Contiguous Deletion of the NDP, MAOA, MAOB, and EFHC2 Genes in a Patient with Norrie Disease, Severe Psychomotor Retardation and Myoclonic Epilepsy

Total Page:16

File Type:pdf, Size:1020Kb

Contiguous Deletion of the NDP, MAOA, MAOB, and EFHC2 Genes in a Patient with Norrie Disease, Severe Psychomotor Retardation and Myoclonic Epilepsy ß 2007 Wiley-Liss, Inc. American Journal of Medical Genetics Part A 143A:916–920 (2007) Contiguous Deletion of the NDP, MAOA, MAOB, and EFHC2 Genes in a Patient With Norrie Disease, Severe Psychomotor Retardation and Myoclonic Epilepsy L. Rodriguez-Revenga,1,2 I. Madrigal,1,2 L.S. Alkhalidi,3 L. Armengol,4 E. Gonza´lez,4 C. Badenas,1,2 X. Estivill,1,5 and M. Mila`1,2* 1Biochemistry and Molecular Genetics Department, Hospital Clı´nic, Barcelona, Spain 2IDIBAPS (Institut d’Investigacions Biome`diques August Pi i Sunyer), Barcelona, Spain 3Department of Health and Medical Services, Rashid Hospital, Dubai, United Arab Emirates 4Genes and Disease Programme, Centre for Genomic Regulation (CRG), Barcelona Biomedical Research Park, Barcelona, Spain 5Department of Experimental and Health Sciences, Universitat Pompeu Fabra (UPF), Barcelona, Spain Received 20 February 2006; Accepted 7 September 2006 Norrie disease (ND) is an X-linked disorder, inherited as a Clinical features of the proband include bilateral retinal recessive trait that, therefore, mostly affects males. The gene detachment, microcephaly, severe psychomotor retardation responsible for ND, called NDP, maps to the short arm of without verbal language skills acquired, and epilepsy. The chromosome X (Xp11.4-p11.3). We report here an atypical identification and molecular characterization of this case case of ND, consisting of a patient harboring a large reinforces the idea of a new contiguous gene syndrome that submicroscopic deletion affecting not only the NDP gene would explain the complex phenotype shared by atypical but also the MAOA, MAOB, and EFHC2 genes. Microarray ND patients. ß 2007 Wiley-Liss, Inc. comparative genomic hybridization (CGH) analysis showed that 11 consecutive bacterial artificial chromosome (BAC) clones, mapping around the NDP gene, were deleted. These clones span a region of about 1 Mb on Xp11.3. The deletion Key words: microarray comparative genomic hybridiza- was ascertained by fluorescent in situ hybridization (FISH) tion; Norrie disease; NDP gene; MAOA and MAOB genes; analysis with different BAC clones located within the region. EFHC2 gene; contiguous gene syndrome How to cite this article: Rodriguez-Revenga L, Madrigal I, Alkhalidi LS, Armengol L, Gonza´lez E, Badenas C, Estivill X, Mila` M. 2007. Contiguous deletion of the NDP, MAOA, MAOB, and EFHC2 genes in a patient with Norrie disease, severe psychomotor retardation and myoclonic epilepsy. Am J Med Genet Part A 143A:916–920. INTRODUCTION time of clinical examination. ND is inherited as an X- linked recessive trait and therefore it mostly affects Norrie disease (ND, OMIM# 310600) is a rare males. The gene responsible for ND, named NDP inherited neurodevelopmental disorder of congeni- gene, maps to the short arm of chromosome X tal blindness that occurs early during embryogenesis (p11.4-p11.3) [Chen et al., 1992; Sims et al., 1992]. [Norrie, 1927; Warburg, 1971]. It is characterized by The function of the gene product is still unknown, bilateral and severe retinal malformations and although most observations are consistent with a opacity of the lens. In addition to ocular symptoms, primary role of norrin in vascular development and a certain portion of patients present mental dis- turbances, often with psychotic features, and/or sensorineural deafness. The hearing loss is progres- sive and recent evidence shows that its penetrance appears to be complete, although there is some Grant sponsor: ‘‘Fondo de Investigacio´n Sanitaria’’, Spain; Grant variability in the clinical severity and the age of onset numbers: PI050776, PI050159, FS041126, RGPG, (G03/184); Grant [Rehm et al., 2002]. Even though these symptoms are sponsor: Genome Spain. *Correspondence to: M. Mila`, Biochemistry and Molecular Genetics considered as classical in ND, the clinical diagnosis is Department, Hospital Clı´nic, C/Villarroel 170, 08036 Barcelona, Spain. often difficult, mainly because more than half of E-mail: [email protected] patients are neither deaf nor mentally delayed at the DOI 10.1002/ajmg.a.31521 American Journal of Medical Genetics Part A: DOI 10.1002/ajmg.a NORRIE DISEASE 917 proliferation [Shastry and Trese, 2003; Michaelides NDP gene was PCR amplified in different segments et al., 2004]. containing complete exon, acceptor, and donor Atypical ND patients harboring large DNA dele- splicing sites sequences. PCR conditions for each tions have also been reported. Those fewer patients, exon and the primer sequences used were as in addition to the retinal abnormalities, show other previously described by Meindl et al. [1992]. PCR clinical features, including microcephaly, growth amplification products were further sequenced on delay, severe to profound mental retardation, immu- an automated sequencer (ABI3100; Applied Biosys- nodeficiency, and epileptic seizures [Donnai et al., tems, Foster City, CA). 1988; Zhu et al., 1989; Suarez-Merino et al., 2001]. We report here on the clinical and molecular Microarray Comparative Genomic characterization of a new case of a large deletion of Hybridization (CGH) Xp11.4-p11.3, including the NDP gene. Genotype– phenotype correlation has allowed us to establish The tiling path X chromosome-specific array the cause of epilepsy that this patient shows. The consists >1,600 genomic bacterial artificial chromo- identification of this case reinforces the idea of a new some (BAC) clones derived from the X chromosome, contiguous gene syndrome that could explain the with an average density of one BAC every 100 kb on complex phenotype shared by these patients. the X chromosome, plus internal quality control BACs from autosomal chromosomes. All clones had three replicates on the array. The production of the CLINICAL REPORT X-array, probe preparation, and hybridization on The patient is a 7-year-old boy, who was born as the array were performed at the microarray unit of the second child of healthy unrelated parents. He the Center for Genomic Regulation (CRG). The set of was born at term after an uneventful pregnancy but at clones used to produce this array was purchased at 5 weeks of age he had to be taken into a hospital due the Children Hospital Oakland Research Institute to chest infection. At that time he was found to have (http://bacpac.chori.org/home.htm). DNA amplifi- bilateral yellowish reflex in both eyes. Retinal cation, spotting on the slides, and hybridization dysplasia was suggested as the diagnosis, and procedures had been published elsewhere [Fiegler another molecular laboratory confirmed ND after et al., 2003; Wang et al., 2004]. Test and control DNAs molecular analysis. The family reported a maternally were labeled by random priming using the BioPrime related nephew with similar clinical features. Patient Array CGH Genomic Labeling System (Invitrogen, was not seen again until 5 years when the family Life technologies, Carlsbad, CA). Dye swap was used visited a specialist seeking for genetic counseling to reduce false positives due to dye-related artifacts. since they were planning for a third child. Physical Two hybridization experiments were performed for examination at that age showed that the patient was each sample: in the forward experiment the array below the third centile for both height and weight was hybridized with a mixture of patient’s DNA (<3 SD), and that his head size could be considered labeled with Cy3-dCTP and the reference (control) as microcephalic. He was blind with whitish-yellow DNA labeled with Cy5-dCTP, while in the reverse retrolental masses that contained proliferated blood experiment patient’s DNA was labeled with Cy5- vessels, and he exhibited severe psychomotor dCTP and co-hybridized with reference (control) retardation without verbal language skills acquired. DNA labeled with Cy3-dCTP, to a second array. Neither hearing abnormalities nor other congenital Genomic imbalances were determined based on log2 findings were detected. At this time, brief seizures ratios of the average of their replicates, and were observed and antiepileptic treatment with sequences were considered as amplified or deleted valproic acid was started. Latest examinations when reported in the direct and reverse experiment revealed a normal MRI and a diffuse slow wave outside the Æ0.30 range. dysfunction without any epileptiform activity by EEG. No more seizures episodes had occurred after Fluorescent In Situ Hybridization (FISH) the antiepileptic treatment was initiated. Currently, Analysis the patient is regularly followed by pediatric and neuropediatric specialists due to severe psychomo- BAC/PAC clones located in the region identified as tor retardation, epilepsy, microcephaly, and blind- deleted by array CGH were purchased from the BAC/ ness. PAC Resources of the Children’s Hospital Oakland Research Institute (CHORI, Oakland, CA). The order of the probes according to the current mapping data MATERIAL AND METHODS is: centromere—RP1-95C20–RP1-27K14–RP6- Molecular Analysis 218J18–RP11-334D18—telomere. Clones were grown and DNA was extracted as manufacturer’s Genomic DNA samples were obtained from instructions. Afterwards, approximately 200 ng of peripheral blood of patient and his family. The each DNA sample were labeled with Spectrum American Journal of Medical Genetics Part A: DOI 10.1002/ajmg.a 918 RODRIGUEZ-REVENGA ET AL. Orange or Spectrum Green by nick translation (Vysis, Downers Grove, IL). Then 100 ng of each sample were precipitated with 5 mg of human cot-1 DNA (Vysis, Downers Grove, IL) and dissolved in 10 mLof hybridization buffer (Vysis, Downers Grove, IL). FISH using this solution as a probe was performed in a chromosome preparation from the patient and patient’s mother. Briefly, the slide was denatured by immersion in 70, 85, and 100% ethanol. The probe was also denatured at 738C for 5 min. After application of 10 ml of probe, the slide was incubated in a moist chamber for 16 hr at 378C. After hybridization, the slide was washed in 0.4 Â SSC at 728C during 2 min and 2 Â SSC at room temperature during 30 sec; chromosomal DNA was counter- stained with DAPI (Vysis, Downers Grove, IL).
Recommended publications
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Protein Localization Screening in Vivo Reveals Novel Regulators of Multiciliated Cell Development and Function Fan Tu1, Jakub Sedzinski1,2, Yun Ma1,3, Edward M
    © 2018. Published by The Company of Biologists Ltd | Journal of Cell Science (2018) 131, jcs206565. doi:10.1242/jcs.206565 SHORT REPORT Protein localization screening in vivo reveals novel regulators of multiciliated cell development and function Fan Tu1, Jakub Sedzinski1,2, Yun Ma1,3, Edward M. Marcotte1 and John B. Wallingford1,* ABSTRACT RESULTS AND DISCUSSION Multiciliated cells (MCCs) drive fluid flow in diverse tubular organs High-content screening of protein localization in MCCs in vivo and are essential for the development and homeostasis of the vertebrate central nervous system, airway and reproductive tracts. High-content screening of protein localization is a powerful These cells are characterized by dozens or hundreds of motile cilia approach for linking genomics to cell biology (Boutros et al., Xenopus that beat in a coordinated and polarized manner. In recent years, 2015), so we turned to embryos, where the epidermis genomic studies have not only elucidated the transcriptional develops as a mix of MCCs and mucus-secreting cells similar to in hierarchy for MCC specification but also identified myriad new the mammalian airway (Hayes et al., 2007; Walentek and Quigley, proteins that govern MCC ciliogenesis, cilia beating and cilia 2017; Werner and Mitchell, 2011). Molecular mechanisms of MCC Xenopus polarization. Interestingly, this burst of genomic data has also development and function are highly conserved between highlighted that proteins with no obvious role in cilia do, in fact, have and mammals, including humans (e.g. Boon et al., 2014; Toriyama important ciliary functions. Understanding the function of proteins et al., 2016; Wallmeier et al., 2014, 2016; Zariwala et al., 2013), and Xenopus with little prior history of study presents a special challenge, MCCs are very large and present on the external surface of especially when faced with large numbers of such proteins.
    [Show full text]
  • Genome-Wide Meta-Analysis Identifies 127 Open-Angle Glaucoma Loci with Consistent Effect Across Ancestries
    UC San Diego UC San Diego Previously Published Works Title Genome-wide meta-analysis identifies 127 open-angle glaucoma loci with consistent effect across ancestries. Permalink https://escholarship.org/uc/item/6fn1m7tr Journal Nature communications, 12(1) ISSN 2041-1723 Authors Gharahkhani, Puya Jorgenson, Eric Hysi, Pirro et al. Publication Date 2021-02-24 DOI 10.1038/s41467-020-20851-4 Peer reviewed eScholarship.org Powered by the California Digital Library University of California ARTICLE https://doi.org/10.1038/s41467-020-20851-4 OPEN Genome-wide meta-analysis identifies 127 open-angle glaucoma loci with consistent effect across ancestries ✉ Puya Gharahkhani 1,190 , Eric Jorgenson 2,190, Pirro Hysi 3,190, Anthony P. Khawaja 4,5,190, Sarah Pendergrass6,190, Xikun Han 1, Jue Sheng Ong 1, Alex W. Hewitt 7,8, Ayellet V. Segrè9, John M. Rouhana 9, Andrew R. Hamel9, Robert P. Igo Jr 10, Helene Choquet 2, Ayub Qassim11, Navya S. Josyula 12, Jessica N. Cooke Bailey 10,13, Pieter W. M. Bonnemaijer 14,15,16, Adriana Iglesias 14,15,17, Owen M. Siggs 11, Terri L. Young 18, Veronique Vitart 19, 1234567890():,; Alberta A. H. J. Thiadens 14,15, Juha Karjalainen20,21,22, Steffen Uebe23, Ronald B. Melles24, K. Saidas Nair25, Robert Luben 5, Mark Simcoe 3,26,27, Nishani Amersinghe28, Angela J. Cree 29, Rene Hohn30,31, Alicia Poplawski 32, Li Jia Chen33, Shi-Song Rong 9,33, Tin Aung34,35,36, Eranga Nishanthie Vithana 34,37, NEIGHBORHOOD consortium*, ANZRAG consortium*, Biobank Japan project*, FinnGen study*, UK Biobank Eye and Vision Consortium*, GIGA study group*, 23 and Me Research Team*, Gen Tamiya38,39, Yukihiro Shiga40, Masayuki Yamamoto 38, Toru Nakazawa40,41,42,43, Hannah Currant 44, Ewan Birney 44, Xin Wang 45, Adam Auton45, Michelle K.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name EF-hand domain (C-terminal) containing 1 Gene Symbol EFHC1 Organism Human Gene Summary This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. Gene Aliases FLJ10466, FLJ37290, dJ304B14.2 RefSeq Accession No. NC_000006.11, NT_007592.15, NG_016760.1 UniGene ID Hs.403171 Ensembl Gene ID ENSG00000096093 Entrez Gene ID 114327 Assay Information Unique Assay ID qHsaCEP0049958 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000433625, ENST00000538167, ENST00000371068 Amplicon Context Sequence AGCCTGTTGTAGAAAATTCTGGAATCCTTCAAGGCAAGTTAATAAAACGCCAGCG GCTAGCCAAGAATGACCGGGGTGACCATTACCATTGGAAAGACCTAAATCGAGG AATAAACATC Amplicon Length (bp) 89 Chromosome Location 6:52303220-52303338 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9999 cDNA Cq 22.22 cDNA Tm (Celsius) 81.5 gDNA Cq 24.45 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report EFHC1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
    Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades.
    [Show full text]
  • Novel Gene Discovery in Primary Ciliary Dyskinesia
    Novel Gene Discovery in Primary Ciliary Dyskinesia Mahmoud Raafat Fassad Genetics and Genomic Medicine Programme Great Ormond Street Institute of Child Health University College London A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy University College London 1 Declaration I, Mahmoud Raafat Fassad, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Primary Ciliary Dyskinesia (PCD) is one of the ‘ciliopathies’, genetic disorders affecting either cilia structure or function. PCD is a rare recessive disease caused by defective motile cilia. Affected individuals manifest with neonatal respiratory distress, chronic wet cough, upper respiratory tract problems, progressive lung disease resulting in bronchiectasis, laterality problems including heart defects and adult infertility. Early diagnosis and management are essential for better respiratory disease prognosis. PCD is a highly genetically heterogeneous disorder with causal mutations identified in 36 genes that account for the disease in about 70% of PCD cases, suggesting that additional genes remain to be discovered. Targeted next generation sequencing was used for genetic screening of a cohort of patients with confirmed or suggestive PCD diagnosis. The use of multi-gene panel sequencing yielded a high diagnostic output (> 70%) with mutations identified in known PCD genes. Over half of these mutations were novel alleles, expanding the mutation spectrum in PCD genes. The inclusion of patients from various ethnic backgrounds revealed a striking impact of ethnicity on the composition of disease alleles uncovering a significant genetic stratification of PCD in different populations.
    [Show full text]
  • Evolutionary Proteomics Uncovers Ciliary Signaling Components 2 3 Monika Abedin Sigg1, Tabea Menchen2, Jeffery Johnson3, Chanjae Lee4, Semil P
    bioRxiv preprint doi: https://doi.org/10.1101/153437; this version posted June 22, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Evolutionary proteomics uncovers ciliary signaling components 2 3 Monika Abedin Sigg1, Tabea Menchen2, Jeffery Johnson3, Chanjae Lee4, Semil P. Choksi1, Galo 4 Garcia 3rd,1, Henriette Busengdal5, Gerard Dougherty2, Petra Pennekamp2, Claudius Werner2, 5 Fabian Rentzsch5, Nevan Krogan3,6, John B. Wallingford4, Heymut Omran2 and Jeremy F. 6 Reiter1* 7 8 Affiliations 9 1Department of Biochemistry and Biophysics, Cardiovascular Research Institute, University of 10 California, San Francisco, CA 94158, USA 11 2Department of General Pediatrics, University of Muenster, Muenster 48149, Germany 12 3Gladstone Institute of Cardiovascular Disease and Gladstone Institute of Virology and 13 Immunology, San Francisco, CA 94158, USA 14 4Department of Molecular Biosciences, Center for Systems and Synthetic Biology and Institute 15 for Cellular and Molecular Biology, University of Texas at Austin, Austin 78712, Texas 16 5Sars International Centre for Marine Molecular Biology, University of Bergen, Bergen 5008, 17 Norway 18 6Department of Cellular and Molecular Pharmacology, University of California, San Francisco, 19 CA 94158, USA 20 *Correspondence: [email protected] 21 22 1 bioRxiv preprint doi: https://doi.org/10.1101/153437; this version posted June 22, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 23 ABSTRACT 24 Cilia are organelles specialized for movement and signaling. To infer when during animal 25 evolution signaling pathways became associated with cilia, we characterized the proteomes of 26 cilia from three organisms: sea urchins, sea anemones and choanoflagellates.
    [Show full text]
  • Genomic Approach in Idiopathic Intellectual Disability Maria De Fátima E Costa Torres
    ESTUDOS DE 8 01 PDPGM 2 CICLO Genomic approach in idiopathic intellectual disability Maria de Fátima e Costa Torres D Autor. Maria de Fátima e Costa Torres D.ICBAS 2018 Genomic approach in idiopathic intellectual disability Genomic approach in idiopathic intellectual disability Maria de Fátima e Costa Torres SEDE ADMINISTRATIVA INSTITUTO DE CIÊNCIAS BIOMÉDICAS ABEL SALAZAR FACULDADE DE MEDICINA MARIA DE FÁTIMA E COSTA TORRES GENOMIC APPROACH IN IDIOPATHIC INTELLECTUAL DISABILITY Tese de Candidatura ao grau de Doutor em Patologia e Genética Molecular, submetida ao Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto Orientadora – Doutora Patrícia Espinheira de Sá Maciel Categoria – Professora Associada Afiliação – Escola de Medicina e Ciências da Saúde da Universidade do Minho Coorientadora – Doutora Maria da Purificação Valenzuela Sampaio Tavares Categoria – Professora Catedrática Afiliação – Faculdade de Medicina Dentária da Universidade do Porto Coorientadora – Doutora Filipa Abreu Gomes de Carvalho Categoria – Professora Auxiliar com Agregação Afiliação – Faculdade de Medicina da Universidade do Porto DECLARAÇÃO Dissertação/Tese Identificação do autor Nome completo _Maria de Fátima e Costa Torres_ N.º de identificação civil _07718822 N.º de estudante __ 198600524___ Email institucional [email protected] OU: [email protected] _ Email alternativo [email protected] _ Tlf/Tlm _918197020_ Ciclo de estudos (Mestrado/Doutoramento) _Patologia e Genética Molecular__ Faculdade/Instituto _Instituto de Ciências
    [Show full text]
  • Meta-Analysis Identifies Seven Susceptibility Loci Involved in the Atopic March
    ARTICLE Received 20 Jul 2015 | Accepted 6 Oct 2015 | Published 6 Nov 2015 DOI: 10.1038/ncomms9804 OPEN Meta-analysis identifies seven susceptibility loci involved in the atopic march Ingo Marenholz et al.# Eczema often precedes the development of asthma in a disease course called the ‘atopic march’. To unravel the genes underlying this characteristic pattern of allergic disease, we conduct a multi-stage genome-wide association study on infantile eczema followed by childhood asthma in 12 populations including 2,428 cases and 17,034 controls. Here we report two novel loci specific for the combined eczema plus asthma phenotype, which are associated with allergic disease for the first time; rs9357733 located in EFHC1 on chromo- some 6p12.3 (OR 1.27; P ¼ 2.1 Â 10 À 8) and rs993226 between TMTC2 and SLC6A15 on chromosome 12q21.3 (OR 1.58; P ¼ 5.3 Â 10 À 9). Additional susceptibility loci identified at genome-wide significance are FLG (1q21.3), IL4/KIF3A (5q31.1), AP5B1/OVOL1 (11q13.1), C11orf30/LRRC32 (11q13.5) and IKZF3 (17q21). We show that predominantly eczema loci increase the risk for the atopic march. Our findings suggest that eczema may play an important role in the development of asthma after eczema. Correspondence and requests for materials should be addressed to Y.A.L. (email: [email protected]). #A full list of authors and their affiliations appears at the end of the paper. NATURE COMMUNICATIONS | 6:8804 | DOI: 10.1038/ncomms9804 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9804 he atopic or allergic march describes the sequential located in the same region, we selected the best SNP per 1-Mb progression of different allergic conditions frequently window.
    [Show full text]
  • Novel Myoclonin1/EFHC1 Mutations in Mexican Patients with Juvenile
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Seizure 21 (2012) 550–554 Contents lists available at SciVerse ScienceDirect Seizure jou rnal homepage: www.elsevier.com/locate/yseiz Short communication Novel Myoclonin1/EFHC1 mutations in Mexican patients with juvenile myoclonic epilepsy a b a a Aurelio Jara-Prado , Iris E. Martı´nez-Jua´rez , Adriana Ochoa , Vı´ctor M. Gonza´lez , c d e Marı´a del Carmen Ferna´ndez-Gonza´lez-Arago´ n , Minerva Lo´ pez-Ruiz , Marco T. Medina , f f a, Julia N. Bailey , Antonio V. Delgado-Escueta , Marı´a Elisa Alonso * a Neurogenetics and Molecular Biology Department, National Institute of Neurology and Neurosurgery of Mexico, Insurgentes Sur 3877, Col. La Fama, Tlalpan, Me´xico D.F. 14269, Mexico b Epilepsy Clinic, National Institute of Neurology and Neurosurgery of Mexico, Insurgentes Sur 3877, Col. La Fama, Tlalpan, Me´xico D.F. 14269, Mexico c Clinical Neurophysiology Department, National Institute of Neurology and Neurosurgery of Mexico, Insurgentes Sur 3877, Col. La Fama, Tlalpan, Me´xico D.F. 14269, Mexico d Neurology and Neurosurgery Unit, Mexico General Hospital, Dr. Balmis 161, Col. Doctores, Mexico D.F, Mexico e National Autonomous University of Honduras, Tegucigalpa, Honduras f Epilepsy Genetics/Genomics Laboratories and Epilepsy Center of Excellence, Neurology and Research Services, VA GLAHS and David Geffen School of Medicine at UCLA, Los Angeles, CA 90073, USA A R T I C L E I N F O A B S T R A C T Article history: Purpose: The purpose of this study was to identify the prevalence of mutations in the Myoclonin1/EFHC1 Received 1 February 2012 gene in Mexican patients with juvenile myoclonic epilepsy (JME).
    [Show full text]