DOCSLIB.ORG

Mutational Analysis of Myoclonin1 Gene in Pakistani Juvenile Myoclonic Epilepsy Patients

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutational Analysis of Myoclonin1 Gene in Pakistani Juvenile Myoclonic Epilepsy Patients Hindawi BioMed Research International Volume 2021, Article ID 7509825, 6 pages https://doi.org/10.1155/2021/7509825 Research Article Mutational Analysis of Myoclonin1 Gene in Pakistani Juvenile Myoclonic Epilepsy Patients Tayyaba Saleem , Arooj Mustafa , Nadeem Sheikh , Maryam Mukhtar , Mavra Irfan , and Saira Kainat Suqaina Cell and Molecular Biology Laboratory, Department of Zoology, University of the Punjab, Lahore 54590, Pakistan Correspondence should be addressed to Nadeem Sheikh; [email protected] Received 22 July 2020; Revised 3 February 2021; Accepted 10 April 2021; Published 21 April 2021 Academic Editor: Bilal ig Copyright © 2021 Tayyaba Saleem et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Juvenile myoclonic epilepsy (JME) is the most prevalent and genetically heterogeneous form of epilepsy and accounts for 10–30% of all the cases worldwide. Ef-hand domain- (c-terminal-) containing protein 1 (EFHC1) encodes for a nonion channel protein and mutations in this gene have been extensively reported in different populations to play a causative role in JME. Linkage between JME and 6p11-12 locus has already been confirmed in Mexican and Dutch families. A case-control study was conducted on Pakistani JME patients for the first time, aimed at finding out EFHC1 mutations that have been reported in different populations. For this purpose, 66 clinically diagnosed JME patients and 108 control subjects were included in the study. Blood samples were collected from all the participants, and DNA was isolated from the lymphocytes by the modified organic method. Total 3 exons of EFHC1, harboring extensively reported mutations, were selected for genotypic analysis. We identified three heterozygous variants, R159W, V460A, P436P, and one insertion in the current study. V460A, an uncommon variant identified herein, has recently been reported in public databases in an unphenotyped American individual. This missense variant was found in 3 Pakistani JME patients from 2 unrelated families. However, in silico analysis showed that V460A may possibly be a neutral variant. While the absence of a majority of previously reported mutations in our population suggests that most of the mutations of EFHC1 are confined to particular ethnicities and are not evenly distributed across the world. However, to imply the causation, the whole gene and larger number of JME patients should be screened in this understudied population. 1. Introduction regular basis but upon discontinuation of medication, a high recurrence rate has been reported in various studies [5, 6]. Juvenile myoclonic epilepsy (JME) is the most prevalent form JME seizures occur in adolescents with the typical onset of genetic generalized epilepsy and accounts for at least age of 12-18 years [7]. It has been found more prevalent 10–30% of all epilepsies [1, 2]. JME alone is responsible for in females than in males (23). Till date, mutations in eight 2 million cases in India [3]. No epidemiological data of Mendelian genes (gamma-aminobutyric acid receptor JME is present for Pakistan, so the exact prevalence is not subunit alpha-1; GABRA1, calcium-sensing receptor; CASR, known yet. JME is typified by myoclonic jerks that predom- gamma-aminobutyric acid receptor, delta; GABRD, calcium inantly occur after waking, generalized tonic–clonic (GTC) channel, voltage-dependent, beta-4 subunit; CACNB4, ef- seizures, and infrequent absence seizures [4]. Epileptologists hand domain- (c-terminal-) containing protein 2; EFHC2, follow the varied criteria for JME diagnosis but the key diag- bromodomain-containing protein 2; BRD2, sodium chan- nostic feature, according to all epileptologists is the same that nel, voltage-gated, type i, beta subunit; SCN1B, and ef- all JME patients experience myoclonic seizures with or with- hand domain (c-terminal)-containing protein 1; EFHC1) out GTCS and absence seizure in the early morning. Typical have been identified which are linked with JME [8, 9]. So EEG symptom for JME is considered as polyspike wave pat- far, heterozygous mutations in the coding sequence of tern of >4 Hz with normal background activity. Seizures are EFHC1/Myoclonin1 are persistent, causing JME including well controlled when the patient follows the prescription on autosomal dominant, singleton, and sporadic cases in 2 BioMed Research International various independent families around the world [7, 10, 11]. Table 1: Clinical characters of the JME patients. Genetic studies have affirmed that mutations in EFHC1 con- N stitute 3 to 9% of all the JME cases all over the world [12]. Character EFHC1 gene consisting of 11 exons encodes a 70 kDa protein Gender 66 of 640 amino acids containing three DM10 domains, a motif Female 27 with unknown function, and an EF-hand Ca2+-binding Male 39 motif. EFHC1 modulates the apoptotic activity by interacting mean ± SD 17 ± 3:33 with R-type voltage-dependent calcium channels. Thus, the Age years ( ) mutations in EFHC1 interfere with the apoptotic activity of Female 16 ± 3:12 this gene by increasing the neuronal density leading to the Male 15 ± 3:24 production of hyperexcitable circuits [13]. Interestingly, EFHC1 mutations are not limited to JME Seizure type but it has also been identified in different idiopathic general- Myoclonic seizures 66 ized epilepsies and temporal lobe epilepsy. EFHC1 mutations GTCS 50 may be considered pleiotropic due to their involvement in Absence seizures 6 various epilepsy phenotypes [14]. EFHC1 (a microtubule- Absence+myoclonic 2 associated protein) plays a vital role in radial migration and Absence + myoclonic + GTCS 4 cell division during cerebral corticogenesis. Functional anal- ysis of various mutations has established that mutant EFHC1 Myoclonic+GTCS 46 impairs mitotic spindle organization and affects the mor- Myoclonic seizures alone 14 phology of radial glia that further leads to disruption of the Distribution of myoclonic jerks radial and tangential migration. Mutations in the EFHC1 Upper extremities 57 gene potentially produce structural brain anomalies due to Lower extremities 09 disruption in brain development [15]. Several studies have indicated that mutations in neuro- Precipitating factors transmitter receptors and ion channel genes are linked with Sleep deprivation 39 JME. The mutations that have been reported in these genes Fatigue 21 were private mutations, only found in single families and Stress 11 typically of de novo origin, that are not spotted in biological parents. Importantly, these de novo mutations (DNMs) were Family history not detected in other family-based association studies for 1st-degree relatives 11 JME in the same or different ethnicities [16]. Consequently, 2nd-degree relatives 17 mutations in genes coding for ion channel proteins cannot be accounted as the common cause of JME. EFHC1 is consid- ered as a potential candidate gene for JME and has been is indispensable to ascribe causation [20]. Therefore, to found very interesting in many aspects. First, EFHC1 is the ascertain whether the different variants of the EFHC1 gene only gene in which mutations were found in many unrelated contribute to JME in Pakistani patients, we genotyped 3 families with JME across the world, and second, no ion chan- important exons of this gene on which mutations had been nel protein is coded by it as usually the case in epilepsy [17]. reported extensively in previous genetic studies. This presents a new perspective to the pathophysiology of JME and genetic epilepsy as a whole. However, Pinto et al. 2. Materials and Methods found 6p12–11 loci very heterogeneous and reported EFHC1 mutations nonexistent in 112 Dutch patients of JME [18]. 2.1. Subjects. 66 Pakistani patients with JME were selected for Hence, it can be presumed that JME may be caused by muta- the current study from two different hospitals of Punjab, tions in multiple genes, which may vary between populations Pakistan, who were visiting the outpatient department from of different ethnic origins. Mapping of 6p12–11 loci in a large September 2018 to November 2019. All JME patients were Belize family with JME revealed a common EFHC1 polymor- diagnosed by neurologists by the following criteria. The onset phism present in higher frequency than in healthy individ- of myoclonic seizures varied between 8 and 20 years age uals, cosegregating with juvenile myoclonic epilepsy. When bracket. Patients experienced short bilateral myoclonic jerks the cell death analysis mediated by EFHC1 was judged, it of shoulders and arms without losing consciousness just after was evident that this common polymorphism had no effect awakening. Interictal electroencephalography (EEG) of the on protein function, prospecting the involvement of other patients showed diffused, bilateral synchronous, and 4-6 Hz nearby mutations accountable for JME in this family [19]. polyspike waves with normal background, provoked by Several studies had questioned the mutation-specific patho- photic stimulation [21, 22]. Furthermore, patients with focal genic effects of the EFHC1 gene linked to JME. Subaran seizures, mental retardation, or with a suggestion of any et al. highlighted that the pathogenicity of EFHC1 mutations degenerative disease were excluded from this study. This may depend on heterogeneity in terms of the genetic back- study was approved by the Bioethics Committee of Univer- ground of the ethnic group considered for the study. Fur- sity of the Punjab, Lahore, Pakistan. Written informed con- thermore, this study cautions us that compelling evidence sent was signed by all the patients/guardians before taking BioMed Research International 3 Table 2: Variants identified by sequencing the exons of EFHC1 in Pakistani JME patients. Genotype counts/(no. of No. Region NCBI dbSNP ID Nucleotide change Amino acid change Molecular consequence subjects) JME probands Control subjects 1 Exon 3 rs3804506 475C > T R159W Missense 19/66 11/108 2 Intron 5 rs1581829739 c:723 + 18 723 + 19insG N/A Unknown 1/66 0/108 3 Exon 8 rs764251038 1436 T > C V460A Missense 3/66 0/108 4 Exon 8 rs1581846971 1365T > C P436P Synonymous 2/66 0/108 the blood sample.
Load more

Recommended publications
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
    [Show full text]
  • Contiguous Deletion of the NDP, MAOA, MAOB, and EFHC2 Genes in a Patient with Norrie Disease, Severe Psychomotor Retardation and Myoclonic Epilepsy
    ß 2007 Wiley-Liss, Inc. American Journal of Medical Genetics Part A 143A:916–920 (2007) Contiguous Deletion of the NDP, MAOA, MAOB, and EFHC2 Genes in a Patient With Norrie Disease, Severe Psychomotor Retardation and Myoclonic Epilepsy L. Rodriguez-Revenga,1,2 I. Madrigal,1,2 L.S. Alkhalidi,3 L. Armengol,4 E. Gonza´lez,4 C. Badenas,1,2 X. Estivill,1,5 and M. Mila`1,2* 1Biochemistry and Molecular Genetics Department, Hospital Clı´nic, Barcelona, Spain 2IDIBAPS (Institut d’Investigacions Biome`diques August Pi i Sunyer), Barcelona, Spain 3Department of Health and Medical Services, Rashid Hospital, Dubai, United Arab Emirates 4Genes and Disease Programme, Centre for Genomic Regulation (CRG), Barcelona Biomedical Research Park, Barcelona, Spain 5Department of Experimental and Health Sciences, Universitat Pompeu Fabra (UPF), Barcelona, Spain Received 20 February 2006; Accepted 7 September 2006 Norrie disease (ND) is an X-linked disorder, inherited as a Clinical features of the proband include bilateral retinal recessive trait that, therefore, mostly affects males. The gene detachment, microcephaly, severe psychomotor retardation responsible for ND, called NDP, maps to the short arm of without verbal language skills acquired, and epilepsy. The chromosome X (Xp11.4-p11.3). We report here an atypical identification and molecular characterization of this case case of ND, consisting of a patient harboring a large reinforces the idea of a new contiguous gene syndrome that submicroscopic deletion affecting not only the NDP gene would explain the complex phenotype shared by atypical but also the MAOA, MAOB, and EFHC2 genes. Microarray ND patients. ß 2007 Wiley-Liss, Inc.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Protein Localization Screening in Vivo Reveals Novel Regulators of Multiciliated Cell Development and Function Fan Tu1, Jakub Sedzinski1,2, Yun Ma1,3, Edward M
    © 2018. Published by The Company of Biologists Ltd | Journal of Cell Science (2018) 131, jcs206565. doi:10.1242/jcs.206565 SHORT REPORT Protein localization screening in vivo reveals novel regulators of multiciliated cell development and function Fan Tu1, Jakub Sedzinski1,2, Yun Ma1,3, Edward M. Marcotte1 and John B. Wallingford1,* ABSTRACT RESULTS AND DISCUSSION Multiciliated cells (MCCs) drive fluid flow in diverse tubular organs High-content screening of protein localization in MCCs in vivo and are essential for the development and homeostasis of the vertebrate central nervous system, airway and reproductive tracts. High-content screening of protein localization is a powerful These cells are characterized by dozens or hundreds of motile cilia approach for linking genomics to cell biology (Boutros et al., Xenopus that beat in a coordinated and polarized manner. In recent years, 2015), so we turned to embryos, where the epidermis genomic studies have not only elucidated the transcriptional develops as a mix of MCCs and mucus-secreting cells similar to in hierarchy for MCC specification but also identified myriad new the mammalian airway (Hayes et al., 2007; Walentek and Quigley, proteins that govern MCC ciliogenesis, cilia beating and cilia 2017; Werner and Mitchell, 2011). Molecular mechanisms of MCC Xenopus polarization. Interestingly, this burst of genomic data has also development and function are highly conserved between highlighted that proteins with no obvious role in cilia do, in fact, have and mammals, including humans (e.g. Boon et al., 2014; Toriyama important ciliary functions. Understanding the function of proteins et al., 2016; Wallmeier et al., 2014, 2016; Zariwala et al., 2013), and Xenopus with little prior history of study presents a special challenge, MCCs are very large and present on the external surface of especially when faced with large numbers of such proteins.
    [Show full text]
  • Genome-Wide Meta-Analysis Identifies 127 Open-Angle Glaucoma Loci with Consistent Effect Across Ancestries
    UC San Diego UC San Diego Previously Published Works Title Genome-wide meta-analysis identifies 127 open-angle glaucoma loci with consistent effect across ancestries. Permalink https://escholarship.org/uc/item/6fn1m7tr Journal Nature communications, 12(1) ISSN 2041-1723 Authors Gharahkhani, Puya Jorgenson, Eric Hysi, Pirro et al. Publication Date 2021-02-24 DOI 10.1038/s41467-020-20851-4 Peer reviewed eScholarship.org Powered by the California Digital Library University of California ARTICLE https://doi.org/10.1038/s41467-020-20851-4 OPEN Genome-wide meta-analysis identifies 127 open-angle glaucoma loci with consistent effect across ancestries ✉ Puya Gharahkhani 1,190 , Eric Jorgenson 2,190, Pirro Hysi 3,190, Anthony P. Khawaja 4,5,190, Sarah Pendergrass6,190, Xikun Han 1, Jue Sheng Ong 1, Alex W. Hewitt 7,8, Ayellet V. Segrè9, John M. Rouhana 9, Andrew R. Hamel9, Robert P. Igo Jr 10, Helene Choquet 2, Ayub Qassim11, Navya S. Josyula 12, Jessica N. Cooke Bailey 10,13, Pieter W. M. Bonnemaijer 14,15,16, Adriana Iglesias 14,15,17, Owen M. Siggs 11, Terri L. Young 18, Veronique Vitart 19, 1234567890():,; Alberta A. H. J. Thiadens 14,15, Juha Karjalainen20,21,22, Steffen Uebe23, Ronald B. Melles24, K. Saidas Nair25, Robert Luben 5, Mark Simcoe 3,26,27, Nishani Amersinghe28, Angela J. Cree 29, Rene Hohn30,31, Alicia Poplawski 32, Li Jia Chen33, Shi-Song Rong 9,33, Tin Aung34,35,36, Eranga Nishanthie Vithana 34,37, NEIGHBORHOOD consortium*, ANZRAG consortium*, Biobank Japan project*, FinnGen study*, UK Biobank Eye and Vision Consortium*, GIGA study group*, 23 and Me Research Team*, Gen Tamiya38,39, Yukihiro Shiga40, Masayuki Yamamoto 38, Toru Nakazawa40,41,42,43, Hannah Currant 44, Ewan Birney 44, Xin Wang 45, Adam Auton45, Michelle K.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name EF-hand domain (C-terminal) containing 1 Gene Symbol EFHC1 Organism Human Gene Summary This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. Gene Aliases FLJ10466, FLJ37290, dJ304B14.2 RefSeq Accession No. NC_000006.11, NT_007592.15, NG_016760.1 UniGene ID Hs.403171 Ensembl Gene ID ENSG00000096093 Entrez Gene ID 114327 Assay Information Unique Assay ID qHsaCEP0049958 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000433625, ENST00000538167, ENST00000371068 Amplicon Context Sequence AGCCTGTTGTAGAAAATTCTGGAATCCTTCAAGGCAAGTTAATAAAACGCCAGCG GCTAGCCAAGAATGACCGGGGTGACCATTACCATTGGAAAGACCTAAATCGAGG AATAAACATC Amplicon Length (bp) 89 Chromosome Location 6:52303220-52303338 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9999 cDNA Cq 22.22 cDNA Tm (Celsius) 81.5 gDNA Cq 24.45 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report EFHC1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
    Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades.
    [Show full text]
  • Novel Gene Discovery in Primary Ciliary Dyskinesia
    Novel Gene Discovery in Primary Ciliary Dyskinesia Mahmoud Raafat Fassad Genetics and Genomic Medicine Programme Great Ormond Street Institute of Child Health University College London A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy University College London 1 Declaration I, Mahmoud Raafat Fassad, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Primary Ciliary Dyskinesia (PCD) is one of the ‘ciliopathies’, genetic disorders affecting either cilia structure or function. PCD is a rare recessive disease caused by defective motile cilia. Affected individuals manifest with neonatal respiratory distress, chronic wet cough, upper respiratory tract problems, progressive lung disease resulting in bronchiectasis, laterality problems including heart defects and adult infertility. Early diagnosis and management are essential for better respiratory disease prognosis. PCD is a highly genetically heterogeneous disorder with causal mutations identified in 36 genes that account for the disease in about 70% of PCD cases, suggesting that additional genes remain to be discovered. Targeted next generation sequencing was used for genetic screening of a cohort of patients with confirmed or suggestive PCD diagnosis. The use of multi-gene panel sequencing yielded a high diagnostic output (> 70%) with mutations identified in known PCD genes. Over half of these mutations were novel alleles, expanding the mutation spectrum in PCD genes. The inclusion of patients from various ethnic backgrounds revealed a striking impact of ethnicity on the composition of disease alleles uncovering a significant genetic stratification of PCD in different populations.
    [Show full text]
  • Evolutionary Proteomics Uncovers Ciliary Signaling Components 2 3 Monika Abedin Sigg1, Tabea Menchen2, Jeffery Johnson3, Chanjae Lee4, Semil P
    bioRxiv preprint doi: https://doi.org/10.1101/153437; this version posted June 22, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Evolutionary proteomics uncovers ciliary signaling components 2 3 Monika Abedin Sigg1, Tabea Menchen2, Jeffery Johnson3, Chanjae Lee4, Semil P. Choksi1, Galo 4 Garcia 3rd,1, Henriette Busengdal5, Gerard Dougherty2, Petra Pennekamp2, Claudius Werner2, 5 Fabian Rentzsch5, Nevan Krogan3,6, John B. Wallingford4, Heymut Omran2 and Jeremy F. 6 Reiter1* 7 8 Affiliations 9 1Department of Biochemistry and Biophysics, Cardiovascular Research Institute, University of 10 California, San Francisco, CA 94158, USA 11 2Department of General Pediatrics, University of Muenster, Muenster 48149, Germany 12 3Gladstone Institute of Cardiovascular Disease and Gladstone Institute of Virology and 13 Immunology, San Francisco, CA 94158, USA 14 4Department of Molecular Biosciences, Center for Systems and Synthetic Biology and Institute 15 for Cellular and Molecular Biology, University of Texas at Austin, Austin 78712, Texas 16 5Sars International Centre for Marine Molecular Biology, University of Bergen, Bergen 5008, 17 Norway 18 6Department of Cellular and Molecular Pharmacology, University of California, San Francisco, 19 CA 94158, USA 20 *Correspondence: [email protected] 21 22 1 bioRxiv preprint doi: https://doi.org/10.1101/153437; this version posted June 22, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 23 ABSTRACT 24 Cilia are organelles specialized for movement and signaling. To infer when during animal 25 evolution signaling pathways became associated with cilia, we characterized the proteomes of 26 cilia from three organisms: sea urchins, sea anemones and choanoflagellates.
    [Show full text]
  • Genomic Approach in Idiopathic Intellectual Disability Maria De Fátima E Costa Torres
    ESTUDOS DE 8 01 PDPGM 2 CICLO Genomic approach in idiopathic intellectual disability Maria de Fátima e Costa Torres D Autor. Maria de Fátima e Costa Torres D.ICBAS 2018 Genomic approach in idiopathic intellectual disability Genomic approach in idiopathic intellectual disability Maria de Fátima e Costa Torres SEDE ADMINISTRATIVA INSTITUTO DE CIÊNCIAS BIOMÉDICAS ABEL SALAZAR FACULDADE DE MEDICINA MARIA DE FÁTIMA E COSTA TORRES GENOMIC APPROACH IN IDIOPATHIC INTELLECTUAL DISABILITY Tese de Candidatura ao grau de Doutor em Patologia e Genética Molecular, submetida ao Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto Orientadora – Doutora Patrícia Espinheira de Sá Maciel Categoria – Professora Associada Afiliação – Escola de Medicina e Ciências da Saúde da Universidade do Minho Coorientadora – Doutora Maria da Purificação Valenzuela Sampaio Tavares Categoria – Professora Catedrática Afiliação – Faculdade de Medicina Dentária da Universidade do Porto Coorientadora – Doutora Filipa Abreu Gomes de Carvalho Categoria – Professora Auxiliar com Agregação Afiliação – Faculdade de Medicina da Universidade do Porto DECLARAÇÃO Dissertação/Tese Identificação do autor Nome completo _Maria de Fátima e Costa Torres_ N.º de identificação civil _07718822 N.º de estudante __ 198600524___ Email institucional [email protected] OU: [email protected] _ Email alternativo [email protected] _ Tlf/Tlm _918197020_ Ciclo de estudos (Mestrado/Doutoramento) _Patologia e Genética Molecular__ Faculdade/Instituto _Instituto de Ciências
    [Show full text]
  • Meta-Analysis Identifies Seven Susceptibility Loci Involved in the Atopic March
    ARTICLE Received 20 Jul 2015 | Accepted 6 Oct 2015 | Published 6 Nov 2015 DOI: 10.1038/ncomms9804 OPEN Meta-analysis identifies seven susceptibility loci involved in the atopic march Ingo Marenholz et al.# Eczema often precedes the development of asthma in a disease course called the ‘atopic march’. To unravel the genes underlying this characteristic pattern of allergic disease, we conduct a multi-stage genome-wide association study on infantile eczema followed by childhood asthma in 12 populations including 2,428 cases and 17,034 controls. Here we report two novel loci specific for the combined eczema plus asthma phenotype, which are associated with allergic disease for the first time; rs9357733 located in EFHC1 on chromo- some 6p12.3 (OR 1.27; P ¼ 2.1 Â 10 À 8) and rs993226 between TMTC2 and SLC6A15 on chromosome 12q21.3 (OR 1.58; P ¼ 5.3 Â 10 À 9). Additional susceptibility loci identified at genome-wide significance are FLG (1q21.3), IL4/KIF3A (5q31.1), AP5B1/OVOL1 (11q13.1), C11orf30/LRRC32 (11q13.5) and IKZF3 (17q21). We show that predominantly eczema loci increase the risk for the atopic march. Our findings suggest that eczema may play an important role in the development of asthma after eczema. Correspondence and requests for materials should be addressed to Y.A.L. (email: [email protected]). #A full list of authors and their affiliations appears at the end of the paper. NATURE COMMUNICATIONS | 6:8804 | DOI: 10.1038/ncomms9804 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9804 he atopic or allergic march describes the sequential located in the same region, we selected the best SNP per 1-Mb progression of different allergic conditions frequently window.
    [Show full text]