DOCSLIB.ORG

Human NK Cells with the 2B4 Receptor Inhibits Self-Killing of the Association of MHC Class I Proteins

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Human NK Cells with the 2B4 Receptor Inhibits Self-Killing of the Association of MHC Class I Proteins The Association of MHC Class I Proteins with the 2B4 Receptor Inhibits Self-Killing of Human NK Cells This information is current as Gili Betser-Cohen, Saar Mizrahi, Moran Elboim, Osnat of September 27, 2021. Alsheich-Bartok and Ofer Mandelboim J Immunol 2010; 184:2761-2768; Prepublished online 17 February 2010; doi: 10.4049/jimmunol.0901572 http://www.jimmunol.org/content/184/6/2761 Downloaded from References This article cites 39 articles, 14 of which you can access for free at: http://www.jimmunol.org/content/184/6/2761.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Association of MHC Class I Proteins with the 2B4 Receptor Inhibits Self-Killing of Human NK Cells Gili Betser-Cohen, Saar Mizrahi, Moran Elboim, Osnat Alsheich-Bartok, and Ofer Mandelboim The killing activity of NK cells is carried out by several activating NK receptors, which includes NKp46, NKp44, NKp30, NKp80, NKG2D, and 2B4. The ligands of these receptors are either self-derived, pathogen-derived, stress-induced ligands or tumor ligands. Importantly, none of these killer ligands are expressed on NK cells and thus self-killing of NK cells is prevented. A notable exception with this regard, is the ligand of the 2B4 receptor. This unusual receptor can exert both activating and inhibiting signals; however, in human NK cells, it serves mainly as an activating receptor. The ligand of 2B4 is CD48 and in contrast to the ligands of all the other NK activating receptors, CD48 is also present on NK cells. Thus, NK cells might be at risk for self-killing that is mediated via the 2B4-CD48 interaction. In this study, we identify a novel mechanism that prevents this self-killing as we show that the association of Downloaded from the MHC class I proteins with the 2B4 receptor, both present on NK cells, results in the attenuation of the 2B4-mediated self-killing of NK cells. The Journal of Immunology, 2010, 184: 2761–2768. atural killer cells are cytotoxic lymphocytes that belong to CD150 subfamily, within the CD2 family, includes several dual- the innate immune system. They were initially described functional receptors such as CD150, CD84, CD229, CD244 N as cells able to kill virally infected and tumor cells (1), (2B4), NTB-A, and CS1 (11) that can exert both activating and http://www.jimmunol.org/ although it is known today that they posses several additional inhibitory signals, depending on the adaptor proteins, which they functions such as production of growth factors during pregnancy (2) interact with (12). An example for such a receptor, is 2B4, the and even being APCs (3). The killing of NK cells is regulated by subject of this research, which contains within its cytoplasmic tail surface receptors that either induce or inhibit the cytotoxic re- four signaling ITSM (immunoreceptor tyrosine-based switch sponse. NK inhibition is mediated mainly via the recognition of motif) (13). MHC class I molecules by NK inhibitory receptors, such as the The ligands for the activating NK receptors that have been killer-Ig–like receptors (KIRs), CD94/NKG2A, and the leukocytes identified so far includes stress-induced ligands for NKG2D (14), Ig-like receptors (LIRs). Recently, we have shown that TIGIT could viral ligands for NKp44, NKp46, and NKp30 (15–17), a soluble also inhibit NK cells by binding to PVRL-2 and PVR (4). MHC ligand for NKp30 (18), a tumor ligand for NKp30 (19), and self- by guest on September 27, 2021 class I proteins are also needed for proper NK cell education (5, 6) ligands such as AICL and PVR/PVRL-2 for the NKp80 (20) and and in the absence of MHC class I proteins the killing activity of DNAM/CD96 (21) receptors, respectively. Finally, the CD48 NK cells is impaired. protein, has been identified as a ligand for 2B4 (22) and CD2 (10). The killing of NK cells is extracted by a limited number of In humans, 2B4 almost exclusively functions as an activating re- activating and coactivating NK receptors, including the natural ceptor and its inhibitory properties are mostly evident in genetic cytotoxicity receptors NKp46, NKp44, NKp30 (known as the deficiencies in which the signaling lymphocyte activation mole- NCRs), as well as by NKp80, DNAM, CD96, and the NKG2D cule-associated protein (SAP) is absent. In such a deficiency receptor (7, 8). Another family of killer receptors that is involved named X-linked lymphoproliferative disease (XLP) (23), different in the killing mediated by NK cells is the CD2 family (9, 10). The phosphatases such as Src homology region 2 domain-containing phosphatase 1 (SHP-1), SHP-2, and SHIP are recruited, instead of SAP, and 2B4 becomes inhibitory (24). The Lautenberg Center for General and Tumor Immunology, The Institute for Med- Among all the killer receptor ligands, CD48 is the only protein ical Research Israel Canada, Hebrew University-Hadassah Medical School, Jerusa- expressed on NK cells (25). Therefore, we wondered why NK cells lem, Israel do not kill each other via the 2B4-CD48 interactions, and hy- Received for publication June 26, 2009. Accepted for publication December 23, 2009. pothesized that NK cells probably possess a mechanism that This work was supported by grants from the US–Israel Bi-National Science Foun- prevent this 2B4-mediated self-killing. dation, the Israeli Cancer Research Foundation, The Israeli Science Foundation, the legacy heritage Bio-Medical program of the Israel Science Foundation (1838/08), The European Consortium (MRTN-CT-2005 and LSCH-CT-2005-518178), and by the Association for International Cancer Research. Materials and Methods Address correspondence and reprint requests to Prof. Ofer Mandelboim, The Lauten- Cell, transfectants, mAb, and proteins berg Center for General and Tumor Immunology, The Institute for Medical Research Israel Canada, Hadassah Medical School, 91120 Jerusalem, Israel. E-mail address: The cell lines used in this work were the MHC class I-negative human B [email protected] lymphoblastoid cell line 721.221, various MHC class I transfectants, the human NK cell line YTS eco, and the Fc receptor positive murine mas- Abbreviations used in this paper: BG, background; ITSM, immunoreceptor tyrosine- tocytoma cell line P815. Primary human NK cells were isolated from PBLs based switch motif; KIR, killer-Ig–like receptor; LIR, leukocytes Ig-like receptor; Med, medium only; PI, propidium iodide; SAP, signaling lymphocyte activation by using a human NK cell isolation kit and an auto-MACS instrument molecule-associated protein; SHP, Src homology region 2 domain-containing phos- (Miltenyi Biotec, Auburn, CA). phatase 1; XLP, X-linked lymphoproliferative disease. For the generation of YTS cells expressing the chimeric protein con- taining the extracellular portion of NKp44 fused to the transmembrane and Copyright Ó 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00 cytoplasmic tail portion of 2B4, plasmid constructs were prepared in EcoRI- www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901572 2762 MHC CLASS I ON NK CELLS PREVENTS SELF-KILLING BAMH1 pBABE vector. Transfection with the encoding plasmid for Class I MHC tetramers-SA-PE that are used in this work are composed of the chimeric NKp44/2B4 protein or for the chimeric NKp44/Cw7 was a complex offour HLA-A2MHC class I molecules,each bound to the specific performed in three PCR steps: first, amplification of the extracellular do- peptide and conjugated with a fluorescent protein (Beckman Coulter). main of NKp44 containing 3 aa from the beginning of the transmembrane BrdU and propidium iodide assays domain of 2B4 or HLA-Cw7, using the same 59 primer for both proteins GGAATTCCGCCGCCACCATGGCCTGGCGAGCCCTACAC (including For BrdU incorporation, cells (1 3 106) were incubated with 20 mM BrdU for the EcoRI restriction site) and 39 primer for 2B4 CACCAAAAAGG- 30 min, washed three times with PBS, fixed with 5 ml ice-cold 70% ethanol CAATGGGGGCTGCAGGG or 39 primer for HLA-Cw7 GATGCCCATGG- and kept over night at 220˚C. On the next day, cells underwent centrifu- CAATGGGGGCTGCAGGG. Second, amplification includes 3 aa derived gation and washed three times to remove ethanol residues, and emulsified from the end of the extracellular domain of NKp44 with the transmembrane with 0.3 ml PBS, 30 min on ice (rehydration). DNA denaturation was per- domain and the tail of 2B4 receptor or HLA-Cw7, for the 2B4 using 59 primer formed with 1 ml fresh HCL solution (0.5% Triton X-100, 2 N HCL) for 30 CCCATTGCCTTTTTGGTGATCATCGTGATTCTA and for the HLA-Cw7 min at room temperature. After the incubation, cells were washed twice, using 59 primer CCCATTGCCATGGGCATCGTTGCTGGCGGCCTG. The resuspended in 1 ml basic solution (0.1 M Na2B4O7), and immediately 39 primer for both proteins CGGGATCCCGCTAGGAATTAAACATCAAA- washed with incubation solution (1% BSA, 0.5% Triton X-100). For BrdU GTTCTC (including the BamHI restriction site). The final PCR step included staining, the cells were resuspend in 50 ml incubation solution containing mixing of the two PCR products that were used as templates and PCR ampli- 1:10 anti–BrdU-FITC for 30 min on ice.
Load more

Recommended publications
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • CD48 Is Critically Involved in Allergic Eosinophilic Airway Inflammation
    CD48 Is Critically Involved in Allergic Eosinophilic Airway Inflammation Ariel Munitz,1 Ido Bachelet,1 Fred D. Finkelman,2 Marc E. Rothenberg,3 and Francesca Levi-Schaffer1,4 1Department of Pharmacology, School of Pharmacy, Faculty of Medicine, Hebrew University of Jerusalem, Jerusalem, Israel; 2Department of Medicine, University of Cincinnati College of Medicine, Cincinnati, Ohio; 3Division of Allergy and Immunology, Department of Pediatrics, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, Ohio; and 4David R. Bloom Center for Pharmacology, Hebrew University of Jerusalem, Jerusalem, Israel Rationale: Despite ongoing research, the molecular mechanisms con- trolling asthma are still elusive. CD48 is a glycosylphosphatidylinositol- AT A GLANCE COMMENTARY anchored protein involved in lymphocyte adhesion, activation, and costimulation. Although CD48 is widely expressed on hematopoi- Scientific Knowledge on the Subject etic cells and commonly studied in the context of natural killer and CD48 is an activation molecule able to facilitate various cytotoxic T cell functions, its role in helper T cell type 2 settings cellular activities. Its role in asthma is unknown. has not been examined. Objectives: To evaluate the expression and function of CD48, CD2, and 2B4 in a murine model of allergic eosinophilic airway inflammation. What This Study Adds to the Field Methods: Allergic eosinophilic airway inflammation was induced by CD48 is upregulated in experimental asthma. Anti-CD48– ovalbumin (OVA)–alum sensitization and intranasal inoculation of based therapies may be useful for asthma and perhaps OVA or, alternatively, by repeated intranasal inoculation of Aspergil- various allergic diseases. lus fumigatus antigen in wild-type, STAT (signal transducer and acti- vator of transcription)-6–deficient, and IL-4/IL-13–deficient BALB/c mice.
    [Show full text]
  • CD226 T Cells Expressing the Receptors TIGIT and Divergent Phenotypes of Human Regulatory
    The Journal of Immunology Divergent Phenotypes of Human Regulatory T Cells Expressing the Receptors TIGIT and CD226 Christopher A. Fuhrman,*,1 Wen-I Yeh,*,1 Howard R. Seay,* Priya Saikumar Lakshmi,* Gaurav Chopra,† Lin Zhang,* Daniel J. Perry,* Stephanie A. McClymont,† Mahesh Yadav,† Maria-Cecilia Lopez,‡ Henry V. Baker,‡ Ying Zhang,x Yizheng Li,{ Maryann Whitley,{ David von Schack,x Mark A. Atkinson,* Jeffrey A. Bluestone,‡ and Todd M. Brusko* Regulatory T cells (Tregs) play a central role in counteracting inflammation and autoimmunity. A more complete understanding of cellular heterogeneity and the potential for lineage plasticity in human Treg subsets may identify markers of disease pathogenesis and facilitate the development of optimized cellular therapeutics. To better elucidate human Treg subsets, we conducted direct transcriptional profiling of CD4+FOXP3+Helios+ thymic-derived Tregs and CD4+FOXP3+Helios2 T cells, followed by comparison with CD4+FOXP32Helios2 T conventional cells. These analyses revealed that the coinhibitory receptor T cell Ig and ITIM domain (TIGIT) was highly expressed on thymic-derived Tregs. TIGIT and the costimulatory factor CD226 bind the common ligand CD155. Thus, we analyzed the cellular distribution and suppressive activity of isolated subsets of CD4+CD25+CD127lo/2 T cells expressing CD226 and/or TIGIT. We observed TIGIT is highly expressed and upregulated on Tregs after activation and in vitro expansion, and is associated with lineage stability and suppressive capacity. Conversely, the CD226+TIGIT2 population was associated with reduced Treg purity and suppressive capacity after expansion, along with a marked increase in IL-10 and effector cytokine production. These studies provide additional markers to delineate functionally distinct Treg subsets that may help direct cellular therapies and provide important phenotypic markers for assessing the role of Tregs in health and disease.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Cytokine-Enhanced Cytolytic Activity of Exosomes from NK Cells
    Cancer Gene Therapy https://doi.org/10.1038/s41417-021-00352-2 ARTICLE Cytokine-enhanced cytolytic activity of exosomes from NK Cells 1 1 2 3 2 3 Yutaka Enomoto ● Peng Li ● Lisa M. Jenkins ● Dimitrios Anastasakis ● Gaelyn C. Lyons ● Markus Hafner ● Warren J. Leonard 1 Received: 4 February 2021 / Revised: 9 May 2021 / Accepted: 18 May 2021 This is a U.S. Government work and not under copyright protection in the US; foreign copyright protection may apply 2021. This article is published with open access Abstract Natural killer (NK) cells play key roles in immune surveillance against tumors and viral infection. NK cells distinguish abnormal cells from healthy cells by cell–cell interaction with cell surface proteins and then attack target cells via multiple mechanisms. In addition, extracellular vesicles (EVs) derived from NK cells (NK-EVs), including exosomes, possess cytotoxic capacity against tumor cells, but their characteristics and regulation by cytokines remain unknown. Here, we report that EVs derived from human NK-92 cells stimulated with IL-15 + IL-21 show enhanced cytotoxic capacity against tumor cells. Major cytolytic granules, granzyme B and granzyme H, are enriched by IL-15 + IL-21 stimulation in NK-EVs; however, knockout experiments reveal those cytolytic granules are independent of enhanced cytotoxic capacity. To find out the key molecules, mass spectrometry analyses were 1234567890();,: 1234567890();,: performed with different cytokine conditions, no cytokine, IL-15, IL-21, or IL-15 + IL-21. We then found that CD226 (DNAM-1) on NK-EVs is enriched by IL-15 + IL-21 stimulation and that blocking antibodies against CD226 reduced the cytolytic activity of NK-EVs.
    [Show full text]
  • Binding Mode of the Side-By-Side Two-Igv Molecule CD226/DNAM-1 to Its Ligand CD155/Necl-5
    Binding mode of the side-by-side two-IgV molecule CD226/DNAM-1 to its ligand CD155/Necl-5 Han Wanga, Jianxun Qib, Shuijun Zhangb,1, Yan Lib, Shuguang Tanb,2, and George F. Gaoa,b,2 aResearch Network of Immunity and Health (RNIH), Beijing Institutes of Life Science, Chinese Academy of Sciences (CAS), 100101 Beijing, China; and bCAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, 100101 Beijing, China Edited by K. Christopher Garcia, Stanford University School of Medicine, Stanford, CA, and approved December 3, 2018 (received for review September 11, 2018) Natural killer (NK) cells are important component of innate immu- CD226, also known as DNAM-1, belongs to the Ig superfamily nity and also contribute to activating and reshaping the adaptive and contains two extracellular Ig-like domains (CD226-D1 and immune responses. The functions of NK cells are modulated by CD226-D2), and is widely expressed in monocytes, platelets, multiple inhibitory and stimulatory receptors. Among these recep- T cells, and most of the resting NK cells (8, 13, 19, 20). The tors, the activating receptor CD226 (DNAM-1) mediates NK cell intracellular domain of CD226 does not contain a tyrosine-based activation via binding to its nectin-like (Necl) family ligand, CD155 activation motif, which is accepted as responsible for activating (Necl-5). Here, we present a unique side-by-side arrangement signal transduction of stimulatory molecules (13). Instead, it pattern of two tandem immunoglobulin V-set (IgV) domains transmits the downstream signaling by phosphorylation of in- deriving from the ectodomains of both human CD226 (hCD226- tracellular phosphorylation sites and subsequent association with ecto) and mouse CD226 (mCD226-ecto), which is substantially integrin lymphocyte function-associated antigen 1 (21).
    [Show full text]
  • CD Markers Are Routinely Used for the Immunophenotyping of Cells
    ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr.
    [Show full text]
  • CD226 Axis Fact Sheet
    Exploring the potential of next generation immuno-oncology therapies for cancer Until recently, standard treatments for What are checkpoint cancer included: inhibitors? T cells are an important part of our immune system and produce proteins called checkpoints which help keep the immune system in surgery radiotherapy “check” by not acting too aggressively. However, the checkpoints can also prevent T cells from recognising and killing cancer cells. When these checkpoints are blocked with chemotherapy targeted therapy certain medications, called checkpoint inhibitors, T cells function better and can attack cancer cells. The leading type However, immuno-oncology (IO) has emerged of checkpoint inhibitors include as a novel treatment approach by harnessing those targeting and the body’s own immune system to fight cancer. blocking PD-1/PD-L1. While IO therapies have transformed cancer Tumour cell care, unfortunately, not all patients benefit. One T cell of the most widely used types of IO therapies, checkpoint inhibitors, have only demonstrated response rates of 15 to 30% across most solid tumours.i Checkpoint inhibitor Targeting the CD226 axis CD226 is a molecule expressed on the surface of T cells and natural killer (NK) cells, which binds to CD155 and CD112 on tumour cells, stimulating an immune response. However, the immune checkpoints TIGIT, CD96 and PVRIG may prevent CD226 from interacting with CD155 and CD112, which may result in a reduced immune response and the development or progression of cancer. Blocking the CD96, PVRIG and TIGIT checkpoints may enable T and NK cells to better target tumour cells. We are uniquely positioned to explore innovative combinations with our CD226 axis checkpoint inhibitors – key targets for next-generation immuno-oncology therapies We are exploring potential therapeutic approaches to better understand how and when these assets may be used to improve outcomes for patients with cancer.
    [Show full text]
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells with an Increased Cytotoxic Potential
    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
    [Show full text]
  • Elevated Plasma BDNF Levels Are Correlated with NK Cell Activation in Patients with Traumatic Spinal Cord Injury T
    International Immunopharmacology 74 (2019) 105722 Contents lists available at ScienceDirect International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp Elevated plasma BDNF levels are correlated with NK cell activation in patients with traumatic spinal cord injury T Long Xua,1,2, Yong Zhangb,1,3, Renjie Zhangb, Huaqing Zhangb, Peiwen Songb, Tai Maa, Yue Lia, ⁎ ⁎⁎ Xian Wanga, Xin Houa, Qun Lia, Jiegou Xua, Xiaoping Gaoc, ,4, Cailiang Shenb, ,4 a School of Basic Medical Science, Anhui Medical University, Hefei, Anhui, China b Department of Orthopedics & Spine Surgery, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, China c Department of Rehabilitation Medicine, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, China ARTICLE INFO ABSTRACT Keywords: Background: The precise role of innate immune responses in the early stage of traumatic spinal cord injury (SCI), Spinal cord injury especially those mediated by natural killer (NK) cells, is poorly understood. BDNF Methods: The frequency and phenotype of NK cells from traumatic SCI patients and healthy controls were as- NK cells sessed by flow cytometry. ELISA assay was used to detect the production of a series of cytokines, neurotrophins, Activation and neurohormones in plasma samples. In vitro cell culture was performed to observe brain-derived neurotrophic factor (BDNF)-induced NK cell activation. Results: A significant increase in the NK cell frequency and the presence of NK cells with the activated phenotype was observed, as reflected by the enhanced expression of CD69, HLA-DR, NKG2D, and NKp30 on the NK cells, in traumatic SCI patients within 24 h of injury, compared to case for the healthy controls.
    [Show full text]
  • Identification of Common Gene Networks Responsive To
    Cancer Gene Therapy (2014) 21, 542–548 © 2014 Nature America, Inc. All rights reserved 0929-1903/14 www.nature.com/cgt ORIGINAL ARTICLE Identification of common gene networks responsive to radiotherapy in human cancer cells D-L Hou1, L Chen2, B Liu1, L-N Song1 and T Fang1 Identification of the genes that are differentially expressed between radiosensitive and radioresistant cancers by global gene analysis may help to elucidate the mechanisms underlying tumor radioresistance and improve the efficacy of radiotherapy. An integrated analysis was conducted using publicly available GEO datasets to detect differentially expressed genes (DEGs) between cancer cells exhibiting radioresistance and cancer cells exhibiting radiosensitivity. Gene Ontology (GO) enrichment analyses, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and protein–protein interaction (PPI) networks analysis were also performed. Five GEO datasets including 16 samples of radiosensitive cancers and radioresistant cancers were obtained. A total of 688 DEGs across these studies were identified, of which 374 were upregulated and 314 were downregulated in radioresistant cancer cell. The most significantly enriched GO terms were regulation of transcription, DNA-dependent (GO: 0006355, P = 7.00E-09) for biological processes, while those for molecular functions was protein binding (GO: 0005515, P = 1.01E-28), and those for cellular component was cytoplasm (GO: 0005737, P = 2.81E-26). The most significantly enriched pathway in our KEGG analysis was Pathways in cancer (P = 4.20E-07). PPI network analysis showed that IFIH1 (Degree = 33) was selected as the most significant hub protein. This integrated analysis may help to predict responses to radiotherapy and may also provide insights into the development of individualized therapies and novel therapeutic targets.
    [Show full text]
  • Understanding the Synergy of Nkp46 and Co-Activating Signals in Various NK Cell Subpopulations: Paving the Way for More Successful NK-Cell-Based Immunotherapy
    cells Article Understanding the Synergy of NKp46 and Co-Activating Signals in Various NK Cell Subpopulations: Paving the Way for More Successful NK-Cell-Based Immunotherapy 1,2, 3, 1, 1 Loris Zamai * , Genny Del Zotto y , Flavia Buccella y, Sara Gabrielli , Barbara Canonico 1 , Marco Artico 4, Claudio Ortolani 1 and Stefano Papa 1 1 Department of Biomolecular Sciences, University of Urbino “Carlo Bo”, 61032 Urbino, Italy; fl[email protected] (F.B.); [email protected] (S.G.); [email protected] (B.C.); [email protected] (C.O.); [email protected] (S.P.) 2 INFN-Gran Sasso National Laboratory, Assergi, 67100 L’Aquila, Italy 3 Area Aggregazione Servizi e Laboratori Diagnostici, IRCCS Istituto Giannina Gaslini, 16147 Genoa, Italy; [email protected] 4 Department of Sensory Organs, Sapienza University of Rome, 00161 Rome, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-0722-304319; Fax: +39-0722-304319 These authors contributed equally. y Received: 11 February 2020; Accepted: 13 March 2020; Published: 19 March 2020 Abstract: The NK cell population is characterized by distinct NK cell subsets that respond differently to the various activating stimuli. For this reason, the determination of the optimal cytotoxic activation of the different NK cell subsets can be a crucial aspect to be exploited to counter cancer cells in oncologic patients. To evaluate how the triggering of different combination of activating receptors can affect the cytotoxic responses of different NK cell subsets, we developed a microbead-based degranulation assay. By using this new assay, we were able to detect CD107a+ degranulating NK cells even within the less cytotoxic subsets (i.e., resting CD56bright and unlicensed CD56dim NK cells), thus demonstrating its high sensitivity.
    [Show full text]