size difference translates into different amounts of cellular RNA; eukaryotic cells contain in the range of 10–20 pg of total RNA, which is ~100–200 times the ~0.1 pg present in a bacterial cell (Fig. 8). In practice, this excess is reduced, as in most cases a single infected host cell will contain multiple bacteria. The intracellular copy number for a pathogen varies from species to species, but assuming that on average each infected mammalian cell is associated with ten bacteria, the relative difference in total RNA content will be decreased to 10–20-fold in most infection models. Depletion of ribosomal RNA is also a critical point for RNA profiling by dual RNA-seq. Both the bacterial and eukaryotic cellular RNA pools consist predominantly (>80%) of rRNA, whereas mRNA constitutes only a minor fraction (<5%), therefore a ribodepletion step 23

CHAPTER I: INTRODUCTION significantly increases the total number of reads obtained in an experiment hence provides a broader genome coverage.

Figure 8. Estimation of minimal sequencing depth required for dual host-pathogen RNA-seq. A) Overview of the reported copy numbers of selected adhesive or invasive pathogens; an approximation is ten bacteria per host cell. B) Whereas a single mammalian cell typically contains around 20 pg of total RNA, the bacterial cellular RNA content does not exceed a few hundred femtograms. C) The required sequencing depth for dual RNA-seq. (Source: Westermann et al., 2012)

AIMS OF THE STUDY

This study aims to characterize for the first time the molecular interactions between nontypeable Haemophilus influenzae and the ciliated human bronchial epithelium, the primary target of NTHi, with an emphasis on the whole-transcriptome of both host and the invading pathogen. By developing in vitro models of fully- differentiated bronchial tissue which resemble human upper respiratory tract and mimic natural infection during the first 72 hours of the infectious process, and integrating a dual RNA-seq approach to this complex host-pathogen interface, we have studied the following:

 The temporal events associated to the initial contact of NTHi with the respiratory epithelium and the cell types involved in primary interaction

 Transcriptome analysis of NTHi during early-stage colonization as well as during prolonged infections i.e. microcolony formation and bacterial internalization to monitor pathways activated

 The host response in terms of monitoring transcriptional reprogramming of the bronchial epithelial cells as well as the immune response to infection

CHAPTER II: EXPERIMENTAL PROCEDURES

2 EXPERIMENTAL PROCEDURES

2.1 Calu-3 Cell-line

Calu-3 adenocarcinoma cell line (ATCC No. HTB-55) was expanded in in 75 cm2 flasks using Dulbecco’s Modified Essential Medium (DMEM, Gibco) supplemented with 20% fetal bovine serum (DMEM-20% FBS) and 100 μg/ml of penicillin/streptomycin until until ~80% confluency and were used after third passage. Cells were dissociated with 0.05% trypsin-0.02% EDTA and were seeded at a density of 6.0 × 105 cells/cm2 onto type I collagen-coated polyester trans-well inserts (12 mm) with 0.4 μ pores (Corning) in DMEM-10% FBS. Polarized Calu-3 cultures can be generated by growing cells in submerged culture (Fig. 9) and polarization is dependent on several factors including growth medium, cell density and trans-well membrane pore size and composition. After reaching confluency, the cells were raised at ALI and were cultured for at least 21 days changing the medium every other day. Penicillin/streptomycin used in initial establishment of epithelial cultures was removed by repeated apical and basolateral washings, and antibiotic-free media changes overnight before infections. Following seeding into trans-well culture, the development of transepithelial electrical resistance TEER by Calu-3 cultures was monitored using an epithelial voltohmmeter under sterile conditions (EVOM2; World Precision Instruments). Transwell inserts coated with collagen without any cells were used as blank for measurements. Cultures with TEERs ≥15000 Ω/cm2 were retained for experimentation. The actual TEER was calculated using below equation:

Ω actual = Ω sample - Ω blank

Figure 9. In vitro Calu-3 model of polarized epithelium. Schematic representation of Calu-3 monolayer grown in Transwell system, with upper (apical) and lower (basolateral) compartments allowing membrane polarity

CHAPTER II: EXPERIMENTAL PROCEDURES

2.2 Primary Airway Epithelial Cells

Primary normal human bronchial epithelial (NHBE) cells (Clonetics-BioWhittaker, San Diego, CA) isolated from a single healthy donor were used in this study. The cells were expanded in 75 cm2 flasks using Bronchial Epithelial Basal Growth Medium (BEBM; Lonza) supplemented with BEGM bullet-kit (CC-3170) as recommended by supplier at 37°C in 5% CO2 until ~80% confluency and used between passage 2 and 3. Then the cells were dissociated using StemPro Accutase Cell Dissociation Reagent (Life Technologies) and were seeded onto semipermeable membrane supports (12-mm diameter, 0.4-μm pore size; Transwell; Corning- Costar), previously coated with collagen, type I solution from rat tail (Gibco) at a concentration of 0.03 mg/ml. The cells were seeded at a density of 105 cells per well using Bronchial Air-Liquid Interface (B-ALI) Medium (Lonza) supplemented with B-ALI bullet-kit (193514) containing insulin, hydrocortisone, retinoid acid, transferrin, bovine pituitary extract, triiodothyronine, epinephrine and human epidermal growth factor. When confluence was reached, the apical medium was removed, and an air-liquid interface was established to trigger differentiation (Fig. 10). Cells were maintained at ALI for at least 28 days, with the basolateral medium changed every second day, prior to use in biological assays to ensure a differentiated cell population with a mucociliary phenotype. The apical side was rinsed with PBS every week to remove excess mucus production. Cell polarity and TJ barrier function were veriﬁed by TEER using an epithelial volt ohmmeter. Mucus production and cilia development were monitored by immunofluorescence microscopy, Zeiss LSM 710 (Fig. 11). Cultures with TEERs ≥800 Ω/cm2 and extensive coverage with beating cilia were retained for experimentation.

Figure 10. Differentiation schedule of primary NHBE cells at air-liquid interface.When cultured at ALI, NHBE cells reach a fully-differentiated state of bronchial epithelium with typical cell types including goblet cells and ciliated cells with mucociliary beating activity mimicking airway lumen

CHAPTER II: EXPERIMENTAL PROCEDURES

B C

Figure 11. Mucociliary phenotype markers are present in the reconstituted in vitro human bronchial epithelium. As observed by confocal microscopy, bronchial epithelium was stained for phalloidin (magenta); β-tubulin IV (green); MUC5AC (yellow); ZO-I (red); nuclei were counterstained with Hoechst 33342 (blue). B) 3D Z-stack reconstruction of bronchial epithelium reveals multilayered columnar epithelium phenotype, β-tubulin IV (green); phalloidin (red); nuclei (blue) (Magnification: 40x.) C) TEER measurements throughout culture period shows peak at 10 days with a plateau after 14 days, with a good barrier functioning.

2.3 Bacterial Culture and Time-Course Infection of Calu-3 and WD-NHBE Cells

NTHi strain 176, an isolate obtained from the middle ear and was a part of a Finnish otitis media outbreak cohort study, was used in this study (kindly provided by Derek Hood, University Oxford, UK). NTHi was routinely grown on chocolate agar PoliVitex (BioMerieux) incubated O/N at 37°C with 5% CO2. For infection studies, NTHi was grown in brain heart infusion (BHI) broth (Difco Laboratories) supplemented with 10 µg/mL each of haemin (Fluka Biochemika) and nicotinamide adenine dinucleotide (NAD, Sigma-

Aldrich) until an optical density measured at a wavelength of 600 nm (OD600) reached 0.5 (exponential phase). Bacteria at OD 0.5 were pelleted and resuspended in infection medium comprised of unsupplemented BEBM to prepare the inoculum. WD-NHBE cultures were infected synchronously or were mock infected. All infections (multiplicity of infection 100:1 bacteria per cell, 600 µL/well) were performed in triplicates using WD-NHBE cultures 28 days post-ALI or Calu-3 days at 21 days. The inocula or medium-only controls were

CHAPTER II: EXPERIMENTAL PROCEDURES added to the apical surface of the cultures and incubated for 1 h at 37°C, 5% CO2. Subsequently, the inoculum was removed, and the apical surface was gently rinsed three times with 500 µl BEBM to remove any non- adherent bacteria. Percentage cytotoxicity in infected WD-NHBE cells were determined by LDH Cytotoxicity Detection Kit Assay (Roche Diagnostics, Indianapolis, USA) and significance was determined with a two- tailed Student’s t- test.

For gentamicin-protection assays, infection of WD-NHBE was performed as described above. At selected time-points, membranes were thoroughly washed and incubated apically and basolaterally with BEGM supplemented with 200 µg/ml gentamicin (Sigma Aldrich, St. Louis, MO USA). After incubation at 37°C in 5%

CO2 for one hour, membranes were washed three times and lysed with 1% saponin (Sigma Aldrich) in infection medium. The number of invaded bacteria was determined by protection from gentamicin killing.

2.4 Isolation of Total RNA from Infected Cells

Total RNA was isolated from NTHi infected WD-NHBE cells at 1, 6, 24 and 72 hours and corresponding mock controls (three replicates per time-point) using TRIzol reagent (Life Technologies). RNA was treated twice with Turbo DNA-free DNase (Ambion), according to the manufacturer’s protocol for rigorous sample treatment. Complete DNA removal was verified by qRT-PCR by amplifying 16S and GAPDH. DNAse treated RNA was purified using Direct-zol RNA MiniPrep Kit (Zymo) and stored at −80 °C until further use. The RNA quality was analyzed using Bioanalyzer 2100 (Agilent Technologies) and the RNA concentrations were measured using the nanodrop.

2.5 cDNA Library Construction and Illumina Sequencing

cDNA libraries were prepared using reagents and protocols supplied with the ScriptSeq- Complete Gold Kit – Epidemiology, Low Input (Epicentre) using 450 ng of each sample. Briefly, human and bacterial ribosomal RNA was depleted using Ribo-Zero Gold – Epidemiology kit and purified using ethanol precipitation method. Removal of rRNA was confirmed by Agilent Bioanalyzer 2100 using RNA 6000 Pico Kit (Appendix 4). Ribodepleted RNA was fragmented chemically and cDNA was synthesized using random primers (Epicentre). The library was amplified by adding unique indexed primers of the ScriptSeq Index PCR Primers kit (Epicentre, RSBC10948), in an amplification protocol of 15 cycles (Fig. 12) and purified with the AMPure XP purification protocol (Beckman Coulter). Libraries were validated by using DNA High Sensitivity Chips on the Agilent Bioanalyzer (Appendix 5) and quantified by Real-Time PCR on the 7900 HT Fast RT-PCR System (Life Technologies) using the “KAPA SYBR FAST ABI Prism qPCR KIT”. Sequencing was carried out on HiSeq 2500 in a 75 bp paired-end run with Illumina TruSeq SBS v3 chemistry (Fig. 13). The cDNA

CHAPTER II: EXPERIMENTAL PROCEDURES sequences were deposited in the Gene Expression Omnibus (GEO) Sequence Read Archive of the National Center for Biotechnology Information under submission accession ID No. GSE63900.

Figure 12. Overview of the ScriptSeq v2 RNA-seq library preparation method.The ScriptSeq v2 RNA-Seq Library Preparation involves terminal-tagging process to generate directional RNA-seq libraries. Ribo-Zero-treated or poly(A)+ RNA is fragmented and reverse transcribed using random primers containing a 5’-tagging sequence. The 5’-tagged cDNA is then tagged at its 3’ end by the terminal-tagging reaction to yield di-tagged, single-stranded cDNA. Following purification, the di-tagged cDNA is amplified by limited-cycle PCR, which completes the addition of the Illumina adaptor sequences, amplifies the library for subsequent cluster generation and adds an optional Illumina Index or user-defined barcode. The amplified RNA-seq library is purified and is ready for cluster generation and sequencing (Source: Pease and Sooknanan, 2012)

CHAPTER II: EXPERIMENTAL PROCEDURES

Figure 13. Illumina's Solexa Sequencing Technology. Solexa sequencing involves step 1: sample preparation (from RNA to cDNA as shown in Fig. 12), steps 2-6: cluster generation by bridge amplification, steps 7-12: sequencing by synthesis. Sequencing-by-synthesis chemistry allows precise measurement of mRNA strand orientation for detection of antisense transcription, enhanced transcript annotation, and increased alignment efficiency (Source: Illumina)

CHAPTER II: EXPERIMENTAL PROCEDURES

2.6 Read Mapping and Data Analysis

All the reads obtained from Illumina HiSeq 2500 sequencer were preprocessed to remove low quality bases (

Human analysis: reads were aligned in paired-end mode to human genome (hg19) using STAR aligner (version 2.3.1n) [142] using default settings. Mapped data were converted in gene level counts using HTSeq- count and the UCSC annotation (http://genome.ucsc.edu/). Differential expression was evaluated, for each time point, comparing infected sample with respect to untreated sample using DESeq Bioconductor package [143]. Differential expression was detected using the following thresholds: |log2Fold Change|≥1 and adjusted p-value≤0.1.

Bacterial analysis: reads were aligned in single-end mode to Hi176 assembled transcriptome using Rsubread (version 1.15.9) [144] with default settings. Transcripts counts were calculated from transcriptome alignment using R script, available upon request to the authors. Differential expression was evaluated as described for the human data.

Figure 14. Data analysis strategy for dual RNA-seq. All reads obtained were primarily aligned with human hg19 genome. In the second step of analysis, all the reads non-mapped to human genome were aligned with Hi176 genome to map the sequences belonging to bacterial genome.

CHAPTER II: EXPERIMENTAL PROCEDURES

2.6.1 Bioinformatics

The Hi176 genome sequences were assembled using Celera Assembler 7 [145]. The draft genomes were annotated using a hybrid approach. To identify ORFs in regions that had no close homology to already- annotated strains, we performed a de novo ORFs prediction using Glimmer3 [146]. Mapped unique reads were visualized with the Artemis Genome Browser 16.0.0. [147] and candidate sRNAs were identified. Putative functions of the candidates were identified by BLAST using Rfam database, Wellcome Trust Sanger Institute (http://fram.sanger.ac.uk/).

2.6.2 Clustering and Enrichment Analysis

Functional classification of eukaryotic genes was performed using the DAVID online database [148,149]. Ingenuity Pathway Analysis (IPA) software (Ingenuity® Systems, www.ingenuity.com) was used to discover pathways and transcriptional networks in the RNA-seq data. The Functional Analysis identified the biological functions and/or disease that were most significant to data set. Genes from the data set with more than 2-fold up/down regulation and p<0.05 that were associated with biological and/diseases in the Ingenuity Knowledge Base were considered for the analysis. Top Molecular and Cellular Functions and Top Canonical Pathways were primarily used in this analysis. Right-tailed Fisher’s exact test was used to calculate a p-value determining the probability of the assigned biological function and/or disease.

Gene expression heat-maps were generated using the MultiExperiment Viewer (MEV) software suit [150,151]. Hierarchical clustering was applied using the Euclidean metrics and default parameters. Prokaryotic enrichment analysis was performed by Fisher’s exact test and Benjamini-Hochberg correction as implemented by MEV, to test whether a list of genes differentially regulated was particularly rich of genes annotated in a particular KEGG metabolic pathway (release 48.0).

2.7 Real-time Quantitative Reverse-Transcription-PCR

For validation of RNA-seq data, 2 µg of DNAseI treated total RNA was reverse transcribed using GoScript Reverse Transcription System and random hexamers (Promega, Southampton, UK). qPCR was performed using a Stratagene Mx3000P qPCR System (Agilent Technologies), using 200 ng cDNA, 0.1 µM gene specific primers (Appendix 1) and Power SYBR Green Master Mix (Applied Biosystems). Each gene was normalized to housekeeping gene GAPDH and relative expression shown as 2-ΔΔCt.

CHAPTER II: EXPERIMENTAL PROCEDURES

2.8 Immunofluorescence Microscopy

WD-NHBE cultures, medium alone or following infection with NTHi, were rinsed three times with BEBM infection medium, and the epithelium-containing inserts were fixed with 4% paraformaldehyde, except for mucin staining where a methanol/acetone fixation protocol was used. Membranes were permeabilized and blocked with 3% bovine serum albumin and 0.1% triton in phosphate buffered saline. Incubation with primary antibodies (Appendix 2) and rabbit anti-total NTHi serum was performed either overnight at 4°C or for 2 hours at room temperature and followed by treatment with the appropriate Alexa fluor-conjugated secondary antibody. Samples were mounted using ProLong Gold Antifade Reagent with diamidino-2-phenylindole (DAPI, Invitrogen) and analyzed by confocal microscopy using Zeiss LSM 710 confocal microscope. Z-stack 3D reconstructions were performed using Imaris software (Bit-Plane Inc.).

2.9 Electron Microscopy

For SEM, samples were fixed in 2.5% glutaraldehyde and 2.5% paraformaldehyde in 0.1 M sodium cacodylate buffer overnight, washed in buffer and secondarily fixed in 1% osmium tetroxide in cacodylate buffer for 1 h. Samples were then washed in water and block stained with 1% uranyl acetate for 1 h. They were dehydrated with ethanol using progressively increased concentrations and dried by the critical point method using CO2 in a Balzers Union CPD 020 (BAL-TEC AG), sputter-coated with gold in a Balzers MED 010 unit, and observed with a JEOL JSM 6010LA Scanning Electron Microscope. For TEM, samples were fixed and dehydrated as described as above and embedded in Epon-based resin. Ultrathin sections (50-70 nm) were cut with a Reichert Ultracut ultramicrotome by using a diamond knife, collected on formvar copper grids and stained with uranyl acetate and lead citrate. The observation was made by a JEOL 1200 EXII Transmission Electron Microscope, and micrographs were acquired by the Olympus SIS VELETA CCD camera equipped the iTEM software.

2.10 Western Blotting

Cells were lyzed in RIPA lysis buffer containing 1 mM PMSF, 1 mM pepstatin A, 1 mM aprotonin, 1 mM leupeptin, 1 mM NaOrthovanadate and 1% triton. Protein concentration was determined by BCA Assay (Thermo-Fisher Scientific, Loughborough, UK). Samples were added to 4 x gel loading buffer (Life Technologies), DTT and boiled at 100°C for 5 minutes. 15 µg of samples were resolved on 4-12% Bis-Tris gel (Life Technologies) and transferred to a nitrocellulose membrane and blocked with 5% milk. Membranes were incubated with antibodies (Appendix 2) and detected by ECL (Thermo Scientific).

CHAPTER II: EXPERIMENTAL PROCEDURES

2.11 Determination of Cytokine/Chemokine Concentration

To study components of the innate immune responses to NTHi infection, we selected a panel of 40 cytokines/chemokines on the basis of their mRNA levels detected by RNA-seq. Basolateral medium samples were collected at 6, 24 and 72 h post infection in triplicates, and were stored at -80°C until use. Samples were then thawed and analyzed for chemokine concentrations using Bio-Plex Pro Human Chemokine 40-plex Panel (Bio-Rad) according to the manufacturer’s instructions with Luminex 200 System.

2.12 Statistical Analysis

Data are presented as the mean ± SEM. Statistical analyses were performed using GraphPad Prism 5 software (GraphPad Software, Inc.). Unpaired Student t-test or one-way ANOVA statistical test followed by Tukey or Bonferroni post-tests were applied.

CHAPTER III: RESULTS

3 RESULTS

3.1 NTHi interactions with human bronchial epithelium in vitro

3.1.1 NTHi forms biofilms on airway epithelia

Biofilm-forming pathogens are typically studied on non-physiologically relevant plastic surfaces such as on microtitre plates which do not mimic the environmental niche found in the human body. To overcome this, we employed a human adenocarcinoma cell line, Calu-3, that resembles the natural physiology of human bronchial tissue in vitro. Time-course experiments were designed in order to monitor NTHi biofilm formation, and consequently the adaptation of NTHi to host epithelium. Calu-3 cells were grown on a porous filter support membranes and polarized human airway epithelia were subsequently infected from the apical side, with strain Hi176, an isolate from the Finnish otitis media outbreak cohort study. Importantly, no medium was apically supplied to the bacteria in this model, requiring the bacteria to obtain all nutrients and growth factors from or through the polarized airway epithelial layer, mimicking conditions in an in vivo lung infection. At different time-points after the infection the membranes were harvested, immuno-stained and analyzed by confocal laser scanning microscopy (CLSM) and scanning electron microscopy (SEM).

Figure 15. Polarized airway epithelial cultures infected with NTHi show progressive biofilm formation over time. Samples were inoculated with NTHi and imaged at 1 h, 1 d, 3 d, 7 d. Representative LSCM 3D Z-stack reconstruction images are shown (A, B, C and D respectively), in red: rabbit anti-total NTHi, in grey: phalloidin. One hour: scattered bacteria on the apical surface with virtually no matrix; day 1: areas of microcolonies observed; day 3: larger biofilm structures have formed; day 7: thick biofilm structures entirely obscuring the apical surface in some areas.

CHAPTER III: RESULTS

A B C

Figure 16. SEM analysis reveals the presence of a matrix structure embedding biofilm-associated bacteria. A) Represents uninfected Calu-3 cell layers grown at ALI on day 14 with short and thick apical microvilli structures and clear cell-cell boundaries B,C) 3 day-old Hi176 biofilms on Calu-3 monolayers. Large clusters of bacteria were found attached to the bronchial epithelium. Bacterial clusters were observed to be enclosed in an amorphous extracellular matrix structure (arrows).

On the basis of several morphologic criteria, NTHi formed structures consistent with biofilms over 3 day of co-culture. Structurally, biofilms are a community of microorganisms encased in a matrix, attached to a surface. As shown Fig. 15 and 16, NTHi bacteria were initially scattered over the cell surface with little associated matrix formation. Over subsequent days of co-culture, matrix formation increased, resulting in large biofilm structures measuring over 20 µm in depth. By day 3, communities of NTHi bacteria were observed within a matrix-like structure on the apical surface of epithelia. Profound effects of NTHi infection on the actin cytoskeleton were evident at 72 h post infection as observed in 3D Z-stack reconstruction micrographs.

3.1.2 NTHi preferentially targets ciliated cells of primary human bronchial epithelium

Considering that Calu-3 cells represent a transformed cell line, in order to improve the physiological relevance of the cellular model used in this study, we developed a primary bronchial model based on primary well-differentiated normal human bronchial epithelial (WD-NHBE) cells which undergo mucociliary differentiation. To characterize the interactions of NTHi with human bronchial epithelium, we infected WD- NHBE cell cultures from the apical side with strain Hi176. Under the growth conditions used, WD-NHBE cultures form a pseudostratified epithelium with TJs and AJs containing a high population of ciliated cells. The airway epithelium also exhibits transepithelial resistance (TEER), mucus secretion and mucociliary activity, hence representing an environment similar to that of the in vivo airway. Interestingly, IFM analysis revealed preferential binding of NTHi to ciliated cells as early as 2 minutes to 1 h post infection, and occasionally, to nonciliated epithelial cells. The cross-sectional z-plane stack view of infected cultures demonstrates binding to the apical portion of cilia Fig. 17. This observation was further confirmed by SEM and transmission EM (TEM) analysis of infected epithelia 1 h post infection (Fig. 18). Although NTHi has been previously reported to also bind to non-ciliated cell types [67], our data suggest that cilia protuberances are the preferential target during early stage of colonization.

Figure 17. NTHi preferentially targets ciliated cells of primary human bronchial epithelium.A) Cultured at air-liquid interface, WD-NHBE cells exhibit a multilayered ciliated epithelium phenotype as observed by confocal microscopy. Bronchial epithelium was stained for phalloidin (magenta); β-tubulin IV (green); nuclei were counterstained with Hoechst 33342 (blue). (Magnification: 40x.) B,C) En face and orthogonal sections of NTHi (red) infected WD-NHBE, show co-localization NTHi with ciliated cells as early as 2 minutes of infection, and same observation in samples fixed at 1 h of infection. D) A single ciliated cell demonstrating NTHi tropism for ciliated cells. (Magnification: 100x.) E,F) NTHi is able to invade WD-NHBE cells and survive within the bronchial epithelium for prolonged periods of time up to 72h. (Magnification: 40x.) G) Growth kinetics and survival of NTHi on and within WD-NHBE cells determined by gentamicin protection assays.

CHAPTER III: RESULTS

A B C D

Figure 18. Electron microscopy analysis confirms NTHi ciliary binding. A) SEM and B) TEM micrographs of uninfected ciliated bronchial epithelium. C,D) TEM and E) SEM micrographs of ciliated bronchial epithelium 1 h post infection showing NTHi ciliary binding. Scale: 5-10µm

A B Hoechst 33342 TUNEL Hi176 Merge

pi hours 24

48 hours pi hours 48

72 hours pi hours 72

Figure 19. Cellular fitness decreases in a time-dependent manner during NTHi infection. A) Cell cytotoxicity during 72 h infection time-course. Results are expressed as mean values + SEM. *P < 0.05, **P < 0.01, ***P < 0.001. B) Click-iT TUNEL Alexa Fluor Imaging Assay: 24 hours post-challenge with Hi176, signs of DNA damage in WD-NHBE cells were detected. These apoptotic signals indicate that this model is not fit for infections longer than 72 hours.

CHAPTER III: RESULTS

The intracellular stage of NTHi pathogenesis is a non-replicative process and our data indicate an increase in NTHi internalization during infection time-course. IFM analysis of infected epithelia at 24 h and 72 h demonstrate the proportion of internalized vs adhered bacteria, and the formation of microcolony structures on apical surface of epithelium after prolong infection periods with aberrant rearrangements in actin cytoskeleton. Compared with uninfected controls, no obvious deterioration was evident in the cultures in terms of the number of cell layers. As infection progressed, the number of internalized bacteria increased significantly as determined by gentamicin-protection assay. Internalized bacterial counts peaked at 3.5 x 105 CFU/cm2 after 72 h whereas the overall viable bacterial load (both adhered and internalized) decreased slightly after 1 h. Cell viability was drastically reduced 72 h post infection as determined by LDH assay (Fig. 19A). For LDH assays, 1% Triton X-100 treated cells were used as positive control. In order to evaluate the presence of apoptotic cells in our assays, TUNEL staining was performed to detect nuclear DNA fragmentation (Fig. 19B). The number of TUNEL-positive cells in bronchial epithelium infected with NTHi at 24, 48 and 72 hours (the maximum incubation time used in this study) revealed that 72 hour time-point was the ultimate time-frame suitable for transcriptome profiling.

3.2 Dual RNA-sequencing of NTHi-infected WD-NHBE cells

Primary human bronchial epithelium was infected with NTHi at a multiplicity of 100:1. Total RNA was isolated at 1, 6, 24 and 72 h post-infection in three biologically-independent experiments and cDNA libraries were prepared and sequenced with Illumina HiSeq 2500 sequencer. At each time point, between 60 and 180 million total reads per sample were obtained of which approximately one-third could be aligned to non-rRNA regions of the bacterial and human genomes (Table 4). Of all the total uniquely mapped sequence reads, ~1% were bacterial at 1h, whereas this proportion was reduced to 0.5% at 72h. The gradual decrease in prokaryotic read mapping may be due to decrease in number of live bacteria at later time-points. On the contrary, reads mapping to the human genome increased from ~60% at 1h to 70% at 72 h, demonstrating elevated transcript levels in infected host cells (Fig. 20). Reciprocal mapping verified that no reads mapped to the other genome.

Figure 20. Mapping analysis of non-rRNA reads obtained from RNA-seq against NTHi and human genomes.The uniquely mapped sequence reads that mapped to NTHi genome were between 0.4-1.1%, whereas the majority of the reads mapped to the human genome (60-80%). Each value is representative of 3 biological replicates sequenced per time-point.

CHAPTER III: RESULTS

Table 4. Summary of Illumina RNA-seq mapping data. Total number reads obtained and total number of reads mapping to the hg19 reference genome and NTHi genome with 100% accuracy are shown. Percentages of mapping analysis are shown in parenthesis.

Library Total # of reads Total # of reads mapped Total # of reads mapped to human genome (PE) to NTHi genome (SE) t1 uninfected NHBE R1 94,635,010 51,123,742 (54.02%) - t1 uninfected NHBE R2 67,129,188 52,591,230 (78.34%) - t1 uninfected NHBE R3 89,824,350 73,530,786 (81.86%) - t1 infected NHBE R1 75,860,270 33,755,564 (44.50%) 925,063 (1.22%) t1 infected NHBE R2 158,135,300 86,126,428 (54.46%) 1,646,745 (1.04%) t1 infected NHBE R3 152,579,366 77,471,824 (50.77%) 1,530,594 (1.00%) t6 infected NHBE R1 175,966,596 104,761,274 (59.53%) 1,296,766 (0.74%) t6 infected NHBE R2 146,780,238 92,029,526 (62.70%) 1,437,976 (0.98%) t6 infected NHBE R3 174,955,950 97,498,086 (55.73%) 1,503,689 (0.86%) t24 uninfected NHBE R1 110,051,896 90,732,072 (82.44%) - t24 uninfected NHBE R2 93,282,492 78,653,468 (84.32%) - t24 uninfected NHBE R3 97,111,032 81,928,398 (84.37%) - t24 infected NHBE R1 114,759,310 48,929,464 (42.64%) 95,046 (0.08%) t24 infected NHBE R2 115,486,974 86,939,972 (73.55%) 358,837 (0.31%) t24 infected NHBE R3 94,635,372 69,706,936 (73.66%) 291,030 (0.31%) t72 uninfected NHBE R1 100,592,622 76,650,932 (76.20%) - t72 uninfected NHBE R2 104,098,524 87,174,036 (83.74%) - t72 uninfected NHBE R3 99,218,056 79,030,560 (79.65%) - t72 infected NHBE R1 83,329,496 56,060,568 (67.28%) 356,968 (0.43%) t72 infected NHBE R2 117,197,758 90,650,622 (77.35%) 692,070 (0.59%) t72 infected NHBE R3 106,284,334 73,401,304 (69.06%) 499,644 (0.47%) t1 Hi176 control R1 100,496,004 181,430 (0.18%) 33,834,837 (33.67%) t1 Hi176 control R2 61,902,856 542 (0.00%) 20,612,087 (33.30%) t1 Hi176 control R3 130,037,454 844,358 (0.65%) 57,049,103 (43.87%)

3.3 Transcriptome analysis of bronchial epithelium during NTHi infection

3.3.1 The human host cell response to NTHi infection

Analysis of the transcriptional profile of human bronchial epithelium over a 72 h time-course revealed a total of 1423 statistically significant (p<0.01) genes to be differentially expressed (DE) (790 genes up-regulated, 633 genes down-regulated). Genes were considered to be differentially regulated if they showed, at least in one condition, an average transcript value of log2 ratio greater than 1 or less than -1. DE host genes in infected cells compared to mock-infected cells were identified by calculating RPKM. For this analysis, gene expression profiles of cells at 1 h and 6 h after infection were compared with mock infected controls at 1 h, whereas time-matched mock controls were used for comparative analysis of infected cells at 24 h and 72 h post infection. In this analysis, 121 genes were found to be modulated at the immediate-early infection time (1 h), with a sharp increase in gene expression dynamics at 6 h with 537 genes, whilst the numbers showed a transient decrease at transient decrease at later time-points (Fig. 21B). Gene set enrichment analysis using the online DAVID functional annotation resource identified significantly enriched functional groups (PBH <0.05)

CHAPTER III: RESULTS altered by intracellular NTHi infection. In order to gain insights into the immediate-early and late host responses, we performed joint enrichments of functionally-related gene groups considering all modulated transcripts at 1 h and 6 h together as analysis I, and all other transcripts obtained at 24 h and 72 h as analysis II.

1 6 24 72 (hours) ratio 1/8 1 8

-3 0 3

log2 (ratio)

Figure 21. Analysis of host mRNA changes during NTHi infection. A) Heat-maps during infection time-course. The read counts of each cellular mRNA were normalized by the sum of the total reads, and the fold change was calculated from time 1 mock control for both 1h and 6h, while time-matched mock controls were used for 24h and 72h time-points. Colors from black to yellow indicate up-regulated cellular genes; colors from black to blue indicate down-regulated cellular genes. B) Venn diagram showing the number of differentially expressed host genes per comparison across time- points (log2FC ≥1, BH p-value <0.1) and the overlap between each set of genes. C) Enrichment analysis of functional groups by DAVID. Genes which were differentially expressed in the 1-6 h and 24-72 h groups were analyzed. Enriched functional groups (Benjamini-Hochberg adjusted P-value <0.05) were identified and groups of representative of overall enrichment results are shown.

CHAPTER III: RESULTS

The initial attachment of bacteria to cilia and basal membrane triggered a dynamic response in host cells, as observed by DAVID I enrichment of several functional groups including response to hypoxia, regulation of cell cycle and cell death, negative regulation of apoptosis and regulation of cell differentiation. Importantly, the analysis also deduced that NTHi exposure profoundly affected epidermis development (GO:0008544), the anchoring (GO:0070161) and adherence junctions (GO:0005912) of target cells. As previously described, bronchial epithelial cells and keratinocytes share common epithelial-specific molecular gene signatures comprising of family members of keratins, small proline-rich proteins (SPRRs) and proteinase inhibitors that are essential components of epithelial barrier and host defense [152]. Epidermis development was also an over-represented category analysis II, as well as gene sets related to intermediate filaments (IF), cytoskeleton and proteinaceous extracellular matrix components (Fig. 21C). Significant changes in the expression profiles of a broad range of cytoskeletal structural and cell-cell adhesion genes was an evident finding, suggesting major effects of infection on host cell epithelial structure.

We have additionally performed selected paired Ingenuity Pathway Analysis (IPA) to map functional networks of relevant genes. The top 5 molecular and cellular functional pathways and top 5 canonical identified by IPA at 1, 6, 24 and 72 h are listed in Tables 5 and 6. IPA analysis results indicate a rapid and strong induction of cell-to-cell signaling and interaction, immune cell trafficking, cellular movement, cellular development and inflammatory response modules by NTHi infection within 24 h, with infiltration and chemotaxis of granulocyte functions having the highest activation score.

Table 5. Ingenuity Pathway Analysis – top molecular and cellular functions summary

Top Molecular and Cellular Time-point Number of Molecules p-value Functions* Cell Death and Survival 11 2.99E-05 Carbohydrate Metabolism 10 6.33E-05 1h Molecular Transport 10 6.33E-05 Small Molecular Biochemistry 10 6.33 E-05 Gene Expression 0 6.62E-05 Cell Cycle 66 2.77E-09 Cellular Development 120 3.96E-09 6 h Cellular Growth and Proliferation 130 3.96E-09 Cellular Movement 90 2.40E-08 Cell Death and Survival 123 3.26E-08

Cell-To-Cell Signaling and Interaction 20 6.68E-06 24 h Cellular Movement 30 6.68E-06 Cell Signaling 13 3.37E-05 Carbohydrate Metabolism 10 1.19E-04 Small Molecule Biochemistry 23 1.19E-04

CHAPTER III: RESULTS

Cellular Movement 70 3.20E-08 Cell Death and Survival 89 5.78E-08 72 h Cell-To-Cell Signaling and Interaction 52 1.81E-07 Cellular Growth and Proliferation 104 2.63E-07 Post-Translational Modification 4 8.41E-06

*The functional Analysis of a Network identified biological functions that were most significant to the molecules in the network using a right-tailed Fisher’s exact test.

Table 6. Ingenuity Pathway Analysis – top canonical pathways summary

Time-point Top Canonical Pathways* Ratio p-value

Factors Promoting Cardiogenesis in Vertebrates 3/92 1.54E-04 Human Embryonic Stem Cell Pluripotency 3/134 4.67E-04 1h Basal Cell Carcinoma Signaling 2/72 3.06E-03 Glutathione Biosynthesis 1/3 3.44E-03 TR/RXR Activation 2/85 4.24E-03 Erb Signaling 8/86 1.33E-04 G-Protein Coupled Receptor Signaling 14/256 1.81E-04 6 h Trombopoietin Signaling 6/55 3.90E-04 Acute Myeloid Leukemia Signaling 7/77 4.02E-04 ERK/MAPK Signaling 11/187 4.79E04

Pathogenesis of Multiple Scleroris 3/9 1.59E-05 Differential Regulation of Cytokine Production by IL-17A 3/23 3.16E-04 24 h and IL-17F IL-17A Signaling in Gastric Cells 3/25 4.07E-04 Granulocyte Adhesion and Diapedesis 6/177 6.07E-04 Agranulocyte Adhesion and Diapedesis 6/189 8.55E-04 Granulocyte Adhesion and Diapedesis 13/177 5.44E-07 Interferon Signaling 6/36 6.21E-06 72 h Role of IL-17A in Psoriasis 4/13 1.78E-05 Airway Pathology in COPD 3/8 1.14E-04 Pathogenesis of Multiple Sclerosis 3/9 1.70E-04

*Canonical Pathway Analysis identified pathways from the IPA library that were most significant to the data set. Significance of the association was measured in two ways: (1) as the ratio of the number of molecules from the focus gene set that map to the pathway to the total number of molecules that map to the canonical pathway and (2) using Fisher’s exact test.

CHAPTER III: RESULTS

Additionally, the cellular assembly and organization module at 6 h was particularly enriched in host functions confirming disruption of cytoskeleton, formation and extension of lamellipodia/cellular protrusions, and membrane ruffling (Table 7). These findings provide insights into the genomic events that take place in host cell during infection and reveal the activator molecules involved. Our data indicate modulation of various genes with increased expression: CCDC88A, CRK, CNM2, KITLG, SRC, SNX2, ITGB4; HSP90AA1, SH2B1, WASF3, PLXNB1; and ARPC2, CAST, FGD4, MYC, NRP1, CTGF, PHLDB2, RHOB, VLC with decreased expression to induce formation and extension of lamellipodia in infected WD-NHBE cells. This finding was further confirmed in infected epithelia by SEM, in which host cells extend microvilli and form protrusions around adhered bacteria, as shown in Fig. 22.

Table 7. Selected paired Ingenuity Pathway Analysis of host functions showing changes in Cellular Assembly and Organization module. Activation scores across cytostructural components including multiple extracellular matrix proteins, laminins, collagens and cytoskeletal proteins indicate modulation of host cytoskeletal architecture during NTHi infections.

Enriched host functions at 6 hpi Activation score P value Formation of fibronectin matrix 1.72 1.18E-03 Formation of lamellipodia 1.65 1.40E-04 Ruffling 1.34 2.57E-03 Disruption of cytoskeleton 1.34 1.03E-03 Formation of cellular protrusions 0.83 1.88E-03 Organization of cytoskeleton 0.51 2.15E03 Extension of lamellipodia 0.45 7.80E-05 Formation of actin filaments 0.44 2.65E-04

Figure 22. SEM micrographs reveal morphological changes in infected host cell as indicated by transcriptome signatures. The host cells extend microvilli and form protrusions around adhered bacteria at 1 hour post challenge.

CHAPTER III: RESULTS

The extracellular matrix protein mindin (spondin-2, SPON2), which is a pattern-recognition receptor (PRR) molecule was the most highly up-regulated cellular gene at 6h, indicating an important role of this PRR in NTHi recognition. As previously reported [110], NTHi is able to modulate the expression of carcinoembryonic antigen (CEA)-related cell adhesion molecule 1, CAECAM1 in bronchial epithelial cells. In our dataset, we detected enhanced expression of CAECAM7 as well as the intercellular adhesion molecule 1 (ICAM1) by 72 h. Sodium channel non-neuronal 1 (SCNN1) also known as epithelial sodium channel (ENaC) was down-regulated more than two-fold after 6 h of NTHi infection. The induction of expression of the innate immune protein LCN2 by nasal colonization by both gram-positive and gram-negative pathogens is a well-described phenomenon, with iron-sequestering and pro-inflammatory effects shown in vivo in various bacterial pathogens including S. pneumoniae and type B H. influenzae [153,154]. Consistent with these findings, our data has shown that NTHi infection markedly increased the expression of LCN2 in bronchial epithelium (log2 FC>2.4), in an effort to block bacterial siderophore-mediated iron acquisition by the host. Expectedly, NTHi infection induced strong inflammatory response in the bronchial epithelial cells after 24 h. The components of the innate immune response, particularly CXCL5, CXCL10, CXCL11, CCL5, IL-1α, IL-8, IL-23α were among the most up-regulated genes.

As a part of our analysis, we have notably detected a discrete set of 63 host snoRNAs to be differentially regulated and previously not reported to be associated with NTHi infection (Fig. 23). These metabolically stable RNAs were categorized into 2 main groups - 33 C/D box type (SNORD) and 30 H/ACA box type (SNORA) which showed a trend of significant up-regulation during NTHi infection. In addition to this, 9 microRNA (miRNA) precursor signature genes were found to be specifically down-regulated within the first 6 h, while the expression of small Cajal body-specific RNA 1 (SCARNA1) and SCARNA11 was enhanced by more than 2-fold following NTHi infection. These data are indicative of novel biomarkers of NTHi-induced diseases.

CHAPTER III: RESULTS

SNORD99 SNORD116-8 SNORD116-25 SNORA6 SNORD53-SNORD92 SNORA36A ratio SNORD54 1/8 1 8 SNORA52 SNORD33 -3 0 3 SNORD46 log (ratio) SNORD58A 2 SNORA55 SNORD104 SNORD90 SNORD102 SNORA65 SNORA57 SNORA63 SNORA54 SNORA41 SNORD10

SNORA79 SCARNA1 SNORA37 SCARNA11 SNORD94 MIR4521 SNORA72 MIRLET7A1 SNORA68 MIR222 SNORA10 MIR181A1HG SNORD15A MIR3609 SNORA70 MIR22HG SNORA13 MIR3607 SNORD32A MIR568 SNORA81 MIR635 SNORA14A MIR221 SNORD41 MIR1282 SNORD17

SNORA53 1 6 24 72 SNORA74A SNORA12 SNORA26 Time (hours) SNORD105B SNORA38 SNORD45B SNORA71D SNORD16 SNORD8 SNORA71A SNORD87 SNORA24 SNORD97 SNORA34 SNORA23 SNORA22 SNORA49 SNORD42B SNORD89 SNORD117 SNORD55 SNORD36A SNORD61 SNORD24 SNORD21 SNORD81 SNORD43

1 6 24 72 Time (hours) Figure 23. Heat-map profiles of novel snoRNAs, microRNAs and scaRNAs identified to be differentially expressed during NTHi infection in host cells

CHAPTER III: RESULTS

3.3.2 Functional characterization of host transcriptome signatures

During the initial assessment of genomic events following an NTHi infection, we found a specific cluster of genes with modulated expression comprised of type I acidic and type II basic-neutral cytokeratins (CK), in particular KRT5, KRT16P2 AND KRT23 within first 6 h, as well as KRT6B, KRT6C, KRT8, KRT10, KRT14, KRT15 and KRT17 at later stages of infection (Fig. 24A). Filaggrin (FLG) which specifically binds to CK, causing their aggregation into tightly packed parallel array network was also down-regulated (log2 fold change: -1.84). On the basis of these results, we aimed to further investigate the overall organization of the keratin IFs during intracellular NTHi infection. Immunofluorescent staining of keratin network in infected and uninfected epithelia with a pan-cytokeratin antibody demonstrated substantial re-organization of keratin filaments in infected cells, with evident complete depolymerization of keratin bundles associated with cell- cell adhesion (Fig. 24C). These results were confirmed at protein level as demonstrated with a decrease in expression of suprabasal KRT10 after 72 h of infection (Fig. 24B). Many other proteins with related cytoskeletal function such as ɣ-adducin (ADD3), epiplakin 1 (EPPK1), involucrin (IVL), repetin (RPTN), actin related protein 2/3 complex, subunit 2 (ARPC2), tubulin α-1a and tubulin α-1c (TUBA1A, TUBA1C), myosin light chain 5 and 12B (MYL5, MYL12A) were also significantly down-regulated. The decrease in protein expression of ɣ-adducin, an important constituent of spectrin-actin network, induced by infection at 6 h was also confirmed by western blotting.

CHAPTER III: RESULTS

Figure 24. Functional characterization of host transcriptome signatures. A) Selected heat-map analysis of genes identified by GO term enrichments, in particular epidermis development, intermediate filament cytoskeleton and cell-to- cell junction B) Protein extracts were analyzed by immunoblotting for suprabasal KRT10, CDH6, CLD3 and ADD3 ɣ expression at 1, 6, 24 and 72 h in mock cells and after NTHi exposure. C) Immunofluorescent staining of NTHi infected and uninfected WD-NHBE cells indicate overall re-organization of the keratin intermediate filaments induced by invasive NTHi infection, versus the organization of keratin network in mock-infected epithelia. High resolution analysis of infected cells at 72 h demonstrates depolymerization of keratin bundles and loss of overall architecture induced by NTHi infection, visualized by pan-keratin antibody staining (Magnification: 40x.).

Cross-linking SPRR proteins have previously been described as mediators of effective epithelial barrier functioning, particularly in viral infections of cornified cell envelope [155]. Within our 6 h dataset, SPRR1 transcripts were more than 2-fold up-regulated suggesting a previously unrecognized mechanism of host bronchial epithelial defense towards respiratory bacterial pathogens. Another group of proteins contributing to epithelial cell integrity that was highlighted in this analysis was part of the cadherins family. Among these transmembrane cell-adhesion molecules (CAMs) that mediate cell-cell interactions, E-cadherin and P- cadherin are often implicated in infections of the bronchial epithelium. Our data indicated a two-fold reduction in protocadherin8 (PCDH8), and almost a four-fold decrease in cadherin-6 (CDH6). Also known as K-cadherin, CDH6 is normally indicated to be kidney-specific; however our data strongly suggests modulation of the cell-cell adhesion mediated by this CAM in bronchial epithelium. The alterations in the mRNA expression levels of CDH6 at all time-points finely correlated with a reduction in protein expression following NTHi infection (Fig. 24B). Cell-to-cell junction proteins, in particular claudin 3 (CLDN3) and claudin 8 (CLDN8) that serve as the sealing components of the TJs that form the paracellular barrier were also down-regulated at 6 hpi and the decrease in CLD3 protein expression was further confirmed by western blotting.

As part of the enriched GO terms, many genes encoding components of the proteinaceous extracellular matrix were interestingly an outcome of this analysis. Some examples include down-regulation of fibrillin 2 (FBN2), hemicentin 1 (HMCN1), laminin β3 (LAMB3), collagen type VII (COL7A1), cartilage intermediate layer

CHAPTER III: RESULTS protein (CILP), matrix metallopeptidases MMP13, ADAMTSL3, ADAMTS15, ADAM9, ADAM17 (range of log2 fold change: -1.1 to -2.4; all p<0.05), and up-regulation of MMP1, MMP9 (range of log2 fold change: 1.8 to 2.2; p<0.05) at 24 and 72 h of infection. The extracellular matrix protein spondin-2 (mindin), which is a pattern-recognition molecule [156] was the most up-regulated protein of the extracellular matrix at 6 h with 6 fold increase in expression levels. Enhanced mucus secretion is a hallmark of NTHi-induced mucosal infections such as COPD and CF. Parallel to that, we detected increased levels of expression of MUC5B and

MUC4 (log2 fold change: 1.80 and 1.93 respectively) 24 h post infection.

To confirm also the inflammatory transcriptome signatures in infected epithelia, we analyzed the basal secretions of infected WD-NHBE cells for the presence a panel of 40 chemokines, confirming the marked increase in the secretion of inflammatory response components IL-1β, IL-8, TNF-α, CXCL9, CXCL10, CXCL11, CCL2 and CCL3 elicited by NTHi infection in host bronchial epithelium (Fig. 25). No significant changes were detected in the levels of GM-CSF, IL-6 and IL-10 in the infected cells (data not shown).

Figure 25. Basolateral cytokine/chemokine secretions induced following NTHi infection. WD-PBECs were infected as indicated in Fig. 17. Cytokine secretions in the basolateral medium of NTHi- and mock-infected cultures harvested at 6, 24, and 72 hpi were measured. Values are means + SEM. *P < 0.05, **P < 0.01, ***P < 0.001

CHAPTER III: RESULTS

To validate the results obtained in the RNA-seq experiments, qRT-PCR was used to analyze the relative expression levels of eighteen genes from different functional categories. The comparison of gene expression by qRT-PCR and RNA-seq analyses showed a significant Pearson correlation between two approaches (p- value <0.01, R=0.8291) as shown in Fig. 26.

Figure 26. Validation of comparative RNA-seq analysis. A) qRT-PCR analysis of representative genes identified by RNA-seq. The x-axis represents individual genes and the y-axis fold-change in expression by RNA-seq (black bars) or qRT-PCR (gray bars). B) Correlation coefficient (R) between two data-sets.

CHAPTER III: RESULTS

3.4 NTHi whole-transcriptome analysis during infection of bronchial epithelium

3.4.1 Genome-wide NTHi transcriptome map during infection

The reads were aligned with the NTHi genome to construct transcriptome maps during temporal progression of infection. The projection of differentially regulated transcripts is displayed along the chromosome map in Fig. 27. DE genes were spanning the whole Hi176 genome. The genome of Hi176 harbors 1877 protein- encoding genes of which the vast majority (87,96 %) were represented in our RNA-seq data, providing a comprehensive coverage of the NTHi transcriptome under the conditions used in this study.

Figure 27. Genome-wide NTHi transcriptome map during 72 h of host infection. At various time points, DE genes showing ≥2-fold change (p-value <0.05) were selected. Internal circles indicate transcripts on reverse strand, external are on forward strand. Only sense transcripts are represented. The most internal circle (blue bars) show contig edges. Time- points are specular respect to the chromosome rings: the closest to the chromosome is 1h, followed by 6h, 24 h and 72 h after infection. Red/green colour scale represents up- or down-regulation of genes.

CHAPTER III: RESULTS

3.4.2 Gene repertoire of NTHi during host infection

Using DESeq, we identified 1068 NTHi genes whose expression was either positively- or negatively- regulated by ≥2-fold (adjusted p-value ≤0.05) during infection of human bronchial epithelium. Of these genes, 151 were within the core set of genes common to all time-points of infection. The maximum number of DE genes was observed at 1 h post challenge with 246 genes, indicating a rapid organization of the transcriptome already at 1 h in response to the mucosal niche, whereas the numbers of subsequent time-point specific genes were detected to 117 at 6h, 100 at 24 h and 23 at 72 h post infection (Fig. 28A).

Time (h) Time (h) 128 1 +7 128 +7 1 6 24 72 1 6 24 72 4

fold change change fold

ratio

ratio 2 1

0 1 0

log

(128) (456) -7 1/128 -7 1/128 +7 128 +7 128 2 1 6 24 72 24 72 1 6 5

0 1 0 1

(75) (358) -7 1/128 -7 1/128 3 +7 128 +7 128 1 6 24 72 1 6 24 72 6

0 1 0 1

(295) (338) -7 1/128 -7 1/128 54

CHAPTER III: RESULTS

Amino Acid Metabolism Biosynthesis of Other Secondary Metabolites 1 h Cancers Carbohydrate Metabolism 6 h Cell Growth and Death Cell Motility 24 h Cellular Processes and Signaling Digestive System 72 h Endocrine and Metabolic Diseases Endocrine System Energy Metabolism Environmental Adaptation Enzyme Families Folding, Sorting and Degradation Genetic Information Processing Glycan Biosynthesis and Metabolism

Immune System Infectious Diseases Lipid Metabolism Membrane Transport Metabolism Metabolism of Cofactors and Vitamins Metabolism of Other Amino Acids Metabolism of Terpenoids and Polyketides Nervous System Neurodegenerative Diseases Nucleotide Metabolism Poorly Characterized Replication and Repair Signal Transduction Signaling Molecules and Interaction Transcription Translation Transport and Catabolism Xenobiotics Biodegradation and Metabolism

0 20 40 60 80 100

Number of genes (log2 FC≤1)

Figure 28. Temporal expression dynamics of NTHi during host infection. (A) Venn diagram showing the number of differentially expressed genes per comparison across time-points (log2FC ≥1, BH p-value <0.05) and the overlap between each set of genes. (B) Clusters of differentially expressed genes defined by the K-means algorithm and grouped based on the dynamics of expression changes during infection time-course (shown in blue-yellow lines) and mean expression values of genes located in defined clusters (red lines). The number of genes includes within each cluster is reported in brackets. C) KEGG pathway (sub-role) analysis showing a time-course distribution of genes during metabolic adaptation of NTHi to host bronchial epithelium.

Figure of Merit (FOM) analysis [157] shown in (Fig. S34) identified 6 clusters of co-regulated genes according to the K-means partitioning, each of which exhibited particular expression profile of dynamics (Fig.

CHAPTER III: RESULTS

28B). Clusters 1 and 4 showed high expression patterns at all-time points, whereas clusters 2 and 3 presented with down-regulation of expression at all time-points examined. Some clusters demonstrated different dynamics, such as cluster 5 where genes showed down-regulation during first 6 h of infection but expression levels were increased by 72 h. Analogously, genes within cluster 6 demonstrate up-regulation during first 6 h after which the expression profile reached a stable down-regulation by the end of the infection time-course.

During the whole-transcriptome analysis of bacterial adaptation to host cells, important global changes in NTHi gene repertoire were observed as compared to bacteria conditioned in infection medium. While the majority of the DE gene families were involved in protein synthesis, carbohydrate, amino acid, energy metabolism and membrane transport (Fig. 28C), many of the regulated genes can be grouped into five major categories.

Virulence-associated genes: The initial contact of NTHi with the human bronchial epithelium instigated a strong response at the transcriptome level. Several virulence factors have been described for NTHi which promote colonization of the nasopharynx and evasion of the host defenses [158]. Of these, a number of adhesins are involved in the initial adherence to host epithelium. Our data show down-regulation of the genes of pili biosynthesis (major prepilin protein pilA, pilus assembly protein pilF, prepilin signal peptidase pilD) already at 1 h, suggesting an immediate activation of these genes at an earlier time-point after host cell contact (Fig. 29). Down-regulation of pili biosynthesis genes has also been observed in Neisseria meningitidis at 30 minutes of adhesion to host cells, which initiates adhesion via pilus binding [125]. Outer membrane proteins (OMPs), in particular genes encoding omp5, the NTHi ligand of both complement factor H [159] and epithelial cell carcinoembryonic antigen-related cell adhesion molecule-1 (ICAM-1); ompE, the vitronectin- binding protein, and Hap adhesin were either poorly transcribed or down-regulated. On the contrary, adhesin Hia, ompP26 and putative surface adhesin OlpA1 were up-regulated during infection. These results are in agreement with the mechanism that some bacterial adhesins, involved in the primary cell-contact, are necessary during the very early phase of the adhesion process whereas others exploit their function subsequently. The expression of the protective antigen periplasmic protease HtrA and the well-known virulence protein IgA protease were also found to increase in a time-dependent manner.

One of the requirements of a successful adaptation of NTHi to host mucosal surface, is the ability to form and reside in a biofilm as often reported both in vitro and in vivo. Demonstrated by Goodman et al., integration host factor (IHF) belonging to DNABII family has a role in the structural stability of biofilm extracellular matrix (ECM) by its interaction with extracellular DNA [160-162]. The expression of ihfA and ihfB was up- regulated during infection time-course in our model of primary human bronchial epithelium. NTHi exploits decoration of its lipooligosaccharide (LOS) with host-derived N-acetylneuraminic acid (Neu5Ac) as strategy of serum resistance as well as during biofilm formation as demonstrated in chinchilla model of experimental OM [163-165]. In agreement with this immune evasion mechanism, we found genes encoding LOS sialyltransferase siaA (R2846_1446), LOS biosynthesis protein sialyltransferase lsgB (R2846_0692) involved

CHAPTER III: RESULTS in sialylation of terminal N-acetyllactosamine residues to be up-regulated, the latter by more than 2-fold after 6 h of infection. With a role in acid tolerance in the respiratory tract [166], the urease gene cluster ureABCEFGH encoding urease ɣ, β, α subunits (R2846_0044, R2846_0045, R2846_0046) and EFGH accessory proteins (R2846_0047, R2846_0048, R2846 _0049, R2846_0050) respectively, were found to have elevated transcript levels.

1 6 24 72 hrs pilA pilD pilF Omp5 HtrA SiaA LsgB Integration host factor subunit alpha (IHF α) Integration host factor subunit beta (IHF β) Putative survival protein SurA-like protein Heme-hemepexin utilization protein A Murein transglycosylase C

Figure 29. Expression profile of selected virulence factors and vaccine candidates. Many known virulence factors including OMPs, enzymes involved in LOS sialylation and IHF proteins were found to be up-regulated during infection of bronchial epithelium.

Host-pathogen crosstalk: The interaction with host epithelium not only modulated the expression of surface- associated proteins likely to act as the front line of infection, but the new environmental milieu induced expression of a large proportion of genes encoding transport machineries, including those involved in uptake and utilization of iron/heme, transporters of amino acids, vitamins, metal ions, sodium and ATP-binding cassette (ABC)-type transporters (Fig. 30). In particular, arginine regulon artPIQM (R2846_1163, R2846_1164, R2846_1165, R2846_1166) which is a well-characterized transport system in Escherichia coli [167]; predicted amino-acid ABC transport system genes NTHI1241, NTHI1242, NTHI1243 specifically activated at 6h; tryptophan-specific transport protein mtr (R2846_0294); cysteine/glutathione ABC transporter, fused ATPase and permease components cydD and cydC (R2846_1184 and R2846_1185) thiBPQ operon required for transport of thiamine and thiamine pyrophosphate as characterized initially for Salmonella typhimurium [168] (R2846_1304, R2846_1303, R2846_1302); the dipeptide permease dppBCDF operon (R2846_1157, R2846_1158, R2846_1159, R2846_1160) primed for glutathione transport in Haemophilus spp. [169]; the putative oligopeptide transporter periplasmic-binding protein R2846_0426 and putative ion-coupled membrane transporter R2846_1590. Lactate transporter lctP lactate permease (R2846_1126) was 10-fold up- regulated after 6 h of infection indicating lactate uptake from host cells and utilization as carbon source.

Iron is an important factor for NTHi survival in the human host and persistence of this organism on the respiratory mucosa. NTHi does not possess the genes necessary for heme or heme precursor protoporphyrin

CHAPTER III: RESULTS

IX synthesis and therefore in vitro growth requires exogenously supplied sources of heme. Consistent with such nature of the organism, our data indicate strong up-regulation of the ferric hydroxamate ABC transporter operon fhuCDBA (R2846_1655, R2846_1656, R2846_1657, R2846_1658) up to 12-fold in a time-dependent fashion particularly increasing expression after 24 h of adaptation, as well as the hitABC transporter (R2846_0548, R2846_0547, R2846_0546) a highly conserved siderophore-independent high-affinity iron acquisition system [170]. HitABC transport machinery employs specific surface receptors that directly bind host iron-binding proteins, transferrin or lactoferrin [171]. Similarly, the predicted manganese/iron transport system sitABCD (CGSHiGG_04600, CGSHiGG_04605, NTHI0481) genes and magnesium/nickel/cobalt transporter CorA (R2846_1297, fold change ≤ 9.5 at 6h) were increasingly up-regulated over time.

1 6 24 72 hrs

L-lactate permease, LctP family Dipeptide ABC transporter, permease protein DppB Dipeptide ABC transporter, permease protein DppC Dipeptide ABC transporter ATP-binding protein DppD Dipeptide ABC transporter ATP-binding protein DppF

Ferric hydroxymate uptake protein FhuA Ferric hydroxymate ABC transporter, permease FhuB Ferric hydroxymate ABC transporter, periplasmic FhuD Ferric hydroxymate ABC transporter, ATP-binding FhuC Spermidine/putrescine ABC transporter, ATP-binding potA Spermidine/putrescine ABC transporter, permease potB Spermidine/putrescine ABC transporter, permease potC Spermidine/putrescine ABC transporter, substrate- b. potD

Figure 30. Expression dynamics of selected NTHi transport machineries. Several ABC transporters involved in the uptake of nutrients available from the host cell were observed to be highly up-regulated during 72 hours of infection.

Another transport system with high expression profile belongs to the transport of polyamines, essential for normal cellular growth and multiplication of prokaryotic cells. Genes coding for spermidine/putrestine uptake, namely potABCD operon genes potA ATP-binding protein (R2846_0824), potB and potC permease-proteins (R2846_0823 and R2846_0822) and spermidine/putrescine transport system substrate-binding protein potD were increasingly activated. Sap operon in NTHi has been implicated as a mechanism of host antimicrobial peptide (AMP) resistance and sapA is demonstrated to be required for virulence during in vivo infections [81,172-174]. In accordance with this, our findings show that sapABCDF operon was down-regulated at early time-points of infection; however the expression dynamics of this gene cluster during 72 h of host adaptation indicate increased expression over time. Analogously, phosphate-specific transport genes pstS, pstC, pstA, pstB (R2846_0863, R2846_0862, R2846_0861, R2846_0260); oligopeptide permease operon OppABCDF (R2846_1217, R2846_1218, R2846_1219, R2846_1220, R2846_1221): the galactoside ABC transporter encoded by mglBAC (R2846_1505, R2846_1504, R2846_1503) and the genes encoding

CHAPTER III: RESULTS components of cytochrome C maturation operon ccmDCBA (CGSHiEE_06605, CGSHiEE_06610, CGSHiEE_06615, CGSHiEE_06620) were observed to be down-regulated at all time-points studied.

Metabolic adaptation: While transport machineries involved in the uptake of nutrients available from host cells were mainly active during colonization and infection, overall, the genes encoding bacterial biosynthesis pathways of carbohydrates, lipids, amino acids, nucleotides and energy metabolism were down-regulated on a large scale. These include, but are not limited to, glycolysis, gluconeogenesis, pentose phosphate pathway, fatty acid biosynthesis, nucleotide sugar and trehalose biosynthesis, as well as biosynthesis of urine, pyrimidine, serine/threonine, cysteine/methionine, arginine/proline, histidine, cofactor and vitamins. Interestingly, although not active during initial contact with host cells at 1h, we observed specific up- regulation of branched-chain amino acid metabolism and tryptophan biosynthesis pathway (M00023) at 6h onwards. The fatty acid biosynthesis pathways although active at 1h, were poorly transcribed at later time- points of infection. NTHi is capable of utilizing Neu5Ac as a carbon and nitrogen source via its breakdown to N-acetylmannosamine and pyruvate by neuraminyl lyase (nanA, R2846_0495) and the tripartite ATP- independent periplasmic (TRAP) transporter SiaPT (R2846_0491, R2846_0490) is involved in Neu5Ac uptake [175,176]. Both SiaPT and NanA were strongly down-regulated during infection of the host cells, as also observed for the genes encoding fructose-specific phosphotransferase system (PTS) components ptsI (R2846_0679) and ptsH (R2846_0678). While induced expression of several aminoacyl tRNA synthase genes (pheST, lysU, valS) were observed, remarkably, we found the eight enzymes mainly involved in the biosynthesis of essential amino acid histidine in NTHi, encoded by eight genes (hisG,D,C,B,F,IE) organized in an operon, to be highly down-regulated suggesting the availability of histidine within host cells Of interest, we detected an upstream His operon leader sequence as an area of high transcriptional activity which is a well-documented transcription attenuator in bacteria with a transcription pause site [177-179] (Fig. 32, Table 8). This operon has been demonstrated to be significantly more prevalent in OM strains than in throat strains, implicating a role in acute OM and/or middle ear survival [180,181].

Stress response: Under the experimental conditions used, we observed an increased number of intracellular bacteria during infection. In this context, NTHi encounters and must adapt to numerous stressors generated endogenously by host cells or co-pathogens, most notably oxidative stress. Among stress response genes, transcript changes were observed in oxyR (R2846_0013), hydrogen peroxide-inducible genes activator and global regulator of OxyR regulon which has been demonstrated to comprise 11 genes in strain 86-028NP [182,183], with more than 2-fold up-regulation at 1 h of host infection. Within the members of this regulon, we have found increased expression of pgdX (R2846_0012) which encodes peroxiredoxin/glutaredoxin glutathione-dependent, chimeric peroxidase as well as pntA and pntB which encode the α and β subunits of NAD(P) transhydrogenase. PgdX has recently been reported to be important for NTHi persistence in vivo and promote survival in neutrophil extracellular traps [184]. In addition to oxidative stress, highly conserved toxin-antitoxin (TA) family of genes that are hypothesized to function in stress resistance in bacteria were among the genes with highest transcript levels at 6 h of host infection (Fig. 31). These include relBE (R2846_1620, R2846_1619); higBA (R2846_0777, R2846_0778); vapBC1 (R2846_0260, R2846_0259);

CHAPTER III: RESULTS vapBC2 (R2846_1361, R2846_1362) and stbDE (R2846_1391, R2846_1392), some of which have been implicated in NTHi survival and persistence following stress within host [185,186] and also recently been shown to be involved in niche-specific colonization in E. coli [187]. Moreover, numerous molecular chaperons such as GroEL and co-chaperonin GroES; DNaK; DnaJ, previously shown to be modulated in in vitro grown biofilms and in human sputum from COPD patients [188,189]; HtpG; GrpE; Hsp33; HscA/HscB and thiol:disulfide interchange protein DsbA were highly up-regulated.

1 6 24 72 hrs Toxin/ antitoxin locus vapDX, antitoxin protein VapX Toxin/ antitoxin locus vapDX, antitoxin protein VapD Probable toxin-antitoxin relE-like protein Probable toxin-antitoxin relB-like protein Toxin-antitoxin locus protein VapC1 Probable toxin/ antitoxin locus protein (HigA-family) Probable toxin/ antitoxin locus protein (HigB-family) Probable toxin/ antitoxin locus protein VapB2 Probable toxin/ antitoxin locus protein VapC2 Toxin-antitoxin system protein, StbD Toxin-antitoxin system protein, StbE Toxin-antitoxin locus protein VapB1 Urease accessory protein ureH Urease accessory protein ureG Urease accessory protein ureF Urease alpha subunit Urease beta subunit Urease gamma subunit

Figure 31. Increased expression of stress-induced bacterial factors during infection. Analysis of stress components revealed activation of toxin-antitoxin systems specifically at 6 hour of host infection, and upregulation of urease complex consistent with intracellular lifestyle of NTHi.

Transcriptional regulation: Differential expression of multiple gene products involved in regulation of transcription in NTHi was observed. These include members of LysR family, in particular azlR (R2846_0658), the activator of branched-chain amino acid permeases azlCD (R2846_0659, R2846_0660); members of CRP/FNR involved in regulation of fumarate/nitrate reduction (fnr, R2846_0902); putative leucine-responsive regulator R2846_0376 of rp/AsnC family as well as alternate sigma factors rpoE and rpoH (R2846_0315, R2846_1716) which increased expression. In contrast, some members of two-component histidine kinases (HKs) including those of ompR family such as phosphate pstSCAB regulon response regulator PhoB (R2846_0859) and sensor HK PhoR (R2846_0858) involved autoregulation and activation of pstSCAB were found to be down-regulated within the transcriptional machinery.

Reports on post-transcriptional regulation by sRNAs in Haemophilus are very limited. As a part of our sequencing screen for novel transcripts, we identified 17 novel putative sRNAs in the intergenic regions with high transcriptional activity (Table 8). 6 of these are homologous to known sRNA families (RNaseP, tmRNA, sSRP, glycine, His leader attenuator element and GcvB). Importantly, GcvB, a sRNA involved in the

CHAPTER III: RESULTS regulation multiple amino acid and peptide ABC transporters was detected upstream of the LysR-type transcriptional regulator GcvA (Fig. 32). GcvB has been reported to target mRNAs that commonly code for periplasmic substrate-binding proteins such as OppA (repressed in our study) by binding to C/A rich-regions via its conserved G/U rich-elements [190]. HrrF, a recently validated Fur-regulated sRNA in Haemophilus [191], was also present in our dataset.

Table 8. Selected NTHi candidate small non-coding regulatory RNAs with high transcriptional activity during host infection identified by RNA-seq

1 2 Transcript Homology E-value Genome Coordinates Size Validation Hinc1 • 56,261 56,385 125 - Hinc2 126,528 126,708 181 - Hinc3 - 149,794 149,889 126 - Hinc4 - 214,371 214,462 92 - Hinc5 - 289,759 289,932 174 - Hinc6 His leader 2.1E-13 502,489 502,702 214 - Hinc7 - 794,881 795,067 187 - Hinc8 - 1,026,603 1,026,809 207 - Hinc9 - 1,082,498 1,082,758 261 - Hinc10 tmRNA 4.3E-41 1,154,662 1,154,991 330 - Hinc11 RNaseP 3.8E-35 1,257,046 1,257,364 319 - Hinc12 - 1,323,992 1,324,278 287 - Hinc13 GcvB 1.9E-26 1,345,230 1,345,587 356 - Hinc14 sSRP 3.5E-14 1,380,444 1,380,550 107 -

Hinc15 hrrF 1,383,458 1,383,597 140 + [58] Hinc16 - 1,563,833 1,564,055 223 - Hinc17 Glycine 3.9E-15 1,647,278 1,647,664 387 - Hinc18 - 1,661,507 1,661,648 142 - 1 Homology to known sRNA families is shown according to the search against Rfam database with the corresponding E-value. 2 Previously validated in another study.

Figure 32. Artemis viewer of his leader element and GcvB. His leader, an attenuator of his operon and GcvB, sRNA involved in regulation of amino acid biosynthesis genes were identified as an area of high transcriptional activity within intergenic regions of Hi176 genome. Expression data 1 h of host cell infection is indicated. Annotated genes are shown minus strand (His leader) and on plus strand (GcvB). The read count scale is for GcvB:0-500, for His leader:0-550.

CHAPTER IV: DISCUSSION

4 DISCUSSION

Simultaneous monitoring of host-pathogen interplay through transcriptome profiling has been a highly challenging aspect of infection biology mainly due to the incapacity of array-based techniques to concurrently capture and analyze prokaryotic and eukaryotic transcripts from model systems. In recent years, the consolidation of Illumina-based RNA-seq methodology has allowed simultaneous RNA profiling of a variety of host-pathogen systems providing new perspectives in our understanding of infection processes [192-194]. In the current study, we describe the first report to generate comprehensive transcriptome profiles of NTHi and human host in order to capture key features during progressive stages of infection of a highly differentiated primary ciliated human bronchial epithelium.

During whole-transcriptome analysis we observed substantial reprogramming of both epithelial cell and NTHi gene expression, reflecting the dynamic events that take place during the progression of mucosal infection. From the pathogen perspective, a major finding of our study is the demonstration of numerous bacterial substrate-specific transporters and uptake systems being highly up-regulated during the initial host colonization and infection time-course. These observations support the mechanism that NTHi preferentially scavenges the substrates available within the host milieu, while lowering the transcript levels of genes responsible for the biosynthesis of endogenous carbohydrate, amino acid, and lipids. In line with this hypothesis, polyamine transport system known to be important for initial steps of pathogenesis in many bacteria [195-197] and to confer protection in Streptococcus pneumonia [198,199], was found to be activated along with transporters of amino acids, metal ions and peptides. Although metabolic genes represent a high proportion of NTHi transcriptome modulated after host infection, they constitute the major part of the down- regulated genes indicating a striking need to metabolically adapt to nutrients available at the site of colonization. Importantly, our data also suggest that lactate, which is present in respiratory mucosa, could be the primary carbon and energy source, as the genes involved in the uptake and conversion of L- and D-lactate to pyruvate and acetyl-CoA are highly up-regulated during the entire experiment. On the contrary, the genes involved in the glycolysis and the pentose phosphate pathways were repressed or not regulated suggesting a profound adaptation of the bacterial central metabolism to the upper respiratory niche. These finding correlate with recent work demonstrating that lactate is a fundamental carbon source for bacterial pathogens colonizing the human mucosal environments [200,201]. Our observations also reveal that modification of NTHi gene expression during infection is dominated by the activation of virulence and stress related genes. Indeed, we detected the activation of IHF proteins, previously demonstrated to have a role in ECM formation and integrity in NTHi biofilms, as well as the genes involved in the biosynthesis and decoration of the LOS. LOS represents a fundamental moiety for NTHi as it exploits incorporation of sialic acid (Neu5Ac) to LOS as a terminal non-reducing sugar which confers protection from the immune-mediated clearing during colonization [202]. NTHi is incapable of sialic acid de novo synthesis therefore it acquires this substrate from the environment. Allen et al. have recently demonstrated that NTHi sialic acid transport machinery is mediated by a novel TRAP transport system, while the putative NanT transporter, highly homologous to the E. 62

CHAPTER IV: DISCUSSION coli sialic acid transport system, was indicated not to be involved in the Neu5Ac uptake. Interestingly, we found the genes encoding the TRAP system to be highly down-regulated throughout infection time-course, whereas the gene homologous to the NanT transporter was up-regulated suggesting that the latter could be the principal way by which NTHi acquires sialic acid from the host during mucosal colonization. Activation of the stress-induced genes of the TA systems was another intriguing finding and the understanding of the physiological relevance of the transient activation of relBE, higBA, vapBC1, vapBC2 and stbDE systems would be an important area of discovery. The operon responsible for glutathione uptake (DppBCDF) is also highly up-regulated during the time-lapse of the experiment indicating a crucial need for this important antioxidant reservoir during colonization of host niches.

Non-coding sRNAs are increasingly recognized as essential regulators of post-transcriptional gene expression and been described to enable bacterial adaption in response to environmental signals [203]. In our study, we detected at least 18 new candidate small regulatory RNAs with a potential role in NTHi pathogenesis, of which HrrF, has been characterized to be Fur-regulated in iron-limited conditions. GcvB, which we detected upstream of transcription activator GcvA of glycine cleavage system, is involved in the regulation multiple amino acid and peptide ABC transporters [204]. A deletion in gcvB leads to constitutive synthesis of OppA, the periplasmic substrate-binding protein of the one of the major peptide transport systems, which normally is repressed in nutrient-rich growth conditions. In our experimental conditions, OppABCDF operon was highly down-regulated during contact with host cells. The high transcriptional-activity of GcvB detected upstream of the transcriptional regulator GcvA suggests that NTHi GcvB may act as a repressor of the OppA during contact with the host cells which serve as a rich source of substrates.

As a consequence of the prolonged NTHi infection, significant alterations in host cell transcriptome were evident with many of the top down-regulated genes associated to cytoskeletal rearrangements. Most notably, a large-scale dysregulation of bronchial cytokeratins (CKs) synthesis and depolymerization of the epithelial intermediate filament network following intracellular NTHi infection was observed. Interaction between keratins and invading pathogens is an emerging concept and various pathogens achieve intracellular persistence through modulation of keratin filaments in terms of expression, rearrangement, dysfunctioning and cleavage [205-209]. The modulation of multiple apico-lateral junctions is essential for maintaining cellular structure and integrity. Junction complexes are composed of several transmembrane proteins that promote homophilic interactions and are linked inside the cells to specific intracellular partners that mediate their anchorage to the actin cytoskeleton. Transcriptome signatures indicate significant down-regulation of claudins (CLDN) 3 and 8 following NTHi infection, underlying the activation of a mechanism of bacterial invasion based on the translocation of the epithelium. Similar observations have been described by the work of Clarke et al. [104], in which they demonstrated the TLR-dependent down-regulation of CLDN 7 and CLDN 10 by type B H. influenzae in polarized bronchial 16HBE14o- cell line as well as in vivo experiments. Within the host defences, down-regulation of cadherin proteins also represents alterations in Ca2+-dependent cell-cell adhesion at AJs. We also demonstrate that NTHi alters the expression of ɣ-adducin, a protein which belongs to actin-spectrin network. Membrane-skeletal protein ɣ-adducin is localized at spectrin-actin

CHAPTER IV: DISCUSSION junctions that binds calmodulin and is an in vivo substrate for protein kinase C (PKC) and Rho-associated kinases. It regulates remodeling of AJs in human epithelial cells and has been reported to be re-distributed during bacterial infections [210,211]. Down-regulation of ɣ -adducin in bronchial epithelium gives intriguing insights into a potential role this protein in the loss of stabilization of epithelial junctions during respiratory infections.

The extracellular matrix (ECM) is a dynamic network controlling architecture, elasticity and tensile strength of tissues [212]. In our RNA-seq data many host ECM moieties, including laminins, collagens, zinc- dependent matrix metalloprotainases (MMPs), ADAM and ADAMTS families were regulated, suggesting a dramatic remodeling of bronchial ECM following NTHi infection. Of importance, up-regulation of MMP1 (collagenase I) and MMP9 (gelatinase I) has been proposed to lead to degradation of ECM proteins allowing further migration of immune cells to site of infection. Considering the ECM remodeling that takes place during COPD pathophysiology such as changes in mucosal tissue fiber types and/or fibrosis [213], our results support the physiological relevance of the model used. Deep-sequencing of infected bronchial cells also revealed several snoRNA, miRNA and scaRNA species to be DE during NTHi infection. SnoRNAs represent one of the largest groups of functionally diverse trans-acting noncoding RNAs currently known in mammalian cells. In their transcriptomic analysis, Liao et al. have reported the differential expression of a number of snoRNAs in serum samples from patients with COPD [214]. Our data also shows that NTHi infection regulates host microRNAs, which repress gene expression on a post-transcriptional level by targeting the 3’ UTRs of cellular mRNA, leading to its degradation or inhibition of translation [215]. Consistent with previous studies which report differential expression of miRNAs induced by bacterial infection, our data highlight in particular strong down-regulation of let-7a1 involved in repression of the major cytokine immune-modulatory cytokines IL-6 and IL-10 production in a cell type-dependent manner [216]. However, a clear elucidation of the role of these regulatory RNAs in NTHi-induced disease requires further experimentation.

Inflammation is a hallmark of both OM and COPD induced by NTHi, which is mainly mediated by inflammatory cytokines and chemokines such as IL-1β, IL-8, and TNF-α. TLR-2 dependent activation of NF- ĸβ occurs via NF-ĸβ inducing kinase (NIK)-IKKα/β-IĸBα pathway and MKK3/6-p38 mitogen-activated protein (MAP) kinase pathway and serves as the transcriptional activator of multiple host defense genes involved in inflammatory response [217]. In addition to TLR-2, TLR-3 and TLR-4 have been indicated to contribute to epithelial cell response to NTHi [218,219]. We observed a marked increase in secretions of IL- 1β, IL-8, TNF-α, CXCL9, CXCL10, CXCL11, CCL2 and CCL3 in NTHi infected bronchial epithelial cells and 25-fold increase in the CCL5 (RANTES) transcript abundance, highlighting the recruitment of T-cells and macrophages to the lungs, a phenomenon associated with airway inflammation during stable and acutely exacerbated COPD [220,221].

CONCLUDING REMARKS

5 CONCLUDING REMARKS

In summary, during progressive infection of the bronchial epithelium, NTHi re-programmes its transcriptional machinery to optimally benefit from the host milieu and withstand stress conditions it may encounter. In return, infection alters the structure and integrity of the ciliated bronchial epithelium, a condition that is coupled to immune modulators leading to the onset of disease. Here, we present a valuable data resource that informs the regulation of the majority of NTHi genomic determinants under conditions that mimic the first stages of bacterial infection. One of the most promising advantages of this approach is the possibility of gene predictions likely to be activated during NTHi infection of human mucosae. Importantly, we observed that a significant part of the highly up-regulated genes were annotated with unknown function or with no clear cellular localization. Therefore, our attempt to reproduce a temporal infection model could be taken as a unique opportunity to disclose new factors that may act as important players in NTHi pathogenesis. Using this approach to monitor the expression dynamics of virulence factors in real-time represents a novel complementary tool to classical screening procedures used for NTHi vaccine discovery, with a potential application to other bacterial pathogens.

BIBLIOGRAPHY

6 BIBLIOGRAPHY

1. Morris SK, Moss WJ, Halsey N (2008) Haemophilus influenzae type b conjugate vaccine use and effectiveness. Lancet Infect Dis 8: 435-443. 2. Kelly DF, Moxon ER, Pollard AJ (2004) Haemophilus influenzae type b conjugate vaccines. Immunology 113: 163-174. 3. Gallaher TK, Wu S, Webster P, Aguilera R (2006) Identification of biofilm proteins in nontypeable Haemophilus Influenzae. BMC Microbiol 6: 65. 4. Adam HJ, Richardson SE, Jamieson FB, Rawte P, Low DE, et al. (2010) Changing epidemiology of invasive Haemophilus influenzae in Ontario, Canada: evidence for herd effects and strain replacement due to Hib vaccination. Vaccine 28: 4073-4078. 5. Bender JM, Cox CM, Mottice S, She RC, Korgenski K, et al. (2010) Invasive Haemophilus influenzae disease in Utah children: an 11-year population-based study in the era of conjugate vaccine. Clin Infect Dis 50: e41-46. 6. Dworkin MS, Park L, Borchardt SM (2007) The changing epidemiology of invasive Haemophilus influenzae disease, especially in persons > or = 65 years old. Clin Infect Dis 44: 810-816. 7. Kalies H, Siedler A, Grondahl B, Grote V, Milde-Busch A, et al. (2009) Invasive Haemophilus influenzae infections in Germany: impact of non-type b serotypes in the post-vaccine era. BMC Infect Dis 9: 45. 8. Kastrin T, Paragi M, Kolman J, Cizman M, Kraigher A, et al. (2010) Characterisation of invasive Haemophilus influenzae isolates in Slovenia, 1993-2008. Eur J Clin Microbiol Infect Dis 29: 661-668. 9. Ladhani S, Slack MP, Heath PT, von Gottberg A, Chandra M, et al. (2010) Invasive Haemophilus influenzae Disease, Europe, 1996-2006. Emerg Infect Dis 16: 455-463. 10. Laupland KB, Schonheyder HC, Ostergaard C, Knudsen JD, Valiquette L, et al. (2011) Epidemiology of Haemophilus influenzae bacteremia: a multi-national population-based assessment. J Infect 62: 142-148. 11. McConnell A, Tan B, Scheifele D, Halperin S, Vaudry W, et al. (2007) Invasive infections caused by haemophilus influenzae serotypes in twelve Canadian IMPACT centers, 1996- 2001. Pediatr Infect Dis J 26: 1025-1031. 12. Resman F, Ristovski M, Ahl J, Forsgren A, Gilsdorf JR, et al. (2011) Invasive disease caused by Haemophilus influenzae in Sweden 1997-2009; evidence of increasing incidence and clinical burden of non-type b strains. Clin Microbiol Infect 17: 1638-1645. 13. Van Eldere J, Slack MP, Ladhani S, Cripps AW (2014) Non-typeable Haemophilus influenzae, an under-recognised pathogen. Lancet Infect Dis 14: 1281-1292. 14. Teele DW, Klein JO, Rosner B (1989) Epidemiology of otitis media during the first seven years of life in children in greater Boston: a prospective, cohort study. J Infect Dis 160: 83-94. 15. Bakaletz LO (2010) Immunopathogenesis of polymicrobial otitis media. J Leukoc Biol 87: 213- 222. 16. Murphy TF, Faden H, Bakaletz LO, Kyd JM, Forsgren A, et al. (2009) Nontypeable Haemophilus influenzae as a pathogen in children. Pediatr Infect Dis J 28: 43-48. 17. Leibovitz E, Jacobs MR, Dagan R (2004) Haemophilus influenzae: a significant pathogen in acute otitis media. Pediatr Infect Dis J 23: 1142-1152. 18. Murphy TF, Brauer AL, Schiffmacher AT, Sethi S (2004) Persistent colonization by Haemophilus influenzae in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 170: 266-272. 19. Rayner MG, Zhang Y, Gorry MC, Chen Y, Post JC, et al. (1998) Evidence of bacterial metabolic activity in culture-negative otitis media with effusion. Jama 279: 296-299.

BIBLIOGRAPHY

20. Post JC (2001) Direct evidence of bacterial biofilms in otitis media. Laryngoscope 111: 2083- 2094. 21. Ehrlich GD, Veeh R, Wang X, Costerton JW, Hayes JD, et al. (2002) Mucosal biofilm formation on middle-ear mucosa in the chinchilla model of otitis media. Jama 287: 1710- 1715. 22. Weimer KE, Armbruster CE, Juneau RA, Hong W, Pang B, et al. (2010) Coinfection with Haemophilus influenzae promotes pneumococcal biofilm formation during experimental otitis media and impedes the progression of pneumococcal disease. J Infect Dis 202: 1068- 1075. 23. (1995) Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease. American Thoracic Society. Am J Respir Crit Care Med 152: S77-121. 24. Barnes PJ (2000) Chronic obstructive pulmonary disease. N Engl J Med 343: 269-280. 25. King PT, Hutchinson PE, Johnson PD, Holmes PW, Freezer NJ, et al. (2003) Adaptive immunity to nontypeable Haemophilus influenzae. Am J Respir Crit Care Med 167: 587- 592. 26. Soler N, Ewig S, Torres A, Filella X, Gonzalez J, et al. (1999) Airway inflammation and bronchial microbial patterns in patients with stable chronic obstructive pulmonary disease. Eur Respir J 14: 1015-1022. 27. Monso E, Ruiz J, Rosell A, Manterola J, Fiz J, et al. (1995) Bacterial infection in chronic obstructive pulmonary disease. A study of stable and exacerbated outpatients using the protected specimen brush. Am J Respir Crit Care Med 152: 1316-1320. 28. Zalacain R, Sobradillo V, Amilibia J, Barron J, Achotegui V, et al. (1999) Predisposing factors to bacterial colonization in chronic obstructive pulmonary disease. Eur Respir J 13: 343- 348. 29. Eldika N, Sethi S (2006) Role of nontypeable Haemophilus influenzae in exacerbations and progression of chronic obstructive pulmonary disease. Curr Opin Pulm Med 12: 118-124. 30. Berenson CS, Garlipp MA, Grove LJ, Maloney J, Sethi S (2006) Impaired phagocytosis of nontypeable Haemophilus influenzae by human alveolar macrophages in chronic obstructive pulmonary disease. J Infect Dis 194: 1375-1384. 31. Leopold PL, O'Mahony MJ, Lian XJ, Tilley AE, Harvey BG, et al. (2009) Smoking is associated with shortened airway cilia. PLoS One 4: e8157. 32. Tamashiro E, Xiong G, Anselmo-Lima WT, Kreindler JL, Palmer JN, et al. (2009) Cigarette smoke exposure impairs respiratory epithelial ciliogenesis. Am J Rhinol Allergy 23: 117- 122. 33. Verra F, Escudier E, Lebargy F, Bernaudin JF, De Cremoux H, et al. (1995) Ciliary abnormalities in bronchial epithelium of smokers, ex-smokers, and nonsmokers. Am J Respir Crit Care Med 151: 630-634. 34. Fahy JV, Dickey BF (2010) Airway mucus function and dysfunction. N Engl J Med 363: 2233- 2247. 35. van Schilfgaarde M, Eijk P, Regelink A, van Ulsen P, Everts V, et al. (1999) Haemophilus influenzae localized in epithelial cell layers is shielded from antibiotics and antibody- mediated bactericidal activity. Microb Pathog 26: 249-262. 36. Hiltke TJ, Schiffmacher AT, Dagonese AJ, Sethi S, Murphy TF (2003) Horizontal transfer of the gene encoding outer membrane protein P2 of nontypeable Haemophilus influenzae, in a patient with chronic obstructive pulmonary disease. J Infect Dis 188: 114-117. 37. Murphy TF, Kirkham C (2002) Biofilm formation by nontypeable Haemophilus influenzae: strain variability, outer membrane antigen expression and role of pili. BMC Microbiol 2: 7. 38. Berenson CS, Murphy TF, Wrona CT, Sethi S (2005) Outer membrane protein P6 of nontypeable Haemophilus influenzae is a potent and selective inducer of human macrophage proinflammatory cytokines. Infect Immun 73: 2728-2735. 39. Khair OA, Davies RJ, Devalia JL (1996) Bacterial-induced release of inflammatory mediators by bronchial epithelial cells. Eur Respir J 9: 1913-1922.

BIBLIOGRAPHY

40. Miyamoto N, Bakaletz LO (1996) Selective adherence of non-typeable Haemophilus influenzae (NTHi) to mucus or epithelial cells in the chinchilla eustachian tube and middle ear. Microb Pathog 21: 343-356. 41. Reddy MS, Bernstein JM, Murphy TF, Faden HS (1996) Binding between outer membrane proteins of nontypeable Haemophilus influenzae and human nasopharyngeal mucin. Infect Immun 64: 1477-1479. 42. Hill DJ, Toleman MA, Evans DJ, Villullas S, Van Alphen L, et al. (2001) The variable P5 proteins of typeable and non-typeable Haemophilus influenzae target human CEACAM1. Mol Microbiol 39: 850-862. 43. Jurcisek JA, Bookwalter JE, Baker BD, Fernandez S, Novotny LA, et al. (2007) The PilA protein of non-typeable Haemophilus influenzae plays a role in biofilm formation, adherence to epithelial cells and colonization of the mammalian upper respiratory tract. Mol Microbiol 65: 1288-1299. 44. Carruthers MD, Tracy EN, Dickson AC, Ganser KB, Munson RS, Jr., et al. (2012) Biological roles of nontypeable Haemophilus influenzae type IV pilus proteins encoded by the pil and com operons. J Bacteriol 194: 1927-1933. 45. Barenkamp SJ, St Geme JW, 3rd (1996) Identification of a second family of high-molecular- weight adhesion proteins expressed by non-typable Haemophilus influenzae. Mol Microbiol 19: 1215-1223. 46. Dawid S, Barenkamp SJ, St Geme JW, 3rd (1999) Variation in expression of the Haemophilus influenzae HMW adhesins: a prokaryotic system reminiscent of eukaryotes. Proc Natl Acad Sci U S A 96: 1077-1082. 47. St Geme JW, 3rd (1994) The HMW1 adhesin of nontypeable Haemophilus influenzae recognizes sialylated glycoprotein receptors on cultured human epithelial cells. Infect Immun 62: 3881-3889. 48. St Geme JW, 3rd, Kumar VV, Cutter D, Barenkamp SJ (1998) Prevalence and distribution of the hmw and hia genes and the HMW and Hia adhesins among genetically diverse strains of nontypeable Haemophilus influenzae. Infect Immun 66: 364-368. 49. Fink DL, Green BA, St Geme JW, 3rd (2002) The Haemophilus influenzae Hap autotransporter binds to fibronectin, laminin, and collagen IV. Infect Immun 70: 4902-4907. 50. Wang X, Moser C, Louboutin JP, Lysenko ES, Weiner DJ, et al. (2002) Toll-like receptor 4 mediates innate immune responses to Haemophilus influenzae infection in mouse lung. J Immunol 168: 810-815. 51. Janssens S, Beyaert R (2003) Role of Toll-like receptors in pathogen recognition. Clin Microbiol Rev 16: 637-646. 52. Jono H, Shuto T, Xu H, Kai H, Lim DJ, et al. (2002) Transforming growth factor-beta -Smad signaling pathway cooperates with NF-kappa B to mediate nontypeable Haemophilus influenzae-induced MUC2 mucin transcription. J Biol Chem 277: 45547-45557. 53. Ono K, Han J (2000) The p38 signal transduction pathway: activation and function. Cell Signal 12: 1-13. 54. Zhang Y, Feng XH, Derynck R (1998) Smad3 and Smad4 cooperate with c-Jun/c-Fos to mediate TGF-beta-induced transcription. Nature 394: 909-913. 55. Johnson AP, Inzana TJ (1986) Loss of ciliary activity in organ cultures of rat trachea treated with lipo-oligosaccharide from Haemophilus influenzae. J Med Microbiol 22: 265-268. 56. Janson H, Carl n B, Cervin A, Forsgren A, Magnusdottir AB, et al. (1999) Effects on the ciliated epithelium of protein D-producing and -nonproducing nontypeable Haemophilus influenzae in nasopharyngeal tissue cultures. J Infect Dis 180: 737-746. 57. Bailey KL, LeVan TD, Yanov DA, Pavlik JA, DeVasure JM, et al. (2012) Non-typeable Haemophilus influenzae decreases cilia beating via protein kinase Cepsilon. Respir Res 13: 49.

BIBLIOGRAPHY

58. Kilian M, Reinholdt J, Lomholt H, Poulsen K, Frandsen EV (1996) Biological significance of IgA1 proteases in bacterial colonization and pathogenesis: critical evaluation of experimental evidence. Apmis 104: 321-338. 59. Kilian M, Mestecky J, Schrohenloher RE (1979) Pathogenic species of the genus Haemophilus and Streptococcus pneumoniae produce immunoglobulin A1 protease. Infect Immun 26: 143-149. 60. Male CJ (1979) Immunoglobulin A1 protease production by Haemophilus influenzae and Streptococcus pneumoniae. Infect Immun 26: 254-261. 61. Hoa M, Tomovic S, Nistico L, Hall-Stoodley L, Stoodley P, et al. (2009) Identification of adenoid biofilms with middle ear pathogens in otitis-prone children utilizing SEM and FISH. Int J Pediatr Otorhinolaryngol 73: 1242-1248. 62. Armbruster CE, Hong W, Pang B, Dew KE, Juneau RA, et al. (2009) LuxS promotes biofilm maturation and persistence of nontypeable haemophilus influenzae in vivo via modulation of lipooligosaccharides on the bacterial surface. Infect Immun 77: 4081-4091. 63. Hong W, Juneau RA, Pang B, Swords WE (2009) Survival of bacterial biofilms within neutrophil extracellular traps promotes nontypeable Haemophilus influenzae persistence in the chinchilla model for otitis media. J Innate Immun 1: 215-224. 64. Nistico L, Kreft R, Gieseke A, Coticchia JM, Burrows A, et al. (2011) Adenoid reservoir for pathogenic biofilm bacteria. J Clin Microbiol 49: 1411-1420. 65. van Schilfgaarde M, van Alphen L, Eijk P, Everts V, Dankert J (1995) Paracytosis of Haemophilus influenzae through cell layers of NCI-H292 lung epithelial cells. Infect Immun 63: 4729-4737. 66. Ren D, Nelson KL, Uchakin PN, Smith AL, Gu XX, et al. (2012) Characterization of extended co-culture of non-typeable Haemophilus influenzae with primary human respiratory tissues. Exp Biol Med (Maywood) 237: 540-547. 67. Ketterer MR, Shao JQ, Hornick DB, Buscher B, Bandi VK, et al. (1999) Infection of primary human bronchial epithelial cells by Haemophilus influenzae: macropinocytosis as a mechanism of airway epithelial cell entry. Infect Immun 67: 4161-4170. 68. St Geme JW, 3rd, Falkow S (1990) Haemophilus influenzae adheres to and enters cultured human epithelial cells. Infect Immun 58: 4036-4044. 69. Swords WE, Buscher BA, Ver Steeg Ii K, Preston A, Nichols WA, et al. (2000) Non-typeable Haemophilus influenzae adhere to and invade human bronchial epithelial cells via an interaction of lipooligosaccharide with the PAF receptor. Mol Microbiol 37: 13-27. 70. Virji M, Kayhty H, Ferguson DJ, Alexandrescu C, Moxon ER (1991) Interactions of Haemophilus influenzae with cultured human endothelial cells. Microb Pathog 10: 231-245. 71. Forsgren J, Samuelson A, Ahlin A, Jonasson J, Rynnel-Dagoo B, et al. (1994) Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay. Infect Immun 62: 673-679. 72. Bandi V, Apicella MA, Mason E, Murphy TF, Siddiqi A, et al. (2001) Nontypeable Haemophilus influenzae in the lower respiratory tract of patients with chronic bronchitis. Am J Respir Crit Care Med 164: 2114-2119. 73. Marti-Lliteras P, Regueiro V, Morey P, Hood DW, Saus C, et al. (2009) Nontypeable Haemophilus influenzae clearance by alveolar macrophages is impaired by exposure to cigarette smoke. Infect Immun 77: 4232-4242. 74. Morey P, Cano V, Marti-Lliteras P, Lopez-Gomez A, Regueiro V, et al. (2011) Evidence for a non-replicative intracellular stage of nontypable Haemophilus influenzae in epithelial cells. Microbiology 157: 234-250. 75. Salcedo SP, Holden DW (2005) Bacterial interactions with the eukaryotic secretory pathway. Curr Opin Microbiol 8: 92-98. 76. Clementi CF, Murphy TF (2011) Non-typeable Haemophilus influenzae invasion and persistence in the human respiratory tract. Front Cell Infect Microbiol 1: 1.

BIBLIOGRAPHY

77. Weiser JN, Maskell DJ, Butler PD, Lindberg AA, Moxon ER (1990) Characterization of repetitive sequences controlling phase variation of Haemophilus influenzae lipopolysaccharide. J Bacteriol 172: 3304-3309. 78. Weiser JN, Shchepetov M, Chong ST (1997) Decoration of lipopolysaccharide with phosphorylcholine: a phase-variable characteristic of Haemophilus influenzae. Infect Immun 65: 943-950. 79. Weiser JN, Pan N, McGowan KL, Musher D, Martin A, et al. (1998) Phosphorylcholine on the lipopolysaccharide of Haemophilus influenzae contributes to persistence in the respiratory tract and sensitivity to serum killing mediated by C-reactive protein. J Exp Med 187: 631- 640. 80. Lysenko ES, Gould J, Bals R, Wilson JM, Weiser JN (2000) Bacterial phosphorylcholine decreases susceptibility to the antimicrobial peptide LL-37/hCAP18 expressed in the upper respiratory tract. Infect Immun 68: 1664-1671. 81. Mason KM, Munson RS, Jr., Bakaletz LO (2005) A mutation in the sap operon attenuates survival of nontypeable Haemophilus influenzae in a chinchilla model of otitis media. Infect Immun 73: 599-608. 82. Hallstrom T, Jarva H, Riesbeck K, Blom AM (2007) Interaction with C4b-binding protein contributes to nontypeable Haemophilus influenzae serum resistance. J Immunol 178: 6359-6366. 83. Hallstrom T, Zipfel PF, Blom AM, Lauer N, Forsgren A, et al. (2008) Haemophilus influenzae interacts with the human complement inhibitor factor H. J Immunol 181: 537-545. 84. Wong SM, St Michael F, Cox A, Ram S, Akerley BJ (2011) ArcA-regulated glycosyltransferase lic2B promotes complement evasion and pathogenesis of nontypeable Haemophilus influenzae. Infect Immun 79: 1971-1983. 85. St Geme JW, 3rd (2000) The pathogenesis of nontypable Haemophilus influenzae otitis media. Vaccine 19 Suppl 1: S41-50. 86. Huh D, Hamilton GA, Ingber DE (2011) From 3D cell culture to organs-on-chips. Trends Cell Biol 21: 745-754. 87. Hurley BP, McCormick BA (2003) Translating tissue culture results into animal models: the case of Salmonella typhimurium. Trends Microbiol 11: 562-569. 88. Villenave R, Thavagnanam S, Sarlang S, Parker J, Douglas I, et al. (2012) In vitro modeling of respiratory syncytial virus infection of pediatric bronchial epithelium, the primary target of infection in vivo. Proc Natl Acad Sci U S A 109: 5040-5045. 89. Prince OA, Krunkosky TM, Krause DC (2014) In vitro spatial and temporal analysis of Mycoplasma pneumoniae colonization of human airway epithelium. Infect Immun 82: 579- 586. 90. Edwards JA, Groathouse NA, Boitano S (2005) Bordetella bronchiseptica adherence to cilia is mediated by multiple adhesin factors and blocked by surfactant protein A. Infect Immun 73: 3618-3626. 91. Matrosovich MN, Matrosovich TY, Gray T, Roberts NA, Klenk HD (2004) Human and avian influenza viruses target different cell types in cultures of human airway epithelium. Proc Natl Acad Sci U S A 101: 4620-4624. 92. Balder R, Krunkosky TM, Nguyen CQ, Feezel L, Lafontaine ER (2009) Hag mediates adherence of Moraxella catarrhalis to ciliated human airway cells. Infect Immun 77: 4597- 4608. 93. Akira S, Uematsu S, Takeuchi O (2006) Pathogen recognition and innate immunity. Cell 124: 783-801. 94. Nickerson CA, Richter EG, Ott CM (2007) Studying host-pathogen interactions in 3-D: organotypic models for infectious disease and drug development. J Neuroimmune Pharmacol 2: 26-31. 95. Schmeichel KL, Bissell MJ (2003) Modeling tissue-specific signaling and organ function in three dimensions. J Cell Sci 116: 2377-2388.

BIBLIOGRAPHY

96. Oakland M, Sinn PL, McCray PB, Jr. (2012) Advances in cell and gene-based therapies for cystic fibrosis lung disease. Mol Ther 20: 1108-1115. 97. Ebnet K (2008) Organization of multiprotein complexes at cell-cell junctions. Histochem Cell Biol 130: 1-20. 98. Nichols JE, Niles JA, Vega SP, Argueta LB, Eastaway A, et al. (2014) Modeling the lung: Design and development of tissue engineered macro- and micro-physiologic lung models for research use. Exp Biol Med (Maywood) 239: 1135-1169. 99. Sutherland TC, Quattroni P, Exley RM, Tang CM (2010) Transcellular passage of Neisseria meningitidis across a polarized respiratory epithelium. Infect Immun 78: 3832-3847. 100. Losa D, Kohler T, Bellec J, Dudez T, Crespin S, et al. (2014) Pseudomonas aeruginosa- induced apoptosis in airway epithelial cells is mediated by gap junctional communication in a JNK-dependent manner. J Immunol 192: 4804-4812. 101. Gulraiz F, Bellinghausen C, Bruggeman CA, Stassen FR (2014) Haemophilus influenzae increases the susceptibility and inflammatory response of airway epithelial cells to viral infections. Faseb j. 102. Unger BL, Faris AN, Ganesan S, Comstock AT, Hershenson MB, et al. (2012) Rhinovirus attenuates non-typeable Hemophilus influenzae-stimulated IL-8 responses via TLR2- dependent degradation of IRAK-1. PLoS Pathog 8: e1002969. 103. Sajjan U, Wang Q, Zhao Y, Gruenert DC, Hershenson MB (2008) Rhinovirus disrupts the barrier function of polarized airway epithelial cells. Am J Respir Crit Care Med 178: 1271- 1281. 104. Clarke TB, Francella N, Huegel A, Weiser JN (2011) Invasive bacterial pathogens exploit TLR-mediated downregulation of tight junction components to facilitate translocation across the epithelium. Cell Host Microbe 9: 404-414. 105. Junkins RD, Shen A, Rosen K, McCormick C, Lin TJ (2013) Autophagy enhances bacterial clearance during P. aeruginosa lung infection. PLoS One 8: e72263. 106. de Astorza B, Cortes G, Crespi C, Saus C, Rojo JM, et al. (2004) C3 promotes clearance of Klebsiella pneumoniae by A549 epithelial cells. Infect Immun 72: 1767-1774. 107. Chi E, Mehl T, Nunn D, Lory S (1991) Interaction of Pseudomonas aeruginosa with A549 pneumocyte cells. Infect Immun 59: 822-828. 108. Ioannidis I, Ye F, McNally B, Willette M, Flano E (2013) Toll-like receptor expression and induction of type I and type III interferons in primary airway epithelial cells. J Virol 87: 3261-3270. 109. Gentry M, Taormina J, Pyles RB, Yeager L, Kirtley M, et al. (2007) Role of primary human alveolar epithelial cells in host defense against Francisella tularensis infection. Infect Immun 75: 3969-3978. 110. Klaile E, Klassert TE, Scheffrahn I, Muller MM, Heinrich A, et al. (2013) Carcinoembryonic antigen (CEA)-related cell adhesion molecules are co-expressed in the human lung and their expression can be modulated in bronchial epithelial cells by non-typable Haemophilus influenzae, Moraxella catarrhalis, TLR3, and type I and II interferons. Respir Res 14: 85. 111. Hao Y, Kuang Z, Jing J, Miao J, Mei LY, et al. (2014) Mycoplasma pneumoniae Modulates STAT3-STAT6/EGFR-FOXA2 Signaling To Induce Overexpression of Airway Mucins. Infect Immun 82: 5246-5255. 112. Heyl KA, Klassert TE, Heinrich A, Muller MM, Klaile E, et al. (2014) Dectin-1 is expressed in human lung and mediates the proinflammatory immune response to nontypeable Haemophilus influenzae. MBio 5: e01492-01414. 113. Deng X, Li Y, Qiu J (2014) Human bocavirus 1 infects commercially available primary human airway epithelium cultures productively. J Virol Methods 195: 112-119. 114. Barrila J, Radtke AL, Crabbe A, Sarker SF, Herbst-Kralovetz MM, et al. (2010) Organotypic 3D cell culture models: using the rotating wall vessel to study host-pathogen interactions. Nat Rev Microbiol 8: 791-801.

BIBLIOGRAPHY

115. Wong KW, Isberg RR (2005) Yersinia pseudotuberculosis spatially controls activation and misregulation of host cell Rac1. PLoS Pathog 1: e16. 116. Patel JC, Galan JE (2005) Manipulation of the host actin cytoskeleton by Salmonella--all in the name of entry. Curr Opin Microbiol 8: 10-15. 117. Gouin E, Welch MD, Cossart P (2005) Actin-based motility of intracellular pathogens. Curr Opin Microbiol 8: 35-45. 118. Kau AL, Hunstad DA, Hultgren SJ (2005) Interaction of uropathogenic Escherichia coli with host uroepithelium. Curr Opin Microbiol 8: 54-59. 119. Oswald E, Nougayrede JP, Taieb F, Sugai M (2005) Bacterial toxins that modulate host cell- cycle progression. Curr Opin Microbiol 8: 83-91. 120. Scobie HM, Young JA (2005) Interactions between anthrax toxin receptors and protective antigen. Curr Opin Microbiol 8: 106-112. 121. Sansonetti P (2002) Host-pathogen interactions: the seduction of molecular cross talk. Gut 50 Suppl 3: Iii2-8. 122. Jansen A, Yu J (2006) Differential gene expression of pathogens inside infected hosts. Curr Opin Microbiol 9: 138-142. 123. Staudinger BJ, Oberdoerster MA, Lewis PJ, Rosen H (2002) mRNA expression profiles for Escherichia coli ingested by normal and phagocyte oxidase-deficient human neutrophils. J Clin Invest 110: 1151-1163. 124. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, et al. (2003) Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: Insights into the Phagosomal Environment. J Exp Med 198: 693-704. 125. Grifantini R, Bartolini E, Muzzi A, Draghi M, Frigimelica E, et al. (2002) Previously unrecognized vaccine candidates against group B meningococcus identified by DNA microarrays. Nat Biotechnol 20: 914-921. 126. Liu M, Popper SJ, Rubins KH, Relman DA (2006) Early days: genomics and human responses to infection. Curr Opin Microbiol 9: 312-319. 127. Schena M, Shalon D, Davis RW, Brown PO (1995) Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270: 467-470. 128. Merrell DS, Butler SM, Qadri F, Dolganov NA, Alam A, et al. (2002) Host-induced epidemic spread of the cholera bacterium. Nature 417: 642-645. 129. Revel AT, Talaat AM, Norgard MV (2002) DNA microarray analysis of differential gene expression in Borrelia burgdorferi, the Lyme disease spirochete. Proc Natl Acad Sci U S A 99: 1562-1567. 130. Belland RJ, Zhong G, Crane DD, Hogan D, Sturdevant D, et al. (2003) Genomic transcriptional profiling of the developmental cycle of Chlamydia trachomatis. Proc Natl Acad Sci U S A 100: 8478-8483. 131. Maurer AP, Mehlitz A, Mollenkopf HJ, Meyer TF (2007) Gene expression profiles of Chlamydophila pneumoniae during the developmental cycle and iron depletion-mediated persistence. PLoS Pathog 3: e83. 132. Eriksson S, Lucchini S, Thompson A, Rhen M, Hinton JC (2003) Unravelling the biology of macrophage infection by gene expression profiling of intracellular Salmonella enterica. Mol Microbiol 47: 103-118. 133. Toledo-Arana A, Dussurget O, Nikitas G, Sesto N, Guet-Revillet H, et al. (2009) The Listeria transcriptional landscape from saprophytism to virulence. Nature 459: 950-956. 134. Perez N, Trevino J, Liu Z, Ho SC, Babitzke P, et al. (2009) A genome-wide analysis of small regulatory RNAs in the human pathogen group A Streptococcus. PLoS One 4: e7668. 135. Leroy Q, Raoult D (2010) Review of microarray studies for host-intracellular pathogen interactions. J Microbiol Methods 81: 81-95. 136. Der SD, Zhou A, Williams BR, Silverman RH (1998) Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci U S A 95: 15623-15628.

BIBLIOGRAPHY

137. Zhu H, Cong JP, Mamtora G, Gingeras T, Shenk T (1998) Cellular gene expression altered by human cytomegalovirus: global monitoring with oligonucleotide arrays. Proc Natl Acad Sci U S A 95: 14470-14475. 138. Jenner RG, Young RA (2005) Insights into host responses against pathogens from transcriptional profiling. Nat Rev Microbiol 3: 281-294. 139. Westermann AJ, Gorski SA, Vogel J (2012) Dual RNA-seq of pathogen and host. Nat Rev Microbiol 10: 618-630. 140. Metzker ML (2010) Sequencing technologies - the next generation. Nat Rev Genet 11: 31-46. 141. Pease J, Sooknanan R (2012) A rapid, directional RNA-seq library preparation workflow for Illumina[reg] sequencing. Nat Meth 9. 142. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, et al. (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29: 15-21. 143. Anders S, McCarthy DJ, Chen Y, Okoniewski M, Smyth GK, et al. (2013) Count-based differential expression analysis of RNA sequencing data using R and Bioconductor. Nat Protoc 8: 1765-1786. 144. Liao Y, Smyth GK, Shi W (2013) The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res 41: e108. 145. Myers EW, Sutton GG, Delcher AL, Dew IM, Fasulo DP, et al. (2000) A whole-genome assembly of Drosophila. Science 287: 2196-2204. 146. Delcher AL, Bratke KA, Powers EC, Salzberg SL (2007) Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics 23: 673-679. 147. Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, et al. (2000) Artemis: sequence visualization and annotation. Bioinformatics 16: 944-945. 148. Huang da W, Sherman BT, Lempicki RA (2009) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4: 44-57. 149. Huang da W, Sherman BT, Lempicki RA (2009) Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37: 1- 13. 150. Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, et al. (2006) TM4 microarray software suite. Methods Enzymol 411: 134-193. 151. Saeed AI, Sharov V, White J, Li J, Liang W, et al. (2003) TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34: 374-378. 152. Vos JB, Datson NA, van Kampen AH, Luyf AC, Verhoosel RM, et al. (2006) A molecular signature of epithelial host defense: comparative gene expression analysis of cultured bronchial epithelial cells and keratinocytes. BMC Genomics 7: 9. 153. Goetz DH, Holmes MA, Borregaard N, Bluhm ME, Raymond KN, et al. (2002) The neutrophil lipocalin NGAL is a bacteriostatic agent that interferes with siderophore-mediated iron acquisition. Mol Cell 10: 1033-1043. 154. Nelson AL, Barasch JM, Bunte RM, Weiser JN (2005) Bacterial colonization of nasal mucosa induces expression of siderocalin, an iron-sequestering component of innate immunity. Cell Microbiol 7: 1404-1417. 155. Lehr E, Hohl D, Huber M, Brown D (2004) Infection with Human Papillomavirus alters expression of the small proline rich proteins 2 and 3. J Med Virol 72: 478-483. 156. He YW, Li H, Zhang J, Hsu CL, Lin E, et al. (2004) The extracellular matrix protein mindin is a pattern-recognition molecule for microbial pathogens. Nat Immunol 5: 88-97. 157. Yeung KY, Haynor DR, Ruzzo WL (2001) Validating clustering for gene expression data. Bioinformatics 17: 309-318. 158. King P (2012) Haemophilus influenzae and the lung (Haemophilus and the lung). Clin Transl Med 1: 10. 159. Langereis JD, de Jonge MI, Weiser JN (2014) Binding of human factor H to outer membrane protein P5 of non-typeable Haemophilus influenzae contributes to complement resistance. Mol Microbiol 94: 89-106.

BIBLIOGRAPHY

160. Goodman SD, Obergfell KP, Jurcisek JA, Novotny LA, Downey JS, et al. (2011) Biofilms can be dispersed by focusing the immune system on a common family of bacterial nucleoid- associated proteins. Mucosal Immunol 4: 625-637. 161. Brandstetter KA, Jurcisek JA, Goodman SD, Bakaletz LO, Das S (2013) Antibodies directed against integration host factor mediate biofilm clearance from Nasopore. Laryngoscope 123: 2626-2632. 162. Gustave JE, Jurcisek JA, McCoy KS, Goodman SD, Bakaletz LO (2013) Targeting bacterial integration host factor to disrupt biofilms associated with cystic fibrosis. J Cyst Fibros 12: 384-389. 163. Bouchet V, Hood DW, Li J, Brisson JR, Randle GA, et al. (2003) Host-derived sialic acid is incorporated into Haemophilus influenzae lipopolysaccharide and is a major virulence factor in experimental otitis media. Proc Natl Acad Sci U S A 100: 8898-8903. 164. Jurcisek J, Greiner L, Watanabe H, Zaleski A, Apicella MA, et al. (2005) Role of sialic acid and complex carbohydrate biosynthesis in biofilm formation by nontypeable Haemophilus influenzae in the chinchilla middle ear. Infect Immun 73: 3210-3218. 165. Swords WE, Moore ML, Godzicki L, Bukofzer G, Mitten MJ, et al. (2003) Sialylation of Lipooligosaccharides Promotes Biofilm Formation by Nontypeable Haemophilus influenzae. Infection and Immunity 72: 106-113. 166. Murphy TF, Brauer AL (2011) Expression of urease by Haemophilus influenzae during human respiratory tract infection and role in survival in an acid environment. BMC Microbiol 11: 183. 167. Wissenbach U, Six S, Bongaerts J, Ternes D, Steinwachs S, et al. (1995) A third periplasmic transport system for L-arginine in Escherichia coli: molecular characterization of the artPIQMJ genes, arginine binding and transport. Mol Microbiol 17: 675-686. 168. Webb E, Claas K, Downs D (1998) thiBPQ encodes an ABC transporter required for transport of thiamine and thiamine pyrophosphate in Salmonella typhimurium. J Biol Chem 273: 8946-8950. 169. Vergauwen B, Elegheert J, Dansercoer A, Devreese B, Savvides SN (2010) Glutathione import in Haemophilus influenzae Rd is primed by the periplasmic heme-binding protein HbpA. Proc Natl Acad Sci U S A 107: 13270-13275. 170. Mietzner TA, Tencza SB, Adhikari P, Vaughan KG, Nowalk AJ (1998) Fe(III) periplasm-to- cytosol transporters of gram-negative pathogens. Curr Top Microbiol Immunol 225: 113- 135. 171. Anderson DS, Adhikari P, Nowalk AJ, Chen CY, Mietzner TA (2004) The hFbpABC transporter from Haemophilus influenzae functions as a binding-protein-dependent ABC transporter with high specificity and affinity for ferric iron. J Bacteriol 186: 6220-6229. 172. Mason KM, Bruggeman ME, Munson RS, Bakaletz LO (2006) The non-typeable Haemophilus influenzae Sap transporter provides a mechanism of antimicrobial peptide resistance and SapD-dependent potassium acquisition. Mol Microbiol 62: 1357-1372. 173. Shelton CL, Raffel FK, Beatty WL, Johnson SM, Mason KM (2011) Sap transporter mediated import and subsequent degradation of antimicrobial peptides in Haemophilus. PLoS Pathog 7: e1002360. 174. Mason KM, Munson RS, Jr., Bakaletz LO (2003) Nontypeable Haemophilus influenzae gene expression induced in vivo in a chinchilla model of otitis media. Infect Immun 71: 3454- 3462. 175. Vimr E, Lichtensteiger C, Steenbergen S (2000) Sialic acid metabolism's dual function in Haemophilus influenzae. Mol Microbiol 36: 1113-1123. 176. Allen S, Zaleski A, Johnston JW, Gibson BW, Apicella MA (2005) Novel sialic acid transporter of Haemophilus influenzae. Infect Immun 73: 5291-5300. 177. Chan CL, Landick R (1989) The Salmonella typhimurium his operon leader region contains an RNA hairpin-dependent transcription pause site. Mechanistic implications of the effect on pausing of altered RNA hairpins. J Biol Chem 264: 20796-20804.

BIBLIOGRAPHY

178. Chan CL, Landick R (1993) Dissection of the his leader pause site by base substitution reveals a multipartite signal that includes a pause RNA hairpin. J Mol Biol 233: 25-42. 179. Kolter R, Yanofsky C (1982) Attenuation in amino acid biosynthetic operons. Annu Rev Genet 16: 113-134. 180. Xie J, Juliao PC, Gilsdorf JR, Ghosh D, Patel M, et al. (2006) Identification of new genetic regions more prevalent in nontypeable Haemophilus influenzae otitis media strains than in throat strains. J Clin Microbiol 44: 4316-4325. 181. Juliao PC, Marrs CF, Xie J, Gilsdorf JR (2007) Histidine auxotrophy in commensal and disease-causing nontypeable Haemophilus influenzae. J Bacteriol 189: 4994-5001. 182. Harrison A, Ray WC, Baker BD, Armbruster DW, Bakaletz LO, et al. (2007) The OxyR regulon in nontypeable Haemophilus influenzae. J Bacteriol 189: 1004-1012. 183. Whitby PW, Morton DJ, Vanwagoner TM, Seale TW, Cole BK, et al. (2012) Haemophilus influenzae OxyR: characterization of its regulation, regulon and role in fitness. PLoS One 7: e50588. 184. Juneau RA, Pang B, Armbruster CE, Murrah KA, Perez AC, et al. (2014) Peroxiredoxin/glutaredoxin (pdgX) and catalase (htkE) promote resistance of nontypeable Haemophilus influenzae 86-028NP to oxidant and survival within neutrophil extracellular traps. Infect Immun. 185. Ren D, Kordis AA, Sonenshine DE, Daines DA (2014) The ToxAvapA toxin-antitoxin locus contributes to the survival of nontypeable Haemophilus influenzae during infection. PLoS One 9: e91523. 186. Ren D, Walker AN, Daines DA (2012) Toxin-antitoxin loci vapBC-1 and vapXD contribute to survival and virulence in nontypeable Haemophilus influenzae. BMC Microbiol 12: 263. 187. Norton JP, Mulvey MA (2012) Toxin-antitoxin systems are important for niche-specific colonization and stress resistance of uropathogenic Escherichia coli. PLoS Pathog 8: e1002954. 188. Pang B, Hong W, Kock ND, Swords WE (2012) Dps promotes survival of nontypeable Haemophilus influenzae in biofilm communities in vitro and resistance to clearance in vivo. Front Cell Infect Microbiol 2: 58. 189. Qu J, Lesse AJ, Brauer AL, Cao J, Gill SR, et al. (2010) Proteomic expression profiling of Haemophilus influenzae grown in pooled human sputum from adults with chronic obstructive pulmonary disease reveal antioxidant and stress responses. BMC Microbiol 10: 162. 190. Sharma CM, Darfeuille F, Plantinga TH, Vogel J (2007) A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome- binding sites. Genes Dev 21: 2804-2817. 191. Santana EA, Harrison A, Zhang X, Baker BD, Kelly BJ, et al. (2014) HrrF is the Fur-regulated small RNA in nontypeable Haemophilus influenzae. PLoS One 9: e105644. 192. Juranic Lisnic V, Babic Cac M, Lisnic B, Trsan T, Mefferd A, et al. (2013) Dual analysis of the murine cytomegalovirus and host cell transcriptomes reveal new aspects of the virus- host cell interface. PLoS Pathog 9: e1003611. 193. Humphrys MS, Creasy T, Sun Y, Shetty AC, Chibucos MC, et al. (2013) Simultaneous transcriptional profiling of bacteria and their host cells. PLoS One 8: e80597. 194. Jones M, Dry IR, Frampton D, Singh M, Kanda RK, et al. (2014) RNA-seq analysis of host and viral gene expression highlights interaction between varicella zoster virus and keratinocyte differentiation. PLoS Pathog 10: e1003896. 195. Ware D, Jiang Y, Lin W, Swiatlo E (2006) Involvement of potD in Streptococcus pneumoniae polyamine transport and pathogenesis. Infect Immun 74: 352-361. 196. Jelsbak L, Thomsen LE, Wallrodt I, Jensen PR, Olsen JE (2012) Polyamines are required for virulence in Salmonella enterica serovar Typhimurium. PLoS One 7: e36149. 197. Goytia M, Shafer WM (2010) Polyamines can increase resistance of Neisseria gonorrhoeae to mediators of the innate human host defense. Infect Immun 78: 3187-3195.

BIBLIOGRAPHY

198. Shah P, Swiatlo E (2006) Immunization with polyamine transport protein PotD protects mice against systemic infection with Streptococcus pneumoniae. Infect Immun 74: 5888-5892. 199. Min X, Zhang X, Wang H, Gong Y, Li M, et al. (2012) Protection against pneumococcal infection elicited by immunization with glutamyl tRNA synthetase, polyamine transport protein D and sortase A. Vaccine 30: 3624-3633. 200. Exley RM, Goodwin L, Mowe E, Shaw J, Smith H, et al. (2005) Neisseria meningitidis lactate permease is required for nasopharyngeal colonization. Infect Immun 73: 5762-5766. 201. Exley RM, Wu H, Shaw J, Schneider MC, Smith H, et al. (2007) Lactate acquisition promotes successful colonization of the murine genital tract by Neisseria gonorrhoeae. Infect Immun 75: 1318-1324. 202. Hood DW, Makepeace K, Deadman ME, Rest RF, Thibault P, et al. (1999) Sialic acid in the lipopolysaccharide of Haemophilus influenzae: strain distribution, influence on serum resistance and structural characterization. Mol Microbiol 33: 679-692. 203. Repoila F, Darfeuille F (2009) Small regulatory non-coding RNAs in bacteria: physiology and mechanistic aspects. Biol Cell 101: 117-131. 204. Urbanowski ML, Stauffer LT, Stauffer GV (2000) The gcvB gene encodes a small untranslated RNA involved in expression of the dipeptide and oligopeptide transport systems in Escherichia coli. Mol Microbiol 37: 856-868. 205. Vanderhoeven JP, Bierle CJ, Kapur RP, McAdams RM, Beyer RP, et al. (2014) Group B streptococcal infection of the choriodecidua induces dysfunction of the cytokeratin network in amniotic epithelium: a pathway to membrane weakening. PLoS Pathog 10: e1003920. 206. Zhu C, Bai Y, Liu Q, Li D, Hong J, et al. (2013) Depolymerization of cytokeratin intermediate filaments facilitates intracellular infection of HeLa cells by Bartonella henselae. J Infect Dis 207: 1397-1405. 207. Dong F, Su H, Huang Y, Zhong Y, Zhong G (2004) Cleavage of host keratin 8 by a Chlamydia-secreted protease. Infect Immun 72: 3863-3868. 208. Batchelor M, Guignot J, Patel A, Cummings N, Cleary J, et al. (2004) Involvement of the intermediate filament protein cytokeratin-18 in actin pedestal formation during EPEC infection. EMBO Rep 5: 104-110. 209. Vos JB, van Sterkenburg MA, Rabe KF, Schalkwijk J, Hiemstra PS, et al. (2005) Transcriptional response of bronchial epithelial cells to Pseudomonas aeruginosa: identification of early mediators of host defense. Physiol Genomics 21: 324-336. 210. Naydenov NG, Ivanov AI (2010) Adducins regulate remodeling of apical junctions in human epithelial cells. Mol Biol Cell 21: 3506-3517. 211. Chu HG, Weeks SK, Gilligan DM, Rockey DD (2008) Host alpha-adducin is redistributed and localized to the inclusion membrane in chlamydia- and chlamydophila-infected cells. Microbiology 154: 3848-3855. 212. Lu P, Takai K, Weaver VM, Werb Z (2011) Extracellular matrix degradation and remodeling in development and disease. Cold Spring Harb Perspect Biol 3. 213. Demedts IK, Brusselle GG, Bracke KR, Vermaelen KY, Pauwels RA (2005) Matrix metalloproteinases in asthma and COPD. Curr Opin Pharmacol 5: 257-263. 214. Liao J, Yu L, Mei Y, Guarnera M, Shen J, et al. (2010) Small nucleolar RNA signatures as biomarkers for non-small-cell lung cancer. Mol Cancer 9: 198. 215. Ambros V (2004) The functions of animal microRNAs. Nature 431: 350-355. 216. Schulte LN, Eulalio A, Mollenkopf HJ, Reinhardt R, Vogel J (2011) Analysis of the host microRNA response to Salmonella uncovers the control of major cytokines by the let-7 family. Embo j 30: 1977-1989. 217. Shuto T, Xu H, Wang B, Han J, Kai H, et al. (2001) Activation of NF-kappa B by nontypeable Hemophilus influenzae is mediated by toll-like receptor 2-TAK1-dependent NIK-IKK alpha /beta-I kappa B alpha and MKK3/6-p38 MAP kinase signaling pathways in epithelial cells. Proc Natl Acad Sci U S A 98: 8774-8779.

BIBLIOGRAPHY

218. Teng F, Slavik V, Duffy KE, San Mateo L, Goldschmidt R (2010) Toll-like receptor 3 is involved in airway epithelial cell response to nontypeable Haemophilus influenzae. Cell Immunol 260: 98-104. 219. Wieland CW, Florquin S, Maris NA, Hoebe K, Beutler B, et al. (2005) The MyD88-dependent, but not the MyD88-independent, pathway of TLR4 signaling is important in clearing nontypeable haemophilus influenzae from the mouse lung. J Immunol 175: 6042-6049. 220. Costa C, Rufino R, Traves SL, Lapa ESJR, Barnes PJ, et al. (2008) CXCR3 and CCR5 chemokines in induced sputum from patients with COPD. Chest 133: 26-33. 221. Fujimoto K, Yasuo M, Urushibata K, Hanaoka M, Koizumi T, et al. (2005) Airway inflammation during stable and acutely exacerbated chronic obstructive pulmonary disease. Eur Respir J 25: 640-646.

APPENDICES

7 APPENDICES

APPENDIX 1

Table 9. Primer sequences used in qRT-PCR

Primer Name Primer Sequence 5’-3’ ADD3 F TGACCATACAGGATTCAGTC ADD3 R CCACATTTCATGGAGGATAC CDH6 F GTCACAGCCCAAGATCCAGATGCT CDH6 R GTGCCATAGCAGTGTTTCTCGGTCA COL7A1 F ATGACCTTGGCATTATCTTG COL7A1 R TGAATATGTCACCTCTCAAGG EPPK F GGTTCAGAGGCCAGAAACCAACAC EPPK R CTCGATCAACTCTAAGATGAGCTGCGC FLG F AATTTCGGCAAATCCTGAAG FLG R CTTGAGCCAACTTGAATACC GAPDH F CATGGCACCGTCAAGGCTGAGAA GAPDH R CAGTGGACTCCACGACGTACTCA KRT 5 F GCATCACCGTTCCTGGGTAACAG KRT 5 R CGCTCCGGAAGGACACACTT KRT 6B F TCAGCACTCAGACATGCGAATGTCC KRT 6B R GAGGACTCCTCATCTGCAGCTGG KRT 10 F GGACATAGAACTACAGTCCC KRT 10 R GTATTCAGTATTCTGGCACTC KRT 14 F GAGATGTCAATGTGGAGATG KRT 14 R GTCTTGGTGAAGAACCATTC KRT 15 F AGGTGTGCAGGCAGCTGTGTTTG KRT 15 R AGAGGGTGTTGTGGGACCTCGT KRT 16 F CATCGAGGACCTGAGGAACAAGGT KRT 16 R GACCCTCTGCTACCACTTCCCTG KRT 17 F GTGAGATCAATGTGGAGATG KRT 17 R GTCTTGCTGAAGAACCAATC LAMP3 F CAGAAAAGTCCACATAACCC LAMP3 R AACACATGAGGAAAGTCAAC LCN2 F GGAAAAAGAAGTGTGACTACTG LCN2 R GTAACTCTTAATGTTGCCCAG MMP1 F GCTAACAAATACTGGAGGTATG MMP1 R ATCAACTTTGTGGCCAATTC RPTN F ATCCTCCAGAGACCAAATG RPTN R TCTAGCTTATGATAGCAGGC SPON2 F CTTGAGAAGTGAATAAATGGGG SPON2 R TTTGTGAGCAACAGAGATAG SPRR1B F TATTCCTCTCTTCACACCAG SPRR1B R TCCTTGGTTTTGGGGATG TUBA1A F AGATGCTGCCAATAACTATG TUBA1A R CTTGCCATAATCAACTGAGAG 16S F GGTGCTGCATGGCTGTCGTC 16S R CACCTCGCAGCTTCGCTTCC

APPENDICES

APPENDIX 2

Table 10. Antibodies used in CLSM and WB analysis

Antibody Dilution Company Cat No. Anti-serum total Hi176 1:5000 In house -

Β-tubulin IV IF 1:200 Sigma T7941 MUC5AC IF 1:200 Millipore MAB2011

ZO-I IF 1:200 Invitrogen 61-7300

Pan cytokeratin IF 1:200 Invitrogen 18-0132 KRT10 WB 1:5000 Abcam Ab76318 K-cadherin WB 1:1000 Thermo Scientific PA5-11456 Claudin 3 WB 1:500 Abcam Ab52231 Adducin gamma WB 1:500 Abcam Ab135868 GAPDH WB 1:2000 Life Technologies AM4300 Anti Mouse HRP 1:2500 Dako P0161 Anti Rabbit HRP 1:2500 Dako P0448 Alexa Fluor 568 anti mouse 1:1000 Life Technologies A11004 Alexa Fluor 568 anti rabbit 1:1000 Life Technologies A11011 Alexa Fluor 488 anti mouse 1:1000 Life Technologies A11079 Alexa Fluor 647 phalloidin 1:400 Life Technologies A22287

APPENDICES

APPENDIX 3 – Ribo-depletion analysis of total RNA samples for Illumina sequencing

APPENDICES

APPENDIX 4 – Quality control analysis of cDNA libraries for Illumina sequencing

APPENDICES

APPENDIX 5

Table 11. Illumina HiSeq flowcell design, 2-lane rapid run

Lane SampleID Index Procedure

1 t24 conditioned uninfected cells - control (Replicate 1) index 1 ATCACG HiSeq es.RNA PE 75bp+ 6bp INDEX

1 t24 conditioned uninfected cells - control (Replicate 2) index 4 TGACCA HiSeq es.RNA PE 75bp+ 6bp INDEX

1 t24 conditioned uninfected cells - control (Replicate 3) index 8 ACTTGA HiSeq es.RNA PE 75bp+ 6bp INDEX

2 t72 conditioned uninfected cells - control (Replicate 1) index 12 CTTGTA HiSeq es.RNA PE 75bp+ 6bp INDEX

2 t72 conditioned uninfected cells - control (Replicate 2) index 6 GCCAAT HiSeq es.RNA PE 75bp+ 6bp INDEX

2 t72 conditioned uninfected cells - control (Replicate 3) index 10 TAGCTT HiSeq es.RNA PE 75bp+ 6bp INDEX

Table 12. Illumina HiSeq flowcell design, 8-lane flowcell full-run

Lane Sample ID Index Procedure 1 t1 conditioned uninfected cells - control (Replicate 1) index 1 ATCACG HiSeq es.RNA PE 75bp+ 6bp INDEX 1 t1 conditioned uninfected cells - control (Replicate 2) index 4 TGACCA HiSeq es.RNA PE 75bp+ 6bp INDEX 1 t1 conditioned bacteria - control (Replicate 1) index 8 ACTTGA HiSeq es.RNA PE 75bp+ 6bp INDEX 1 t1 conditioned bacteria - control (Replicate 2) index 2 CGATGT HiSeq es.RNA PE 75bp+ 6bp INDEX 2 t1 conditioned uninfected cells - control (Replicate 3) index 6 GCCAAT HiSeq es.RNA PE 75bp+ 6bp INDEX 2 t1 conditioned bacteria - control (Replicate 3) index 12 CTTGTA HiSeq es.RNA PE 75bp+ 6bp INDEX 2 t1 hour post infection (Replicate 1) index 1 ATCACG HiSeq es.RNA PE 75bp+ 6bp INDEX 3 t1 hour post infection (Replicate 2) index 6 GCCAAT HiSeq es.RNA PE 75bp+ 6bp INDEX 3 t1 hour post infection (Replicate 3) index 12 CTTGTA HiSeq es.RNA PE 75bp+ 6bp INDEX 4 t6 hour post infection (Replicate 1) index 6 GCCAAT HiSeq es.RNA PE 75bp+ 6bp INDEX 4 t6 hour post infection (Replicate 2) index 12 CTTGTA HiSeq es.RNA PE 75bp+ 6bp INDEX

APPENDICES

5 t6 hour post infection (Replicate 3) index 6 GCCAAT HiSeq es.RNA PE 75bp+ 6bp INDEX 5 t24 hour post infection (Replicate 1) index 12 CTTGTA HiSeq es.RNA PE 75bp+ 6bp INDEX 6 t24 hour post infection (Replicate 2) index 6 GCCAAT HiSeq es.RNA PE 75bp+ 6bp INDEX 6 t24 hour post infection (Replicate 3) index 12 CTTGTA HiSeq es.RNA PE 75bp+ 6bp INDEX 7 t72 hour post infection (Replicate 1) index 6 GCCAAT HiSeq es.RNA PE 75bp+ 6bp INDEX 7 t72 hour post infection (Replicate 2) index 12 CTTGTA HiSeq es.RNA PE 75bp+ 6bp INDEX 8 t72 hour post infection (Replicate 3) index 6 GCCAAT HiSeq es.RNA PE 75bp+ 6bp INDEX 8 t72 conditioned uninfected cells - control (Replicate 1) index 12 CTTGTA HiSeq es.RNA PE 75bp+ 6bp INDEX

APPENDICES

APPENDIX 6

Table 13. Sequence analysis primary run metrics- Illumina sequencing raw data (full run)

APPENDICES

Table 14. Sequence analysis primary run metrics- Illumina sequencing raw data (rapid run)

APPENDICES

APPENDIX 7 – FASTQC quality control analysis of Illumina raw data

Figure 33: Per base sequence Illumina quality control

 A quality-score of 10 means a 1/10 chance of the base being incorrectly called, 20 means a 1/100 chance and 30 means 1/1000. All the scores for both Illumina runs were in the range 30-40, indicating a very high quality for sequencing performed.

APPENDICES

APPENDIX 7 – Figure of Merit analysis

Figure 34: Figure of Merit (FOM) analysis of gene clusters

Analysis results [Method: Calculated means (KMC) – Euclidean distance]

1 1 4.522 2 3.477 3 2.937 4 2.63 5 2.453 6 2.301 7 2.184 8 2.1 9 2.058 10 1.982 11 1.951 12 1.894 13 1.867 14 1.848 15 1.747 16 1.727 17 1.701 18 1.668 19 1.643 20 1.619

APPENDICES

APPENDIX 9

Table 15. Raw data for eukaryotic analysis

ucscid Gene Symbol log2 FoldChange t1 log2 FoldChange t6 log2 FoldChange t24 log2 FoldChange t72 uc001acj.4 ISG15 0.300321964 -0.233182965 0.011923705 4.184634168 uc001age.1 SSU72 0.251420216 -1.556667686 -0.028362253 -0.153296436 uc001ajn.3 HES5 0.285209284 1.372585775 0.110992044 0.09371038 uc001akg.4 ARHGEF16 0.173424586 0.33986499 -1.048391309 0.554430157 uc001aoe.2 THAP3 0.331339839 0.665459354 -1.511003846 -0.66538871 uc001aoz.3 ERRFI1 0.562933505 -1.002755368 0.823073079 0.416622977 uc001apa.1 ERRFI1 0.333761047 -1.023195417 0.436912823 -0.043957807 uc001aqp.3 NMNAT1 -0.002065574 1.197473573 0.262076705 0.124064723 uc001art.3 TARDBP 0.144818485 1.205704136 0.874313848 0.264651483 uc001aso.3 FBXO6 0.370410248 0.122646651 -0.027130404 1.417894268 uc001atn.4 MFN2 0.119363804 1.036852864 0.271682464 0.442952366 uc001awm.2 CASP9 0.04004852 -1.411381236 0.16000878 -0.275624401 uc001ayl.1 SPATA21 0.494560964 1.106713435 -1.318617623 -1.081465167 uc001ayt.2 CROCCP3 0.553227619 1.724562719 0.129452166 -0.928242857 uc001beb.3 HP1BP3 0.362755373 1.055518332 0.184767074 -0.634760984 uc001bgo.3 HNRNPR 0.686218813 -1.439821375 0.169619313 0.271677082 uc001bgw.3 C1orf213 0.254697528 1.415009328 -0.258496449 0.670660422 uc001bhh.4 ID3 -0.316165942 1.233528537 -0.099045586 0.149534608 uc001bij.2 SRSF10 -0.264179232 -1.135278729 -0.038630531 -0.298538295 uc001bjo.2 CLIC4 0.053158174 0.798555606 2.335169536 1.468120782 uc001bkw.1 AUNIP -0.270955988 -1.089644855 -0.305513564 -1.10757308 uc001boy.1 SCARNA1 0.923469142 -0.2743566 1.134471997 1.341503322 uc001bqq.1 SNORD99 2.165260699 1.455195167 0.698958971 1.171215006

APPENDICES

uc001bzm.1 AK025726 0.076753221 0.358168315 -0.344868148 -1.013399317 uc001cca.1 YRDC -0.007009556 -1.251996752 -0.455972342 0.178797167 uc001cdo.1 SNORA55 1.698934093 0.309024394 1.093199945 0.914216217 uc001cgb.3 NFYC 0.76869928 1.122750944 -0.322280547 -0.06518352 uc001cgj.3 CITED4 -0.495944157 -1.024992582 -0.160334283 0.139447392 uc001cmj.1 SNORD55 1.228684524 0.469852504 2.136560746 1.040992675 uc001cmk.1 SNORD46 1.366620715 0.388580873 1.172867756 1.27383306 uc001cmn.3 PLK3 0.087461808 -1.317845452 0.202800753 0.43702485 uc001cqk.4 EFCAB14 0.252905434 1.037400447 -0.052593396 -0.854555823 uc001cqs.3 CYP4X1 0.228508748 0.527718134 1.063048009 0.568994562 uc001cqw.3 PDZK1IP1 0.194091449 -0.183286954 0.511706298 1.420756838 uc001cxy.3 PARS2 0.281747089 1.119541998 -0.369673232 -0.041611386 uc001dey.4 ANKRD13C 0.455546731 -1.045079634 -0.180291213 0.170423744 uc001dfr.3 ZRANB2-AS1 0.984491541 1.341715549 -1.200737752 -0.369470441 uc001dik.3 GIPC2 -0.845001207 -1.13454054 -0.4870572 1.064460669 uc001dip.4 IFI44 -0.182914791 -0.903277473 -0.768345737 1.577302527 uc001dlx.3 SH3GLB1 -0.295864683 -1.086257518 0.154601268 -0.246361266 uc001dmx.2 GBP1 -0.124671492 -0.117848721 0.482067193 2.051050875 uc001dmy.1 GBP2 0.043917638 -1.03545566 0.005455117 0.189376534 uc001dnb.3 GBP4 0.13341037 -0.135321657 0.41358036 1.854755408 uc001dpe.2 SNORD21 0.838955625 0.188795921 1.178609299 0.055751107 uc001dqd.1 MIG7 0.052280977 -1.145899761 0.359143467 0.406937777 uc001dqf.3 DNTTIP2 0.061095299 0.793958366 1.170180986 0.549819423 uc001drw.3 DPYD -0.726642096 -1.079874373 -0.087322873 -0.472054971 uc001dsv.3 TRMT13 0.245266883 1.762002804 0.708900374 -0.416183103 uc001duq.3 AMY2B -0.302333811 -0.063027836 -0.293148256 -1.012105243 uc001eaa.3 LRIF1 -0.271755758 1.012526851 0.146557405 0.153288283 uc001eae.4 DRAM2 -0.051336476 0.628024945 0.951530967 1.001472011 uc001ecy.3 SLC16A1 -0.01949797 0.660065531 1.98986848 1.440356907 uc001egg.3 ATP1A1OS 0.633196258 0.592473926 -1.652267215 -0.771433548

APPENDICES

uc001enn.4 TXNIP -0.436523698 1.243773009 -0.321082071 0.54207314 uc001eqi.1 AK023809 -0.228381061 0.462220728 3.739087398 0.928001087 uc001etd.3 HIST2H2AC -0.280700309 -1.204410474 -0.193385273 0.401422546 uc001ewn.3 C1orf56 0.746927657 0.558074387 -1.125964133 -0.518355853 uc001ezs.1 RPTN -0.003534102 0.694523627 -0.246473922 -1.123979066 uc001ezu.1 FLG 0.394318372 1.023946943 -0.457907976 -1.838977974 uc001fau.3 IVL -0.106622361 -0.983926869 0.088595856 -1.673886466 uc001fba.3 SPRR1B 0.14430687 1.141818281 0.272814045 -0.328157945 uc001fbr.1 S100A12 0.026079979 0.210265034 0.814374419 1.452724047 uc001fbs.3 S100A8 -0.03380148 0.475833923 0.030008837 1.092034154 uc001fbv.1 S100A7 0.584710424 1.497683789 0.453886674 2.47472478 uc001fgc.3 FLAD1 -0.651656232 -1.177875882 -0.225907946 0.190870793 uc001fho.3 KRTCAP2 0.264204438 0.430178902 1.455532164 1.327396843 uc001fkh.1 RUSC1-AS1 0.902285641 0.517437227 -1.472573867 -0.831798489 uc001fpy.4 HDGF -0.17748099 0.506482941 1.897398988 0.359502173 uc001ftj.1 AIM2 -0.412886504 -0.281173549 0.170781832 1.907029764 uc001gaf.4 MPZ -0.142542617 0.827932513 -0.524947756 1.3767966 uc001gdo.3 BC071770 -0.032697919 1.02408965 0.161018939 -0.266230439 uc001gii.1 PIGC -0.371668584 -1.616950736 0.191240846 -0.199883172 uc001gof.2 LOC100527964 -0.073868916 1.192668335 0.013258981 -0.92549668 uc001gqn.3 APOBEC4 -0.173204202 -1.722125274 0.300509043 0.645644513 uc001grf.4 TRMT1L -0.159404969 1.654529819 -0.71011223 0.198423326 uc001grq.1 HMCN1 -0.123412341 -1.163888229 -0.204105681 -1.434363185 uc001gsl.3 RGS2 -1.236668612 -0.57799997 -0.306208494 -0.741553973 uc001hhg.3 LAMB3 -0.436195431 -0.865773951 -0.247552849 1.026556739 uc001hhi.4 G0S2 -0.014446115 0.666462544 1.08451291 2.114676705 uc001hio.1 SLC30A1 -0.505356918 -1.019185485 -0.459931806 -0.404183785 uc001hjb.3 PPP2R5A 0.061690264 0.239096142 -1.314743916 -0.18618118 uc001hkm.3 CENPF 0.500344479 0.365625573 0.079757333 -1.651921761 uc001hll.3 TGFB2 -1.087774806 0.414528565 0.002477989 -0.696849092

APPENDICES

uc001hmx.2 DUSP10 -0.130924916 -1.096569016 -0.249256667 -1.127908219 uc001hnr.1 AK094916 0.851823332 0.347327706 -1.652427621 -0.79781271 uc001hvk.1 PCNXL2 0.443825166 1.191118889 -0.124147514 -0.471155793 uc001ihb.2 KLF6 0.028438572 -1.017007866 0.10222233 0.587919722 uc001ihf.4 LINC00704 -0.034112968 -0.948407356 -0.693549295 -1.046881905 uc001iie.1 CALML3 0.194742981 -0.679991216 -1.081006619 -1.264295252 uc001irl.4 PIP4K2A 0.48514965 1.263528378 0.352193523 0.629530805 uc001isi.4 THNSL1 -0.331904062 1.366760804 0.864311738 0.13980442 uc001ivi.2 MAP3K8 0.61538337 -1.689888794 0.794282667 0.534915297 uc001iyz.1 FZD8 1.152302903 -0.262807744 1.162456378 0.584111334 uc001jex.3 ZNF488 0.353354177 0.969279003 -0.196794741 -1.140218464 uc001kcu.3 C10orf99 0.110768025 -0.364015661 -0.144413873 -1.094675093 uc001kec.1 AL157440 0.337826692 -0.062195442 -2.248437185 -1.428705386 uc001ked.2 ADIRF 0.100895355 -0.658154087 -0.916497667 -1.232205885 uc001kee.2 AGAP11 0.875018633 -0.101618528 0.000492133 -1.135492905 uc001keh.3 GLUD1 0.281225989 -0.28461737 -1.08171479 -0.339927491 uc001kem.3 NUTM2A-AS1 -0.056770103 1.472915334 -0.006010031 -0.213572491 uc001khe.1 ANKRD1 -0.571302087 0.968917485 0.420749616 -1.426698088 uc001koi.2 AVPI1 -0.198821222 -1.198845608 -0.493494732 0.274623493 uc001kqu.1 SNORA12 1.122151404 -0.346999599 0.912291487 1.28575209 uc001krt.4 FAM178A -0.098549787 1.055035664 0.250565253 -0.131784941 uc001kyx.3 ADD3 -0.898246324 -1.600869684 -0.253334929 -0.174211751 uc001kzd.3 DUSP5 0.379455023 -1.989915317 0.247934966 0.437088891 uc001kzf.2 RBM20 0.683664084 2.204389468 -0.486538828 -0.356988075 uc001lat.2 PLEKHS1 -0.473460144 -0.794288247 -0.195569583 -1.310359379 uc001lcl.4 PNLIPRP3 -0.058354829 -0.441299699 -0.211855036 1.14906165 uc001lda.1 AK092331 -0.02407833 -0.326527096 -0.504203715 -1.691323753 uc001lgy.1 PSTK -0.55607583 -1.084609202 -0.523553952 -0.771587375 uc001lox.4 IFITM2 0.134180762 0.206926623 0.50153661 1.031357863 uc001loy.4 IFITM1 -0.101283291 -0.192904875 1.200432739 3.342907162

APPENDICES

uc001lpa.2 IFITM3 -0.036304711 -0.122022011 0.570025559 2.17748995 uc001lrs.1 SNORA52 1.19450796 0.67273173 1.087190412 1.691348328 uc001lta.3 MUC5B 0.909979311 0.728540696 1.802789775 -0.319627961 uc001lwe.3 BC019904 0.197055968 -0.034686485 -1.743910715 -1.151337362 uc001lxd.1 SNORA54 1.290484927 0.266822371 1.318908015 1.627946437 uc001lyy.1 TRIM21 -0.001313677 0.396209144 0.010130103 1.250643033 uc001mcu.1 PRKCDBP -0.173979818 -0.453330125 -1.136028301 -0.137639824 uc001med.3 RRP8 0.143643085 1.166759381 -0.120378408 0.072735736 uc001mfv.1 NLRP10 -0.300525325 0.180995355 -0.543656581 -1.823092909 uc001mhp.1 SNORA23 0.661363321 -0.158189131 1.080963708 0.858246216 uc001mif.3 SBF2 0.124047372 -1.690008601 -0.398915217 -0.771980979 uc001mil.1 ADM 1.473725592 -1.201041647 -0.019420553 0.573357468 uc001miq.3 MTRNR2L8 0.838433673 -0.425593358 2.719919563 0.767190972 uc001mnz.4 SAA2 -0.083824574 0.195384556 0.448303798 1.236238871 uc001msc.2 KIF18A 0.002473126 0.757751852 -0.486407052 -1.076191558 uc001muh.3 CSTF3 -0.238091978 1.045608655 0.217112756 -0.306414661 uc001mvk.3 NAT10 -0.204577213 1.289613805 0.548861142 0.413590334 uc001mvu.3 CD44 -0.348682359 -0.777064422 -0.157046399 -1.668487059 uc001mxr.1 AK094325 0.786699225 0.014039464 -1.316621735 -0.293864236 uc001nbo.3 SLC35C1 -0.476345248 -1.024631837 -0.418002467 -0.135531891 uc001nsu.3 FTH1 0.19502303 0.204228515 0.196609289 1.325544595 uc001ntj.3 SCGB1A1 -0.113917082 -0.228154415 -0.237167468 -1.076257832 uc001nxg.1 HRASLS2 0.087738057 -0.219360575 -0.162374363 2.696572097 uc001obf.3 SF1 -0.277924129 -1.342146358 -0.763261717 -0.15169792 uc001odl.3 CDC42EP2 -0.078447269 -0.304091479 0.333881255 1.024516687 uc001oiv.3 RBM4 -0.398366217 -1.051613775 -0.022301173 -0.235566177 uc001owj.1 SNORD15A 0.989394639 -0.290104507 1.121585073 1.690531187 uc001oxt.3 TSKU 0.177746453 -0.148181505 -0.157338497 1.03689864 uc001pep.2 HEPHL1 -0.216711581 -0.592896406 0.665037767 2.004478676 uc001pez.3 FUT4 -0.793331036 -1.003644667 -0.258038537 -0.489595726

APPENDICES

uc001pgf.3 TMEM133 0.072005672 -1.286193752 0.192054118 -0.34877904 uc001phi.2 MMP1 -0.57159403 0.497932897 2.146846838 1.827205998 uc001phl.3 MMP13 -0.464291347 -1.626421319 0.298840589 -0.423706078 uc001pkf.3 ATM -0.279380481 1.300521413 0.971863866 -0.239592983 uc001plg.4 POU2AF1 -0.286899335 -1.055990289 0.212480988 0.222536297 uc001pso.3 MPZL2 -0.428674849 -1.29168746 -0.088054 -0.288733733 uc001pwf.3 MCAM -0.186989032 -0.460056778 -0.633327727 -1.388755433 uc001pxx.3 SORL1 -0.105783915 -0.493694599 0.103931719 -1.035113712 uc001qak.4 TBRG1 -0.44820682 -0.335087126 -1.228030797 -0.809788656 uc001qby.2 FEZ1 -0.263953294 0.019751494 0.868103171 1.212267716 uc001qda.3 BC043578 -0.369562758 -1.010572449 -0.483149424 0.03441929 uc001qnw.3 SCNN1A 0.287427087 -0.040993716 1.282275818 0.467938472 uc001qpr.1 SCARNA11 1.37109604 0.223561997 1.050417199 1.306076091 uc001qtw.1 BC039122 1.148551138 0.88898701 -0.136762366 0.235893089 uc001qwn.3 CLEC2B 0.219135101 -1.156842707 -0.188018014 -0.174342958 uc001rcb.3 BC067269 -0.2011861 1.29137546 0.661506027 0.315712706 uc001rco.3 ERP27 0.094520991 -0.925237966 -0.249280296 -1.299582647 uc001rfh.3 ABCC9 -0.33950533 -0.634389504 -0.351514812 -1.491033965 uc001rgr.3 KRAS -0.307945528 -1.296485398 -0.123153083 -0.769699624 uc001rhk.4 ASUN -0.602520168 1.160235287 0.350206832 0.134806155 uc001rhx.3 BC043511 0.994892822 0.346692008 -3.159150842 -1.085315122 uc001riu.1 AX746523 0.030846172 -0.393934814 -0.214963562 -1.188643649 uc001rmx.2 YAF2 -0.473118592 -1.011019837 0.18014034 -0.386223372 uc001roz.3 SCAF11 -0.633291395 -1.07874904 0.063569839 -1.033831121 uc001rsa.2 SNORA34 1.179472345 0.234855721 1.518736924 1.173545921 uc001rsn.3 RND1 -0.111074033 -0.346082034 1.422484735 2.027302217 uc001rta.4 KMT2D 0.484203344 1.00507737 0.750894204 -0.457541756 uc001rwi.4 LIMA1 -0.602145637 1.003128911 1.541994596 -0.214122697 uc001sak.3 KRT6B 0.460763349 0.75658175 -0.362674929 1.089079881 uc001sal.4 KRT6C 0.648131652 0.609257728 -0.806542873 -1.27210531

100

APPENDICES

uc001sdx.3 LOC100652999 0.484715406 0.918585433 -0.997734438 -1.492316303 uc001sfo.3 HNRNPA1 -0.070604241 -1.016651572 -0.046962891 -0.581114164 uc001shq.3 GDF11 0.59646385 1.101421889 0.40416195 0.215158605 uc001sla.3 IL23A 0.151354961 -0.95110802 1.614203112 2.557980845 uc001spy.3 mar-09 0.669619722 1.005230657 0.397193425 -0.003485137 uc001swq.3 THAP2 0.170914706 2.531236973 0.533411546 0.252240516 uc001sxu.3 PHLDA1 -0.37757525 -1.426028058 0.259926839 -0.154949368 uc001sym.4 E2F7 0.634810392 -1.061745058 -0.15959917 -0.872945922 uc001sze.2 PTPRQ -0.392707522 -1.084428508 -0.324220116 -1.341132201 uc001tay.3 DUSP6 -0.121464299 -1.157743458 0.470509855 0.114588425 uc001tfs.3 SLC25A3 -0.448226787 -1.230592051 -0.418433289 -0.156327357 uc001tfu.1 SNORA53 0.56425269 -0.574725645 0.373908855 1.265410574 uc001tlo.1 TCP11L2 1.240849017 -0.409348879 0.262722114 0.63505102 uc001tsa.2 CUX2 -0.268648038 -0.988612106 -0.037698637 -1.339362833 uc001tsl.1 ATXN2 0.189968196 1.285739787 -0.353763739 -0.777655835 uc001ttk.1 ERP29 0.134583441 0.706136114 0.707165059 1.249110439 uc001tub.3 OAS1 0.042567382 0.460662052 0.723181727 3.270012487 uc001tud.3 OAS1 -0.053690977 0.315560949 0.443375428 3.310591524 uc001tug.3 OAS3 -0.19213756 0.04956116 0.782963563 3.518956036 uc001tuh.3 OAS2 -0.218316165 -0.560794854 0.09620109 2.488180645 uc001tui.1 OAS2 -0.236954391 0.403132284 0.916767339 3.680947905 uc001tuj.3 OAS2 -0.073712288 0.153902433 0.330344415 3.578675832 uc001tuu.3 IQCD 0.106766006 -0.001688136 0.545293695 1.909467701 uc001twu.1 PEBP1 -0.132554195 0.665796666 -1.09505213 0.155745492 uc001uae.3 ANAPC5 -0.55536013 1.370210841 0.221944079 -0.535905043 uc001ubb.3 RHOF -0.132966396 -0.132051201 0.556433029 2.076821105 uc001ucn.3 ZCCHC8 -0.12730601 1.063988677 -0.129683367 0.03361128 uc001ucx.1 HCAR2 0.121850177 -1.269509033 -0.421744912 -0.025145748 uc001ucy.4 HCAR3 0.667910141 -1.309821392 0.198455008 0.318091106 uc001ujo.3 SNORA49 0.404640424 -0.011523378 1.142677187 1.226864335

101

APPENDICES

uc001urb.2 SNORD102 0.396818972 -1.025423529 0.23359199 -0.092918577 uc001uta.1 HMGB1 -0.940629775 -1.006597466 -0.144948096 0.034567939 uc001uti.3 TEX26 0.339928344 0.003450669 0.890992173 1.514742407 uc001uuw.3 STARD13 -0.734790242 -1.207650631 0.24288376 0.10964577 uc001uxs.3 ELF1 -0.239067101 1.219817415 -0.023676266 -0.225868406 uc001uxu.1 KBTBD6 -0.446811952 1.124429888 0.205250563 0.096781614 uc001uyi.2 RGCC 0.076516881 -1.890508168 -0.889158228 0.160284676 uc001uzg.3 LINC00284 -0.230575127 -1.857487583 0.87424818 -0.049718059 uc001vfi.3 INTS6 0.314904057 0.890342459 0.274655532 -1.003065003 uc001vku.1 RNF219-AS1 1.879122252 1.750593671 -1.045051981 -0.09413577 uc001voi.1 AK123584 0.262674991 1.071818572 0.365645369 0.564797449 uc001vpx.1 METTL21EP 0.195476829 1.011204679 0.381352951 -1.027857134 uc001vqv.3 IRS2 0.861334553 -1.432683459 0.291978496 -0.310158578 uc001wau.1 SNORD8 0.256698226 0.530948937 1.587238061 0.972194393 uc001wrf.4 HEATR5A -0.073194426 1.603134165 0.338782412 -0.122937734 uc001wsa.4 EGLN3 1.705134994 0.374333233 0.320217956 -0.771553057 uc001wtz.2 SLC25A21 0.613902176 1.46347905 -0.60283665 -0.599257449 uc001wxa.3 NEMF -0.344018958 -1.446287771 -0.158079438 -1.060935608 uc001wzg.3 FRMD6 0.170036824 -1.197625099 -0.291305988 -0.329223269 uc001wzr.3 PTGER2 -0.691246226 -1.312412311 -0.804843055 -0.490371428 uc001wzy.3 PSMC6 0.149674048 -1.226269724 0.293110383 -0.009463038 uc001xbz.2 KTN1-AS1 -0.515131006 1.383893571 -0.03192721 0.093284233 uc001xch.3 PELI2 0.080944645 -1.07004267 0.149248511 0.982900276 uc001xdn.2 FLJ31306 -0.189338838 -1.211670196 -0.425038282 -0.161731758 uc001xes.3 DHRS7 -0.119735039 0.673423962 -0.437247343 1.068685914 uc001xfc.3 SIX4 -0.102180293 1.014914489 0.251637662 0.035416278 uc001xkf.2 RAD51B -0.145326051 -2.582039984 -0.614847381 -0.856059968 uc001xqj.4 YLPM1 0.646318197 1.004601646 1.418950267 -0.834858819 uc001xzt.4 TC2N 0.691946006 0.495082148 1.310537702 1.617463372 uc001yff.4 C14orf132 -0.059722855 -0.629211481 -0.91497466 -1.327488806

102

APPENDICES

uc001yxr.3 SNORD116-8 1.087478942 0.738064585 0.549721282 -0.018209064 uc001yyk.3 SNORD116-25 0.793561807 1.260018477 0.096659044 -0.581575407 uc001zan.1 SNURF-SNRPN 1.496495928 1.857518738 -1.889912629 -1.115090096 uc001zcq.3 TJP1 -0.106193541 -1.312341781 -0.009793578 -0.40787929 uc001zhq.3 EMC4 0.002598813 0.550888739 0.714602295 1.329097545 uc001zix.1 BC069776 1.611398215 1.738079566 -0.705101607 -0.547894482 uc001ziy.3 ANP32AP1 0.183940188 -0.200435246 1.282532812 0.592660665 uc001zqm.3 BC037861 0.551795932 1.495531413 -2.144400443 -0.438631553 uc001zst.3 CATSPER2P1 0.403963259 0.435275285 -1.904776005 -1.305435259 uc001zuc.3 B2M 0.007164906 0.04444283 -0.140927678 1.036471191 uc001zue.3 TRIM69 -0.105434512 0.653399673 0.204033703 1.723239838 uc001zyo.1 AX746640 0.804416362 0.702303096 -2.152040452 -0.909971353 uc002afr.1 SLTM -1.000964916 -0.794721348 -0.727441641 -0.350496213 uc002afz.3 CCNB2 0.206060528 0.329208277 -0.40127284 -1.316929864 uc002agd.3 GCNT3 0.236738513 -0.809389054 1.248084559 1.349144231 uc002agn.3 ANXA2 0.075347768 -0.618969132 -0.333419676 -1.000903711 uc002ahf.4 C2CD4A 0.240927796 -2.085413847 0.425055548 -0.4165596 uc002alb.4 TLN2 -0.079860712 -1.124620204 0.131353704 -0.335762703 uc002aly.3 RPS27L 0.064093469 0.627419276 1.383260401 1.810888172 uc002aon.2 CILP 0.023248878 -0.304617262 -0.929686951 -2.140159762 uc002aug.3 BC034424 0.650203492 0.00746493 -2.087269246 -0.889175118 uc002aww.1 PML 0.003626146 -1.293836262 0.230372199 0.554249325 uc002bbj.2 FBXO22 -0.436329952 -0.202347655 0.193561317 -1.073620287 uc002bbm.1 FBXO22-AS1 0.682207474 0.936129856 -1.114954485 -1.372983106 uc002bfz.3 MESDC1 0.164156487 -1.026804611 -0.242998734 0.105453393 uc002bjz.4 ADAMTSL3 0.129196926 -0.398951813 0.121598125 -1.083036979 uc002bkm.2 GOLGA6L5 -0.381574873 -1.091805314 -0.212006419 -0.697139388 uc002bqx.2 SLCO3A1 -0.224527171 -0.148764822 0.034702497 -1.416596097 uc002bsl.4 FAM174B 0.32859169 -1.019745022 0.241155082 1.010219846 uc002bwn.4 ALDH1A3 0.325631038 0.974406215 -0.344813218 1.302028752

103

APPENDICES

uc002bwo.1 AK126286 1.389391646 1.480801046 -2.084650929 -0.306692319 uc002bwp.3 BC073817 1.060069643 1.568593879 -2.013908236 0.097185026 uc002bww.3 SNRPA1 0.146725981 -1.05481376 -0.339442734 -0.203882602 uc002cnp.1 SNORA10 1.340307389 -0.087330383 1.340498476 1.804652318 uc002cru.3 ZG16B -0.154830255 -0.165968938 0.389829174 1.263185214 uc002cur.2 ZNF263 -0.293724027 -1.548183274 -0.599523321 -0.080332213 uc002cvp.2 SLX4 0.433829363 1.332863714 -0.052618588 -0.039482962 uc002cvr.3 DNASE1 0.792769458 1.401651946 0.541541804 0.500176905 uc002cvu.3 BC095475 0.354562589 1.513826087 -0.119324284 -0.529651682 uc002dlm.1 SCNN1G 0.347560771 -1.23456255 -0.435818388 -0.64449242 uc002dmb.1 CHP2 0.111894858 -0.586446977 -0.244458979 -1.087666607 uc002drm.3 SH2B1 0.561679807 1.371798796 0.084211087 -0.354610705 uc002duc.1 AK097472 0.355384614 0.727201494 -1.268222376 -1.08553631 uc002dve.3 HIRIP3 0.192002421 1.378238935 1.099167826 -0.010471294 uc002dyv.2 ZNF785 0.069295209 1.210653668 0.100181135 0.134870322 uc002dzd.4 FBRS 0.54371126 0.249438971 1.215746623 0.648439267 uc002eid.1 CAPNS2 -0.010032995 -1.111623746 -0.061412168 -0.380280799 uc002ejh.3 MT2A -0.312011792 0.651918489 0.871832802 1.358497076 uc002eua.1 AX747090 0.690702217 1.12672244 0.004697297 0.489209699 uc002ewk.3 HAS3 1.189555229 0.402654686 -1.65476648 -0.708231327 uc002eyi.1 AK096066 0.950885798 0.910194179 -1.864563011 -0.641513626 uc002eyl.1 LOC100506060 0.47399772 1.106473503 1.396893531 0.852946323 uc002eyn.1 AARS 0.130007058 0.660800924 0.841468904 1.053928704 uc002fgv.3 HSD17B2 0.045875124 0.021892968 0.080197807 1.356587537 uc002fkm.3 SLC7A5 0.4219687 0.984037244 1.149726391 0.545867417 uc002ftf.3 MIR22HG -0.205654624 -1.07069774 0.176808311 0.682043603 uc002fur.3 MNT 0.475340301 -1.62668848 0.786493114 -0.181888096 uc002fwd.3 P2RX5-TAX1BP3 0.637277635 1.134069435 -2.663711673 -1.393211365 uc002gbn.3 Nup88 1.176669449 1.380221595 -1.863415403 -0.808833086 uc002gdm.1 XAF1 -0.225955386 1.28027295 1.079243321 2.542937533

104

APPENDICES

uc002ghm.3 SENP3 0.007142285 0.82747425 -1.068975489 0.47652067 uc002ght.3 SNORD10 0.759011868 -0.162136242 0.38408955 1.230632066 uc002ghz.1 SOX15 0.046942223 1.716078508 1.341535424 1.506047427 uc002gyw.4 C17orf51 -0.352304014 1.112973671 0.461427003 -0.077180672 uc002gyy.3 UBBP4 1.650809535 -0.245059458 -0.134404299 0.3645736 uc002gzb.2 MTRNR2L1 1.120992754 0.157967852 3.055625686 0.555884202 uc002gzo.1 AK095721 0.165923055 -0.283036912 0.019556246 -1.178943886 uc002hcj.1 SNORD42B 1.1304768 0.219199574 1.579738731 1.27980554 uc002hkf.3 CCL5 0.055048023 -0.976823776 1.733947153 4.711454457 uc002hqp.1 PCGF2 0.778497508 1.196152969 0.517825945 0.322962614 uc002hub.3 MSL1 0.405838853 0.146861253 -1.017758824 -0.661877344 uc002huq.3 TOP2A 0.577081035 0.617995185 0.096445898 -1.816945389 uc002hvi.3 KRT10 0.492555124 0.130437977 0.311806833 -1.803732097 uc002hxb.1 KRT15 -0.098518462 0.233128159 -0.364172492 -1.176891985 uc002hxf.2 KRT14 0.280550983 0.691035164 -0.670716976 -1.955828216 uc002hxg.4 KRT16 0.214170979 0.637318768 -0.304809402 -1.104947248 uc002hyj.4 TTC25 -0.103003385 0.025355618 0.601383662 1.372301301 uc002idi.1 AK093551 0.123695415 1.004705895 0.392761585 -0.984083439 uc002ioz.4 NGFR 0.293494636 -0.665116222 0.290108617 -1.374597868 uc002ivh.1 AK126318 -0.484656374 -0.416927855 -0.451262084 -1.28103863 uc002iyr.1 L32131 1.17982492 0.150686558 1.147583686 0.456522273 uc002jfz.3 PSMD12 0.219710387 -1.044075721 0.596500969 -0.101873975 uc002jij.3 MAP2K6 -0.047202599 -1.263071501 0.139779653 -1.200897046 uc002jiz.2 LINC00673 -0.123635418 -1.402518811 0.243804785 0.524930954 uc002jof.1 TSEN54 -0.155883729 1.049971344 -0.432176626 0.146630027 uc002jow.2 SMIM5 -0.354446421 -1.246770701 -0.693324235 0.26585262 uc002jpl.3 H3F3B -0.003661524 -1.151722792 -0.307446822 0.456634999 uc002jrt.3 AX747521 1.626593817 0.839257523 1.004705733 0.595336475 uc002jvl.2 SOCS3 -0.057232292 0.208455815 0.373649969 1.14030715 uc002jyg.1 RNF213 0.722968727 1.63665309 0.712195032 0.674554193

105

APPENDICES

uc002kdu.3 FASN 0.418585107 0.568867808 -0.046694791 -1.076648924 uc002ked.3 SLC16A3 1.277776474 1.51305793 0.178145546 0.304192137 uc002keo.3 SECTM1 0.3278941 0.323609884 -0.195532443 1.327862605 uc002kls.3 MYL12A 0.030741358 -1.154727626 -0.121404268 0.142068696 uc002klt.4 MYL12B -0.180943714 0.569611725 1.581970557 1.495617699 uc002kmi.3 BC094703 -0.256131825 -1.443702594 0.362937247 0.764134437 uc002kqe.3 CHMP1B 0.059120021 -1.249096363 -0.039671378 0.320730587 uc002kst.2 ZNF519 -0.432406507 0.442826104 -0.684715644 -1.037912589 uc002kvy.3 KCTD1 0.675376421 1.199440733 -0.080598597 -0.185280952 uc002kwv.4 LOC100652770 1.159455925 0.114539964 -1.272790329 -1.173581058 uc002lds.1 SNORD58A 1.267160863 0.250763416 1.047372729 0.814371311 uc002lee.2 CCDC11 -0.317193782 0.207880395 1.103600717 0.254250612 uc002lfi.1 SNORA37 1.15893255 0.038664612 0.760119191 1.526470054 uc002lgv.1 LOC100505549 1.597819113 0.990022969 0.170376738 0.119420598 uc002ljf.3 SERPINB4 0.141525983 1.28330585 1.862616762 1.021250563 uc002lke.1 DSEL -0.11904958 -0.279462535 -0.074533787 -1.174608899 uc002llm.2 CNDP2 0.178402347 1.106278453 1.478692255 0.855145832 uc002lny.3 PARD6G 0.314367399 -0.209861389 -0.586643008 -1.034610497 uc002lou.3 TPGS1 -0.625617467 -1.292461452 -1.175587992 0.080607459 uc002lsc.1 MUM1 0.132220677 1.144405253 -0.468757975 -0.497409273 uc002lzv.4 CCDC94 -0.120791575 -1.171016543 0.259885355 0.472447579 uc002mbg.1 AK126532 0.090337053 0.199441686 -2.119287714 -0.763585964 uc002mjn.3 RPS28 -0.056785392 -0.373231206 -1.033082258 -0.455998995 uc002mnq.2 ICAM1 0.024960574 -0.549146874 0.488948621 1.064847621 uc002mtp.3 ZNF563 0.508993607 1.101126932 -0.563769324 -0.250917402 uc002mut.1 SNORD41 1.722779106 -0.313147852 0.846374313 1.373138467 uc002mxc.1 CCDC130 0.087901466 1.060527723 0.127488639 0.345194947 uc002nar.3 BRD4 0.991049128 0.960919942 1.088054678 -0.204172681 uc002ngl.3 BST2 0.010283705 -0.095998243 0.380317186 3.448342187 uc002nhq.1 SNORA68 0.838435686 0.130418584 1.098627155 2.118301843

106

APPENDICES

uc002niv.2 GDF15 1.354215918 -1.232875055 0.124728896 1.653710011 uc002nvm.3 WTIP 0.451205369 1.330463921 -0.215175188 -0.047923153 uc002nvo.1 AX748165 -0.059359154 -1.408557338 0.452654179 0.410683033 uc002oag.3 LOC100506469 0.35853569 0.351578869 -1.524841271 -0.681975231 uc002ohr.2 SPINT2 0.624020271 0.483051965 0.621825205 1.126842536 uc002okq.1 NCCRP1 0.28213478 0.617713849 0.495619995 1.335859935 uc002omw.4 ZNF780A -0.259921601 1.142769486 -0.061977064 -0.14651864 uc002onw.2 BLVRB 0.215395732 -0.029913333 -0.189424919 1.012467087 uc002oqj.2 B9D2 -0.135616167 -1.003294135 -0.453928583 0.22533466 uc002ori.1 CEACAM7 -0.36698502 -0.504978526 -0.157959276 1.526655878 uc002owq.3 ZNF575 0.48037701 -0.045609045 -2.349688985 -1.382269844 uc002oxd.2 PLAUR 0.062035506 0.415896197 0.256083352 1.17869257 uc002oyi.3 LOC100379224 0.921210846 1.717343775 -0.164355986 -0.568883668 uc002ozv.3 PVRL2 0.492544214 -0.049580312 0.91774218 1.025846142 uc002pbm.3 PPP1R13L 0.618493482 1.359800713 0.224704483 -0.3069843 uc002pdj.1 DMWD 0.403698941 1.050946914 0.640776281 0.013949503 uc002pdt.3 MYPOP 1.040950528 1.660938631 0.240838471 -0.317604637 uc002pfs.3 SLC1A5 0.119179734 0.257167265 0.378828919 1.319799485 uc002pfz.3 TMEM160 0.006472558 -0.407749511 -1.460847919 -0.095266468 uc002phj.4 EHD2 0.378148092 0.836387484 -0.067735565 -1.020883181 uc002pjz.1 CA11 0.252829575 -0.009292622 0.772857665 1.046814497 uc002pky.4 PPP1R15A 0.822048124 -1.250470137 0.380621106 0.504157323 uc002poq.3 SCAF1 0.776218791 1.06873297 0.51088598 -0.04567522 uc002pzi.3 ZNF528 0.526591039 0.849315873 1.926884658 0.535164603 uc002pzq.2 ZNF808 0.398509034 1.104343611 0.683281652 -0.212102779 uc002qfv.1 LENG8 0.270138283 0.173222182 -0.09583582 -1.099349213 uc002qfz.1 CDC42EP5 0.048228922 -0.066102417 0.178636674 1.430635632 uc002qku.3 TMEM238 0.715189326 -0.168462364 0.883776919 1.047573463 uc002qog.2 ZNF460 -0.513636301 1.092187271 -1.084766458 -0.548237368 uc002qxj.2 TSSC1 0.059436616 0.110008626 -0.599657754 1.296927979

107

APPENDICES

uc002qyd.1 BC113076 1.014434794 -0.251933796 0.936068729 1.215446423 uc002qyp.1 RSAD2 -0.083904795 0.750897825 1.675122513 5.999839941 uc002qza.3 ID2 -0.304007359 1.318488289 0.179578617 -0.386685801 uc002rac.3 BC051708 0.856944141 0.469360085 -1.625870918 -1.258978816 uc002rcs.1 AX748233 -0.539334801 -1.019807158 -0.635875738 -1.015409724 uc002rdg.3 TTC32 -0.245925425 -1.254087504 -0.315473429 0.360608324 uc002rdv.3 RHOB -0.693414242 -1.498316472 -0.371876984 0.277393143 uc002rec.3 C2orf43 -0.476807326 -1.067248198 -0.834793161 0.602901415 uc002red.3 APOB -0.193750459 -0.664353189 -1.321317775 -1.056594152 uc002rew.3 FAM228B 0.600273308 0.189162277 -1.889102483 -0.859817472 uc002rkn.1 FTH1P3 0.814681392 0.527873817 0.629833897 1.381284729 uc002rno.3 CAPN13 -1.378202374 -1.262471299 -0.252368068 -0.046928007 uc002rqf.1 PRKD3 -0.039433634 -1.59466557 -0.238448943 -0.750147086 uc002ruw.3 EPAS1 0.35867632 0.208560008 0.384829511 -1.117170411 uc002rzt.3 VRK2 -0.206893107 -1.700849186 0.033864139 0.482933572 uc002sbk.3 XPO1 -0.326633065 -1.192373738 -0.072161745 0.254119362 uc002scl.3 UGP2 0.196062041 0.54322304 1.637755507 0.282654232 uc002sco.3 VPS54 -0.25391924 -1.067674986 0.104144158 -0.336403691 uc002scr.4 PELI1 -1.210375735 -0.934339516 0.223753587 0.30437838 uc002scu.1 AK026714 -0.367750083 -1.229767897 0.024562672 -0.731539423 uc002seo.3 FBXO48 0.270267275 1.427924415 -0.02201354 -0.225443076 uc002shr.3 NAGK -0.081970915 0.033246346 1.030139422 -0.188687037 uc002sro.3 BC066991 0.641869945 0.089597904 -1.326119938 -1.214090818 uc002sxq.2 ANKRD36 -0.413061592 -1.116056973 -0.044740982 -1.323937694 uc002tay.1 SNORD89 1.216006971 0.370189756 1.912134291 1.560197081 uc002tfb.3 SOWAHC -0.203519408 -1.307234373 -0.038227553 -0.220661867 uc002thr.1 ZC3H6 0.108612938 1.142989256 -0.015206762 -0.614388874 uc002tib.3 SLC20A1 -0.116215525 -1.792956518 -0.165816842 -0.231335063 uc002tic.1 SLC20A1 -0.272728567 -2.095891712 -0.082085123 -0.173948777 uc002tig.3 IL1A 0.432410169 -1.800289418 1.388497407 1.366132116

108

APPENDICES

uc002ttp.3 NCKAP5 -0.641649349 -0.207099653 0.768203937 -1.551893899 uc002txi.2 NMI -0.289305505 -0.094752532 0.570253189 1.333728624 uc002txx.1 ARL5A 0.224353491 0.818332633 0.337241408 1.105032494 uc002tyj.2 PRPF40A -0.39141569 -1.306617144 -1.056979701 0.535286482 uc002uae.1 PKP4 0.179824807 1.236936111 0.41755233 0.084581762 uc002uaf.3 DAPL1 -0.292056636 -0.903762802 -0.463582297 -1.065663966 uc002uep.3 DHRS9 -0.159576217 -1.137099315 0.057652431 0.250987911 uc002ufc.1 PPIG 0.390715147 1.189305606 1.030948243 0.757155913 uc002uhx.3 ZAK -0.120513837 -1.180866629 -0.068505394 0.133062026 uc002upt.3 FAM171B -0.51775298 -1.110394617 -1.203500719 -0.802296246 uc002utb.3 SDPR -0.203963729 -1.601359197 -0.190177043 0.527614655 uc002utn.1 BC062769 -0.781328389 -1.083953758 -0.431964691 -1.727703219 uc002uwg.2 CLK1 0.105606609 1.0249986 0.064429197 0.141663835 uc002uwp.2 NIF3L1 -0.292107377 0.358407815 1.136676826 0.751642381 uc002uxe.2 CFLAR 0.287659463 -0.774738648 1.226584954 1.908095675 uc002uyr.3 ALS2 -0.334245806 -1.493997574 -0.064771595 0.25737637 uc002uyw.1 FZD7 0.043039941 -0.730738954 0.280903881 -1.07650955 uc002vbb.3 BC047484 -0.159566443 -1.033945175 -0.724438058 0.111294372 uc002vbj.3 SNORA41 1.024177304 0.266934692 1.140210183 1.707989034 uc002vce.3 METTL21A 0.287017653 1.144067921 -0.196797809 0.060489782 uc002vcu.3 IDH1 -0.127612581 0.432635795 0.002682262 1.601425709 uc002vga.1 AX747067 -0.125475159 0.530955153 0.351465829 -1.028824021 uc002vgj.4 IGFBP5 0.006821906 -0.377556984 0.786566937 -1.059133975 uc002vhf.3 ARPC2 -0.132483413 -1.071147744 0.099337275 -0.424814349 uc002viz.4 CYP27A1 0.413969382 -0.043625711 -0.194723713 1.047881689 uc002vml.3 STK11IP 0.035197242 -0.771691308 -1.211378661 -0.559959837 uc002vqt.3 SP100 -0.087824299 0.408186552 0.39227446 1.141196677 uc002vxg.3 LRRFIP1 -0.067029651 -1.858193487 -0.486170628 -0.632814683 uc002vxi.4 RBM44 0.033632176 -1.713975468 -0.331779109 -0.783791656 uc002vyw.4 GPC1 0.492159103 0.307105164 -0.495987475 -1.015013087

109

APPENDICES

uc002vyy.1 PP14571 -0.358956951 -1.087284293 -0.498217846 -0.421524457 uc002wqf.1 SNORD17 0.849752707 -0.527037589 0.648843761 1.327281896 uc002wyo.1 BPIFA2 0.247987806 -0.551216727 0.90048596 1.08322745 uc002wyt.4 BPIFA1 -0.097862814 -1.607069485 0.487451719 0.152436013 uc002xgh.2 SAMHD1 0.277823892 0.160675543 0.031096536 1.259571664 uc002xim.1 SNORA71A 0.095895529 0.499528687 1.448649982 0.706333147 uc002xio.1 SNORA71D 1.075008886 0.293664185 1.173019581 0.647486638 uc002xji.3 MAFB -0.54804141 0.506739328 -0.46672596 -1.506718055 uc002xjn.1 BC035080 0.772030642 0.062615729 -1.492994687 -0.893738361 uc002xmr.3 KCNK15 -0.801331457 -1.188973329 0.076657064 0.772424869 uc002xng.3 PI3 0.146590037 0.13459539 0.789081591 1.458443161 uc002xqz.3 MMP9 0.1644559 -0.151955683 0.637189667 1.673059798 uc002xvp.1 BCAS4 1.639262106 1.195697409 0.050140186 0.490077046 uc002xwo.3 TSHZ2 0.354216892 -0.280718924 1.288488732 1.261057939 uc002xyw.3 PPP4R1L 0.229777067 -0.106845594 1.273166564 -0.166359337 uc002yal.3 ATP5E -0.312624437 1.037249678 1.82861758 0.691994587 uc002yay.3 PHACTR3 0.059431519 -1.613503208 -0.880853774 -0.640402383 uc002ybj.1 C20orf197 -0.408025053 -0.745208398 -0.375730482 -1.056322577 uc002yff.3 PPDPF 0.314044331 0.741873566 1.334876101 0.207134314 uc002ynu.2 CLDN8 -0.241828645 -1.003896874 -0.669848778 -0.335249587 uc002ypk.3 MRAP 0.823641978 1.429700282 0.411259901 -2.126616644 uc002yun.1 RUNX1 0.389563204 -0.246657796 0.335285335 -1.44035197 uc002yut.1 RUNX1 -0.054050145 -1.234297264 -0.223580447 -0.565789154 uc002yve.3 CBR3 0.234526343 -0.385373144 -1.157000292 -0.035228433 uc002zcy.1 U2AF1 -0.176843503 -1.495065217 -0.022009239 -0.131965661 uc002zdc.1 U2AF1 0.340801655 -0.249988778 0.361619464 -1.102900243 uc002zdf.2 SIK1 0.212936366 -1.398366283 0.204772356 -0.202389683 uc002zny.3 USP18 0.33808375 -0.224281655 0.35012883 2.942839353 uc002zys.2 LOC284889 0.684496322 0.171275975 -2.925693436 -1.735343509 uc002zyy.4 DDTL 0.358884041 0.803562911 -1.87200885 -0.668053092

110

APPENDICES

uc003adp.4 TTC28 -0.096380223 -1.247773582 0.178872834 -0.503639237 uc003amv.3 FBXO7 0.183267941 -1.360892715 -0.18784161 -0.101117732 uc003ant.2 HMOX1 0.366516045 -1.371960228 -0.335688934 0.950543036 uc003apb.1 AX747758 0.769617182 1.026978921 0.813343093 0.064961421 uc003aqz.1 C1QTNF6 0.422720749 1.210329405 -0.064311079 -0.651115624 uc003aty.3 H1F0 0.215085028 -0.374896261 0.577585764 1.88320271 uc003aww.3 APOBEC3F 0.508126908 0.884013453 1.467580864 0.109632702 uc003axn.1 SNORD43 -1.098536719 -1.226585934 -0.799054998 -0.6573057 uc003azk.3 RBX1 -0.09377271 0.380552667 -0.174741444 1.053887543 uc003azp.1 AK057177 0.052311006 -0.546555751 0.470614187 1.443012214 uc003bcq.3 RRP7A 0.290315856 0.477225709 0.623715784 1.009449752 uc003bhx.3 GRAMD4 -0.21872125 1.129956347 0.178044742 0.198088436 uc003boy.1 AK126307 0.571228946 -1.215681204 0.258405978 -0.664161472 uc003brl.3 BC041457 0.040343464 -0.375829183 0.533617649 1.544974018 uc003brw.1 SETD5 -0.311516338 -0.317109149 -0.771484545 1.380722955 uc003bve.1 IRAK2 0.024778081 -0.579279061 0.918580261 1.09065766 uc003bxl.3 RPL32 0.50598859 0.484835878 0.972011873 1.457773513 uc003cfo.1 SUSD5 -0.367596926 1.230917389 -0.585440424 -0.791071326 uc003cjs.1 SNORA6 1.124466971 0.441872223 0.911226433 0.66269019 uc003cke.4 ENTPD3-AS1 0.257735537 -0.053156364 -1.160042584 -0.400856733 uc003clm.1 NKTR -0.422871025 -1.186818275 -0.342357162 -0.012641639 uc003cls.3 NKTR -0.498958372 0.052613062 1.108831305 0.444088251 uc003cmy.1 DQ592230 -0.310569568 0.648933399 -0.725342416 -1.265427412 uc003cor.3 LIMD1-AS1 0.531006918 0.736737244 -2.458228903 -1.213360741 uc003cst.2 PLXNB1 -0.117586947 1.151457199 -0.194935586 -0.409151793 uc003ctz.2 COL7A1 -0.331912829 -0.500854453 -0.237300803 -1.026563552 uc003cxz.3 MON1A 0.218593099 1.425154837 0.024310417 -0.439481382 uc003dhd.3 ACTR8 0.459505899 1.33253745 0.594116736 0.453939939 uc003dnw.2 FRMD4B 0.848453481 1.013204921 -0.052327349 0.277978474 uc003dua.1 TMEM45A -0.257615647 0.139224193 0.386156886 1.015794681

111

APPENDICES

uc003duy.1 FAM172BP -0.271740318 -1.318444449 -0.351513382 0.459820103 uc003dxb.4 KIAA1524 -0.296866869 -0.318590815 -0.528464123 -1.084996426 uc003dye.4 PHLDB2 -0.25024965 -1.066694423 -0.562428459 -0.34693475 uc003ebh.2 MIR568 -0.619546365 -1.229026112 0.393148629 -0.198745565 uc003efj.2 PARP9 0.268185455 -0.395380933 0.295485005 1.831478267 uc003efq.4 PARP14 0.140001917 0.445306016 0.390801373 1.366768551 uc003efs.1 PARP14 -0.001027457 -0.400240604 0.278917155 1.15110385 uc003ekf.3 RUVBL1 0.680721841 -0.040389066 -1.851180737 -0.794553971 uc003evn.3 SLC9A9 -0.15709694 -1.034728618 0.019332534 0.164588168 uc003evq.1 PLOD2 1.285391736 0.42636632 0.622849105 0.148864266 uc003ewa.2 PLSCR1 0.102489115 -0.308927342 -0.45977246 1.050013172 uc003eww.4 CP 0.052065046 1.275943036 1.550660577 -0.349731631 uc003exw.3 TSC22D2 0.278115116 -1.004789413 0.156618942 -0.639880141 uc003faw.3 TIPARP 0.685083338 -1.443388494 0.348729175 1.251874527 uc003fbe.3 CCNL1 0.135452177 -1.365787994 0.157392543 0.238014942 uc003fbi.1 CCNL1 0.019510216 -1.464682534 -0.368082648 0.082043446 uc003fcl.2 MFSD1 0.018900056 0.327168755 0.779026144 1.417467011 uc003fdq.3 ARL14 -0.409908903 -1.275986982 0.095638159 0.160315634 uc003fif.1 AK127557 0.685872716 1.852066222 1.097050877 -0.2221291 uc003fiz.1 AK056252 -0.529266231 -1.016635052 1.243666888 2.113005238 uc003fkh.3 USP13 -0.116350256 0.198884364 0.160726905 -1.225203923 uc003flh.4 LAMP3 0.551026313 0.377344865 1.194850112 4.505190495 uc003flo.3 BC040935 -0.111642329 -1.008829093 0.099158178 0.388334008 uc003frm.3 RTP4 0.134423557 -0.571442813 -0.191747341 1.6083066 uc003ftz.1 ATP13A3 0.057911632 -2.313462274 0.538463686 0.218859344 uc003fuj.3 FAM43A 1.084200683 -1.013640856 0.132459688 1.082839688 uc003fxg.3 NCBP2-AS2 0.093824725 -1.030655403 -0.517508838 -0.078135314 uc003gat.3 MYL5 0.724648703 0.010632385 -1.87761705 -1.031663545 uc003gcm.1 SPON2 1.137867125 2.619507295 -0.664263109 -1.180469427 uc003gdf.2 CRIPAK -0.038212874 0.098216131 0.648496531 -1.070728566

112

APPENDICES

uc003gox.1 BC010030 -0.086714435 1.162786038 -0.171413956 -0.406630028 uc003gph.1 LAP3 -0.21717441 -0.09382285 -0.241512571 1.65479384 uc003gqu.4 PPARGC1A 1.227754439 -1.190573244 -0.139636734 0.197294741 uc003gqw.3 DHX15 -0.273068523 -1.311683794 -0.363600317 -0.127738433 uc003gxw.3 NIPAL1 0.06016444 -1.192222989 -0.635838993 -0.573512831 uc003gyl.1 FRYL -0.609226311 -0.266842261 -0.387864298 -1.297979888 uc003gzq.1 SNORA26 0.960738591 -0.365143557 1.58781377 1.057964166 uc003haj.2 CHIC2 -0.179134818 -1.011778222 -0.081956116 0.081581932 uc003hav.1 SRD5A3-AS1 0.930651606 -0.063592911 -2.041854398 -0.318512043 uc003hbv.3 SRP72 0.110827604 1.182453862 0.465836583 -0.022135607 uc003hdh.1 UBA6 -0.070436534 -1.50955715 -0.656693049 -0.291224353 uc003hdi.3 UBA6 -0.070012943 -1.628387685 -0.180018883 -0.527896466 uc003hdv.1 TMPRSS11BNL 0.067041577 -0.080970106 0.074773358 -1.444287109 uc003hhe.3 IL8 0.41054885 -0.741003372 0.90882424 1.549359023 uc003hhj.3 PPBP -1.051688985 -1.137414407 -0.396682436 -1.370215548 uc003hhq.1 LOC541467 -0.267226807 -1.386631309 -0.483702074 0.258255785 uc003hie.1 EREG -0.044928233 -2.161893111 0.849367348 1.329733785 uc003hjl.4 CXCL10 0.068255095 -0.141528147 2.74979975 5.259035589 uc003hjm.3 CXCL11 -0.17574964 -0.247139806 2.999398989 6.161981338 uc003hlb.2 FRAS1 -0.451799252 -1.123173922 -0.300414209 -0.615599637 uc003hlk.3 BMP2K -0.200101471 1.082021438 0.355964022 -0.325343725 uc003hpf.3 WDFY3 0.003951877 -1.592488901 -0.07170373 -0.306154646 uc003hpn.3 MAPK10 -0.531754104 -2.073559081 -0.559660786 -0.052593029 uc003hqe.4 C4orf36 -0.16330677 -1.664746263 -0.917069942 -0.499804715 uc003huk.1 ADH5 -0.762971395 -1.265441955 -0.365613737 -0.144486734 uc003hvn.1 H2AFZ -0.827349098 0.171694924 0.320867433 1.150664451 uc003hyb.2 TBCK -0.531548284 1.442620738 -0.133587048 -0.428332695 uc003hzq.3 CFI -0.354706605 -1.341416746 -0.098762601 -0.253967335 uc003ibz.1 SNORA24 0.841493802 0.195342384 1.326255898 0.774296035 uc003iec.4 CCNA2 0.705443894 1.076369071 -0.034198391 -0.633609873

113

APPENDICES

uc003inj.2 ANXA2P1 1.187454931 0.31958155 0.27841694 0.270898711 uc003iqb.3 ETFDH -0.270507021 0.017958566 1.050299016 0.173377666 uc003irp.3 DDX60 -0.007849617 -0.562189195 -0.240385434 1.193615622 uc003ivd.1 TENM3 0.00452854 0.354702741 -0.111639425 -1.480474108 uc003jek.2 SEMA5A -0.1335054 -0.457795328 -0.617112646 -1.388911993 uc003jfm.4 ANKH 0.196235486 -0.252696884 -0.390497832 -1.115542754 uc003jhe.2 CDH6 -0.533466655 -0.497879119 -0.338027187 -1.765113047 uc003jhq.3 MTMR12 0.46074082 1.125688924 0.821404006 0.078839804 uc003jlz.3 PTGER4 -0.449744491 -1.459751359 -0.487014622 -0.31235584 uc003jnz.2 C5orf34 -0.346362364 1.114392004 -0.494475976 0.293366247 uc003jpy.4 SKIV2L2 0.202082984 0.94406996 1.232000166 0.507813918 uc003jrw.2 PDE4D 0.004522922 -2.126969581 0.426394122 -0.456726273 uc003jrx.2 PDE4D -0.006023877 -1.657088665 0.335961502 -0.490284467 uc003jsd.1 BX641110 0.290573914 -1.363436904 0.451211304 -0.655346431 uc003kbu.1 MCCC2 -0.18544059 -0.477926933 -0.418888941 -1.558030772 uc003kek.3 IQGAP2 -0.368297268 -0.419346661 0.272750304 -1.109848352 uc003kfk.3 BC039455 -0.196647904 -1.027721883 -0.309842052 0.252699311 uc003kjy.1 AK091866 0.39684543 -0.29074285 0.739729317 1.09337758 uc003kml.3 ERAP1 0.554228992 0.254099713 -1.458879773 -0.924469999 uc003knk.3 ST8SIA4 0.0678727 0.634331836 -1.206768019 -0.827996154 uc003kpt.1 SNORA13 0.959076529 -0.580323156 0.96041779 1.430513623 uc003ktb.1 MGC32805 0.100604413 -0.457757352 0.34520717 -1.55055114 uc003kuu.3 FBN2 -0.639877713 -0.118549467 -0.398673132 -1.100413901 uc003lay.3 CXCL14 -0.225297422 -0.796557529 -0.073312792 -1.708665463 uc003lcm.1 CDC23 0.06714258 0.226770961 -0.200077412 1.310583504 uc003ldv.1 SNORA74A 0.67190498 -0.560599434 0.418723151 1.191140794 uc003lfa.3 PURA 0.00898735 1.066634896 0.256945892 0.040871936 uc003lfb.1 IGIP 0.05248648 1.394619995 -0.04091144 -0.091546045 uc003lsc.3 CD74 0.675413868 1.235724179 0.879487643 0.989293268 uc003lue.4 FAT2 -0.083792806 0.540997145 0.098880428 -1.047890746

114

APPENDICES

uc003luf.3 BC034636 0.129935077 -1.033432487 -0.326262998 -1.039559139 uc003lyl.4 DQ658414 0.379791707 0.46149598 1.879711638 1.459692284 uc003mco.1 STC2 0.424761353 0.104791261 2.538904812 1.40372297 uc003mec.1 ARL10 0.548031736 1.475435388 -0.122120127 0.138732812 uc003mjd.1 AGXT2L2 0.348379076 1.351729865 -0.968345866 -0.781945116 uc003mna.2 TRIM7 -0.074558848 -0.374125572 -1.009459436 0.0196811 uc003mtp.3 FOXC1 -0.033037849 -1.437414387 -0.142469263 0.23704029 uc003mxu.4 BMP6 1.185770168 0.550426712 -1.404188276 -1.588790295 uc003nad.3 EDN1 -0.53405825 -1.217466227 -0.412736246 -0.263456366 uc003nbs.3 GMPR 0.557738484 0.004103677 -0.79844014 1.858664109 uc003new.3 CMAHP -0.396941977 -1.258243916 -0.711016772 -0.474159015 uc003nfr.3 HIST1H4B -0.187360962 -0.115947011 -1.140717629 -0.425804883 uc003nfw.3 HIST1H1C -0.270002499 -1.043187526 -0.010947137 0.442696113 uc003ngq.3 HIST1H1E -0.210577328 -1.460875155 0.000523907 0.575333231 uc003nhd.3 HIST1H1D -0.04439859 -0.374811954 0.908680259 1.491773177 uc003nhe.1 HIST1H4F -0.322044989 -1.057825169 -0.496581832 0.609047709 uc003nhg.1 HIST1H3F 0.218642423 -0.792647328 -0.701403112 1.274645432 uc003nix.2 HIST1H2BK 0.461582347 0.53450125 0.620873035 1.311890618 uc003ntl.3 HCP5 0.190729217 -0.78184639 0.007812309 2.342293362 uc003nty.1 SNORD117 0.289320207 -0.002525171 1.622284735 0.863082776 uc003nvd.3 SNORA38 1.112488852 -0.550749991 1.408039223 0.895756373 uc003ocg.3 TAP1 -0.284654611 0.738028174 -0.061501864 1.351862911 uc003odr.3 B3GALT4 0.191786075 -1.184678247 -0.591701474 0.405595911 uc003oez.1 SBP1 0.284140982 1.602063825 -0.410673073 -0.360667901 uc003ome.3 KCTD20 0.720521602 1.308464961 -0.068874813 0.310896471 uc003onk.3 PIM1 0.263482969 -1.190088031 0.02510475 0.454184858 uc003onm.4 TMEM217 0.292035447 -1.688983431 -1.433302725 -0.097930398 uc003ovq.4 POLH 0.047050178 1.187137327 0.418044768 -0.339021119 uc003ovs.3 GTPBP2 0.184855158 0.432143586 1.364163565 1.440626779 uc003pay.3 GSTA2 0.136323179 -0.689593204 -0.556056009 -1.340238708

115

APPENDICES

uc003pbg.3 AK125212 -0.579382107 1.394093921 -0.502938412 -0.596686852 uc003pbt.4 BC009838 -0.456402529 -1.01362794 -0.493075897 0.38944348 uc003pbv.1 GCLC 1.027368895 -0.598709596 0.114641426 0.240067998 uc003pel.3 PTP4A1 0.038608904 0.448637923 1.083560163 1.504615281 uc003pjq.3 UBE3D 0.8053098 1.249875576 0.873771797 -0.349081201 uc003plx.3 SLC35A1 0.501456748 -0.469758982 -0.424737695 -1.123918285 uc003pmx.3 PNRC1 0.622773264 1.355231267 0.112121969 0.18475739 uc003prd.2 PRDM1 0.825745435 -1.406715419 0.719969929 0.59732806 uc003pre.3 PRDM1 0.634558927 -0.801288848 1.287338643 1.497614541 uc003pwo.1 AK093256 0.243530069 1.320892721 0.332603175 0.192533759 uc003pzg.3 SMPDL3A -1.663324049 -0.095026273 0.484375021 -0.346662862 uc003qaa.1 HDDC2 0.307623274 1.177784174 -0.180674404 0.327461944 uc003qak.3 NCOA7 0.46785902 0.197014577 1.590477072 1.008211156 uc003qcz.3 CTGF -0.499090848 -1.584149724 -0.038711885 -0.270653476 uc003qdn.3 VNN1 -0.052625311 -0.546945802 1.071710586 1.376682403 uc003qdx.3 RPS12 -0.074440917 0.58872816 1.116720056 0.872132447 uc003qem.1 SLC2A12 -0.074438517 -0.615151541 0.130211992 1.167888888 uc003qgp.3 PDE7B -0.065582896 -1.239939081 -0.209601927 -1.516642042 uc003qks.4 STX11 0.433148301 -1.147911457 0.789682059 1.539636197 uc003qoh.3 ZBTB2 -0.410134512 -1.068782167 -0.205219323 0.439589695 uc003qok.1 C6orf211 -0.074108253 1.023126148 0.755561663 0.056124917 uc003qsf.4 BC016015 0.118813891 0.638831547 1.378344156 1.926004106 uc003qsj.3 SOD2 1.345415909 -0.266684384 1.033657701 1.406623232 uc003sga.3 PSMB9 0.29397335 0.822124106 0.879362109 2.197884354 uc003skt.4 TMEM184A 0.661115678 1.172905448 -0.125475174 -0.909624432 uc003ssa.3 PHF14 -0.633597327 -1.019167782 -0.393151577 -0.529905864 uc003swk.2 CLK2P 0.624391119 1.300833911 0.423098551 0.040087163 uc003taq.3 PLEKHA8 0.313938135 1.155848553 0.363926604 0.11258455 uc003tib.3 MRPL32 -0.764880204 -1.427999218 -0.347834107 -0.022029192 uc003tih.3 STK17A -0.202701635 -1.184319086 -0.328942884 -0.171282539

116

APPENDICES

uc003tpo.4 COBL -0.201518127 -1.396695449 0.546780701 -0.633041256 uc003tpt.3 COBL 0.155268122 -1.035268764 0.251657021 -1.287771367 uc003tuj.3 SNORA22 0.525010233 0.147674126 1.397308513 1.355390291 uc003tve.3 KCTD7 0.70596973 1.478908049 -0.416496454 -0.077620175 uc003tvj.1 GTF2IRD1P1 0.44217373 0.915519808 -1.552171479 -0.668439333 uc003tvk.3 TMEM248 0.007560538 0.674107861 0.66606323 1.123920245 uc003tzg.4 CLDN3 0.265250021 -1.043996865 -0.231029396 0.291499783 uc003uaz.3 BC070376 1.57248067 0.827047266 -2.155714478 -0.925124295 uc003udh.1 NSUN5P1 0.152139543 -0.300977745 -0.017690744 -1.089227886 uc003udz.1 SNORA14A 1.200599879 -0.277693077 0.591070479 1.762707919 uc003uew.3 HSPB1 0.148656841 0.178961195 -1.132669808 -1.191815045 uc003ugg.1 GSAP -0.092769576 -0.121914475 1.107169939 0.944001462 uc003ugw.1 AK124308 -0.136310158 -1.021023671 -0.381858777 -0.303217374 uc003uhq.1 AK092048 -1.033199908 -0.721628617 0.391619159 -1.068723486 uc003uma.3 RBM48 -0.119370113 1.159833873 0.017073074 -0.571537693 uc003umf.3 SAMD9 0.339944997 0.890630726 1.156401827 1.877593817 uc003uoa.3 PDK4 -0.008187357 -0.502598816 0.813811779 1.148260728 uc003uxq.3 TRIM56 0.532136161 1.451841542 1.014115556 1.004663548 uc003vcr.1 AF520792 -0.276807661 -0.185231524 -0.560825878 -1.13013602 uc003vfm.3 THAP5 -0.015418004 1.102360952 0.253221449 1.207513187 uc003vgi.3 IFRD1 0.194338623 -1.068870227 0.560666159 0.74743361 uc003vov.3 AHCYL2 -0.027535871 0.047115339 0.660056497 1.539286295 uc003vqn.4 LOC646329 -0.250518059 -1.236900611 0.221702782 -0.635909612 uc003vrp.1 AKR1B1 -0.282535243 -0.210699374 -0.32292281 1.324025329 uc003vsi.3 TMEM140 -0.237377708 0.46528589 0.48417858 2.178570343 uc003vum.1 ZC3HAV1L 0.699978857 1.956474298 -0.16992193 -0.203343994 uc003vwp.1 TAS2R3 0.344597246 1.155585974 -0.782928688 -0.683990986 uc003wfj.3 ZNF425 -0.041770913 1.332458268 -0.287717063 -0.009046079 uc003wgy.3 ZBED6CL -0.112129408 -1.252273514 -0.384808552 0.622228387 uc003wjz.1 AK055458 0.412936767 1.065434327 -0.101206312 0.512538862

117

APPENDICES

uc003wkv.1 GALNT11 0.257326956 -1.068126467 -0.355770481 0.133602106 uc003wmm.3 C7orf13 0.009568546 1.239354465 -0.270401438 -0.183363854 uc003xbu.1 AK125860 1.179713935 1.339066689 -0.03561835 -0.5224376 uc003xdr.1 AF116693 -0.146660532 0.195174716 1.745061508 0.685613496 uc003xhm.3 DUSP4 -0.634426595 -1.202796804 -0.394109215 0.187636383 uc003xmp.3 ADAM9 -0.281771424 -1.261865862 -0.002793943 0.20820366 uc003xnm.3 IDO1 -0.066003508 0.160012245 0.695065222 1.788443684 uc003xnq.2 C8orf4 0.372070684 -0.099420829 1.580333071 1.779427534 uc003xpk.3 THAP1 -0.30377737 0.668171944 1.194187608 0.601629732 uc003xsi.1 TMEM68 -0.411442023 -1.464089906 -0.028479851 -0.04030256 uc003xso.1 SNORD54 1.253812966 0.464931446 0.351934093 0.818229404 uc003xtv.1 AX747379 1.047882083 0.266589179 -1.281251652 -0.083627514 uc003xuf.3 CHD7 -0.393828788 -1.11770785 -0.221792252 -0.092009408 uc003xur.3 ASPH -0.34421192 -1.210702274 -0.11913639 -0.171107509 uc003xvl.3 ARMC1 0.10012956 1.084037087 0.258015216 0.293846861 uc003xvr.3 PDE7A -1.067398116 1.138371388 0.566928991 -0.670071445 uc003xxb.1 SNORD87 0.823978438 0.34872118 1.306945906 0.769072747 uc003yby.2 ZNF704 0.110012197 -0.274856275 -0.078187882 -1.067244289 uc003ybz.3 PAG1 -0.240972809 -0.30721647 0.082975759 -1.257496456 uc003ydc.1 AB209185 1.086246527 0.769002434 -1.772999616 -1.176644654 uc003ygo.2 KIAA1429 0.009582264 1.205260439 0.183121201 0.155856594 uc003yig.1 SNORA72 1.208150985 -0.149175375 0.195366975 1.556808503 uc003yjx.2 YWHAZ 0.228475038 0.981799839 0.058321691 1.091238049 uc003yon.4 TNFRSF11B -0.860929655 0.323470905 0.076604189 -1.319442743 uc003yoo.3 COLEC10 -0.414674774 -1.057019365 -0.044517913 0.273618135 uc003yph.2 HAS2 -0.856675158 -1.795178923 -0.356251599 1.60344686 uc003yqy.1 AK057332 0.98868046 0.883558579 -1.477904167 -1.214168773 uc003ysa.2 CCAT1 -0.157900263 -1.119818318 -0.113531395 -0.278068565 uc003ysi.3 MYC -0.23470004 -1.019950761 0.694193846 -0.074820534 uc003yuf.1 NDRG1 2.222039055 -0.136708266 0.179108528 -0.393401099

118

APPENDICES

uc003yui.1 AX746885 2.075761438 0.16220806 0.368745056 -0.543069476 uc003yxa.3 LYNX1 0.376613313 0.89801881 1.129386768 -0.077835624 uc003yyb.3 RHPN1 -0.386486024 -1.141971364 -0.684185945 0.07969117 uc003zaa.1 EPPK1 0.55435579 1.265648678 0.007369073 -1.173290423 uc003zkx.4 MPDZ -0.050332772 -1.258107884 -0.913069192 -0.05390472 uc003zmx.4 CNTLN 0.140290954 -1.007434085 -0.220368135 -0.680341123 uc003zpg.3 IFNE 0.296888436 0.411100387 0.02740204 -1.150848325 uc003zsm.4 CHMP5 -0.046369616 0.191844685 0.410550418 1.616592836 uc004aae.4 TOMM5 -0.387384522 -1.215254942 0.391021054 -0.588719971 uc004aat.2 DQ590189 0.223544341 -1.048777521 -0.173643656 -0.396659438 uc004abh.4 FAM201A -0.36276391 -1.471048669 -0.049663677 -0.337243099 uc004abk.1 CNTNAP3 -0.067296124 -0.927111569 0.450789284 -1.926569979 uc004ahb.1 TJP2 -0.281683613 0.46230786 1.346253892 0.389050978 uc004ajf.1 ANXA1 -0.213761824 1.009040269 1.194055803 0.132311892 uc004ajo.4 C9orf40 0.368457023 1.072087761 0.003509867 0.116910756 uc004aom.3 GOLM1 0.116596978 1.366316923 1.180853171 -0.245888057 uc004aqx.1 DIRAS2 -0.634887575 -1.500908085 0.299222137 -0.331084198 uc004asd.4 OMD -0.195457289 -1.027182906 -1.448496278 -0.943281845 uc004aui.3 MIRLET7A1 -1.12243343 -1.101140427 0.341353533 -0.765498793 uc004aum.1 ZNF169 -0.253602437 1.014246489 0.239825503 -0.044937259 uc004axb.2 BC070371 -0.142380419 1.041445956 -0.3316813 -0.15776108 uc004bff.2 ZNF483 -1.061632163 -1.086201954 -0.909837295 -1.069743246 uc004bha.3 RNF183 -0.05714415 -1.007659432 0.396684204 0.406079562 uc004bki.3 CDK5RAP2 -0.195892409 -1.261466693 0.052231946 -0.282335155 uc004bkv.3 C5 -0.460791611 -1.252531371 0.066137225 -0.086427421 uc004bnf.1 SNORD90 1.97127683 -0.078612535 0.919589776 0.565244286 uc004bra.1 SNORA65 1.325080584 0.342743051 1.176925727 1.434449696 uc004bto.1 LCN2 -0.407909222 0.670401291 0.733543272 2.112270716 uc004bvv.1 Y16709 1.418273273 0.887703539 -1.597500514 -0.625094969 uc004bxz.2 LOC100506190 0.244554965 -1.344539258 -0.473544928 0.098558067

119

APPENDICES

uc004byk.1 TOR1B -0.016010736 0.024552652 0.10478201 1.416704394 uc004cas.1 LQFBS-1 0.600275229 1.122021213 -1.039458673 -1.297457694 uc004chz.3 NOTCH1 -0.176847003 0.536925029 0.32151308 -1.304034383 uc004cow.2 DQ584698 -0.179486431 -0.742579899 1.068956112 0.322362182 uc004cox.4 MTND5 0.487326844 0.809954175 1.668782585 -0.203241781 uc004coz.1 AF079515 0.132994882 0.433999627 1.075179894 0.534650782 uc004crg.4 MXRA5 0.022577169 -0.069699297 -0.10281267 -1.16694948 uc004cxq.2 TXLNG -0.442080532 1.159866779 0.424852533 0.340550581 uc004dhk.4 UBA1 0.61697427 1.206655917 1.184819631 0.484819736 uc004ehd.2 TIMM8A 0.016665009 1.061509986 -0.218587723 -0.66646286 uc004ehj.2 RPL36A -0.695491316 -1.043678036 0.102670573 -0.058806804 uc004ekw.3 MORF4L2 -0.175946024 0.247889475 1.109460697 -0.11414454 uc004enf.3 TSC22D3 -0.14743579 -1.018542958 -0.499219055 -0.328081996 uc004fah.1 SNORD61 1.278039134 0.987172357 1.751829302 0.711790299 uc004flm.3 PLXNA3 -0.061468174 0.135305739 0.093039328 -1.015990907 uc004fmn.3 SNORA36A 1.63443853 0.534008239 0.556745569 1.383518825 uc009vsy.3 AHDC1 0.580993076 0.506011894 1.678003315 0.015334829 uc009wbv.1 SNORD45B -0.726232 -1.864383917 -0.237773385 -0.4205896 uc009wcy.1 GBP1P1 -0.341633469 -0.44888641 -0.107362688 2.050848307 uc009whb.2 ATP1A1OS 0.979301647 0.600060105 -1.144405559 -1.349296243 uc009whk.2 BC043601 -0.170573522 -0.064564213 -0.020466568 -1.037988166 uc009wog.1 AK307246 0.440966379 0.170213938 -2.413850203 -0.923725312 uc009wwi.1 SNORD81 1.042643841 0.413198995 1.46510579 -0.26354806 uc009xco.3 LAMB3 0.003636947 -1.138052338 0.612308386 1.152496044 uc009xhx.2 AKR1C1 -0.205188178 -0.835781321 -0.215957717 1.139163698 uc009xlu.2 CCDC7 0.474129817 1.106659203 0.145927196 -0.868654073 uc009xon.3 NCOA4 0.397015449 -1.178146303 0.099566367 0.131794192 uc009xrr.3 VCL -0.444852546 -1.330148448 0.103189086 -0.213069733 uc009xth.1 ATAD1 -0.25852203 -1.533154727 0.155121112 0.479307764 uc009xts.3 IFIT2 0.198739819 0.174466502 0.986139029 3.057811374

120

APPENDICES

uc009xzf.1 NANOS1 -0.002157881 0.221778611 -1.373334044 -1.077138842 uc009yge.3 SNORD97 0.943511087 0.367734624 1.59277299 0.881978455 uc009yhj.3 SAA2 -0.261393206 0.484563897 1.21943355 0.862305073 uc009yoa.1 SNORA57 0.614013496 -0.034769959 0.636475626 1.178504894 uc009zbd.2 HSPA8 1.053366288 0.362955794 0.753959238 0.755738225 uc009zmh.3 KRT5 -2.204215559 0.142483438 -0.556571294 -0.778571182 uc010aax.1 HSPH1 -0.219933079 -1.139607995 -0.14500089 0.075922577 uc010asi.3 FOS -1.08213522 -2.029649163 0.609122419 0.427940071 uc010bgj.3 ANXA2 -0.450312691 -1.010051041 0.448751438 0.180716798 uc010bht.3 SNORD16 0.878103316 0.183427051 1.02187474 0.536270095 uc010bom.3 ARRDC4 -0.323263677 1.129622026 -0.30904189 -0.752341439 uc010cdt.2 CMTM1 -0.62001845 1.1548273 0.262301101 0.058969734 uc010cla.1 ZNF594 -0.252529952 1.427948882 0.250236193 -0.433832772 uc010clp.1 C17orf100 0.035002957 -1.001607417 -0.209541722 -0.549712445 uc010crq.2 SGK494 -0.098902052 1.023926149 0.534516698 0.093387608 uc010cxg.3 KRT23 -0.14154482 -1.062580587 0.285943412 0.871774225 uc010dee.1 SNORD104 1.377865831 -0.066460246 0.8563546 0.71157669 uc010dmp.3 ZNF397 -0.172506558 1.015073028 0.077779609 -0.035759759 uc010dwz.1 SNORD105B 1.552029494 0.250776208 2.20325911 1.795340731 uc010dxk.2 DNM2 0.655433415 1.108588195 0.121722451 0.052798262 uc010emy.1 SNORD32A 1.397334277 -0.288480131 1.954870656 1.933977244 uc010emz.1 SNORD33 1.235275773 0.458822878 1.241357471 1.276891227 uc010exa.3 ADAM17 0.11381823 -1.206394638 0.241186398 -0.137234928 uc010exw.1 SDC1 0.561301173 1.012200341 0.599254225 0.844380353 uc010fep.3 EXOC6B 0.206014816 -1.094163462 -0.502225946 -0.565331897 uc010fgr.1 SNORD94 0.956412738 -0.064682917 0.95770435 1.618390274 uc010fiu.1 RPL31 -0.025954351 0.468651818 1.038526801 -0.024591585 uc010fnm.3 KYNU 0.883017465 0.673444486 0.976977123 1.329306914 uc010fpl.3 SCN9A -0.192808848 -0.2387089 -0.606561074 -1.328707319 uc010fxh.1 TRIP12 -0.52123851 -1.057910113 0.24185129 -0.126899175

121

APPENDICES

uc010hwf.3 PPM1L -0.259884141 -1.439229464 0.071291545 -0.945775542 uc010hwu.2 TNFSF10 -0.41662362 2.056740127 0.578955472 0.256858528 uc010hyv.2 SNORA81 0.710433099 -0.403589944 1.464197963 1.430234559 uc010hyw.1 SNORA63 0.710203142 0.049359698 0.955531528 1.294193794 uc010iev.3 SLC34A2 1.302557092 -0.067816236 0.384538485 0.740587106 uc010ihk.1 CENPC1 -0.738981659 -1.495155094 -0.085341092 -0.912499667 uc010ijh.1 Sep-11 0.013739544 -1.340808133 -0.557727827 -0.964999047 uc010iqq.3 ETFDH -0.232247058 -1.43186074 -0.020345154 0.545800753 uc010jav.3 RASA1 -0.22396549 -1.114937522 -0.05274228 -0.845687118 uc010jro.3 HLA-H 0.098815216 0.409913758 -0.138935112 1.228095758 uc010jxh.1 OARD1 -0.474401196 1.049585476 -0.299540575 -0.046416793 uc010keg.2 AJ420595 0.276566201 1.0777964 -0.150891397 -0.446362893 uc010kka.1 TCP1 0.078099628 -1.01584168 0.244898047 0.149758236 uc010lfp.1 MGC72080 -0.560713488 -1.093915566 -0.126238502 -0.381175619 uc010mbt.1 GRHL2 -0.551565482 -1.104285991 0.641084502 0.065419902 uc010mzz.2 GTF3C5 0.245687928 1.350457319 0.339841833 0.593531816 uc010nah.3 SNORD24 0.85638071 0.535035418 1.858728855 0.558093515 uc010naj.3 SNORD36A 0.622816054 -0.081682358 1.536863992 0.301955625 uc010nkg.2 KLF8 -0.028455373 1.466762912 0.050642838 -1.27163952 uc010nux.1 SNORA70 1.077293671 -0.246762288 1.162944222 1.827647368 uc010odg.1 HP1BP3 -0.558298496 1.73120693 0.140659777 0.028094432 uc010ofi.1 SFN 0.561635317 0.405823121 -1.540138201 -1.074132086 uc010ogm.2 PEF1 -0.072056948 -1.443908913 -0.427439397 -1.112879604 uc010oro.2 IFI44L -0.453633788 -0.631892783 0.274549559 4.701715303 uc010owx.2 ATP1A1 -0.10295971 -0.749995735 -0.245552108 -1.335389812 uc010oys.2 TXNIP -1.378116125 0.90917287 -0.156459178 0.343687775 uc010pbl.2 HIST2H3D -0.576703031 -0.474571703 -1.280646549 0.359790709 uc010plo.2 ANKRD36BP1 1.048436009 1.126193318 -3.822112558 -1.735711965 uc010pyc.2 LOC100130331 0.942393453 0.638119046 1.876392666 0.349321124 uc010qbx.2 DCLRE1C 0.628210572 1.034384897 0.995683794 1.051618818

122

APPENDICES

uc010qfa.1 HNRPF 0.924953498 0.224567598 -1.086440778 -0.783866862 uc010qlo.2 RPS24 -0.499935828 0.140951451 -1.095333119 -0.407305823 uc010qnh.2 IFIT5 0.136062304 0.285995878 0.254779293 1.864913761 uc010qqp.2 NT5C2 -0.428172363 -1.362697935 0.172930265 -0.581526412 uc010rpj.2 RBM4 0.172012021 -1.321076413 -0.488789527 -0.500568106 uc010rqh.1 AK294004 0.881970707 1.007205171 -2.901862653 -2.173863299 uc010scd.2 ADAMTS15 -0.151344978 -1.150042136 -0.808350163 -2.379142036 uc010sfy.2 C1R -0.059204596 -0.450612939 0.333277009 2.145892136 uc010smg.1 TUBA1A 0.824080079 0.491064759 -1.932564293 -1.053023366 uc010smi.1 TUBA1C 0.389380711 0.18495105 -2.210036579 -0.85282514 uc010snf.1 DAZAP2 0.209294857 -0.052752062 -1.110613002 -0.927718884 uc010ssv.1 HMGA2 -0.814086361 -2.110995549 0.3578166 -0.288191995 uc010swe.1 NT5DC3 0.177173709 -0.771609552 -0.410930501 -1.230922497 uc010tco.1 ZMYM2 -0.814336342 -1.298074633 -0.200672015 0.154936994 uc010thw.2 LMO7 -0.371954003 -1.232135894 -0.281734397 -0.082051582 uc010uek.1 B2M -0.283736272 -0.209987253 0.318765421 1.239542347 uc010uri.2 NR2F2 0.498331086 1.543644248 0.852060675 0.130276851 uc010uzb.2 MKL2 0.278800367 -0.60415264 0.762938475 1.085670885 uc010vwr.1 KRT16P2 0.03487399 -2.318499089 -1.182010088 -0.709256918 uc010vxz.2 AK296148 1.491182446 1.390421479 0.97029393 1.223057643 uc010wft.2 KRT17 0.791718241 -0.235305585 1.823635433 1.364379176 uc010wia.1 AK027091 0.795672649 2.155859129 0.377152042 -0.275645564 uc010wjl.1 ARHGAP27 0.172981991 -1.140466146 -0.930442173 0.217230448 uc010wsh.1 ITGB4 0.003832468 1.090577121 0.710191009 -1.032476719 uc010wsy.1 UBALD2 -0.062689862 -1.296444265 0.486789853 0.650112743 uc010wvp.1 NARF 0.57042523 1.455142936 0.387835435 0.054447661 uc010wyu.2 LOC727896 -0.109223343 1.073347554 0.747811675 0.43412096 uc010xbh.2 SS18 -0.41673511 -1.588727234 0.299340677 0.083213882 uc010xbm.2 AQP4-AS1 -0.207554584 -1.134868887 -0.314202257 -0.735439216 uc010xeu.2 SERPINB2 -0.015384428 -1.349857128 -0.08061749 -1.384733114

123

APPENDICES

uc010xgl.1 CIRBP -0.071004107 1.764917625 0.05841395 0.10441501 uc010xxe.2 BCL3 0.771043475 -0.076416515 1.108268565 0.394556885 uc010yim.2 FAM110C 0.133676851 -1.07825248 -0.229146264 -0.057533148 uc010yix.1 MBOAT2 -0.030013424 -1.419371353 -1.102716853 0.031387069 uc010ynu.1 THUMPD2 -0.265072542 -1.069879185 0.325581576 -0.203189002 uc010yov.1 RTN4 0.86454556 1.165182434 -1.708331365 -1.17277456 uc010yqn.1 ANXA4 0.32305625 1.194804907 0.988132179 0.224802676 uc010yud.1 MRPS5 -0.008625496 1.786599412 0.110380334 -0.15173726 uc010zcc.2 ARL5A -0.403242653 1.189783076 0.354350819 -0.101939479 uc010zdd.2 DHRS9 -0.076263138 -1.31425749 -0.398964699 0.037069113 uc010zde.2 DHRS9 -0.039215345 -1.262909188 0.309298815 0.028369971 uc010zpq.2 SDCBP2 -0.020216324 -1.457613173 -0.072842268 0.155801228 uc010zue.2 BPIFB4 0.504248058 0.572295001 1.169593554 1.56990989 uc010zyb.2 LOC100131496 -0.324618363 -1.569327528 -0.112107865 0.322629901 uc011aea.1 LOC100133286 0.217997861 0.206091933 -2.200695406 -0.314055839 uc011bds.2 DOCK3 0.187515158 -0.097330815 -0.136093495 -1.682710448 uc011bmw.1 COPB2 -0.700686416 -1.386966781 0.356109719 -0.702449777 uc011boq.2 TIPARP-AS1 0.934852549 -1.209283994 -1.105047913 -0.142497349 uc011bsp.2 MB21D2 0.288873451 -1.056732813 -0.263772674 0.792145608 uc011btw.2 CEP19 0.279548669 2.140620961 0.597054111 0.334943819 uc011bys.1 RBM47 0.869157204 0.750227896 1.347584257 1.491471635 uc011cmq.2 CCT5 -0.451019542 -1.264545553 -0.145174472 -0.894973727 uc011cuq.2 CAST 0.036957662 -1.088737533 0.207917369 -0.89173562 uc011czv.1 VTRNA1-1 1.410982656 -0.480620695 1.257085157 2.323068808 uc011czx.1 VTRNA1-3 0.741731157 -0.057123848 0.651402573 1.81335413 uc011daz.2 PCDHGB8P -0.273743739 0.38597829 0.278858903 -1.313869514 uc011dgr.2 SQSTM1 0.970976287 1.465601499 -1.619211631 -0.533743956 uc011dhk.1 GNB2L1 -0.367488269 -1.246199259 0.168819329 0.334185555 uc011djv.1 CMAHP -0.018633337 -1.584998277 -0.01817797 0.492847966 uc011dlx.1 HLA-F 0.845395025 -0.442662459 0.755279431 1.192413386

124

APPENDICES

uc011dly.1 HLA-F 1.805122594 0.452404085 -0.606959424 -0.77228217 uc011dme.2 ZNRD1-AS1 0.198617426 1.534070292 0.141120266 -0.687264776 uc011dok.1 AK298056 0.809615663 1.361999103 -0.889505621 0.117720087 uc011dos.1 CFB -0.529924223 0.736054768 1.447263121 0.642267343 uc011ebf.1 DSE 0.67499945 0.991205696 -1.20271537 -0.683280164 uc011eha.1 PHF10 -0.132676506 -1.077013706 -0.130542854 -0.305113388 uc011kdm.2 ZNF727 -0.109049618 1.010880571 -0.83140446 -0.252923646 uc011kqs.2 LUC7L2 -0.252277233 -1.482469364 0.464992321 -0.162640052 uc011kvf.2 AK296065 0.291529029 0.655721452 -1.680206637 -0.222748897 uc011kyw.1 FAM160B2 0.397643501 1.137061363 0.033452557 -0.145114946 uc011mfi.2 OK/SW-cl.16 0.285981274 0.375438887 1.369534022 0.06139638 uc011mle.1 MIR221 -0.413382157 -2.006384452 -0.043124624 0.058181205 uc011mlf.1 MIR222 -0.396120262 -1.810676811 1.220379172 0.338674851 uc021ohh.1 TRNA_Asn 0.819895676 0.881759056 1.095987308 1.38362414 uc021ohi.1 DL489931 -0.470589905 -1.848008537 0.038534172 0.231550729 uc021ohp.1 LOC100506730 0.355271233 1.096428559 0.134258248 -0.590097503 uc021onu.1 HP08874 0.293603368 -0.157318833 -1.466918782 -0.907242101 uc021osb.1 DKFZp686N1631 0.290661594 -1.391369021 0.377249075 0.117401994 uc021ouu.1 TRNA_His 0.534394955 -0.254321624 0.74204997 1.177586802 uc021ovy.1 TRNA_Asn -0.111845907 -0.096325162 1.2207096 1.340299253 uc021owi.1 TRNA_Asn -0.182653047 -0.054756424 1.041824037 1.09166026 uc021oxk.1 TRNA_Val 1.244562308 -0.025798475 0.432852868 1.358131816 uc021oxu.1 TRNA_Pseudo 0.893153927 0.082168822 0.27584269 1.516916168 uc021pdg.1 TRNA_Asn 0.645465341 0.074454303 1.599254654 1.383406923 uc021pgz.1 MIR181A1HG -0.589986401 -1.092599968 0.376351465 0.483063892 uc021pst.1 JA700173 0.206162889 -0.294130181 -2.155891664 -1.591450016 uc021psu.1 JA700174 0.32204311 -0.471611153 -2.815479898 -1.394003912 uc021psv.1 JA700157 1.155843001 0.361983574 -1.35163925 0.281189309 uc021pxl.1 USMG5 -0.051887218 1.091906215 0.084439506 0.354119224 uc021qdz.1 RASSF10 -0.253032967 0.323096512 1.278418167 0.21006536

125

APPENDICES

uc021qfs.1 KIAA1549L -0.468889216 0.1441519 0.108904668 -1.143457839 uc021qjp.1 TRNA_Val 1.091550008 -0.024541254 1.260012424 1.529836729 uc021qjr.1 TRNA_Leu 0.878734101 -0.83351725 0.530322523 1.123898145 uc021qlw.1 TRNA_Ser 0.525354511 -0.458030813 1.335094929 1.610362818 uc021qqx.1 AB488780 0.25937375 1.199424819 0.835940309 0.495904794 uc021qsm.1 AK095267 -0.200857949 1.559851753 0.02268146 -0.388094957 uc021rdn.1 USP30-AS1 -0.083519336 0.041603955 0.586855114 1.385169664 uc021rgi.1 TRNA_Asp 0.093502503 -0.971159088 0.457400574 1.118725756 uc021rjb.1 TSC22D1-AS1 -0.371190304 -0.006707609 -1.173484169 -0.030236672 uc021rjc.1 LINC00330 -0.081399018 -0.389150437 -1.210407826 -0.927416519 uc021rlx.1 7SK 1.084378548 0.667744766 0.049868602 0.165189385 uc021rnq.1 SNORA79 0.488204602 -0.442130359 0.162665115 1.000001844 uc021rnx.1 TRNA_Pro 0.066244983 -1.377658777 0.618426198 0.831889713 uc021rnz.1 TRNA_Leu 0.05691123 0.186382363 1.558155887 1.914378601 uc021roa.1 TRNA_Thr -0.313239772 -0.715186245 1.940343676 1.737217655 uc021rob.1 TRNA_Pro -0.166167061 -1.002952671 -0.009876641 1.089238843 uc021roi.1 TRNA_Tyr -0.437610105 -1.449976973 -0.24188849 0.438797914 uc021rov.1 LINC00641 -0.13770026 -1.370631921 0.832180019 -0.040657969 uc021rtb.1 U6 0.019841106 -1.298620717 -0.151487751 -1.097288846 uc021ryh.1 TRNA_Ala -0.061358127 -0.48907203 1.258229572 1.21285571 uc021sba.1 IFI27 -0.315809527 -0.243945608 1.022635979 5.856204544 uc021ske.1 MIR1282 0.868030837 -0.233738594 -1.87866663 -0.286919451 uc021snf.1 DJ439529 0.814097637 1.058593949 -1.469365845 -0.758485897 uc021sng.1 DJ439575 1.120520409 0.991888267 -2.129759929 -0.716134063 uc021snh.1 DJ439531 0.721079174 0.560090837 -2.15077097 -0.915549466 uc021spv.1 JA375062 0.616177766 0.348983311 -2.719485419 -1.44477982 uc021sqh.1 HP11097 -0.486156974 -1.161751991 0.325843126 0.365964837 uc021sra.1 AK025664 -0.30226919 -1.38454129 0.216713525 -0.698927318 uc021srj.1 TRNA_Lys 1.320589916 0.005287009 0.676630947 1.541263203 uc021sxs.1 AF198444 0.322355082 -1.437977507 -0.378120541 0.486839233

126

APPENDICES

uc021tdf.1 TRNA_Thr 0.459758597 -0.012227886 1.191621197 0.757178203 uc021tec.1 AK123332 -0.456763635 -1.476324551 -0.864362781 -0.171580268 uc021tes.1 TRNA_Leu 1.615777545 -0.016583157 1.126046009 1.583359158 uc021tjb.1 TRNA_Leu -0.219063752 -1.832566508 0.089571441 0.219366387 uc021tjc.1 TRNA_Leu 0.15656262 -0.765756656 1.303771087 1.110281391 uc021tkp.1 TRNA_Gly 0.094680624 -0.552223387 1.854272313 1.237873855 uc021tlu.1 7SK 1.519155665 0.478757063 0.7680745 0.877682448 uc021tpq.1 TRNA_Leu 0.825373796 -0.160135913 0.913969555 2.026901933 uc021tpt.1 TRNA_Thr 0.942745386 1.076869677 0.978892263 1.00764802 uc021tpv.1 MIR4521 -0.099265884 -0.207790902 0.971700956 1.568961517 uc021tpx.1 TRNA_Ile 0.418732644 -0.601273686 0.783458193 1.477378536 uc021tts.1 SPAG5-AS1 0.307840782 0.414917225 -2.080863661 -1.703792305 uc021twr.1 TRNA_Cys 0.797466956 -0.760944253 0.377272895 2.038462052 uc021txx.1 IFI35 0.269130652 -0.102071033 0.48930684 2.545746592 uc021ucf.1 MIR635 -0.809418576 -1.431537787 0.096439274 -0.181066903 uc021ucl.1 LINC00511 0.158535224 -1.135704546 0.019719464 0.63157436 uc021umd.1 U6 1.439562664 -0.735913172 0.706188449 1.661021891 uc021uop.1 ZNF812 -0.106414592 -1.153862545 0.518634123 0.022437706 uc021url.1 ZNF90 0.497265506 0.31066929 1.433169224 0.868670831 uc021uss.1 TRNA_Lys 1.504968902 1.102945095 2.638446014 1.062671993 uc021vdr.1 RRM2 0.699093635 -0.517975914 0.066848111 -1.888953731 uc021vdz.1 Metazoa_SRP 0.939140046 -0.416453764 -1.463351196 -0.845053125 uc021vfj.1 SNORD53_SNORD92 2.073371638 0.914280527 1.142905429 1.776315038 uc021vxo.1 RHBDD1 -0.108436814 1.171280531 0.919953569 0.270719858 uc021wai.1 PCNA-AS1 0.205537058 0.747245512 -2.467214964 -1.212078726 uc021waw.1 RRBP1 0.260228799 1.100612504 0.578584437 0.618773782 uc021way.1 AK296947 -0.993064136 -1.444183841 -0.574177715 0.15019148 uc021wcx.1 SOGA1 -0.009005435 0.825808087 0.03514515 -1.304020536 uc021wdn.1 ARHGAP40 0.409730957 -0.888363817 -0.701856266 -1.077963478 uc021wqz.1 TRNA_SeC 1.963408798 0.342833246 0.775779429 2.438929927

127

APPENDICES

uc021wym.1 LUST 0.48284065 1.652905316 -1.452331009 -0.825206036 uc021xcj.1 AX747104 -0.260422131 -1.227545596 -0.25638166 -0.226381945 uc021xhy.1 U6 0.810764432 0.139903735 0.354141961 1.182525153 uc021xjp.1 MUC4 0.536432026 0.496915167 1.93480225 0.175690243 uc021xpc.1 AREG 0.281765379 -2.129996949 0.338143143 -0.571854557 uc021xrw.1 SLC7A11 -0.137025273 -0.629294432 1.422887066 1.264153426 uc021xwp.1 ANKRD33B -0.166295653 -0.374206329 -0.152730698 -1.325093751 uc021yay.1 MTRNR2L2 1.025795711 0.031447116 2.70080438 0.47695256 uc021yba.1 MIR3607 -0.225961836 -1.274065443 0.377410489 -0.068330682 uc021ydy.1 VTRNA2-1 1.224811787 -0.515018878 1.321263763 2.593078612 uc021yjh.1 AK095057 0.548953712 1.639227777 -0.009686294 0.299422169 uc021ykb.1 TRNA_Thr 1.183998167 -1.220465199 0.931586788 1.012338354 uc021ykd.1 TRNA_Lys 0.29051269 -0.06195743 0.646375416 1.663993066 uc021ymw.1 TRNA_Ser 0.473411436 -0.762270286 0.331085034 1.491070127 uc021ynk.1 TRNA_Thr 0.542868939 -0.627848393 0.919836921 1.175205069 uc021ynp.1 TRNA_Ile -0.056401358 -1.700217778 0.267442035 0.890544439 uc021ynv.1 TRNA_Tyr -0.055327163 0.382681553 0.260186772 1.09705143 uc021yoe.1 TRNA_Met -1.110729144 -0.240977666 1.260132283 1.486882506 uc021yow.1 TRNA_Ser 0.322864974 0.483487344 0.847389163 1.464940741 uc021ypi.1 TRNA_Leu -1.02793957 -1.346899866 -0.495770011 0.613851936 uc021ypn.1 TRNA_Val 1.133276051 0.016235159 1.326277992 2.312795931 uc021yqp.1 TRNA_Leu 0.956315169 -0.063285647 1.64954925 2.499280078 uc021yqs.1 TRNA_Val 0.758522716 -0.538370469 1.769943664 1.475792063 uc021yrr.1 TRNA_Ser 0.905265698 0.601790853 1.381940048 2.108003457 uc021ysg.1 TRNA_Ala 0.687124999 0.897349306 1.346210581 1.571476084 uc021ysk.1 TRNA_Ala 0.269725696 0.568600158 0.379888716 1.69400657 uc021ysy.1 TRNA_Ala 0.220831691 -0.359791628 1.304544709 2.207236488 uc021ywj.1 HCG25 0.47999583 -0.167781841 -1.683105365 -0.641180316 uc021zfy.1 TXLNB -0.302411487 -0.455233801 0.144000262 1.095547903 uc021zzi.1 DQ579268 0.520341479 -1.108643105 -1.145909506 -0.64711544

128

APPENDICES

uc022ahx.1 MIR3609 -0.380814028 -1.358130183 0.21717386 0.731384401 uc022avg.1 TRNA_Tyr 0.752090657 -0.306059488 0.338048367 1.792762151 uc022ayh.1 LOC100288748 -0.061826803 -1.414219931 0.562749911 0.001103431 uc022bce.1 AX747544 0.398710819 0.546639105 -1.801745434 -0.30530173 uc022bdw.1 DQ572382 0.38153992 -1.048394357 -0.488119146 0.056839229 uc022bfp.1 DJ439583 0.03364003 1.218085406 -2.317468147 -0.928999241 uc022bfr.1 DJ439530 1.04583176 0.108142658 -2.130943621 -0.972690286 uc022bfs.1 DJ439561 0.804579661 -0.146909612 -2.144251748 -1.294970711 uc022boh.1 TRNA_Arg -0.374651783 -0.813249122 0.405674572 1.192857243 uc022bqs.1 JA760602 1.777092497 1.402566842 -0.215473002 -0.5794229 uc022bqt.1 JA760600 1.263221942 1.146817645 0.80785081 -0.26335039 uc022bqw.1 cytochrome b 0.461657512 0.620584561 1.455470609 -0.256746148 uc022bqx.1 tRNA Pro 1.467088844 1.184277212 -0.602836914 0.254307193 uc022bsa.1 CXorf28 0.103532943 -1.497811809 0.232746744 -0.960732006 uc022btz.1 RPL9 -0.371148215 -1.213256538 1.345821422 1.760597252 uc022cdj.1 SLC25A5-AS1 0.673793922 0.628387008 -2.915651702 -1.115262342 uc022cgl.1 TMEM185A 0.27361303 0.213827185 0.822150711 1.280245275 uc022cjg.1 JB175072 0.489410826 -0.688125903 2.875018119 1.068219866

APPENDIX 10

Table 16. Raw data for prokaryotic analysis

129

APPENDICES

log2FoldChang log2FoldChange log2FoldChang log2FoldChang id start stop annotation e 1-1c 6-1c e 24-1c e 72-1c ctg7180000001708_orf00019 9660 9839 glimmer prediction NA NA 0,857227095 NA ctg7180000001719_orf00030 18035 18475 glimmer prediction 4,939916567 4,939916567 2,666620399 1,54895279 R2846_0576 84326 86002 DNA repair protein RecN 4,462461848 4,462461848 3,118257582 2,255987543 R2846_0885 37499 37729 Probable bacteriophage phi-related protein 4,294050285 4,294050285 1,838906137 1,029971845 R2846_0888 35958 36635 Probable phage repressor protein 4,074057154 4,074057154 6,004072122 6,006891076 R2846_0964 17722 17922 Hypothetical protein 3,960166269 3,960166269 3,517231486 2,577213398 R2846_0260 23444 23707 Toxin-antitoxin locus protein VapB1 3,700933922 3,700933922 1,007262865 0,809425468 ctg7180000001701_orf00004 3872 4192 glimmer prediction 3,688889272 3,688889272 5,21190962 0,892236124 R2846_0965 18141 19142 Conserved hypothetical protein 3,44128154 3,44128154 1,644891872 1,026374877 ctg7180000001703_orf00020 13374 14939 glimmer prediction 3,348204767 3,348204767 3,650983608 2,972368005 R2846_1126 51548 53146 L-lactate permease 3,339977525 3,339977525 3,226024222 2,61761078 R2846_1297 233890 234837 Magnesium/nickel/cobalt transporter CorA 3,258990715 3,258990715 2,26538491 1,579075596 ctg7180000001728_orf00328 187953 188726 glimmer prediction 3,207907808 3,207907808 0,774488068 0,670050377 R2846_0889 35587 35937 Probable phage-related protein 3,141055037 3,141055037 2,606444214 1,987198577 R2846_0352 6702 7988 Putative integrase 3,102441471 3,102441471 0,574929352 -0,202267369 R2846_0886 37006 37455 Probable phage-related protein 3,097451136 3,097451136 1,218466141 0,637643095 ctg7180000001709_orf00051 30695 32071 glimmer prediction 3,056349805 3,056349805 2,808559729 2,201641527 R2846_1552 4736 5047 30S ribosomal protein S10 3,044634766 3,044634766 2,498418299 2,517535143 ctg7180000001709_orf00052 32209 33255 glimmer prediction 3,030382892 3,030382892 1,227347845 0,652997377 R2846_0795 24025 24885 Probable tellurite resistance protein B 2,964395953 2,964395953 1,606497899 1,395768786 Fused chorismate mutase T/prephenate R2846_0811 2595 3728 dehydrogenase 2,937912094 2,937912094 2,349850681 1,350959071 ctg7180000001709_orf00011 3367 3570 glimmer prediction 2,93333342 2,93333342 3,577844314 2,364657371 R2846_1733 21507 22571 DNA recombination protein RecA 2,912574732 2,912574732 0,973041983 0,429732205 R2846_1546 1695 2027 50S ribosomal protein L22 2,897848141 2,897848141 3,496367404 3,280485258 R2846_1548 2340 3161 50S ribosomal protein L2 2,866637956 2,866637956 3,209038106 3,162007441 R2846_1545 970 1677 30S ribosomal protein S3 2,863888893 2,863888893 3,347088151 3,253586655

130

APPENDICES

R2846_0959 12483 12920 Hypothetical protein 2,844342311 2,844342311 3,61822028 2,891212815 R2846_0784 38196 39587 Periplasmic serine protease HtrA 2,823964863 2,823964863 2,086618507 1,010725337 R2846_1389 334452 334760 Hypothetical protein 2,792376792 2,792376792 0,836427468 0,880158494 R2846_1177 103982 104305 grxD 2,780813211 2,780813211 1,873533676 1,568568452 R2846_1542 98 355 30S ribosomal protein S17 2,750761695 2,750761695 2,732974309 2,669933541 R2846_0366 25216 25461 Conserved hypothetical protein 2,721949273 2,721949273 -0,744609843 0,238583432 ctg7180000001720_orf00015 6645 6824 glimmer prediction 2,719331689 2,719331689 -0,1546646 -0,204703714 R2846_1549 3179 3478 50S ribosomal protein L23 2,715373006 2,715373006 2,974987456 2,856976083 R2846_0550 30706 31461 Probable methyltransferase 2,712741156 2,712741156 1,957239109 2,707441187 R2846_1550 3475 4077 50S ribosomal protein L4 2,711634407 2,711634407 3,156579284 2,871915742 R2846_1551 4093 4719 50S ribosomal protein L3 2,702902225 2,702902225 2,686575465 2,616521169 R2846_1543 355 546 50S ribosomal protein L29 2,685353605 2,685353605 3,087218475 2,698632698 Glutamate-ammonia-ligase R2846_0577 81339 84305 adenylyltransferase (ATase) 2,614257812 2,614257812 3,327625698 2,547953359 R2846_1620 29249 29545 Probable toxin-antitoxin relE-like protein 2,592849954 2,592849954 0,737128764 0,501523612 R2846_1544 546 956 50S ribosomal protein L16 2,573378452 2,573378452 2,843542926 2,969775342 R2846_0563 96315 96638 Thioredoxin 2,513044588 2,513044588 1,391480584 1,095528776 R2846_1688 23051 23629 NADPH quinone reductase 2,500948354 2,500948354 2,239670104 2,834570343 R2846_1577 27257 27880 SOS-response transcriptional repressor LexA 2,461056671 2,461056671 0,323790896 -0,053082765 R2846_0259 23704 24108 Toxin-antitoxin locus protein VapC1 2,455074281 2,455074281 0,645418945 0,175260711 R2846_1547 2039 2314 30S ribosomal protein S19 2,429686417 2,429686417 3,1243253 3,018983045 CGSHiEE_05735 19976 20224 HicA 2,367102917 2,367102917 -0,154302762 -0,480589909 R2846_0963 16880 17725 Conserved hypothetical protein 2,35344932 2,35344932 2,539685068 2,419637026 Holliday junction resolvasome, DNA- R2846_0267 17403 18017 binding subunit 2,341097822 2,341097822 0,818331395 0,750174486 R2846_1423 370977 371540 Putative transcriptional regulator AcrR 2,333889491 2,333889491 1,090760385 1,016576019 R2846_1482 432449 433066 Thiol:disulfide interchange protein DsbA 2,313306392 2,313306392 1,095498164 1,144367674 NADP-dependent L-serine/L-allo-threonine R2846_0907 22406 23164 dehydrogenase 2,305181547 2,305181547 1,032849825 0,231009921

131

APPENDICES

R2846_0315 23614 24459 RNA polymerase sigma-32 factor 2,285548428 2,285548428 0,988026406 0,875675284 ctg7180000001728_orf00319 183163 183792 glimmer prediction 2,284431863 2,284431863 1,029275579 0,687758215 R2846_1481 432052 432387 Conserved hypothetical protein 2,276586012 2,276586012 1,328385705 0,898425216 ctg7180000001709_orf00012 3824 3946 glimmer prediction 2,222085493 2,222085493 1,076869425 1,571674721 ctg7180000001728_orf00815 478343 478777 glimmer prediction 2,215873387 2,215873387 2,682500148 2,357892061 R2846_1734 20970 21428 RecA regulator RecX 2,215862692 2,215862692 0,034677698 -0,712364408 ctg7180000001714_orf00085 39837 39953 glimmer prediction 2,200480567 2,200480567 -0,115302996 -0,154484341 R2846_1332 279441 280421 tRNA-dihydrouridine synthase B 2,196014081 2,196014081 1,807275589 1,689029723 R2846_1480 430818 431951 tRNA m(5)U54 methyltransferase 2,187150589 2,187150589 2,445587768 1,856549584 R2846_1700 33537 34028 50S ribosomal protein L10 2,148341371 2,148341371 1,924993608 1,32851902 R2846_0584 74084 74521 Regulator of rRNA transcription (DksA) 2,082022369 2,082022369 0,100584771 -0,017109509 R2846_0040 29804 30031 30S ribosomal subunit protein S18 2,081690171 2,081690171 1,965325173 2,076216026 R2846_0376 37014 37475 Putative transcriptional regulator 2,065901863 2,065901863 1,203686529 0,929711746 R2846_1188 116728 118050 Putative transporter 2,045377163 2,045377163 1,333223101 1,203227083 ctg7180000001715_orf00214 115275 117170 glimmer prediction 2,041556013 2,041556013 3,355010496 3,383758808 ctg7180000001728_orf00337 196352 196585 glimmer prediction 2,031477351 2,031477351 -1,525605195 1,368549965 ctg7180000001718_orf00026 12033 12329 glimmer prediction 2,015289458 2,015289458 0,534735049 -0,095555753 CGSHiGG_06395 2330 2800 30S ribosomal protein S7 2,011949953 2,011949953 1,274547691 1,337464402 ctg7180000001703_orf00058 34481 34756 glimmer prediction 2,000390301 2,000390301 2,400929083 2,228739282 R2846_0736 96061 96645 DnaA inititator-associating protein DiaA 1,995084056 1,995084056 1,370892011 0,451664076 R2846_0887 36792 36974 Conserved hypothetical protein 1,957918731 1,957918731 2,605478791 0,913771603 ctg7180000001724_orf00041 19955 20407 glimmer prediction 1,947535042 1,947535042 0,792868169 0,827169387 R2846_0351 5195 6715 Putative integrase 1,941916382 1,941916382 0,396035962 -0,099696557 R2846_1619 29545 29853 Probable toxin-antitoxin relB-like protein 1,934819651 1,934819651 0,844305702 0,705466473 R2846_1534 479482 479835 50S ribosomal protein L18 1,933768844 1,933768844 2,504196642 2,213935421 R2846_0868 52546 53127 Anthranilate synthase component II 1,933591081 1,933591081 1,022504639 0,864344573 R2846_0899 30015 30266 Putative phage-related protein 1,932359457 1,932359457 0,910671514 0,721602426 ctg7180000001728_orf00817 478967 479467 glimmer prediction 1,924623743 1,924623743 2,111694777 2,102982988

132

APPENDICES

ctg7180000001724_orf00003 863 1600 glimmer prediction 1,918990213 1,918990213 2,387434199 2,300356892 ctg7180000001703_orf00018 12940 13380 glimmer prediction 1,918924602 1,918924602 2,924683292 1,783414676 R2846_0265 18699 19439 Conserved hypothetical protein 1,905700352 1,905700352 0,770411538 0,503301443 ctg7180000001728_orf00367 211314 211793 glimmer prediction 1,896072309 1,896072309 1,068218551 1,741433774 R2846_0354 8793 11624 Excinuclease ABC subunit A 1,888383258 1,888383258 1,886043248 1,227483795 ctg7180000001728_orf00320 183789 184574 glimmer prediction 1,884974097 1,884974097 1,480208221 0,887322841 R2846_1325 272648 274195 2-isopropylmalate synthase 1,880318647 1,880318647 2,33825693 2,234546646 ctg7180000001708_orf00003 3374 3529 glimmer prediction 1,875466971 1,875466971 1,51372199 0,392011742 CGSHiEE_05730 19635 19979 HicB 1,865354717 1,865354717 -0,717726531 -0,337727003 R2846_1576 26290 27114 Diaminopimelate epimerase 1,859637273 1,859637273 0,137538079 0,510794035 ctg7180000001728_orf00816 478781 478960 glimmer prediction 1,856792918 1,856792918 2,39177925 2,187315022 R2846_0737 95689 96048 Conserved hypothetical protein 1,847591189 1,847591189 0,394690693 0,466547465 CGSHiEE_04900 1783 3147 hypothetical protein 1,840957329 1,840957329 1,640830744 1,347541934 R2846_1439 387246 388166 Conserved hypothetical protein 1,840381202 1,840381202 2,115895598 1,550794173 R2846_0041 30048 30497 50S ribosomal subunit protein L9 1,835788556 1,835788556 1,738348104 1,774866978 R2846_0890 35414 35620 Probable phage-related protein 1,827721479 1,827721479 0,112752764 -0,154688399 R2846_0434 26727 26975 30S ribosomal subunit protein S16 1,819945233 1,819945233 1,80237529 2,273664104 ctg7180000001724_orf00037 17854 18177 glimmer prediction 1,81954836 1,81954836 1,573577235 1,380247555 ctg7180000001728_orf00329 188749 189426 glimmer prediction 1,797809643 1,797809643 1,091804737 0,936442547 R2846_1715 7986 8573 Sigma-E factor negative regulatory protein 1,79629496 1,79629496 0,68584373 0,133241154 R2846_1524 473874 474260 50S ribosomal protein L17 1,78720109 1,78720109 1,382108923 1,612429864 ctg7180000001713_orf00046 31550 31669 glimmer prediction 1,783836528 1,783836528 1,000952114 1,708738569 CGSHiEE_04905 1776 1952 hypothetical protein 1,782583381 1,782583381 1,734319499 0,851520965 ctg7180000001712_orf00001 226 483 glimmer prediction 1,782335054 1,782335054 1,889549566 0,475761945 R2846_0923 10234 10662 50S ribosomal protein L13 1,781642792 1,781642792 0,712296958 1,128908006 ctg7180000001728_orf00330 189436 190203 glimmer prediction 1,760514271 1,760514271 1,873453701 1,368660405 R2846_1422 369749 370897 Multidrug efflux system protein AcrA 1,753955858 1,753955858 2,179041874 1,402997858 R2846_1716 7392 7961 RNA polymerase sigma-E (sigma 24) factor 1,753673757 1,753673757 0,746978338 0,44347283

133

APPENDICES

R2846_1536 480398 480790 30S ribosomal protein S8 1,751887029 1,751887029 1,83307601 1,835833884 Probable toxin-antitoxin locus protein R2846_1361 306288 306521 VapB2 1,75133937 1,75133937 0,235487186 -0,329331034 CGSHiEE_05780 26638 27045 HTH-type transcriptional regulator 1,750714143 1,750714143 0,19973988 0,604632006 Periplasmic molecular chaperone for outer R2846_1401 346835 347428 membrane proteins 1,743903621 1,743903621 0,886929719 0,822239654 ctg7180000001698_orf00001 120 1289 glimmer prediction 1,740984056 1,740984056 0,927209518 0,631323835 R2846_0429 21030 21890 DNA adenine methylase 1,740123116 1,740123116 0,557667935 0,772539734 R2846_1579 30646 31980 NADH dehydrogenase 1,730923105 1,730923105 1,160993538 0,994272756 R2846_0636 20121 20525 DNA polymerase III, psi subunit 1,724174358 1,724174358 0,697311616 0,298841594 ctg7180000001728_orf00814 477010 478335 glimmer prediction 1,707238659 1,707238659 2,050482523 2,121910637 R2846_0902 27242 28015 Fumarate/nitrate reduction regulatory protein 1,701189471 1,701189471 0,926360928 1,437177254 R2846_1453 402966 404816 Ribosome binding GTPase BipA 1,694657555 1,694657555 1,986021819 1,449018308 ctg7180000001728_orf00318 181944 182579 glimmer prediction 1,684179881 1,684179881 0,823283846 1,246508923 R2846_1388 333883 334422 Hypothetical protein 1,680704611 1,680704611 -0,024240444 1,139868307 ctg7180000001723_orf00020 7605 7724 glimmer prediction 1,677004833 1,677004833 -0,445519872 -0,081394928 R2846_1535 479849 480382 50S ribosomal protein L6 1,65902131 1,65902131 1,960251809 1,681225944 R2846_0377 37583 38485 Hypothetical protein 1,647512732 1,647512732 1,945210958 2,795172919 R2846_0345 202 816 Probable transport protein 1,635871337 1,635871337 1,439517583 1,872491199 R2846_0590 65106 65819 Conserved hypothetical protein 1,633588008 1,633588008 1,141469467 1,117798903 R2846_1537 480827 481132 30S ribosomal protein S14 1,625604376 1,625604376 1,633561054 1,555321271 R2846_0121 52466 53407 Putative survival protein SurA-like protein 1,623851243 1,623851243 0,605490447 0,360113104 R2846_0437 28362 28712 50S ribosomal subunit protein L19 1,618320916 1,618320916 2,097664613 2,544278609 R2846_1455 405729 406436 Conserved hypothetical protein 1,616661835 1,616661835 1,613538045 1,274921095 R2846_0802 16660 17115 30S ribosomal maturation protein RimP 1,616214121 1,616214121 1,03054815 1,039209072 CGSHiEE_05740 20395 20889 riboflavin synthase subunit alpha 1,614535646 1,614535646 -0,624440859 -0,815812814 ctg7180000001721_orf00097 54190 54771 glimmer prediction 1,594648692 1,594648692 1,97419234 1,48851607 R2846_1399 342980 344311 Protease EcfE (RseP) 1,589787087 1,589787087 0,200222687 -0,183986163 R2846_0358 18300 19448 tRNA-guanine transglycosylase 1,582648858 1,582648858 1,789928914 1,714345543

134

APPENDICES

R2846_0338 45601 46146 Conserved hypothetical protein 1,568802242 1,568802242 2,251141301 1,925592731 2-succinyl-6-hydroxy-2, 4-cyclohexadiene- R2846_0298 11237 11980 1-carboxylate synthase 1,567914815 1,567914815 1,998384836 1,80810897 R2846_0038 29101 29478 30S ribosomal subunit protein S6 1,567537592 1,567537592 1,44566688 1,192985398 ctg7180000001725_orf00107 71220 72098 glimmer prediction 1,565550226 1,565550226 1,333281783 1,254254884 ctg7180000001724_orf00040 18674 19894 glimmer prediction 1,556959645 1,556959645 1,262774844 0,729765012 R2846_0299 12036 13352 Putative transport protein 1,552700403 1,552700403 2,138680273 1,877277213 R2846_0431 23000 23542 Shikimate kinase I 1,549485142 1,549485142 0,502087937 0,192667535 R2846_0829 2365 3879 Sodium/proline symporter 1,543000266 1,543000266 1,94876836 1,481439468 ctg7180000001728_orf00822 481144 481572 glimmer prediction 1,541451973 1,541451973 1,731108636 1,495182339 ctg7180000001709_orf00046 25333 26673 glimmer prediction 1,541287962 1,541287962 1,736944822 1,648317558 ctg7180000001727_orf00154 89937 90047 glimmer prediction 1,534806717 1,534806717 1,585390238 0,120001958 R2846_0436 27585 28325 tRNA (guanine-N1)-methyltransferase 1,526242452 1,526242452 1,86084584 2,552056523 R2846_1421 366651 369749 Multidrug efflux system protein AcrB 1,5194767 1,5194767 2,08132131 1,76431344 ctg7180000001706_orf00052 30006 30230 glimmer prediction 1,509063633 1,509063633 0,558802006 0,631587053 R2846_0123 54510 55169 Thymidylate kinase 1,504206755 1,504206755 2,046743613 1,162417116 R2846_0342 47986 48288 Probable transcriptional regulator ArsR 1,503354911 1,503354911 0,727676246 0,184656641 ctg7180000001709_orf00050 30136 30636 glimmer prediction 1,500236773 1,500236773 1,253150369 0,689987798 ctg7180000001705_orf00001 2 529 glimmer prediction 1,496049402 1,496049402 0,653719949 0,470928479 Iron(III) ABC transporter periplasmic- R2846_0548 29074 30072 binding protein 1,493734813 1,493734813 2,894788365 2,168724106 R2846_1426 373345 373965 Dephospho-CoA kinase 1,488276328 1,488276328 1,266598919 0,972864085 Probable ABC transport system, permease R2846_0775 49152 50120 protein 1,485182927 1,485182927 1,517486427 1,238904004 R2846_1169 96828 97298 Conserved hypothetical protein 1,479355608 1,479355608 1,642807745 0,767633268 R2846_1540 482023 482394 50S ribosomal protein L14 1,472813832 1,472813832 1,223655621 0,942287709 R2846_1351 298129 299304 23S rRNA m(5)U747-methyltransferase 1,464835178 1,464835178 1,266246376 0,743940932 R2846_0921 11252 11890 Stringent starvation protein A 1,461781455 1,461781455 0,353512491 0,056633224 R2846_0323 33379 35532 Heme-hemopexin utilization protein C 1,455706365 1,455706365 1,958091671 1,276907844

135

APPENDICES

Tyrosine-specific transport protein 1 R2846_0103 32908 34110 (HAAAP family) 1,455105243 1,455105243 0,76607469 0,2422043 Probable ferric hydroxamate ABC R2846_1655 8023 8787 transporter, ATP-binding component FhuC 1,454551117 1,454551117 2,59890404 2,693361802 ctg7180000001706_orf00096 52417 52557 glimmer prediction 1,451773951 1,451773951 1,190051444 0,825907702 Probable ABC transport system, periplasmic R2846_1464 412276 413331 binding component 1,444790675 1,444790675 1,088407042 0,49601012 R2846_0248 32211 33803 23S rRNA m5U1939 methyltransferase 1,444159057 1,444159057 1,034454961 0,701995669 R2846_0797 20601 21713 Mrp protein 1,434687257 1,434687257 0,89674255 0,79700062 R2846_0517 33776 34795 Periplasmic zinc-binding protein 1,419230941 1,419230941 1,83366356 1,195584744 ctg7180000001724_orf00001 144 866 glimmer prediction 1,414120652 1,414120652 2,037914062 1,77277238 R2846_0600 56219 56545 Conserved hypothetical protein 1,412192371 1,412192371 -0,080761729 0,428718902 R2846_0900 28522 29436 Probable integrase 1,410500041 1,410500041 1,686047996 0,919908526 ctg7180000001728_orf00321 184584 185084 glimmer prediction 1,409222533 1,409222533 1,037920301 0,570177128 R2846_1699 33111 33482 50S ribosomal protein L7/L12 1,407859965 1,407859965 1,150179988 1,298183235 CGSHiEE_05815 30099 30386 50S ribosomal protein L25 1,403851905 1,403851905 1,054876053 0,606502535 R2846_0687 32360 33463 Lipopolysaccharide export permease, LptF 1,394541639 1,394541639 1,06648724 0,782388388 ctg7180000001724_orf00030 14127 14321 glimmer prediction 1,379202972 1,379202972 1,264315256 1,05690389 R2846_0346 888 1286 Probable transcriptional regulator 1,377892272 1,377892272 0,10374446 -0,147955275 R2846_0879 43704 43877 Hypothetical protein 1,375051651 1,375051651 0,61798326 1,118601959 ctg7180000001724_orf00038 18234 18614 glimmer prediction 1,37312866 1,37312866 1,053957912 1,042537924 R2846_1331 279148 279447 DNA architectural protein Fis 1,372264087 1,372264087 1,055405919 0,990490681 R2846_0661 2830 3063 Conserved hypothetical protein 1,371527075 1,371527075 -0,645174823 1,29312628 R2846_0592 63092 63841 Uxu operon transcriptional regulator 1,371387344 1,371387344 -0,243668466 -0,181302488 ctg7180000001724_orf00042 20460 21185 glimmer prediction 1,370720985 1,370720985 0,475540322 0,186519438 DNA-directed RNA polymerase subunit R2846_1525 474301 475287 alpha 1,370508322 1,370508322 1,389666581 1,640047112 R2846_0565 95722 95979 Hypothetical protein 1,370447894 1,370447894 1,578425112 0,89766588 Probable ABC transport system, R2846_0776 48529 49149 periplasmic-binding protein 1,36760852 1,36760852 1,105438419 0,71209228

136

APPENDICES

ctg7180000001727_orf00042 21636 21785 glimmer prediction 1,364809923 1,364809923 0,926090355 0,389896094 Phenylalanyl-tRNA synthetase, alpha R2846_0974 25981 26970 subunit 1,352933841 1,352933841 0,010668244 -0,267065582 R2846_0834 102774 103238 Conserved hypothetical protein 1,348592126 1,348592126 1,73667895 0,352776824 R2846_0971 22730 23215 Putative lipoprotein 1,34818199 1,34818199 1,22471662 1,231527669 R2846_0685 28732 30741 Osmoprotection-related protein BetT 1,348018655 1,348018655 0,990343906 1,340412717 FKBP-type peptidyl-prolyl cis-trans R2846_0010 1892 2617 isomerase (PPIase) 1,342450853 1,342450853 0,433124538 0,394421458 R2846_0247 33836 35284 Hypothetical protein 1,337163959 1,337163959 0,1289628 -0,258561001 R2846_0922 10679 11071 30S ribosomal protein S9 1,334632229 1,334632229 0,535173717 1,088737465 ctg7180000001724_orf00035 17317 17841 glimmer prediction 1,334240696 1,334240696 1,282636261 0,856621558 R2846_0356 16295 16741 Hypothetical protein 1,33183784 1,33183784 0,237362479 0,698567512 R2846_1391 335282 335536 Toxin-antitoxin system protein, StbD 1,329581239 1,329581239 -0,777318625 -1,321550842 R2846_0867 53140 54696 Anthranilate synthase component I 1,329277198 1,329277198 1,133736408 0,576346807 R2846_0973 23560 25947 Phenylalanyl-tRNA synthetase, beta subunit 1,328908239 1,328908239 1,285127258 1,278420897 CGSHiGG_06410 144 2246 elongation factor Tu 1,313442246 1,313442246 1,50524059 1,580441874 R2846_1483 433077 433343 Conserved hypothetical protein 1,312273154 1,312273154 0,101798396 0,565743833 R2846_0479 70244 70768 50S ribosomal protein L32 1,300450523 1,300450523 0,800647346 0,344222739 ctg7180000001728_orf00106 56369 57058 glimmer prediction 1,299375971 1,299375971 1,47757908 1,048005639 R2846_1497 445472 445777 Trp operon repressor 1,29755421 1,29755421 -0,05165471 -0,453117767 R2846_0122 53477 54520 Conserved hypothetical protein 1,294046931 1,294046931 1,631901024 0,909505144 Probable toxin-antitoxin locus protein R2846_0777 47899 48204 (HigB-family) 1,290491551 1,290491551 -1,589748092 -1,453631293 ctg7180000001718_orf00025 11858 12040 glimmer prediction 1,281403811 1,281403811 -0,52876373 -0,565738649 Probable ferric hydroxamate ABC R2846_1657 9667 11637 transporter, permease component FhuB 1,280998011 1,280998011 3,500435103 2,725202254 R2846_1438 386908 387165 50S ribosomal protein L27 1,272872807 1,272872807 0,546126656 0,494185513 ctg7180000001709_orf00027 12092 12556 glimmer prediction 1,270977028 1,270977028 -0,022098223 0,538662948 R2846_0621 36505 37467 Lipoate biosynthesis protein A 1,269610911 1,269610911 1,86293658 1,031452112 R2846_0357 16865 17956 S-adenosylmethionine:tRNA 1,262298094 1,262298094 1,425060344 1,079408756

137

APPENDICES

ribosyltransferase-isomerase (queuosine biosynthesis protein) R2846_0359 19513 20031 Conserved hypothetical protein 1,259841207 1,259841207 1,952260727 1,765610189 ctg7180000001727_orf00064 35147 35305 glimmer prediction 1,25371745 1,25371745 0,502643151 0,230078944 R2846_0530 2757 4994 Probable TonB-dependent heme receptor 1,251561624 1,251561624 0,946806694 0,543307885 R2846_0343 48352 48756 Arsenate reductase 1,251114262 1,251114262 0,265829242 -0,081540799 R2846_0670 15270 15623 Conserved hypothetical protein 1,249822772 1,249822772 0,361021085 0,41000211 R2846_0427 18496 19146 GTP cyclohydrolase II 1,24374788 1,24374788 0,699554464 0,146018521 R2846_0564 95990 96256 Hypothetical protein 1,234406194 1,234406194 1,035166566 1,723163487 R2846_0972 23268 23558 Integration host factor, alpha subunit 1,233714182 1,233714182 2,042101243 0,771909969 Dipeptide ABC transporter, permease R2846_1157 87285 88256 protein DppB 1,23360885 1,23360885 1,365159646 1,50410072 R2846_0428 19215 19940 Putative phosphatidylglycerophosphatase B 1,233180487 1,233180487 0,817687539 0,420865008 R2846_0877 44496 44669 Hypothetical protein 1,232743622 1,232743622 0,186153668 -0,127142755 R2846_0878 43980 44414 DNA polymerase III, chi subunit 1,224095704 1,224095704 0,10938801 -0,003539037 R2846_0375 35773 36975 Na+/H+ antiporter 1 1,222669297 1,222669297 0,411531721 0,988645402 R2846_0070 59275 63306 DNA-directed RNA polymerase beta chain 1,222576146 1,222576146 2,03164497 1,978488096 R2846_1133 61843 63351 Lysyl-tRNA synthetase 1,219268633 1,219268633 0,792181553 0,876799921 R2846_1528 476372 476728 30S ribosomal protein S13 1,214576853 1,214576853 0,820894923 0,958541489 ctg7180000001728_orf00809 475319 475939 glimmer prediction 1,213799065 1,213799065 1,187142407 1,396042849 R2846_1340 287122 287571 3-dehydroquinate dehydratase II 1,210153608 1,210153608 0,101005265 -1,063628878 R2846_0908 21194 22387 Tryptophan synthase, beta subunit 1,20889945 1,20889945 0,473051356 0,131137093 R2846_0360 20028 20249 Conserved hypothetical protein 1,205556605 1,205556605 2,330922504 1,995125745 R2846_0039 29507 29791 Primosomal replication protein N 1,202665391 1,202665391 1,53529367 1,363280373 ctg7180000001706_orf00196 105175 105519 glimmer prediction 1,201429522 1,201429522 1,638466426 1,052704023 R2846_1597 57314 57619 Frataxin-like protein CyaY 1,196705515 1,196705515 0,7343767 0,223231874 R2846_1344 290329 290598 30S ribosomal protein S20 1,193909858 1,193909858 -0,004446022 -0,039467943 ctg7180000001728_orf00813 476868 476981 glimmer prediction 1,188275608 1,188275608 0,57236912 1,303313929 R2846_0904 25155 25991 Putative ABC transporter, periplasmic- 1,182211493 1,182211493 1,07503452 1,535177123

138

APPENDICES

binding protein

R2846_0804 12625 15144 Translation initiation factor 2 1,180982055 1,180982055 1,645071319 1,460661822 R2846_0803 15156 16643 Transcription elongation factor NusA 1,17840966 1,17840966 1,27144927 1,226363562 R2866_1103 1612 2328 Hypothetical protein 1,173317018 1,173317018 1,101841824 1,110475836 R2846_0962 16119 16880 Hypothetical protein 1,172636732 1,172636732 1,594737343 1,106307116 ctg7180000001698_orf00002 1327 2154 glimmer prediction 1,172493791 1,172493791 0,131739992 0,139204837 R2846_0643 12105 12569 Conserved hypothetical protein 1,171751089 1,171751089 0,626881378 0,371588903 R2846_1539 481701 482012 50S ribosomal protein L24 1,167724057 1,167724057 0,99377863 0,929056068 ctg7180000001724_orf00033 16580 17266 glimmer prediction 1,167153993 1,167153993 1,415900724 1,098841091 16S rRNA C1402 ribose 2-O- R2846_0739 93039 93890 methyltransferase, SAM-dependent 1,167150135 1,167150135 0,458758033 0,605607053 Spermidine/putrescine ABC transporter, R2846_0823 9727 10587 permease protein 1,162602363 1,162602363 1,296049182 0,864120659 ctg7180000001702_orf00012 4466 4651 glimmer prediction 1,158197441 1,158197441 1,751257002 0,217277022 R2846_0336 44810 45022 Conserved hypothetical protein 1,154838153 1,154838153 2,002299377 0,72915644 R2846_0909 20388 21194 Tryptophan synthase, alpha subunit 1,140474089 1,140474089 0,572087255 0,16226564 ctg7180000001721_orf00098 54859 55437 glimmer prediction 1,133868125 1,133868125 0,879204015 0,381720785 CGSHiGG_06390 2958 3332 30S ribosomal protein S12 1,130742678 1,130742678 0,525460171 0,985186324 ctg7180000001718_orf00070 31128 31256 glimmer prediction 1,129924277 1,129924277 -0,88998242 -0,059477262 R2846_0430 21892 22980 3-dehydroquinate synthase 1,129119708 1,129119708 0,77342995 0,671049623 ctg7180000001709_orf00035 18037 19557 glimmer prediction 1,127619011 1,127619011 0,855648081 0,993617656 Probable ABC transport system, permease R2846_1463 411248 412270 component 1,123475931 1,123475931 1,592515351 1,269447585 R2846_1488 437409 438425 Nucleoid associated protein NdpA 1,113014211 1,113014211 -0,124849637 -0,188164 R2846_0916 15574 17031 Thiamine biosynthesis protein ThiI 1,104492111 1,104492111 0,931610221 0,799205472 R2846_0609 49547 50602 Rod shape-determining protein MreC 1,103895339 1,103895339 1,417378724 0,502113854 R2846_1110 31112 31477 Hypothetical protein 1,094952603 1,094952603 0,123426439 0,437019381 R2846_0337 45174 45566 Conserved hypothetical protein 1,094680214 1,094680214 -0,019708166 0,539251724 R2846_1447 396130 396819 Hypothetical protein 1,089618602 1,089618602 0,445340843 0,478163974

139

APPENDICES

ctg7180000001728_orf00154 87194 87310 glimmer prediction 1,089538188 1,089538188 1,60268833 0,22264195 1,4-dihydroxy-2-naphthoate R2846_0074 6440 7351 octaprenyltransferase 1,076122427 1,076122427 0,960818298 0,861667083 ADP-L-glycero-D-mannoheptose-6- R2846_1227 158163 159089 epimerase 1,0726782 1,0726782 0,584698386 0,269244228 R2846_0435 27020 27547 16S rRNA processing protein RimM 1,071802894 1,071802894 1,290949567 1,877201893 Formate dehydrogenase formation protein R2846_0642 12831 13643 FdhD 1,071410261 1,071410261 0,12648508 -0,040807661 ctg7180000001726_orf00040 21181 22695 glimmer prediction 1,06915509 1,06915509 0,764310586 0,676609947 ctg7180000001701_orf00003 1978 3879 glimmer prediction 1,065068539 1,065068539 0,948984338 0,303867855 R2846_0125 56204 56986 Putative Mg-dependent Dnase (TatD-family) 1,060663298 1,060663298 1,991201861 1,662835419 ctg7180000001728_orf00592 341192 341320 glimmer prediction 1,054858104 1,054858104 -0,259783289 0,083395372 R2846_1392 335526 335816 Toxin-antitoxin system protein, StbE 1,052479518 1,052479518 -0,610167183 -1,360059014 R2846_0551 31761 32558 hypothetical protein 1,051925898 1,051925898 1,161098939 0,86730017 R2846_1489 438491 438904 Putative small protein A -like protein 1,050943167 1,050943167 0,281700316 -0,037563431 R2846_1555 6984 8186 Signal recognition particle receptor FtsY 1,049121902 1,049121902 0,24481905 -0,003519012 Probable ferric hydroxymate uptake protein R2846_1658 11756 13927 FhuA 1,046194003 1,046194003 2,444623067 1,881840096 DL-methionine transporter, ATP binding R2846_0410 53628 54665 protein MetN 1,045296039 1,045296039 -0,324146612 -0,631914593 R2846_0071 217 4467 DNA-directed RNA polymerase beta chain 1,043102952 1,043102952 2,304444058 2,344454931 Probable ferric hydroxamate ABC transporter, periplasmic binding component R2846_1656 8789 9673 FhuD 1,042016579 1,042016579 2,45429655 2,525214734 R2846_1170 97638 98792 S-adenosylmethionine synthetase 1,04108782 1,04108782 0,387523528 -0,210269366 R2846_0917 15187 15426 Exodeoxyribonuclease VII, small subunit 1,033615335 1,033615335 -0,189004106 -0,125871141 ctg7180000001715_orf00040 25869 26243 glimmer prediction 1,031546498 1,031546498 0,470406906 1,114099803 R2846_0931 3860 4330 Conserved hypothetical protein 1,029548977 1,029548977 0,335484144 -0,252088774 ctg7180000001709_orf00032 15557 16048 glimmer prediction 1,023660969 1,023660969 -0,432869652 -1,302904579 R2846_0613 44210 44518 Conserved hypothetical protein 1,023471731 1,023471731 0,507510907 -0,080428291 R2846_0671 15625 15969 Iron-sulfur cluster insertion protein ErpA 1,022215547 1,022215547 0,258147641 0,384180943

140

APPENDICES

R2846_0477 69217 70089 Phosphatidylserine decarboxylase 1,021381397 1,021381397 0,979364603 0,795298981 R2846_0387 10900 11319 Conserved hypothetical protein 1,016522986 1,016522986 0,940369665 0,93459644 R2846_0091 23905 24507 Putative hydrolase/phosphatase 1,014931235 1,014931235 0,450801064 0,280187732 ctg7180000001718_orf00058 23066 23266 glimmer prediction 1,012451959 1,012451959 1,917916898 2,33627595 R2846_1390 334760 334984 Hypothetical protein 1,01240351 1,01240351 1,32388423 1,161367618 ctg7180000001725_orf00105 70791 70961 glimmer prediction 1,009740663 1,009740663 0,06848964 0,792946691 R2846_0045 33172 33477 Urease beta subunit 1,00838258 1,00838258 0,467406795 -0,040239136 R2846_1614 36791 37207 Probable preprotein translocase SecE subunit 1,00565445 1,00565445 0,46228566 0,977447868 R2846_0616 40608 41723 Rod shape-determining protein 1,003256464 1,003256464 1,095368857 0,987683135 ctg7180000001727_orf00032 18510 18626 glimmer prediction 1,001149999 1,001149999 0,614746315 1,351201667 ctg7180000001709_orf00049 27369 30134 glimmer prediction 0,991669448 0,991669448 1,513494016 1,132084247 ctg7180000001724_orf00032 14702 16561 glimmer prediction 0,985708864 0,985708864 1,60121703 1,183377732 ctg7180000001724_orf00031 14321 14662 glimmer prediction 0,985439591 0,985439591 0,882303818 0,765437192 ctg7180000001709_orf00034 16048 17769 glimmer prediction 0,983879311 0,983879311 -0,411655147 -0,70020223 R2846_0314 22642 23574 tRNA-dihydrouridine synthase YohI 0,979304087 0,979304087 0,88877685 0,755260245 R2846_0147 76258 76854 Fe/S biogenesis protein NfuA 0,97875126 0,97875126 0,492376035 0,113151487 R2846_0629 26941 27600 Uracil DNA glycosylase 0,976187053 0,976187053 0,189790532 0,319453313 Probable ABC transporter, multidrug efflux R2846_1282 217756 219600 pump 0,972789048 0,972789048 1,366797862 1,505511809 Lipopolysaccharide biosynthesis protein R2846_0694 41289 42062 LsgD 0,972787155 0,972787155 0,550698168 0,649956834 Lipopolysaccharide biosynthesis protein R2846_0691 38098 39303 LsgA 0,971992367 0,971992367 0,824065417 0,762805447 CGSHiEE_05725 16982 19591 aminopeptidase N 0,971292974 0,971292974 0,056132434 -0,310405253 ctg7180000001728_orf00323 185787 186089 glimmer prediction 0,968075468 0,968075468 0,929169289 0,701533843 R2846_1307 245156 245671 Lipoprotein signal peptidase 0,96749288 0,96749288 0,589668004 0,439139525 ctg7180000001709_orf00048 26734 27351 glimmer prediction 0,96539407 0,96539407 0,766229293 0,596388747 R2846_0788 33022 34098 Homoserine O-acetyltransferase 0,949824136 0,949824136 0,530314673 0,34334462 R2846_1425 373146 373352 zinc-binding protein YacG 0,949740795 0,949740795 0,439295135 0,173300304

141

APPENDICES

Acyltransferase for 30S ribosomal subunit protein S18; acetylation of N-terminal R2846_0637 19678 20118 alanine 0,949349841 0,949349841 0,219240203 0,549369406 Probable tryptophan-specific transport R2846_0294 5439 6695 protein 0,948364441 0,948364441 0,732134962 -0,502297763 R2846_0944 1667 1966 RNA-binding protein YhbY 0,944066564 0,944066564 -0,403944085 -0,169526554 R2846_0124 55166 56149 DNA polymerase III, delta subunit 0,942654441 0,942654441 1,709767528 1,21012098 R2846_0933 2103 3164 Peptide methionine sulfoxide reductase 0,942369139 0,942369139 0,380808693 -0,241873946 ctg7180000001728_orf00052 27603 28187 glimmer prediction 0,941725459 0,941725459 0,179176225 0,0839968 Membrane-bound lytic murein R2846_0519 35744 36853 transglycosylase A 0,938203032 0,938203032 1,055512668 0,577213501 R2846_0054 44001 44216 30S ribosomal subunit protein S21 0,929771367 0,929771367 0,33973367 0,156300485 R2846_0755 77433 78059 Uracil phosphoribosyltransferase 0,929360605 0,929360605 -0,922857561 -0,92482219 tRNA mo(5)U34 methyltransferase, SAM- R2846_0828 3876 4841 dependent 0,924668506 0,924668506 1,410256495 1,185845914 ctg7180000001719_orf00028 16877 17965 glimmer prediction 0,924225778 0,924225778 0,629611524 0,379878249 R2846_0547 27436 28893 Iron(III) ABC transporter permease protein 0,922833889 0,922833889 1,078399303 0,9995603 R2846_1226 157607 158110 Putative thioredoxin 0,921248167 0,921248167 0,300979594 0,224365036 R2846_0601 55562 56116 Conserved hypothetical protein 0,920287535 0,920287535 0,535716826 0,531521325 Holliday junction resolvasome, ATPase R2846_0268 16388 17395 subunit 0,920252311 0,920252311 0,759376797 0,680457454 ctg7180000001728_orf00110 57055 57456 glimmer prediction 0,915769289 0,915769289 1,010675224 0,519763295 R2846_0898 30697 31188 Hypothetical protein 0,914604708 0,914604708 0,579164311 0,602676413 ctg7180000001728_orf00111 57755 59482 glimmer prediction 0,911860797 0,911860797 1,276043164 0,784853307 ctg7180000001720_orf00016 6895 7068 glimmer prediction 0,907447559 0,907447559 2,2175408 1,427459931 R2846_0568 92826 94205 Cysteinyl-tRNA synthetase 0,90315634 0,90315634 0,414289589 0,322434112 R2846_1393 335852 336106 Hypothetical protein 0,902285364 0,902285364 -1,032648757 -1,123924962 ctg7180000001728_orf00324 186110 186367 glimmer prediction 0,9000249 0,9000249 0,94680491 0,501232058 ctg7180000001706_orf00133 74777 75112 glimmer prediction 0,898727633 0,898727633 1,347217815 -0,412067782 R2846_0447 40086 40610 Flavodoxin 1 0,896312232 0,896312232 -0,398772275 -0,27950016

142

APPENDICES

R2846_1612 37917 38669 Lipoprotein VacJ 0,896117621 0,896117621 0,043338764 0,203816397 Probable outer membrane protein assembly R2846_0462 55080 55868 complex subunit BamD 0,894877994 0,894877994 0,333192362 0,073453133 R2846_0418 4994 5623 Conserved hypothetical protein 0,892653769 0,892653769 0,805742908 0,390989004 R2846_0873 46302 49166 Valyl-tRNA synthetase 0,887056176 0,887056176 1,061325159 0,871465278 R2846_0748 82798 83082 Integration host factor, beta-subunit 0,881299181 0,881299181 0,662236075 0,270064361 R2846_0662 3139 4722 Peptide chain release factor 3 0,880794435 0,880794435 0,743355442 0,20269774 R2846_0295 6812 8026 Putative aminotransferase 0,880554554 0,880554554 0,441745743 0,172734625 R2846_0264 19599 20063 dATP pyrophosphohydrolase 0,8794864 0,8794864 0,551281788 -0,347812741 Spermidine/putrescine ABC transporter, R2846_0824 8595 9743 ATP-binding protein 0,875546419 0,875546419 0,484843994 -0,001830183 Spermidine/putrescine ABC transporter, R2846_0822 10587 11357 permease protein 0,875512946 0,875512946 1,570002768 1,165528721 R2846_1574 25194 25520 Conserved hypothetical protein 0,869531719 0,869531719 0,581270212 1,075051121 R2846_1474 424583 425344 Heme oxygenase 0,863964422 0,863964422 0,548310543 0,901857971 R2846_1687 22051 22938 Transcriptional regulator CrgA 0,86309497 0,86309497 -0,280457084 0,094563712 CGSHiGG_00325 10183 11118 lipid A biosynthesis lauroyl acyltransferase 0,86166967 0,86166967 0,326966195 0,613125523 R2846_0920 11890 12342 Stringent starvation protein B 0,861327827 0,861327827 0,563958298 0,347928496 CGSHiEE_05715 14858 16252 multidrug efflux protein 0,860493365 0,860493365 1,23619223 0,969987459 Malonyl CoA-acyl carrier protein R2846_0481 189 1127 transacylase 0,858816362 0,858816362 0,16109828 0,23329203 R2846_1127 53446 56292 Heme-utilization protein Hup 0,856291937 0,856291937 0,594919905 0,755196972 R2846_1714 8653 9600 Periplasmic negative regulator of sigmaE 0,85562566 0,85562566 1,001551944 0,361948013 ctg7180000001728_orf00382 216781 217677 glimmer prediction 0,855509679 0,855509679 0,296112438 -0,055813982 ctg7180000001728_orf00584 336276 336413 glimmer prediction 0,855474843 0,855474843 -0,513253135 -1,231160644 R2846_0705 50985 52061 Electron transport complex protein RnfD 0,855356552 0,855356552 1,299715281 1,171597068 ctg7180000001726_orf00036 19307 19771 glimmer prediction 0,852790626 0,852790626 1,103120471 0,240384361 R2846_1637 7255 8733 Ketol-acid reductoisomerase 0,851932803 0,851932803 0,460457869 0,707612689 Probable toxin-antitoxin locus protein R2846_1362 306521 306919 VapC2 0,849437562 0,849437562 -0,314055208 -0,473980281

143

APPENDICES

ctg7180000001706_orf00137 75543 77972 glimmer prediction 0,840493504 0,840493504 0,766199192 0,252193913 R2846_0969 21197 21652 Conserved hypothetical protein 0,835345458 0,835345458 1,078773934 0,497598604 ctg7180000001728_orf00402 227966 228292 glimmer prediction 0,829718535 0,829718535 1,171450232 0,853810265 R2846_0780 45328 45711 Conserved hypothetical protein 0,828567776 0,828567776 1,487255887 0,906635003 ctg7180000001710_orf00009 2481 2609 glimmer prediction 0,826423554 0,826423554 -0,10027028 1,599297584 R2846_0372 33106 33624 Putative glycosyltransferase 0,825584763 0,825584763 -0,959926944 -0,360081253 ctg7180000001725_orf00003 4997 5149 glimmer prediction 0,822170147 0,822170147 0,240265133 0,440008828 ctg7180000001721_orf00104 57713 59869 glimmer prediction 0,821907716 0,821907716 1,510425511 0,919817544 R2846_0157 86335 87057 Putative methyltransferase 0,821334649 0,821334649 0,317766333 0,400941821 Probable toxin-antitoxin locus protein R2846_0778 47565 47888 (HigA-family) 0,820445696 0,820445696 -0,970990972 -1,269493459 Probable ABC transporter, ATPase R2846_0792 26491 27255 component 0,820150399 0,820150399 -0,964273553 0,830328887 Probable ABC transport system, ATP- R2846_0779 45731 47401 binding protein 0,820085472 0,820085472 0,291044425 0,532519549 R2846_1229 160678 161997 D-xylose isomerase 0,818806267 0,818806267 0,393110147 0,370943813 R2846_0749 82430 82723 Conserved hypothetical protein 0,816168801 0,816168801 0,949390113 0,697587723 R2846_1607 41153 42616 TRK system potassium uptake protein TrkH 0,816023003 0,816023003 0,570255779 0,438205212 ctg7180000001728_orf00112 59770 60459 glimmer prediction 0,810201813 0,810201813 0,442547148 0,17926793 R2846_0159 88456 89835 Putative protease 0,809724065 0,809724065 0,778452628 0,689943564 R2846_0090 23432 23905 Conserved hypothetical protein 0,805810835 0,805810835 0,942093776 0,731690372 Outer membrane protein assembly factor R2846_1400 344331 346727 BamA 0,805181731 0,805181731 0,508078721 -0,233792682 R2846_1437 386576 386887 50S ribosomal protein L21 0,804785722 0,804785722 0,062367962 0,102441754 R2846_0581 76693 77169 Conserved hypothetical protein 0,803285714 0,803285714 -0,397440034 -0,220367964 R2846_1469 420106 420669 Conserved hypothetical protein 0,799498914 0,799498914 0,003447381 0,032990069 NADPH-dependent 7-cyano-7-deazaguanine R2846_0812 1723 2562 reductase QueF 0,798989667 0,798989667 1,137190743 0,803955365 ctg7180000001711_orf00025 12212 12361 glimmer prediction 0,798225357 0,798225357 -0,894115459 0,163041846 CGSHiEE_05625 2284 2448 hypothetical protein 0,79610526 0,79610526 0,067618577 0,123296731

144

APPENDICES

R2846_0075 7403 7891 Regulator of ribonuclease activity A 0,794323487 0,794323487 -0,359734423 -0,483669289 CGSHiEE_05675 8220 8831 hypothetical protein 0,794230345 0,794230345 1,552180571 1,200338276 Peroxiredoxin/glutaredoxin glutathione- R2846_0012 3028 3753 dependent peroxidase 0,792315676 0,792315676 0,6505351 0,176450789 R2846_0870 51057 52058 Anthanilate phosphoribosyltransferase 0,789110828 0,789110828 0,281651383 0,316367924 Large conductance mechanosensitive R2846_1718 6551 6937 channel 0,784581813 0,784581813 0,433185961 0,477481304 R2846_0869 52111 52497 Conserved hypothetical protein 0,782592455 0,782592455 0,808317201 0,087331334 Putative lipooligosaccharide biosynthesis R2846_1450 398761 399978 protein 0,779475142 0,779475142 0,068917709 -0,045109423 Probable branched-chain amino acid R2846_0659 1667 2401 permease AzlC 0,776512465 0,776512465 1,523327444 1,008480247 R2846_1446 395110 396024 Lipooligosaccharide sialyltransferase SiaA 0,775635484 0,775635484 -0,014459168 0,094464241 ctg7180000001728_orf00326 186378 187652 glimmer prediction 0,770937592 0,770937592 1,063490069 0,650587792 R2846_1123 47986 49002 Conserved hypothetical protein 0,770210754 0,770210754 0,65452524 0,452610766 R2846_0552 32567 33703 Glycerate kinase 0,770024592 0,770024592 1,028273825 0,946644685 R2846_0666 8832 10313 Conserved hypothetical protein 0,768622474 0,768622474 0,803803616 0,629797192 R2846_1527 475967 476356 30S ribosomal protein S11 0,765695155 0,765695155 0,760631538 0,964953026 R2846_1345 290901 292433 Peptidoglycan lipid II flippase 0,765072933 0,765072933 0,480527449 0,67700598 ctg7180000001715_orf00159 87014 87184 glimmer prediction 0,764634598 0,764634598 -0,06485222 -0,226569218 Thiamin ABC transporter, periplasmic- R2846_1304 242454 243452 binding protein 0,763985377 0,763985377 0,071800737 0,843362517 ctg7180000001712_orf00019 12651 12893 glimmer prediction 0,759351469 0,759351469 1,103614921 0,317485787 R2846_1342 288687 289544 Naphthoate synthase 0,755808018 0,755808018 0,533989998 0,53848137 R2846_0872 49198 49470 Hydrogenase 2 accessory protein 0,755538504 0,755538504 0,618568679 1,115905815 R2846_0876 44632 45252 Hypothetical protein 0,749306894 0,749306894 0,249028998 -0,065416251 ctg7180000001728_orf00723 429282 429425 glimmer prediction 0,749086141 0,749086141 -0,278225236 0,904805834 Peptide ABC transporter system, ATPase R2846_1122 47165 47974 protein SapF 0,748521037 0,748521037 -0,124307672 0,062209095 Arginine ABC transporter, permease protein R2846_1166 95034 95717 ArtM 0,748263705 0,748263705 1,045546245 1,381124852

145

APPENDICES

R2846_0514 30078 31268 Cystathionine beta-lyase 0,745451786 0,745451786 0,263242917 0,425592483 ctg7180000001719_orf00031 18802 20004 glimmer prediction 0,745034373 0,745034373 0,630016232 1,082087601 R2846_0608 50602 51090 Rod shape-determining protein MreD 0,744056884 0,744056884 1,211435539 0,559588588 R2846_1496 444745 445485 biosynthetic peptidoglycan transglycosylase 0,74083805 0,74083805 -0,166897582 -0,28472967 R2846_0369 27634 29475 ATP-dependent RNA helicase DeaD 0,740792362 0,740792362 2,111464649 2,110174254 R2846_0967 19930 20424 Hypothetical protein 0,740753392 0,740753392 0,081260619 0,646900423 Anaerobic ribonucleoside-triphosphate R2846_1187 116161 116628 reductase activating protein 0,739074845 0,739074845 0,920247188 1,028264746 R2846_1359 304259 304429 50S ribosomal protein L33 0,737810915 0,737810915 -0,160533093 0,061547475 R2846_0914 17361 18080 tRNA U65 pseudouridine synthase 0,735371006 0,735371006 0,376166807 0,625822158 ctg7180000001718_orf00087 39049 39648 glimmer prediction 0,73157557 0,73157557 1,193071881 1,354816736 UDP-N-acetylmuramate:L-alanyl-gamma-D- R2846_0515 31662 33107 glutamyl- meso-diaminopimelate ligase 0,729494224 0,729494224 0,126342479 0,271225888 R2846_0744 86989 87567 Glutamine amidotransferase subunit PdxT 0,727383003 0,727383003 0,141861156 0,117445894 R2846_1367 311738 312187 Transcriptional regulator NrdR 0,726912844 0,726912844 0,361399048 0,471622107 R2846_0322 31610 33304 Heme-hemopexin utilization protein B 0,721913975 0,721913975 1,983851198 1,184795245 R2846_0353 8133 8639 Single-stranded DNA-binding protein 0,715790222 0,715790222 -0,54035541 -0,53433739 R2846_0286 411 797 Copper-responsive transcriptional regulator 0,715708725 0,715708725 -0,46201113 0,229854119 R2846_1487 437065 437283 Conserved hypothetical protein 0,713679224 0,713679224 -0,58993345 -0,601753626 R2846_0561 97766 98911 Cystathionine gamma-synthase 0,713372762 0,713372762 0,472768265 0,536821569 Diadenosine tetraphosphatase (Ap4A R2846_0032 23985 24812 hydrolase) 0,70928198 0,70928198 -0,21631293 -0,225470922 R2846_1516 464790 466163 Argininosuccinate lyase 0,707889298 0,707889298 1,529653465 0,934307876 Holliday junction resolvasome, R2846_0266 18080 18652 endodeoxyribonuclease subunit 0,705862991 0,705862991 0,880356273 0,593274147 CGSHiEE_05720 16296 16910 riboflavin synthase subunit alpha 0,705536718 0,705536718 -0,401401483 -0,410936443 ctg7180000001702_orf00011 4274 4456 glimmer prediction 0,702873857 0,702873857 0,785132561 1,434560338 ctg7180000001714_orf00054 28560 28703 glimmer prediction 0,702188337 0,702188337 -0,744193131 -1,809773533 R2846_1310 249445 250830 tRNA modification GTPase mnmE 0,698849138 0,698849138 1,424667042 1,026262151 R2846_0326 37725 38312 dITP/XTP pyrophosphatase 0,698821918 0,698821918 0,339571582 -0,447835168

146

APPENDICES

R2846_0615 41713 43668 Penicillin-binding protein 2 0,697391015 0,697391015 0,866759351 0,408229214 23S rRNA m(3)Psi1915 pseudouridine R2846_0614 43689 44156 methyltransferase 0,695396747 0,695396747 0,417235548 0,439167179 Probable TRAP-type transport system, small R2846_0595 60354 60851 permease component 0,693857098 0,693857098 0,232029247 -0,895929095 R2846_0160 90004 91347 Putative permease 0,688696191 0,688696191 1,440130037 1,127084298 CGSHiGG_00295 3318 3581 glutaredoxin 0,68839049 0,68839049 -0,732021229 -0,496823154 R2846_1702 35692 36309 Conserved hypothetical protein 0,687874897 0,687874897 -0,46093264 0,265921265 R2846_0301 14573 15226 Conserved hypothetical protein 0,686943645 0,686943645 -0,141703824 -0,080061028 ctg7180000001709_orf00028 12883 13452 glimmer prediction 0,684584027 0,684584027 -0,359224111 -0,344440943 R2846_1436 385373 386362 Octaprenyl-diphosphate synthase 0,680719128 0,680719128 -0,068554316 -0,052538947 R2846_0262 22082 22600 Conserved hypothetical protein 0,680260728 0,680260728 0,200450504 0,407489887 Acetyl-CoA carboxylase, biotin carboxyl R2846_1339 286503 286970 carrier protein 0,679762059 0,679762059 0,257315269 0,536691103 R2846_0875 45279 45593 Conserved hypothetical protein 0,672611208 0,672611208 0,15977424 0,049906992 ctg7180000001728_orf00515 297834 298136 glimmer prediction 0,668122043 0,668122043 1,490339492 0,621225902 R2846_0318 25969 27672 Sensory histidine kinase NarQ 0,665060585 0,665060585 0,451745247 0,47464886 R2846_1596 55453 57312 ATP-dependent DNA helicase RecQ 0,659080117 0,659080117 1,301369313 0,50333335 R2846_0126 57013 57537 Conserved hypothetical protein 0,658519619 0,658519619 0,325740084 0,43462432 R2846_1454 404904 405593 Probable pyridoxamine 5-phosphate oxidase 0,65721652 0,65721652 0,374467243 0,07785137 R2846_0058 47594 47854 Putative 4Fe-4S ferredoxin-type protein 0,653461278 0,653461278 0,157241285 0,392944973 R2846_1590 46406 47932 Putative membrane transporter 0,648086299 0,648086299 0,626207316 0,880130303 Lipopolysaccharide biosynthesis protein R2846_0695 42074 42958 LsgE 0,642567559 0,642567559 1,011342031 0,867140198 R2846_1343 289690 290256 Hypothetical protein 0,641552719 0,641552719 -0,359976346 0,216716121 ctg7180000001728_orf00359 208025 208471 glimmer prediction 0,640710409 0,640710409 0,189654583 0,047765504 R2846_1414 359593 360387 Conserved hypothetical protein 0,640615453 0,640615453 0,548294606 0,878311294 predicted ABC-type cobalt transport system, CGSHiEE_05755 23484 24110 ATPase component 0,638843957 0,638843957 0,604581862 -0,283060432 Putative branched-chain amino acid R2846_0374 34275 35585 transport system II carrier protein 0,638336327 0,638336327 0,055611236 0,172342685

147

APPENDICES

ctg7180000001728_orf00365 209301 210512 glimmer prediction 0,636908537 0,636908537 1,067825719 0,702217967 R2846_0416 2283 2870 Conserved hypothetical protein 0,636364066 0,636364066 -0,912229544 -0,670186786 ctg7180000001712_orf00018 11488 12570 glimmer prediction 0,63563366 0,63563366 0,427934248 1,150977437 R2846_0253 27984 28550 Elongation factor P (EF-P) 0,633942095 0,633942095 0,642855419 0,372947395 R2846_0518 34974 35759 Conserved hypothetical protein 0,632164801 0,632164801 0,096670211 0,505130845 R2846_1479 430063 430836 Putative SAM-dependent methyltransferase 0,628922615 0,628922615 1,510245341 0,882550478 ctg7180000001727_orf00051 27255 27494 glimmer prediction 0,627692222 0,627692222 1,549804948 1,722278317 ctg7180000001719_orf00007 3789 4874 glimmer prediction 0,627556632 0,627556632 -0,113110465 0,108189176 R2846_0406 50412 50990 GlpG-like protein 0,627130159 0,627130159 0,701583503 0,729690172 R2846_0915 17047 17367 Conserved hypothetical protein 0,625675036 0,625675036 1,00188114 1,41431826 R2846_0273 11997 12905 DNA recombination related-protein RdgC 0,623378907 0,623378907 0,215685908 -0,030521282 R2846_0791 27464 27850 Hypothetical protein 0,621554134 0,621554134 1,067478066 1,05145993 R2846_0009 1137 1802 Conserved hypothetical protein 0,618045959 0,618045959 0,132834869 0,427495026 R2846_1613 37209 37766 Transcription antitermination protein NusG 0,615700495 0,615700495 0,451349021 0,516523002 R2846_0628 27670 29094 2-methylthioadenine synthetase (MiaB) 0,605440504 0,605440504 -0,141837227 -0,080412548 Formaldehyde dehydrogenase, glutathione- R2846_0454 45214 46350 dependent 0,603441746 0,603441746 0,714265331 0,640517401 ctg7180000001701_orf00005 4329 5474 glimmer prediction 0,594138028 0,594138028 0,127521419 0,954076515 R2846_0816 3772 4254 Putative nuclease 0,591763615 0,591763615 0,528935979 -0,126052907 R2846_1609 40176 40415 tRNA 2-thiouridine synthesizing protein A 0,590925784 0,590925784 -0,534803491 0,267263965 R2846_0347 1325 1666 Conserved hypothetical protein 0,58893844 0,58893844 0,47506979 0,600172654 R2846_1358 304011 304247 50S ribosomal protein L28 0,585088154 0,585088154 0,003588745 0,377779508 ctg7180000001709_orf00016 4503 5900 glimmer prediction 0,584866611 0,584866611 0,059152206 0,037792463 R2846_0440 30922 31689 Putative permease YcfA 0,583255755 0,583255755 1,170786457 1,119005169 R2846_0926 7648 7971 Conserved hypothetical protein 0,580607638 0,580607638 -0,173437888 1,08387162 R2846_1232 164902 166065 Xylose operon regulatory protein 0,577229032 0,577229032 -0,064000165 -0,391658202 R2846_0927 6988 7644 GTP cyclohydrolase I 0,574372955 0,574372955 0,195731314 -0,044639382 R2846_1567 16339 16551 50S ribosomal subunit protein L31 0,570203756 0,570203756 0,626307043 1,023693603

148

APPENDICES

R2846_1397 341367 342086 Undecaprenyl pyrophosphate synthetase 0,57004641 0,57004641 -0,203921964 0,038939608 Probable lipooligosaccharide biosynthesis R2846_1456 406488 406808 protein 0,569223222 0,569223222 -0,13109229 -0,636734012 ctg7180000001709_orf00005 1053 1469 glimmer prediction 0,569012766 0,569012766 0,313282209 0,732010333 R2846_0321 28848 31598 Heme-hemopexin utilization protein A 0,567016132 0,567016132 0,327779337 -0,062945158 tRNA cmo(5)U34 methyltransferase, SAM- R2846_0261 22653 23378 dependent 0,566902661 0,566902661 0,297271269 0,938074178 Cell-division ATP transporter, permease R2846_1553 5367 6299 protein FtsX 0,566798544 0,566798544 0,627931646 0,715431252 putative ABC-type chelated iron transport CGSHiEE_05630 2579 2917 system, permease component 0,566370486 0,566370486 -1,268562982 -0,348019773 R2846_1403 348635 349486 Elongation factor Ts 0,564098736 0,564098736 0,873679655 1,394181231 R2846_0893 33017 33832 Hypothetical protein 0,563331847 0,563331847 0,049620682 -0,247748908 R2846_0340 46985 47452 Conserved hypothetical protein 0,560747005 0,560747005 -1,135637186 -0,554011733 R2846_1642 3015 3455 Conserved hypothetical protein 0,558636163 0,558636163 0,145821401 0,383904345 Molybdopterin-guanine dinucleotide R2846_1484 433408 433986 biosynthesis protein A 0,557855714 0,557855714 -0,826863573 0,143371979 Dipeptide ABC transporter, permease R2846_1158 88271 89158 protein DppC 0,554459357 0,554459357 1,286887335 1,146389828 ctg7180000001728_orf00401 227430 227918 glimmer prediction 0,553840701 0,553840701 1,338854383 0,686112258 R2846_0617 39692 40555 Rare lipoprotein A-like protein 0,552932619 0,552932619 0,704297684 0,23749942 R2846_0884 38163 39182 Dihydroorotate dehydrogenase 0,547514013 0,547514013 -0,131839866 -0,255873595 R2846_1466 414226 416574 Exoribonuclease R (RNase R) 0,547268212 0,547268212 0,181095758 0,211189496 R2846_1617 33400 34698 Trigger factor 0,545461161 0,545461161 0,038336589 0,454114426 Negative modulator of replication initiation R2846_0445 38545 39138 SeqA 0,543060604 0,543060604 6,44E-05 -0,238536231 R2846_1315 253493 254938 Putative outer membrane protein OmpU1 0,540201635 0,540201635 1,17299114 0,601901205 R2846_1308 245741 247300 Hypothetical protein 0,540168828 0,540168828 1,165047086 0,681854809 R2846_0333 42705 43157 Biopolymer transport protein ExbB 0,53654809 0,53654809 1,133402756 1,251132188 Probable ABC transport system, periplasmic R2846_1461 409776 410501 component 0,53450557 0,53450557 0,640945191 0,347124224 R2846_0068 57770 58198 50S ribosomal subunit protein L11 0,530605232 0,530605232 0,626850853 0,951944579 149

APPENDICES

R2846_1485 434125 435117 Conserved hypothetical protein 0,530180031 0,530180031 -0,360975016 -0,180904908 R2846_1236 169810 170628 Conserved hypothetical protein 0,528181474 0,528181474 0,120506533 -0,069150208 R2846_0049 36726 37361 Urease accessory protein ureG 0,527174673 0,527174673 1,07749894 0,562000232 R2846_1419 364102 365634 Multidrug resistance protein EmrB 0,525209165 0,525209165 1,042011633 0,825745283 R2846_0566 94872 95660 Putative TatD-family Dnase 0,524635958 0,524635958 1,1386077 0,61288117 ctg7180000001728_orf00361 208485 209273 glimmer prediction 0,523872862 0,523872862 0,049254742 0,555412253 ctg7180000001705_orf00008 3161 3289 glimmer prediction 0,522611421 0,522611421 1,677766973 2,459417356 Arginine ABC transporter, permease protein R2846_1165 94369 95034 ArtQ 0,521171725 0,521171725 1,903424324 1,692653861 R2846_1124 49096 49905 tRNA pseudouridine synthase A 0,518065727 0,518065727 0,53856271 0,008065437 CGSHiEE_05785 27060 27602 hypothetical protein 0,516348373 0,516348373 0,282621807 0,259910787 R2846_1514 463555 463746 Carbon storage regulator 0,51567806 0,51567806 0,191518171 -0,052797641 R2846_0813 811 1596 Conserved hypothetical protein 0,510007855 0,510007855 0,762674043 0,24823101 R2846_0750 81240 82430 Conserved hypothetical protein 0,509727841 0,509727841 0,735099272 0,547201694 R2846_1465 413468 413944 Hypothetical protein 0,506884927 0,506884927 0,390532544 0,949893914 R2846_0544 24529 25662 N-succinyl-diaminopimelate deacylase 0,505662602 0,505662602 0,372853606 0,228255884 R2846_0448 40638 41078 Ferric uptake regulation protein 0,505615495 0,505615495 -0,182355637 -0,134963102 R2846_0932 3176 3817 Conserved hypothetical protein 0,504177357 0,504177357 0,754816486 0,664741156 2,3,4,5-tetrahydropyridine-2-carboxylate N- R2846_1112 32961 33788 succinyltransferase 0,503125218 0,503125218 -0,347102336 0,220271597 R2846_1570 18720 19562 Conserved hypothetical protein 0,502664201 0,502664201 0,810851875 0,516720598 Lipoyl(octanyl)-acyl carrier protein: protein R2846_0620 37521 38159 transferase 0,502080504 0,502080504 0,810860637 0,19784226 R2846_0701 47465 48838 Conserved hypothetical protein 0,49987637 0,49987637 1,208086138 0,818984981 D-alanyl-D-alanine carboxypeptidase/D- R2846_0946 2645 4084 alanyl-D-alanine-endopeptidase 0,497259709 0,497259709 0,786790739 0,309081908 R2846_1396 338533 341118 Leucyl-tRNA synthetase 0,49563879 0,49563879 0,67855103 0,601168436 R2846_0968 20503 21213 Putative NAD-dependent protein deacetylase 0,495600083 0,495600083 0,503166696 0,638120916 Putative oligopeptide transporter R2846_0426 16635 18179 periplasmic-binding protein 0,487318848 0,487318848 0,965467348 1,056465359

150

APPENDICES

R2846_0136 65102 67057 DNA topoisomerase III 0,486807051 0,486807051 1,455570392 1,119297292 Indole-3-glycerol phosphate synthase/phosphoribosylanthranilate R2846_0871 49586 51019 isomerase 0,486483341 0,486483341 0,981942475 0,681401108 R2846_1440 388194 389405 Ribosome-associated GTPase CgtA 0,485588947 0,485588947 0,716289248 0,191021422 R2846_0252 28588 29604 Conserved hypothetical protein 0,483794851 0,483794851 -0,05863612 -0,148134674 R2846_0798 19892 20554 Putative NAD(P)H-flavin oxidoreductase 0,483425453 0,483425453 -0,261255773 0,179240649 R2846_0842 87538 88962 NAD(P) transhydrogenase, subunit beta 0,482257421 0,482257421 0,861864443 1,358207184 R2846_0658 728 1657 Probable transcriptional activator for azlCD 0,481438598 0,481438598 0,554148809 0,595377079 R2846_0046 33488 35206 Urease alpha subunit 0,48095879 0,48095879 0,527502861 0,550897102 R2846_0069 58203 58892 50S ribosomal subunit protein L1 0,479430896 0,479430896 0,543614302 0,926933665 R2846_1404 349620 350342 30S ribosomal protein S2 0,479135224 0,479135224 0,424031345 1,164128776 R2846_0794 24935 25636 Glyoxalase II 0,478644844 0,478644844 0,192887365 -0,080990258 R2846_0651 1942 2751 Glutamate racemase 0,47736377 0,47736377 1,001690204 0,99003279 R2846_1635 10308 10991 23S rRNA U2457 pseudouridine synthase 0,476272876 0,476272876 -0,399026083 -0,206222397 R2846_1415 360387 360977 RNA pyrophosphohydrolase 0,475176745 0,475176745 0,392746805 0,380372822 R2846_0957 10911 11318 Translation initiation factor IF-3 0,471505209 0,471505209 -0,47860631 0,002230934 R2846_0570 91013 91873 Acyl-CoA thioesterase II 0,469366007 0,469366007 0,037649614 0,25659719 Putative riboflavin kinase/FMN R2846_1346 292468 293406 adenylyltransferase 0,462481963 0,462481963 -0,104154611 -0,244645624 R2846_1139 68088 68531 Conserved hypothetical protein 0,457832781 0,457832781 1,056759378 1,00197776 ctg7180000001719_orf00005 3470 3682 glimmer prediction 0,457088265 0,457088265 -0,448710965 0,069392449 R2846_0787 34256 34936 SanA protein 0,454166917 0,454166917 -0,010583531 -0,323926444 R2846_0977 28148 28960 Dihydrodipicolinate reductase 0,45173173 0,45173173 0,104510546 -0,00716952 R2846_0703 49653 50360 Electron transport complex protein RnfE 0,448181554 0,448181554 0,933648667 1,055334715 R2846_1323 269901 271310 3-isopropylmalate dehydratase, large subunit 0,447840239 0,447840239 1,373383343 1,1532548 R2846_0463 55976 56950 23S rRNA pseudouridine synthase 0,446879075 0,446879075 0,03853052 0,287979376 R2846_1566 15026 16162 A/G-specific adenine glycosylase 0,444159476 0,444159476 0,466355839 0,144286814 R2846_1517 466308 467189 Hsp33-like chaperonin 0,443689362 0,443689362 0,869272394 1,168267849

151

APPENDICES

R2846_1418 362920 364092 Multidrug resistance protein EmrA 0,442699229 0,442699229 0,589785973 0,114965476 R2846_0652 583 1728 L-lactate dehydrogenase, FMN-linked 0,441824677 0,441824677 0,557550837 0,628781229 Lipooligosaccharide transporter, periplasmic R2846_1193 121732 122250 binding protein LptA 0,440902973 0,440902973 -0,246137613 -0,363671596 R2846_1111 31606 32904 Adenylosuccinate synthetase 0,440212727 0,440212727 0,282353625 0,320544546 R2846_1142 72231 72755 Conserved hypothetical protein 0,438366226 0,438366226 -0,320810907 -0,080942484 R2846_1420 365647 366417 Conserved hypothetical protein 0,433021395 0,433021395 -0,078066189 0,034694318 R2846_0975 27119 27859 Hypothetical protein 0,432212513 0,432212513 0,736110972 0,698567841 R2846_1368 312242 315607 Exodeoxyribonuclease V, gamma chain 0,430715579 0,430715579 0,135790065 -0,124502678 R2846_1521 471022 471831 Hypothetical protein 0,429284111 0,429284111 0,325946004 0,218245649 Peptidyl-prolyl cis-trans isomerase B R2846_0567 94308 94817 (rotamase B) 0,428848868 0,428848868 0,957338174 0,229477293 R2846_0936 191 787 Putative sigma factor 0,428487993 0,428487993 -0,161738888 -0,063233423 ADP-heptose--lipooligosaccharide R2846_0324 35868 36911 heptosyltransferase I OpsX 0,428434693 0,428434693 0,490864447 0,223087438 R2846_0747 83205 84854 30S ribosomal protein S1 0,424811966 0,424811966 -0,168562427 0,403117812 R2846_1190 119106 120461 Protease PmbA 0,423630308 0,423630308 -0,016108242 -0,181437837 4-hydroxy-3-methylbut-2-enyl diphosphate R2846_1306 244215 245159 reductase 0,423587161 0,423587161 0,469696973 0,387724704 3-isopropylmalate dehydrogenase (beta-IPM R2846_1324 271486 272562 dehydrogenase) 0,421948248 0,421948248 1,556934907 1,751919371 ctg7180000001728_orf00190 101630 101749 glimmer prediction 0,419748374 0,419748374 0,28818006 -1,266257017 R2846_0055 44448 45476 Putative O-sialoglycoprotein endopeptidase 0,419208726 0,419208726 0,249633649 0,279782755 R2846_0052 40127 42016 RNA polymerase sigma-70 factor 0,416974973 0,416974973 -0,153287784 -0,12889539 R2846_0425 16280 16642 Conserved hypothetical protein 0,416617487 0,416617487 0,568916645 1,204209647 Acetyl-CoA carboxylase carboxyl R2846_0785 37112 38002 transferase, beta subunit 0,412781722 0,412781722 -0,597650198 -0,444602025 ctg7180000001728_orf00607 351404 353260 glimmer prediction 0,410276406 0,410276406 -0,144571221 0,323512093 4.5S-RNP protein, GTP-binding export factor, part of signal recognition particle R2846_0536 10804 12183 with 4.5 RNA 0,409717994 0,409717994 0,030851038 -0,149205462

152

APPENDICES

R2846_0631 24339 26135 GTP-binding membrane protein 0,40881614 0,40881614 0,361474585 0,44197141 Cell-division ATP transporter, ATP-binding R2846_1554 6309 6965 protein FtsE 0,407806151 0,407806151 0,463259503 0,652434575 R2846_0740 91489 92937 Protease TldD 0,407776607 0,407776607 0,875435091 0,766695265 R2846_0833 103304 104977 Glutaminyl-tRNA synthetase 0,407705749 0,407705749 0,259065423 0,095494109 R2846_0272 12971 13786 Pyrroline-5-carboxylate reductase 0,405035929 0,405035929 0,140907307 -0,19007185 ctg7180000001728_orf00590 340963 341160 glimmer prediction 0,400973698 0,400973698 0,586869575 1,115004645 R2846_1556 8283 8864 16S rRNA m(2)G966 methyltransferase 0,399799606 0,399799606 -0,291614541 -0,112167272 R2846_1156 84982 87165 DNA helicase II 0,399527685 0,399527685 0,461077387 0,136900635 tRNA (5-methylaminomethyl-2- R2846_0465 57730 58971 thiouridylate)- methyltransferase 0,393004794 0,393004794 0,567281125 0,396325173 R2846_0830 775 2250 Ribonuclease G 0,391504577 0,391504577 0,283208236 0,101565307 ctg7180000001706_orf00140 80979 82910 glimmer prediction 0,391349481 0,391349481 0,71126958 0,574725994 R2846_1713 9691 10614 Pantothenate kinase 0,390381355 0,390381355 0,50083979 -0,082473915 R2846_0790 27982 29745 Conserved hypothetical protein 0,389739564 0,389739564 0,584402836 0,484436622 DNA glycosylase and apyrimidinic (AP) R2846_0702 48897 49532 lyase (endonuclease III) 0,388730894 0,388730894 0,678540263 0,177306213 ctg7180000001719_orf00035 21337 21891 glimmer prediction 0,383744837 0,383744837 -0,473924553 -0,524995776 ctg7180000001706_orf00104 54802 55566 glimmer prediction 0,383431867 0,383431867 -0,625357468 -0,742533697 R2846_0664 5770 7749 Ribonuclease II 0,376004854 0,376004854 0,740097998 -0,136811963 Membrane-bound lytic murein R2846_1564 13688 14761 transglycosylase C 0,374988335 0,374988335 -0,012435155 0,023457977 R2846_0007 401 760 tRNA 2-thiouridine synthesizing protein C 0,374323182 0,374323182 0,55605086 0,201817741 R2846_1230 162210 163382 Probable PLP-dependent aminotransferase 0,371830951 0,371830951 -0,579227302 -0,840941214 R2846_0746 84957 85628 Cytidylate kinase 1 0,369732248 0,369732248 -0,673588078 -0,528411649 R2846_0059 47932 48726 Putative ribonuclease (Rnase T2 family) 0,367012132 0,367012132 0,168280508 0,4373552 Biotin-[acetylCoA carboxylase] holoenzyme R2846_0380 41821 42729 synthetase and biotin operon repressor 0,361496514 0,361496514 -0,224652204 0,023611868 R2846_0760 68635 71295 Pyruvate dehydrogenase, E1 component 0,35612513 0,35612513 0,979608222 1,505171435 CGSHiEE_05680 8838 10088 hypothetical protein 0,355599067 0,355599067 1,458843387 0,714036858

153

APPENDICES

ctg7180000001728_orf00403 228296 228457 glimmer prediction 0,35472594 0,35472594 1,687809655 -0,033554814 ctg7180000001728_orf00113 60839 61690 glimmer prediction 0,351178043 0,351178043 0,293202758 0,188046605 R2846_1478 429635 430069 Conserved hypothetical protein 0,349951756 0,349951756 1,501199005 0,644471383 R2846_1215 145845 146075 Conserved hypothetical protein 0,34765784 0,34765784 -0,081052306 -1,157916521 R2846_1298 235133 235624 Conserved hypothetical protein 0,347615879 0,347615879 -0,399155471 -0,663255983 R2846_1608 40530 41150 Conserved hypothetical protein 0,347198709 0,347198709 0,42257471 -0,131883862 R2846_0048 35997 36581 Urease accessory protein ureF 0,34676419 0,34676419 0,567567173 0,843378103 Probable ABC transporter, fused permease R2846_0992 150 1919 and ATP-binding components 0,344394482 0,344394482 -0,032182212 -0,351887088 R2846_1639 4814 5692 Conserved hypothetical protein 0,344238765 0,344238765 0,377929975 0,420686542 tRNA m(7)G46 methyltransferase, SAM- R2846_0237 46007 46747 dependent 0,342984864 0,342984864 -0,025990166 -0,326832283 R2846_1601 60466 61026 Conserved hypothetical protein 0,342959747 0,342959747 -1,006319833 -1,123629511 ctg7180000001726_orf00037 19832 20599 glimmer prediction 0,341047855 0,341047855 0,207912591 0,023865569 R2846_1191 120550 121086 Conserved hypothetical protein 0,339204944 0,339204944 -0,335916777 -0,588599202 R2846_0841 88973 90511 NAD(P) transhydrogenase, subunit alpha 0,338586221 0,338586221 0,295283795 0,815265649 ctg7180000001706_orf00130 73834 74775 glimmer prediction 0,337412517 0,337412517 -0,04234728 -0,444143093 ctg7180000001724_orf00006 2576 3223 glimmer prediction 0,335584529 0,335584529 0,982409641 1,157421674 ctg7180000001726_orf00073 40078 41265 glimmer prediction 0,335434152 0,335434152 -0,173718011 -0,33569299 ctg7180000001714_orf00119 57664 57768 glimmer prediction 0,335188481 0,335188481 1,212202111 1,409628593 ctg7180000001717_orf00022 15149 15304 glimmer prediction 0,328210398 0,328210398 1,89930487 1,15345676 R2846_0672 16105 16911 Methionine aminopeptidase 0,325642466 0,325642466 -0,289534889 -0,238674576 ctg7180000001719_orf00032 20127 20735 glimmer prediction 0,324917341 0,324917341 0,121236394 -0,103071911 Dipeptide ABC transporter, ATP-binding R2846_1160 90163 91146 protein DppF 0,321337994 0,321337994 1,515541449 0,576120423 R2846_0246 35299 37584 Hypothetical protein 0,321173968 0,321173968 -0,629845451 -0,60799874 R2846_0350 3153 5192 Conserved hypothetical protein 0,318303061 0,318303061 -0,071510452 -0,257244938 R2846_0269 16049 16336 Hypothetical protein 0,317589469 0,317589469 -1,525596996 -0,737276589 R2846_1610 39283 40134 Heat shock protein HtpX 0,315268827 0,315268827 -0,6339185 -0,399351841

154

APPENDICES

ctg7180000001728_orf00639 375436 376305 glimmer prediction 0,313816891 0,313816891 -0,570702241 -0,177585159 R2846_0291 300 2468 Copper-transporting ATPase 0,313270415 0,313270415 0,434054846 0,437581447 R2846_0302 15238 15723 Conserved hypothetical protein 0,305986885 0,305986885 -0,496618617 -0,809808426 R2846_1167 95924 96229 Hypothetical protein 0,30571649 0,30571649 0,778355019 0,795149075 UDP-GlcNAc:undecaprenylphosphate R2846_0674 19670 20737 GlcNAc-1-phosphate transferase 0,302326051 0,302326051 0,329060389 -0,123502085 R2846_1363 306939 308474 L-2,4-diaminobutyrate decarboxylase 0,302127618 0,302127618 0,18484621 0,121185089 Lipopolysaccharide biosynthesis protein R2846_0692 39300 40214 LsgB 0,301587296 0,301587296 1,557531319 1,189733971 R2846_0226 55836 56852 UDP-glucose 4-epimerase 0,300843141 0,300843141 -0,592301967 -0,302785454 Acetyl-CoA carboxylase, biotin carboxylase R2846_1338 284980 286326 subunit 0,299860819 0,299860819 0,894904105 0,860044603 R2846_1314 253183 253317 50S ribosomal protein L34 0,299681082 0,299681082 0,780206579 0,109063366 R2846_0404 46952 49723 ATP-dependent helicase HepA 0,299247858 0,299247858 0,317969163 0,153244322 R2846_0724 112753 114003 Conserved hypothetical protein 0,298129691 0,298129691 0,246807114 0,532700104 R2846_0050 37434 38249 urease accessory protein ureH 0,297077402 0,297077402 1,368914629 1,441277085 R2846_0148 76921 77715 NADH pyrophosphatase 0,291626164 0,291626164 0,482177953 0,4523821 ATP-dependent Clp protease proteolytic R2846_1616 34821 35402 subunit ClpP 0,291258545 0,291258545 -0,275712366 0,169534675 R2846_0706 52066 54189 Electron transport complex protein RnfC 0,290749567 0,290749567 1,537866942 0,590543152 N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate R2846_1698 31582 32952 acetyl transferase 0,288893358 0,288893358 -0,461592256 -0,262411029 R2846_0258 24175 24582 Lactoylglutathione lyase 0,288056179 0,288056179 -0,815925032 -0,453796843 R2846_0053 42086 43867 DNA primase 0,287047036 0,287047036 0,566951691 0,274630241 R2846_0883 39182 40006 Conserved hypothetical protein 0,286488814 0,286488814 0,115458941 -0,252809348 R2846_1333 280568 281455 Ribosomal protein L11 methyltransferase 0,286388546 0,286388546 0,674168014 0,783383612 R2846_0591 63869 65053 Mannonate dehydratase 0,285275506 0,285275506 -0,197619672 -0,45332016 R2846_1434 383156 384526 Conserved hypothetical protein 0,283232075 0,283232075 0,697616243 0,178058108 R2846_0663 4901 5689 Enoyl-(acyl carrier protein) reductase 0,28176086 0,28176086 -0,417681016 -0,620211218

155

APPENDICES

hydrogen peroxide-inducible genes activator R2846_0013 3877 4782 (OxyR) 0,281608626 0,281608626 -0,516930937 0,013986786 R2846_0610 48412 49467 Rod shape-determining protein MreB 0,281387216 0,281387216 0,099158768 0,083588877 R2846_0688 33460 34536 Lipopolysaccharide export permease, LptG 0,278201438 0,278201438 0,681563865 0,513145249 R2846_1515 463768 464655 Glucose-1-phosphate uridylyltransferase 0,264368054 0,264368054 -0,006603708 0,360775693 R2846_1366 310617 311735 Riboflavin biosynthesis protein RibD 0,260420666 0,260420666 0,366645443 0,309932855 R2846_1706 38788 38964 Hypothetical protein 0,260140043 0,260140043 0,097697064 0,603664303 R2846_0023 14751 16739 Conserved hypothetical protein 0,258480325 0,258480325 0,808205565 1,011441472 Probable TRAP-type transport system, large R2846_0596 59073 60329 permease component 0,25729506 0,25729506 -0,149876456 -0,21898356 Probable 7-cyano-7-deazaguanine (preQ0) R2846_1153 82633 83316 synthesis protein QueC 0,252095667 0,252095667 0,211210564 -0,508664808 ctg7180000001719_orf00038 22082 23836 glimmer prediction 0,24770921 0,24770921 -0,08458176 -0,174071086 R2846_1317 257002 259737 Transferrin-binding protein 1 0,246632698 0,246632698 0,552839348 0,077903507 ctg7180000001720_orf00057 32959 33066 glimmer prediction 0,245092372 0,245092372 1,652137858 1,212808563 ctg7180000001728_orf00252 146536 146646 glimmer prediction 0,23719239 0,23719239 -1,530660138 -0,593868621 PTS system, fructose-specific IIBC R2846_0133 62434 64104 component 0,236778839 0,236778839 0,862935885 0,677064116 ctg7180000001709_orf00030 13532 15265 glimmer prediction 0,234280104 0,234280104 -0,026302358 0,173084929 ctg7180000001719_orf00009 5372 6250 glimmer prediction 0,232073194 0,232073194 0,66840055 0,913191547 R2846_1471 420987 421289 Z-ring associated protein ZapA 0,229753461 0,229753461 -0,543154121 -0,443158653 R2846_0508 26601 27917 Putative membrane permease 0,228112926 0,228112926 -0,931815434 -0,49410778 R2846_0630 26303 26686 Conserved hypothetical protein 0,227563647 0,227563647 -1,176318723 0,004287383 ctg7180000001727_orf00001 30 443 glimmer prediction 0,225974368 0,225974368 0,554025242 0,533326639 R2846_1624 22988 25573 DNA mismatch repair protein MutS 0,222071282 0,222071282 0,357847097 0,063771476 Fermentative D-lactate dehydrogenase, R2846_0562 96758 97753 NAD-dependent 0,216567743 0,216567743 0,775284482 0,771979592 R2846_0984 33764 34453 Carbonic anhydrase 2 0,216349586 0,216349586 0,62205365 0,920581993 R2846_0516 33220 33726 Conserved hypothetical protein 0,212589819 0,212589819 1,753543457 1,267455587 R2846_1240 174206 174697 Hypothetical protein 0,208869889 0,208869889 -0,950175434 -0,392284655

156

APPENDICES

R2846_1330 278568 279053 SsrA-binding protein 0,206190379 0,206190379 -0,468358305 -0,45584812 UDP-glucose-Lipooligosaccharide beta 1-4 R2846_1682 17127 17903 glucosyltransferase 0,206138088 0,206138088 -0,501457276 -0,72544265 R2846_0583 74768 76126 Poly(A) polymerase I 0,203519002 0,203519002 0,452468413 0,648068373 R2846_0370 29595 30539 Lipoprotein NlpI 0,20256565 0,20256565 1,547224668 1,530133501 R2846_0256 25660 27012 Putative permease 0,202210434 0,202210434 0,002714437 0,856726514 R2846_0727 108278 109747 Putative murein L,D-transpeptidase 0,201908867 0,201908867 0,363534668 0,182299609 CGSHiGG_00310 5901 8144 DNA topoisomerase IV subunit A 0,200929304 0,200929304 -0,535387592 -0,074214395 R2846_1113 34150 35160 Purine regulon repressor 0,19846372 0,19846372 -0,276159188 -0,535299273 R2846_1183 111406 112362 Thioredoxin reductase 0,196822357 0,196822357 0,381625838 0,181139235 R2846_0759 71358 72989 Dihydrolipoamide acetyltransferase 0,194443398 0,194443398 1,293321248 1,484158617 R2846_1595 53650 55368 Prolyl-tRNA synthetase 0,192573265 0,192573265 0,311875244 0,000324004 R2846_0475 66922 67521 Lipoprotein, putative 0,189690953 0,189690953 -0,75068426 -0,173520127 R2846_0549 30224 30505 Hypothetical protein 0,187579864 0,187579864 1,166422481 2,029667253 R2846_1213 143405 143860 MraZ protein 0,185763298 0,185763298 -1,21550193 -0,584877622 R2846_0951 1997 3802 Putative ATP-dependent protease 0,185605223 0,185605223 -0,321625903 0,142658799 R2846_0735 96702 97283 Conserved hypothetical protein 0,184709828 0,184709828 -0,240958662 -0,820750204 ctg7180000001727_orf00045 25313 25525 glimmer prediction 0,182929915 0,182929915 -1,211739585 -0,924224884 R2846_0606 51927 52730 Exodeoxyribonuclease III 0,181404372 0,181404372 -0,382061621 -0,117893857 Menaquinone-specific isochorismate R2846_0296 8162 9454 synthase 0,181075469 0,181075469 0,364924518 0,207809254 R2846_1200 127985 129262 Cell division protein FtsA 0,177845721 0,177845721 0,379914198 0,3691099 R2846_0335 43614 44408 TonB protein 0,172876105 0,172876105 0,999283881 0,868050857 ctg7180000001728_orf00686 407213 407878 glimmer prediction 0,16904641 0,16904641 -0,47637712 -0,262686913 R2846_1435 384585 385322 Conserved hypothetical protein 0,158851677 0,158851677 0,384833278 0,338255798 R2846_0149 77751 78341 Conserved hypothetical protein 0,157663996 0,157663996 -1,196969859 -0,844401581 bifunctional pyrimidine regulatory protein R2846_0120 51857 52396 PyrR uracil phosphoribosyltransferase 0,157390343 0,157390343 -0,182497468 -1,013453778 R2846_0057 46236 47456 Tyrosine-specific transport protein 0,150025676 0,150025676 0,348995202 0,397530057

157

APPENDICES

CGSHiEE_05710 14133 14849 sugar fermentation stimulation protein A 0,14949835 0,14949835 1,306023305 0,828263426 R2846_0956 10503 10700 50S ribosomal protein L35 0,148729873 0,148729873 0,346442037 1,112117546 R2846_0781 43353 45323 Conserved hypothetical protein 0,148592264 0,148592264 0,553976655 0,525790855 ctg7180000001714_orf00050 24865 25827 glimmer prediction 0,146883323 0,146883323 1,628335149 0,88302284 R2846_0981 31147 31581 Transcription antitermination protein NusB 0,146281717 0,146281717 -0,271231047 -0,379013601 R2846_0363 22578 23555 General secretory pathway component SecF 0,145648783 0,145648783 1,427960466 0,830548694 R2846_0704 50362 50985 Electron transport complex protein RnfG 0,145237943 0,145237943 1,617969631 1,216047732 R2846_0783 39640 43080 Transcription-repair coupling factor 0,14467717 0,14467717 0,633355921 0,556203915 R2846_0758 73103 74527 Dihydrolipoamide dehydrogenase 0,144048781 0,144048781 1,553845374 1,869792029 R2846_0874 45616 46254 Hypothetical protein 0,142844883 0,142844883 0,543170853 -0,013285404 2-succinyl-6-hydroxy-24-cyclohexadiene-1- carboxylate synthase/2-oxoglutarate R2846_0297 9470 11176 decarboxylase 0,140337443 0,140337443 0,560874663 0,71696101 R2846_0741 90825 91376 Putative lipoprotein Spr 0,136728435 0,136728435 0,905734049 0,172841139 ctg7180000001721_orf00101 56980 57645 glimmer prediction 0,133955552 0,133955552 -0,248239488 -0,466963171 R2846_0961 15066 16040 Hypothetical protein 0,126452867 0,126452867 0,201054796 0,551612055 R2846_1467 416630 417367 23S rRNA mG2251 methyltransferase 0,125500371 0,125500371 0,892606254 0,852567669 R2846_1442 389907 391235 Aminopeptidase B 0,124088244 0,124088244 -0,682273413 -0,784079333 R2846_0543 24157 24501 Conserved hypothetical protein 0,118455964 0,118455964 -0,075011027 -0,584767494 iron chelatin ABC transporter, ATP-binding HI_1470 17901 18662 protein, putative 0,116686155 0,116686155 -0,828548984 -0,346312673 R2846_0950 1295 1828 3-hydroxydecanoyl-ACP dehydratase 0,114852748 0,114852748 -0,62232027 -1,681360489 R2846_0303 15720 16529 tRNA processing exoribonuclease BN 0,111640456 0,111640456 0,588863977 -0,159752317 R2846_1571 19623 20366 beta-(1-4)-glucosyltransferase Lex2B 0,110846476 0,110846476 -0,184940072 -0,781807906 Thiamin ABC transporter, ATP-binding R2846_1302 240202 240849 protein 0,109875705 0,109875705 0,079208689 0,597757949 Lipopolysaccharide biosynthesis protein R2846_0693 40216 41277 LsgC 0,109574022 0,109574022 1,00299914 1,359444183 ctg7180000001709_orf00008 2500 3024 glimmer prediction 0,109563275 0,109563275 1,768309926 1,030381924 R2846_1689 23907 24623 Conserved hypothetical protein 0,107259069 0,107259069 0,013509546 0,817366724

158

APPENDICES

ctg7180000001728_orf00356 205536 206249 glimmer prediction 0,106603722 0,106603722 -0,389868254 -0,589844275 R2846_1189 118356 118895 Hypoxanthine phosphoribosyltransferase 0,106550181 0,106550181 -0,443570336 -0,613579387 tRNA delta(2)-isopentenylpyrophosphate R2846_0578 80398 81333 transferase (IPTase) 0,103399108 0,103399108 1,953978614 1,703336628 R2846_1685 19713 19925 Hypothetical protein 0,10280625 0,10280625 1,255510623 0,57485931 R2846_0444 37184 38542 O-succinylbenzoate-CoA ligase 0,100211263 0,100211263 -0,191783825 -0,419219217 N-acetyl-anhydromuramyl-L-alanine R2846_0279 6550 7110 amidase AmpD 0,095791745 0,095791745 -1,389638709 -0,296348165 R2846_0036 27794 28471 beta-1,4-galactosyltransferase 0,095627439 0,095627439 -0,955335993 -0,587559553 R2846_1584 35974 36303 Hypothetical protein 0,094088203 0,094088203 0,665118373 -0,017155413 R2846_0810 3808 4728 tRNA pseudouridine synthase B 0,092128128 0,092128128 -0,110096626 0,344857293 R2846_0677 21658 22698 Ribosome-small-subunit-dependent GTPase 0,091924126 0,091924126 -1,090278863 -0,349295559 R2846_0676 21039 21587 Oligoribonuclease 0,087067009 0,087067009 -0,30116196 -0,728854138 R2846_0644 11301 12089 Conserved hypothetical protein 0,083088273 0,083088273 0,470711711 0,068557397 ctg7180000001709_orf00038 20008 20412 glimmer prediction 0,080359615 0,080359615 -1,288332932 -1,31410954 R2846_0460 53746 54486 Pyruvate formate-lyase activating enzyme 0,079548166 0,079548166 -1,028100185 -0,474268727 R2846_0531 5786 6415 Putative glutathione-S-transferase 0,078280209 0,078280209 -0,371240455 -0,139300226 Molybdopterin-guanine dinucleotide R2846_1477 428695 429231 biosynthesis protein B 0,078170709 0,078170709 -0,59601573 -0,251104131 Leader peptidase (signal peptidase I), serine R2846_0632 23281 24330 protease 0,078024418 0,078024418 0,526630706 0,890389595 R2846_0474 66517 66828 Morphology-related protein BolA 0,077240602 0,077240602 -0,226365114 -0,605867163 R2846_0669 12918 15263 Penicillin-binding protein 1B 0,076523322 0,076523322 0,99320232 0,767955447 R2846_0110 39619 40902 L-histidinol:NAD+ oxidoreductase 0,07558416 0,07558416 -0,346145443 -0,536877474 Cysteine synthase A, O-acetylserine R2846_1235 168761 169711 sulfhydrolase A subunit 0,07520033 0,07520033 -0,504923698 -0,386072291 R2846_0362 20720 22570 General secretory pathway component SecD 0,074235067 0,074235067 0,673446479 0,387296976 R2846_0111 40995 41906 ATP phosphoribosyltransferase 0,07216443 0,07216443 -0,288001197 -0,862935115 ctg7180000001719_orf00002 305 841 glimmer prediction 0,071731712 0,071731712 0,209453313 -0,438394742 R2846_1117 41094 42506 Conserved hypothetical protein 0,062157787 0,062157787 -0,276749634 -0,122150953

159

APPENDICES

R2846_1629 19052 20071 tRNA pseudouridine synthase D 0,061256361 0,061256361 -0,267668877 -0,712139472 ATP-dependent Clp protease ATP-binding R2846_1615 35412 36647 subunit ClpX 0,060637359 0,060637359 -0,32625198 -0,213379425 R2846_0285 811 1128 Met repressor 0,060193004 0,060193004 -1,053724746 -1,641121327 R2846_0891 34627 35283 Probable prophage repressor protein 0,059863625 0,059863625 -0,803171353 -0,114627443 ctg7180000001706_orf00138 78077 80857 glimmer prediction 0,056617 0,056617 -0,321083199 -0,722523178 R2846_1513 460853 463477 Alanyl-tRNA synthetase 0,050082676 0,050082676 -0,045918116 0,117006809 R2846_1234 167290 168513 Conserved hypothetical protein 0,045087856 0,045087856 0,659876495 1,529248539 ctg7180000001728_orf00322 185117 185761 glimmer prediction 0,044619236 0,044619236 0,180371455 -0,311975905 R2846_1373 318059 318862 Inositol monophosphatase SuhB 0,041237999 0,041237999 -0,777231809 -0,801353125 R2846_1575 25574 26071 Thiol peroxidase p20 0,04010199 0,04010199 -0,59549332 -0,056696937 R2846_1417 362266 362748 Dihydrofolate reductase (DHFR) 0,039872619 0,039872619 -1,026612067 -0,619955876 R2846_0411 54841 55395 D,D-heptose 1,7-bisphosphate phosphatase 0,039682368 0,039682368 -0,253339439 -0,492813075 R2846_0367 25480 25776 Conserved hypothetical protein 0,039122047 0,039122047 -0,285742063 0,457530356 LPS assembly OM complex LptDE, R2846_1395 337935 338438 lipoprotein component 0,038022809 0,038022809 0,627519359 0,521225831 Probable 7-cyano-7-deazaguanine (preQ0) R2846_1155 83735 84370 synthesis protein QueE 0,035465619 0,035465619 -0,431954345 -0,179373715 Dipeptide ABC transporter, ATP-binding R2846_1159 89168 90160 protein DppD 0,031481475 0,031481475 1,51883451 1,522457008 R2846_1299 235642 236586 Phosphoserine phosphatase 0,030839176 0,030839176 -0,809425573 -0,565282476 R2846_1589 45362 46159 Hypothetical protein 0,027451061 0,027451061 0,115534058 0,478426938 R2846_0355 11954 16156 Adhesion and penetration protein precursor 0,027352636 0,027352636 -0,196431939 -0,359605086 R2846_1347 293435 296260 Isoleucyl-tRNA synthetase 0,027062026 0,027062026 0,485869299 0,383717101 ctg7180000001717_orf00030 20610 20819 glimmer prediction 0,024840511 0,024840511 -0,494850232 -1,049843695 R2846_0022 14127 14522 Heat shock protein 15 0,023949719 0,023949719 -0,62305129 -0,608038032 R2846_0766 60962 61624 Conserved hypothetical protein 0,023290221 0,023290221 0,221492814 0,682195777 Ribonucleoside diphosphate reductase 1, R2846_0733 100231 101361 beta subunit 0,017909717 0,017909717 0,559442241 0,993912512 R2846_0650 2781 4862 ATP-dependent DNA helicase 0,016759304 0,016759304 0,39410031 0,480744889

160

APPENDICES

ctg7180000001722_orf00027 13959 14525 glimmer prediction 0,015666187 0,015666187 -0,505671993 -0,053278899 Anaerobic ribonucleoside-triphosphate R2846_0571 88772 90895 reductase, alpha subunit 0,014447599 0,014447599 0,619619454 1,143613652 R2846_0482 1144 1872 3-ketoacyl-acyl carrier protein reductase 0,01322021 0,01322021 -0,145614086 0,260292302 ctg7180000001718_orf00014 4876 6534 glimmer prediction 0,0106753 0,0106753 0,886667475 0,399559092 3-deoxy-D-manno-octulosonate R2846_0588 67748 68512 cytidylyltransferase (CMP-KDOsynthetase) 1,07E-05 1,07E-05 0,549874852 0,351541195 R2846_1427 374036 375301 Serine hydroxymethyltransferase -0,000804301 -0,000804301 -0,387551909 0,071772113 R2846_0575 86115 87005 NAD kinase -0,00287022 -0,00287022 -0,540865315 0,164150234 undecaprenyl-phosphate galactose R2846_1445 393699 395117 phosphotransferase -0,003767485 -0,003767485 -0,826969835 -0,40533332 tRNA uridine 5-carboxymethylaminomethyl CGSHiGG_06385 3514 5403 modification enzyme GidA -0,004927676 -0,004927676 -0,115282385 -0,16565635 R2846_0334 43161 43604 Biopolymer transport protein ExbD -0,01176329 -0,01176329 0,242090953 0,465492423 R2846_1587 41861 43402 Threonine deaminase -0,01247317 -0,01247317 1,101902166 1,053151651 Molybdenum ABC transporter, permease R2846_0699 45710 46399 protein -0,013337571 -0,013337571 0,281006907 0,70956715 R2846_1341 287629 288618 O-succinylbenzoate-CoA synthase -0,015074526 -0,015074526 1,079257709 0,850094518 ctg7180000001728_orf00334 193440 195005 glimmer prediction -0,015985268 -0,015985268 -0,418261655 0,131595033 R2846_0446 39209 39991 Putative esterase -0,016188141 -0,016188141 -0,496974748 -0,675850847 R2846_1168 96265 96777 Probable surface adhesin OlpA1 -0,016862416 -0,016862416 -0,675250862 -0,621510901 R2846_0934 1065 1967 Putative permease -0,018575243 -0,018575243 0,40349116 0,238539589 R2846_0163 92785 93582 Hydroxyethylthiazole kinase -0,026380513 -0,026380513 0,911666261 0,440455379 R2846_0349 2741 3151 Conserved hypothetical protein -0,026763596 -0,026763596 -0,342196453 -0,718125236 ctg7180000001727_orf00183 105791 105907 glimmer prediction -0,029298505 -0,029298505 1,781957044 1,708963031 2-dehydro-3-deoxygluconokinase (KDG R2846_0597 58109 59053 kinase) -0,031247213 -0,031247213 -0,389477279 -0,483359155 R2846_1364 308705 309520 Formamidopyrimidine-DNA glycosylase -0,034643695 -0,034643695 -0,316050797 -0,526116488 R2846_1239 173896 174204 Hypothetical protein -0,035623233 -0,035623233 -0,897722532 -0,422100909 R2846_0400 42073 42507 L-fucose mutarotase -0,035666486 -0,035666486 0,695610934 0,149552678 ctg7180000001728_orf00346 197318 201157 glimmer prediction -0,037654641 -0,037654641 0,886910684 0,564713766

161

APPENDICES

R2846_0135 64652 64993 Protein-export membrane protein SecG -0,037939811 -0,037939811 -1,185318228 -0,891851107 R2846_0263 20097 21863 Aspartyl-tRNA synthetase -0,039636297 -0,039636297 -0,234402135 -0,286363828 2-keto-3-deoxygluconate 6-phosphate aldolase and 2-keto-4-hydroxyglutarate R2846_0599 56598 57236 aldolase -0,041164658 -0,041164658 -0,770415318 -0,534005895 R2846_0092 24622 24999 Conserved hypothetical protein -0,042681918 -0,042681918 -1,2347956 -1,349746556 R2846_1178 104453 105532 Outer membrane protein P5 -0,044163375 -0,044163375 0,160613944 0,282351762 R2846_1199 126636 127901 Cell division protein FtsZ -0,045967717 -0,045967717 -0,421159194 -0,133790873 ctg7180000001709_orf00042 22871 24094 glimmer prediction -0,047938866 -0,047938866 -0,760401398 -0,455391744 R2846_1316 255036 256988 Transferrin-binding protein 2 -0,048631921 -0,048631921 -0,074493477 -0,520462632 R2846_0725 111930 112568 Conserved hypothetical protein -0,051186811 -0,051186811 -0,484665618 -0,448002599 ctg7180000001728_orf00136 77126 77596 glimmer prediction -0,051792569 -0,051792569 -0,349608669 -0,541756497 R2846_1151 81252 82283 Branched-chain amino acid transaminase -0,053384005 -0,053384005 -0,259122127 -0,594518771 3-isopropylmalate dehydratase, small R2846_1322 269274 269876 subunit -0,053522304 -0,053522304 0,839746761 0,862184754 R2846_1452 401316 402734 Glutamine synthetase -0,054337431 -0,054337431 -0,252506932 -0,214388387 Na+-transporting NADH:ubiquinone R2846_0469 61693 62289 oxidoreductase, subunit NqrE -0,056160116 -0,056160116 0,599972559 1,009218387 R2846_0044 32793 33095 Urease gamma subunit -0,056939538 -0,056939538 -0,926734801 -0,649410043 Type II secretory pathway, prepilin signal R2846_0283 2692 3384 peptidase PilD -0,058714977 -0,058714977 -0,239717512 -0,95494168 R2846_0371 30621 32750 Polynucleotide phosphorylase -0,059345114 -0,059345114 -0,18723453 0,159104003 R2846_0156 85249 86304 Putative rRNA methylase -0,061379522 -0,061379522 -0,566948105 -0,251969526 R2846_1588 43482 45359 Dihydroxyacid dehydratase -0,065416579 -0,065416579 0,472935467 0,514142879 R2846_0228 53688 54332 Adenylate kinase -0,066855609 -0,066855609 -0,522581286 -0,289246325 R2846_1327 275913 276689 Conserved hypothetical protein -0,068582309 -0,068582309 -0,68093311 -0,320769242 ctg7180000001724_orf00024 9526 10065 glimmer prediction -0,069150674 -0,069150674 -0,853858002 -0,868605538 R2846_0768 58837 60033 Probable efflux permease Bcr -0,071392759 -0,071392759 0,178182148 0,300852232 R2846_0245 37600 38217 Hypothetical protein -0,072085329 -0,072085329 -1,011202831 -0,836615739 R2846_1667 3820 4821 Fructose 1,6-bisphosphatase II -0,075335598 -0,075335598 -0,738131834 -0,519462985

162

APPENDICES

R2846_0278 7670 8632 Putative transport protein CorC -0,075609013 -0,075609013 -0,356004225 -0,124035552 Protease modulator complex HflKC, subunit R2846_0487 6002 6889 HflC -0,078100525 -0,078100525 0,434491011 0,735868394 R2846_0364 23670 24719 Putative permease (PerM family) -0,078869422 -0,078869422 -0,496927409 -0,143361593 R2846_0320 28396 28752 Dihydroneopterin aldolase -0,079162101 -0,079162101 -0,864771106 -0,577102185 UDP-3-O-(3-hydroxymyristoyl)- R2846_1402 347441 348466 glucosamine N-acyltransferase -0,081184817 -0,081184817 0,920823951 0,782419218 ctg7180000001728_orf00333 191151 192788 glimmer prediction -0,082283331 -0,082283331 0,427552958 0,246914585 Lipid A export ATP-binding/permease R2846_0586 69654 71417 protein -0,083040196 -0,083040196 -0,208491101 -0,158419193 R2846_0056 45648 46199 Thymidine kinase -0,090827404 -0,090827404 0,427668462 0,134827944 R2846_1309 247388 249256 Putative peptidyl-prolyl cis-trans isomerase -0,093485425 -0,093485425 -0,179766667 -0,303956303 R2846_0348 1719 2540 Probable oxidoreductase -0,095168234 -0,095168234 0,236638526 0,196370506 R2846_1691 25959 26900 Putative lysophospholipase L2 -0,09518626 -0,09518626 -0,757279314 0,404913673 ATP-dependent Clp protease ATPase R2846_1468 417408 419978 subunit -0,095256349 -0,095256349 0,895077082 0,978710863 R2846_0769 58137 58835 16S rRNA U516 pseudouridine synthase -0,096045496 -0,096045496 -0,73398812 -0,734228465 R2846_1630 18521 18943 Conserved hypothetical protein -0,098301627 -0,098301627 -0,585688482 -0,334005732 R2846_0603 54573 55235 Conserved hypothetical protein -0,098889543 -0,098889543 -0,017080949 0,279507221 CGSHiEE_05635 2985 3173 hypothetical protein -0,102388914 -0,102388914 1,854419898 0,569310343 ctg7180000001717_orf00024 12149 15130 glimmer prediction -0,107576896 -0,107576896 -0,297745686 -0,172810853 R2846_1735 20587 20973 Putative CrcB-like protein -0,107609286 -0,107609286 -0,916962784 -1,344298713 CGSHiGG_00300 3698 4606 ribosomal protein S6 modification protein -0,108226142 -0,108226142 -0,300071292 -0,517076468 Probable two-component regulator, sensory R2846_0684 27083 28438 histidine kinase component QseC -0,11261831 -0,11261831 -0,161696387 -0,30982241 R2846_1321 263713 269160 Immunoglobulin A1 protease -0,118582284 -0,118582284 0,508425867 0,317713023 R2846_0723 113987 116632 Conserved hypothetical protein -0,120811455 -0,120811455 0,475566174 0,47510376 phosphoribosylaminoimidazole carboxylase CGSHiEE_05745 20959 22047 ATPase subunit -0,122505628 -0,122505628 -0,877158798 0,023593807 R2846_0751 80524 81216 Orotidine 5-phosphate decarboxylase -0,123982521 -0,123982521 0,02436858 -0,273098582 R2846_1490 438958 439641 Response regulator CpxR -0,124941908 -0,124941908 -0,44754125 -0,686999009

163

APPENDICES

FKBP-type peptidyl prolyl cis-trans R2846_1631 17881 18441 isomerase (rotamase) -0,12505071 -0,12505071 -0,963280839 -0,150089234 N-acetylmannosamine-6-phosphate 2- R2846_0492 12088 12774 epimerase -0,129983184 -0,129983184 -0,548836417 -0,469387995 R2846_0132 61491 62432 Fructose-1-phosphate kinase -0,130728892 -0,130728892 0,544018226 0,453616926 ctg7180000001718_orf00030 12610 14430 glimmer prediction -0,131253646 -0,131253646 0,473752508 0,109805467 R2846_0665 7727 8599 Hsf protein -0,136825174 -0,136825174 1,001333192 0,865535341 R2846_0112 42366 43217 Conserved hypothetical protein -0,140132288 -0,140132288 -0,873388373 -0,571739166 R2846_1197 124396 125553 Chorismate mutase/prephenate dehydratase -0,143345303 -0,143345303 -0,196595289 -0,284475328 R2846_0911 18756 19232 Aminoacyl-tRNA deacylase -0,146515274 -0,146515274 -0,432427659 -0,471231436 R2846_0918 14297 15187 Geranyltranstransferase -0,147334657 -0,147334657 0,282902215 -0,00229601 R2846_0686 30777 32252 Leucyl aminopeptidase -0,147678697 -0,147678697 0,105847626 0,346788789 R2846_0738 93962 95689 Lipoprotein LppC -0,154440631 -0,154440631 -0,2477675 -0,297390552 D-ribose ABC transporter, ATP-binding R2846_0081 12616 14097 protein -0,159069202 -0,159069202 -0,790774318 -0,320952513 R2846_0113 43227 44069 Conserved hypothetical protein -0,164700305 -0,164700305 -0,338113972 -0,271588858 ctg7180000001728_orf00135 76716 77072 glimmer prediction -0,164938627 -0,164938627 -0,458955459 -1,001267771 Lipooligosaccharide transporter, accessory R2846_1192 121137 121751 protein LptC -0,175959068 -0,175959068 -0,475439382 -0,6055722 R2846_0952 3899 4345 Conserved hypothetical protein -0,178558527 -0,178558527 -0,755902359 -1,122720437 R2846_1722 2178 2687 N-formylmethionyl-tRNA deformylase -0,180065658 -0,180065658 -0,415673516 -0,539263967 R2846_0271 13786 14952 Conserved hypothetical protein -0,180986485 -0,180986485 0,697557212 0,265680312 PTS system, glucose-specific IIA component R2846_0680 24981 25481 Crr -0,185297202 -0,185297202 -0,854177144 -0,649474232 R2846_1201 129281 130045 Cell division protein FtsQ -0,186909781 -0,186909781 0,282024288 0,295463072 R2846_1386 331455 333521 Glycyl-tRNA synthetase, beta subunit -0,189910204 -0,189910204 0,763512141 0,366553764 CGSHiGG_00290 2031 3251 3-oxoacyl-(acyl carrier protein) synthase I -0,190857776 -0,190857776 -0,213531131 -0,359013492 R2846_0844 83855 86479 DNA topoisomerase I -0,193070741 -0,193070741 -0,387433902 -0,535514143 R2846_1162 92187 92771 Sedoheptulose 7-phosphate isomerase -0,196053594 -0,196053594 -0,530010117 -0,128883821 ctg7180000001711_orf00049 25910 26077 glimmer prediction -0,197477829 -0,197477829 -1,167667652 -1,10853271

164

APPENDICES

R2846_0819 1043 2428 Conserved hypothetical protein -0,200089969 -0,200089969 -0,688989793 -0,564616016 R2846_0634 21691 22599 GTP-binding protein -0,203115926 -0,203115926 0,931294445 1,115959012 R2846_1216 146724 147677 Transaldolase B -0,205931686 -0,205931686 -0,45128986 -0,410017141 R2846_1296 233345 233890 Conserved hypothetical protein -0,206030475 -0,206030475 -0,985564784 -0,840034841 R2846_0782 43183 43356 Hypothetical protein -0,206791526 -0,206791526 -0,076784394 -0,645775635 R2846_0982 31585 32058 Riboflavin synthase beta chain -0,211533592 -0,211533592 -1,229346577 -0,723580909 R2846_1175 101627 102715 Phosphoserine aminotransferase -0,213977791 -0,213977791 -0,778280845 -0,651784305 CGSHiEE_05670 6892 8154 putative phosphate permease -0,218044709 -0,218044709 -0,009506952 0,404657274 DNA-directed RNA polymerase omega R2846_0648 7046 7312 chain -0,21836841 -0,21836841 -0,766327005 -0,627223396 R2846_0745 86113 86988 Pyridoxine biosynthesis lyase PdxS -0,220413397 -0,220413397 -0,619088295 -0,373267033 ctg7180000001718_orf00033 14440 14976 glimmer prediction -0,222912083 -0,222912083 1,094213925 0,67247804 R2846_1441 389475 389900 Nucleoside diphosphate kinase -0,224708458 -0,224708458 -0,54364653 -0,177562652 ctg7180000001719_orf00004 1485 3125 glimmer prediction -0,225792315 -0,225792315 -0,464392195 -0,569314967 R2846_1432 380115 381854 Thiol-disulfide interchange protein DsbD -0,231324166 -0,231324166 0,164217574 0,450195758 R2846_0726 109821 111908 carboxy-terminal protease -0,232931632 -0,232931632 -0,147380296 -0,059853223 Anaerobic glycerol-3-phosphate R2846_1652 3529 5220 dehydrogenase subunit A -0,234067004 -0,234067004 -0,378822407 -0,062928957 R2846_1681 16567 17130 DNA-3-methyladenine glycosidase I -0,234886034 -0,234886034 0,405519884 0,280734387 R2846_0274 11528 11947 Conserved hypothetical protein -0,23679919 -0,23679919 -0,560714198 -0,602864694 R2846_0593 61903 62931 Putative zinc-type alcohol dehydrogenase -0,241785479 -0,241785479 -1,637303531 -1,328247149 R2846_0826 6036 6518 DPS ferritin-like protein -0,24190261 -0,24190261 -0,87883078 -0,830359903 R2846_1233 166141 167181 ADP-heptose-LOS heptosyltransferase II -0,241988348 -0,241988348 -0,615814179 -0,203762337 R2846_0344 48760 49519 Probable arsenite transport protein -0,243166097 -0,243166097 0,483106235 0,01858873 CGSHiEE_05760 24112 24744 aromatic-amino-acid aminotransferase -0,243290164 -0,243290164 1,233216895 0,749190087 R2846_0109 38447 39550 Histidinol-phosphate aminotransferase -0,243447498 -0,243447498 -0,484401335 -0,571305958 23S rRNA mG2445 methyltransferase, R2846_0521 37248 39383 SAM-dependent -0,245330775 -0,245330775 -0,339244508 -0,462554187 CGSHiEE_05810 29275 29880 cobalt transport protein CbiM -0,245948828 -0,245948828 -0,334566734 -0,396879425

165

APPENDICES

ctg7180000001720_orf00021 10197 10301 glimmer prediction -0,246429031 -0,246429031 1,724142064 -0,126358413 5-methyltetrahydropteroyltriglutamate- R2846_0689 34729 36999 homocysteine methyltransferase -0,246517268 -0,246517268 0,698833517 0,817827756 R2846_1293 229417 230313 Hypothetical protein -0,249942992 -0,249942992 -0,413012503 -0,307288767 R2846_1150 79885 80778 Probable transcription activator GcvA -0,251480706 -0,251480706 -0,873815409 -0,797545075 R2846_1448 397139 398053 Putative glycosyltransferase -0,253659108 -0,253659108 -0,534173511 -0,229171235 R2846_1472 421438 424230 DNA polymerase I -0,253697633 -0,253697633 0,412175421 0,487998936 Na+-transporting NADH:ubiquinone R2846_0468 60445 61680 oxidoreductase, subunit NqrF -0,25540965 -0,25540965 0,497040384 0,796023557 R2846_0817 3235 3657 Putative murein hydrolase effector LrgA -0,256592279 -0,256592279 -0,664197865 -1,224438934 Probable D-glycero-D-manno- R2846_1459 407881 408912 heptosyltransferase LosB2 -0,257007553 -0,257007553 -0,566280043 -0,354122388 Putative lipooligosaccharide biosynthesis R2846_1443 391361 392587 protein -0,257478954 -0,257478954 -0,440854893 -0,331694097 R2846_0461 54518 55000 Adhesin protein E (PE) -0,260349155 -0,260349155 -1,367449049 -1,143784962 R2846_0236 46832 47176 Conserved hypothetical protein -0,263744702 -0,263744702 -0,929098777 -1,129545368 R2846_0767 60065 60865 Conserved hypothetical protein -0,266359901 -0,266359901 0,396030348 0,617791355 R2846_0762 66372 67814 Conserved hypothetical protein -0,266947755 -0,266947755 -0,190976071 -0,471893043 R2846_1541 482676 483299 Hypothetical protein -0,267891422 -0,267891422 -1,189883642 -0,497957371 lipid A biosynthesis (KDO)2-(myristoyl)- R2846_0439 29919 30875 lipid IVA acyltransferase -0,271259413 -0,271259413 0,6381761 0,527089741 Iron(III) ABC transporter ATP-binding R2846_0546 26379 27434 protein -0,275568296 -0,275568296 1,044168494 0,2495168 R2846_1212 142409 143374 16S rRNA m(4)C1402 methyltranserfase -0,277020238 -0,277020238 -0,201934953 -0,808871896 R2846_0966 19200 19916 Hypothetical protein -0,278805608 -0,278805608 -0,355937347 0,120583956 R2846_1394 336901 337935 DNA polymerase III subunit delta -0,279796897 -0,279796897 0,660426627 0,491315394 Putative cytochrome C-type biogenesis R2846_1374 318972 320879 protein -0,281216873 -0,281216873 0,256696505 0,812555487 R2846_1565 14776 15048 Fe(2+) trafficking protein YggX -0,288126112 -0,288126112 -0,770248895 -0,715754102 R2846_0115 45375 46034 Ribose-5-phosphate isomerase A -0,288181495 -0,288181495 -0,890617693 -0,652717247 R2846_0158 87103 88422 ATP-dependent RNA helicase -0,28936895 -0,28936895 -0,289379723 -0,371600024

166

APPENDICES

R2846_0955 10084 10437 50S ribosomal protein L20 -0,291449401 -0,291449401 0,273983944 1,270180183 ctg7180000001725_orf00041 28821 29792 glimmer prediction -0,291954426 -0,291954426 0,833009958 0,630805463 R2846_0238 43730 45922 Primosomal protein N putative -0,292001524 -0,292001524 -0,04289219 -0,388239978 R2846_0082 14111 14530 D-ribose pyranase -0,292088451 -0,292088451 -1,555361888 -1,402765288 R2846_0682 25992 26357 Conserved hypothetical protein -0,293733728 -0,293733728 -0,902467694 -0,321001233 R2846_0311 20316 21032 Ribonuclease PH -0,299661002 -0,299661002 -0,737254908 -0,542381152 3,4-dihydroxy-2-butanone 4-phosphate R2846_1559 10268 10915 synthase -0,300355175 -0,300355175 0,306366043 0,344357521 ctg7180000001724_orf00025 10137 11048 glimmer prediction -0,300862668 -0,300862668 -0,859018388 -0,508439693 R2846_0476 67738 69108 Glutathione oxidoreductase -0,300905897 -0,300905897 -0,618173964 -0,591471583 R2846_0080 11632 12603 D-ribose ABC transporter, permease protein -0,303286248 -0,303286248 -0,77535884 -0,362790993 R2846_0897 31452 31664 Hypothetical protein -0,304408243 -0,304408243 -1,607194534 -1,533365492 ctg7180000001728_orf00379 213449 216217 glimmer prediction -0,304801555 -0,304801555 0,205642892 -0,054011782 R2846_0316 24598 24909 Conserved hypothetical protein -0,30657669 -0,30657669 1,06889584 0,901585138 ctg7180000001728_orf00689 409153 409623 glimmer prediction -0,307676669 -0,307676669 -0,005198119 -0,182691144 R2846_0313 21776 22642 Probable DnaJ-like co-chaperone (DjlA) -0,308895859 -0,308895859 -0,177629219 0,012495294 R2846_1301 239088 240089 Biotin synthetase -0,312417667 -0,312417667 -0,281579945 -0,768729223 R2846_0018 11044 11718 D-ribulose-5-phosphate 3-epimerase -0,314728823 -0,314728823 -0,240830371 -0,320021313 R2846_0598 57252 58109 Putative short-chain alcohol dehydrogenase -0,314833104 -0,314833104 -0,507796419 -0,610273142 ctg7180000001709_orf00039 20483 21319 glimmer prediction -0,315156506 -0,315156506 -1,607157263 -1,062556841 R2846_0607 51141 51917 Conserved hypothetical protein -0,315327841 -0,315327841 -0,13780759 -0,184381796 R2846_0949 333 1061 Conserved hypothetical protein -0,320000496 -0,320000496 -0,771108168 -0,001188668 R2846_0420 8906 9904 Conserved hypothetical protein -0,3224984 -0,3224984 -0,512801255 -0,297866821 R2846_0880 42426 43418 Probable glycosyltransferase -0,323687578 -0,323687578 0,423267533 0,272528955 ctg7180000001698_orf00004 2266 3411 glimmer prediction -0,324798675 -0,324798675 0,490851299 0,326746389 Bifunctional folylpolyglutamate R2846_0786 35806 37119 synthase/dihydrofolate synthase -0,327040314 -0,327040314 0,087502863 -0,247330635 R2846_1413 358778 359584 Prolipoprotein diacylglyceryl transferase -0,328463234 -0,328463234 0,166995059 0,414389474 ctg7180000001719_orf00012 7068 7922 glimmer prediction -0,333037553 -0,333037553 -0,363112579 -0,120530168

167

APPENDICES

R2846_0227 54417 55655 Peptidoglycan permease AmpG -0,337905856 -0,337905856 0,60153876 0,56888179 R2846_0545 25664 26344 Conserved hypothetical protein -0,34667859 -0,34667859 0,649409579 0,024928469 R2846_1405 350520 351284 Conserved hypothetical protein -0,348912628 -0,348912628 -0,360250383 0,213199745 R2846_0390 5492 8023 Adenylate cyclase -0,349217982 -0,349217982 0,372740786 0,468577567 Lipooligosaccharide transporter, ATP- R2846_1194 122254 122979 binding protein LptB -0,349628333 -0,349628333 -0,232331567 -0,439307763 ctg7180000001720_orf00003 720 830 glimmer prediction -0,351538086 -0,351538086 -1,291700586 -0,605388725 Tetraacyldisaccharide 4-kinase (Lipid A 4- R2846_0587 68583 69581 kinase) -0,357034434 -0,357034434 1,069789238 0,33364995 NMN acetyltransferase/ribosylnicotinamide R2846_1560 11134 12399 kinase -0,35714262 -0,35714262 0,432467957 0,254639553 R2846_1138 67510 68001 Conserved hypothetical protein -0,35937162 -0,35937162 -0,948454398 0,018828156 R2846_1640 4496 4813 Thiosulfurtransferase GlpE -0,363621237 -0,363621237 -1,29420659 -0,296987952 murein DD-endopeptidase, penicillin- R2846_0441 31707 32567 insensitive -0,365022704 -0,365022704 0,353198994 0,582702221 R2846_0138 67808 68137 Conserved hypothetical protein -0,366823716 -0,366823716 -1,451591299 -1,368503594 Probable TRAP-type transport system, R2846_0594 60890 61876 periplasmic component -0,367630211 -0,367630211 -1,262952324 -1,270961314 R2846_0162 91983 92792 Phosphomethylpyrimidine kinase -0,372913698 -0,372913698 2,185718505 0,375573948 R2846_0453 44685 45092 Putative transcriptional regulator -0,376348375 -0,376348375 -0,610376069 -0,818476138 Arginine ABC transporter, ATP-binding R2846_1163 92898 93629 protein ArtP -0,37776578 -0,37776578 1,932766975 0,431945021 R2846_0389 8328 9539 Conserved hypothetical protein -0,382811919 -0,382811919 -0,510238662 -0,371742773 R2846_1582 34938 35384 Conserved hypothetical protein -0,383732948 -0,383732948 -1,107482421 -0,497321744 R2846_0553 33743 34456 Conserved hypothetical protein -0,384531496 -0,384531496 -0,903240884 -0,427867926 R2846_1600 60022 60462 Conserved hypothetical protein -0,388589853 -0,388589853 -0,367352053 -0,92028899 23S rRNA C2498 ribose 2-O- R2846_1149 78801 79892 methyltransferase -0,390295652 -0,390295652 -0,757212449 -0,608085523 R2846_0928 5636 6850 Molybdopterin biosynthesis protein MoeA -0,390397664 -0,390397664 -0,039058789 -0,030286456 R2846_1237 170781 171767 Cell division protein ZipA -0,394605855 -0,394605855 -0,712004137 -0,517700615 R2846_1283 219725 220003 Putative heavy metal chaperone protein -0,396617055 -0,396617055 -0,35961007 0,645406236

168

APPENDICES

R2846_1182 110475 111332 Thioredoxin protein YbbN -0,397581344 -0,397581344 -0,892122704 -1,166372554 R2846_0535 9261 10523 Conserved hypothetical protein -0,398522219 -0,398522219 -0,1434817 0,073175437 CGSHiEE_05750 22187 23377 aspartate aminotransferase -0,40101356 -0,40101356 -0,998855763 -1,045061678 R2846_1451 400216 400839 Hypothetical protein -0,402510327 -0,402510327 -0,214958743 0,090074913 R2846_1179 105914 108997 Conserved hypothetical protein -0,405985549 -0,405985549 0,065427498 0,230967456 R2846_1705 37802 38785 tRNA-dihydrouridine synthase A -0,40850529 -0,40850529 -0,344681108 -0,073997345 R2846_0341 47466 47795 Conserved hypothetical protein -0,415260898 -0,415260898 -1,678868497 -2,061166174 Putative K+-tellurite ethidium and proflavin R2846_0072 4620 5606 transport protein (TDT family) -0,415956382 -0,415956382 -0,636454767 -0,186846512 R2846_0533 8206 8436 Hypothetical protein -0,41636139 -0,41636139 -1,67954109 -1,558150815 Putative LysR-family transcriptional R2846_0843 86557 87474 regulator -0,416921576 -0,416921576 -0,640543713 -0,398079607 Formate dehydrogenase formation protein R2846_0638 18724 19632 FdhE -0,417428936 -0,417428936 0,019110644 -0,011972209 R2846_1203 131037 132464 UDP-N-acetylmuramate--L-alanine ligase -0,419690748 -0,419690748 0,137851636 0,014050719 R2846_0077 8687 9685 Ribose operon repressor -0,422610455 -0,422610455 -1,09494544 -0,586160182 R2846_0464 56952 57686 Conserved hypothetical protein -0,426692532 -0,426692532 0,421149466 0,75733402 R2846_1591 48162 48875 UDP-2,3-diacylglucosamine hydrolase -0,427905365 -0,427905365 -1,510758302 -0,497471992 R2846_1365 309594 310616 Serine endoprotease DegS -0,429626741 -0,429626741 0,328626224 0,796323786 Putative type II secretory pathway, R2846_1369 315653 315958 pseudopilin -0,434414107 -0,434414107 -1,26657998 -1,040060401 R2846_1569 17488 18720 Conserved hypothetical protein -0,435090834 -0,435090834 -0,268637934 -0,712898449 R2846_0589 65917 67746 Excinuclease ABC subunit C -0,436290299 -0,436290299 0,371026715 0,567912632 Na+-transporting NADH:ubiquinone R2846_0473 64884 66227 oxidoreductase, subunit NqrA -0,442214588 -0,442214588 -0,294573134 -0,031757827 R2846_0277 8616 10184 Apolipoprotein N-acyltransferase -0,444649342 -0,444649342 0,323863463 0,394126341 ctg7180000001728_orf00366 210505 211098 glimmer prediction -0,445017435 -0,445017435 0,126689365 0,750622508 R2846_1686 19931 21952 ATP-dependent DNA helicase Rep -0,453239441 -0,453239441 0,119591536 0,887470718 R2846_1416 361058 362164 glutamate 5-kinase/gamma-glutamyl kinase -0,45401406 -0,45401406 0,04735083 -0,22271336 Cysteine/glutathione ABC transporter, fused R2846_1184 112423 114183 ATPase and permease components -0,455880026 -0,455880026 0,361159203 0,84890217

169

APPENDICES

R2846_0423 12337 13881 Type I restriction enzyme M protein HsdM1 -0,456764168 -0,456764168 -0,302188918 -0,290066566 R2846_1285 220349 221458 Conserved hypothetical protein -0,458578502 -0,458578502 -0,742171863 -0,227061138 NAD(P)H-dependent glycerol-3-phosphate R2846_0391 4411 5418 dehydrogenase -0,460631394 -0,460631394 0,029711949 0,046354973 ctg7180000001706_orf00122 66061 66969 glimmer prediction -0,461263721 -0,461263721 -0,073078884 0,382855636 Toxin/antitoxin locus vapDX, toxin protein R2846_0129 59158 59295 VapD -0,464500518 -0,464500518 -1,255687349 -1,207376006 Aerobic respiration sensor-response protein R2846_0417 2984 4780 ArcB -0,468320285 -0,468320285 -0,031727785 -0,402707482 R2846_0140 69211 71805 Penicillin-binding protein 1A (PBP 1a) -0,468918158 -0,468918158 -0,246920512 -0,304230046 Putative mechanosensitive channel protein R2846_0443 33822 37157 KefA -0,47000314 -0,47000314 0,119188381 0,215650375 Glutamate tRNA synthetase, catalytic R2846_0309 18573 20015 subunit -0,472948116 -0,472948116 -0,49253606 -0,491818844 R2846_1491 440118 441119 Putative lysyl-tRNA synthetase -0,474323118 -0,474323118 0,526484808 -0,095148947 R2846_1294 230702 231904 Conserved hypothetical protein -0,474784386 -0,474784386 0,462194324 -0,329884823 R2846_0678 22857 23114 PTS system, phosphocarrier protein HPr -0,474790918 -0,474790918 -1,551963795 -1,392930807 Glucose-6-phosphate dehydrogenase R2846_0026 18098 19582 (G6PD) -0,475134467 -0,475134467 -0,018065747 -0,010431655 R2846_1145 74851 75924 23S rRNA pseudouridylate synthase RluB -0,475308397 -0,475308397 -0,021805974 0,026742608 R2846_0906 23344 24378 Phosphoribosylaminoimidazole synthetase -0,475402793 -0,475402793 -2,206577791 -1,425912322 ctg7180000001700_orf00018 13543 14340 glimmer prediction -0,47804688 -0,47804688 -0,574979991 -0,744153691 R2846_0015 5456 5944 Transcription elongation factor GreB -0,485914815 -0,485914815 -0,954121893 -0,981538792 ctg7180000001706_orf00120 65183 66058 glimmer prediction -0,486019186 -0,486019186 0,50264728 0,834812571 R2846_1586 38343 41822 DNA polymerase III alpha subunit -0,486316049 -0,486316049 -0,172835413 0,131039795 R2846_0154 82964 83689 Fatty acid metabolism regulator protein -0,488446187 -0,488446187 -0,513072816 -0,480235567 R2846_0394 1247 2632 Probable permease -0,489692371 -0,489692371 -0,976792813 -0,289769849 ctg7180000001706_orf00129 72350 73684 glimmer prediction -0,490030703 -0,490030703 -0,468936115 -0,094925756 Type I restriction enzyme HindVIIP, R R2846_0805 9379 12546 protein -0,491054514 -0,491054514 0,503232085 0,453603982 ctg7180000001724_orf00028 13462 14076 glimmer prediction -0,491493025 -0,491493025 -0,20969467 0,664506216

170

APPENDICES

ctg7180000001718_orf00037 14992 15543 glimmer prediction -0,496136841 -0,496136841 0,756387635 0,457718807 ctg7180000001728_orf00336 195020 196156 glimmer prediction -0,496812446 -0,496812446 -0,002634664 0,525677418 R2846_1318 259929 261293 Chromosomal replication initiator protein -0,502859544 -0,502859544 -0,432410364 -0,288630712 Imidazole glycerol phosphate synthase, R2846_0107 36582 37181 subunit HisH -0,503135051 -0,503135051 -0,571177193 -0,250344419 R2846_1380 325709 326290 Hypothetical protein -0,505442877 -0,505442877 -0,866364693 -0,806976169 R2846_1704 37464 37754 Conserved hypothetical protein -0,508474974 -0,508474974 -0,345514777 -0,471374746 R2846_1680 15547 16353 Hypothetical protein -0,512441938 -0,512441938 0,602698155 0,02956141 R2846_0827 4884 5762 Cytidine deaminase -0,514778925 -0,514778925 -0,892725955 -1,005942429 R2846_1636 9305 10129 outer membrane protein P4 -0,515303583 -0,515303583 -0,43563607 0,045602132 R2846_1408 353844 356549 Preprotein translocase, subunit SecA -0,515682862 -0,515682862 0,432577275 0,553005926 ctg7180000001728_orf00357 206687 207949 glimmer prediction -0,519107547 -0,519107547 0,779548413 -0,054593487 R2846_1222 153559 154437 Conserved hypothetical protein -0,51988473 -0,51988473 0,261684227 -0,184634388 R2846_0017 8477 10897 DNA gyrase subunit B -0,520123926 -0,520123926 0,073066567 -0,096478078 R2846_0114 44113 45345 D-3-phosphoglycerate dehydrogenase -0,520277237 -0,520277237 -0,679006214 -0,684491119 R2846_0287 128 334 Copper chaperone protein -0,520838039 -0,520838039 -1,162849788 -0,603242503 R2846_0729 106895 107650 Conserved hypothetical protein -0,522909543 -0,522909543 -0,755766749 -0,633162361 R2846_1643 2134 3021 Site-specific tyrosine recombinase XerC -0,526394332 -0,526394332 0,542995578 -0,126592738 R2846_0579 78477 80390 DNA mismatch repair protein MutL -0,528171336 -0,528171336 1,109592022 0,870662701 R2846_0532 6750 8039 Seryl-tRNA synthetase -0,529074318 -0,529074318 -0,571464878 -0,39792722 R2846_0605 52778 53452 Probable pseudouridylate synthase -0,531613921 -0,531613921 -0,082665572 0,131691235 R2846_1144 73869 74840 Cys regulon transcriptional activator -0,532677064 -0,532677064 -0,107512864 -0,145846033 Formate dehydrogenase-N, cytochrome R2846_0639 17933 18652 B556(Fdn) gamma subunit, nitrate-inducible -0,533233911 -0,533233911 0,024001203 -0,038582976 ctg7180000001728_orf00067 33922 34035 glimmer prediction -0,533705923 -0,533705923 -0,389647538 -1,830767089 2-C-methyl-D-erythritol 4-phosphate R2846_1662 1011 1688 cytidylyltransferase -0,535562634 -0,535562634 0,036565136 -0,064356545 Probable ABC transporter, fused permease R2846_0611 46504 48282 and ATP-binding components -0,541196896 -0,541196896 0,598996829 0,258487418 R2846_0574 87009 87701 Hsp 24 nucleotide exchange factor GrpE -0,541555852 -0,541555852 -0,112237242 -0,170564647

171

APPENDICES

ctg7180000001724_orf00012 4131 4979 glimmer prediction -0,541644807 -0,541644807 0,357560243 0,910840957 R2846_1424 371782 373038 ATP-dependent RNA helicase RhlB -0,543524724 -0,543524724 -0,690201304 -0,47989419 R2846_1384 330462 330722 Conserved hypothetical protein -0,545468562 -0,545468562 -0,071974104 0,019348924 R2846_0856 63749 65170 Conserved hypothetical protein -0,550315983 -0,550315983 0,012559398 0,261816933 Cysteine/glutathione ABC transporter, fused R2846_1185 114183 115913 ATPase and permease components -0,550497179 -0,550497179 0,666950118 0,815764148 R2846_0084 16301 17596 Probable oxidoreductase OrdL -0,553686564 -0,553686564 -0,040691197 -0,268719777 ctg7180000001728_orf00371 212119 213459 glimmer prediction -0,553803225 -0,553803225 0,0838198 -0,019526493 R2846_0467 59261 60301 Lipoprotein ApbE -0,557063189 -0,557063189 0,421682298 0,078003557 R2846_0541 21131 21886 Conserved hypothetical protein -0,558015787 -0,558015787 -1,335533302 -0,829258125 R2846_1205 133668 134852 Cell division protein FtsW -0,560000557 -0,560000557 -0,258055052 0,178097812 R2846_0796 21864 23912 Methionyl-tRNA synthetase -0,560213025 -0,560213025 -0,288010228 -0,053147776 R2846_0078 9713 10636 Ribokinase -0,562252823 -0,562252823 -0,90082405 -0,960774351 R2846_0243 38965 41256 GTP pyrophosphokinase -0,563957267 -0,563957267 -0,387123676 -0,536593674 R2846_1633 12089 15985 Conserved hypothetical protein -0,564312265 -0,564312265 0,40331058 0,236493836 conserved hypothetical phosphate transport CGSHiEE_05665 6187 6867 regulator -0,567627315 -0,567627315 0,080940331 -0,510232937 Transcriptional regulator of asparagine R2846_0021 13649 14101 biosynthesis -0,569288701 -0,569288701 -1,363229204 -1,375741624 R2846_0388 9550 10836 Conserved hypothetical protein -0,569789117 -0,569789117 -0,333645603 -0,289447612 R2846_1383 329495 330403 Glycyl-tRNA synthetase, alpha subunit -0,572781113 -0,572781113 -0,292819142 -0,313100936 R2846_0361 20357 20650 General secretory pathway component YajC -0,574234471 -0,574234471 -0,448184651 -0,243480373 R2846_1292 228801 229412 Conserved hypothetical protein -0,574643128 -0,574643128 -0,833374562 -0,651247847 Toxin/antitoxin locus vapDX, antitoxin R2846_0128 58958 59149 protein VapX -0,575773512 -0,575773512 -0,487602614 -0,562006669 R2846_1486 435315 437063 Inner membrane hydrolase YejM -0,576638285 -0,576638285 -0,559040835 -0,492658846 R2846_1225 156825 157496 Deoxyribose-phosphate aldolase -0,576748658 -0,576748658 -1,278963605 -1,0249799 bifunctional phosphoribosylaminoimidazolecarboxamide R2846_1430 377807 379405 formyltransferase/IMP cyclohydrolase -0,58900663 -0,58900663 -2,04185087 -1,559479137

172

APPENDICES

R2846_0919 12378 14255 1-deoxyxylulose-5-phosphate synthase -0,589095684 -0,589095684 0,26622106 0,212318701 Periplasmic nitrate reductase, cytochrome C- R2846_0229 52926 53528 type protein NapC -0,589907884 -0,589907884 -0,223867744 -0,869801861 R2846_0627 29514 30953 Putative membrane pump protein -0,594328743 -0,594328743 0,053907968 0,233086324 ctg7180000001720_orf00058 29910 32891 glimmer prediction -0,59433022 -0,59433022 -0,424509026 -0,274520359 Ribonucleoside-diphosphate reductase 1, R2846_0734 97538 99808 alpha subunit -0,598459457 -0,598459457 0,157740408 0,729615567 NTP pyrophosphohydrolase (MutT) (7,8- R2846_1407 353369 353779 dihydro-8-oxoguanine-triphosphatase) -0,601812514 -0,601812514 0,342689218 0,31355153 R2846_1352 299669 300343 Catabolite gene activator (Crp) -0,602527712 -0,602527712 -1,010791591 -1,002058524 R2846_0924 8891 9769 5,10-methylenetetrahydrofolate reductase -0,602756241 -0,602756241 -0,563432812 -0,997559306 ctg7180000001706_orf00157 90772 91053 glimmer prediction -0,608245574 -0,608245574 -0,128194123 -1,006203382 R2846_1353 300328 300579 Conserved hypothetical protein -0,609133775 -0,609133775 -0,545634797 -0,611096886 R2846_0509 28152 28682 Putative inorganic pyrophosphatase -0,609505063 -0,609505063 -1,231316628 -0,274414817 cytochrome c maturation heme lyase subunit R2846_1241 174818 175735 CcmH2 -0,609802087 -0,609802087 -0,633981216 -0,657276302 5-methylaminomethyl-2-thiouridine CGSHiGG_00285 128 1882 methyltransferase -0,613159173 -0,613159173 -0,702388632 -0,535883141 R2846_0493 12819 13721 N-acetylmannosamine kinase -0,613544073 -0,613544073 -1,637091124 -0,875606209 ctg7180000001724_orf00004 1664 2566 glimmer prediction -0,615698715 -0,615698715 0,693632561 0,619222781 R2846_0118 50009 50884 Conserved hypothetical protein -0,616025866 -0,616025866 -0,664881454 -0,603691803 R2846_0743 88116 89810 D-lactate dehydrogenase -0,618773358 -0,618773358 -0,606641834 -0,285502424 ctg7180000001728_orf00213 116104 116244 glimmer prediction -0,619637875 -0,619637875 0,857735372 0,890128141 R2846_0155 83735 85102 Phosphatidylserine synthase -0,623399779 -0,623399779 -0,715424231 -0,573762415 Phosphate regulon transcriptional regulatory R2846_0859 61092 61787 protein -0,623892021 -0,623892021 -0,49270035 -0,840616265 R2846_0037 28684 28902 translation initiation factor 1 (IF-1) -0,625344225 -0,625344225 -0,077431598 -0,524890499 R2846_1561 12396 13076 Conserved hypothetical protein -0,625428873 -0,625428873 -0,083661051 -0,005991103 ctg7180000001706_orf00105 55629 55739 glimmer prediction -0,627365368 -0,627365368 -2,112091622 -1,812712411 ctg7180000001710_orf00078 45187 45306 glimmer prediction -0,629982225 -0,629982225 1,557959302 0,160301808 R2846_0789 30319 32967 DNA gyrase subunit A -0,633377256 -0,633377256 -0,056561396 0,162889059

173

APPENDICES

R2846_0127 57588 58886 Putative hemolysin -0,637889793 -0,637889793 0,27590778 0,170482757 R2846_1238 171879 173891 NAD-dependent DNA ligase -0,642009416 -0,642009416 -0,290825882 0,527493245 ctg7180000001724_orf00011 3323 4138 glimmer prediction -0,642506186 -0,642506186 0,496107491 0,908609529 R2846_0716 120628 121641 Arabinose-5-phosphate isomerase -0,643041957 -0,643041957 -0,671830815 -0,685491257 ctg7180000001729_orf00042 20380 20697 glimmer prediction -0,648482625 -0,648482625 0,688645864 0,077163072 R2846_1592 48961 49683 1-acyl-glycerol-3-phosphate acyltransferase -0,649831301 -0,649831301 -0,588002269 -0,6012442 Probable type I restriction modification R2846_0540 18583 20955 system, methylase component HsdM2 -0,652038152 -0,652038152 -0,002053742 -0,216147499 R2846_1410 357054 357368 Hypothetical protein -0,653771141 -0,653771141 -0,00758927 -1,547024415 R2846_0485 3953 4660 Putative 4-phosphopantetheinyl transferase -0,657919756 -0,657919756 -0,454371864 0,14899548 Citrate lyase alpha chain, citrate-ACP R2846_0625 32533 34035 transferase -0,658461527 -0,658461527 -0,248787934 0,287326063 R2846_1148 77596 78765 Succinyl-CoA synthetase, beta subunit -0,663547762 -0,663547762 -0,391020524 0,264705045 7,8-dihydro-6-hydroxymethylpterin- R2846_0582 76135 76617 pyrophosphokinase -0,667335134 -0,667335134 1,223989026 0,8999089 R2846_0457 48994 49908 N-acetyl-D-glucosamine kinase -0,669532956 -0,669532956 -1,073490952 -1,401432273 Periplasmic nitrate reductase, small subunit R2846_0230 52459 52911 B -0,677125563 -0,677125563 0,004213611 -0,650064626 R2846_0728 107702 108262 Conserved hypothetical protein -0,679761889 -0,679761889 0,139607634 -0,204299015 R2846_1634 11104 12081 Hypothetical protein -0,681287254 -0,681287254 0,014581631 0,318774447 R2846_1195 122982 123476 PtsN-like protein -0,681758364 -0,681758364 0,400523431 0,389731383 3-deoxy-D-manno-octulosonate 8-phosphate R2846_0715 121651 122193 phosphatase -0,682851856 -0,682851856 0,466039828 0,72845407 R2846_0275 10968 11528 Conserved hypothetical protein -0,686003869 -0,686003869 0,408942902 0,496050872 CGSHiEE_05650 5249 5485 hypothetical protein -0,691656759 -0,691656759 -0,993571199 -0,658169113 R2846_1210 140238 142070 Peptidoglycan synthetase FtsI -0,693667807 -0,693667807 -0,331941324 -0,369532433 R2846_1500 447925 448389 Acyl-CoA thioesterase YciA -0,695645674 -0,695645674 -0,217142262 -0,210313538 R2846_1628 20081 20830 Stationary-phase survival protein SurE -0,696541466 -0,696541466 -0,345421033 -0,53713841 R2846_1599 59334 59960 nitrate/nitrite response regulator protein -0,696905634 -0,696905634 -1,901323991 -1,457123978 R2846_1303 240833 242449 Thiamin ABC transporter, permease protein -0,697827555 -0,697827555 -0,018282003 -0,115999367

174

APPENDICES

ctg7180000001718_orf00018 8652 8786 glimmer prediction -0,699082889 -0,699082889 1,14599837 0,606881678 Na+-transporting NADH:ubiquinone R2846_0470 62293 62919 oxidoreductase, subunit NqrD -0,699392177 -0,699392177 0,260500957 0,529629864 ctg7180000001705_orf00002 588 1082 glimmer prediction -0,700989026 -0,700989026 0,185206588 0,465204413 R2846_0365 24798 25148 Putative oxidoreductase -0,701005703 -0,701005703 -1,028846581 -0,939640252 Citrate lyase synthetase (citrate (pro-3S)- R2846_0622 35247 36254 lyase ligase) -0,702669037 -0,702669037 -0,904386092 -0,668267296 R2846_1141 70019 72154 Phosphate acetyltransferase -0,702816452 -0,702816452 0,189802334 0,857953475 Phospho-N-acetylmuramoyl-pentapeptide- R2846_1207 136299 137381 transferase E -0,703214571 -0,703214571 0,017690906 -0,077639795 ctg7180000001720_orf00082 42639 42815 glimmer prediction -0,70518367 -0,70518367 -0,286347813 -0,821330483 R2846_0764 62977 64125 Chaperone Hsp40, co-chaperone with DnaK -0,708562903 -0,708562903 0,807400303 1,32531075 4-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine R2846_1356 301767 302969 synthetase -0,708887313 -0,708887313 -0,730712507 -0,75268243 ctg7180000001729_orf00099 57717 57833 glimmer prediction -0,709422797 -0,709422797 -1,430172539 -1,337168085 ctg7180000001713_orf00006 9138 9260 glimmer prediction -0,710953202 -0,710953202 0,470181305 1,804315359 R2846_0504 22756 23964 Sugar efflux transporter SotB -0,712798721 -0,712798721 -0,171047579 0,04422282 Periplasmic nitrate reductase assembly R2846_0234 47905 48186 protein NapD -0,715037958 -0,715037958 -0,951893287 -2,050397534 R2846_1719 5102 6478 TRK system potassium uptake protein -0,720728551 -0,720728551 -0,075570119 0,302559302 Sec-independent protein secretion pathway R2846_0452 44240 44527 component TatA -0,721209696 -0,721209696 -1,503820233 -1,736337623 R2846_1174 101092 101436 Conserved hypothetical protein -0,721852333 -0,721852333 -1,499925129 -1,146386705 R2846_1181 109424 110395 Ferrochelatase -0,721975294 -0,721975294 -0,465821981 -0,230597276 R2846_0626 30955 32352 CitXG bifunctional protein -0,726411306 -0,726411306 0,018973298 0,09969211 ctg7180000001724_orf00027 12173 13444 glimmer prediction -0,730011209 -0,730011209 0,075915245 0,137126959 R2846_1632 15995 17731 Conserved hypothetical protein -0,734661122 -0,734661122 -0,060019378 -0,040393805 R2846_0864 56316 56903 Ferritin protein A1 -0,734740188 -0,734740188 -2,270523388 -1,536173428 Glucosamine-fructose-6-phosphate R2846_0151 78865 80697 aminotransferase -0,735117068 -0,735117068 -0,945843309 -0,568094443

175

APPENDICES

R2846_0929 4901 5632 Molybdopterin biosynthesis protein MoeB -0,735842665 -0,735842665 0,124420695 0,02691804 Na+-transporting NADH:ubiquinone R2846_0471 62919 63653 oxidoreductase, subunit NqrC -0,737327362 -0,737327362 0,378937079 0,357766931 ctg7180000001718_orf00024 9327 11588 glimmer prediction -0,738645168 -0,738645168 -0,777839037 -1,083043797 R2846_0373 33700 34167 Putative sugar isomerase -0,74182952 -0,74182952 -1,345330655 -1,168181023 ctg7180000001705_orf00003 1283 1705 glimmer prediction -0,746194056 -0,746194056 -1,361974865 -0,912492255 Peptide ABC transporter system, periplasmic R2846_1118 42576 44270 binding protein SapA -0,747357945 -0,747357945 -0,400112316 -0,110173597 R2846_0392 3596 4399 Serine acetyltransferase -0,752438927 -0,752438927 0,135867714 0,18613522 ctg7180000001729_orf00046 22473 24788 glimmer prediction -0,752859092 -0,752859092 -0,758643117 -0,500323905 ctg7180000001728_orf00409 232425 232649 glimmer prediction -0,754033223 -0,754033223 -1,699808992 -1,304597213 R2846_1135 64579 65034 Arginine repressor -0,75585506 -0,75585506 -0,599761556 -0,840914145 iron chelatin ABC transporter, periplasmic- HI_1472 15853 16908 binding protein, putative -0,756399038 -0,756399038 -0,4347547 -0,438707099 R2846_0424 14113 16152 Oligopeptidase A -0,75760493 -0,75760493 -0,156760844 0,205826887 ctg7180000001719_orf00015 8929 10110 glimmer prediction -0,762667752 -0,762667752 0,229272978 0,174530013 LPS assembly OM complex LptDE, protein R2846_1594 51214 53562 LptD -0,763245273 -0,763245273 -0,5112603 -0,199486427 Molybdenum cofactor biosynthesis protein R2846_0719 117960 118973 A -0,763970127 -0,763970127 -1,690553452 -1,999138514 R2846_1312 252587 252847 Conserved hypothetical protein -0,766081199 -0,766081199 1,078154214 0,842843022 ctg7180000001724_orf00023 8328 9425 glimmer prediction -0,773686974 -0,773686974 -0,938117078 -1,469560996 R2846_0433 25661 26434 Hypothetical protein -0,777359619 -0,777359619 -0,709395916 -0,459425357 Deoxyuridine 5-triphosphate R2846_1355 301264 301719 nucleotidohydrolase -0,778364466 -0,778364466 -0,631785719 -0,478440347 (p)ppGpp synthetase II/ guanosine-3,5-bis R2846_0649 4859 6973 pyrophosphate 3-pyrophosphohydrolase -0,778707631 -0,778707631 -0,008578767 -0,261839575 Probable outer membrane protein assembly R2846_0330 40332 40961 complex subunit NlpB -0,781420722 -0,781420722 -1,132196849 -1,116332371 Peptide ABC transporter system, permease R2846_1120 45225 46112 protein SapC -0,786377253 -0,786377253 -0,19225771 -0,034486406 R2846_1720 3737 5089 16S rRNA m5C967 methyltransferase -0,787831486 -0,787831486 0,080773204 0,353218774

176

APPENDICES

Dipeptide/Heme ABC transport system, R2846_1475 425520 427169 periplasmic binding protein -0,789820842 -0,789820842 -1,356238154 -1,12470958 ctg7180000001723_orf00007 1376 2638 glimmer prediction -0,794184262 -0,794184262 0,03057478 -0,203789405 R2846_0051 38405 39823 Aspartate ammonia-lyase (aspartase) -0,797279071 -0,797279071 -0,12789941 0,561173782 R2846_0556 38227 39504 Threonine synthase -0,798428201 -0,798428201 0,037150376 0,370458062 phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP R2846_0104 34374 35039 pyrophosphohydrolase -0,800933886 -0,800933886 -0,463784759 -0,7515329 Chorismate synthase (5- enolpyruvylshikimate-3-phosphate R2846_0442 32739 33812 phospholyase) -0,802538636 -0,802538636 -0,097772609 0,007785035 Formate dehydrogenase-N, Fe-S beta R2846_0640 17002 17940 subunit, nitrate-inducible -0,804298651 -0,804298651 -0,088242822 0,078826221 R2846_0073 5659 6378 Conserved hypothetical protein -0,805541402 -0,805541402 -0,56413352 -0,407560695 R2846_0290 119 325 Copper chaperone protein -0,806036826 -0,806036826 -1,525222436 -0,762941308 ctg7180000001709_orf00043 24104 25246 glimmer prediction -0,807854134 -0,807854134 -0,921754196 -0,718955787 ctg7180000001728_orf00003 990 1103 glimmer prediction -0,812108465 -0,812108465 1,058669749 1,448225861 R2846_0882 40105 40713 Conserved hypothetical protein -0,813830882 -0,813830882 -0,73397133 -0,775020143 R2846_0421 9907 11061 Anticodon nuclease -0,829600213 -0,829600213 -0,465761142 -0,705063843 R2846_0555 37240 38184 Homoserine kinase -0,829729452 -0,829729452 -0,460500126 0,44001526 R2846_1499 447612 447908 Conserved hypothetical protein -0,833383371 -0,833383371 0,177349083 0,123502677 Membrane-bound ATP synthase, F1 sector, R2846_0102 32294 32722 epsilon-subunit -0,841012964 -0,841012964 -0,171551972 0,414871832 R2846_0035 26770 27801 alpha-1,6-DD-heptosyltransferase -0,847745474 -0,847745474 -1,202732745 -0,619355066 ctg7180000001709_orf00041 21319 22617 glimmer prediction -0,851755324 -0,851755324 -0,323812332 -0,964001475 Probable two-component regulator,transcriptional regulatory R2846_0683 26421 27086 component QseB -0,854072807 -0,854072807 0,519699669 -0,184271465 R2846_1651 1788 3236 Glycerol-3-phosphate permease -0,854432078 -0,854432078 -0,599621369 0,029134595 R2846_1510 458274 458822 Conserved hypothetical protein -0,854998854 -0,854998854 -0,781072547 -0,514347458 R2846_0231 51599 52462 Putative ferredoxin-type protein NapH -0,856915949 -0,856915949 -0,430902628 -1,196691574

177

APPENDICES

R2846_1721 2781 3737 Methionyl-tRNA formyltransferase -0,857963745 -0,857963745 0,020039689 0,409487656 ctg7180000001719_orf00040 23874 24509 glimmer prediction -0,860597779 -0,860597779 -0,985458321 -0,621235049 cytochrome c maturation heme lyase subunit R2846_1242 175736 176197 CcmH1 -0,86207767 -0,86207767 -0,277533503 -1,187456858 R2846_0393 2771 3586 Shikimate 5-dehydrogenase (SHD-L) -0,866815338 -0,866815338 0,308387207 0,067145678 R2846_0282 3381 4598 Type II secretory pathway, component PilC -0,871568654 -0,871568654 -0,915186508 -0,674954614 ctg7180000001728_orf00331 190379 191059 glimmer prediction -0,878522266 -0,878522266 -0,845346981 -0,583343091 ctg7180000001723_orf00108 57102 57500 glimmer prediction -0,880116862 -0,880116862 -0,639111169 -0,758014477 putative translation initiation inhibitor, YjgF CGSHiEE_05800 28431 28781 family protein -0,880281821 -0,880281821 -1,391997686 -0,533998849 ctg7180000001720_orf00019 8994 9179 glimmer prediction -0,880967529 -0,880967529 -1,935539262 -1,020236917 R2846_0016 6039 8351 Probable transcription accessory protein Tex -0,883216428 -0,883216428 -0,197504456 -0,075728358 R2846_0242 41271 41627 Diacylglycerol kinase -0,891581444 -0,891581444 -0,124802051 -0,703255438 R2846_1473 424245 424451 Hypothetical protein -0,891796536 -0,891796536 0,880392144 0,518881209 R2846_1412 357917 358768 Thymidylate synthetase -0,893456127 -0,893456127 0,33013946 0,402832742 R2846_1243 176197 176742 heme lyase/disulfide oxidoreductase (DsbE) -0,895513834 -0,895513834 -0,649360339 -0,550202347 R2846_1611 38723 39115 Conserved hypothetical protein -0,897264006 -0,897264006 -1,218810816 -1,109805204 R2846_1116 40067 41050 Putative restriction endonuclease -0,898392891 -0,898392891 -0,832506383 -0,518539365 R2846_1583 35398 35907 Protein export chaperone SecB -0,902574133 -0,902574133 -0,985467009 -0,89410324 R2846_0761 67878 68336 Methylglyoxal synthase -0,909986728 -0,909986728 -1,003017348 -1,052308779 R2846_0753 79473 80168 DNA replication initiation factor Had -0,911538619 -0,911538619 0,032510972 0,018398925 R2846_0690 37220 37963 Conserved hypothetical protein -0,912480506 -0,912480506 0,12536281 0,497844204 R2846_1666 3440 3658 Cell division protein ZapB -0,913142648 -0,913142648 -1,62932624 -1,291502132 R2846_0667 10384 11718 Argininosuccinate synthetase -0,915019654 -0,915019654 -0,479698942 0,048229101 R2846_1311 250962 252587 Inner membrane translocation protein YidC -0,916326515 -0,916326515 0,603964599 0,434895136 R2846_0954 6336 9971 Exodeoxyribonuclease V, beta subunit -0,91967284 -0,91967284 -0,040068247 -0,146059338 Phosphate ABC transport system, ATPase R2846_0860 60228 60995 component -0,921090842 -0,921090842 -0,225529587 -0,266361994 Na+-transporting NADH:ubiquinone R2846_0472 63646 64881 oxidoreductase, subunit NqrB -0,922789173 -0,922789173 0,363979836 0,478282707

178

APPENDICES

R2846_1231 163384 164790 Probable Na+/H+ antiporter -0,924180338 -0,924180338 -1,253078905 -1,380667243 ctg7180000001717_orf00019 10835 11530 glimmer prediction -0,924691206 -0,924691206 -0,954898763 -0,422904458 ctg7180000001714_orf00014 8525 8785 glimmer prediction -0,927349718 -0,927349718 -1,271157736 -0,440876625 R2846_1214 144062 145648 Conserved hypothetical protein -0,928923443 -0,928923443 -1,549498521 -0,583002161 Imidazole glycerol phosphate synthase, R2846_0105 35039 35815 subunit HisF -0,930197043 -0,930197043 -0,402332047 -0,709977509 R2846_1337 284518 284775 Conserved hypothetical protein -0,930682346 -0,930682346 -0,400879987 -0,465278937 R2846_0249 31501 32211 DNA repair protein RecO -0,943696055 -0,943696055 -0,403821652 -0,393739613 R2846_0276 10234 10971 16S rRNA m3U1498 methyltransferase -0,946888261 -0,946888261 0,004144369 -0,078416085 ctg7180000001728_orf00410 232692 232880 glimmer prediction -0,952693194 -0,952693194 -1,372598165 -2,296545474 R2846_1211 142083 142406 Cell division protein FtsL -0,955963858 -0,955963858 -0,495094876 -1,245282771 R2846_0043 32340 32630 GroES, chaperone Hsp10 -0,95797501 -0,95797501 0,097994105 0,43730364 CGSHiEE_05805 28812 29228 hypothetical protein -0,958829452 -0,958829452 -1,508347636 -1,105138334 R2846_1506 453585 454583 Galactose operon regulator -0,962929535 -0,962929535 -1,61396964 -0,34126779 ctg7180000001722_orf00151 87714 87827 glimmer prediction -0,96392835 -0,96392835 -0,486224266 -0,137845387 Probable type I restriction modification system, restriction enzyme component R2846_0537 12408 15431 HsdR2 -0,971076864 -0,971076864 -0,065666011 -0,054613872 R2846_0773 50734 52773 Excinuclease ABC, subunit B -0,971457771 -0,971457771 -0,111858177 -0,026571386 Peptide ABC transporter system, ATPase R2846_1121 46116 47165 protein SapD -0,972220188 -0,972220188 -0,364422111 -0,039579413 ctg7180000001728_orf00339 197013 197249 glimmer prediction -0,974112346 -0,974112346 0,179690776 -0,317038496 ctg7180000001719_orf00027 15408 16658 glimmer prediction -0,976085951 -0,976085951 -0,026954597 0,055103655 HI_1475 14333 14746 predicted coding region HI1475 -0,981855593 -0,981855593 -0,305607083 -0,413417534 ctg7180000001706_orf00126 67040 71572 glimmer prediction -0,987580258 -0,987580258 0,355670574 0,649647395 CDP-diacylglycerol--glycerol-3-phosphate R2846_0513 29246 29803 3-phosphatidyltransferase -0,988236978 -0,988236978 -0,857244674 -0,739119017 R2846_0633 22596 23279 RNase III, dsRNA -0,989398432 -0,989398432 0,284314125 0,615074649 R2846_0251 29703 31034 Opacity-associated protein A -0,99388689 -0,99388689 -0,369389549 -0,654229403 CGSHiEE_05685 10160 10780 outer membrane lipoprotein LolB precursor -1,00403464 -1,00403464 -0,581765219 -0,349189582

179

APPENDICES

R2846_1522 471965 473026 Conserved hypothetical protein -1,005718667 -1,005718667 -1,791898225 -1,465120764 R2846_0697 43867 44634 Transcriptional regulator ModE -1,007001383 -1,007001383 -0,821698831 -1,68318517 Probable DNA specificity protein of R2846_0422 11063 12253 restriction modification system -1,010368996 -1,010368996 -0,863100172 -0,434106096 R2846_0542 22183 24078 Chaperone Hsp90 -1,012035513 -1,012035513 0,230976019 0,397782675 ctg7180000001724_orf00017 5903 6763 glimmer prediction -1,016451364 -1,016451364 -0,381489261 0,239686934 Imidazoleglycerolphosphate dehydratase and R2846_0108 37247 38335 histidinol-phosphate phosphatase -1,016988377 -1,016988377 -0,807071403 -0,68436321 R2846_0752 80197 80517 Translation initiation factor Sui1 -1,0189119 -1,0189119 -0,79112091 -0,723823599 Phosphate ABC transport system, permease R2846_0862 58421 59368 component -1,022109548 -1,022109548 -0,37808085 -0,317602196 S-ribosylhomocysteinase (Autoinducer-2 R2846_0089 22598 23101 production protein LuxS) -1,02248061 -1,02248061 -0,650626154 -0,170710187 R2846_0865 55799 56296 Ferritin protein A2 -1,022649375 -1,022649375 -2,399290615 -1,881395662 R2846_1411 357396 357917 tRNA-specific adenosine deaminase -1,026742706 -1,026742706 -0,493003882 -0,1155896 Phosphate ABC transport system, permease R2846_0861 59370 60218 component -1,030099431 -1,030099431 -0,112537212 -0,069931093 R2846_0117 47405 49816 ATP-dependent protease La -1,033551852 -1,033551852 -0,169781819 -0,421765066 Sec-independent protein secretion pathway R2846_0450 42896 43666 component TatC -1,036008752 -1,036008752 -1,214271198 -1,22193011 R2846_0060 48822 49982 Phosphoglycerate kinase -1,036725902 -1,036725902 -1,695428838 -1,451285063 R2846_1385 330752 331117 Hypothetical protein -1,037548462 -1,037548462 0,023535693 -0,299406562 R2846_1300 236967 238964 Transketolase 1 -1,046168956 -1,046168956 -0,469778788 -0,62125384 Membrane-bound ATP synthase, F0 sector, R2846_0095 26271 27059 subunit A -1,0476348 -1,0476348 -0,508454303 -0,034368172 ctg7180000001709_orf00025 10935 11906 glimmer prediction -1,053817664 -1,053817664 -1,682714972 -1,099623686 R2846_0772 52804 54747 Conserved hypothetical protein -1,05554697 -1,05554697 0,876842791 0,500441071 ctg7180000001727_orf00149 87663 87791 glimmer prediction -1,060769925 -1,060769925 -0,978508842 -0,474368173 R2846_0029 20970 21752 Hypothetical protein -1,06328243 -1,06328243 -0,194666959 -0,93259663 ctg7180000001720_orf00004 861 2081 glimmer prediction -1,065018891 -1,065018891 -1,350616888 -1,026418991 CGSHiGG_00305 4645 5859 glutaredoxin 1 -1,065136664 -1,065136664 -1,014914444 -0,678470983

180

APPENDICES

ctg7180000001700_orf00013 8211 9884 glimmer prediction -1,067509059 -1,067509059 -0,25564913 -0,105072943 ctg7180000001728_orf00314 179344 179547 glimmer prediction -1,069077863 -1,069077863 -1,114969785 -1,937249034 ctg7180000001728_orf00317 181057 181695 glimmer prediction -1,069769254 -1,069769254 -1,881872684 -2,054944 R2846_0064 53104 54648 Conserved hypothetical protein -1,071578074 -1,071578074 -0,812154627 -0,502544386 R2846_0806 8340 9377 Hypothetical protein -1,072696123 -1,072696123 -0,161930108 -0,339604783 R2846_1684 19246 19716 phosphopantetheine adenylyltransferase -1,073356312 -1,073356312 0,481496664 0,110255393 R2846_0970 21711 22721 Conserved hypothetical protein -1,076956093 -1,076956093 -0,712060921 -0,493560476 R2846_1519 469131 469688 Ribosome releasing factor -1,084274578 -1,084274578 -1,24234141 -0,706608995 R2846_0019 11764 12438 2-phosphoglycolate phosphatase -1,094583489 -1,094583489 -0,837466984 -0,875279255 R2846_1140 68746 69951 Acetate kinase -1,094778199 -1,094778199 -0,24195525 0,333137034 R2846_0232 50760 51599 Putative ferredoxin-type protein NapG -1,097953276 -1,097953276 -0,301040262 -0,900033342 R2846_0331 41072 41968 Dihydrodipicolinate synthetase -1,099226038 -1,099226038 -1,715708554 -1,21510327 R2846_0244 38223 38804 Hypothetical protein -1,099679723 -1,099679723 -1,215141783 -1,109144224 R2846_0942 911 1540 ATP-dependent protease FtsH -1,102002119 -1,102002119 0,338653609 0,009576987 UDP-N-acetylmuramoyl-tripeptide--D- R2846_1208 137375 138748 alanyl-D- alanine ligase -1,103425612 -1,103425612 -0,638708624 -0,347989041 UDP-N-acetylmuramoylalanyl-D-glutamate- R2846_1209 138762 140228 -2, 6-diaminopimelate ligase -1,107858407 -1,107858407 -0,768439251 -0,751358661 CGSHiEE_05695 11735 12682 ribose-phosphate pyrophosphokinase -1,108472 -1,108472 -0,526033061 -0,585610868 R2846_0289 70 195 Copper chaperone protein -1,108650354 -1,108650354 -1,503788676 -0,429790371 R2846_1013 53 679 Phosphocholine transferase LicD -1,110329539 -1,110329539 -1,620525098 -1,009109094 R2846_1295 232329 233165 Conserved hypothetical protein -1,111144262 -1,111144262 -2,002426461 -2,046998981 ctg7180000001725_orf00014 13948 14094 glimmer prediction -1,112526477 -1,112526477 -0,141052518 -0,123801589 R2846_0958 11586 12398 Conserved hypothetical protein -1,122241675 -1,122241675 -0,613308582 -0,787885082 L-2,4-diaminobutyrate:2-ketoglutarate 4- R2846_1360 304777 306141 aminotransferase aminotransferase -1,124123683 -1,124123683 -1,016183379 0,065917118 R2846_1429 376335 377621 Phosphoribosylamine-glycine ligase -1,129245028 -1,129245028 -1,351697187 -1,371794138 R2846_0604 53452 54513 Conserved hypothetical protein -1,130746945 -1,130746945 -0,187508934 0,219966541 R2846_0067 56881 57597 Purine-nucleoside phosphorylase (PNPase) -1,131105344 -1,131105344 -0,533456077 -0,540549

181

APPENDICES

R2846_0930 4509 4832 dsDNA mimic protein -1,132468854 -1,132468854 0,034635543 0,023209584 Sec-independent protein secretion pathway R2846_0451 43676 44236 component TatB -1,133460124 -1,133460124 -1,552880791 -2,021442967 R2846_0332 42069 42536 Thioredoxin-dependent thiol peroxidase -1,134618209 -1,134618209 -0,854612499 -0,819126897 R2846_0020 12503 13495 Asparagine synthetase A -1,142750643 -1,142750643 -0,957563556 -1,444227823 R2846_0419 5812 8895 Type I restriction enzyme R protein HsdR1 -1,145707048 -1,145707048 -0,615260429 -0,392680932 Phosphoribosylaminoimidazole- R2846_0668 11874 12746 succinocarboxamidesynthase -1,146206948 -1,146206948 -2,275837949 -1,854155144 ctg7180000001724_orf00026 11108 12163 glimmer prediction -1,146207634 -1,146207634 -0,464956706 0,259953644 R2846_0953 4414 6336 Exodeoxyribonuclease V, alpha subunit -1,149811931 -1,149811931 -0,17071318 -0,184177301 R2846_1172 99500 100486 Conserved hypothetical protein -1,14981768 -1,14981768 -0,968266746 -0,689590708 R2846_1125 50140 51144 Fructose-1,6-bisphosphatase -1,150294395 -1,150294395 -1,623209228 -1,365183254 Putative cytochrome C-type biogenesis R2846_1376 321406 322560 protein -1,150569193 -1,150569193 0,304542404 0,15510519 R2846_0765 61645 62898 Gamma-glutamyl phosphate reductase -1,153046856 -1,153046856 -0,101314614 0,116255007 ctg7180000001718_orf00016 6527 8272 glimmer prediction -1,156165546 -1,156165546 0,166263905 -0,761281824 Membrane-bound ATP synthase, F1 sector, R2846_0100 30005 30874 gamma-subunit -1,156245971 -1,156245971 -0,289042112 0,133390543 ctg7180000001709_orf00020 7455 8537 glimmer prediction -1,159439479 -1,159439479 -0,118995459 0,111682988 Putative soluble lytic murein R2846_1498 445815 447596 transglycosylase -1,164677477 -1,164677477 -0,359515339 -0,241515449 Undecaprenyl-PP-MurNAc-pentapeptide- R2846_1204 132601 133656 UDPGlcNAc GlcNAc transferase -1,166018851 -1,166018851 -0,209579553 0,077736789 R2846_1354 300601 301260 Nucleoid occlusion protein -1,170871408 -1,170871408 -0,592872701 -0,431434563 Probable transcriptional regulator of fatty R2846_0014 4782 5399 acid biosynthesis (FabR) -1,183223625 -1,183223625 -0,838963317 -0,216841109 ctg7180000001728_orf00257 149587 149784 glimmer prediction -1,183550711 -1,183550711 -1,048437504 -0,746766758 ctg7180000001727_orf00011 5279 6175 glimmer prediction -1,185866095 -1,185866095 -1,066770162 -0,718156195 R2846_1664 2471 2905 D-Tyr-tRNA deacylase -1,190268357 -1,190268357 -1,237801933 -0,608886054 R2846_0456 47371 48816 Putative amino acid symporter -1,190289227 -1,190289227 -0,527526602 -0,994914121 R2846_0731 102809 105616 2-oxoglutarate dehydrogenase E1 component -1,192418391 -1,192418391 -1,111964928 -1,068849674

182

APPENDICES

Phosphoribosylglycinamide R2846_0905 24433 25071 formyltransferase -1,197065246 -1,197065246 -1,838117514 -1,248853295 ctg7180000001724_orf00015 4983 5513 glimmer prediction -1,202733926 -1,202733926 -0,273243192 -0,014986389 ctg7180000001721_orf00105 59878 60042 glimmer prediction -1,20429965 -1,20429965 -0,460760743 -0,580992678 PTS system, phosphoenolpyruvate-protein R2846_0679 23194 24921 phosphotransferase -1,204880619 -1,204880619 -0,962761129 -0,797437793 ctg7180000001706_orf00159 91461 93221 glimmer prediction -1,2062296 -1,2062296 -0,282262345 -0,574346475 Arginine ABC transporter, periplasmic- R2846_1164 93646 94365 binding protein ArtI -1,20761718 -1,20761718 -0,237760842 -0,11341851 Methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate R2846_0395 261 1109 cyclohydrolase -1,209885208 -1,209885208 -1,087739554 -0,457315365 R2846_0065 54657 55445 Conserved hypothetical protein -1,215602466 -1,215602466 -0,933449109 -0,534481966 R2846_0554 34780 37227 Aspartokinase I/homoserine dehydrogenase I -1,216146621 -1,216146621 -0,737908071 -0,296742756 ctg7180000001724_orf00014 5646 5756 glimmer prediction -1,218209457 -1,218209457 -0,922011389 0,416646359 R2846_1598 57881 59128 Diaminopimelate decarboxylase -1,219060315 -1,219060315 -1,02382452 -0,645419532 R2846_1320 262408 263487 DNA replication and repair protein RecF -1,221224525 -1,221224525 -0,495459619 -0,002073858 Membrane-bound ATP synthase, F1 sector, R2846_0101 30891 32264 beta-subunit -1,225775449 -1,225775449 -0,439592533 -0,01864148 ctg7180000001729_orf00044 20893 22443 glimmer prediction -1,226428688 -1,226428688 -0,776256713 -0,526210496 R2846_0146 75496 76182 Competence protein F -1,228050955 -1,228050955 -0,682104388 -0,424096279 R2846_1622 25779 27164 L-seryl-tRNA selenium transferase -1,229997606 -1,229997606 -0,815634346 -0,591766605 DNA polymerase III, subunits gamma and R2846_0756 75240 77309 tau -1,233548081 -1,233548081 0,059477983 -0,32178837 R2846_0494 13714 14580 Putative transcriptional regulator -1,236003486 -1,236003486 -1,904499505 -1,518262902 ctg7180000001713_orf00018 15535 16611 glimmer prediction -1,242272867 -1,242272867 -0,343281927 -0,071659841 6-phosphogluconate dehydrogenase, R2846_0030 21772 23226 decarboxylating (6PGD) -1,244794939 -1,244794939 -0,364321345 -0,058121277 Peptide ABC transporter system, permease R2846_1119 44270 45235 protein SapB -1,248461237 -1,248461237 -0,197798705 -0,27098096 R2846_0858 61784 63061 Phosphate regulon sensor protein -1,249944407 -1,249944407 -0,479494354 -0,433296791 R2846_1328 276682 277263 Conserved hypothetical protein -1,252194918 -1,252194918 -0,137363711 -0,592579865

183

APPENDICES

R2846_0624 34050 34907 Citrate lyase beta chain, citryl-ACP lyase -1,252375022 -1,252375022 -0,750232956 -0,622463855 R2846_0031 23352 23975 Conserved hypothetical protein -1,254440194 -1,254440194 -0,205027322 -0,680242628 ctg7180000001728_orf00001 21 965 glimmer prediction -1,268481106 -1,268481106 -0,387347525 -0,21098162 ctg7180000001722_orf00028 14574 17000 glimmer prediction -1,270531872 -1,270531872 -0,48502826 -0,282859773 ctg7180000001728_orf00316 180387 181052 glimmer prediction -1,271989864 -1,271989864 -1,576854804 -0,810486092 ctg7180000001719_orf00014 7982 8929 glimmer prediction -1,27377108 -1,27377108 -0,626146834 -0,390579175 N-(5-phospho-L-ribosyl-formimino)-5- amino-1-(5- phosphoribosyl)-4- R2846_0106 35797 36546 imidazolecarboxamide isomerase -1,274985014 -1,274985014 -0,750238933 -0,684515974 CGSHiEE_05765 24744 25364 cobalt transport protein CbiM -1,276077942 -1,276077942 0,424765889 0,401659138 Probable long-chain-fatty-acid--CoA ligase R2846_0645 9441 11264 (Long-chain acyl-CoA synthetase) (LACS) -1,279209428 -1,279209428 -1,350725113 -1,242424479 ctg7180000001709_orf00019 6243 7445 glimmer prediction -1,280207642 -1,280207642 -0,570545463 -0,269891269 ctg7180000001720_orf00053 29004 29129 glimmer prediction -1,283320775 -1,283320775 0,278314249 -1,750342318 ctg7180000001714_orf00034 17234 17365 glimmer prediction -1,291728662 -1,291728662 0,061090029 0,476380472 R2846_1701 34299 35669 Adenylosuccinate lyase -1,315598284 -1,315598284 -0,835076731 -0,185361904 R2846_1690 24789 25904 Ribosomal protein S12 methylthiotransferase -1,318548087 -1,318548087 -1,57346547 -1,247260086 R2846_0730 106247 106885 Conserved hypothetical protein -1,321213443 -1,321213443 -0,908091653 -0,285221856 R2846_1357 303132 303797 Conserved hypothetical protein -1,322069981 -1,322069981 -1,939244196 -1,014927065 ctg7180000001709_orf00022 8634 10283 glimmer prediction -1,323755611 -1,323755611 -0,442284202 -0,064878147 ctg7180000001728_orf00312 176883 178829 glimmer prediction -1,323892537 -1,323892537 -0,794550325 -0,821245323 R2846_0139 68290 69135 Conserved hypothetical protein -1,324322844 -1,324322844 -0,888775072 -0,643950924 R2846_1501 448389 448946 intracellular septation protein A -1,337146614 -1,337146614 0,070825733 0,017826858 ctg7180000001726_orf00033 16623 17768 glimmer prediction -1,339178981 -1,339178981 -1,364180069 -0,954662553 R2846_1161 91175 91981 ATP-dependent DNA ligase -1,339495203 -1,339495203 -1,209444127 -1,577895047 ctg7180000001728_orf00315 179589 180329 glimmer prediction -1,350148013 -1,350148013 -2,54705501 -1,364010046 R2846_0402 44006 45775 L-fucose isomerase -1,354123121 -1,354123121 -1,213920613 -1,762625116 R2846_0912 18380 18598 Cold shock protein CspD -1,363088599 -1,363088599 -2,304908008 -1,350649725 R2846_0028 20376 20822 Conserved hypothetical protein -1,367294671 -1,367294671 -0,062002896 -0,423591279

184

APPENDICES

S-adenosylmethionine-6-N,N-adenosyl R2846_0034 25866 26729 (rRNA) dimethyltransferase -1,370837784 -1,370837784 -1,299898009 -0,399340656 molybdenum transport system protein HI_1473 14940 15785 (modD) -1,371138639 -1,371138639 -0,132626682 0,195712966 R2846_0585 71458 73824 Recombination protein Rec2 -1,375864908 -1,375864908 -1,56857563 -0,964918154 R2846_0379 40228 41694 Inosine-5-monophosphate dehydrogenase -1,380498368 -1,380498368 -1,165580177 -1,108895286 ctg7180000001723_orf00106 55627 55740 glimmer prediction -1,380679075 -1,380679075 -0,035269288 -0,068835296 R2846_0378 38547 40118 GMP synthetase (glutamine-hydrolyzing) -1,381385432 -1,381385432 -0,280741117 0,05504199 R2846_1196 123494 124351 Conserved hypothetical protein -1,387986898 -1,387986898 -0,294038875 -0,019034791 R2846_1593 49685 51094 repressor protein for FtsI -1,39322714 -1,39322714 -1,207138622 -0,662788707 ctg7180000001706_orf00128 71572 72303 glimmer prediction -1,399559431 -1,399559431 -0,078745138 0,193857546 UDP-N-acetylmuramoylalanine-D-glutamate R2846_1206 134874 136187 ligase -1,402151538 -1,402151538 -0,429918033 -0,429172475 ctg7180000001710_orf00039 20123 20239 glimmer prediction -1,412105143 -1,412105143 0,740211888 -0,185324349 R2846_1665 2902 3342 FMN-binding protein MioC -1,413375921 -1,413375921 -1,495772005 -0,576072491 Membrane-bound ATP synthase, F1 sector, R2846_0099 28448 29989 alpha-subunit -1,419071523 -1,419071523 -0,514811252 -0,129812531 R2846_0488 6933 7367 Hypothetical protein -1,426897141 -1,426897141 -0,915903793 -1,431467725 16S rRNA 7-methylguanosine R2846_0093 25139 25750 methyltransferase GidB -1,428548351 -1,428548351 -1,273675734 -1,302921028 R2846_0818 2521 3216 Putative murein hydrolase effector LrgB -1,430296088 -1,430296088 -0,387725203 -0,349864194 Probable 6-phosphogluconolactonase R2846_0027 19667 20365 (6PGL) -1,434187079 -1,434187079 -0,289220283 0,048534916 Galactoside ABC transporter, permease R2846_1503 449832 450842 protein -1,437307369 -1,437307369 -1,295128981 -0,292739237 Type II secretory pathway, ATPase R2846_0281 4595 6058 component PilB -1,437869889 -1,437869889 -1,019806612 -1,443670561 R2846_1649 964 1443 Hypothetical protein -1,443144033 -1,443144033 -0,803639141 -0,66027084 R2846_0235 47382 47912 Putative ferredoxin-type protein NapF -1,445471491 -1,445471491 -1,990479277 -1,859184032 R2846_0763 64212 66119 Molecular chaperone DnaK (Hsp70) -1,449365163 -1,449365163 0,163047783 0,324869822 R2846_0250 31094 31498 Opacity associated protein B -1,454319977 -1,454319977 -0,803629933 -0,379946328 R2846_1329 277359 278324 6-phosphofructokinase -1,471129266 -1,471129266 -1,51477184 -1,367612632 185

APPENDICES

DL-methionine transporter, periplasmic R2846_0408 52089 52910 binding protein MetQ -1,472508834 -1,472508834 -1,338624798 -0,806275837 ctg7180000001722_orf00010 6830 6955 glimmer prediction -1,479468948 -1,479468948 -1,074918563 -0,145783973 R2846_0647 7375 8001 Guanylate kinase -1,501529287 -1,501529287 -1,77693771 -1,285772181 R2846_1375 320879 321409 Putative thiol-disulfide interchange protein -1,508671315 -1,508671315 0,517078094 0,084693908 Putative type II secretory pathway, R2846_1370 315933 316616 pseudopilin -1,51379741 -1,51379741 -2,003350702 -2,06387696 ctg7180000001711_orf00008 2367 2516 glimmer prediction -1,523330199 -1,523330199 -0,749925691 0,411752996 ctg7180000001717_orf00016 8179 9450 glimmer prediction -1,525060387 -1,525060387 -0,817164191 -0,546704233 R2846_0042 30671 32317 GroEL, chaperone Hsp60 -1,528886306 -1,528886306 0,071275223 0,464898723 R2846_1508 455917 457071 Galactokinase -1,529473806 -1,529473806 -1,498661934 -1,128575919 R2846_0233 48223 50706 Periplasmic nitrate reductase, subunit A -1,545061512 -1,545061512 -1,137717804 -1,96235082 Membrane-bound ATP synthase, F1 sector, R2846_0098 27902 28435 delta-subunit -1,547793914 -1,547793914 -0,811825486 -0,255993497 ctg7180000001709_orf00003 717 893 glimmer prediction -1,575701345 -1,575701345 0,255360705 0,726398626 R2846_0449 41186 42535 Glutamate dehydrogenase, NADP-specific -1,5774445 -1,5774445 -2,210621166 -1,54374267 Anaerobic glycerol-3-phosphate R2846_1653 5210 6508 dehydrogenase subunit B -1,577796842 -1,577796842 -1,080127144 -0,056989718 ctg7180000001728_orf00261 150707 150880 glimmer prediction -1,589551482 -1,589551482 -0,794294669 -0,903418737 ctg7180000001719_orf00017 10125 11414 glimmer prediction -1,595221218 -1,595221218 -0,646575716 -0,419942499 R2846_0061 50093 51172 Fructose-bisphosphate aldolase, class II -1,60285444 -1,60285444 -1,493497508 -1,319097462 R2846_0024 16792 17208 Hypothetical protein -1,626128476 -1,626128476 -0,033164334 0,438712122 Oligopeptide ABC transporter, permease R2846_1219 150608 151543 protein OppC -1,63869485 -1,63869485 -0,851880512 -0,32001139 R2846_0086 18858 20189 Protease HslVU, ATPase subunit -1,639733741 -1,639733741 -0,553331647 -0,660946397 Membrane-bound ATP synthase, F0 sector, R2846_0096 27115 27369 subunit C -1,646917577 -1,646917577 -0,93867361 -0,469022926 Anaerobic glycerol-3-phosphate R2846_1654 6520 7800 dehydrogenase subunit C -1,648346128 -1,648346128 -0,599732602 -0,114941243 R2846_0339 46224 46442 Conserved hypothetical protein -1,648523301 -1,648523301 -2,350843673 -0,429662895 2-oxoglutarate dehydrogenase E2 component R2846_0732 101477 102706 dihydrolipoamide succinyltransferase -1,652771974 -1,652771974 -1,410562941 -1,363825481 186

APPENDICES

R2846_0646 8252 9271 Glyceraldehyde-3-phosphate dehydrogenase -1,664271513 -1,664271513 -1,738936286 -1,254108398 R2846_0116 46137 47288 Putative oxidase -1,671843664 -1,671843664 -0,458901236 -0,133765829 R2846_0300 13577 14335 Uridine phosphorylase -1,686782809 -1,686782809 -1,786097837 -1,433539132 R2846_0240 42305 42643 Glutamine synthetase regulatory protein P-II -1,688050069 -1,688050069 -0,97176103 -1,068429114 R2846_0754 78163 79407 Probable uracil permease -1,688106143 -1,688106143 -0,634350735 0,310156834 R2846_0241 41710 42303 Molybdopterin biosynthesis protein -1,695107786 -1,695107786 -0,617747148 -0,630267867 R2846_1511 458834 460126 Aminopeptidase P -1,701825881 -1,701825881 -0,608491619 -0,933454892 R2846_1650 1545 1688 Hypothetical protein -1,706836173 -1,706836173 -0,619494086 0,133557149 R2846_1661 733 1011 Putative cell division protein ftsB -1,707485878 -1,707485878 -1,222745774 -0,633746966 R2846_1507 454791 455840 Galactose-1-phosphate uridylyltransferase -1,715673052 -1,715673052 -1,861668548 -0,84155344 Oligopeptide ABC transporter, permease R2846_1218 149678 150598 protein OppB -1,731848957 -1,731848957 -0,665121226 -0,513675909 Selenocysteine-tRNA-specific elongation R2846_1621 27161 29020 factor -1,74003965 -1,74003965 -1,024505146 -0,701573524 R2846_0539 16993 18456 Conserved hypothetical protein -1,779034809 -1,779034809 -0,808971087 -0,432655199 R2846_1512 460228 460653 Universal stress protein A -1,780248559 -1,780248559 -2,807388491 -1,911654326 R2846_1409 356673 356975 Hypothetical protein -1,782970832 -1,782970832 0,372847896 -0,031139061 Oligopeptide ABC transporter, ATP-binding R2846_1221 152521 153519 protein OppF -1,789835096 -1,789835096 -1,103137475 -0,855906687 R2846_1578 28134 30566 glycerol-3-phosphate acyltransferase -1,812266061 -1,812266061 -1,328268373 -1,233926825 ctg7180000001706_orf00058 32263 32382 glimmer prediction -1,815767857 -1,815767857 -2,503067413 -0,921817752 R2846_1739 15786 17315 Putative transport protein -1,823711558 -1,823711558 -0,742067572 -0,782207165 Deoxycytidine triphosphate deaminase R2846_0506 25143 25730 (dCTP deaminase) -1,829515249 -1,829515249 -0,759790851 -0,448048079 Membrane-bound ATP synthase, F0 sector, R2846_0097 27419 27889 subunit B -1,834783294 -1,834783294 -1,196013224 -0,605250562 R2846_0150 78481 78753 DNA-binding protein HU-alpha -1,843585536 -1,843585536 -2,762952312 -1,385548711 ctg7180000001724_orf00013 5490 5615 glimmer prediction -1,845440809 -1,845440809 -0,944463389 0,202598928 CGSHiEE_05770 25364 25852 hypothetical protein -1,855675539 -1,855675539 -0,164339608 0,399830106 R2846_1224 155262 156791 Competence protein ComM -1,863376551 -1,863376551 -1,741607604 -2,029253203

187

APPENDICES

R2846_0507 25739 26380 Uridine/cytidine kinase -1,868012151 -1,868012151 -0,881683404 -0,665099474 Spermidine/putrescine ABC transporter, R2846_0085 17737 18789 periplasmic-binding protein -1,870476937 -1,870476937 -1,142314335 -0,719736122 ctg7180000001717_orf00014 6112 8082 glimmer prediction -1,883043793 -1,883043793 -1,366829822 -0,815274456 R2846_1377 322557 323759 Conserved hypothetical protein -1,883435093 -1,883435093 0,382745639 0,228573733 Phosphate ABC transport system, R2846_0863 57310 58329 periplasmic binding protein -1,905352834 -1,905352834 -1,390978849 -1,129821383 R2846_0534 8390 9133 Hypothetical protein -1,915981052 -1,915981052 -2,352660383 -2,495063327 R2846_0270 14983 15876 Site-specific, tyrosine recombinase XerD -1,921124065 -1,921124065 -0,157275224 -0,461518092 R2846_0145 74146 75483 Outer membrane secretin ComE -1,923588819 -1,923588819 -2,87219328 -1,783899408 ctg7180000001719_orf00022 14002 14643 glimmer prediction -1,947685131 -1,947685131 -0,048206698 -0,262767589 R2846_0239 42643 43689 Putative permease -1,950410371 -1,950410371 -0,247997655 0,096872423 R2846_1137 65982 67499 Amidophosphoribosyltransferase -1,95375481 -1,95375481 -1,127884487 -0,434528627 ctg7180000001713_orf00016 15415 15525 glimmer prediction -1,980204311 -1,980204311 -1,502603307 -0,689684696 R2846_1523 473150 473746 Hypothetical protein -1,981088207 -1,981088207 -2,852520273 -2,603018966 ctg7180000001706_orf00156 91117 91359 glimmer prediction -1,983622135 -1,983622135 -0,251557266 -0,191638389 4-diphosphocytidyl-2-C-methyl-D-erythritol CGSHiEE_05690 10780 11733 kinase -1,987056915 -1,987056915 -0,780769414 -0,900806119 ctg7180000001726_orf00034 17961 19046 glimmer prediction -1,995716885 -1,995716885 -1,690068603 -1,273801065 ctg7180000001728_orf00313 178826 179347 glimmer prediction -2,004533036 -2,004533036 -1,85251723 -1,918727447 R2846_1336 283067 284521 Sodium/pantothenate symporter -2,007148201 -2,007148201 -0,280085619 0,091045293 R2846_0255 27045 27632 Hypothetical protein -2,019567039 -2,019567039 -1,242955238 -0,7035861 ctg7180000001719_orf00018 11423 12565 glimmer prediction -2,035668913 -2,035668913 -0,272991378 -0,30317524 Type I restriction enzyme HindVIIP, S R2846_0807 6947 8350 protein -2,050568947 -2,050568947 -0,261425071 0,333488168 Probable 3-phosphoadenosine 5- phosphosulfate (PAPS) 3-phosphatase R2846_0025 17213 18022 (CysQ) -2,052582376 -2,052582376 -0,409567678 0,187411041 ctg7180000001700_orf00017 12930 13568 glimmer prediction -2,054305175 -2,054305175 -2,084429282 -1,6589354 R2846_1319 261306 262406 DNA polymerase III beta subunit -2,059730647 -2,059730647 -0,803182189 -0,450110576

188

APPENDICES

R2846_0142 72702 73208 Competence operon protein B -2,078883435 -2,078883435 -3,673717804 -2,601757432 R2846_0087 20200 20727 Protease HslVU, peptidase subunit -2,081745638 -2,081745638 -0,736929741 -1,058753304 ctg7180000001717_orf00018 9522 10817 glimmer prediction -2,089800401 -2,089800401 -1,027021913 -0,461084608 R2846_0088 20947 21654 acid phosphatase/phosphotransferase -2,111060718 -2,111060718 -3,764229141 -2,521468168 R2846_0505 23964 25139 Hypothetical protein -2,147086224 -2,147086224 -1,126636371 -0,231994712 R2846_1736 19769 20587 Probable hydrolase (HAD superfamily) -2,170212756 -2,170212756 -2,955954036 -3,033958759 R2846_0141 71904 72701 Competence operon protein A -2,194113367 -2,194113367 -2,364729194 -2,501753807 R2846_1371 316631 317347 Type II secretory pathway, pseudopilin -2,200095435 -2,200095435 -2,40355575 -2,085680484 R2846_1495 444296 444640 Fumarate reductase, subunit D -2,226687712 -2,226687712 -2,46580598 -1,677311067 R2846_1114 35343 37982 Phosphoenolpyruvate carboxylase -2,237515535 -2,237515535 -1,518161864 -1,540035877 NADP-dependent malic enzyme (NADP- R2846_0771 54958 57228 ME) -2,24400291 -2,24400291 -1,887463626 -1,475423891 ctg7180000001719_orf00020 13210 13992 glimmer prediction -2,244305002 -2,244305002 0,244912983 -0,229959156 Type II secretory pathway, major prepilin R2846_0280 5986 6411 PilA -2,245740767 -2,245740767 -3,054823267 -2,472647563 Oligopeptide ABC transporter, ATP-binding R2846_1220 151553 152524 protein OppD -2,249470033 -2,249470033 -1,343788309 -0,620198773 ctg7180000001706_orf00160 93339 93455 glimmer prediction -2,25031183 -2,25031183 -0,222458593 -1,059119447 R2846_0895 32119 32340 Hypothetical protein -2,263300813 -2,263300813 -2,159732681 -1,077455452 Galactoside ABC transporter, ATP-binding R2846_1504 450859 452379 protein -2,263724075 -2,263724075 -2,001181942 -0,91710985 Putative anaerobic C4-dicarboxylate R2846_0484 2562 3893 transporter -2,26597113 -2,26597113 -1,78859266 -1,604762877 R2846_1509 457081 458103 Galactose-1-epimerase (mutarotase) -2,270780302 -2,270780302 -1,719621215 -1,134204978 Citrate lyase gamma chain, acyl carrier R2846_0623 34922 35209 protein -2,275791912 -2,275791912 -0,857938374 -1,15031777 R2846_1326 274739 275860 DNA processing chain A -2,293448608 -2,293448608 -2,156900087 -1,731587036 R2846_0153 81295 82839 Na+/H+ antiporter -2,303150223 -2,303150223 -2,183503346 -2,303443679 R2846_0612 44643 46298 Conserved hypothetical protein -2,307401352 -2,307401352 -2,96986643 -2,227499427 R2846_1378 323883 325193 Phosphopyruvate hydratase -2,310292278 -2,310292278 -2,300109508 -2,03813359 ctg7180000001728_orf00455 263529 263657 glimmer prediction -2,329685555 -2,329685555 0,488188975 -0,4339222

189

APPENDICES

Glucosamine-6-phosphate R2846_0496 15757 16569 isomerase/deaminase -2,341939654 -2,341939654 -1,296639028 -1,609505021 R2846_1732 22944 23597 DNA transformation regulatory protein -2,372476976 -2,372476976 -4,000023778 -3,408194464 R2846_0432 23827 25638 5-nucleotidase NucA -2,377801286 -2,377801286 -1,442961379 -0,733300504 R2846_1136 65034 65924 Conserved hypothetical protein -2,384134565 -2,384134565 -0,799359919 -0,431337116 R2846_0143 73205 73726 Competence operon protein C -2,395572246 -2,395572246 -2,382132993 -2,760193997 putative ABC-type Co2+ transport system, CGSHiEE_05775 25865 26548 periplasmic component -2,402087588 -2,402087588 -1,115767315 -0,831660123 R2846_0894 32355 32525 Hypothetical protein -2,402168669 -2,402168669 -2,035312807 -1,398829511 R2846_1494 443873 444283 Fumarate reductase, subunit C -2,413644187 -2,413644187 -2,591502036 -2,08386679 R2846_0718 119418 120089 Iron-sulfur repair protein YtfE -2,423100649 -2,423100649 -2,874283539 -3,049203943 R2846_1641 3552 4412 Triosephosphate isomerase -2,441527394 -2,441527394 -3,138325615 -2,586836571 R2846_0152 80752 81285 Disulfide bond formation protein B -2,465293354 -2,465293354 -2,066071421 -1,66355496 R2846_1173 100486 101052 Conserved hypothetical protein -2,484975616 -2,484975616 -1,809438344 -0,731771117 ctg7180000001719_orf00019 12575 13222 glimmer prediction -2,490077656 -2,490077656 -0,139574832 -0,41832425 ctg7180000001726_orf00047 26307 26459 glimmer prediction -2,491641262 -2,491641262 -0,791212612 -0,581705308 R2846_0720 117387 117869 Molybdenum cofactor biosynthesis protein C -2,518817458 -2,518817458 -1,758013501 -2,596874416 R2846_0329 39819 40142 Ribosome binding protein Y -2,532435937 -2,532435937 -2,821604812 -2,114481789 R2846_0066 55544 56797 Probable nucleoside transporter -2,568235977 -2,568235977 -1,577586458 -1,281004781 R2846_0495 14591 15472 N-acetylneuraminate lyase (aldolase) -2,569399136 -2,569399136 -3,099892452 -2,030645374 R2846_1372 317347 317859 Type II secretory pathway, pseudopilin -2,583831181 -2,583831181 -2,86599798 -3,62458848 ctg7180000001727_orf00013 6172 6954 glimmer prediction -2,591944942 -2,591944942 -1,537563465 -0,212552683 ctg7180000001718_orf00020 8787 8963 glimmer prediction -2,612647485 -2,612647485 -1,809510823 -1,496241727 R2846_0458 50413 51267 Probable formate transporter -2,666475351 -2,666475351 -2,70008102 -2,20994865 R2846_1492 441300 443099 Fumarate reductase, subunit A -2,672525138 -2,672525138 -2,346147984 -1,918938011 R2846_1518 467363 468979 Phosphoenolpyruvate carboxykinase -2,675500052 -2,675500052 -3,178304166 -2,169708722 R2846_1493 443092 443862 Fumarate reductase, subunit B -2,689286159 -2,689286159 -2,282759166 -1,821365962 R2846_0722 116687 117139 Molybdopterin synthase, large subunit -2,743532901 -2,743532901 -1,973208082 -1,711681139 R2846_1433 382046 382756 Aerobic respiration control protein ArcA -2,752091464 -2,752091464 -3,006682285 -2,484378215

190

APPENDICES

ctg7180000001727_orf00201 117723 117899 glimmer prediction -2,842821712 -2,842821712 -1,265130581 -2,494265236 R2846_1290 226324 226824 Putative ferredoxin-type protein -2,847451746 -2,847451746 -2,029000693 -3,359648223 R2846_0721 117140 117385 Molybdopterin synthase, small subunit -2,881022865 -2,881022865 -2,506745092 -1,784588291 Sialic acid TRAP transporter, fused R2846_0490 8834 10684 permease protein SiaT -2,882049401 -2,882049401 -2,691651039 -1,64814507 R2846_1738 17420 18352 Carbamate kinase -2,904636531 -2,904636531 -1,901269084 -1,870090818 Sialic acid TRAP transporter, periplasmic- R2846_0491 10749 11738 binding protein SiaP -2,937445554 -2,937445554 -3,279399911 -2,108090548 ctg7180000001706_orf00059 32719 32835 glimmer prediction -2,962033291 -2,962033291 -2,89404089 -1,896171526 R2846_1585 36452 38104 Phosphoglucomutase PgmB -3,002535055 -3,002535055 -3,104054278 -2,565140579 R2846_1647 2217 3011 Aquaglyceroporin GlpF -3,038483034 -3,038483034 -2,510469868 -1,50188801 Galactoside ABC transporter, periplasmic R2846_1505 452445 453440 binding protein -3,08821831 -3,08821831 -3,529653078 -2,38085414 D-ribose ABC transporter, periplasmic- R2846_0079 10734 11612 binding protein -3,091862133 -3,091862133 -3,610296353 -2,997954653 R2846_1737 18362 19366 Ornithine carbamoyltransferase -3,092676745 -3,092676745 -2,643666058 -2,190642768 Oligopeptide ABC transporter, periplasmic- R2846_1217 147972 149597 binding protein OppA -3,109860374 -3,109860374 -3,361259221 -2,500324058 50S subunit L3 protein glutamine R2846_1143 72866 73810 methyltransferase -3,1161748 -3,1161748 -2,837356958 -2,627627968 R2846_1134 63437 64372 Malate dehydrogenase -3,16696264 -3,16696264 -3,416871338 -2,590210634 R2846_0838 95012 96346 Glucose-1-phosphate adenylyltransferase -3,255831945 -3,255831945 -3,826504313 -3,073137684 R2846_0293 3964 5331 L-serine deaminase -3,270610176 -3,270610176 -2,889685977 -2,562602431 2,3-bisphosphoglycerate-dependent R2846_1568 16629 17312 phosphoglycerate mutase -3,356093984 -3,356093984 -3,20433805 -2,502832388 Probable anaerobic C4-dicarboxylate R2846_1580 32184 33506 membrane transporter protein DcuB -3,393192909 -3,393192909 -2,541457918 -2,540025512 R2846_0459 51303 53621 Formate acetyltransferase 1 -3,413290638 -3,413290638 -2,326772849 -2,571748898 R2846_0881 40841 42235 Fumarate hydratase class II -3,439265534 -3,439265534 -3,465258368 -3,435413796 R2846_1646 685 2196 Glycerol kinase -3,462920697 -3,462920697 -2,67833298 -1,957977755 R2846_0292 2691 3929 Probable serine transporter -3,501229662 -3,501229662 -3,063037423 -3,014170963 R2846_0698 44772 45536 Molybdenum ABC transporter, periplasmic- -3,528297353 -3,528297353 -3,579847158 -3,165694277 191

APPENDICES

binding protein

R2846_0144 73723 74136 Competence operon protein D -3,678048509 -3,678048509 -3,483377362 -2,524254105 R2846_1305 243699 244037 Putative DNA uptake protein ComE1 -3,795457129 -3,795457129 -3,732540658 -3,97258617 Anaerobic dimethyl sulfoxide reductase, R2846_1288 224762 225601 subunit C -3,876698387 -3,876698387 -3,638608365 -4,22025843 R2846_0835 100613 102712 4-alpha-glucanotransferase (amylomaltase) -3,974712362 -3,974712362 -3,52797631 -2,822494005 R2846_0836 98411 100603 1,4-alpha-glucan branching enzyme -4,153639405 -4,153639405 -3,795286823 -3,153115027 R2846_0925 8074 8802 Putative dithiobiotin synthase -4,182841559 -4,182841559 -5,023002563 -4,223249085 ctg7180000001728_orf00355 204332 205297 glimmer prediction -4,208049709 -4,208049709 -4,071580947 -3,937222371 ctg7180000001728_orf00351 203011 203661 glimmer prediction -4,215245693 -4,215245693 -4,274917882 -4,559020608 R2846_0837 96336 98312 Glycogen debranching enzyme -4,26957991 -4,26957991 -3,758954031 -3,162602 R2846_0489 7531 8670 Putative N-acetylneuraminate epimerase -4,341674601 -4,341674601 -4,565195086 -3,357889071 ctg7180000001728_orf00349 201535 202935 glimmer prediction -4,47694038 -4,47694038 -4,881042067 -5,758787023 R2846_0839 93474 94904 Glycogen synthase -4,509907686 -4,509907686 -3,254412441 -2,947756656 R2846_0825 7090 8328 Peptidase T -4,514206673 -4,514206673 -4,304863658 -4,997499145 ctg7180000001728_orf00354 203658 204335 glimmer prediction -4,656786279 -4,656786279 -2,264488969 -4,536980452 R2846_1581 33664 34713 L-asparaginase II -4,806211919 -4,806211919 -4,853656619 -3,611827297 Trimethylamine N-oxide reductase system R2846_1693 28184 30661 III, catalytic subunit -5,302009816 -5,302009816 -4,858001043 -4,416837415 Redox enzyme maturation protein (REMP) R2846_1289 225713 226324 for DmsA -5,346279513 -5,346279513 -4,43255375 -4,921035993 Trimethylamine N-oxide reductase system R2846_1692 27055 28155 III, cytochrome c-type subunit -6,012493085 -6,012493085 -5,518431097 -5,149598346 ctg7180000001728_orf00392 224203 224508 glimmer prediction -6,257387152 -6,257387152 -4,98778333 -5,102553363 Anaerobic dimethyl sulfoxide reductase, R2846_1287 224143 224760 subunit B -6,431335771 -6,431335771 -5,828712816 -5,92022043 Anaerobic dimethyl sulfoxide reductase, R2846_1286 221712 224132 subunit A -7,097388023 -7,097388023 -6,588067582 -6,529837862

192

APPENDICES

193