DOCSLIB.ORG

Urethral Catheter Biofilms Reveal Plasticity in Bacterial Composition

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Urethral Catheter Biofilms Reveal Plasticity in Bacterial Composition ORIGINAL RESEARCH published: 23 June 2021 doi: 10.3389/fmed.2021.667462 Urethral Catheter Biofilms Reveal Plasticity in Bacterial Composition Edited by: Xiaoyun Liu, and Metabolism and Withstand Host Peking University, China Reviewed by: Immune Defenses in Hypoxic Ruibing Chen, Tianjin University, China Environment Xu Zhang, University of Ottawa, Canada Yanbao Yu 1†, Harinder Singh 1†, Tamara Tsitrin 1, Shiferaw Bekele 1‡, Yi-Han Lin 1, *Correspondence: Patricia Sikorski 1‡, Kelvin J. Moncera 2‡, Manolito G. Torralba 2, Lisa Morrow 3, Rembert Pieper Randall Wolcott 3, Karen E. Nelson 1,2 and Rembert Pieper 1*‡ [email protected] 1 J. Craig Venter Institute, Rockville, MD, United States, 2 J. Craig Venter Institute, La Jolla, CA, United States, 3 Southwest † These authors have contributed Regional Wound Care Center, Lubbock, TX, United States equally to this work ‡Present address: Shiferaw Bekele, Biofilms composed of multiple microorganisms colonize the surfaces of indwelling University of Maryland Medical Center, urethral catheters that are used serially by neurogenic bladder patients and cause Baltimore, MD, United States chronic infections. Well-adapted pathogens in this niche are Escherichia coli, Proteus, Patricia Sikorski, Department of Neurology, George and Enterococcus spp., species that cycle through adhesion and multilayered cell Washington University, Washington, growth, trigger host immune responses, are starved off nutrients, and then disperse. DC, United States Kelvin J. Moncera, Viable microbial foci retained in the urinary tract recolonize catheter surfaces. The Western University of Health molecular adaptations of bacteria in catheter biofilms (CBs) are not well-understood, Sciences, College of Osteopathic promising new insights into this pathology based on host and microbial meta-omics Medicine of the Pacific, Pomona, CA, United States analyses from clinical specimens. We examined catheters from nine neurogenic bladder Rembert Pieper, patients longitudinally over up to 6 months. Taxonomic analyses from 16S rRNA gene Janssen Biopharma Inc., South San Francisco, CA, United States sequencing and liquid chromatography–tandem mass spectrometry (LC-MS/MS)–based proteomics revealed that 95% of all catheter and corresponding urinary pellet (UP) Specialty section: samples contained bacteria. CB biomasses were dominated by Enterobacteriaceae This article was submitted to Infectious Diseases–Surveillance, spp. and often accompanied by lactic acid and anaerobic bacteria. Systemic antibiotic Prevention and Treatment, drug treatments of patients resulted in either transient or lasting microbial community a section of the journal perturbations. Neutrophil effector proteins were abundant not only in UP but also Frontiers in Medicine CB samples, indicating their penetration of biofilm surfaces. In the context of one Received: 13 February 2021 Accepted: 06 May 2021 patient who advanced to a kidney infection, Proteus mirabilis proteomic data suggested Published: 23 June 2021 a combination of factors associated with this disease complication: CB biomasses Citation: were high; the bacteria produced urease alkalinizing the pH and triggering urinary salt Yu Y, Singh H, Tsitrin T, Bekele S, Lin Y-H, Sikorski P, Moncera KJ, deposition on luminal catheter surfaces; P. mirabilis utilized energy-producing respiratory Torralba MG, Morrow L, Wolcott R, systems more than in CBs from other patients. The NADH:quinone oxidoreductase II Nelson KE and Pieper R (2021) (Nqr), a Na+ translocating enzyme not operating as a proton pump, and the nitrate Urethral Catheter Biofilms Reveal Plasticity in Bacterial Composition and reductase A (Nar) equipped the pathogen with electron transport chains promoting Metabolism and Withstand Host growth under hypoxic conditions. Both P. mirabilis and E. coli featured repertoires of Immune Defenses in Hypoxic Environment. Front. Med. 8:667462. transition metal ion acquisition systems in response to human host-mediated iron and doi: 10.3389/fmed.2021.667462 zinc sequestration. We discovered a new drug target, the Nqr respiratory system, whose Frontiers in Medicine | www.frontiersin.org 1 June 2021 | Volume 8 | Article 667462 Yu et al. Urethral Catheter Biofilm Composition and Metabolism deactivation may compromise P. mirabilis growth in a basic pH milieu. Animal models would not allow such molecular-level insights into polymicrobial biofilm metabolism and interactions because the complexity cannot be replicated. Keywords: proteomics, catheter biofilm, infection, bacterial metabolism, pathogen, polymicrobial, immune defense INTRODUCTION type of infiltrating immune cells. In this model, E. coli and Enterococcus faecalis caused urothelial barrier disruption and Urethral catheter-associated urinary tract infection (CAUTI) is further immune cell infiltration with pyuria (12). However, a the most common type of complicated UTI. Enhanced risks of proteomic study on samples from catheterized trauma patients recurrence and spread to other organs (e.g., pyelonephritis and was consistent with neutrophil infiltration at a higher level in urosepsis) compared to acute urinary tract infections (UTIs) individuals diagnosed with CAASB or CAUTI as compared to exist in nosocomial environments (1–3). Asymptomatic cases non-bacteriuric patients (13). are diagnosed as catheter-associated asymptomatic bacteriuria The pathogenesis of single-species–associated UTI and (CAASB). The use of nearly 100 million urethral catheters CAUTI has been extensively studied in the context of E. per year worldwide, a 3–10% incidence of bacteriuria over coli and P. mirabilis (4, 14–17). Type I fimbriae are thought 24 h following patient catheterization, and an average bladder to initiate mucosal colonization via their ability to bind to catheter insertion time of 72h (2) suggest that 9 million mannosylated uroplakins that coat the luminal surface of to 27 million CAUTI and CAASB cases occur globally per urothelial umbrella cells (18). P. mirabilis produces several year. Indwelling Foley catheters are used by patients with types of fimbriae of which the best characterized ones are anatomical and neurological urinary tract abnormalities and mannose-resistant Proteus-like (MR/P) fimbriae, uroepithelial typically retained for 1–3 weeks before replacement to minimize cell adhesin (UCA), and proton motive force (PMF) fimbriae microbial colonization. (16). Fimbriae are virulence factors involved in the formation Among the most common etiological agents of CAUTIs are of salt-encrusted (SE) CBs entailing struvite and apatite crystal Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, deposition on catheter surfaces (3, 14, 16). Host proteins such Proteus mirabilis, Enterococcus, and Candida spp. (1, 3, 4). These as fibrinogen are also deposited on catheter surfaces (3, 4). microbes have adapted to form biofilms on catheter surfaces; e.g., Biofilm-embedded bacterial cells embedded disperse, swarm, Proteus and Providencia spp. metabolize urea to NH3 and use and recolonize unoccupied catheter surfaces. Their ascendance it as a nitrogen source (3, 5, 6). Furthermore, urea degradation to the kidneys poses an elevated threat of pyelonephritis and alkalinizes the pH of urine and triggers deposition of phosphate urosepsis (3). Microbial colonization dynamics in CBs over time salt crystals in and on catheters, thus increasing the risks of are influenced by the availability of various nutrients such as luminal occlusion and complications such as urinary stones nitrogen, carbohydrates, transition metal ions (TMIs), oxygen, and kidney infection (3). Unless specific risk factors such as a and antibiotic drug exposure. Iron and zinc ions are specifically compromised immune system exist, clinical guidelines do not sequestered by the innate immune system during infection recommend use of antibiotics in CAASB cases (7). Of major (14, 19, 20). CBs may have a mucoid phenotype derived from concern are acquired and innate resistances of bacteria causing extracellular polysaccharides that encapsulate bacterial cells and CAUTI, many of these belonging to the multidrug-resistant impede phagocytosis. Furthermore, such biofilms have been group of gram-negative pathogens known as ESKAPE pathogens associated with renal complications by blocking urine flow (3). (8). Understanding mechanisms that underlie cooperation and CBs typically harbor more than a single species (5, 6, 21). competition of bacteria and fungi in urethral catheter biofilms Culture-independent metagenomic analyses have highlighted the (CBs) may lead to new approaches to prevent or target considerable microbial diversity in CBs, including fastidious their formation. bacteria, such as Actinomyces, Stenotrophomonas, Finegoldia, and Innate immunity has a key role in defending against bacteria Corynebacterium (22, 23). To what extent the entire microbial invading the urinary tract. They express pathogen-associated community elicits inflammatory responses by the host is unclear. molecular patterns recognized by immunoglobulin A and A few studies have described biofilm profiles related to long- lipopolysaccharide-binding protein and then presented to term catheterization. One study reported high prevalence of Toll-like receptors on urothelial cells. Intracellular signaling E. coli, P. mirabilis, and Providencia stuartii for bacteriuric pathways result in cytokine release followed by leukocyte patients catheterized over 4 or more weeks (24). In a survey infiltration. Evidence from murine studies verified that of hundreds of urine samples
Load more

Recommended publications
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Corynebacterium Sp.|NML98-0116
    1 Limnochorda_pilosa~GCF_001544015.1@NZ_AP014924=Bacteria-Firmicutes-Limnochordia-Limnochordales-Limnochordaceae-Limnochorda-Limnochorda_pilosa 0,9635 Ammonifex_degensii|KC4~GCF_000024605.1@NC_013385=Bacteria-Firmicutes-Clostridia-Thermoanaerobacterales-Thermoanaerobacteraceae-Ammonifex-Ammonifex_degensii 0,985 Symbiobacterium_thermophilum|IAM14863~GCF_000009905.1@NC_006177=Bacteria-Firmicutes-Clostridia-Clostridiales-Symbiobacteriaceae-Symbiobacterium-Symbiobacterium_thermophilum Varibaculum_timonense~GCF_900169515.1@NZ_LT827020=Bacteria-Actinobacteria-Actinobacteria-Actinomycetales-Actinomycetaceae-Varibaculum-Varibaculum_timonense 1 Rubrobacter_aplysinae~GCF_001029505.1@NZ_LEKH01000003=Bacteria-Actinobacteria-Rubrobacteria-Rubrobacterales-Rubrobacteraceae-Rubrobacter-Rubrobacter_aplysinae 0,975 Rubrobacter_xylanophilus|DSM9941~GCF_000014185.1@NC_008148=Bacteria-Actinobacteria-Rubrobacteria-Rubrobacterales-Rubrobacteraceae-Rubrobacter-Rubrobacter_xylanophilus 1 Rubrobacter_radiotolerans~GCF_000661895.1@NZ_CP007514=Bacteria-Actinobacteria-Rubrobacteria-Rubrobacterales-Rubrobacteraceae-Rubrobacter-Rubrobacter_radiotolerans Actinobacteria_bacterium_rbg_16_64_13~GCA_001768675.1@MELN01000053=Bacteria-Actinobacteria-unknown_class-unknown_order-unknown_family-unknown_genus-Actinobacteria_bacterium_rbg_16_64_13 1 Actinobacteria_bacterium_13_2_20cm_68_14~GCA_001914705.1@MNDB01000040=Bacteria-Actinobacteria-unknown_class-unknown_order-unknown_family-unknown_genus-Actinobacteria_bacterium_13_2_20cm_68_14 1 0,9803 Thermoleophilum_album~GCF_900108055.1@NZ_FNWJ01000001=Bacteria-Actinobacteria-Thermoleophilia-Thermoleophilales-Thermoleophilaceae-Thermoleophilum-Thermoleophilum_album
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]
  • Vitek®2 Id & Ast Cards
    ® VITEK 2 ID & AST CARDS Reliable • safe • rapid RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in ® the lab. The ADVANCED EXPERT SYSTEM™ validates VITEK 2 ID & AST CARDS ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review Rapid, Flexible, E cient EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor Each self-contained, costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal disposable test card compared to other systems6,10,12.The cards provide provides rapid and INNOVATIVE AND FLEXIBLE DESIGN increased standardization and automated, same-day accurate species- results helping clinicians to optimise antibiotic level identi cation or • Each card contains microwells with biochemicals or antimicrobials therapy sooner2,3. susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability • EUCAST and CLSI compliant AST formulations available Designed for VITEK 2 automated systems, VITEK 2 reference CLSI** and identi cation (ID) and susceptibility (AST) cards provide ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: reliable and accurate results for clinically important US FDA*****, bacteria and yeasts1,2,4,5 or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10.
    [Show full text]
  • Which Organisms Are Used for Anti-Biofouling Studies
    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
    [Show full text]
  • Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level
    Table S5. The information of the bacteria annotated in the soil community at species level No. Phylum Class Order Family Genus Species The number of contigs Abundance(%) 1 Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus cereus 1749 5.145782459 2 Bacteroidetes Cytophagia Cytophagales Hymenobacteraceae Hymenobacter Hymenobacter sedentarius 1538 4.52499338 3 Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatirosa Gemmatirosa kalamazoonesis 1020 3.000970902 4 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas indica 797 2.344876284 5 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus Lactococcus piscium 542 1.594633558 6 Actinobacteria Thermoleophilia Solirubrobacterales Conexibacteraceae Conexibacter Conexibacter woesei 471 1.385742446 7 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas taxi 430 1.265115184 8 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 388 1.141545794 9 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp. FARSPH 298 0.876754244 10 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sorangium cellulosum 260 0.764953367 11 Proteobacteria Deltaproteobacteria Myxococcales Polyangiaceae Sorangium Sphingomonas sp. Cra20 260 0.764953367 12 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas panacis 252 0.741416341
    [Show full text]
  • Gram‑Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract
    This document is downloaded from DR‑NTU (https://dr.ntu.edu.sg) Nanyang Technological University, Singapore. Gram‑Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract Kline, Kimberly A.; Lewis, Amanda L. 2016 Kline, K. A., & Lewis, A. L. (2016). Gram‑Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract. Microbiology Spectrum, 4(2). https://hdl.handle.net/10356/85576 https://doi.org/10.1128/microbiolspec.UTI‑0012‑2012 © 2016 American Society for Microbiology (ASM). This is the author created version of a work that has been peer reviewed and accepted for publication by Microbiology Spectrum, American Society for Microbiology (ASM). It incorporates referee’s comments but changes resulting from the publishing process, such as copyediting, structural formatting, may not be reflected in this document. The published version is available at: [http://dx.doi.org/10.1128/microbiolspec.UTI‑0012‑2012]. Downloaded on 25 Sep 2021 13:11:13 SGT A uthor Ma Gram-Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract n usc Kimberly A. Kline and r ipt Singapore Centre on Environmental Life Sciences Engineering, School of Biological Sciences, Nanyang Technological University, Singapore, Phone: +65 9755-3601, Fax: +65 6316-7349, [email protected] Amanda L. Lewis Department of Molecular Microbiology, Campus Box 8230, Washington University School of Medicine, 660 S. Euclid Avenue, St. Louis, MO 63110, USA, Phone: 314-286-0016, Fax: A 314-747-0264, [email protected] uthor Ma Abstract Gram-positive bacteria are a common cause of urinary tract infection (UTI), particularly among n usc individuals who are elderly, pregnant, or who have other risk factors for UTI.
    [Show full text]
  • Aestuariimicrobium Ganziense Sp. Nov., a New Gram-Positive Bacterium Isolated from Soil in the Ganzi Tibetan Autonomous Prefecture, China
    Aestuariimicrobium ganziense sp. nov., a new Gram-positive bacterium isolated from soil in the Ganzi Tibetan Autonomous Prefecture, China Yu Geng Yunnan University Jiang-Yuan Zhao Yunnan University Hui-Ren Yuan Yunnan University Le-Le Li Yunnan University Meng-Liang Wen yunnan university Ming-Gang Li yunnan university Shu-Kun Tang ( [email protected] ) Yunnan Institute of Microbiology, Yunnan University https://orcid.org/0000-0001-9141-6244 Research Article Keywords: Aestuariimicrobium ganziense sp. nov., Chemotaxonomy, 16S rRNA sequence analysis Posted Date: February 11th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-215613/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Archives of Microbiology on March 12th, 2021. See the published version at https://doi.org/10.1007/s00203-021-02261-2. Page 1/11 Abstract A novel Gram-stain positive, oval shaped and non-agellated bacterium, designated YIM S02566T, was isolated from alpine soil in Shadui Towns, Ganzi County, Ganzi Tibetan Autonomous Prefecture, Sichuan Province, PR China. Growth occurred at 23–35°C (optimum, 30°C) in the presence of 0.5-4 % (w/v) NaCl (optimum, 1%) and at pH 7.0–8.0 (optimum, pH 7.0). The phylogenetic analysis based on 16S rRNA gene sequence revealed that strain YIM S02566T was most closely related to the genus Aestuariimicrobium, with Aestuariimicrobium kwangyangense R27T and Aestuariimicrobium soli D6T as its closest relative (sequence similarities were 96.3% and 95.4%, respectively). YIM S02566T contained LL-diaminopimelic acid in the cell wall.
    [Show full text]
  • Diversity and Prevalence of ANTAR Rnas Across Actinobacteria
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.11.335034; this version posted October 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Diversity and prevalence of ANTAR RNAs across actinobacteria Dolly Mehta1,2 and Arati Ramesh1,+ 1National Centre for Biological Sciences, Tata Institute of Fundamental Research, GKVK Campus, Bellary Road, Bangalore, India 560065. 2SASTRA University, Tirumalaisamudram, Thanjavur – 613401. +Corresponding Author: Arati Ramesh National Centre for Biological Sciences GKVK Campus, Bellary Road Bangalore, 560065 Tel. 91-80-23666930 e-mail: [email protected] Running title: Identification of ANTAR RNAs across Actinobacteria Keywords: ANTAR protein:RNA regulatory system, structured RNA, actinobacteria 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.11.335034; this version posted October 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT Computational approaches are often used to predict regulatory RNAs in bacteria, but their success is limited to RNAs that are highly conserved across phyla, in sequence and structure. The ANTAR regulatory system consists of a family of RNAs (the ANTAR-target RNAs) that selectively recruit ANTAR proteins. This protein-RNA complex together regulates genes at the level of translation or transcriptional elongation.
    [Show full text]
  • Erik Senneby Kappa
    Aerococcal infections - from bedside to bench and back Senneby, Erik 2018 Document Version: Förlagets slutgiltiga version Link to publication Citation for published version (APA): Senneby, E. (2018). Aerococcal infections - from bedside to bench and back. Lund University: Faculty of Medicine. Total number of authors: 1 General rights Unless other specific re-use rights are stated the following general rights apply: Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Read more about Creative commons licenses: https://creativecommons.org/licenses/ Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. LUND UNIVERSITY PO Box 117 221 00 Lund +46 46-222 00 00 Aerococcal infections - from bedside to bench and back Erik Senneby DOCTORAL DISSERTATION by due permission of the Faculty of Medicine, Lund University, Sweden. To be defended at Segerfalkssalen, BMC, on May 24th 2018 at 13.00. Faculty opponent Associate professor Christian Giske Karolinska Institutet 1 Organization Document name LUND UNIVERSITY Doctoral dissertation Department of Clinical Sciences Date of issue Division of Infection Medicine 20180524 Author(s) Erik Senneby Sponsoring organization Title and subtitle Aerococcal Infections – from bedside to bench and back Abstract The genus Aerococcus comprises eight species of Gram-positive cocci.
    [Show full text]
  • Microbiome, Autoimmune Diseases and HIV Infection: Friends Or Foes?
    nutrients Review Microbiome, Autoimmune Diseases and HIV Infection: Friends or Foes? Chiara Pellicano 1, Giorgia Leodori 1, Giuseppe Pietro Innocenti 2, Antonietta Gigante 1 and Edoardo Rosato 1,* 1 Department of Translational and Precision Medicine-Scleroderma Unit, Sapienza University of Rome, 00185 Rome, Italy; [email protected] (C.P.); [email protected] (G.L.); [email protected] (A.G.) 2 Department of Public Health and Infectious Diseases, Sapienza University of Rome, 00185 Rome Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-06-4997-2040 Received: 26 September 2019; Accepted: 30 October 2019; Published: 2 November 2019 Abstract: Several studies highlighted the importance of the interaction between microbiota and the immune system in the development and maintenance of the homeostasis of the human organism. Dysbiosis is associated with proinflammatory and pathological state-like metabolic diseases, autoimmune diseases and HIV infection. In this review, we discuss the current understanding of the possible role of dysbiosis in triggering and/or exacerbating symptoms of autoimmune diseases and HIV infection. There are no data about the influence of the microbiome on the development of autoimmune diseases during HIV infection. We can hypothesize that untreated patients may be more susceptible to the development of autoimmune diseases, due to the presence of dysbiosis. Eubiosis, re-established by probiotic administration, can be used to reduce triggers for autoimmune diseases in untreated HIV patients, although clinical studies are needed to evaluate the role of the microbiome in autoimmune diseases in HIV patients. Keywords: microbiota; autoimmune diseases; HIV; eubiosis; dysbiosis 1. Introduction The human microbiome is the aggregate of all microbiota, encompassing bacteria, archaea, fungi, protists and symbionts, that reside on or within human tissues and biofluids [1].
    [Show full text]