Identification Et Régulation Transcriptionnelle Des Gènes

Home , Esaxerenone

Identification et Régulation 277 Transcriptionnelle des Gènes Cibles du Récepteur Minéralocorticoïde dans les Cellules Rénales : 2017SACLS

NNT Thèse de doctorat de l'Université Paris-Saclay préparée à l’Université Paris-Sud

École doctorale n°568 Signalisation et Réseaux Intégratifs en Biologie (Biosigne) Spécialité de doctorat : Aspects Moléculaires et Cellulaires de la Biologie

Thèse présentée et soutenue à Le Kremlin-Bicêtre, le 6 Octobre 2017, par

Florian LE BILLAN

Composition du Jury :

Madame la Dr Pascale CHAVATTE-PALMER DR INRA-ENVA, INRA Jouy-en-Josas Président Madame la Dr Morgane THOMAS-CHOLLIER MCU, École Normale Supérieure de Paris Rapporteur Monsieur le Dr Antoine OUVRARD-PASCAUD MCU, Université de Rouen Rapporteur Monsieur le Dr Vincent CAVAILLÈS DR Inserm, Université de Montpellier Examinateur Monsieur le Dr Marc LOMBÈS DR Inserm, Université Paris-Sud Directeur de thèse Monsieur le Dr Jérôme FAGART CR Inserm, Université Paris-Sud Co-Directeur de thèse

Identification et Régulation 277 Transcriptionnelle des Gènes Cibles du Récepteur Minéralocorticoïde dans les Cellules Rénales : 2017SACLS

NNT Thèse de doctorat de l'Université Paris-Saclay préparée à l’Université Paris-Sud

École doctorale n°568 Signalisation et Réseaux Intégratifs en Biologie (Biosigne) Spécialité de doctorat : Aspects Moléculaires et Cellulaires de la Biologie

Thèse présentée et soutenue à Le Kremlin-Bicêtre, le 6 Octobre 2017, par

Florian LE BILLAN

Composition du Jury :

Remerciements

Ce travail de Thèse a été rendu possible grâce à la participation et au soutien de nombreuses personnes que je tenais à remercier ici.

Je remercie les membres du jury d’avoir accepté d’évaluer mon travail de Thèse :

Madame le Docteur Morgane Thomas-Chollier et monsieur le Docteur Antoine Ouvrard- Pascaud, je vous remercie plus particulièrement d’avoir pris le temps de lire mon manuscrit de Thèse, d’avoir évalué mon travail, et d’avoir partagé avec moi vos impressions et remarques.

Madame le Docteur Pascale Chavatte-Palmer, je vous remercie de m’avoir fait l’honneur de présider mon jury de Thèse.

Monsieur le Docteur Vincent Cavaillès, je vous remercie de m’avoir fait l’honneur d’être membre du jury en tant qu’examinateur.

Je remercie monsieur le Docteur Laurent Sachs d’avoir suivi et soutenu ce projet au cours du Master et du Doctorat, notamment en y participant en tant qu’expert, au jury du comité de mi- parcours de Thèse. Je remercie également madame le Docteur Joëlle Cohen-Tannoudji d’avoir assumé le rôle de tutrice de Thèse. Vos conseils et suggestions m’ont été précieux.

J’adresse ma plus profonde reconnaissance et mes plus sincères remerciements à mes Directeurs de Thèse, Marc et Jérôme.

Marc, je te remercie de m’avoir accueilli dans ton équipe pour un stage de 1ère année de Master, et de m’avoir depuis permis de découvrir et d’intégrer le monde de la recherche scientifique. Je te remercie de m’avoir fait confiance en me proposant ce projet de Thèse et de m’avoir permis de le défendre au cours de congrès, notamment. J’admire le passionnant projet que tu as développé et la façon dont tu le mènes en t’entourant d’une solide et joyeuse équipe, et je te suis reconnaissant de m’avoir permis d’y apporter ma contribution. Je te remercie enfin pour tes conseils justes et avisés, ton encadrement constructif et bienveillant, ton soutien infaillible, pour tout le temps que tu m’as accordé, et pour le partage de ton immense savoir scientifique, théorique et pratique.

Jérôme, je te remercie d’abord de m’avoir pris sous ton aile pour pouvoir poursuivre ce projet. Je te remercie pour ton encadrement quotidien impeccable, pour les moments inoubliables passés en L2 ou en chambre froide, pour nos conversations scientifiques très instructives et constructives, et pour tout ce que tu as fait pour ce manuscrit. Je te remercie surtout pour tes conseils et nos conversations plus personnelles qui ont contribué à construire notre belle complicité. Je ne saurais assez te remercier pour ton soutien constant et enthousiaste, et pour la confiance que tu m’as accordée.

Junaid, je te remercie de m’avoir choisi pour t’accompagner dans le développement des expériences de ChIP, et de m’avoir appris une grande partie des approches que je maitrise aujourd’hui. C’est en partie grâce à toi que je suis entré dans l’Unité, et je t’en suis grandement reconnaissant. Je te remercie pour ta gentillesse, ta rigueur, ta patience et ton enthousiasme. Ce projet était aussi le tien, et j’espère que tu es fier de voir où je l’ai emmené.

Je remercie chaleureusement l’ensemble des membres de l’Unité 1185 qui participent, chacun à leur manière, à la convivialité, à l’entraide et à l’ambiance de travail exceptionnelle qui y règne au quotidien.

Say, tu es un des piliers centraux du laboratoire et ta présence a été indispensable à la bonne conduite de ce projet. Je te remercie pour ton aide quotidienne pour des conseils techniques, scientifiques, administratifs et personnels. En particulier, je te suis reconnaissant de m’avoir appris, avec rigueur, la culture cellulaire et la PCR quantitative, entre autres, mais aussi pour ta présence amicale à San Diego, ou encore ton aide pour mon ameublement. Je te remercie pour ta disponibilité et ton écoute qui m’ont été indispensables. Ton dévouement aux autres et à la science est pour moi exemplaire.

Larbi, je te remercie pour ta grande générosité et ton énergie communicative. Je te remercie de m’avoir appris la microscopie à fluorescence et fait bénéficier de ton expertise en HTM, ce qui nous aura permis de réaliser deux beaux projets. Je te remercie pour nos conversations toujours intéressantes, tes conseils, scientifiques ou non, qui m’ont beaucoup aidé, et d’avoir partagé avec moi un pêché assumé : la gourmandise.

Khadija, je te remercie pour ta gentillesse et pour le travail d’équipe que nous avons mené à bien, notamment grâce à ton énergie et à ta patience. Je repense à nos longs moments en L2 ou face à un certain sonicateur : ils ont été supportables grâce à ta bonne humeur et à nos rires.

Damien, je te remercie pour ta gentillesse, ta disponibilité et ton aide, et pour toujours savoir partager ton expérience et animer les discussions. Et oui, ramener du fromage aux pots est une très bonne idée !

Stéphanie, je te remercie pour tes nombreux conseils judicieux, de m’avoir guidé en partageant ta propre expérience et pour ta gentillesse.

Jérôme B, je te remercie de nous avoir aidés dans l’analyse bioinformatique des données de ChIP-Seq, avec Florian Nadal et Christophe Habib, et d’avoir toujours essayé de répondre aux questions que nous avions.

Françoise, je te remercie pour ta gentillesse et ton naturel. Je te remercie aussi pour tes conseils, les services que tu m’as rendus et pour m’avoir fait découvrir de très bonnes musiques !

Géraldine, Mirella, Laurence, Thi An et Mohsen, je vous remercie pour votre grande gentillesse, votre bonne humeur quotidienne, votre générosité et votre amitié ! J’ai été heureux de partager mon passage dans l’Unité avec vous, je vous souhaite le meilleur pour la suite et fin de votre Thèse, j’ai confiance en vous !

Ingrid, je te suis reconnaissant pour tous les conseils que tu m’as donnés et tous les services rendus ! Suivre ton chemin au cours du Doctorat m’a permis de moins en appréhender les différentes épreuves. Je te remercie pour ta générosité et ton intégrité. Nathalie E, je te remercie pour ton énergie et ta spontanéité. J’ai été content de t’apprendre la technique de ChIP, certaines expressions françaises et de t’avoir eu comme copine de buffet !

Nadine, je te remercie pour tes nombreux conseils avisés et ta bienveillance. C’était un honneur de t’avoir comme marraine à la SFE !

Isabelle, je te remercie pour ta gentillesse, tes conseils et pour nos sympathiques covoiturages !

Justine, tu as été un exemple pour moi pour ta gentillesse, ta bienveillance, ton sens de l’organisation, ton sérieux et ta générosité ! Je te remercie de m’avoir montré toutes les astuces à connaitre pour un Western blot notamment, de m’avoir donné de bons conseils et de m’avoir aidé même une fois partie !

Valérie, je te remercie pour ta bonne humeur communicative ! C’était un plaisir de partager l’expérience du Doctorat avec toi, et le chocolat, et de pouvoir s’entraider !

Hui, 我很高兴认识你，并且和你分享这几年！我希望你对法国的访问会让你幸福回忆，祝你未来最好！

Charlotte, je te remercie pour ta gentillesse et je te passe un double flambeau : tu es la prochaine à aller vivre à Antony, et surtout la prochaine à soutenir ! Même si je ne me fais pas de soucis pour toi, je te souhaite beaucoup de succès !

Laura, Clémence, Geoffrey, Paul, Nelly, Sophie, Vianney, Florent, Justine VdW, Adrien et Sara, c’était un plaisir de vous rencontrer et de partager votre passage au sein de l’Unité ! Je vous remercie tous pour votre gentillesse ! Mention spéciale pour Laura, ma copine de chocolat, pour Justine VdW et Adrien et leur don incontestable pour la cuisine, pour Nelly et Sophie pour leur diaporama de départ inoubliable, et pour Sara ma souriante camarade de master !

Christophe, je te remercie pour ton aide, ta sympathie et de m’avoir fait découvrir le Coq&Co !

Leïla, je te remercie chaleureusement pour ta grande gentillesse, ta bonne humeur, ton soutien et tes conseils.

Dilek, Qiong-Yao et Alexis, je vous remercie pour votre gentillesse, votre énergie et votre aide pour le sonicateur Covartis, le Bioanalyzer, le Qubit, et les dosages en LC-MS/MS.

Pr Anne Guiochon-Mantel, je vous suis reconnaissant de m’avoir permis de suivre le master Endocrinologie et Métabolisme, et de m’avoir soutenu au concours de l’ED.

Je remercie vivement ceux qui ont contribué et contribuent encore aujourd’hui à faire vivre ce laboratoire : Laëtitia, Lavinia que je remercie d’avoir gentiment accepté de partager son bureau, Cindy, Vixra, Jérôme N, Séverine, Claudia, Ségolène, Bruno, Luc, Simon, Anaïs, Mélanie N, Esther, Meriem, Éric, Peter, Jacques et Philippe. Je tiens à remercier les collaborateurs qui ont contribué à ce projet ou à d’autres :

Claudine Delomenie, je te remercie d’avoir pris le temps de nous former, Jérôme et moi, au logiciel IPA. Dr. Peter Kolkhof, I thank you for the collaboration you built with our lab and I was pleased to participate to this exciting project concerning the Finerenone. Gaëlle Auguste et Jessica Sabourin, je vous remercie pour le temps passé à préparer les CVRN, pour votre aide pour les expériences de ChIP, pour votre implication dans l’avancée du projet Calsignaldo, mais aussi pour votre gentillesse. Ly Tu, Christophe Guignabert et Alice Huertas, je vous remercie pour la préparation des CML, et je suis heureux de participer au passionnant projet Tamirah. J’espère que je pourrais encore suivre, même de loin, son avancée qui a l’air prometteuse. Je remercie enfin François Guillonneau et la Plateforme 3P5 de l’Université Paris-Descartes pour les expériences d’APMS ; Sophie Lemoine et Juliette Pouch du Genomic Paris Centre de l’ENS Ulm pour leur collaboration fructueuse au projet ChIP-Seq sur les cellules HK-GFP-MR ; l’équipe du Dr Claude Thermes de la Plateforme I2BC de l’Université Paris-Sud pour leur collaboration et leur implication dans le projet de séquençage des CML.

Je souhaite remercier ici mes Professeurs de lycée, de prépa, de fac, qui m’ont donné envie de donner le meilleur de moi-même, de continuer dans le domaine de la biologie, de l’endocrinologie et la recherche, ou qui m’ont encouragé à adopter un raisonnement scientifique rigoureux. Tous les noms ne me reviennent pas en mémoire, mais je peux nommer et remercier Hélène Cordoliani, Stéphane Premier, Philippe Canadas, Pr Cazaubon, Christian Plas, Sophie Warin, Patrick Kohl, Anne Roux, Mohammed Taouis et Claire-Marie Vacher.

Je remercie avec une profonde affection mes amis qui m’ont soutenu avant et pendant ma Thèse et qui ont su être présents durant toutes ces années. Votre amitié m’est indispensable et je ne saurais vous dire tout ce que vous m’apportez. Sans vous nommer tous, je pense évidemment à Claire, Elodie, Elise, Vincent, Allison, Chloé, Winchy et Joffrey, Elodie R et Vincent L, Victor et Floriane, Kévin, Sandra et Philippe, Hélène et François.

Je remercie du fond du cœur ma famille pour tout le soutien et l’amour qu’elle m’apporte au quotidien. Maman et Papa, je vous dois d’en être arrivé là, et je vous dois tant d’autres choses ! Je vous suis profondément reconnaissant et j’espère vous le montrer toute notre vie, notamment au travers de ce Doctorat. Antony et Sarah, je ne saurais vous remercier assez pour votre soutien et votre affection indispensables ! Le quatuor que nous formons est formidable et magique. Linda, Marilyn, Yohan, Carletta, Padou, Naomie et Ludo, vous êtes une belle-famille merveilleuse, votre présence et votre soutien me sont nécessaires et vous les assurez très bien au quotidien ! Pépé et Mémé, ma chère tata Sylvie, tonton Alain et tata Nath, Jimy, Daniel, je vous remercie pour votre soutien et pour votre affection qui me sont essentiels !

Aurélie, ma Femme, je te dédie cet accomplissement. Même si ta participation est indirecte, il t’appartient de par ton soutien infaillible, tes encouragements quotidiens et ton envie de me pousser à donner le meilleur de moi-même ! To koné ki sans toi la vie pas serié. Mo mari contan toi mo fiancée ! Publications présentées dans cette thèse

Article 1

Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells. Florian Le Billan, Junaid A. Khan, Khadija Lamribet, Say Viengchareun, Jérôme Bouligand, Jérôme Fagart*, Marc Lombès*. FASEB J. 2015 Sep; 29 (9): 3977-89. *Ces auteurs ont contribué de façon équivalente.

Article 2

Finerenone impedes aldosterone-dependent nuclear import of the mineralocorticoid receptor and prevents genomic recruitment of steroid receptor coactivator-1. Florian Le Billan*, Larbi Amazit*, Peter Kolkhof, Khadija Lamribet, Say Viengchareun, Michel R. Fay, Junaid Ali Khan, Alexander Hillisch, Marc Lombès, Marie-Edith Rafestin-Oblin, Jérôme Fagart. J Biol Chem. 2015 Sep 4; 290 (36): 21876-89. *Ces auteurs ont contribué de façon équivalente.

Article 3

Differential dynamic kinetics of Mineralocorticoid and Glucocorticoid Receptors genomic interaction. Florian Le Billan, Larbi Amazit, Qiong-Yao Xue, Christophe Lhadj, Eric Pussard, Peter Kolkhof, Say Viengchareun, Jérôme Fagart*, Marc Lombès*. Manuscrit en cours de préparation. 2017. *Ces auteurs ont contribué de façon équivalente.

Publications présentées en Annexes

Article 4

Ulipristal Acetate Inhibits Progesterone Receptor Isoform A-Mediated Human Breast Cancer Proliferation and BCl2-L1 Expression. Nathalie Esber, Florian Le Billan, Michèle Resche-Rigon, Hugues Loosfelt, Marc Lombès, Nathalie Chabbert-Buffet. PLoS One. 2015 Oct 16; 10 (10): e0140795.

Article 5

Three Novel Heterozygous Point Mutations of NR3C1 Causing Glucocorticoid Resistance. Géraldine Vitellius, Jérôme Fagart, Brigitte Delemer, Larbi Amazit, Nelly Ramos, Jérôme Bouligand, Florian Le Billan, Frédéric Castinetti, Anne Guiochon-Mantel, Séverine Trabado*, Marc Lombès*. Hum Mutat. 2016 Aug; 37 (8): 794-803. *Ces auteurs ont contribué de façon équivalente. Communications Orales

2016

Identification and Transcriptional Regulation of the Mineralocorticoid Receptor Target Genes in the Cardiorenal System. Florian Le Billan, Junaid Ali Khan, Larbi Amazit, Khadija Lamribet, Say Viengchareun, Jérôme Fagart, Marc Lombès. COST ADMIRE Masterclass “Co‐morbidity of Affective, Metabolic and Cardiovascular Disease: a Crucial Role of the Mineralocorticoid Receptor”, Amsterdam, Pays-Bas, 7 October 2016.

2015

Identification of the Mineralocorticoid Receptor Genomic Targets (Cistrome): Implication in the Transcriptional Regulation of the Aldosterone-Regulated Genes. Florian Le Billan, Junaid Ali Khan, Khadija Lamribet, Say Viengchareun, Jérôme Bouligand, Jérôme Fagart, Marc Lombès. 32ème Congrès de la Société Française d’Endocrinologie, Angers, France, 7-10 Octobre 2015. Award: Award SFE-Novartis 2015 pour la Meilleure Communication Orale.

First Identification of the Mineralocorticoid Receptor Cistrome in Human Renal Cells. Florian Le Billan, Junaid Ali Khan, Khadija Lamribet, Say Viengchareun, Jérôme Bouligand, Jérôme Fagart, Marc Lombès. 5ème Journée des Récepteurs Nucléaires, Clermont-Ferrand, France, 5 Juin 2015.

Identification and Transcriptional Regulation of the Mineralocorticoid Receptor Target Genes. Florian Le Billan, Junaid Ali Khan, Khadija Lamribet, Say Viengchareun, Jérôme Fagart, Marc Lombès. 97th Endocrine Society Annual Meeting, San Diego (CA), USA, 5-8 Mars 2015.

Communications sous forme de poster

2016

The New Nonsteroidal Antagonist Finerenone Impedes Three Critical Steps of the Mineralocorticoid Receptor Signaling Pathway. Florian Le Billan, Larbi Amazit, Peter Kolkhof, Khadija Lamribet, Say Viengchareun, Junaid Ali Khan, Marc Lombès, Jérôme Fagart. Journée de l’Ecole Doctorale Biosigne, Faculté de Médecine, Université Paris Sud, Le Kremlin- Bicêtre, France, 3 Novembre 2016.

2015

Identification and Transcriptional Regulation of the Mineralocorticoid Receptor Target Genes in Human Renal Cells. Florian Le Billan, Junaid Ali Khan, Khadija Lamribet, Say Viengchareun, Jérôme Bouligand, Jérôme Fagart, Marc Lombès. FEBS Advanced Lecture Courses, “Nuclear Receptor Signaling in Physiology and Disease”, Summer School, Spetses, Greece, 23-28 Août 2015.

Table des Matières

Table des matières Table des Illustrations 1 Liste des abréviations 2 Avant-propos 4

INTRODUCTION 7

I. Physiologie de la signalisation minéralocorticoïde 7 A. Le récepteur minéralocorticoïde 7 1. La protéine MR, interface entre ligand, ADN et partenaires transcriptionnels 7 a) Le domaine N-terminal 8 b) Le domaine de liaison à l’ADN 9 c) La région charnière 10 d) Le domaine de liaison au ligand 11 2. Le gène NR3C2 13 3. Expression du MR 14 4. Expression diphasique du MR au cours du développement chez l’Homme 17 5. Régulations post-transcriptionnelles et post-traductionnelles de l’expression du MR 19 a) Régulations post-transcriptionnelles 19 b) Régulations post-traductionnelles 21 B. Les hormones minéralocorticoïdes : lieu de synthèse, régulation et sécrétion 23 1. L’aldostérone 25 2. Autres hormones minéralocorticoïdes naturelles 27 C. Fonctions physiologiques régulées par la signalisation minéralocorticoïde 28 D. Les mécanismes d'action du MR dans la signalisation minéralocorticoïde 30 1. La voie génomique 31 a) Activation du MR lié au complexe chaperon et translocation nucléaire 32 b) Interaction avec les cibles génomiques 32 c) Les corégulateurs transcriptionnels du MR 35 (1) Les coactivateurs du MR 35 (2) Les corépresseurs du MR 40 d) Extinction du signal et adressage au protéasome 42 2. Voies non génomiques 42 E. Les gènes cibles du MR 43

Table des Matières

II. Physiopathologie de l’Aldostérone et du MR 50 A. Invalidations et sous-expressions du MR 50 1. Modèles animaux 50 2. Pseudohypoaldostéronisme de type 1 et mutations du gène NR3C2 51 B. Suractivation de la signalisation minéralocorticoïde et pathologies 53 1. Modèles murins de surexpression du MR 53 2. Stratégies d’interférence du MR 54 3. Une mutation activatrice du MR chez l’Homme 55 4. Hyperaldostéronisme 56 5. MR et inflammation dans les fibroses cardiaques et rénales 57 6. MR et maladies métaboliques 58 C. Les antiminéralocorticoïdes 59 1. La spironolactone, première génération d’antiminéralocorticoïde 59 2. L’éplérénone, seconde génération d’antiminéralocorticoïde sélectif 61 3. La nouvelle génération de MRA est non-stéroïdienne 62 a) Le BR-4628 63 b) BAY 94-8862 ou la finérénone 64 c) CS-3150 ou l’esaxérénone 65

III. Sélectivité de la voie minéralocorticoïde et dynamique des complexes transcriptionnels 67 A. Dualité entre les voies minéralocorticoïdes et glucocorticoïdes 67 1. Sélectivité intrinsèque du MR pour l'aldostérone 68 a) Activité de transactivation du MR en réponse à l'aldostérone et aux corticostéroïdes 68 b) Mode de liaison de l'aldostérone et du cortisol dans le LBD du MR 69 2. Dualités de récepteurs homologues MR et GR 70 a) Données structurales 70 b) Récepteur ancestral 71 3. Sélectivité d’interactions avec les partenaires transcriptionnels et les chaperons 72 a) Corégulateurs transcriptionnels spécifiques du MR 72 b) Corégulateurs transcriptionnels sélectifs du MR ou du GR 73 c) Interactions sélectives dans le cytoplasme 75 4. Les structures quaternaires du MR et du GR 75

Table des Matières

B. Sélectivité et dynamique de la machinerie transcriptionnelle 77 1. Conformation de l’ADN, éléments de réponse et recrutement du MR 77 a) L’ADN, acteur dans le recrutement des transrégulateurs 77 b) La séquence des GRE dans la régulation gène-spécifique 78 2. Le recrutement du MR et de ses corégulateurs transcriptionnels est dynamique 79

OBJECTIFS 82

RESULTATS 86

1ère Partie : Identification et caractérisation du premier cistrome du récepteur minéralocorticoïde dans une lignée rénale humaine 86 A. Justification du projet 86 1. Contexte de l’étude 86 2. Modèle d’étude 86 3. Hypothèses de travail 87 4. Objectifs du travail 88 Article 1 : Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells 88 B. Données complémentaires et autres éléments de discussion 89

2ème Partie : Etude de la signalisation minéralocorticoïde par l’utilisation d’un nouvel antagoniste minéralocorticoïde non-stéroïdien 102

A. Justification du projet 102 1. Contexte de l’étude 102 2. Etude initiale 103 3. Hypothèses de travail 103 4. Objectifs du travail 104 Article 2 : Finerenone impedes aldosterone-dependent nuclear import of the mineralocorticoid receptor and prevents genomic recruitment of Steroid Receptor Coactivator-1 104 B. Données supplémentaires et autres éléments de discussion 105

Table des Matières

3ème Partie : Etude de la contribution relative des récepteurs minéralocorticoïde et glucocorticoïde dans la signalisation des corticostéroïdes dans des cellules n’exprimant pas la 11βHSD2 112

A. Justification du projet 112 1. Contexte de l’étude 112 2. Hypothèses de travail 113 3. Objectifs du travail 114 Article 3 : Differential dynamic kinetics of Mineralocorticoid and Glucocorticoid Receptors genomic interaction 115 B. Données complémentaires et autres éléments de discussion 156

DISCUSSION GENERALE 169

CONCLUSION GENERALE 180

REFERENCES BIBLIOGRAPHIQUES 183

ANNEXES 218 Article 4 : Ulipristal acetate inhibits progesterone receptor isoform A-mediated human breast cancer proliferation and BCL2-L1 expression Article 5: Three novel heterozygous point mutations of NR3C1 causing glucocorticoid Resistance Table des Illustrations

Table des Illustrations Figure 1 : Représentation de la structure modulaire du MR 8 Figure 2 : Structure du DBD du MR humain 9 Figure 3 : Structure du LBD du MR humain en liaison avec l’aldostérone 12 Figure 4 : Gène NR3C2, transcrit et protéine MR 13 Figure 5 : Sites d’expression du MR 15 Figure 6 : Représentation de l’ontogénèse du MR et du GR chez l’Homme 18 Figure 7 : Modifications post-traductionnelles du MR 21 Figure 8 : Le cortex des glandes surrénales, principal responsable de la stéroïdogénèse 24 Figure 9 : Voie d’action génomique du MR dans une cellule épithéliale du tubule contourné Distal 31 Figure 10 : Interactions entre le domaine AF-2 du MR et le RID du coactivateur SRC-1 36 Figure 11 : Le complexe aldostérone-MR régule la réabsorption de sodium dans les cellules du tubule contourné distal 44 Figure 12 : Les antiminéralocorticoïdes de la famille des spirolactones 60 Figure 13 : Les antiminéralocorticoïdes non-stéroïdiens 63 Figure 14 : L’enzyme 11βHSD2 métabolise le cortisol de façon NAD+-dépendante 68 Figure 15 : Dynamiques de recrutement des partenaires transcriptionnels coordonnés par le ERα activé par l’œstradiol sur le promoteur du gène pS2 80 Figure 16 : Activité transrégulatrice associée à un MBS localisé dans une région génomique désertique 90 Figure 17 : Recrutement aldostérone-induit du MR sur le promoteur du gène SGK1 93 Figure 18 : Recrutement aldostérone-induit du MR sur le promoteur des gènes Scnn1a et Sgk1 dans les cellules KC3AC1 97 Figure 19 : Recrutement aldostérone-induit du MR sur le promoteur du gène KCNIP3 dans les cellules HK-GFP-hMR 99 Figure 20 : Recrutement du MR sur le promoteur du gène Scnn1a dans le rein et du gène Sgk1 dans le cœur de souris 108 Figure 21 : Expression des ARNm du gène PER1 en fonction de la durée d’exposition à l’aldostérone 158 Figure 22 : Stratégie des mutants dim du MR et du GR de rat pour l’étude des hétérodimères MR-GR 162 Figure 23 : Modèle d’une structure quaternaire de GR en homotétramère 163 Figure 24 : Différentes hypothèses de structures quaternaires proposées pour le MR et le GR 165

Tableau 1 : Les motifs de liaison génomique du MR 33 Tableau 2 : Les coactivateurs connus pour interagir avec le MR 39 Tableau 3 : Les corépresseurs connus pour interagir avec le MR 41 Tableau 4 : Identification de transcriptomes et de cistromes du MR et de l’aldostérone 49 Tableau 5 : Sélectivité des MRA vis-à-vis des récepteurs des oxo-stéroïdes 60

Liste des Abréviations

Liste des abréviations

3’-UTR 3’-Untranslated region 11βHSD2 11β-Hydroxystéroïde déshydrogénase de type 2 AncCR Ancestral Corticosteroid Receptor ACE Angiotensin-Converting Enzyme ACTH Adrénocorticotropine ADN (c) Acide désoxyribonucléique (complémentaire) AF Activation Function AKI Acute Kidney Injury APMS Affinity Purification followed by Mass Spectrometry AR Androgen Receptor ARE AU Rich Element ARN Acide ribonucléique ARNhn heterogeneous nuclear RNA ARNi ARN interférent ARNm ARN messager ChIA-PET Chromatin Interaction Analysis by Paired-End Tag Sequencing ChIP-(seq) Chromatin immunoprecipitation-(followed by sequencing) CIH Cold-Induced Hypertension CMLV Cellules Musculaires Lisses Vasculaires CoRNR Motif d’interaction corépresseur-récepteur DBD DNA-Binding Domain DOC 11-Désoxycorticostérone DOCA Deoxycorticosterone acetate eGFP enhanced Green Fluorescent Protein ENaC Epithelial Na+ Channel ER Estrogen Receptor FDR False Discovery Rate FKBP5 FK506 Binding Protein 5 GFP Green Fluorescent Protein GILZ Glucocorticoid-Induced Leucine Zipper GR Glucocorticoid Receptor GRE Glucocorticoid Responsive Element GST Glutathione S-Transferase HAT Histone Acetyltransferase HDAC Histone Deacetylase HFpEF/HFrEF Heart Failure with preserved/reduced Ejection Fraction HK Human Kidney hMR human Mineralocorticoid Receptor HRE Hormone Responsive Element Hsp Heat-shock protein HTAP Hypertension artérielle pulmonaire HTM High-Throughput Microscopy

Liste des Abréviations

ID Inhibitor Domain IGV Integrative Genomics Viewer Kbp kilobase pairs KCNIP3 Potassium Voltage-Gated Channel Interacting Protein 3 KO Knock-out LBD Ligand-Binding Domain LC-MS/MS Liquid Chromatography - tandem Mass Spectrometry MBS Mineralocorticoid Binding Sequence Mbp Millions de paires de bases miR MicroRNA mMR mouse Mineralocorticoid Receptor MR Mineralocorticoid Receptor MRA Mineralocorticoid Receptor Antagonist MRE Mineralocorticoid Responsive Element NADPH Nicotinamide Adénine Dinucléotide Phosphate NES Nuclear Export Signal NLS Nuclear Localization Signal NR Nuclear Receptor NR3C2 Nuclear Receptor subfamily 3 group C member 2 NTD N-terminal Domain pb paires de bases PER1 Period circadian protein homolog 1 protein PHA1 Pseudohypoaldostéronisme de type 1 Pol II ARN Polymérase de type 2 PR Progesterone Receptor PTM Post-Translational Modification qPCR quantitative Polymerase Chain Reaction RAR Retinoic Acid Receptor RCPG Récepteur Couplé à une Protéine G RID Receptor Interacting Domain RIP140 Receptor Interacting Protein 140 RXR Retinoid X Receptor SCNN1A Sodium Channel epithelial 1 alpha subunit SG Semaine de Grossesse SGK1 Serum and Glucocorticoid-regulated Kinase 1 siRNA small interferent silencing RNA SNC Système Nerveux Central SRAA Système Rénine-Angiotensine-Aldostérone SUMO Small Ubiquitin-like Modifier SV40 Virus simien 40 TR Thyroid hormone Receptor TSS Transcription Start Site

Les abréviations anglaises sont en italiques.

Avant-Propos

AVANT-PROPOS

Mon intérêt pour la physiologie et la physiopathologie a été croissant au cours de mon cursus de second cycle universitaire, nourri par des lectures et les cours passionnants des professeurs de physiopathologie endocrinienne de l’Université Paris-Sud. Afin d'approfondir mes connaissances dans ce domaine et de m'initier à la recherche scientifique, j’ai rejoint l’unité Inserm 693 (actuellement U1185), localisée au sein de la Faculté de Médecine Paris-Sud, au Kremlin- Bicêtre, pour effectuer mon stage de première année de master. Cette unité Inserm, dirigée par le Dr. Marc Lombès, s’intéresse à la signalisation hormonale, et à la physiopathologie endocrinienne et métabolique.

Au cours de ce stage de M1, j’ai été initié à la recherche par le Dr Junaid Ali Khan sur la problématique de l’identification des cibles génomiques du MR et de la régulation transcriptionnelle par l’aldostérone des gènes associés. J’ai poursuivi ce projet au cours de mon stage de master 2, sous la direction conjointe des docteurs Jérôme Fagart et Marc Lombès. Etant tout à fait convaincu de vouloir poursuivre dans la recherche, et souhaitant approfondir ce projet, j’ai obtenu un financement du Ministère de l’Éducation Supérieure et de la Recherche me permettant de réaliser en trois ans une thèse de Sciences.

Mon projet s’inscrivait dans le cadre de collaborations de l’unité, engagées grâce à des projets de recherche soutenus financièrement par l’Agence Nationale de la Recherche (ANR), ou en collaboration avec le département de recherche cardiologique du laboratoire pharmaceutique Bayer AG. Le programme "Ephimir" (ANR 11-BSV1-028-01, 2011-2014) avait pour double objectif d’étudier les mécanismes régulant l’expression tissu-spécifique du MR, et d’identifier de nouveaux gènes cibles du MR et les protéines régulées par l’aldostérone, dans le but de préciser les implications physiopathologiques de la signalisation minéralocorticoïde. Notre collaboration avec Bayer avait pour but de caractériser les mécanismes moléculaires d’un nouvel antagoniste non- stéroïdien du MR, la finérénone. Enfin, j’ai eu l’opportunité d’apporter ma contribution aux programmes "Calsignaldo" (ANR-15-CE14-0005, 2015-2018), portant sur la signalisation calcique en lien avec le réseau minéralocorticoïde cardiaque, et "Tamirah" (ANR-16-CE17-0014, 2016- 2020) portant sur l’étude des conséquences d’une activation anormale du MR dans l’hypertension artérielle pulmonaire.

Ces projets collaboratifs, par les rencontres occasionnées et les sujets étudiés, représentent des expériences particulièrement enrichissantes. Ils ont conduit à la publication d’articles originaux, dont deux dans lesquels je suis premier auteur ou co-premier auteur, et m’ont permis

Avant-Propos de participer à des congrès scientifiques nationaux et internationaux. J’ai également contribué par ma maîtrise de la technique de ChIP à d’autres travaux sur d’autres récepteurs nucléaires.

Le présent mémoire de thèse est subdivisé en 3 grandes parties : une Introduction Bibliographique, une partie réunissant les résultats que j'ai obtenus, et une dernière partie de Discussion Générale et de Perspectives.

L'introduction bibliographique est structurée en trois grands chapitres. Le premier présente la physiologie de la signalisation minéralocorticoïde, en introduisant les principaux acteurs, le MR et les hormones minéralocorticoïdes, et leur participation à la régulation de grandes fonctions physiologiques. Cette partie se poursuit par la description des mécanismes moléculaires mis en jeu dans cette voie et les gènes auxquels ces mécanismes s’appliquent. La deuxième partie de l'Introduction Générale est consacrée aux aspects physiopathologiques de la signalisation minéralocorticoïde, en présentant successivement les cas d’invalidation puis de suractivation de cette voie, ainsi que les pathologies associées. Elle se termine sur la présentation des principaux antagonistes du MR développés à ce jour et leur utilisation en thérapeutique. Enfin, la troisième partie de l’Introduction Générale est axée sur la sélectivité de la signalisation minéralocorticoïde en lien avec la dynamique des complexes transcriptionnels. Cette partie introductive aura mis en évidence certaines lacunes dans nos connaissances de la signalisation minéralocorticoïde, et elle sera donc suivie par les objectifs de mes travaux de thèse qui en découlent directement.

Le corps du mémoire, présentant les principaux résultats originaux obtenus au cours du doctorat, est divisé aussi en trois chapitres correspondants aux deux articles publiés et à un article en préparation. Chaque article est précédé d’une courte introduction rappelant le contexte et les hypothèses qui ont motivé le travail effectué, et est suivi d’un prolongement de la réflexion au cours d’une discussion accompagnée de résultats complémentaires éventuels. Ainsi, dans le premier chapitre des résultats, nous décrivons l’identification et la caractérisation du premier cistrome du MR activé par l’aldostérone dans des cellules rénales humaines. Les résultats obtenus ont fait l’objet d’une publication en 2015 dans The FASEB Journal. Dans le second chapitre, nous décrivons l’impact de la finérénone, un nouvel antagoniste sélectif du MR, sur certaines étapes clés de la voie de signalisation du MR. Les résultats obtenus ont fait l’objet d’une publication en 2015 dans le Journal of Biological Chemistry. Enfin, dans le troisième chapitre, nous décrivons l’implication que peuvent avoir des dynamiques différentielles d’interaction entre les récepteurs minéralocorticoïde et glucocorticoïde et les cibles génomiques sur la contribution respective de ces deux récepteurs dans la signalisation corticostéroïde dans les cellules rénales

Avant-Propos humaines. Les résultats obtenus sont présentés sous forme du manuscrit d'un article qui est en cours de préparation.

Une discussion synthétisant l’ensemble des résultats, et proposant des perspectives intéressantes pour ce travail, est présentée en troisième partie. Le manuscrit de thèse se termine par une Conclusion Générale.

Enfin, sont présentées en Annexes des travaux auxquels j’ai participé au cours de mon doctorat. Une première publication présente les travaux portant sur les effets de l’acétate d’Ulipristal sur la prolifération de cellules mammaires cancéreuses humaines et l’expression du gène BCL2L1 induites par l’isoforme A du récepteur de la progestérone. Les résultats obtenus ont fait l’objet d’une publication en 2015 dans le journal PLoS One. Une seconde publication porte sur la caractérisation de trois nouvelles mutations ponctuelles hétérozygotes dans le gène NR3C1 impliqués dans la résistance aux glucocorticoïdes. Les résultats obtenus ont fait l’objet d’une publication en 2016 dans le journal Human Mutation.

INTRODUCTION

Introduction

La signalisation minéralocorticoïde est étudiée depuis des décennies essentiellement pour son rôle dans le maintien de l’homéostasie hydro-électrolytique et de la pression artérielle. Cette signalisation est d’ailleurs impliquée dans différentes pathologies majeures chez l’Homme, notamment l’hypertension artérielle, certains dysfonctionnements cardiorénaux et le syndrome métabolique. L’effecteur principal de cette signalisation est le Récepteur Minéralocorticoïde, ou MR, qui est un facteur de transcription dont l’activité est induite par une hormone, l’aldostérone. Dans ses tissus cibles, le MR agit principalement au niveau génomique en réponse aux stimuli hormonaux. Il induit la régulation de la transcription de gènes cibles de l’aldostérone. Au cours de l’introduction, nous présenterons successivement les aspects physiologiques puis pathologiques de la signalisation minéralocorticoïde, pour finalement évoquer la sélectivité de cette voie en relation avec la dynamique des complexes transcriptionnels.

I. Physiologie de la signalisation minéralocorticoïde

A. Le récepteur minéralocorticoïde

1. La protéine MR, interface entre ligand, ADN et partenaires transcriptionnels

Le récepteur minéralocorticoïde (codé par le gène NR3C2) est une protéine composée chez l’Homme de 984 acides aminés et dont la masse moléculaire est de 107 kDa. C’est un facteur de transcription hormono-induit faisant partie de la superfamille des récepteurs nucléaires (NR) (Nuclear Receptors Nomenclature Committee, 1999). Il est classé dans la famille des récepteurs stéroïdiens (NR, sous-famille 3) et dans la sous-famille des récepteurs des oxo-stéroïdes (NR3, groupe C) avec les récepteurs des glucocorticoïdes (GR, NR3C1), de la progestérone (PR, NR3C3) et des androgènes (AR, NR3C4). Les récepteurs nucléaires sont structurés en domaines fonctionnels : un domaine N-terminal (NTD pour N-terminal Domain), un domaine central de liaison à l’ADN (DBD pour DNA-Binding Domain), une région charnière et un domaine C-terminal de liaison au ligand (LBD pour Ligand-Binding Domain) (Figure 1). La relation structure-fonction de chaque domaine sera décrite dans les prochains paragraphes.

Introduction

Figure 1 : Représentation de la structure modulaire du MR. NTD : domaine N-terminal, DBD : domaine de liaison à l’ADN, Hinge : région charnière, LBD : domaine de liaison au ligand, AF : fonction d’activation (1a, 1b et 2), ID : domaine central inhibiteur, NLS : signal de localisation nucléaire (0, 1 et 2), NES : signal d’export nucléaire.

a) Le domaine N-terminal

Le domaine N-terminal (NTD) des récepteurs oxo-stéroïdiens est un domaine très peu conservé, avec seulement 15% d’homologie entre les membres de ce groupe. Néanmoins, la comparaison de la séquence du NTD du MR de différentes espèces révèle une homologie supérieure à 50%, ce qui souligne son importance fonctionnelle. Constitué de 602 acides aminés chez l’Homme, il est le plus long domaine N-terminal décrit parmi les récepteurs nucléaires. Sa structure tridimensionnelle n’est pas connue à ce jour. Cependant, plusieurs sous-domaines fonctionnels ont été décrits en son sein (Figure 1). Il s'agit des fonctions d'activation de la transcription AF-1a et AF-1b localisées aux deux extrémités du domaine (acides aminés 1 à 167 et 445 à 602). Ces dernières sont séparées par le domaine central inhibiteur ID (résidus 168 à 437) qui a des propriétés inhibitrices de la transactivation. Ce domaine porte également le signal de localisation nucléaire 0 (NLS0 pour Nuclear Localization Signal 0). Le domaine ID module l’activité transactivatrice du MR en modifiant la configuration tridimensionnelle des domaines AF- 1a et AF-1b (Pascual-Le Tallec et al., 2003), ce qui participe à la sélectivité minéralocorticoïde (Edman et al., 2015), comme nous le détaillerons plus loin. Les domaines AF-1a et AF1-b ne sont pas toujours accessibles pour les corégulateurs du MR. La nature du ligand lié dans la cavité de liaison du LBD, ainsi que les modifications post-traductionnelles (PTM) présentes à un temps donné, modulent la conformation tridimensionnelle du MR. De cette modulation dépendent les interactions qui vont être favorisées entre le MR et ses corégulateurs. En effet, aucune structure tridimensionnelle complète du NTD du MR n’a été proposée à ce jour. Il en a été déduit que le

Introduction

NTD pouvait adapter sa structure en fonction de la nature du ligand et des PTM. Cette souplesse permettrait au MR d’offrir une réponse transcriptionnelle spécifique à un contexte donné à un moment donné (Fuller, 2015). Les PTM et les partenaires du MR seront décrits en détail dans la suite du manuscrit. b) Le domaine de liaison à l’ADN

Figure 2 : Structure du DBD du MR humain. 2+ A, Représentation linéaire du DBD du MR. Les deux atomes de zinc (Zn ) forment avec 4 cystéines chacun les deux doigts de zinc caractéristiques du DBD des récepteurs nucléaires. DNA Reading Helix : séquence de reconnaissance des GRE, contenant la « boîte P », Dimerization Loop : boîte D permettant la dimérisation du MR, Lever Arm : séquence levier. B, Structure tridimensionnelle de deux DBD d’un homodimère de MR liés à une séquence GRE consensus. Les nucléotides sont représentés en rouge, bleu, jaune et vert pour l’adénine, la cytosine, la guanine et la thymine respectivement. D’après (Hudson et al., 2014).

Le domaine central du MR est le domaine de liaison à l'ADN (DBD pour DNA-Binding Domain) (Figure 1). Il est hautement conservé au sein de la superfamille des récepteurs nucléaires. Ce domaine de 66 acides aminés (résidus 603-670 pour le MR humain) est riche en cystéines. Ces

Introduction cystéines du DBD sont tétracoordonnées autour de deux atomes de zinc pour former deux doigts de zinc (Figure 2A). L'hélice α du premier doigt de zinc est impliquée dans la liaison au grand sillon de l’ADN, au niveau d'éléments de réponse aux hormones (HRE pour Hormone Response Element). Cette hélice porte une séquence peptidique spécifique appelée « boîte P ». Elle est caractérisée par trois résidus (lysine 624, valine 625 et arginine 629) qui permettent une reconnaissance des bases nucléotidiques du HRE (Hudson et al., 2014) (Figure 2B). La séquence HRE la mieux caractérisée est le motif GRE (Glucocorticoid Response Element) qui est reconnue par tous les récepteurs des oxo-stéroïdes, de par la forte homologie entre leur DBD. Le GRE dit classique ou parfait est un palindrome composé de deux hexanucléotides séparés par trois nucléotides favorisant la symétrie axiale. Il a pour séquence consensus 5’- AGAACAnnnTGTTCT-3’ (où n désigne n’importe quel nucléotide). Le second doigt de zinc du DBD contient une boucle, appelée « boîte D » (résidus 641 à 648) impliquée dans la dimérisation du MR (Mifsud and Reul, 2016). Les études cristallographiques sur le complexe MR-GRE ont montré que le MR se fixe sous forme de dimère, chaque monomère liant un des hémi-sites du GRE (Figure 2). Entre les deux doigts de zinc, une séquence dite « levier », identique dans le GR, le PR et le MR, est essentielle à l’activité régulatrice des récepteurs nucléaires (Meijsing et al., 2009). Il a été décrit que les bases nucléotidiques de chaque GRE entraînaient un positionnement spécifique de la boîte P ayant une répercussion sur la structure du levier. Cette répercussion sur le levier se propagerait du côté C-terminal du MR, jusqu’à influencer la configuration du domaine de liaison au ligand (Watson et al., 2013). Ces connections indirectes entre le levier et le LBD permettrait d’adapter la réponse transcriptionnelle de façon GRE- spécifique.

c) La région charnière

La région charnière du MR est peu caractérisée. Néanmoins, il a été décrit qu'au niveau du cytoplasme, la liaison d'un ligand agoniste au MR induit un repliement de cette région permettant aux régions N- et C-terminales de se rapprocher et d'exposer les signaux de localisation nucléaire de la région charnière (NLS1) et du LBD (NLS2) (NLS pour Nuclear Localization Signal). Le complexe MR-aldostérone peut alors migrer dans le compartiment nucléaire de la cellule cible. Une seconde séquence importante est localisée dans la région charnière, entre le NLS1 et le DBD ; il s’agit du signal d’export nucléaire (NES pour Nuclear Export Signal), qui régule le trafic

Introduction du MR du compartiment nucléaire vers le cytoplasme (Pascual-Le Tallec and Lombès, 2005) (Figure 1). d) Le domaine de liaison au ligand

La partie C-terminale du MR correspond au domaine de liaison du ligand (LBD) (Figure 1). Ce domaine possède plusieurs fonctions : l’interaction et la reconnaissance du ligand, l’interaction avec la protéine chaperonne Hsp90 (Heat shock protein 90) et les corégulateurs transcriptionnels, la localisation nucléaire ainsi que l’activité transrégulatrice ligand-dépendante du MR.

La protéine de choc thermique de 90 kDa de masse moléculaire (Hsp90) est une chaperonne cytoplasmique fortement exprimée (Binart et al., 1995). Elle établit, avec le MR et d’autres protéines, un complexe hétéro-oligomérique stable maintenant le MR dans une configuration capable de lier le ligand. Si la Hsp90 interagit directement avec le LBD du MR, il a été montré que le LBD seul (acides aminés 734 à 984) ne lie pas la Hsp90 (Couette et al., 1998). Par contre, le LBD associé aux 5 acides aminés C-terminaux de la région charnière (729 à 733) peut lier la Hsp90. Enfin, le LBD associé à la région charnière entière peut non seulement lier la Hsp90, mais possède aussi une affinité maximale pour l’aldostérone.

Il existe pour ce domaine des homologies de 50 à 60% avec les autres membres des récepteurs des oxo-stéroïdes mais très faible avec les autres membres des récepteurs nucléaires (moins de 18%). Néanmoins, grâce à un alignement de la séquence des différents LBD des récepteurs nucléaires ainsi qu'à la structure cristallographique de la forme non associée à un ligand de l’isoforme α du récepteur aux rétinoïdes (RXRα) (Bourguet et al., 1995) et à la forme associée au ligand de l’isoforme γ du récepteur de l’acide rétinoïque (RARγ) (Renaud et al., 1995), il a été proposé que l'ensemble des récepteurs nucléaires adoptaient le même repliement tridimensionnel (Wurtz et al., 1996). Un modèle tridimensionnel du LBD du MR a d'abord été construit par homologie en utilisant les données structurales du RARγ (Fagart et al., 1998), puis celles du récepteur de la progestérone (Hellal-Levy et al., 2000a). Sa structure tridimensionnelle a ensuite été résolue par cristallographie aux rayons X (Bledsoe et al., 2005; Fagart et al., 2005a; Li et al., 2005; Huyet et al., 2012). Schématiquement, le LDB est organisé en un sandwich antiparallèle de 11 hélices α (H1, H3 jusqu'à H12), et de deux petits feuillets β (Figure 3).

Introduction

Figure 3 : Structure du LBD du MR humain en liaison avec l’aldostérone. A, Structure tridimensionnelle du LBD de MR dans lequel est logée l’aldostérone (Numéro d’identification dans la Protein Data Bank : 2AA2). B, Diagramme indiquant les contacts entre l’aldostérone et les résidus de la cavité de liaison du LBD. Extrait de (Huyet et al., 2012).

La cavité de liaison du ligand du MR est délimitée par les hélices H3, H5, H6, H7, H11 et H12, le feuillet β entre les hélices H5 et H6, et la boucle entre les hélices H11 et H12 (Fagart et al., 1998, 2005a; Li et al., 2005) (Figure 3A). La cavité de liaison est bordée par 22 acides aminés formant des liaisons spécifiques avec les différents groupements de l’aldostérone (Figure 3B). Seulement cinq des 22 acides aminés sont polaires et ancrent les fonctions polaires de l'aldostérone. La glutamine 776 (Gln776, hélice H3) et l’arginine 817 (Arg817, hélice H5) forment des liaisons hydrogène avec la fonction cétone en position 3 de l'aldostérone, la thréonine 945 (Thr945, hélice H11) avec la cétone en position 20 et l'hydroxyle en position 21. Enfin, l’asparagine 770 (Asn770, hélice H3) forme une liaison hydrogène avec les groupements hydroxyles en 18 et 21 de l’aldostérone. Certains acides aminés sont indispensables à la discrimination des ligands du MR, ils seront évoqués dans le chapitre consacré à la sélectivité minéralocorticoïde.

Le LBD porte une fonction d'activation de la transcription (Activation Function 2, AF-2) qui est formée par les hélices H3, H4, H5 et H12. L’entrée et la liaison de l'aldostérone dans la cavité de liaison entraînent des changements structuraux à l’origine de l’activation du récepteur. La structure non ligandée du LBD du MR n'est pas connue. Néanmoins, par homologie avec le RXRα

Introduction et le RARγ, la liaison de l'aldostérone au récepteur induit un repositionnement de l’hélice H12 contre les hélices H3 et H4 fermant la cavité de liaison comme un couvercle (Renaud et al., 1995). Les hélices H3, H5, H11 et H12 forment alors un sillon hydrophobe dans lequel se loge le motif LXXLL des coactivateurs transcriptionnels. Les corégulateurs transcriptionnels du MR contiennent des domaines de liaison au récepteur (NR boxes, pour Nuclear Receptor boxes) qui présentent des motifs LXXLL (où L désigne une leucine et X un acide aminé quelconque) reconnus au niveau du domaine AF-2 du MR dans sa conformation active (Darimont et al., 1998). La nature et le rôle des corégulateurs du MR seront détaillés dans un chapitre dédié.

2. Le gène NR3C2

Figure 4 : Gène NR3C2, transcrit et protéine MR. P1 et P2 : régions promotrices en amont des deux premiers exons alternatifs 1α et 1β, ATG : codon du site d’initiation de la transcription du gène NR3C2, TGA : codon stop du gène NR3C2.

Le MR est codé chez l’Homme par le gène NR3C2 localisé sur le chromosome 4, dans la région q31.1. Ce gène NR3C2 est un gène qui s’étend sur plus de 450 kilobases et qui est composé de 10 exons et 8 introns (Figure 4). Les deux premiers exons, 1α et 1β, sont non transcrits et sont sous le contrôle en 5’ de leurs promoteurs respectifs P1 et P2. Ils sont à l’origine de deux isoformes d’ARNm du MR (Zennaro et al., 1995). Le promoteur proximal P1 initie la transcription dans l’ensemble des tissus dans lequel le MR est exprimé et tout au long de la vie adulte. L’activité du promoteur distal P2 est plus faible et semble restreinte à certains tissus et à certains stades du développement (Zennaro et al., 1996). Il a été décrit que le MR, de façon

Introduction aldostérone-dépendante, régulerait sa propre expression via le promoteur P2 uniquement (Le Menuet et al., 2000). Ceci est également vrai dans un contexte de cellule neuronale (Munier et al., 2012). L’absence de GRE, et la présence de plusieurs motifs correspondant à d’autres facteurs de transcription, dans les régions promotrices de NR3C2 suggèrent une liaison indirecte du MR sur d’autres facteurs de transcription. En parallèle, il semblerait que le récepteur glucocorticoïde (GR) régule de façon glucocorticoïde-dépendante l’expression du MR via P1 et, en synergie avec le MR, via P2 (Zennaro et al., 1996).

Les exons 2 à 9 du gène NR3C2 sont à l’origine, après transcription et traduction, des 984 acides aminés composant la protéine MR fonctionnelle chez l’Homme (Zennaro et al., 1995) (Figure 4). Plus précisément, le long exon 2, comprenant 1758 paires de base, code l'intégralité du NTD. Les exons 3 et 4, plus courts, codent chacun un des deux doigts de zinc du DBD, tandis que l’exon 5 code la région charnière ainsi que les hélices H1 et H3 du LBD. Enfin, les courts exons 6 à 8, et le long exon 9, composé de 2733 pb, sont à l’origine du reste du LBD. L’exon 9 est également porteur de la séquence transcrite en région 3’ non codante du transcrit du MR qui, nous le verrons plus loin, est importante pour la régulation post-transcriptionnelle de l’expression du MR (Viengchareun et al., 2014).

3. Expression du MR

Le MR a initialement été identifié dans le rein, in vivo, comme un récepteur sensible à l’aldostérone, et dont l’activité et la liaison à l’aldostérone sont inhibées par la spironolactone, qui était alors définie comme antagoniste de l’aldostérone (Marver et al., 1974). Le MR était alors caractérisé par son coefficient de sédimentation en gradient glycérol. Il a ensuite été identifié dans le rein humain avec le même coefficient de sédimentation et une affinité conservée pour l’aldostérone (Matulich et al., 1976) (Figure 5). Le développement d’anticorps anti-MR permettra par la suite d’identifier les tissus exprimant le MR ainsi que la localisation subcellulaire du MR. Par ce moyen, l’expression du MR a été précisée dans les épithélia polarisés à jonctions serrées, cibles de l’aldostérone et sièges d’un transport transépithélial de sodium. Avant le séquençage du gène NR3C2, la séquence du domaine AF-1a du MR humain avait été déduite par comparaison avec celle du GR, permettant de générer trois peptides (selon le cadre de lecture du transcrit) utilisables pour produire trois anticorps polyclonaux (Krozowski et al., 1989). L’un d’entre eux s’est révélé efficace pour la détection du MR sur des coupes de rein humain. Le récepteur a alors été localisé précisément dans les tubules contournés distaux, les anses de Henlé et les tubules

Introduction collecteurs du cortex rénal (Sasano et al., 1992). La génération d’un anticorps anti-idiotypique chez le Lapin a aussi permis de confirmer l’expression majeure du MR dans ces différents segments néphroniques par immunohistochimie (Lombès et al., 1990). Les deux types d’anticorps, antisérum et anti-idiotypique, ne permettaient pas alors de déterminer avec certitude la localisation subcellulaire du MR, et notamment de montrer clairement une influence de l’aldostérone sur celle-ci (Fejes-Tóth et al., 1998), comme nous le décrirons plus loin.

Figure 5 : Sites d’expression du MR. D’après une figure originale de la thèse du Dr Say Viengchareun, Diversité des effets minéralocorticoïdes : Apport de nouveaux modèles cellulaires différenciés établis par oncogenèse ciblée chez la souris, Université Paris-Sud, 2005.

Le clonage du gène NR3C2 de l’Homme par homologie avec l’ADNc de NR3C1 (gène codant le GR) (Arriza et al., 1987), puis au séquençage du gène NR3C2 (Zennaro et al., 1995) représentent et sont à l’origine d’avancées majeures, puisqu’ils ont permis ensuite de produire plusieurs anticorps anti-MR polyclonaux, notamment par des industriels (Santa Cruz). Plusieurs anticorps ont été ainsi générés et utilisés pour des approches d’immunodétection, Western blot ou immunohistochimie. L’expression rénale du MR a été confirmé dans les parties distales du

Introduction néphron (Lombès et al., 1990), et élargie aux cellules mésengiales du glomérule (Nishiyama et al., 2005) et dans les podocytes (Shibata et al., 2007). Il est à noter que l’approche d’immunohistochimie, très spécifique, est une approche lourde et réservé aux expérimentateurs entraînés, notamment pour la réalisation de l’étape de démasquage des antigènes.

L’expression du MR a été rapidement élargie à d’autres tissus épithéliaux (Figure 5). Le récepteur est exprimé dans plusieurs segments du tube digestif. A partir des extraits de muqueuses intestinales de Rat, l’affinité de l’aldostérone a été mesurée par des tests de liaison, ce qui a indirectement montré l’expression du MR dans les différentes parties de l’intestin grêle (duodénum, jéjunum et iléon) et le colon (Pressley and Funder, 1975; Rafestin-Oblin et al., 1984). Grâce à un anticorps anti-AF-1a du MR humain, les résultats précédents ont été confirmés en immunohistochimie, et ont permis de montrer son expression dans l’épithélium œsophagien (Hirasawa et al., 1999). L’hybridation in situ, qui permet de détecter spécifiquement une séquence d’ADN ou des transcrits dans des tissus grâce à des sondes complémentaires, a permis de montrer l’expression du MR dans la peau. En effet, le MR est exprimé dans les kératinocytes, les follicules pileux, les glandes sudoripares et les glandes sébacées (Kenouch et al., 1994). Ces observations ont été confirmé par immunohistochimie (Hirasawa et al., 1999). Enfin, le MR est aussi exprimé dans le poumon (Krozowski and Funder, 1981; Suzuki et al., 2000). Dans ces tissus épithéliaux, l’expression du MR est associée à celle du canal épithélial à sodium (ENaC pour Epithelial Na+ Channel), ce qui corrobore le rôle prépondérant du MR dans la régulation de l’homéostasie hydrosodée. L’expression du MR a aussi été montré dans l’oreille interne, où il pourrait contrôler l’équilibre hydro-électrolytique de l’endolymphe (Furuta et al., 1994).

Le MR est aussi exprimé dans des tissus non-épithéliaux. Dans le système cardio-vasculaire, les effets bénéfiques de la spironolactone, antagoniste du MR, dans le traitement de certaines pathologies cardiaques, laissaient penser que le MR était présent (Kolkhof and Bärfacker, 2017). Ce n’est qu’avec le développement de l’anticorps anti-idiotypique du MR que son expression sera confirmée dans les cardiomyocytes, ainsi que dans les cellules endothéliales des gros vaisseaux sanguins (aorte) (Lombès et al., 1992). Nous détaillerons les effets physiopathologiques de la signalisation minéralocorticoïde dans le cœur dans la seconde partie de l’introduction. Les tests de liaison avec l’aldostérone avaient montré que le foie est sensible à l’aldostérone (Duval and Funder, 1974). Le développement de l’approche d’hybridation in situ a permis de révéler l’expression du MR dans l’hippocampe, structure limbique essentielle à la mémoire, et dans l’hypothalamus, où l’appétit sodée est régulé (Van Eekelen et al., 1988, 1991). Enfin, les différentes approches d’immunologie ont permis de démontrer l’expression du MR dans la rétine

Introduction

(Mirshahi et al., 1997), le placenta (Hirasawa et al., 1999), les macrophages (Rickard et al., 2009), et les tissus adipocytaires blanc et brun (Zennaro et al., 1998; Caprio et al., 2007). Enfin, grâce à deux modèles de souris transgéniques, l’ARNm du MR a aussi été détecté dans l’utérus, les ovaires et les testicules (Le Menuet et al., 2000).

Il est essentiel de noter que, dans les tissus non-épithéliaux, le MR n’est pas coexprimé avec l’enzyme 11β-hydroxystéroïde déshydrogénase de type 2 (11βHSD2) qui protège le MR de l’occupation illicite par les hormones glucocorticoïdes. Nous reviendrons sur l’importance de cette enzyme et sur les mécanismes de sélectivité de la signalisation minéralocorticoïde dans la troisième partie de l’introduction. Le MR est maintenant régulièrement décrit comme un récepteur ubiquitaire de par la démonstration de son expression dans un nombre important de tissus. Pourtant, son expression n’est pas constante à la vie adulte, et de plus varie considérablement au cours du développement.

4. Expression diphasique du MR au cours du développement chez l’Homme

Martinerie et al. se sont intéressés en détail à l’expression rénale du MR dans la période périnatale. Chez l’Homme, le rein n’est pas complètement mature à la naissance, ce qui conduit à une difficulté à maintenir l’homéostasie hydrosodée dans cette période critique de transition entre le milieu liquide intra-utérin et le milieu extérieur. Puisque les concentrations d’aldostérone et de rénine étaient élevées dans le sang du cordon ombilical des nouveau-nés, montrant que le système rénine-angiotensine-aldostérone (SRAA) est fonctionnel, l’équipe a cherché à évaluer l’implication du MR dans la genèse de la résistance rénale à l’aldostérone dans la période périnatale. Cette période est caractérisée par une perte de sel importante contrastant avec des concentrations plasmatiques élevées de rénine et d’aldostérone. En mesurant l’expression de l’ARNm du MR par PCR quantitative en temps réel et l’expression protéique par immunohistochimie, il a été mis en évidence une expression diphasique au cours du développement rénal chez l’Homme (Figure 6). L’immunohistochimie révèle que le MR est absent du rein avant la 15ème semaine de gestation, puis est majoritairement présent dans les noyaux des cellules du tubule contourné distal entre la 15ème et la 24ème semaine. Entre la 15ème et la 24ème semaine de gestation, il existe un pic transitoire d’expression du MR dans le rein fœtal, période qui semble contemporaine à la kératinisation cutanée du fœtus in utero, définissant ainsi les limites physiques et fonctionnelles de la barrière entre le moi (l’intérieur) et le non-moi (l’extérieur). Ensuite, le MR n’est plus détecté dans la période périnatale, à partir de la 30ème semaine de

Introduction gestation ainsi qu'à la naissance pour augmenter progressivement jusqu’à la maturité totale du rein, vers l’âge de un an chez l’Homme. La localisation du MR en période fœtale est nucléaire, ce qui suggère que le récepteur est activé. Il a été montré que l’aldostérone maternelle passe librement par le sang ombilical, ce qui laisse penser que le MR joue déjà un rôle dans le rein, probablement développemental, avant la naissance (Brophy and Robillard, 2004). L’aldostérone est aussi exprimée dans le cortex surrénal fœtal dès la 9ème semaine, elle peut donc agir dans le fœtus en développement. De façon intéressante, l’expression progressive du MR dans la période post-natale corrèle avec l’augmentation concomitante de l’expression de l’enzyme 11βHSD2, facteur important de sélectivité cellulaire de la signalisation minéralocorticoïde (voir chapitre III de l’introduction) et de la sous-unité α du canal ENaC, conduisant à la maturité fonctionnelle complète du rein (Martinerie et al., 2009a, 2009b). Ces résultats sont également observés chez la souris, confirmant la mise en place cyclique de l’expression rénale du MR chez les mammifères.

Figure 6 : Représentation de l’ontogénèse du MR et du GR chez l’Homme. Au cours du développement, l’expression du MR est diphasique chez l’Homme. Celle du GR ne varie pas significativement. Adapté de (Martinerie et al., 2012).

Dans le rein, les mécanismes régulant la mise en place de l’expression du MR, ainsi que sa localisation subcellulaire fœtale et son absence périnatale ne sont pas connus. En parallèle, si la mise en place de l’expression rénale du MR au cours du développement est maintenant mieux caractérisée, il y a peu de données sur la mise en place de la signalisation minéralocorticoïde

Introduction dans ses autres tissus. Chez l’adulte, l’expression et l’activité du MR sont régulées par de nombreux mécanismes moléculaires que nous aborderons dans les paragraphes suivants.

5. Régulations post-transcriptionnelles et post-traductionnelles de l’expression du MR

La régulation transcriptionnelle que nous avons décrit au travers des promoteurs P1 et P2 en amont du gène NR3C2, qui est spécifique du tissu et du temps, ne suffit pas seule à expliquer la finesse des mécanismes de régulation de la signalisation minéralocorticoïde en fonction du contexte physiologique. L’expression et l’activité du MR sont aussi régulées aux niveaux post- transcriptionnel et post-traductionnel par différents mécanismes décrits ici.

a) Régulations post-transcriptionnelles

A côté du contrôle transcriptionnel effectué au niveau des promoteurs P1 et P2 du gène NR3C2, plusieurs travaux ont montré que la stabilité et la demi-vie du transcrit du MR sont fortement régulées. La première étude sur la régulation du transcrit de NR3C2 a été réalisée dans l’hippocampe de rat par hybridation in situ (Herman and Watson, 1995). Elle a d’abord confirmé l’expression des transcrits hétérologues nucléaires (ARNhn) et matures (ARNm) du MR dans l’hippocampe, en particulier dans le gyrus denté. Puis, elle a mis en évidence que le stress par constriction des rats entraînait une diminution de l’expression du gène NR3C2, donc de l’ARNhn, mais pas le niveau d’ARNm, signifiant un effet transcriptionnel et/ou post-transcriptionnel du stress sur l’expression du MR.

Récemment, les microARN (ou miR), petits ARN simples brins capable de s’apparier à des ARN dits cibles, ont été identifiés comme des acteurs majeurs de la régulation post- transcriptionnelle chez les Eucaryotes. Sõber et al. ont les premiers étudié la région 3’UTR du transcrit de NR3C2 comme cible potentielle de miR-124 et miR-135a, grâce à des analyses bioinformatiques de séquence (Sõber et al., 2010). En plaçant in vitro la région 3’UTR du transcrit MR en aval d’un rapporteur luciférase, ils ont démontré que le recrutement de miR-124 et de miR- 135a inhibait l’activité luciférase. Dans des cellules transfectées, les deux miR n’entraînaient pas de diminution du nombre de transcrit du MR, suggérant que, plutôt que d’induire la dégradation du messager, ils agissaient en réduisant sa traduction.

Introduction

Notre équipe a aussi étudié les mécanismes de régulation de l’expression du MR. Dans le tubule contourné distal du néphron, nous avons mis en évidence pour la première fois que l’expression rénale du MR est régulée par les variations de tonicité extracellulaire via des mécanismes post-transcriptionnels. En utilisant une lignée murine immortalisée à partir de tubule contourné distal, les cellules KC3AC1, Viengchareun et al. ont d’abord montré que l’expression de l’ARNm et de la protéine MR diminuait en condition hypertonique (Viengchareun et al., 2009). Cette diminution coïncide avec l’augmentation de l’expression de TonEBP (Tonicity responsive Enhancer Binding Protein), un facteur de transcription connu pour réguler des gènes impliqués dans l’adaptation au stress osmotique. Parmi les cibles activées par TonEBP figure Tis11b, une protéine de liaison de l’ARN, qui interagit avec la partie 3’ non traduite de l’ARNm du MR, diminuant sa durée de vie en accélérant sa dégradation. En condition d’hypertonicité, la transcription et la phosphorylation de TonEBP sont activées, TonEBP se fixe alors sur le promoteur du gène codant Tis11b, active sa transcription et stimule son expression. Tis11b va alors se fixer sur l’ARNm du MR et diminuer sa traduction (Viengchareun et al., 2009). Plus précisément, Tis11b reconnait des éléments riches en A et U (ARE) dans ses ARN cibles. La région 3’UTR (3’-untranslated region) du transcrit MR humain contient 7 ARE et notre équipe a montré que Tis11b interagissait directement sur ceux-ci pour diminuer sa stabilité (Viengchareun et al., 2014). Ces résultats ont été confirmés in vivo sur des reins de souris soumises à des conditions mimant l’hypertonicité extracellulaire relative dans les parties distales du néphron (augmentation de débit de sodium dans le néphron distal par un traitement aigu avec des diurétiques, ou régime riche en sel). Notre équipe a également étudié l’influence de l’hypotonicité sur l’expression rénale du MR, en utilisant à nouveau les cellules KC3AC1. Ils ont d’abord mis en évidence que l’hypotonicité entraîne une augmentation importante de l’expression du MR. Ensuite, une protéine de liaison candidate a été étudiée : HuR (Hu antigen R), connue pour stabiliser l’expression d’ARNm dans d’autres contextes. L’expression protéique de HuR augmente en condition hypotonique, et HuR est rapidement adressée au compartiment cytoplasmique comme l’ont montré et quantifié les expériences d’imagerie au microscope haut débit. Dans le cytoplasme, HuR se fixe à des éléments riches en uridylate, extrêmement nombreux dans la région 3’UTR du transcrit MR mais aussi sur un motif tige-boucle critique. Cette liaison stabilise le transcrit du MR et conduit à une augmentation de l’expression de la protéine MR, affectant la transcription des gènes cibles de l’aldostérone (Lema et al., 2017).

Introduction b) Régulations post-traductionnelles

La protéine MR est également soumise à de multiples modifications post-traductionnelles (PTM), variant selon le tissu et le contexte physiologique, et influençant son activité et sa durée de vie. Il s’agit principalement de phosphorylation, d’ubiquitination, de sumoylation et d’acétylation. Nous en détaillons ici certains aspects.

Figure 7 : Modifications post-traductionnelles du MR. La nature et la position des acides aminés cibles des PTM sont indiquées. S, sérine ; T, thréonine ; K, lysine.

La phosphorylation correspond au greffage d’un groupement phosphate sous l’action d’une kinase, généralement sur un résidu tyrosine, sérine ou thréonine de la protéine cible. C’est une modification post-traductionnelle majeure dans la régulation de la structure, l’activité, la localisation subcellulaire et la stabilité des protéines, quelle que soit leur fonction. La phosphorylation du MR influe sur son affinité pour l’aldostérone, son transfert nucléaire et ses effets non-génomiques (Faresse, 2014; Jiménez-Canino et al., 2016a). Dans les extraits rénaux de rat, l’inhibition des sérine/thréonine phosphatases empêchent la liaison de l’aldostérone au MR et, par conséquent, l’activation aldostérone-induite du MR et la liaison du complexe aldostérone- MR à l’ADN (Galigniana, 1998). Plusieurs sites de phosphorylations ont été identifiés dans les différents domaines du MR (Figure 7). Dans le domaine N-terminal du MR, les sérines 128 et 250 et la thréonine 159 sont les cibles d’une kinase, la cycline-dépendante kinase 5 (CDK5). Cette phosphorylation, par liaison directe de CDK5 sur le NTD, est induite par l’aldostérone et est indispensable à la transactivation de certaines cibles du MR (Bdnf, p75NTR...) dans le système nerveux central (Kino et al., 2010). Le MR interagit aussi avec la protéine kinase D 1 (PKD1), une sérine/thréonine kinase, qui est essentielle à l’activité transactivatrice du complexe aldostérone- MR dans le néphron, et qui stabilise sa localisation nucléaire (McEneaney et al., 2010a). Il a

Introduction d’ailleurs été montré que la sérine 601 du MR, située dans le signal indépendant du ligand NLS0, doit être phosphorylée pour permettre l’entrée et la sortie du noyau du MR (Walther et al., 2005). La phosphorylation fait partie des conséquences immédiates de l’entrée de l’aldostérone dans la cellule. En effet, en quelques minutes, l’hormone induit la phosphorylation du MR par la protéine kinase Cα (PKCα), et permet ainsi l’activité transrégulatrice du MR (Le Moëllic et al., 2004). En comparaison à la CDK5, la PKCα sert les effets rapides de l’aldostérone plutôt que les effets à moyen terme. Récemment, la sérine 843, localisée dans le LBD du MR, a été identifiée pour être impliquée à la fois dans l’inactivation du MR par obstruction partielle de la liaison du ligand (Shibata et al., 2013), et à la fois en empêchant le recrutement des partenaires transcriptionnels (Jiménez-Canino et al., 2016a). La phosphorylation est un processus réversible : les phosphatases, à l’inverse des kinases, retirent les groupements phosphate d’une protéine.

L’ubiquitination correspond au greffage peu ou très partiellement réversible d’un ou plusieurs groupements ubiquitines sur une lysine d’une protéine cible. L’ubiquitine est un petit polypeptide de 8,5 kDa, dont la liaison covalente à une protéine nécessite trois étapes enzymatiques consécutives catalysées par une enzyme d’activation E1, de conjugaison E2 puis une ligase E3 (Helzer et al., 2015; Kerscher et al., 2006). L’ubiquitination est impliquée dans la dégradation des protéines, permettant leur adressage au protéasome, le complexe de protéases cytoplasmiques responsable du recyclage des protéines qui est associé au réticulum endoplasmique (Lee and Lee, 2012). L’activité transcriptionnelle du MR est régulée par l’ubiquitination (Yokota et al., 2004), notamment via une interaction directe avec la ligase de type E3 CHIP (COOH terminus of Hsp70- Interacting Protein) (Faresse et al., 2010). Faresse et al. ont aussi étudié le rôle de USP2-45 (Ubiquitin-Specific Protease), dont la transcription est activée par l’aldostérone dans une lignée murine de cellules du tubule contournée distal (Faresse et al., 2013). Dans des modèles in vitro et in vivo, USP2-45 interagit directement avec le MR en présence d’aldostérone favorisant son ubiquitination, sa dégradation et son adressage au protéasome (Figure 7). Puisque le complexe aldostérone-MR induit l’expression de USP2-45, il a été proposé que ce mécanisme constitue un rétrocontrôle négatif qui limite l’action de l’aldostérone (Faresse et al., 2013). Enfin, il a été montré que l’inhibition du protéasome perturbe l’activité transcriptionnelle du complexe aldostérone-MR sur un gène rapporteur luciférase, indiquant que le recyclage du MR via l’ubiquitination est une étape importante pour l’activation de la signalisation par l’aldostérone (Tirard et al., 2007). Mais l’inhibition du protéasome empêche aussi la phosphorylation activatrice du MR lié à l’aldostérone (Faresse et al., 2012). Il a donc été proposé que l’activité transrégulatrice du MR activé par l’aldostérone était régulée par une balance entre phosphorylation et ubiquitination, comme cela avait déjà été décrit auparavant pour le GR (Faresse, 2014; Wallace and Cidlowski, 2001).

Introduction

La sumoylation est une modification post-traductionnelle qui correspond au greffage covalent réversible d’un groupement SUMO (Small Ubiquitin-like Modifier) sur un résidu lysine d’une protéine cible (Melchior, 2000). Comme l’ubiquitination, la sumoylation est réalisée en trois étapes enzymatiques (trois enzymes successives : E1 d’activation, E2 de conjugaison puis une ligase E3). Cette modification régule les facteurs de transcription essentiellement au niveau de leur transfert nucléo-cytoplasmique et de leur activité transcriptionnelle (Yang and Chiang, 2013). Le MR est sumoylé avec des protéines SUMO1 (Small Ubiquitin-related MOdifier 1) par l’enzyme de conjugaison (E2) Ubc9 sur le motif consensus ΨKxD/E (avec Ψ un résidu hydrophobe, K la lysine cible, x un résidu quelconque et D/E un résidu acide). Le MR possède 5 lysines capables d’être sumoylées dont 4 dans le domaine N-terminal (Figure 7). Le MR sumoylé interagit avec le corépresseur PIAS1 (Protein Inhibitor of Activated Signal transducer 1) qui agit comme une SUMO ligase (E3) et conduit à une répression de l’activité transcriptionnelle ligand-induite du MR (Pascual-Le Tallec et al., 2003).

L'activité du MR est aussi modulé par des phénomènes d’acétylation/désacétylation, et d’oxydation (Faresse, 2014). Nous l’avons vu, le MR est régulé par un ensemble de PTM qui agissent de façon coordonnée pour réguler son activation par l’aldostérone, sa localisation subcellulaire, son activité transrégulatrice et sa dégradation. Elles sont indispensables à la signalisation du MR, afin que celui-ci puisse servir de relais intracellulaire des hormones minéralocorticoïdes et de pivot de la signalisation minéralocorticoïde.

B. Les hormones minéralocorticoïdes : lieu de synthèse, régulation et sécrétion

Le MR est un facteur de transcription activé par la liaison d’un ligand. Deux hormones sont capables d’activer le MR chez l’Homme : l’aldostérone et le cortisol. Nous présentons ici la structure, la biosynthèse et la régulation de l’expression de ces hormones, en commençant par l’aldostérone.

Introduction

Figure 8 : Le cortex des glandes surrénales, principal responsable de la stéroïdogenèse. A, Les deux glandes surrénales se trouvent au-dessus des reins. Les différentes couches cellulaires sont indiquées. B, Dans la chaine enzymatique de la biosynthèse de l’aldostérone et du cortisol, les enzymes localisées dans les mitochondries sont entourées en vert, les autres sont localisées dans le réticulum endoplasmique lisse. D’après (Connell et al., 2008). 24

Introduction

1. L’aldostérone

La principale hormone de la signalisation minéralocorticoïde chez les Mammifères est l’aldostérone. L’aldostérone, initialement appelée électrocortine, a été découverte en 1953 par Simpson et Tait (Simpson et al., 1953). C’est un stéroïde naturel, dérivé du cholestérol, qui est synthétisé par les cellules de la zone glomérulée du cortex des glandes surrénales (Figure 8). La biosynthèse de l’aldostérone commence tôt dans le développement embryonnaire, dès la différenciation des glandes surrénales et l’expression des enzymes de la stéroïdogénèse, à partir de la 24ème semaine de gestation chez l’Homme (Naccache et al., 2016). Parmi ces enzymes, l’aldosterone synthase (CYP11B2) est exprimée dans l’espace intermembranaire des mitochondries des cellules de la zone glomérulée (Adams and Bose, 2012) (Figure 8). La biosynthèse et la sécrétion dans le sang de l’aldostérone sont régulées de façon circadienne par différents sécrétagogues : le système rénine-angiotensine II, l’hyperkaliémie et la corticotrophine ACTH (Koopman et al., 1985; Nakamura et al., 2015). Les mécanismes d’action de ces sécrétagogues sont brièvement présentés ci-après.

Le système rénine-angiotensine-aldostérone (SRAA) est l’un des principaux acteurs de la régulation de la pression sanguine et du maintien de l’homéostasie hydrosodée. En amont de l’appareil juxtaglomérulaire, dans le rein, les artérioles possèdent des barorécepteurs capables de percevoir les variations de pression artérielle et de transmettre l’information en aval (Guazzi et al., 1985). L’appareil juxtaglomérulaire est lui-même capable, par l’intermédiaire des cellules de la macula densa, de capter une diminution du débit de sodium. Or, cet appareil exprime et sécrète dans la circulation sanguine une enzyme, la rénine, en réponse à ces deux signaux (hypotension et hypodébit). La rénine agit sur l’angiotensinogène, une protéine sécrétée par le foie et circulant dans le sang. L’enzyme clive l’angiotensinogène pour générer un décapeptide : l’angiotensine I. L’enzyme de conversion de l’angiotensine (ACE) est exprimée dans les capillaires sanguins du poumon, dans l’endothélium et dans le rein. L’ACE est essentielle puisque c’est elle qui clive l’angiotensine I en supprimant deux acides aminés pour produire l’angiotensine II. Ce dernier octa- peptide, résultat d’une signalisation complexe, est reconnu par les récepteurs de l’angiotensine II (AT1R et AT2R), des récepteurs couplés à une protéine G (RCPG) exprimés à la surface des cellules de la zone glomérulée. Par ce biais, plusieurs voies de signalisation intracellulaires sont activées, dont la voie initiée par la phospholipase C-β (PLCβ) (Catt et al., 1988). Cette enzyme génère par hydrolyse le second messager inositol triphosphate (IP3), qui est un activateur des protéine-kinases dépendantes de calcium/calmoduline (CaMK). Les CaMK activées libèrent le calcium contenu dans le réticulum endoplasmique, ce qui entraîne l’exocytose de l’aldostérone à

Introduction la membrane. Les CaMK activent par phosphorylation les facteurs de transcription ATF et CREB. Or, des éléments de réponse correspondant à ATF et CREB sont présents dans le promoteur du gène CYP11B2, codant pour l’aldosterone synthase. ATF et CREB active la transcription de ce gène, permettant par conséquent l’augmentation de la biosynthèse d’aldostérone (Bassett et al., 2000; Nogueira and Rainey, 2010). Le récepteur AT1R active aussi la voie des kinases ERK pour augmenter la synthèse d’aldostérone. Ces kinases vont favoriser la libération de cholestérol au niveau de microgouttelettes lipidiques intracellulaires. Le cholestérol agit via la protéine régulatrice de la stéroïdogénèse StAR qui transporte le cholestérol dans la mitochondrie où celui-ci est pris en charge par les enzymes de la stéroïdogénèse (McNeill et al., 2005). Le SRAA, faisant intervenir de nombreux acteurs, peut être régulé à plusieurs niveaux, ce qui régule avec précision la synthèse et la sécrétion de l’aldostérone (Bollag, 2014).

Une faible augmentation de kaliémie (ou de la concentration du potassium dans le milieu extracellulaire in vitro) entraîne l’activation de voies communes à la signalisation intracellulaire de AT1R (Spät and Hunyady, 2004). En effet, le potassium entraîne une dépolarisation de la membrane cytoplasmique, ce qui permet l’ouverture de canaux calciques voltage–dépendants, l'entrée de calcium extracellulaire et une sécrétion d’aldostérone (Spät et al., 1996). L’entrée de calcium extracellulaire a le même effet que le relargage de calcium du réticulum endoplasmique, i.e. l’activation de la voie CaMK-ATF-CREB, et résulte en la transactivation du gène CYP11B2. Il faut noter qu’un des rôles majeurs de l’aldostérone dans le néphron distal est d’augmenter la sécrétion du potassium. Ainsi, on voit que le potassium, au cours d’un épisode d’hyperkaliémie, est capable de réguler indirectement sa propre sécrétion, réalisant ainsi une boucle d’autorégulation pertinente (Shibata et al., 1991).

L’ACTH (pour AdrenoCorticoTropic Hormone) est une hormone intermédiaire dans l’axe hypothalamo-hypophyso-surrénalien. Sécrétée par les cellules basophiles corticotropes de l’antéhypophyse, en fonction du rythme circadien et en réponse à un stress, l’ACTH est essentielle à la régulation de la sécrétion des stéroïdes par le cortex des glandes surrénales (Lefebvre et al., 2016). En particulier, elle agit sur les cellules de la zone glomérulée en se liant au récepteur

MC2R, un RCPG couplé à une protéine Gs qui, après activation, va activer l’adénylate cyclase. Cette dernière entraîne une augmentation de la concentration d’AMP cyclique (AMPc) permettant l’activation de la protéine kinase A (PKA). La PKA liée à l’AMPc active d’une part des canaux calciques transmembranaires entraînant une entrée de calcium, et d’autre part ATF et CREB qui vont transactiver le gène CYP11B2 (Bollag, 2014). Ainsi, l’ACTH favorise à la fois la sécrétion et la biosynthèse d’aldostérone.

Introduction

Quelques études ont mis en évidence une biosynthèse extra-surrénalienne d’aldostérone. L’ARNm de Cyp11b2 est exprimé dans le foie et le poumon de rat (Wu et al., 1999). L’ARNm et la protéine CYP11B2 sont aussi exprimés dans le tissu adipeux (MacKenzie et al., 2008a), et dans l’hippocampe et le cervelet (MacKenzie et al., 2008b). De façon intéressante, le gène Cyp11b2 est aussi transcrit dans le cœur de rat (Silvestre et al., 1998). Les mécanismes de régulation de l’expression de cette enzyme et de la sécrétion d’aldostérone sont les mêmes dans le cœur et dans la corticosurrénale. Le rôle physiologique de la synthèse locale d’aldostérone dans le cœur n’a pas été identifié à ce jour. Dans un modèle de souris transgéniques surexprimant l’aldosterone synthase dans le cœur, le flux sanguin coronaire est diminué, alors que les différents tissus cardiaques sont intacts, ce qui montre qu’un niveau élevé d’aldostérone entraîne une diminution de la fonction coronarienne (Garnier et al., 2004). Nous reviendrons en détail sur le rôle physiopathologique du MR dans la troisième partie de cette introduction. La biosynthèse extra- surrénalienne d’aldostérone permettrait une régulation rapide par voie autocrine ou paracrine de la signalisation minéralocorticoïde au niveau de ses organes cibles.

2. Autres hormones minéralocorticoïdes naturelles

D’autres hormones stéroïdiennes que l’aldostérone agissent physiologiquement sur le MR. La désoxycorticostérone, ou DOC, est synthétisée à partir de la progestérone par la 21- hydroxylase, dans les zones glomérulée et fasciculée des glandes surrénales (Figure 8). Elle a une affinité comparable à celle de l’aldostérone pour le MR (Arriza et al., 1987), notamment due aux fonctions cétone du carbone 20 et alcool du carbone 21. La DOC semble surtout agir sur le MR chez les Téléostéens, de façon mineure dans l’adaptation aux variations d’osmolarité, et plus majoritairement dans la régulation de la reproduction mâle au niveau testiculaire, et sur le comportement au niveau du système nerveux central (Takahashi and Sakamoto, 2013).

La progestérone, est synthétisée et sécrétée principalement par les cellules du corps jaune des ovaires et par le placenta, grâce à l’enzyme 3β-HSD2. Elle est un intermédiaire dans la synthèse de l’aldostérone (Figure 8). Elle a une forte affinité pour le MR (Arriza et al., 1987), même si ses principaux effets physiologiques sont relayés par le récepteur de la progestérone (PR). Cette hormone a un effet antagoniste sur le MR (Quinkler et al., 2002). De plus, la progestérone inhibe partiellement l’activité de l’enzyme 11βHSD2 qui, nous le verrons plus loin, protège le MR de l’occupation d’autre ligand que l’aldostérone (Quinkler et al., 1999, 2003). Une mutation du MR, S810L, localisée dans la pochette du LBD, change l’activité antagoniste de la

Introduction progestérone en activité agoniste (Fagart et al., 2005a). Nous reviendrons sur cette mutation dans la seconde partie de l’introduction et dans l’Article 2.

Enfin, les glucocorticoïdes, c’est-à-dire le cortisol chez l’Homme et la corticostérone chez les Rongeurs, sont des ligands physiologiquement majeurs du MR. Ces stéroïdes sont synthétisés par la zone fasciculée de la corticosurrénale (Figure 8), grâce à l’enzyme CYP11B1 exprimée dans ses cellules. Ces hormones possèdent une fonction alcool sur le carbone C11, commune à l’aldostérone, qui est en partie à l’origine de leur activité agoniste envers le MR. Les glucocorticoïdes ont une forte affinité pour le MR, comparable à celle de l’aldostérone (Arriza et al., 1987). Ils agissent au niveau génomique en se liant à leur propre récepteur, le récepteur glucocorticoïde (GR), ou au MR. Nous parlerons de dualité hormonale en aldostérone et cortisol au cours de la troisième partie de l’introduction.

C. Fonctions physiologiques régulées par la signalisation minéralocorticoïde

La signalisation minéralocorticoïde est impliquée dans de nombreuses fonctions physiologiques qui varient en fonction des tissus exprimant le MR (Figure 5). On distingue classiquement ses effets sur les tissus épithéliaux et non-épithéliaux. Les prochains paragraphes détailleront les principaux rôles du MR.

L’aldostérone était initialement désignée comme l’électrocortine (Simpson et al., 1953). Ce nom vient des observations faites après injection d’extraits de zone glomérulée à des chiens surrénalectomisés (Gross and Gysel, 1954). Alors que les chiens présentaient une perte urinaire massive de sodium, les extraits permettaient de rétablir la réabsorption rapide de sodium et d’eau, et de récupérer une volémie équilibrée. Le premier rôle identifié de l’aldostérone est donc le maintien de l’équilibre hydrosodé et la régulation de la volémie. Pour cela, l’aldostérone agit principalement au niveau des reins (Sala and Luetscher, 1954). Plusieurs années ont été nécessaires pour caractériser une protéine nucléaire à forte affinité pour l’aldostérone, et inhibée par la spironolactone (alors décrite comme antagoniste de l’aldostérone, et non du MR). Le MR dans la partie distale du néphron et dans les autres tissus épithéliaux où il est exprimé, agit principalement par voie génomique pour réguler la réabsorption de sodium et d’eau et l’excrétion de potassium. Il permet ainsi de réguler la pression artérielle. Pour cela, le MR module l’expression d’un certain nombre de canaux et transporteurs ioniques membranaires des tissus épithéliaux (Viengchareun et al., 2007), que nous détaillerons plus loin dans l’introduction.

Introduction

Le MR, en tant qu’intermédiaire de l’aldostérone, a un impact majeur sur le système cardiovasculaire. A ce jour, le rôle physiologique de l’aldostérone dans le cœur n’est pas encore parfaitement élucidé. Bénitah et Vassort ont étudié par patch-clamp l’effet de l’aldostérone sur le courant calcique total dans des cardiomyocytes ventriculaires de rats (Bénitah and Vassort, 1999). Il en ressort qu’un traitement de 24 h par l’aldostérone entraîne une augmentation significative de la densité du courant calcique. Cet effet est inhibé par la spironolactone, un antiminéralocorticoïde, ce qui démontre l’implication de l’aldostérone via le MR. Par contre, un nombre important d’études a mis en évidence le rôle globalement délétère du complexe MR- aldostérone dans le système cardiovasculaire que nous détaillerons dans la deuxième partie de l’introduction. En bref, depuis les années 1950, on connait un rôle de l’aldostérone dans l’insuffisance cardiaque et l’apparition des œdèmes, sans connaître encore l’implication directe d’un hyperaldostéronisme. Depuis, de nombreuses études ont montré un rôle prépondérant du complexe MR-aldostérone dans le remodelage cardiomyocytaire (Fejes-Tóth and Náray-Fejes- Tóth, 2007), l’initiation et l’évolutivité des fibroses cardiaques (Azibani et al., 2013) ainsi que l’initiation des processus inflammatoires endothéliaux et des lésions vasculaires (Lombès et al., 2000). Les pathologies associées à la signalisation minéralocorticoïde seront détaillées dans la seconde partie de cette introduction.

Le MR est exprimé dans certaines régions précises du système nerveux central (SNC) : le gyrus denté de l’hippocampe et l’hypothalamus. Dans l’hypothalamus, le complexe aldostérone- MR régule l’appétit sodé (Geerling and Loewy, 2008). Les modèles murins de surexpression ou d’invalidation du MR dans le SNC ont montré des effets positifs de celui-ci dans les neurones hippocampaux. En particulier, le MR régule la réponse au stress en modulant l’excitabilité neuronale et la mémorisation, notamment par l’amélioration de la potentialisation à long-terme, de la protection neuronale et de la neurogenèse (Le Menuet and Lombès, 2014). Notre équipe a montré que la surexpression du MR dans les neurones dérivés de cellules souches embryonnaires facilitait la différenciation de ces cellules et augmentait leur survie (Munier et al., 2012). Il est important de noter que l’aldostérone traverse très peu la barrière hématoencéphalique (Geerling and Loewy, 2009). Les glucocorticoïdes, eux, passent cette barrière. Puisque ces derniers ont une forte affinité pour le MR, il est proposé depuis plusieurs décennies que, dans l’hippocampe, le MR soit l’effecteur des hormones glucocorticoïdes uniquement. Un modèle tout à fait intéressant a été proposé : le MR serait le principal récepteur aux doses physiologiques moyennes et basses d’hormones glucocorticoïdes. Par contre, seul le GR permettrait de relayer les effets des fortes doses des glucocorticoïdes, c’est-à-dire aux zéniths des variations circadiennes et pendant les épisodes de stress (Meijer, 2011; Joëls and de Kloet, 2017). La dualité

Introduction entre le MR et le GR dans les signalisations des corticostéroïdes sera détaillée dans la troisième partie de cette introduction.

Le MR est exprimé dans les tissus adipeux blanc et brun, dans lesquels l’aldostérone promeut la différenciation des pré-adipocytes en adipocytes (Penfornis et al., 2000). Notre équipe a montré dans le modèle de souris surexprimant le MR que celui-ci prévenait l’apparition du syndrome métabolique induit par une alimentation riche en lipides, essentiellement due à l’action du MR sur la polarisation macrophagique (Kuhn et al., 2014). Il a été montré que l’aldostérone inhibe la thermogénèse dans le tissu adipeux brun (Viengchareun et al., 2001; Marzolla et al., 2012). En effet, lors d’une exposition au froid, notre équipe a montré que le complexe MR-aldostérone réprime le gène UCP1 (pour UnCoupling Protein 1), codant pour la thermogénine essentielle à la production de chaleur dans ce tissu (Kuhn et al., 2014). Le MR a donc un rôle encore sous- caractérisé dans l’homéostasie métabolique qui reste à découvrir.

Sans détailler les rôles décrits dans le poumon (de Man et al., 2012) ou les monocytes/macrophages (Kuhn et al., 2014; Marzolla et al., 2014), nous voyons maintenant que le MR, qui est souvent considéré comme un récepteur ubiquitaire, possède des fonctions pléïotropiques.

D. Les mécanismes d'action du MR dans la signalisation minéralocorticoïde

La signalisation minéralocorticoïde se traduit majoritairement par des effets génomiques relayés par le MR, mais passe aussi par certains effets non-génomiques. Les deux seront décrits successivement ici.

Introduction

1. La voie génomique

Figure 9 : Voie d’action génomique du MR dans une cellule épithéliale du tubule contournée distale. L’aldostérone et le cortisol pénètrent dans la cellule par diffusion passive. Le cortisol est métabolisé par l’enzyme 11HSD2 en cortisone, inactif vis-à-vis du MR. La liaison de l’aldostérone au MR entraîne un changement conformationnel du récepteur et la libération d’une partie des protéines chaperonnes. Le complexe aldostérone-MR-HSP90 migre dans le noyau où HSP90 se dissocie. Le MR se dimérise et se fixe sur des séquences GRE dans les régions régulatrices des gènes cibles de l’aldostérone, par exemple les promoteurs des gènes SCNN1A, SGK1 ou TSC22D3 (codant pour les protéines αENaC, SGK1 et GILZ respectivement). Il recrute alors des partenaires transcriptionnels, coactivateurs ou corépresseurs. Dans le cas des coactivateurs, la machinerie transcriptionnelle (MT), dont l’ARN Polymérase II, sont recrutés. Finalement, les protéines produites à partir des gènes cibles, permettent la réabsorption de sodium. D’après (Viengchareun et al, 2007).

Introduction

La voie génomique d’action du MR se présente souvent de façon schématique et simplifiée. L’aldostérone et les glucocorticoïdes sont des hormones stéroïdiennes donc lipophiles. Elles diffusent au travers de la membrane plasmique des cellules cibles (Figure 9). Dans le cytoplasme, elles activent le MR, qui est alors transféré dans le noyau où il se dimérise et lie des séquences génomiques spécifiques, les éléments de réponse aux glucocorticoïdes (GRE). Le complexe dimérique recrute alors des corégulateurs transcriptionnels afin d’activer ou de réprimer ses gènes cibles. Finalement, le MR est recyclé. Ce schéma d’action est bien sûr simplifié et ne prend pas en compte l’aspect dynamique de la régulation transcriptionnelle par le MR, ni la diversité des partenaires de ce dernier. Nous allons à présent reprendre les grandes étapes une à une de façon plus détaillée. a) Activation du MR lié au complexe chaperon et translocation nucléaire

Le MR se situe majoritairement dans le cytoplasme en absence de ligand (Rafestin-Oblin et al., 1989; Lombès et al., 1994). Il est lié à un complexe protéique composé de protéines chaperonnes (Rafestin-Oblin et al., 1989; Yang and Fuller, 2012). Parmi elles, les protéines de choc thermique Hsp70 et Hsp90 (pour Heat Shock Protein) interagissent avec le LBD du MR afin de maintenir la cavité de liaison dans une conformation accessible aux ligands (Binart et al., 1991). La cochaperonne FKBP5 (FK506 Binding Protein 5) - de la famille des immunophilines, impliquées dans les changements conformationnels d’autres protéines, - se lie aux Hsp et est essentielle au maintien de la conformation active du MR (Echeverria and Picard, 2010). La liaison d’un ligand agoniste, comme l’aldostérone et le cortisol, entraîne un changement de conformation du MR, notamment une compaction du LBD avec un repliement de l’hélice H12 sur la cavité de liaison. Ceci a une répercussion directe sur l’interaction entre le MR et le complexe chaperon. De plus, le MR subit certaines modifications post-traductionnelles dont des phosphorylations (Jiménez- Canino et al., 2016a), et ses signaux de localisation nucléaire (NLS) sont alors activés et exposés. Le MR se dissocie des protéines chaperonnes, hormis Hsp90, et est pris en charge par des importines qui lui permettent de passer les pores nucléaires (Nishi and Kawata, 2007). Le MR se dissocie alors de la Hsp90 et se dimérise (Grossmann et al., 2012). b) Interaction avec les cibles génomiques

Le dimère de MR activé est capable d’agir comme facteur de transcription et de lier l’ADN. Nous l’avons vu en amont, la boîte P du DBD permet au MR de reconnaitre les GRE. Un tel motif est retrouvé dans les promoteurs des cibles génomiques classiques du MR : SCNN1A (codant pour αENaC), SGK1 et TSC22D3 (codant pour GILZ) par exemple (Kohler et al., 2001; Webster et al.,

Introduction

1993; Ueda et al., 2014) (Tableau 1). Une certaine variabilité de ce GRE classique a été rapportée. Le promoteur du gène edn1 code l’endothéline-1, protéine importante dans la réabsorption rénale de sodium, comprend deux GRE. Le premier est une répétition directe (DR pour direct repeat) et le second est palindromique (Stow et al., 2009). Stow et al. ont montré que le MR était recruté sur les deux GRE, mais que seul le GRE palindromique entraînait le recrutement d’un complexe transcriptionnel opérationnel et de l’ARN Polymérase de type II. En comparaison au GRE consensus, le spacer du GRE palindromique du promoteur de edn1 est composé de 8 nucléotides. La taille de ce spacer fait partie des déterminants de la réponse transcriptionnelle adoptée de façon gène-spécifique (Mick et al., 2001). En effet, de ce spacer dépend la conformation adoptée par le dimère de MR sur l’ADN, donc de la nature des corégulateurs transcriptionnels recrutés.

Distance Références Gène Protéine du TSS Séquence Validation (pb) (Webster Rapporteur rSgk1 SGK1 -1000 AGGACAgaaTGTTCT et al., 1993) luciférase Retard sur (Sayegh et gel, hSCNN1A αENaC -142 AGAACAgaaTGTCCT al., 1999) rapporteur luciférase -230 GGTACctGGTTCA

(Kohler et -320 TGTTCT Fragments mScnn1a αENaC al., 2001) -401 GTTTCT tronqués -777 AGAACAgaaTGTTCT

(Stow et -551 TGTACCtgacaaaaCCACAT mEdn1 EDN1 ChIP al., 2009) -671 TGGTGGAaggggtggTGGTGGA (Ueda et Cistrome aGnACAnnnTGTnCt ChIP-seq al., 2014)

(O’Hara et ND GGGTCTgcgTGTTCT Rapporteur rKcnn4 IK/KCNN4 al., 2014) ND TCTTGAgtgTGTTCT luciférase

Tableau 1 : Les motifs de liaison génomique du MR. Le MR se lie sur des séquences HRE faisant consensus avec les séquences reconnues par le GR, l’AR et le PR, définie par le motif AGAACAnnnTGTTCT, ou sur des demi-sites TGTTCT. Ici sont représentés des motifs validés sur le plan fonctionnel. Les nucléotides reconnus par le récepteur sont en majuscules, ceux du spacer en minuscules. n désigne n’importe quel nucléotide. ND : non défini. L’espèce est précisée : h pour Homme, m pour Souris et r pour Rat. ChIP-Seq : immunoprécipitation de la chromatine (ChIP) suivie de séquençage haut-débit (Seq).

Introduction

La liaison des facteurs de transcription sur leurs éléments de réponse dépend de l’état de condensation de la chromatine (Engelen et al., 2015). La chromatine est l’ensemble formé par l’ADN génomique enroulé autour des protéines histones, dont l’unité organisatrice et régulatrice est le nucléosome (Lai and Pugh, 2017). Un nucléosome est composé chez l’Homme d’une séquence d’ADN de 146 nucléotides entourée autour d’un octomère de protéines histoniques. Cet octomère est formé par des pairs des histones H2A, H2B, H3 et H4. Le rôle de la chromatine est de compacter l’ADN génomique, déjà divisé en chromosome, en sous-unités pouvant se condenser et se décondenser sur certaines portions individuellement, afin de le contenir dans le noyau. Elle est appelée hétérochromatine quand son état de condensation, observable en microscopie, est maximale (Weaver et al., 2017). L’hétérochromatine est inaccessible aux facteurs de transcription et n’est donc pas transcrit. Elle est caractérisée, au niveau de l’ADN, par une hyperméthylation et une hypoacétylation des bases azotées (Jiang et al., 2004). La présence de nombreux groupements méthyles est reconnue par les histones pour favoriser la compaction. A l’inverse, l’euchromatine est l’état partiellement décondensé de la chromatine, caractérisée par un faible niveau de méthylation des bases et une acétylation augmentée. L’ADN, détaché des protéines histoniques, est lâche et accessible aux enzymes, aux facteurs de transcription et peut donc être transcrit : on parle de chromatine active. Le passage d’un état de condensation à l’autre est finement régulé par un ensemble intriqué d’enzymes, de voies de signalisation et de facteurs de transcription (Rothbart and Strahl, 2014).

John et al. ont montré que 95% des sites génomiques de liaison du GR étaient dans des régions chromatiniennes préalablement accessibles (John et al., 2011). Cela signifie que le GR régule des gènes dans des régions transcriptionnellement actives dans un type cellulaire donné. Cela signifie aussi que le GR n’est que rarement l’initiateur des modifications chromatiniennes permettant l’activation de la transcription d’un gène. Peu de données sont accessibles sur les sites de liaison génomique du MR. Une équipe s’est intéressée à la régulation in vitro de l’expression du gène SCNN1A, que nous décrirons par la suite, par trio formé par le complexe aldostérone-MR, une méthyltransférase H3K79-spécifique Dot1a et le facteur de transcription Af9 (Chen et al., 2015). L’enzyme Dot1a reconnaît et méthyle la lysine 79 de l’histone 3 (H3K79), notamment au niveau du site d’initiation de la transcription (TSS) du gène SCNN1A en collaborant avec Af9. Cela a pour effet de maintenir un état réprimé du gène. Le complexe aldostérone-MR agit à plusieurs niveaux : il transactive le gène Sgk1 et le MR inhibe la liaison Dot1a-Af9 en liant Af9 (Zhang et al., 2013). La protéine kinase SGK1 phosphoryle Af9, ce qui l’empêche d’interagir avec Dot1a (Zhang et al., 2007b). Cette dérépression par inhibition de Dot1a-Af9 est le seul mécanisme de modification de l’état chromatinien connu pour le MR. Un autre corégulateur de

Introduction transcription, SRC-1, qui sera présenté dans le paragraphe suivant, modifie la chromatine pour permettre la transactivation de cibles génomiques (Zennaro et al., 2001; Yang and Young, 2009).

Grâce à notre étude présentée dans l’Article 1, nous apportons des réponses quant aux marques histoniques trouvées dans les régions génomiques que lie le complexe MR-aldostérone.

c) Les corégulateurs transcriptionnels du MR

Le MR interagit avec un grand nombre de corégulateurs transcriptionnels afin de moduler de façon coordonnée, séquentielle et fine la transrégulation de ses cibles génomiques. Les corégulateurs associés au MR sont impliqués dans des fonctions diverses : ouvrir la chromatine, recruter l’ARN polymérase de type II ou, au contraire, bloquer l’accès aux sites d’initiation de la transcription. Parmi ces corégulateurs, on distingue les coactivateurs, qui favorisent la transactivation d’un gène, et les corépresseurs, qui le répriment. Dans les deux cas, ils interagissent avec le MR, certains avec le NTD, et la majorité au niveau du LBD, en particulier avec la fonction d'activation AF-2, grâce à leur domaine Receptor Interacting Domain (RID), dans lequel les motifs riches en leucines LXXLL ont une importance majeure. En trente ans, un large panel d’approches a permis d’identifier et de caractériser certains de ces corégulateurs : criblage de double-hybride dans les levures (Pascual-Le Tallec et al., 2005; Rogerson et al., 2014), GST pulldown (Yokota et al., 2007), spectrométrie de masse après immunoprécipitation (Kino et al., 2010), ou encore coimmunioprécipitation (Murai-Takeda et al., 2010). Ces approches ont été appliquées in vitro et in vivo. Dans les paragraphes suivants, sont présentés les coactivateurs, puis les corépresseurs du MR.

(1) Les coactivateurs du MR

Les coactivateurs du MR sont l’ensemble des partenaires collaborant, in fine, à l’activation de la transcription d’une cible génomique du MR. Ils ont chacun une fonction différente, et leur action est à la fois dépendante du tissu, de l’état de la cellule et de la chromatine, de la nature du ligand lié au MR et du locus régulé.

Introduction

Figure 10 : Interactions entre le domaine AF-2 du MR et le RID du coactivateur SRC-1. Structure cristallographique du LBD de MR dans lequel est logée la désoxycorticostérone, en interaction avec le 4ème RID du coactivateur SRC-1. Les données de diffraction des rayons X (1,5 Å de résolution) ont été enregistrées au synchrotron SOLEIL de Saint-Aubin (Fagart et al., manuscrit en préparation).

Le coactivateur SRC-1 (Steroid Receptor Coactivator 1) est une protéine de la famille p160, avec SRC-2 et SRC-3 (York and O’Malley, 2010), qui interagit avec tous les récepteurs oxo- stéroïdiens (Oñate et al., 1995). Il interagit, grâce à son domaine central RID, avec le domaine AF-2 du MR lié à l’aldostérone (Figure 10). Il permet le recrutement de différents complexes d’acétylation des histones, formés d’histone acétyltransférases (HAT), notamment SWI/SNF et CBP. Les histones acétylées ont une affinité moindre pour l’ADN et facilitent le déplacement des nucléosomes, ce qui résulte en une forme euchromatine favorisée. De plus, SRC-1 est lui-même une HAT, une fonction portée par son domaine C-terminal, même si son activité est faible (Spencer et al., 1997). Son recrutement par le MR permet donc le maintien de la chromatine en

Introduction euchromatine, donc le maintien du MR sur le locus et le recrutement d’autres partenaires, notamment l’ARN Polymérase de type II (ARN Pol II) (Zennaro et al., 2001; Yang and Young, 2009). SRC-1 possède deux isoformes, SRC-1a et SCR-1e, qui sont différemment exprimés selon les types cellulaires (Meijer et al., 2005). Dans des cellules transfectées avec l’un des isoformes et un système promoteur-gène rapporteur, il a été montré que l’activité transactivatrice du MR était augmentée par SRC-1a dans le cas d'un promoteur contenant un GRE unique, et par SRC- 1e dans le cas d'un promoteur contenant plusieurs GRE en tandem. De plus, les deux isoformes semblent être à l’origine d’une spécificité d’action entre le MR et le GR, et nous reviendrons sur la détermination de corégulateurs récepteur-spécifiques dans la troisième partie de l’introduction. Enfin, SRC-1 sert aussi de plateforme pour l’interaction entre le MR et d’autres partenaires. SRC- 1 interagit avec le facteur Ubc9 (UBiquitin-like protein SUMO-1 Conjugating E2 enzyme) au niveau du NTD du MR. Les deux coactivateurs potentialisent l’activité transactivatrice ligand-induite du MR (Yokota et al., 2007). Le coactivateur SRC-2 est de la même famille que SRC-1. Il interagit également avec le MR au niveau du domaine AF-2, mais aussi au niveau des deux séquences AF-1 dans le NTD. La séquence AF-2 a une fonction ligand-dépendante, ce qui suggère que le recrutement de SRC-2 dépend du ligand, du tissu et du locus. Peu d’études ont montré une interaction entre le MR et SRC-3. Ce dernier est important dans le développement fœtal (Xu et al., 2000) et semble important dans la fonction du MR dans l’hippocampe (Schmidt et al., 2007).

Les protéines p300 et CBP (pour CREB Binding Protein) forment une famille de coactivateurs possédant également une activité acétyltransférase. Elles interagissent toutes deux avec les domaines AF-1 et AF-2 du MR, grâce à leur domaine RID (Fuse et al., 2000). En plus de favoriser la conservation conformationnelle de l’euchromatine, elles ont un rôle primordial dans le recrutement de l’ARN Pol II. Entre les complexes de HAT et le MR, le coactivateur PGC-1α (pour Peroxisome Proliferator-activated Receptor Gamma Coactivator 1-alpha), qui interagit avec AF- 2, forme un point d’ancrage. Il favorise aussi le recrutement par le MR du complexe d’initiation de la transcription (Hultman et al., 2005).

Un coactivateur fait partie intégrante du complexe de l’ARN Pol II : le facteur ELL (pour Eleven-nineteen Lysine-rich Leukemia) (Pascual-Le Tallec et al., 2005). ELL est un facteur d’élongation qui interagit avec l’ARN Pol II afin d’optimiser la transcription d’un gène, en augmentant son activité ou en inhibant les pauses dans la transcription. ELL interagit avec la séquence AF-1a du NTD. De façon tout à fait intéressante, ELL potentialise la transactivation du MR mais réprime celle du GR, qui pourrait entrer en concurrence dans certains tissus. Enfin, ce

Introduction facteur d’élongation est exprimé de façon concomitante avec le MR, et son expression est aldostérone-induite dans le DCT où l’action du MR est primordiale.

La protéine RIP140 (Receptor Interacting Protein of 140 kDa) est un corégulateur qui interagit avec la plupart des récepteurs nucléaires, dont le AR et le GR (Augereau et al., 2006). Il possède 9 RID sur l’ensemble de sa séquence, qui lui permettent d’interagir avec le domaine AF-2 de façon ligand-induite. L’interaction entre le MR et RIP140 a été montrée in vitro, sur le variant Δ5,6 du MR, tronqué de la région charnière à la partie N-terminale du LBD (Zennaro et al., 2001). En effet, la présence de RIP140 en plus de l’aldostérone augmentait la transactivation du gène rapporteur luciférase. Le rôle spécifique de RIP140 dans la signalisation du MR reste à investiguer.

D’autres coactivateurs du MR ont été décrits et sont présentés dans le Tableau 2. Certains coactivateurs ont un rôle important dans la sélectivité de la signalisation du MR dans le cadre de la dualité MR-GR et seront présentés dans la troisième partie de l’introduction.

Introduction

Domaine d’interaction Noms Fonctions Références dans le MR SRC-1 Spencer et al., 1997; Recrutement de HAT pour Zennaro et al., 2001; SRC-1a AF-2 l’initiation de la transcription ; Wang et al., 2004; Activité histone acétylase Hultman et al., 2005; SRC-1e AF-1 intrinsèque faible. Meijer et al., 2005 Hong et al., 1997; Augmentation de la SRC-2 AF-1 et AF-2 Fuse et al., 2000; transactivation Wang et al., 2004 Augmentation de la transactivation au cours du Xu et al., 2000; SRC-3 AF-2 développement, puis dans Schmidt et al., 2007 l’hippocampe Enzyme de conjugaison E2 Ubc9 NTD dans la sumoylation, interaction Yokota et al., 2007 via SRC-1 Activité HAT ; Recrutement de p300/CBP AF-1 et AF-2 Fuse et al., 2000 l’ARN Pol II Recrutement de HAT et du PGC-1α AF-2 complexe d’initiation de la Hultman et al., 2005 transcription Facteur d’élongation ; ancrage Pascual-Le Tallec et ELL AF-1b de l’ARN Pol II al., 2005 Augmentation de la Zennaro et al., 2001; RIP140 AF-2 et NTD transactivation Rogerson et al., 2014 FLASH AF-1 Régulation de l’apoptose Obradović et al., 2004 FAF-1 AF-1 Régulation de l’apoptose Obradović et al., 2004 Recrutement de HAT ; Initiation TIF1α NTD Zennaro et al., 2001 de la transcription Augmentation de la Tesmine LBD transactivation en présence Rogerson et al., 2014 d’aldostérone EEF1A1 ND Facteur d’élongation Yang et al., 2014 XRCC6 ND Réparation de l’ADN Yang et al., 2014

Tableau 2 : Les coactivateurs connus pour interagir avec le MR. EEF1A1 : Eukaryotic translation Elongation Factor 1 Alpha 1 ; ELL : Eleven-nineteen Lysine-rich Leukemia ; FAF-1 : Fas Associated Factor 1 ; FLASH : caspase 8 associated protein 2 ; HAT : Histone Acétyltransférase ; p300/CBP : p300 and CREB Binding Protein coactivators ; PGC-1α : Peroxisome Proliferator-activated Receptor Gamma Coactivator 1-alpha ; RIP140 : Receptor Interacting Protein of 140 kDa ; SRC : Steroid Receptor Coactivator (1a, 1e, 2, 3) ; Tesmine : Testis expressed Metallothionein like protein ; TIF1α : tripartite motif containing 24 ; Ubc9 : SUMO-conjugating enzyme UBC9 ; XRCC6 : X-ray Repair Cross Complementing 6. ND : Non déterminé. D’après (Fuller et al., 2017).

Introduction

(2) Les corépresseurs du MR

Les corépresseurs des récepteurs nucléaires agissent de diverses façons : en inhibant l’activité transactivatrice du récepteur, en favorisant l’état hétérochromatinien d’un locus, ou en recrutant un complexe de répression.

L’un des corépresseur les mieux caractérisés pour les récepteurs nucléaires est NCoR (NR CoRepressor) (Watson et al., 2012). C’est une protéine comprenant en N-ter deux domaines d’interaction avec les histone désacétylases (HDAC), et en C-ter trois motifs d’interaction corépresseur-récepteur (ou boîte CoRNR) (Mottis et al., 2013) dont la séquence type I/L-xx-I/V-I (où I désigne une isoleucine, L une leucine, V une valine et x un acide aminé quelconque) permet d’interaction avec le LBD du MR (Wang et al., 2004). NCoR interagit avec le MR de façon aldostérone-induite, et diminue son activité transactivatrice en recrutant HDAC3, qui favorise la formation de nucléosome (Gong et al., 2017). NCoR agit en partenariat avec un autre corépresseur du MR, SMRT (pour Silencing Mediator of Retinoid and Thyroid hormone receptor, aussi appelé RCoR2). SMRT contient les mêmes domaines CoRNR et d’interaction avec les HDAC. Le complexe NCoR/SMRT/HDAC3 est décrit comme acteur majeur de la transrépression (Karagianni and Wong, 2007). Etant donné que le MR interagit aussi avec SMRT au niveau du LBD, il est fort probable que l’ensemble du complexe répresseur puisse être recruté par le MR (Wang et al., 2004).

Notre équipe a réalisé un criblage en double-hybride dans les levures dans le but d’identifier les partenaires interagissant avec le NTD du MR (Pascual-Le Tallec et al., 2003). Par cette approche, la protéine PIAS1 (pour Protein Inhibitor of Activated Signal Transducer and Activator of Transcription 1) a été identifiée. Nous avons vu dans la partie consacrée aux PTM du MR que la protéine PIAS1 est une SUMO ligase qui agit en particulier sur la lysine 494 du domaine AF- 1b. L’interaction entre le MR et PIAS1 entraîne ainsi la répression de la transactivation aldostérone-induite du MR.

Une étude a montré un effet de NF-κB (pour Nuclear Factor κ B) sur la signalisation du MR (Kolla and Litwack, 2000). La protéine NF-κB, connue pour son rôle majeur dans l’immunité et la réponse au stress cellulaire (Oeckinghaus et al., 2011), est le plus souvent rencontrée comme un hétérodimère des sous-unités p50 et p65. La sous-unité p65 interagit de façon indirecte avec le MR in vitro et inhibe son activité transactivatrice ligand-induite sur un promoteur artificiel (Leroy et al., 2009).

Introduction

Quelques autres corépresseurs du MR ont été décrits et sont présentés dans le Tableau 3 (Bulynko and O’Malley, 2011). L’un d’eux, NF-YC, est spécifique du MR et n’est recruté qu’en présence d’aldostérone (Murai-Takeda et al., 2010). Il sera évoqué plus en détail dans la troisième partie de l’introduction.

Domaine d’interaction Noms Fonctions Références dans le MR Wang et al., 2004; NCoR LBD Recrutement des HDAC Karagianni and Wong, 2007 Wang et al., 2004; SMRT LBD Recrutement des HDAC Karagianni and Wong, 2007 Ligase SUMO E3; Répression Pascual-Le Tallec et PIAS1 AF-1b de l’activité de transactivation al., 2003 p65 (NFκB Répression de l’activité de ND Leroy et al., 2009 subunit) transactivation Inhibition de l’interaction N/C Murai-Takeda et al., NF-YC AF-1 et LBD induite par l’aldostérone 2010 Régulation de l’apoptose ; DAXX NTD Répression de l’activité de Obradović et al., 2004 transactivation Gemin4 LBD Facteur d’élongation Yang et al., 2015 SSRP1 ND Facteur d’élongation Yang et al., 2015

Tableau 3 : Les corépresseurs connus pour interagir avec le MR. DAXX : Death domain associated protein ; Gemin4 : Gem nuclear organelle associated protein 4 ; NCoR : Nuclear receptor Corepressor ; NF-YC : Nuclear Factor Y-box C ; p65 : RELA proto-oncogene, NFκB subunit ; PIAS1 : Protein Inhibitor of Activated STAT 1 ; SMRT : nuclear receptor corepressor 2 ; SSRP1 : Structure Specific Recognition Protein 1. ND : Non déterminé. D’après (Fuller et al., 2017).

Le MR au niveau de ses sites de liaison génomiques interagit avec de nombreux partenaires transcriptionnels. Ces interactions sont dynamiques et séquentielles. Il a été décrit pour le récepteur α des estrogènes (ERα) que la liaison de l’œstradiol entrainait dans le noyau la formation d’un complexe de pré-initiation de la transcription, qui est alors responsable de la stabilisation du locus, du recrutement de l’ARN Polymérase de type II (RNA Pol II) et de la transcription du gène cible (Quintin et al., 2014). Le recrutement de coactivateurs par le MR est associé au recrutement de l’ARN Polymérase de type II (Pascual-Le Tallec et al., 2005), ce qui permet la transcription du gène cible en ARN messager.

Introduction d) Extinction du signal et adressage au protéasome

Nous l’avons vu dans la partie sur les PTM du MR, l’inhibition de l’ubiquitination inhibe l’activité transrégulatrice du MR. En effet, le concept selon lequel toute signalisation n’a de sens que si elle est limitée dans le temps s’applique au MR. La dégradation de la protéine MR par le protéasome fonctionnel est indispensable au maintien de l’activité transrégulatrice du MR (Tirard et al., 2007).

Enfin, il a été montré pour le GR que la dissociation du ligand dans le compartiment nucléaire favorise l’export nucléaire (Vandevyver et al., 2012). En effet, le NES compris dans le DBD est lié par le récepteur de l’export nucléaire calréticuline (CRT) qui permet au GR, de façon GTP- dépendante et en liant le cytosquelette, de sortir du noyau. On peut faire l’hypothèse que des mécanismes similaires permettent au MR d’être exporté du noyau, puis d’être à nouveau pris en charge par les protéines chaperonnes.

2. Voies non génomiques

La voie d’action génomique du MR est la voie la mieux caractérisée actuellement, mais pas l’unique. Plusieurs études ont mis en évidence que le MR peut aussi relayer des effets non génomiques, décrits uniquement pour l’aldostérone comme ligand, dans un certain nombre de ses tissus cibles (Ruhs et al., 2017). Une première étude sur les muscles lisses des artères a montré que l’injection de sodium radioactif dans un rat traité par l’aldostérone entraînait en 15 min un efflux. Cet effet n'étant pas inhibé par l’actinomycine D, un inhibiteur de la transcription, l’effet non-génomique de l’aldostérone était postulé (Moura and Worcel, 1984). Ensuite, au niveau moléculaire, l’incubation de leucocytes mononucléaires humains avec de l’aldostérone marqué à l’iode 135 et ne pouvant pas pénétrer dans la cellule, induit rapidement l’activité de l’antiport Na+/H+ (Wehling et al., 1991). La rapidité de l’effet (quelques minutes) était en faveur d’un effet non-génomique et, puisque l’effet avait lieu avec une aldostérone ne passant pas la membrane, cela laissait présager un récepteur membranaire ou juxta-membranaire.

Plusieurs équipes ont alors cherché à identifier un nouveau récepteur membranaire à l’aldostérone. Aucun ne l’est à ce jour. Il semble même que les effets non-génomiques de l’aldostérone soient relayés par le MR lui-même, puisqu’ils sont inhibés par des antagonistes du MR comme la spironolactone et l’éplérénone (Callera et al., 2005; McEneaney et al., 2010b). Un site de palmitoylation, qui est le greffage d’un groupement palmitate sur une protéine permettant son ancrage à la membrane plasmique, a été recherché dans le MR, par homologie avec ce qui

Introduction avait été décrit pour le ER, le PR et le AR (Pedram et al., 2012). Aucun site de palmitoylation n’a été identifié mais le MR est associé à des protéines d’échafaudage, la striatine et la cavéoline 1 (Grossmann et al., 2010). Le MR sous-membranaire, activé par l’aldostérone, agit directement sur plusieurs récepteurs membranaires associés à de nombreuses voies de transduction intracellulaire (Ruhs et al., 2017).

Dans le rein, en parallèle de la voie génomique qui active la transcription de gènes codant pour des canaux ioniques, la voie non-génomique de MR permet en quelques minutes l’adressage de ces canaux à la membrane, côté apical le canal ENaC (McEneaney et al., 2008), côté basolatéral pour la Na+/K+, ATPase (Dooley et al., 2013), et le maintien de leur activité (Kusche- Vihrog et al., 2008). Dans les cellules musculaires lisses vasculaires (CMVL), le complexe aldostérone-MR active de nombreuses voies de transduction, dont le complexe NADPH oxydase (NOX) (Harvey et al., 2017). Les NOX induisent la production d’espèces réactives de l’oxygène (ROS) qui, nous le détaillerons plus loin, sont impliqués dans des dysfonctionnements vasculaires et la fibrose vasculaire. Ainsi, les effets non-génomiques du MR sont indissociables des effets génomiques et sont, comme ces derniers, impliqués autant dans le rôle physiologique que pathologique de la signalisation minéralocorticoïde.

E. Les gènes cibles du MR

Comme nous venons de le décrire, la signalisation du MR se traduit par des effets à court- terme dictés par une voie non-génomique, et des effets à moyen- et long-terme consécutifs à la régulation de cibles génomiques. Quelques-unes des cibles génomiques du MR ont été identifiées, en particulier dans le rein. Les gènes régulés codent pour un réseau interconnecté de protéines permettant la réabsorption de sodium et l’excrétion de potassium (Shibata, 2017). Certains de ces gènes sont présentés ici.

Les cibles génomiques du MR dans les tissus épithéliaux ont en grande majorité été identifiées dans le rein. Le MR, activé par l’aldostérone, induit d’abord la transactivation de gènes dits précoces, qui vont coder pour des modulateurs de l’activité du canal ENaC et de la pompe Na+/K+, ATPase (Thomas et al., 2008), entraînant une activation rapide de la réabsorption de sodium. Ensuite, le MR module des effets intermédiaires et à long-terme,

Introduction

Figure 11 : Le complexe aldostérone-MR régule la réabsorption de sodium dans les cellules du tubule contourné distal. Le complexe aldostérone-MR transactive certains gènes dont SCNN1A (αENaC), ATP1A1 (Na/K-ATPase), SGK1, CAP1, WNK1 (KS-WNK1), TSC22D3 (GILZ), FXYD4 (CHIF), CNKSR3, USP2, FKBP5 et PER1. Le canal ENaC et la pompe Na/K-ATPase permettent la réabsorption transépithéliale de sodium. KS-WNK1, SGK1, USP2, CAP1 et GILZ concourent au maintien de l’activité de ENaC, ou à son maintien à la membrane. En particulier, la kinase KS-WNK1 maintient ENaC et SGK1 activés. La kinase SKG1 inactive par phosphorylation (P) NEDD4-2, ce qui permet à ENaC de ne pas être ubiquitiné et adressé au protéasome. USP2, en compétition avec NEDD4-2, désubiquitine ENaC. SGK1 active aussi CAP1 et GILZ, qui participe au maintien de l’activité de ENaC. CHIF et CNKSR3 participe au maintien de l’activité de la pompe Na/K-ATPase. FKBP5 est une cochaperonne participant à la stabilité du MR dans le cytoplasme. PER1, qui fait partie de l’horloge circadienne intracellulaire, participe à l’activation de ENaC en fonction du rythme circadien. Figure extraite et modifiée de (Viengchareun et al, 2007).

Introduction permettant notamment le maintien de la réabsorption et le renouvellement des canaux et pompes (Eaton et al., 2001).

Le canal épithélial à sodium ENaC est une protéine transmembranaire perméable au sodium, de la superfamille de canaux ioniques ENaC/dégénérines (Hanukoglu and Hanukoglu, 2016). Le canal ENaC est composé des trois sous-unités α, β et γ, codées respectivement par les gènes SCNN1A (locus 12p13), SCNN1B et SCNN1G (loci 16p12.1 et 16p12.2) (Canessa et al., 1994). Il a été identifié en patch-clamp sur des tubules collecteurs du rein comme un canal permettant la diffusion facilitée du sodium avec une conductance de 5 pS, une sélectivité 100 fois supérieure pour le Na+ que pour le K+ (Palmer and Frindt, 1986), et une forte sensibilité à l’amiloride, un diurétique puissant (Kellenberger and Schild, 2002). Grâce aux approches d’hybridation in situ et d’immunocytochimie, l’expression du canal ENaC a été montré dans de nombreux épithélia, dont la partie distale du néphron, l’épithélium du colon, et les canaux excréteurs des glandes salivaires et sudoripares (Duc et al., 1994). Par RT-qPCR et western blot, il a été identifié dans les kératinocytes (Brouard et al., 1999) et la cochlée (Couloigner et al., 2001). Dans la partie distale du néphron, le canal ENaC est localisé à la membrane apicale de la cellule tubulaire (Loffing et al., 2001), où il permet la réabsorption du sodium du lumen vers le milieu intracellulaire (Figure 11). Dans la partie distale du néphron, l’aldostérone active l’expression de la sous-unité α du canal, mais pas celles des sous-unités β et γ, comme cela a été montré par western blot (Masilamani et al., 1999) et au niveau des ARNm (Renard et al., 1995). En générant des délétions dans la région promotrice du gène SCNN1A et en étudiant la transrégulation d’un rapporteur luciférase, il a été démontré que l’effet de l’aldostérone était relayé par le MR qui se lie sur un GRE palindromique unique et suffisant pour transactiver ce gène (Mick et al., 2001). L’excès intracellulaire de sodium, généré par l’expression d’ENaC, est directement éliminé au niveau de la membrane basolatérale par la pompe Na+/K+, ATPase (Rostgaard and Møller, 1980).

La pompe Na+/K+, ATPase est une protéine transmembranaire de la superfamille des P- ATPase, qui regroupe de nombreux transporteurs actifs capables de s’autophosphoryler et d’utiliser l’ATP comme source d’énergie (Chan et al., 2010; Palmgren and Nissen, 2011). Cette pompe est composée de deux sous-unités, α et β. Ces sous-unités possèdent chacune 4 isoformes ayant des spécificités fonctionnelles et tissulaires (Maeda et al., 1998). La pompe Na+/K+, ATPase est ubiquitaire et, en extrudant le Na+ et en faisant entrer de K+, elle permet le maintien du gradient transmembranaire. Cette fonction est utilisée dans la dépolarisation du signal nerveux ou cardiaque, dans la transduction de signal intracellulaire, ou encore dans l’excrétion de sodium dans l’urine primaire (Jørgensen, 1986; Horisberger, 2004; Reinhard et al., 2013). Sur des

Introduction cellules du canal collecteur cortical de rat ex vivo, l’aldostérone induit l’adressage de la pompe Na+/K+, ATPase à la membrane basolatérale en moins de 3 h (Summa et al., 2001). Cet effet est relayé par le MR au niveau d’un MRE/GRE palindromique identifié dans le promoteur du gène ATP1A1, qui code pour la sous-unité α, seule sous-unité régulée transcriptionnellement par le complexe aldostérone-MR (Kolla et al., 1999). L’excès intracellulaire de Na+, généré à travers le canal ENaC, est éliminé dans le milieu intérieur grâce à la pompe Na+/K+, ATPase. Grâce à ces deux acteurs majeurs, activés par le complexe aldostérone-MR, le sodium est réabsorbé de l’ultrafiltrat glomérulaire, ou urine primitive, vers le milieu intérieur (Figure 11).

Si le MR et l’aldostérone régulent directement la transactivation des gènes SCNN1A et ATP1A1, ils régulent aussi d’autres mécanismes favorisant le maintien de leur localisation et de leur activité. L’ubiquitine-ligase (E3) NEDD4-2 induit l’endocytose et la dégradation du canal ENaC activé, et son expression est constitutive dans la partie distale du néphron (Rotin and Staub, 2012). L’utilisation de comparaison de banque d’hybridation de transcrits, ainsi que de Northern blots et de Western blots, ont permis d’identifier un autre gène cible de l’aldostérone : SGK1, qui code pour l’enzyme Serum and Glucocorticoid-regulated Kinase 1 (Pearce, 2001). La transcription du gène SGK1 est fortement et précocement (dès 30 min) activée par l’aldostérone via le MR qui se lie sur un GRE localisé dans le promoteur du gène (Chen et al., 1999; Náray-Fejes-Tóth et al., 1999; Raikwar and Thomas, 2017). L’augmentation de la transcription de SGK1 entraîne un maintien du canal ENaC à la membrane apicale, et donc de la réabsorption de sodium (Pearce and Kleyman, 2007). En particulier, SGK1 inactive NEDD4-2 par phosphorylation au niveau des sérines (Bhalla et al., 2006). Ainsi, NEDD4-2 est dissocié du canal ENaC, ce qui empêche son ubiquitination, et ainsi, ce dernier reste actif au niveau de la membrane (Debonneville et al., 2001). En parallèle, SGK1 active la protéase activatrice de canaux CAP1 (aussi appelée prostatine) (Rotin, 2000), qui est ancrée à la membrane plasmique où elle est elle-même nécessaire au maintien de l’activité du canal ENaC (Vallet et al., 1997). Le complexe aldostérone-MR, en plus d’activer la prostatine indirectement via la transactivation de SGK1, augmente aussi directement l’expression du transcrit et de la protéine prostatine, comme cela a été montré in vitro et in vivo par Northern blot et Western blot (Narikiyo et al., 2002).

Une autre kinase est induite par le complexe aldostérone-MR dans le rein, la With No Lysine kinases 1 (WNK1) (Náray-Fejes-Tóth et al., 2004). Le rôle de cette sérine/thréonine kinase dans le rein a initialement été identifié par la découverte d’une mutation activatrice dans le gènes WNK1 chez des patients atteints d’hypertension artérielle associée à un pseudohypoaldostéronisme de type II (détails dans la Partie II de l’introduction) (Wilson et al., 2001). Le développement d’un

Introduction anticorps polyclonal, et son utilisation en microscopie à fluorescence sur des coupes de rein de souris, ont mis en évidence une forte expression de WNK1 dans le cytoplasme des cellules du néphron distal. L’analyse du transcrit a mis en évidence deux isoformes de WNK1, la forme longue WNK1 et une forme courte exprimée spécifiquement dans le rein, KS-WNK1. L’analyse de l’expression des transcrits par RT qPCR a d’abord mis en évidence une induction rapide (30 min) de l’expression de l’isoforme KS-WNK1 par l’aldostérone via le MR (Náray-Fejes-Tóth et al., 2004). Des analyses fonctionnelles in vitro par électrophysiologie ont démontré que KS-WNK1 augmentait significativement la réabsorption de sodium sur des modèles rénaux polarisés. Cette kinase active le co-transporteur de Na+/Cl- NCC, indispensable partenaire de ENaC pour la réabsorption de sodium dans la membrane apicale. Enfin, il a été montré que SGK1, induit par l’aldostérone, permettait le maintien de la protéine KS-WNK1 et de son activité, en inhibant l’ubiquitine ligase NEDD4-2 dont KS-WNK1 est une cible (Roy et al., 2015). Plusieurs sites de liaisons du GR ont été identifiés dans le gène WNK1 et son promoteur par ChIP-Seq, dont un hémi-GRE contenu dans l’intron 5 (Gerstein et al., 2012; Wang et al., 2012, 2013), mais aucun n’a été validé fonctionnellement à ce jour.

Le développement de l’approche d’analyse en série de l’expression des gènes (SAGE), une approche d’identification transcriptomique partielle permettant le séquençage de l’ensemble des ADNc d’une cellule, a été appliquée sur une lignée de cellules du tubule collecteur cortical de souris après traitement par aldostérone ou non (Robert-Nicoud et al., 2001). Cela a permis la première identification d’un set important de 34 gènes transactivés par l’aldostérone et de 29 gènes transréprimés. Parmi les candidats identifiés et activés précocement (dès 30 min) par l’aldostérone, se trouve le transcrit du gène TSC22D3 (pour TSC22 Domain family member 3) qui est traduit en facteur de transcription GILZ (pour Glucocorticoid-Induced Leucine Zipper). GILZ est transactivé par le MR, comme cela a été montré par une stratégie de gène rapporteur luciférase (Fernandes-Rosa et al., 2011). Dans la partie distale du néphron, GILZ agit directement sur la kinase ERK capable d’inhiber le canal ENaC, et donc permet le maintien de l’activité de ENaC (Soundararajan et al., 2005). Très récemment, il a été montré que GILZ est essentiel à l’excrétion de potassium par le rein. En inhibant le canal NCC, GILZ favorise l’excrétion de sodium, ce qui augmente à la fois la réabsorption de Na+ par ENaC, et par équilibre du potentiel électrochimique transmembranaire, augmente l’excrétion du potassium par le canal K+ ROMK (pour Renal Outer Medullary K+ channel) (Rashmi et al., 2017).

Fakitsas et al. ont appliqué les puces à ADN pour identifier in vivo de nouvelles cibles de l’aldostérone sur des microdissections de néphrons distaux de souris traitées par l’aldostérone

Introduction

(Fakitsas et al., 2007). Ceci a permis d’identifier 9 gènes dont le nombre de transcrits est significativement augmenté par l’aldostérone, et 13 significativement diminué. Parmi les transcrits de gènes transactivés, l’isoforme 45 du gène USP2 (Ubiquitin Specific Peptidase 2) a été investigué in vitro. La protéine USP2 interagit avec le canal ENaC pour exciser les ubiquitines ajoutées par NEDD4-2, permettant au canal de se maintenir à la membrane apicale et d’y exercer sa fonction.

Quelques autres acteurs, dont l’expression est augmentée par le complexe aldostérone-MR, ont été identifiés et validés au niveau des transcrits et des protéines. Le gène CNKSR3 (pour Connector enhancer of kinase suppressor of ras 3) est la cible directe du complexe aldostérone- MR, comme cela a été démontré par immunoprécipitation de la chromatine (ChIP) sur deux GRE identifiés dans le promoteur du gène (Ziera et al., 2009). La protéine CNKSR3 est impliquée dans le maintien de l’activité de la pompe Na+/K+-ATPase. La stabilité de la sous-unité α de cette pompe est garantie en partie par la protéine CHIF (pour Channel-Inducing Factor, codé par le gène FXYD4) (Capurro et al., 1997; Wald et al., 1996, 1997), autre cible de l’aldostérone. Enfin, l’aldostérone favorise aussi la stabilité de son propre récepteur en activant l’expression de la protéine FKBP5 (pour FK506 Binding Protein 5), une cochaperonne de la HSP90 (Jääskeläinen et al., 2011).

Parmi les gènes impliqués dans la signalisation minéralocorticoïde rénale, a été identifié PER1, codant pour le facteur de transcription PER1 (pour PERiod circadian protein homolog 1), un des acteurs majeurs de l’horloge circadienne intracellulaire périphérique, notamment dans le rein (Mészáros et al., 2014). Par puce à ADN, il a été démontré que la transcription de PER1 est augmentée par l’aldostérone dans une lignée rénale murine (Gumz et al., 2009). L’extinction de PER1 avec un ARN silenceur (siRNA) spécifique entraîne la réduction drastique du nombre de transcrit de SCNN1A. Ces résultats ont été confirmés dans les souris invalidées pour PER1. De plus, il a été montré que le transcrit de SCNN1A était exprimé de façon circadienne chez les souris sauvages, alors que cette variation cyclique n’était pas présente chez les KO PER1. Au niveau moléculaire, après mutagenèse dirigée sur deux éléments de réponse de PER1 (les E-boxes) dans le promoteur de SCNN1A, l’expression du gène était abolie (Richards et al., 2013). Des expériences de précipitation et de ChIP ont alors mis en évidence que le MR et PER1 interagissent sur les E-boxes de ce promoteur après activation par l’aldostérone (Gumz et al., 2010; Richards et al., 2013). Cela signifie que le MR collabore avec PER1, donc par extension avec l’horloge circadienne intracellulaire, pour réguler le canal ENaC et probablement d’autres cibles

Introduction génomiques. Il existe donc un lien direct entre la signalisation minéralocorticoïde et le rythme circadien de la réabsorption de sodium par le rein (Bonny et al., 2013).

Les différents acteurs de la signalisation minéralocorticoïde rénale présentés ici montrent combien cette voie est intriquée et complexe. L’identification de cibles génomiques de l’aldostérone a toujours mis à profit les approches contemporaines les plus pointues (Tableau 4). Si la liste présentée ici est loin d’être exhaustive, il est vraisemblable que le complexe aldostérone-MR agit sur de nombreux autres gènes et que les aspects cinétiques et la dynamique de régulation croisée jouent aussi un rôle majeur dans le contrôle du transport vectoriel ionique ; certains gènes servant ses effets immédiats, d’autres des effets à plus long terme. L’approche de ChIP associée au séquençage nouvelle génération et haut-débit (ChIP-Seq) permet l’identification de l’ensemble des cibles génomiques d’un facteur de transcription, ou cistrome (Mundade et al., 2014). Elle a déjà permis l’identification des cistromes de GR (Pan et al., 2011; Polman et al., 2012; Thomas et al., 2015), de AR (Lin et al., 2009; Massie and Mills, 2011) et de PR (Mazur et al., 2015; Rubel et al., 2012). La mise en œuvre de cette approche sur le MR sera détaillée dans le chapitre 1 des résultats.

Nombre Technique Modèle Anticorps de cibles Références identifiées Hippocampe Anti-MR polyclonal H- (van Weert et al., ChIP-Seq 1465 Rats ADX 300 (Lapin, Santa Cruz) 2017) Cellules mDCT Anti-FLAG monoclonal (Ueda et al., ChIP-Seq transfectées avec 1113 M2 (Souris, Sigma) 2014) 3xFLAG-hMR Cellules HEK293 (Ziera et al., Microarray transfectées avec Anti-myc (Abcam) 36 2009) myc-tagged-hMR Néphron distal (Fakitsas et al., Microarray 22 Souris 2007)

(Robert-Nicoud et SAGE Cellules mpkCCDcl4 63 al., 2001)

Tableau 4 : Identification de transcriptomes et de cistromes du MR et de l’aldostérone. Rats ADX : Rats surrénalectomisés. Cellules mDCT : Cellules murines du tubule contourné distal. Cellules mpkCCDcl4 : cellules principales du canal collecteur cortical de rein de Souris, clone 4.

Introduction

II. Physiopathologie de l’Aldostérone et du MR

De nombreuses études ont montré que des dérèglements, en particulier la suractivation, de la signalisation minéralocorticoïde étaient impliqués dans des pathologies majeures chez l’Homme, telles que l'hypertension artérielle, l’insuffisance cardiaque et certaines néphropathies chroniques. Ce constat a conduit à rechercher des antagonistes du récepteur des minéralocorticoïdes, les antiminéralocorticoïdes, visant à contrecarrer la suractivation de cette signalisation. La physiopathologie du MR et ses antagonistes seront présentés successivement dans le présent chapitre.

A. Invalidations et sous-expressions du MR

1. Modèles animaux

L’étude de la signalisation minéralocorticoïde in vivo a profité largement du clonage du gène du MR humain, il y a 30 ans, par l’équipe du Pr Evans (Arriza et al., 1987) qui a permis de développer de nombreuses approches d’immunodétection et d’études in vitro, notamment de mutagenèse dirigée. Aussi, nos connaissances sur le MR ont largement bénéficié de l’apport, il y a 20 ans, de la technologie de recombinaison homologue qui a permis de générer le premier modèle d’invalidation totale du MR chez la souris (Berger et al., 1998).

Afin de confirmer l’importance du rôle physiologique du MR, l’équipe de G. Schütz a réalisé le premier modèle murin d’invalidation totale du gène Nr3c2 (Berger et al., 1998). Après un développement in utero normal, les nouveau-nés meurent prématurément au 10ème jour de vie. Leur mort est causée par une perte urinaire massive de sodium et d’eau, alors même que, de façon étonnante, le canal ENaC et la pompe Na+/K+, ATPase sont transcrits à des niveaux identiques à ceux des souris sauvages dans le rein et le colon. Ces observations indiquaient une incapacité rénale à réabsorber le sodium. En parallèle, on observait une hyperkaliémie et une hyponatrémie : l’homéostasie électrolytique était donc bouleversée par l’absence de MR. De plus, les concentrations plasmatiques d’aldostérone et de rénine étaient élevées, ce qui semblait montrer un fonctionnement normal du SRAA. Les nouveau-nés KO MR peuvent néanmoins être secourus par des injections intrapéritonéales d’une solution de chlorure de sodium (Bleich et al.,

Introduction

1999). Le phénotype de ces nouveau-nés KO MR correspond bien à un tableau de forme primaire de résistance aux minéralocorticoïdes, ou pseudohypoaldostéronisme de type 1 (Zennaro, 1998).

L’équipe de Reichardt a mis au point une stratégie d’interférence ARN (RNAi) pour contre- exprimer le MR chez le rat (siMR, knockdown total) (Lim et al., 2008). Les rats transgéniques issus de la première portée invalidée expriment très peu ou pas de MR dans le rein et l’hippocampe. Certains meurent avant 3 semaines de vie, probablement pour les mêmes raisons que les souris MR KO. Pour les survivants, à 3 semaines, les concentrations de rénine et d’aldostérone dans le sang étaient élevées. Par contre, le niveau de transcription des gènes codant pour le canal ENaC et pour Sgk1 étaient augmenté (de 1,6 à 10 fois), et leur niveau protéique comparable aux sauvages. L’augmentation du niveau de transcrits était probablement une conséquence de l’hyperaldostéronémie qui agit sur un MR faiblement mais continuellement exprimé, contrairement au modèle de souris KO MR où l’expression est totalement abolie. Enfin, les rats transgéniques adultes présentaient une hyponatrémie, une hyperkaliémie et une hypernatriurie, révélant une altération franche de l’homéostasie hydroélectrolytique. L’ensemble de ces résultats concordent avec ceux obtenus avec les souris KO MR : les rats siMR présentent les symptômes d’un pseudohypoaldostéronisme de type 1.

Ces deux études ont permis de mettre en évidence l’absence de phénomène de compensation par un autre récepteur, en particulier le récepteur des glucocorticoïdes (GR) et, ainsi, de démontrer le rôle essentiel du MR dans l’homéostasie hydrosodée.

2. Pseudohypoaldostéronisme de type 1 et mutations du gène NR3C2

Le pseudohypoaldostéronisme de type 1 (PHA1) correspond à un tableau clinique de résistance à l’aldostérone. Les signes biologiques rappellent le bilan ionique du nouveau-né humain : hypernatriurie, hyponatrémie, hyperkaliémie et concentrations plasmatiques d’aldostérone et de rénine élevées. C’est une maladie génétique rare se déclinant schématiquement sous deux formes : le PHA1 rénal et le PHA1 systémique. Le PHA1 rénal, à transmission autosomale dominante, est associé à des mutations inactivatrices du gène codant le MR (NR3C2). Le PHA1 systémique, à transmission autosomale récessive, est associé à des mutations homozygotes d’une des sous-unités du canal ENaC (SCNN1A, SCNN1B, SCNN1G) (Geller et al., 1998 ; Sartorato et al., 2004a). Dans ce dernier cas, les mutations du canal ENaC, qui concernent majoritairement les sous-unités α et β, perturbent l’assemblage tridimensionnel du

Introduction canal, ce qui empêche la réabsorption efficace de sodium. Cela cause des pertes urinaires massives de sodium, mais aussi au niveau colique, pulmonaire et des glandes salivaires et sudoripares (Hanukoglu, 1991 ; Chang et al., 1996).

Le PHA1 rénal se traduit par un retard de croissance et une acidose métabolique. Les investigations cliniques et phénotypiques des patients atteints par cette pathologie ont permis l’identification d’environ une cinquantaine de mutations dans le gène NR3C2 (Zennaro and Fernandes-Rosa, 2017). La prévalence du PHA1 rénal est évaluée à une naissance sur 80000, et une mutation du gène NR3C2 est identifiée dans 62% de cas de PHA1. Ces mutations sont retrouvées sur les différents exons du gène. Par exemple, dans l’exon 2, codant le NTD, des mutations non-sens, indels (insertion/délétion) ou silencieuses ont été décrites, mais elles ne modifient pas la fonctionnalité du MR. Par contre, les mutations hétérozygotes retrouvées dans les exons codant le DBD (exons 3 et 4) se traduisent par des modifications de liaison à l’ADN, une activité transcriptionnelle réduite ou abolie, ce qui se traduit par une transactivation aldostérone-induite faible ou nulle des gènes cibles SGK1, SCNN1A, NDRG2 et TSC22D3 (Fernandes-Rosa et al., 2011). De leur côté, les mutations hétérozygotes localisées dans le LBD (exons 5 à 9) induisent une liaison de l’aldostérone diminuée ou absente (Sartorato et al., 2004b; Fernandes-Rosa et al., 2011).

Hormis ces mutations, plusieurs polymorphismes dans le gène NR3C2 ont été identifiés sans être impliqués dans le PHA1. Le consortium ExAC (Exome Aggregation Consortium) a répertorié 380 polymorphismes rares pour le transcrit du gène NR3C2 (Lek et al., 2016), non impliqués en pathologie, sans conséquence majeure sur la fonctionnalité du MR, montrant une grande susceptibilité du gène NR3C2 pour les mutations faux-sens et non-sens. De plus, le nombre de polymorphismes fréquents du MR (fréquence allélique ≥ 5%) peut probablement expliquer la variabilité individuelle des niveaux de sensibilité aux minéralocorticoïdes dans plusieurs tissus : sensibilité au sel, pression artérielle, réponse au stress ou encore dépression. En effet, ces polymorphismes sont associés des niveaux d’expression et d’activité transcriptionnelle du MR variables (Zennaro and Fernandes-Rosa, 2017).

Introduction

B. Suractivation de la signalisation minéralocorticoïde et pathologies

1. Modèles murins de surexpression du MR

Afin d’étudier en détail les effets physiopathologiques de la signalisation minéralocorticoïde, notre laboratoire a développé le premier modèle de souris transgéniques surexprimant le MR humain sous le contrôle du promoteur P1 (Le Menuet et al., 2001). Les souris transgéniques (souris TG P1-hMR) surexpriment le MR dans l’ensemble des tissus cibles de l’aldostérone et, en particulier, dans le rein et le cœur. Les souris P1-hMR présentent une hypertrophie rénale bilatérale, ou unilatérale compensée par une atrophie de l’autre rein, associées à des tubules dilatés ou nécrotiques. La suractivation de la signalisation minéralocorticoïde se traduit dans le rein et le cœur par une augmentation de l’expression des gènes cibles dont Sgk1 (5 fois). De façon surprenante, ces signes n’entraînent pas de déséquilibre de l’homéostasie hydrosodée, mais une baisse de 30% de la kaliurie, conséquence d’une baisse de la sécrétion de potassium. Les souris P1-hMR ne présentent pas d’hypertension artérielle. Par contre, au niveau cardiaque, elles développent des anomalies fonctionnelles dont des arythmies et des poussées de tachycardie. La surexpression du MR dans ces souris apporte des arguments forts en faveur de l’implication de la signalisation minéralocorticoïde dans le développement de pathologies cardiorénales.

Afin de préciser les effets cardiaques d’une activation excessive du MR, les souris MR-Cardio, dans lesquelles la surexpression du MR est exclusivement induite dans les cardiomyocytes, ont été générées (Ouvrard-Pascaud et al., 2005). Dans le cœur de ces souris, il existe un remaniement des canaux ioniques, notamment des canaux calciques de type T dont l’expression est anormalement élevée, ce qui augmente l’influx calcique (Maturana et al., 2009). Ceci résulte en une repolarisation prolongée dans les cardiomyocytes, et plus généralement dans les ventricules. Cette anomalie est responsable d’arythmies ventriculaires sévères (Ouvrard-Pascaud et al., 2005). Plus récemment, le transcriptome cardiaque de ces souris a été résolu, après traitement ou non par l’aldostérone pendant 7 jours. L’aldostérone entraîne l’activation et la répression de 265 gènes, ce qui démontre une action spécifique de l’aldostérone dans les cardiomyocytes (Messaoudi et al., 2013). En particulier, l’aldostérone stimule via le MR, l’expression de CTGF (pour Connective Tissue Growth Factor). Si cette protéine est indispensable au développement et à la différenciation de certains tissus, notamment dans les vaisseaux, une dérégulation de son expression est récurrente dans le développement de fibrose cardiovasculaire (Thanigaimani et al., 2017). Par ailleurs, ces souris qui développent une insuffisance cardiaque

Introduction ont un niveau de transcrits et de protéines CTGF dans les cardiomyocytes significativement augmentés (6 et 8 fois, respectivement) (Messaoudi et al., 2013). Notre équipe a établi à partir des blastocytes de souris Tg P1-hMR, des cellules souches embryonnaires surexprimant le MR humain (x2), puis a induit leur différenciation en cardiomyocytes (Le Menuet et al., 2010). En comparaison aux cellules contrôles, les cardiomyocytes surexprimant le MR ont une fréquence de battements augmentée de 60%, et une expression remaniée de plusieurs canaux ioniques (HCN1, HCN4, Cav1.2, Kir2.1).

L’ensemble de ces résultats confirme un rôle délétère et prépondérant de la signalisation minéralocorticoïde dans le cœur.

2. Stratégies d’interférence du MR

Environ 10% des patients souffrant d’hypertension artérielle présentent un hyperaldostéronisme (Funder, 2012). Dans le but de préciser le rôle délétère de l’aldostérone dans le système cardiorénal, des études sur le développement d’hypertension induite par le froid (CIH pour Cold-Induced Hypertension) ont été menées chez le rat (Wang et al., 2006). Les rats ont d’abord été maintenus dans une chambre froide (à 6,7°C) pendant une première semaine. Ils ont ensuite été répartis en trois groupes recevant en intraveineuse soit un adénovirus (AAV) recombiné avec un ARN interférent du MR humain (AAV.MR-shRNA), soit un AAV recombiné avec un ARN interférent contrôle (AAV.Control-shRNA), ou bien du PBS. Trois semaines après l’injection, des analyses en Western blot et en immunohistochimie réalisées sur les reins ont validées la stratégie d’interférence en montrant une diminution de moitié de l’expression rénale du MR chez les rats AAV.MR-shRNA par rapport aux rats contrôles. Chez les Rats AAV.Control- shRNA et PBS, l’expression du MR étaient augmentée dans le rein et dans le cœur en parallèle du développement de CIH (Sun et al., 2008). La mesure de la pression artérielle tous les 4 jours pendant les 3 semaines suivant l’injection a montré une augmentation forte (de 140 mmHg à 170 mmHg) chez les rats AAV.Control-shRNA et PBS, ce qui valide le protocole d’induction de CIH. De façon intéressante, le groupe de rats AAV.MR-shRNA ne développe pas d’hypertension : l’inhibition du MR par interférence prévient donc le développement de CIH. L’inhibition du MR augmente significativement la natriurèse (40%), comme cela était attendu, mais aussi diminue la protéinurie (57%) par rapport aux contrôles. Une protéinurie élevée est un signe majeur des néphropathies liées à une hypertension. Sa diminution dans les rats AAV.MR-shRNA par rapport au contrôle sous-tend l’absence de conséquence rénale par le froid. En effet, contrairement aux

Introduction contrôles, les rats AAV.MR-shRNA ont une atténuation marquée de l’hypertrophie rénale (Wang et al., 2006). De façon intéressante, le cœur est lui aussi moins hypertrophique (Sun et al., 2008). L’ensemble de ces résultats confirme que le MR a un rôle délétère dans l’initiation et le développement de l’hypertension induite par le froid, au cours de laquelle son expression est significativement augmentée.

Comme décrit précédemment, le MR est exprimé dans les cellules musculaires lisses vasculaires (CMLV) et dans l’endothélium coronarien. L’équipe du Dr Ouvrard-Pascaud a utilisé un modèle de Souris KO pour le MR dans les CMLV chez lesquelles un infarctus du myocarde a été induit chirurgicalement. En comparaison aux contrôles, les Souris KO MR-CMLV présentent une amélioration de la fonction endothéliale coronarienne (relaxation augmentée de 12% après deux mois), ce qui participe à l'amélioration de la perfusion myocardique (Gueret et al., 2016). Ils montrent ainsi que le MR est impliqué dans le dysfonctionnement endothélial coronarien qui est induit par un stress oxydatif et dans la diminution de la réserve coronarienne.

3. Une mutation activatrice du MR chez l’Homme

Chez l’Homme, la mutation S810L du MR, où la sérine 810 est mutée en leucine, a été découverte après séquençage du gène NR3C2 chez un patient atteint d’une forme sévère d’hypertension familiale (Geller et al., 2000). Les personnes portant cette mutation, appartenant toutes à la même famille, développent une hypertension précoce avant l'âge de 15 ans (un trait rare de la population). De plus, les porteuses de cette mutation présentaient une hypertension exacerbée pendant la grossesse. La mutation S810L confère aux antagonistes du MR, la progestérone et la spironolactone, une activité agoniste aussi puissante que celle de l'aldostérone (Pinon et al., 2004). Ainsi, chez les femmes enceintes, la progestérone dont la concentration plasmatique est explosive durant la grossesse, est capable d’activer le MR, aggravant ainsi l’hypertension artérielle. Il a, par ailleurs, été proposé que la cortisone, le métabolite inactif du cortisol généré par la 11β-hydroxystéroïde déshydrogénase de type 2 dans les cellules épithéliales cibles de l'aldostérone, se comportait comme un agoniste de ce mutant, et serait ainsi responsable de l'hypertension artérielle des hommes et des femmes en dehors des grossesses (Rafestin-Oblin et al., 2003). La mutation S810L est localisée dans la poche de liaison du ligand du MR, au niveau de l’hélice H5. Geller et al. ont proposé, par modélisation moléculaire, que la présence d'une leucine à la place de la sérine en position 810 induisait des contacts stabilisants avec l'hélice H3 voisine, stabilisant la conformation active du LBD (Geller et al., 2000). Fagart et

Introduction ses collaborateurs ont cristallisé ce mutant en présence de différents ligands. Ils ont ainsi montré et validé, par l'utilisation d'approches de mutagenèse dirigée et de tests fonctionnels, que la leucine en position 810 génère des contacts additionnels avec le stéroïde, lui permettant de s'affranchir du contact avec l'asparagine 770 requit pour la stabilisation de la conformation active par les agonistes du récepteur sauvage (Fagart et al., 2005a). En conclusion, l’activation constitutive du MR mène à une hypertension sévère chez l’Homme. Depuis plus de 20 ans, la recherche d’autres mutations activatrices du MR s’est avérée infructueuse, ce qui souligne bien le caractère unique de cette mutation S810L.

4. Hyperaldostéronisme

L’hyperaldostéronisme correspond à une hypersécrétion d’aldostérone par le cortex surrénalien (adénome ou hyperplasie essentiellement). L’excès d’aldostérone entraîne une suractivation de la signalisation relayée par le MR dans les tissus qui l’expriment (rein, cœur…), responsable d’une rétention excessive de sodium par le rein, ce qui entraîne une expansion volémique à l’origine d’une hypertension artérielle. Selon son origine, on distingue deux formes d’hyperaldostéronisme (Stowasser and Gordon, 2013). La forme primaire est due à une pathologie surrénalienne (30% d’adénome de Conn, 70% d’hyperplasie bilatérale des surrénales), dans laquelle la synthèse ou la sécrétion de l’aldostérone par les cellules de la zone glomérulée du cortex surrénalien est accrue et n’est plus sous le contrôle du SRAA. La forme secondaire est due à une atteinte en amont des surrénales, au niveau du SRAA, majoritairement au niveau de l’appareil juxtaglomérulaire (Wong et al., 2008)

L’hyperaldostéronisme est détecté dans 10% des patients hypertendus (Funder, 2012). Il s’associe à une hypertrophie du ventricule gauche, conduisant à un dysfonctionnement diastolique, ce qui augmente les risques cardiovasculaires de ces patients, et augmente le risque d’infarctus du myocarde (Funder, 2017b). L’hyperaldostéronisme entraîne aussi une insuffisance cardiaque, situation dans laquelle le maintien du débit sanguin approprié est insuffisant. L’insuffisance est dite systolique (ou à fraction d’éjection réduite, HFrEF) quand elle est due à un défaut contractile du ventricule gauche, et diastolique (ou à fraction d’éjection préservée, HFpEF) quand elle est associée à un défaut de remplissage ventriculaire. Un tiers des patients atteints d’insuffisance cardiaque systolique à la suite d’un infarctus du myocarde présente des concentrations plasmatiques moyennes d’aldostérone très largement supérieures à la normale (300 ng/dL vs. 5-15ng/dL) (Guichard et al., 2013). En concordance avec les conclusions obtenues

Introduction chez les souris MR KO CMLV, le MR a une responsabilité majeure dans la récupération cardiaque médiocre suite à un infarctus du myocarde (Gueret et al., 2016).

D’un autre côté, l’insuffisance cardiaque diastolique est un syndrome caractérisé par une fraction d’éjection préservée, mais des défauts de la fonction diastolique. En effet, le volume ventriculaire en fin de diastole est réduit, cela s’explique par une augmentation de la rigidité de la paroi du ventricule gauche. Cette rigidité ventriculaire est due à une fibrose myocardique, et une relaxation du ventricule gauche réduit de 30% (Wachter et al., 2009). Le MR, dans un contexte inflammatoire élevé, favorise la fibrose cardiaque et donc l’insuffisance cardiaque diastolique (Jia et al., 2016).

5. MR et inflammation dans les fibroses cardiaques et rénales

Il a été montré que l’aldostérone et le MR participent au développement de la fibrose cardiaque et vasculaire, par l’intermédiaire du déclenchement de processus inflammatoires. Chez la souris ou l’Homme, l’hypernatrémie augmente fortement l’induction des cellules Th17, des lymphocytes T helper exprimant l’interleukine 17 (IL-17) qui jouent un rôle dans les maladies auto- immunes. Les lymphocytes Th17 activés expriment la kinase Sgk1, cible de la signalisation minéralocorticoïde, et de façon complémentaire, l’interférence ARN de Sgk1 empêche le développement des Th17 (Kleinewietfeld et al., 2013). Le phénotype alors adopté par les Th17 est caractérisé par une expression accrue de cytokines pro-inflammatoires (GM-CSF, TNFα et IL- 2) qui est fortement pathogénique. Des rats traités par un agoniste minéralocorticoïde et un régime enrichi en sel (DOCA-salt) développent une hypertension artérielle et, en parallèle, expriment des lymphocytes Th17 activés dans le rein et le cœur. L’utilisation d’un antagoniste du MR (spironolactone) ou d’un anticorps anti-IL-17 prévient le développement de l’hypertension. Plus précisément, ces stratégies (spironolactone ou anti-IL-17) inhibent l’activation des facteurs pro- fibrotiques et pro-inflammatoires, et des dépôts de collagène dans le cœur et le rein, induits par le régime DOCA-salt (Amador et al., 2014). L’invalidation de Sgk1 chez la souris a confirmé la protection des animaux KO Sgk1 vis-à-vis du développement de la fibrose cardiaque et rénale lors d’un régime DOCA-salt (Artunc et al., 2006; Vallon et al., 2006). Ces résultats démontrent un lien direct entre l’activation excessive et pathologique de la signalisation minéralocorticoïde, l’activation d’acteurs de l’immunité pro-inflammatoire et le développement des fibroses cardiaques et rénales.

Introduction

6. MR et maladies métaboliques

Le MR est exprimé dans le tissu adipeux brun (Zennaro et al, 1998) et blanc (Caprio et al., 2007). Le rôle du MR dans ces tissus, hormis la régulation de la thermogénèse, est peu défini. On sait que l’expression du MR dans les adipocytes est augmentée dans l’obésité et le diabète sucré (Guo et al., 2008 ; Hirata et al., 2012). On sait aussi que, dans certains modèles cellulaires adipocytaires, le MR, contrairement au GR, induit la production de cytokines pro-inflammatoires (Hoppmann et al., 2010). Notre équipe, en étudiant le phénotype des souris surexprimant le MR (TG P1-hMR), a montré que le MR, à côté du contrôle direct sur la différenciation des pré- adipocytes en adipocytes, agit aussi indirectement en modifiant la polarisation des macrophages du tissu adipeux. Ces résultats démontrent un rôle essentiel du MR dans la régulation de l’inflammation dans le tissu adipeux (Kuhn et al., 2014). Récemment, un modèle murin surexprimant le MR spécifiquement dans les adipocytes (Adipo-MROE) a été généré (Urbanet et al., 2015). En comparaison aux souris sauvages, les souris Adipo-MROE ont un poids de 10% plus élevé en régime ordinaire, développent une résistance à l’insuline et une dyslipidémie (+ 40% triglycérides, +27% cholestérol) en 12 semaines. Ces souris développent un syndrome métabolique. Pour évaluer le lien entre la surexpression du MR dans les adipocytes et l’apparition de pathologies vasculaires, la fonction des artères mésentériques et l’activation de voies redox dans les adipocytes et les vaisseaux ont été évaluées. Les artères des souris Adipo-MROE sont moins contractiles que celles des souris contrôles, et certaines espèces réactives à l’oxygène (ROS) comme le peroxyde d’hydrogène sont libérées par les adipocytes. Ces adipocytes surexpriment l’élastine, protéine structurale impliquée dans la plasticité cellulaire, dont la surexpression est en partie responsable de la perte de contractilité vasculaire. Si la pression artérielle des souris Adipo-MROE est normale, les modifications des artères et du statut redox augmentent leur risque vasculaire (Nguyen Dinh Cat et al., 2016). Chez l’Homme, l’hyperaldostéronisme est impliqué dans la survenue du syndrome métabolique dans les patients obèses via des processus inflammatoires (Urbanet et al., 2015).

L’ensemble de ces données ont permis de mieux comprendre l’implication du MR dans les pathologies cardiorénales. Les antagonistes du MR, dont la spironolactone, étaient utilisés dans le traitement des pathologies liées à la signalisation minéralocorticoïde avant même d’en connaitre l’implication. La description du rôle du MR dans ces maladies a permis de mieux comprendre l’intérêt d’un traitement antiminéralocorticoïde, et de réfléchir aux améliorations thérapeutiques possibles.

Introduction

C. Les antiminéralocorticoïdes

Les données cliniques présentées ci-dessus mettent en lumière le rôle prépondérant des dysfonctionnements de la signalisation minéralocorticoïde dans les pathologies cardiorénales. Depuis plusieurs décennies, avant même l’identification du MR, les bénéfices des antagonistes de l’aldostérone, comme la spironolactone, étaient connus dans ces pathologies. L’avancée dans la connaissance des mécanismes sous-jacents a permis d’améliorer les stratégies thérapeutiques adaptées à la prise en charge de ces pathologies. Parmi ces traitements, les antagonistes du MR ont une place essentielle.

1. La spironolactone, première génération d’antiminéralocorticoïde

La spironolactone, commercialisée initialement sous le nom d'Aldactone®, a été, historiquement, le premier antagoniste stéroïdien du MR. Cette molécule a été autorisée dès les années 1960 pour le traitement des œdèmes, de l’hyperaldostéronisme primaire et de l’hypertension artérielle, grâce à sa capacité à réduire efficacement la réabsorption de sodium et d’eau (Farrelly et al., 1960; Cejka et al., 1960; Georgopoulos et al., 1961). Cet antagoniste fait partie de la famille des spirolactones qui sont des dérivés de la progestérone dans lesquels la méthylcétone en position 17 du stéroïde est remplacée par une lactone cyclique (Figure 12). In vitro, la spironolactone a une efficacité antagoniste (IC50) de 24 nM pour le MR (Fagart et al., 2010) (Tableau 5). Du fait de sa structure stéroïdienne et de son homologie avec la progestérone et la testostérone, la spironolactone est peu sélective, se comportant comme un antagoniste du

AR (in vitro IC50 de 77 nM), et comme un agoniste du PR (in vitro EC50 de 740 nM). Ce manque de sélectivité induit de nombreux effets indésirables chez 20% des patients hypertendus traités, notamment une gynécomastie (9% des hommes), une impuissance mais aussi un dérèglement menstruel et une perte de libido (Ménard, 2004). Sa propriété antagoniste envers l’AR a été d’ailleurs utilisée dans le traitement contre l’hirsutisme chez la femme (Anttila et al., 1987). De plus, sa capacité à inhiber la réabsorption de sodium et l'excrétion de potassium induites par l'aldostérone, entraîne chez environ 10% des patients une hyperkaliémie et une hyponatrémie (Juurlink et al., 2004). Il est à noter que la spironolactone est métabolisée dans le foie en canrénone (élimination du substituent 17α-thioacétyl) (LaCagnin et al., 1987), qui a une demi-vie plus longue que celle de la spironolactone (demi-vie chez l’Homme : spironolactone = 1 h, canrénone = 11 h) (Overdiek et al., 1985). La canrénone est le métabolite actif de la spironolactone (Yang and Young, 2016).

Introduction

Figure 12 : Les antiminéralocorticoïdes de la famille des spirolactones. Représentation de Cram de la spironolactone et de l’éplérénone.

Antagoniste MR GR AR PR

IC50 (nM) MRA Spironolactonea 24 2410 77 743* stéroïdiens Eplérénonea 990 >22000 >21000 >31000 BR-4628a 28 5470 4441 9020 MRA non- Finérénoneb 18 >10000 >10000 >10000 stéroïdiens Esaxérénonec 9,4 >10000 >10000 >10000

Tableau 5 : Sélectivité des MRA vis-à-vis des récepteurs des oxo-stéroïdes. Concentrations inhibitrices médianes (IC50) de cinq antiminéralocorticoïdes, mesurées sur les quatre récepteurs des oxo-stéroïdes. *La valeur correspond à un EC50. Les données proviennent de a(Fagart et al., 2010), b(Pitt et al., 2012) et c(Arai et al., 2015a).

Les effets indésirables liés à l'administration de spironolactone ont conduit à une utilisation limitée et peu fréquente de cette molécule. Cet antagoniste a néanmoins trouvé un regain d'intérêt dans le traitement des patients souffrant d'insuffisance cardiaque, alors soignés par des inhibiteurs de l’enzyme de conversion de l’angiotensine II (ACE). Le rôle délétère de l’aldostérone dans l'insuffisance cardiaque avait en effet conduit à l'utilisation d'inhibiteurs de l'enzyme de conversion de l'angiotensine (ACE) afin de diminuer la sécrétion d’aldostérone par les surrénales. Or, les inhibiteurs de l’ACE ne suffisent pas à inhiber efficacement l’action de l’aldostérone, et il a semblé intéressant d'associer la spironolactone aux inhibiteurs de l'ACE. Les données recueillies dans l'étude clinique multicentrique RALES (Randomized ALdactone Evaluation Study) réalisée

Introduction chez des patients insuffisants cardiaques ayant reçu la spironolactone en combinaison de l'inhibiteur de l'ACE, en comparaison à des patients ayant reçu l'inhibiteur de l'ACE seul, ont montré une hausse significative de l’activité de la rénine plasmatique, de la sécrétion d’aldostérone, ainsi qu’une baisse significative des pressions systoliques et diastoliques. Pour les patients ayant une insuffisance cardiaque sévère liée à un dysfonctionnement systolique du ventricule gauche, l'administration de spironolactone s’est traduite par une réduction tout à fait significative (20%) de la mortalité et des hospitalisations, en particulier celles associées aux problèmes cardiaques (Pitt et al., 1999). Au niveau fonctionnel, les investigateurs de l’étude RALES ont déterminé un lien direct entre le traitement par la spironolactone chez les insuffisants cardiaques sévères et la diminution importante de l’expression cardiaque de marqueurs de fibrose (Zannad et al., 2000). Les bénéfices évidents de la complémentation de la spironolactone au traitement de ces patients en insuffisance cardiaque sévère ont amené à l’arrêt prématuré de l’étude, pour permettre aux patients du groupe placebo de bénéficier du traitement curateur. Néanmoins, une hyperkaliémie sévère a été observée chez une minorité des patients (2%) pouvant se révéler délétère in fine (Juurlink et al., 2004).

2. L’éplérénone, seconde génération d’antiminéralocorticoïde sélectif

Les chimistes du groupe pharmaceutique Ciba-Geigy ont développé une nouvelle classe de spirolactone en introduisant un groupe époxyde entre les positions 9α et 11α de la spironolactone (Figure 12). La 9α,11α-époxy-mexrénone, ou éplérénone, a ainsi été synthétisée dès 1984 et ses étapes de synthèse optimisées par le laboratoire Searle. Après le rachat successif de Searle par Monsanto, Pharmacia et Pfizer, ce dernier laboratoire a proposé l’éplérénone (nom commercial : Inspra®) comme seconde génération d'antagoniste minéralocorticoïde pour le traitement de l'insuffisance cardiaque. Des tests de transactivation ont montré que l’éplérénone était beaucoup plus sélective pour le MR que la spironolactone (Tableau 5). Par contre, elle est 10 fois moins efficace que la spironolactone pour inhiber l’action de l’aldostérone (Delyani et al., 2001; Fagart et al., 2010; Yang and Young, 2016).

L'éplérénone a été évaluée dans trois études cliniques multicentriques. L’étude EPHESUS (Eplerenone Post–acute myocardial infarction Heart failure Efficacy and SUrvival Study) (Pitt et al., 2003)) a été réalisée sur 6632 patients ayant subi un infarctus aigu du myocarde, et ayant reçu pour moitié 25 mg/jour d’éplérénone pendant 4 semaines, puis 50 mg/jour. L’étude a mis en évidence une baisse hautement significative de 21% de la mortalité et de 15% de l’hospitalisation

Introduction pour problèmes cardiaques du groupe de patients traités avec l’éplérénone en comparaison des patients ayant reçu le placebo (Pitt et al., 2003).

Plus récemment, une seconde étude a été menée, testant l’usage de l’éplérénone pour les patients atteints d’insuffisance cardiaque modérée, c’est-à-dire une réduction de la fraction d’éjection (baisse d’au moins 30% par rapport aux valeurs moyennes) et du débit de filtration glomérulaire (Zannad et al., 2010). Cette étude, nommée EMPHASIS-HF (Eplerenone in Mild Patients Hospitalization And SurvIval Study in Heart Failure), réunissait 2737 patients, présentant (943) ou non (contrôles, 1794) une insuffisance cardiaque, et étudiait l’incidence de la fibrillation atriale ou de flutter atrial (AFF pour Atrial Fibrillation or Flutter). Le traitement par l’éplérénone, en plus du traitement de base, a permis une réduction du nombre de nouveaux cas de AFF chez les patients ayant une insuffisance cardiaque systolique et modérée. Plus généralement, le traitement par l’éplérénone a permis une diminution de 37% de l’ensemble des risques cardiovasculaires chez tous les patients, atteints ou non de AFF. Une troisième étude, REMINDER, a mis en évidence un effet bénéfique de l’éplérénone pour les patients ayant subi un infarctus du myocarde non suivi d’insuffisance cardiaque. Leur première hospitalisation pour nouveau problème cardiaque se faisait deux fois plus tardivement que pour les patients du groupe placebo (Montalescot et al., 2014), indiquant un effet bénéfice de la molécule.

L’éplérénone est donc un meilleur antagoniste du MR puisqu’elle est plus sélective et qu’elle est très efficace dans la prise en charge de l’insuffisance cardiaque. Cependant, comme la spironolactone, l’éplérénone entraîne un risque non négligeable d’hyperkaliémie.

3. La nouvelle génération de MRA est non-stéroïdienne

Différents laboratoires pharmaceutiques ont cherché à développer une nouvelle génération d’antagonistes qui auraient la même efficacité que la spironolactone, une haute sélectivité vis-à- vis du MR comme l’éplérénone, et qui n’entraîneraient pas les mêmes effets indésirables, en particulier les risques d’hyperkaliémie.

Les approches de screening moléculaire haut-débit et ultra-haut-débit ont été développées par plus d'une dizaine de groupes pharmaceutiques (notamment Bayer Pharmaceuticals, Boehringer-Ingelheim, Daiichi Sankyo, Eli-Lilly and Compagny, Exelixis, Merck, Mitsubishi Tanabe Pharma, Pfizer...). Dans cette approche, les laboratoires ont utilisé des lignées cellulaires stablement transfectées par un vecteur rapporteur et par un vecteur permettant l'expression d'une

Introduction protéine de fusion entre le LBD du MR et le domaine de liaison à l'ADN de GAL4. Les molécules identifiées, ne sont pas des stéroïdes et ont des structures chimiques très variées, dérivant des dihydropyridines, des pyrazolines, des pyrroles, des imidazoles ou des oxazolidinediones (Martín- Martínez et al., 2017) (Figure 13).

Figure 13 : Les antiminéralocorticoïdes non-stéroïdiens. Représentation de Cram des molécules dérivés des dihydropyridines, le BR-4628 et la finérénone (Bayer HealthCare AG), ou des pyrroles, l’esaxérénone (Daiichi Sankyo Co).

a) Le BR-4628

Trois grands laboratoires pharmaceutiques (Bayer, Merck et Pfizer) ont simultanément identifié des composés caractérisés par un noyau dihydropyridine (Martín-Martínez et al., 2017). Jusqu’à présent, les dihydropyridines, comme la Nifédipine ou la Nitrendipine, avaient été développées et utilisées comme antagonistes du canal calcique de type L (Meredith and Elliott, 2004). Le groupe pharmaceutique Pfizer a mis en évidence que ces molécules se comportaient comme de faibles antagonistes minéralocorticoïdes (Dietz et al., 2008). D'une façon remarquable, le laboratoire Bayer a identifié, dans son screening à ultra-haut-débit d'un million de molécules, la dihydropyridine BR-4628 qui est caractérisée par une activité antiminéralocorticoïde très forte

(IC50 28 nM) et similaire à celle de la spironolactone (IC50 24 nM) mais surtout des activités très faibles sur le AR, le GR et le PR (IC50 > 4000 nM pour ces trois récepteurs) (Tableau 5) et ayant une activité inhibitrice du canal calcique de type L très réduite (IC50 1990 nM). Le BR-4628, en plus d’être un puissant antagoniste du MR, entraîne une inhibition de l’activité transcriptionnelle

Introduction constitutive du mutant MR S810L. Cet antagoniste non-stéroïdien agit notamment en entravant l’interaction entre le MR et ses coactivateurs (dont TIF2) et corépresseurs (dont NCoR) (Fagart et al., 2010). La nature non-stéroïdienne de cette nouvelle génération d'antagonistes du MR posait la question de son mode de liaison et de son mécanisme d'action. Par des approches de modélisation moléculaire, de mutagenèse dirigée et de tests de fonctionnalité, il a été montré que le BR-4628 se lie dans la cavité de liaison du MR avec une forte affinité (3 nM) en adoptant un positionnement qui ne se superpose que partiellement avec celui des stéroïdes (Fagart et al., 2010). De plus, il a été montré qu'un groupement chimique du BR-4628 obstrue le changement conformationnel de la cavité de liaison dans la direction de l'hélice H12, lui empêchant d'adopter sa conformation active. Cette caractéristique, associée à ses dynamiques de liaison-dissociation très rapides, ont permis de définir le nouveau mécanisme original de cette molécule pour inactiver le MR par le qualificatif "bulky-passif". En se basant sur les relations entre la structure du BR- 4628, son positionnement dans la cavité de liaison du MR, son efficacité et sa sélectivité, le laboratoire Bayer a optimisé la structure de leur molécule sous la forme de la finérénone (BAY 94-8862).

b) BAY 94-8862 ou la finérénone

La finérénone (Bayer HealthCare) est le dérivé amélioré du BR-4628, dans lequel le noyau dihydropyridine a été converti en noyau dihydronaphthyridine (Figure 13). In vitro, en test de liaison couplé à l’activité luciférase, la finérénone a un IC50 de 18 nM pour le MR, soit 10000 fois plus basse que pour AR, PR et GR, ce qui montre qu’elle est plus puissante et sélective que le BR-4628. Un premier essai préclinique a été fait sur le rat soumis à un régime hyposodé pendant 3 jours puis gavé avec différentes doses de finérénone ou d’éplérénone. La finérénone augmente de façon dose-dépendante, le rapport Na+/K+ urinaire, et se montre 3 à 10 fois plus puissant et plus efficace que l’éplérénone (Bärfacker et al., 2012). Dans deux modèles de rats, soit soumis à un régime DOCA-salt et développant une hypertension artérielle et des fibroses cardiorénales, soit soumis à une ligature de l’artère coronarienne et développant une insuffisance cardiaque, la finérénone s’est montré plus efficace que l’éplérénone et à une dose 100 fois plus faible (10 mg/kg) pour la prévention et la prise en charge de ces pathologies (Kolkhof et al., 2014; Gueret et al., 2016). Enfin, chez des rats ayant développé une insuffisance rénale chronique, suite à un protocole d’ischémie/reperfusion, et traités à la finérénone (10 mg/kg) pendant 4 mois, aucune

Introduction détérioration durable de la structure et de la fonction rénales n'a été observée en comparaison aux rats contrôles (Lattenist et al., 2017).

Un essai clinique, phase II, a permis de comparer les effets de la finérénone vs l’éplérénone dans le traitement de patients atteints d’insuffisance cardiaque aggravée avec une fraction d’éjection diminuée, et une insuffisance rénale chronique et/ou un diabète sucré : l’étude multicentrique ARTS-HF (minerAlocorticoid Receptor antagonist Tolerability Study - Heart Failure). Les patients, séparés en six groupes équivalents, ont reçu pendant 90 jours 25 mg/jour d’éplérénone ou 2,5, 5, 7,5 10 ou 15 mg/jour de finérénone. La concentration plasmatique du NT- proBNP (pro-peptide natriurétique de type B N-terminal) a été mesurée (Pitt et al., 2015). Une augmentation de la synthèse et de la sécrétion du NT-proBNP par les cardiomyocytes reflète une distension du tissu cardiaque en rapport avec l’insuffisance cardiaque (Campbell et al., 2000). Après 90 jours de traitement, une diminution du NT-proBNP (supérieure à 30% par rapport au 1er jour) est observée dans au moins 30% des patients de tous les groupes (éplérénone et finérénone). La mortalité et le nombre d’hospitalisation ou d’urgence pour raison cardiovasculaire avant le 90ème jour étaient diminués dans les groupes ayant reçu la finérénone par rapport à l’éplérénone, de façon significative (P<0,05) pour le groupe ayant reçu 20 mg/jour, et hormis le groupe ayant reçu 2,5 mg/jour. La survenue d’hyperkaliémie était faible (4% en moyenne) dans tous les groupes. Ce premier essai clinique de la finérénone a permis de déterminer la dose de 20 mg/jour comme étant la plus favorable, de déterminer une efficacité comparable à l’éplérénone dans la diminution de NT-proBNP circulant et de montrer sa fiabilité (Filippatos et al., 2016). Une extension de cet essai a été réalisée sur une petite cohorte de 96 patients atteints de diabète de type 2 associé à une néphropathie diabétique. L’étude a montré que, par rapport au groupe placebo, le groupe traité par la finérénone avait une albuminurie diminuée et une absence d’hyperkaliémie. Le but de l’étude était de démontrer la faisabilité d’un essai clinique de phase III dans des conditions adéquates pour des patients atteints de diabète de type 2 et d’insuffisance rénale chronique (Katayama et al., 2017). Ce nouvel antagoniste non-stéroïdien du MR est donc actuellement en essai clinique de phase III.

c) CS-3150 ou l’esaxérénone

Le CS-3150, ou esaxérénone (Daiichi Sankyo Co), est un dérivé de pyrrole, non-stéroïdien, candidat comme antiminéralocorticoïde sélectif (Figure 13) (Martín-Martínez et al., 2017). In vitro, lors d’expériences de transactivation sur le MR, le CS-3150 a montré une activité antagoniste

Introduction

forte (IC50 = 9,4 nM) pour le MR, donc plus forte que la spironolactone (IC50 = 36 nM) et l’éplérénone (IC50 = 713 nM), et potentiellement au moins aussi forte que la finérénone (Tableau

5). En parallèle, avec une IC50 > 10000 nM pour le GR, le PR et l’AR, le CS-3150 est tout à fait sélectif pour le MR. In vivo, sur des rats surrénalectomisés traités par l’aldostérone et le CS-3150 (0,3, 1 ou 3 mg/kg), le rapport Na+/K+ urinaire augmenté par l’aldostérone est significativement réduit par l’esaxérénone, plus efficacement et durablement que par la spironolactone et plus durablement que par l’éplérénone. De plus, sur des rats soumis à un régime DOCA-salt donc devenus hypertendus et présentant un début de fibrose cardiorénale, l’esaxérénone empêche l’augmentation induite de la pression systolique, bien plus efficacement que les deux autres antagonistes et à une dose 10 fois plus faible (Arai et al., 2015a). Ce nouvel antagoniste entraîne même une amélioration significative de cas d’insuffisance rénale induite par ce régime, donc un rôle thérapeutique potentiel en plus du rôle préventif (Arai et al., 2015b). Une seconde étude préclinique sur les rats a permis de montrer un effet protecteur du CS-3150 contre le développement de l’hypertension au cours d’un régime hypersalé, en prévenant l’apparition d’une protéinurie et d’une hypertrophie rénale et cardiaque, et sans effet hyperkaliémiant. Cet antagoniste était plus efficace que la spironolactone et l’éplérénone (Arai et al., 2015b). Enfin, le traitement de rats et de macaques a montré que l’esaxérénone est bien absorbée après administration par voie orale, que sa distribution dans l’organisme est homogène, sauf dans le cerveau, et que son élimination se fait par les fèces (Yamada et al., 2016). L’ensemble de ces propriétés a permis d’envisager des essais cliniques chez l’Homme qui sont en cours. L’esaxérénone et la finérénone sont donc deux bons candidats pour le traitement des insuffisances rénales chroniques.

Deux autres molécules sont en cours de développement : LY2623091 par Eli Lilly Company et MT-3995 par Mitsubishi Tanabe Chemistry. LY2623091 est un dérivé hétérotricyclique fusionné dont la structure n’a pas été dévoilée. Des essais cliniques, phases I et II, ont déjà été réalisés mais sont peu détaillés (Wang et al., 2017). Quant au MT-3995, sa structure n’a pas été publiée, et il serait en phase clinique II pour le traitement des néphropathies diabétiques (Kolkhof et al., 2015 ; Martín-Martínez et al., 2017).

Si la signalisation minéralocorticoïde est impliquée dans de graves pathologies humaines, le développement d’une troisième génération d’antagonistes sélectifs et non-stéroïdiens est tout à fait prometteur pour leur traitement. Notre équipe s’est intéressée aux mécanismes moléculaires de la finérénone dans la signalisation minéralocorticoïde. Les résultats issus de cette étude ont

Introduction

été publiés dans le Journal of Biological Chemistry (Le Billan*, Amazit* et al., JBC, 2015) et seront présentés dans la partie 2 des résultats.

III. Sélectivité de la voie minéralocorticoïde et dynamique des complexes transcriptionnels

Comme nous l’avons déjà vu dans le chapitre I, le MR peut être activé par deux ligands physiologiques : l’aldostérone et le cortisol (la corticostérone chez les Rongeurs). De par l’affinité comparable que ces hormones ont pour le récepteur, il existe une vraie dualité. De plus, nous l’avons vu, le MR et le GR ont une forte homologie de séquence et de structure, se traduisant notamment par la reconnaissance de GRE/MRE quasi-identiques : cela représente un vrai problème de complémentarité entre les récepteurs. Dans la prochaine partie, nous détaillerons d’abord les dualités d’hormone et de récepteur entre les voies minéralocorticoïde et glucocorticoïde, avant d’examiner la dynamique des mécanismes de transrégulation qui pourraient différencier les deux voies.

A. Dualité entre les voies minéralocorticoïdes et glucocorticoïdes

Afin de comprendre les similitudes ou les différences de comportements du MR vis-à-vis de l’aldostérone ou du cortisol, quelques rappels de la première partie sont nécessaires. L'aldostérone et le cortisol ont une structure proche, ce qui se traduit par une affinité du MR tout à fait comparable pour les deux hormones, de l’ordre du nanomolaire, comme l’ont montrées des mesures de constante de dissociation à l'équilibre (Arriza et al., 1987 ; Hellal-Levy et al., 1999). Or, chez l’Homme, la concentration sérique moyenne du cortisol total (100-200 ng/mL, soit environ 400 nM), est 100 à 1000 fois plus élevée que celle de l’aldostérone totale (0,5 ng/mL, soit environ 0,35 nM) (Rafestin-Oblin et al., 2003; Travers et al., 2017). Ce résultat suggère que le MR serait continuellement occupé par le cortisol et pose donc la question de savoir si et comment

Introduction l'aldostérone peut agir via son propre récepteur. Deux éléments ont été apportés pour répondre à cette question : le rôle de la 11βHSD2 d'une part, et la capacité intrinsèque du MR à discriminer les deux hormones, d’autre part.

Dans les tissus épithéliaux, sont exprimés de façon conjointe le MR et la 11βHSD2 (Edwards et al., 1988 ; Funder et al., 1988). Cette enzyme dépendante du NAD+ métabolise le cortisol en cortisone (chez les Rongeurs, la corticostérone en 11-déshydrocorticostérone) qui est inactive sur le MR. Ainsi, en abolissant l’excès de glucocorticoïdes, la 11βHSD2 permet à l'aldostérone d'accéder au MR (Odermatt and Atanasov, 2009) (Figure 14). Au contraire, dans les tissus non- épithéliaux (cœur, adipocytes, cerveau), cette enzyme n’est pas exprimée. Le MR est donc beaucoup plus exposé au cortisol. D’autres mécanismes de sélectivité du MR vis-à-vis de l’aldostérone existent néanmoins.

+ Figure 14 : L’enzyme 11βHSD2 métabolise le cortisol de façon NAD -dépendante. 11βHSD2 : 11beta-hydroxystéroïde déshydrogénase de type 2, NAD+ : Nicotinamide Adénine Dinucléotide, NADH : Nicotinamide Adénine Dinucléotide réduit.

1. Sélectivité intrinsèque du MR pour l'aldostérone a) Activité de transactivation du MR en réponse à l'aldostérone et aux corticostéroïdes

L'activité de transactivation du MR en réponse à différents ligands a été étudiée en utilisant le gène rapporteur de la luciférase placé sous le contrôle d'un promoteur sensible aux récepteurs des oxo-stéroïdes (promoteur du MMTV (virus de la tumeur mammaire de souris) ou promoteur contenant deux GRE, GRE2-LUC). Ces expériences ont mis en évidence que le MR est beaucoup plus sensible à l'action de l'aldostérone (ED50 = 0,01 nM) qu'à celle de la corticostérone (ED50 de

1 nM) ou à celle du cortisol (ED50 = 5 nM), alors que ces trois hormones ont une affinité

Introduction sensiblement équivalente pour le récepteur. Ainsi, le MR est 500 fois plus sensible à l’aldostérone qu’au cortisol (Lombes et al., 1994). Il a été également montré que ces différences de sensibilité du MR pour l'aldostérone et les corticostéroïdes étaient corrélées à des différences de stabilité des complexes MR-ligands. En effet, les temps de demi-vie des complexes MR- aldostérone sont trois fois plus longs que ceux impliquant le cortisol et 21 fois plus longs que ceux impliquant la dexaméthasone, qui est un faible agoniste minéralocorticoïde, caractérisée par un

ED50 de 85 nM (Hellal-Levy et al., 1999, 2000b). Cette stabilité du complexe MR-aldostérone permettrait au MR d’être maintenu dans une conformation active et plus stable dans la durée, en comparaison au complexe MR-cortisol. Cette stabilité du complexe MR-aldostérone permettrait ainsi des interactions privilégiées avec certains corégulateurs transcriptionnels favorisant les effets génomiques de l’aldostérone. De façon intéressante, cette stabilité du complexe MR- aldostérone permet aussi au MR d’être protégé du protéasome de façon plus durable que le complexe MR-cortisol ou que le MR non ligandé. L’effet protecteur de l’aldostérone vis-à-vis de la dégradation par le protéasome s’expliquerait par une conformation plus compacte du MR après liaison de l’aldostérone (Trapp and Holsboer, 1995 ; Couette et al., 1996).

b) Mode de liaison de l'aldostérone et du cortisol dans le LBD du MR

Afin de comprendre pourquoi le MR est plus sensible à l’aldostérone qu'au cortisol, les modes de reconnaissance des ligands par la cavité de liaison du LBD ont été étudiés. Des études structurales (modélisation moléculaire par homologie et cristallographie) (Bledsoe et al., 2005; Fagart et al., 2005a; Li et al., 2005) ont mis en évidence que la cétone en position 3 commune à l'aldostérone et au cortisol était ancrée par la glutamine 776 et l'arginine 817 et l'hydroxyle en position 21 par l'asparagine 770 et la thréonine 945. L'hydroxyle en position 18 de l'aldostérone et l'hydroxyle en position 11β du cortisol sont tous deux ancrés sur l'asparagine 770. Ce positionnement fait apparaitre que l'hydroxyle en 17α du cortisol n'est pas ancré dans la cavité de liaison du MR. De plus, l'hydroxyle en position 11β du cortisol fait un contact défavorable avec l'alanine 773 qui est spécifique au MR. Ainsi, la moins bonne reconnaissance du cortisol par la cavité du MR et sa moins bonne accommodation en comparaison à celle de l'aldostérone expliqueraient la moins grande stabilité du complexe MR-cortisol et par voie de conséquence la moindre sensibilité du MR pour le cortisol.

Cette différence de reconnaissance de l'aldostérone et du cortisol pour le LBD du MR induit des interactions entre les domaines N- et C-terminaux différentes. Ce type d'interaction entre les

Introduction domaines N et C-terminaux a d’abord été rapporté pour le récepteur des androgènes (AR), en utilisant l’approche de double hybride (Ikonen et al., 1997). Encore peu caractérisée sur le plan structural, l’interaction N/C semble portée par une large partie du NTD d’un côté et le domaine AF-2 du LBD de l’autre. Il n’est pas encore clairement défini si cette interaction a lieu de façon intramoléculaire (entre le NTD et le LBD d’une même molécule), ou si elle implique deux molécules de MR en position tête-bêche. Dans le cas du MR, l’interaction N/C a été décrite comme étant ligand-dépendante. Elle est favorisée par l’aldostérone mais est inhibée par le cortisol et la spironolactone (Rogerson and Fuller, 2003; Pippal et al., 2009).

2. Dualités de récepteurs homologues MR et GR

En parallèle de la dualité hormonale du MR, il existe la dualité entre les récepteurs MR et GR. Les deux récepteurs partagent une importante homologie de séquence dans les deux domaines clés que sont le LBD et le DBD. Le GR est un récepteur ubiquitaire (Kino, 2000). Au cours du développement du rein, nous avons vu que l’expression du MR était biphasique et qu’elle commence à la 15ème SG. Le GR est exprimé à partir de la 10ème SG dans la plupart des segments du néphron (Martinerie et al., 2009a). Dans le rein adulte, les niveaux protéiques de MR et de GR dans le néphron sont équivalents. Pour les autres tissus, le GR est exprimé à des niveaux variables finement régulés (Turner et al., 2006) et est fortement exprimé dans l’hippocampe (Herman et al., 1989). Il faut rappeler que le GR a une affinité équivalente pour l’aldostérone et le cortisol, mais qui sont 20 fois plus faibles que celle du MR (Hellal-Levy et al., 1999). Aussi, si le MR est 500 fois plus sensible à l’aldostérone qu’au cortisol, les tendances sont inversées pour le GR qui a une sensibilité 10 fois supérieure pour le cortisol que pour l’aldostérone. Ces propriétés sont dues aux acides aminés composant le LBD, qui ont spécifié les deux récepteurs au cours de l’évolution (von Langen et al., 2005; Baker and Katsu, 2017).

a) Données structurales

Par des approches de modélisation et de cristallographie, il a pu être montré que le cortisol est ancré dans la cavité de liaison du GR au moyen de nombreuses liaisons hydrogènes. Comme pour le MR, la cétone en position 3 du stéroïde est ancrée par une glutamine et une arginine (Gln510 et Arg611) (von Langen et al., 2005). A l'autre extrémité de la poche de liaison, les hydroxyles en 11 et 21 sont ancrés à l'asparagine 564 et l'hydroxyle en 17α par la glutamine 642.

Introduction

De façon intéressante, le GR présente une glycine à la position correspondant à l'Ala773 du MR et permet donc l'accommodation de l'hydroxyle en C11 du cortisol. A l'inverse, l'aldostérone, dépourvue de l'hydroxyle en position C17, ne peut interagir avec la Gln642. De plus, la présence d’une proline en position 637 empêche la stabilisation de la cavité du LBD du hGR autour de l’aldostérone, ce qui explique la faible stabilité du complexe aldostérone-GR (Mani et al., 2016). Il est intéressant d’observer qu’aucune pathologie liée à l’aldostérone, comme l’hyperaldostéronisme, n’implique l’activation du GR. Ainsi, c'est la capacité du GR à ancrer l'hydroxyle en C17 du cortisol et à accommoder l'hydroxyle en C11 qui confère à ce récepteur sa sensibilité pour le cortisol.

L’équipe de Rogerson a cherché à préciser au sein du LBD du MR et du GR quelles étaient les régions responsables de la sélectivité de ces récepteurs pour les hormones corticostéroïdes. L'utilisation de chimères entre les LBD du MR et du GR a permis de préciser que la région comprenant le feuillet bêta entre les hélices H5 et H6 ainsi que l'hélice H6 était déterminante pour la sélectivité MR ou GR. La cassette du MR correspondant à cette région insérée dans le GR confère une sensibilité de type MR, alors que la même cassette du GR introduite dans le MR confère une sélectivité GR. La spécialisation de MR et du GR pour respectivement l’aldostérone et le cortisol tient donc à quelques résidus déterminants dans la cavité du LBD (Rogerson and Fuller, 2003; Rogerson et al., 1999, 2003, 2007, 2014).

b) Récepteur ancestral

Des approches de détermination de séquence la plus probable à partir d'analyses phylogéniques ont permis de « ressusciter » le récepteur ancestral aux corticostéroïdes, AncCR (Hu and Funder, 2006). Ce récepteur ancestral a peu évolué chez les poissons cartilagineux, où il est appelé récepteur des corticostéroïdes (CR) et lie le 11-désoxycortisol, la progestérone et la 11-désoxycorticostérone. Par des approches structurales, de phylogénie ainsi que l'utilisation de tests fonctionnels, il a été montré que l'AncCR présente une sélectivité mixte de type minéralocorticoïde (Baker and Katsu, 2017). C’est à partir de l’embranchement des Vertébrés que le gène codant l’AncCR est dupliqué, une des copies restant relativement conservée et se spécialisant dans la reconnaissance des minéralocorticoïdes (MR), l’autre évoluant pour donner le GR. Ce sont des modifications dans les hélices H3 et H5 du LBD qui ont amené la sélectivité des récepteurs, et ces évolutions se retrouvent maintenant dans les différences de résidus majeurs précédemment présentées dans ce chapitre (Baker et al., 2013). L’alanine 773 et la

Introduction sérine 810 du hMR d’un côté, la sérine 843 et la leucine 848 de l’autre, ne sont pas retrouvés dans l’AncCR, alors que comme nous l’avons vu précédemment, les premiers résidus stabilisent le complexe aldostérone-MR et les seconds sont impliqués dans la sélectivité du MR pour l’aldostérone. Ainsi, sans entraver la reconnaissance du MR pour les glucocorticoïdes, ces résidus ont évolué pour permettre une plus grande sélectivité pour l’aldostérone. Dans le hGR, la proline 637 et la glutamine 642 diffèrent par rapport au AncCR et au hMR, et il est proposé que ces résidus, impliqués dans la stabilisation des glucocorticoïdes dans la cavité du GR, soient responsables de la sélectivité de celui-ci (Baker et al., 2013).

3. Sélectivité d’interactions avec les partenaires transcriptionnels et chaperons

La liaison d’un ligand agoniste dans la cavité de liaison du LBD du MR entraîne un changement conformationnel qui permet la délimitation de la fonction d'activation AF-2 dans laquelle se lient les motifs LXXLL des coactivateurs. Ce changement est très spécifique de l’agoniste. En effet, l’aldostérone n’entraîne pas les mêmes interactions que le cortisol (Yang et al., 2011). Plusieurs équipes ont cherché à identifier des corégulateurs expliquant une sélectivité de l’aldostérone par rapport au cortisol, mais aussi du MR par rapport au GR.

(a) Corégulateurs transcriptionnels spécifiques du MR

La sélectivité d’un corégulateur transcriptionnel pour un complexe ligand-récepteur spécifique représente un attrait intéressant dans le contexte de dualité hormonale de la signalisation minéralocorticoïde. Kitagawa et al. avaient décrit une interaction ligand-spécifique entre l’ARN hélicase A (RHA) et le domaine AF-1a du MR transfecté in vitro dans des cellules HEK293. L’interaction se ferait en présence d’aldostérone, mais pas en présence de cortisol (Kitagawa et al., 2002). Cette information, très intéressante, reste à être confirmée, puisque l’article a été rétracté pour « manipulations inacceptables de figures » (2014). Rogerson et al. ont réalisé deux criblages moléculaires par la technique de double hydride, dans la Levure et dans des cellules de Mammifères, en utilisant le LBD du MR humain comme proie, et une librairie d’ADN complémentaires de rein humain (Rogerson et al., 2014). Ils ont ainsi identifié un clone pour lequel le produit du gène interagit avec le LBD du MR 7 fois plus en présence d’aldostérone qu’en présence de cortisol : la protéine Tesmine, ou MTL5 (pour Métallothionéine-5). La protéine Tesmine contient deux motifs LXXLL permettant une interaction directe avec le domaine AF-2 du

Introduction

MR. Elle entraîne la transactivation de gènes cibles du MR lié à l’aldostérone, et son action est inhibée par la spironolactone. L’identification de ce premier coactivateur ligand-spécifique du MR est intéressante et pourrait être utilisée pour l’étude des cibles génomiques sélectives du complexe aldostérone-MR.

(b) Corégulateurs transcriptionnels sélectifs du MR ou du GR

Dans la première partie de l’introduction, nous décrivions PIAS1, de la famille des SUMO ligases PIAS, qui interagit avec le MR comme corépresseur ligand-dépendant. Notre équipe, après l’identification de PIAS1, a étudié l’influence du ligand sur son l’activité transrépressive du MR. Il a été montré que PIAS1 réduit l'activité de transactivation du gène rapporteur luciférase quelque soit la nature de l'agoniste lié au MR (aldostérone ou le cortisol). De façon intéressante, PIAS1 n’a aucun effet quand le MR est lié à la spironolactone même si cette dernière est caractérisée par une très faible activité agoniste partielle. Si les deux agonistes agissent de la même façon, les résultats obtenus avec la spironolactone montre tout de même que la nature du ligand a une influence sur la structure quaternaire du récepteur, et donc sur le recrutement de partenaires transcriptionnels. Par ailleurs, si PIAS1 réprime l’activité transcriptionnelle du MR, il n’a aucun effet sur celle du complexe dexaméthasone-GR. Ainsi, in vitro, PIAS1 est un corépresseur sélectif du MR (Pascual-Le Tallec et al., 2003).

Tirard et al. ont réalisé le même type d’approche de double-hybride sur des cellules neuronales pour identifier des partenaires du MR, et ont identifié d’autres membres de la famille PIAS comme partenaires du MR dans ce modèle. Les investigations ont montré que la protéine PIAS3 est co-immunoprécipitée avec le NTD du MR, mais pas celui du GR (Tirard et al., 2004). La liaison entre PIAS3 et le MR est accrue en présence d’aldostérone, et entraîne une répression de l’activité transactivatrice du MR, comme c'est le cas avec PIAS1. Par contre, PIAS3 ne modifie pas l’activité du GR, ce qui montre qu’il est un partenaire exclusif du MR dans les neurones. Deux autres membres de la famille, PIASy et PIASxβ, ont le même effet répressif que PIAS3 sur le MR. Contrairement à ce que nous avions montré, PIAS1 dans le modèle neuronal réprime aussi l’activité du GR, ce qui semble montrer qu’il est un modulateur tissu-spécifique du GR. Quant à PIASxβ, il a un effet opposé pour le MR et le GR, puisqu’il agit comme coactivateur du GR. Enfin, la protéine PIASy agit seulement comme un coactivateur du GR, ce qui montre que dans ce tissu, il est sélectif pour un des récepteurs. En résumé, les membres de la famille PIAS agissent donc

Introduction dans les neurones comme des modulateurs différentiels du MR et du GR (Tirard et al., 2004), et l’action de PIAS1 est tissu-spécifique.

Dans la présentation des coactivateurs du MR (Chapitre I de l'introduction), nous avions vu l’importance de la famille p160, codant notamment pour les isoformes SRC-1a et 1e. Ces deux isoformes présentent une expression tissu-spécifique (Hong et al., 1996; Xu et al., 2000), et nous avions décrit l’aspect promoteur-spécifique de leur interaction avec le MR. Ce dernier point est identique entre le MR et le GR. En fonction du promoteur, l’isoforme SRC-1e favorise la transactivation du MR, mais pas celle du GR. Ce niveau de sélectivité pour le récepteur est atteint quand SRC-1e se lie sur le NTD du MR plutôt que sur le domaine AF-2. L’influence du ligand a aussi été investiguée en traitant les cellules par de la corticostérone ou par du RU486, l’antagoniste à activité agoniste partielle du GR. De cette façon, il a été montré que le complexe corticostérone-GR est coactivé seulement par SRC-1e, tandis que le complexe RU486-GR est coactivé seulement par SRC-1a (Meijer et al., 2005). Cette étude a mis en évidence un partenariat entre les isoformes de SRC-1 et les récepteurs MR et GR qui est sélectif du locus, du ligand, du récepteur et probablement du tissu.

Un nouveau criblage double-hybride utilisant le MR entier a permis d’identifier la sous-unité γ du facteur de transcription NF-Y (NF-YC) comme nouveau partenaire du MR (Murai-Takeda et al., 2010). Après validation extensive de l’interaction entre NF-YC et le NTD du MR, il a été démontré que l’aldostérone induit la translocation nucléaire du MR et de NF-YC in vitro et in vivo. Une fois dans le noyau, l’activité transactivatrice du MR induit par l’aldostérone ou le cortisol est inhibée par NF-YC, et cet effet est aboli par un siRNA spécifique de NY-FC, ce qui permet de le définir comme corépresseur. Enfin, NF-YC n’a aucun effet sur l’activité de transactivation des autres récepteurs oxo-stéroïdiens. NF-YC est donc un corégulateur sélectif et agoniste-induit du MR.

Oakley et al. ont identifié la protéine MDFIC comme étant un partenaire du GR qui guide l’action tissu-spécifique des glucocorticoïdes (Oakley et al., 2017). MDFIC (pour MyoD Family Inhibitor domain Containing) interagit avec la région charnière du GR et régule l’activité du GR en modifiant son état de phosphorylation. De part cette interaction, le GR possède une activité transcriptionnelle gène-spécifique. De façon intéressante, le GR réprime le gène codant l’expression de MDFIC, autorisant ainsi une boucle de rétrocontrôle négatif sur l’activité de MDFIC.

Introduction

L’ensemble de ces partenaires transcriptionnels, sélectifs du récepteur, du ligand, du gène et/ou du tissu, montre que les mécanismes de sélectivité entre le MR et le GR sont complexes et dépendants du contexte. S’il est fort probable que les deux récepteurs régulent certains gènes en commun, il existe aussi un certain nombre de mécanismes et de partenaires permettant à chacun d’avoir un rôle spécifique.

Quelques études se sont intéressées aux différences entre le MR et le GR en amont de leur activité de transactivation, en particulier au niveau de leur disponibilité au sein du complexe de protéines chaperonnes. Kovacs et al. se sont intéressés aux interactions entre les histones désacétylases (HDAC), la chaperonne Hsp90 et le GR. L’hyperacétylation de la Hsp90 inhibe sa fonction de chaperonne. Ils ont démontré que la HDAC6 régule la Hsp90 par désacétylation, donc permet le maintien de sa capacité à chaperonner le GR. En cela, HDAC6 est indispensable à la signalisation relayé par le GR (Kovacs et al., 2005). Récemment, il a été démontré que la désacétylation de la Hsp90 par la HDAC6 influençait de façon importante le MR, non pas au niveau de son activité de transactivation, mais au niveau de sa localisation subcellulaire. En fait, le MR serait ainsi plus disponible. La HDAC6 agit comme un garant de la disponibilité du MR via la Hsp90, générant ainsi un point de balance dans la disponibilité respective du MR et du GR (Jiménez-Canino et al., 2016b).

4. Les structures quaternaires du MR et du GR

L’homologie de structure et de séquence dans le DBD du GR et du MR se traduit à la fois par la reconnaissance d’un même MRE/GRE, mais surtout par celle de cibles génomiques communes validées physiologiquement, comme SCNN1A, SGK1 ou PER1 (Mifsud and Reul, 2016). S’il est communément admis que le MR et le GR agissent sous forme d’homodimères, plusieurs études se sont intéressées à la formation d’hétérodimères MR-GR, en particulier dans l’hippocampe où les deux récepteurs sont exprimés à des niveaux comparables et lient tous les deux le cortisol (Gómez-Sánchez et al., 1990; Joëls and De Kloet, 1992; Trapp et al., 1994; Liu et al., 1995; Ou et al., 2001; Nishi et al., 2004).

Introduction

Le fait que le MR agisse sous la forme d'un dimère avait été montré par l’utilisation du promoteur artificiel du MMTV contenant un GRE palindromique et 3 hémi-GRE, lié à un gène rapporteur. Cette même stratégie a permis d’évoquer l’hypothèse d’un hétérodimère MR-GR (Cato and Weinmann, 1988). Le même type d’expériences a été réalisée sur le hMR transfecté et stimulé par différents agonistes sélectifs du MR (aldostérone, DOC), du GR (dexaméthasone) ou du AR (R1881). L’aldostérone et la dexaméthasone avaient le même effet activateur sur la transcription. En mettant en compétition la dexaméthasone avec de l’aldostérone tritiée, l’effet de la dexaméthasone était maintenue, suggérant que le GR, endogène dans le modèle utilisé, était impliqué (Govindan et al., 1991). A nouveau, des effets transcriptionnels sur MMTV-gène rapporteur ont été observés en transfectant une lignée de neuroblastes avec le MR et le GR, seuls ou associés. Il a alors été montré un effet collaboratif synergique entre les deux récepteurs qui n’était pas retrouvé pour les récepteurs seuls (Trapp et al., 1994). L’équipe du Pr Pearce a réalisé les premiers mutants des deux récepteurs au niveau de la boite D du DBD, appelés mutants dim pour dimérisation. Après avoir étudié par retard sur gel (gel shift) l’interaction entre le MR et le GR sur un GRE, ils ont validé l’existence d‘homodimères et d’hétérodimères. Dans un modèle cellulaire CV1b transfecté avec les récepteurs sauvages ou mutés, ils ont apporté des preuves supplémentaires sur la possibilité pour le MR et le GR de former des homodimères et des hétérodimères grâce à leur boucle D. Plus précisément, la boite D présente une arginine, résidu chargé positivement, et un acide aspartique, résidu chargé négativement (pour rappel, voir la Figure 2). Au sein d'un dimère, l'acide aspartique d'un monomère forme un pont salin avec l'arginine de l'autre monomère et vice-versa (Liu et al., 1995). C’est grâce au développement du FRET (pour Fluorescence Resonance Energy Transfert) que la proximité des deux récepteurs sur l’ADN a été démontré sur des cellules vivantes. Les protéines de fusion CFP-GR (Cyan Fluorescent Protein-GR) et YFP-MR (Yellow) ont été transfectées dans des neurones hippocampaux en culture. Les cellules étaient ensuite traitées par la corticostérone et suivies par microscopie. Le FRET ne permet de voir que les interactions de deux molécules distantes de moins de 10 nm. C’est ainsi que cette étude a permis de démontrer la présence d’hétérodimères MR-GR in vivo (Nishi et al., 2004).

La fonction de ces hétérodimères MR-GR a été recherchée dans des modèles cellulaires hippocampaux. Il a d’abord été montré que l’hétérodimère transréprime Htr1a (codant pour le récepteur à la sérotonine), via un GRE négatif (nGRE, 2 hexanucléotides en répétition directe séparés par six paires de bases) (Ou et al., 2001), puis qu’il avait un rôle propre dans la transactivation de cibles génomiques communes au MR et au GR, comme Per1, Sgk1 ou Fkbp5 en se liant à des GRE palindromiques (Mifsud and Reul, 2016). La fonction précise et spécifique

Introduction de ces hétérodimères n’est pas encore définie. Nous nous sommes intéressés à l’existence de ces structures quaternaires dans un modèle rénal dans le troisième chapitre des résultats.

B. Sélectivité et dynamique de la machinerie transcriptionnelle

1. Conformation de l’ADN, éléments de réponse et recrutement du MR

Les récepteurs nucléaires sont exprimés dans divers tissus et certains d'entre eux, comme le GR, sont ubiquitaires. Selon le tissu, le rôle physiologique d’un récepteur change, comme nous l’avons vu pour le MR dans la première partie de l’introduction. Pour qu’un même récepteur, dont les structures primaires et secondaires ne changent pas au sein d’une espèce, puissent exercer une série importante de fonctions selon les tissus, il doit faire preuve d’une certaine plasticité, ou capacité d’adaptation. Cette plasticité se traduit par la capacité à être modifié après la traduction, pour s’adapter dans tous les contextes, mais aussi à apporter une réponse précise et adéquate à un contexte particulier. Pour cela, les récepteurs nucléaires sont régulés par des modifications allostériques en fonction du contexte physiopathologique, du type cellulaire et du gène. Quatre types de signaux sont intégrés au niveau du récepteur nucléaire : la liaison de l’ADN, la liaison du ligand, les modifications post-traductionnelles, et les interactions avec d’autres facteurs de transcription (Weikum et al., 2017). Ces signaux modifient les structures quaternaires et tridimensionnelles du récepteur nucléaire, et vont chacun différemment moduler son activité. Nous avons décrit précédemment l’importance du ligand, des partenaires transcriptionnels et des PTM dans la réponse différentielle qu’adoptent le MR et le GR en réponse à leur hormone. Le quatrième acteur de la spécificité de la réponse transcriptionnelle est l’ADN.

a) L’ADN, acteur dans le recrutement des transrégulateurs

Depuis quelques années, l’ADN est décrit comme ayant un rôle actif dans la régulation transcriptionnelle due aux récepteurs nucléaires. L’analyse de la structure cristallographique du DBD du GR en complexe avec différents GRE, endogènes ou synthétiques, a montré que les nucléotides non engagés par une interaction avec les acides aminés de la boîte P, id est les nucléotides du spacer séparant les deux hémi-GRE, influencent directement la conformation

Introduction adoptée par le DBD (Thomas-Chollier et al., 2013). En particulier, le levier du DBD du GR (résidus 469 à 474) adopte des conformations distinctes selon la nature des nucléotides non spécifiques du spacer du GRE, ce qui conditionne le changement de conformation du LBD (Meijsing et al., 2009). De plus, une variation d’un acide aminé dans la séquence du levier, comme c’est le cas entre les isoformes α et γ du GR, a des conséquences directes sur l’activité transcriptionnelle du récepteur (Thomas-Chollier et al., 2013). En modifiant artificiellement et précisément le spacer d’un GRE, la réponse transcriptionnelle du GR est modifiée (Watson et al., 2013). Cela montre que le spacer est aussi important que la séquence des hémi-GRE, et il a de plus été proposé que l'ensemble de la séquence entre les positions -8 et +8 par rapport au centre du GRE serait importante pour la réponse transcriptionnelle du GR.

Enfin, de la conformation du LBD, en particulier de la fonction AF-2, dépend le recrutement des partenaires du GR, et donc la réponse transcriptionnelle sur la cible génomique. L’ADN est depuis lors décrit comme un ligand allostérique des récepteurs nucléaires ayant un rôle actif dans leur activité transrégulatrice de façon gène-spécifique (Watson et al., 2013). On peut émettre l’hypothèse que les 2 acides aminés qui différent entre le DBD du GR et le DBD du MR sont responsables de la reconnaissance de motifs identiques mais de réponses transcriptionnelles différentes.

b) La séquence des GRE dans la régulation gène-spécifique

La séquence des GRE influencerait le recrutement du MR au niveau de la stabilité de la liaison du DBD. En effet, chaque GRE entraîne un changement conformationnel du DBD différent, ce qui se reflète sur la conformation du LBD, et ce qui influe la nature des partenaires transcriptionnels du MR recrutés, comme cela a été montré pour le GR (Meijsing et al., 2009), le ER et le AR. Pour le AR, la séquence du GRE influence aussi la conformation du NTD, protégeant plus ou moins le AR des enzymes de dégradation (Brodie and McEwan, 2005).

Plusieurs équipes ont cherché à identifier des motifs, seuls ou combinés à un GRE, responsables d’un recrutement tissu-spécifique des récepteurs stéroïdiens. Dans le cas du GR, l’approche de ChIP-exo (ChIP suivi d’une digestion par exonucléases), appliquée à des lignées humaines exprimant le GR (cellules IMR90 et U-2 OS) et couplée à une analyse bioinformatique, a permis d’identifier les motifs, seul ou en combinaison avec un GRE, et correspondant aux facteurs de transcription TEAD/TEF, au sein des sites de liaisons génomiques du GR (Starick et

Introduction al., 2015). A partir de cette donnée, il a été possible de caractériser un nouveau mode de liaison du GR sur ses cibles, sous forme de monomère sur un motif TEAD/TEF et en partenariat avec les protéines de cette famille de facteurs (dont ETS2, TEAD3 et TEAD4). Dans le cas du MR, le but est également d’identifier des motifs qui seraient à l’origine d’un recrutement préférentiel au MR vis-à-vis du GR. Lisa van Weert et ses collaborateurs ont réalisé une étude cistromique du MR et du GR à partir d’hippocampes de rat, en utilisant l’approche de ChIP-Seq. Ces hippocampes provenaient de rats surrénalectomisés depuis 3 jours, ayant été sacrifiés 1 h après avoir reçu une injection de corticostérone (300 ou 3000 mg/kg). A partir des sites génomiques identifiés, ils ont fait une recherche de motifs de novo. Ils ont ainsi mis en évidence que le motif Atoh1, correspondant aux facteurs de transcription NeuroD, est présent exclusivement dans les sites génomiques du liaison du MR (van Weert et al., 2017). Il n’est retrouvé ni dans les sites de liaison du GR, ni dans les sites communs au MR et au GR. De plus, le motif Atoh1 est co-localisé au GRE dans l’ensemble des sites. Il a été proposé que NeuroD, en tant que partenaire transcriptionnel, stabilisait la liaison du MR sur l’ADN. Cette stabilisation favoriserait la réponse transcriptionnelle sélective du MR par rapport au GR dans ce contexte neuronal.

2. Le recrutement du MR et de ses corégulateurs transcriptionnels est dynamique

L’étude du complexe transcriptionnel formé par un récepteur nucléaire et ses corégulateurs transcriptionnels se fait souvent de façon linéaire, en observant une série de phénomènes figés à un temps t. Or, il faut prendre en compte le fait que l’ensemble des évènements transcriptionnels d’un système biologique se déroule de façon dynamique. Métivier et al. ont apporté des informations majeures sur ce sujet. Ce groupe a étudié le recrutement du récepteur α des œstrogènes (ERα) et de ses partenaires sur le promoteur du gène pS2, codant pour le Trefoil Factor 1 (TFF1), dans les cellules tumorales mammaires humaines MCF-7 (Masiakowski et al., 1982). Ils ont développé l’approche de ChIP cinétique sur des cellules synchronisées 3 jours par déprivation en stéroïde, puis traitées 2 h par l’α-amanitine, ce qui déstabilise l’ensemble des complexes transcriptionnels en inhibant sélectivement l’ARN Pol II (Rudd and Luse, 1996). Les cellules ont été ensuite traitées pendant 180 min par l’estradiol, agoniste sélectif du ERα, et un aliquote est arrêté par intervalles de 5 min en fixant les cellules avec du paraformaldéhyde (Métivier et al., 2003). Ils ont ainsi démontré que le ERα est le moteur du recrutement ordonné, cyclique et combinatoire de ses différents partenaires transcriptionnels (Figure 15). Pour le MR, cet aspect est d’autant plus intéressant que, dans les tissus où il est coexprimé avec le GR, les

Introduction

évènements dynamiques pourraient rendre compte qu’en fonction du contexte cellulaire, l’un agisse préférentiellement à l’autre.

Figure 15 : Dynamiques de recrutement des partenaires transcriptionnels coordonnés par le ERα activé par l’œstradiol sur le promoteur du gène pS2. Le complexe ERα, après un cycle improductif, entraîne le recrutement de coactivateurs, dont SRC-1, et de l’ARN Polymérase II. Ces recrutements ordonnés, cycliques et combinatoires, permettent la régulation de la transcription. D’après (Métivier et al., 2003).

Nous l’avons vu précédemment, les codes épigénétiques et les histones sont les garants de la conformation et de l’accessibilité à l’information génétique. Le concept de dissociation facilitée des facteurs de transcription de l’ADN a récemment été développé. Selon le contexte physiologique, le niveau d’expression d’un facteur de transcription change dans la cellule, ainsi que celui de ses partenaires transcriptionnels et de ses compétiteurs (par exemple le GR pour le MR). En présence d’une forte quantité de compétiteurs, la dissociation d’un FT de l’ADN peut être accélérée : c’est la dissociation facilitée. Ce phénomène, décrit à partir d’expériences sur Escherichia coli, pourrait avoir une importance capitale dans les dynamiques de régulation transcriptionnelle (Kamar et al., 2017).

Introduction

En résumé, dans la première partie de l’introduction, nous avons présenté successivement le récepteur minéralocorticoïde, les mécanismes régulant son expression, ses ligands physiologiques, ses fonctions pléiotropes et la voie de signalisation qu’il régule. La seconde partie était consacrée aux implications physiopathologiques des dysfonctionnements de la signalisation du MR, au développement consécutif d’antagonistes du MR. Nous avons pris conscience à ce moment de l’importance d’identifier de nouvelles cibles génomiques du MR qui pourraient être impliquées en pathologie. Enfin, au cours de la troisième partie, nous avons mis en lumière la complexité de la signalisation minéralocorticoïde, qui est confrontée à la double dualité de ses ligands et de ses récepteurs. Il apparait maintenant clair que les mécanismes de transrégulation impliquant le MR sont insuffisamment caractérisés. Ainsi, au cours de mon travail de thèse, j’ai cherché à identifier de façon exhaustive de nouvelles cibles génomiques du MR, ainsi qu’à caractériser plus précisément les mécanismes moléculaires impliqués dans la signalisation minéralocorticoïde.

OBJECTIFS

Objectifs

La place fondamentale qu’occupe la signalisation minéralocorticoïde en physiologie, notamment dans la régulation de l’homéostasie hydroélectrolytique et de la pression artérielle, est relativement bien définie (Viengchareun et al., 2007). Son implication déterminante dans le développement et la progression de plusieurs pathologies majeures chez l’Homme est incontestable. De nombreuses études fondamentales et cliniques ont montré un lien entre des altérations de la signalisation minéralocorticoïde et d’importants problèmes de santé publique, comme l’hypertension artérielle, des dysfonctionnements cardiorénaux et le syndrome métabolique (Jaisser and Farman, 2016). Nonobstant, de nombreux points d’ombre restent à éclaircir quant aux nombreux acteurs régulés et aux mécanismes moléculaires impliqués dans la signalisation minéralocorticoïde. C’est pourquoi il est aujourd’hui essentiel d’identifier de nouvelles cibles de la signalisation minéralocorticoïde et d’en appréhender les mécanismes moléculaires complexes et dynamiques, notamment dans un contexte de sélectivité hormonale, et cela afin de pouvoir mieux comprendre ces pathologies et de proposer aux patients de nouvelles thérapies adaptées.

Lorsque mon projet de thèse a démarré, plusieurs questions restaient ouvertes :

- Quelles sont les cibles génomiques du récepteur minéralocorticoïde dans les cellules rénales ?

Le nombre de gènes identifiés comme étant régulés par l’aldostérone via le récepteur minéralocorticoïde dans le rein est très restreint. Pourtant, la signalisation de l’aldostérone est loin d’être complètement caractérisée. D’une part, si son rôle dans la réabsorption de sodium et l’excrétion de potassium est bien défini (Viengchareun et al., 2007), les mécanismes fins de régulation restent à identifier. D’autre part, son implication en physiopathologie cardiorénale (Jaisser and Farman, 2016), nous a mené à nous intéresser et à décrire l’ensemble des gènes cibles du MR. En effet, il est probable que parmi ces cibles, certaines soient associées à des dysfonctionnements observés dans la signalisation minéralocorticoïde cardiorénale. La technique d’immunoprécipitation de la chromatine (ChIP), couplée au séquençage haut-débit (ChIP-Seq) et associée à des outils bioinformatiques, avait déjà permis d’identifier les cibles génomiques des autres récepteurs oxo-stéroïdiens, et semblait tout à fait appropriée pour répondre à notre objectif.

Objectifs

- Quel est le lien entre le recrutement du MR sur ses cibles génomiques et la transrégulation des gènes cibles de l’aldostérone ?

Le lien entre le site de liaison d’un facteur de transcription et les gènes environnants n’est pas évident, et ce pour au moins trois raisons. Classiquement, il est proposé que les facteurs de transcription se fixent dans les régions promotrices de gènes, à moins de 2 kb en amont du TSS, pour réguler la transcription. Or il a été montré, pour le GR et le PR, que la majorité des sites de liaison génomiques se situe à plus de 10 kb du TSS du gène le plus proche (Pan et al., 2011 ; Rubel et al., 2012). L’association entre un site de liaison génomique et le gène régulé doit donc être investiguée. De plus, l’assemblage d’un complexe transcriptionnel fonctionnel comprend un ensemble d’évènements dynamiques tout à fait spécifiques des acteurs présents et du locus concerné. L’observation d’un recrutement à un locus donné à un temps donné n’est pas forcément suivi d’effets immédiats sur la transcription (Métivier et al., 2003). La dimension temporelle de ces phénomènes doit donc être prise en compte. Enfin, la présence d’un élément de réponse de type GRE semblait jusqu’à récemment un prérequis au recrutement des récepteurs oxo-stéroïdiens. Or, dans une étude sur un modèle neuronal, l’équipe de Datson a montré que seule la moitié des sites de liaison du GR contiennent un GRE (Polman et al., 2012), et l’équipe de Meijsing que le recrutement du GR pouvait se faire sur des co-motifs du GRE correspondant à d’autres facteurs de transcription, suggérant que le GR peut aussi se lier de façon indirecte à l’ADN (Starick et al., 2015). Ainsi, il nous a semblé important d’approfondir l’étude des effets transcriptionnels qu’entraîne le recrutement du complexe MR-aldostérone sur certaines des cibles identifiées dans la lignée rénale humaine.

- Comment les antagonistes du MR interfèrent dans la signalisation minéralocorticoïde ?

La découverte, depuis les années 1950, de l’implication de la signalisation minéralocorticoïde dans plusieurs pathologies humaines majeures s’est faite en parallèle du développement et de l’utilisation thérapeutique d’antagonistes du MR. En effet, la spironolactone, premier antagoniste historique du MR, a permis de mieux appréhender le rôle délétère du MR dans les pathologies cardiovasculaires, autant par les approches de biologie moléculaire que par les essais précliniques et cliniques (Ménard, 2004). Or, la spironolactone n’est pas un antagoniste sélectif du MR, puisqu’elle est aussi un antagoniste du AR et du GR, et est un agoniste du PR (Yang and Young, 2016). Le développement de la finérénone, un nouvel antagoniste non-stéroïdien sélectif du MR développé par le laboratoire pharmaceutique Bayer Pharma, devrait permettre 1)

Objectifs

d’améliorer la prise en charge des patients insuffisants cardiaques souffrant d’hyperkaliémie sous spironolactone, 2) d’améliorer celle des patients atteints de néphropathie diabétique (Filippatos et al., 2016). Une collaboration entre Bayer et notre équipe a débuté en 2005 par la caractérisation du BR-4628, un précurseur de la finérénone (Fagart et al., 2010). Elle s’est poursuivie par la caractérisation des mécanismes moléculaires de la finérénone dans la signalisation minéralocorticoïde.

- Quels sont les mécanismes de sélectivité de la signalisation minéralocorticoïde dans un contexte de dualité hormonale (minéralocorticoïdes vs glucocorticoïdes) et cellulaire (épithélial vs non-épithélial) ?

Il est bien établi que l’aldostérone autant que les glucocorticoïdes peuvent se lier au MR, avec une affinité équivalente, et entraîner des effets transcriptionnels (Fuller, 2015). Dans les tissus exprimant l’enzyme 11βHSD2, majoritairement épithéliaux, l’excès de cortisol est réduit de sorte que le MR relaie majoritairement les effets de l’aldostérone (Morris et al., 2009). Dans les tissus non-épithéliaux, comme les cardiomyocytes et les neurones, les deux hormones activent le MR et pourraient ne pas entraîner les mêmes effets transcriptionnels. En se basant sur un modèle cellulaire exprimant le MR et le GR, et n’exprimant pas la 11βHSD2, nous avons cherché à comprendre les mécanismes de sélectivité minéralocorticoïde, en s’intéressant notamment à l’aspect dynamique de la liaison de ces deux récepteurs à l’ADN.

Dans son ensemble, ce projet a donc pour objectifs 1) d’identifier et de caractériser de nouvelles cibles génomiques du complexe MR-aldostérone dans un modèle de cellules rénales humaines et, 2) de préciser les mécanismes moléculaires de transrégulation par le MR, notamment au niveau du recrutement de partenaires transcriptionnels, en prenant en compte la dynamique du phénomène et en impliquant le contexte hormonal (aldostérone vs. glucocorticoïdes) et tissulaire (épithélial vs. non-épithélial).

Ainsi, dans la première partie de mon travail de thèse, j’ai mis au point et appliqué l’approche de ChIP-Sequencing au MR dans un modèle de cellules rénales humaines établi au laboratoire. En analysant les données de séquençage, j’ai cherché à identifier et caractériser l’ensemble des

Objectifs

cibles génomiques du MR dans ces cellules, et à valider certaines d’entre elles, notamment au niveau transcriptionnel. Dans la seconde partie de ma thèse, nous avons étudié les mécanismes moléculaires de la signalisation minéralocorticoïde en utilisant un nouvel antagoniste non-stéroïdien du MR, la finérénone. Nous avons démontré que la finérénone agit sur trois étapes majeures de la signalisation du MR dans les cellules rénales humaines. Pour cela, nous avons étudié la translocation nucléaire du MR par microscopie haut-débit, après traitement par un agoniste ou un antagoniste. J’ai démontré que l’aldostérone et la finérénone ont des impacts opposés sur la phosphorylation et la dégradation du MR. J’ai également étudié l’influence du ligand sur la formation d’un complexe transcriptionnel actif autour du MR. Dans la troisième et dernière partie de ma thèse, j’ai cherché à évaluer la contribution respective de l’aldostérone et des glucocorticoïdes dans la signalisation minéralocorticoïde dans un modèle cellulaire n’exprimant pas l’enzyme 11βHSD2, et exprimant à la fois le MR et le GR. L’étude de la transactivation de cibles génomiques communes ou spécifiques du MR et du GR, après exposition des cellules aux agonistes et antagonistes spécifiques des deux récepteurs, ainsi que l’étude de leur recrutement par ChIP, m’ont permis d’avancer dans cette voie. De plus, j’ai évalué l’occurrence d’homodimères et d’hétérodimères sur les cibles génomiques communes. Enfin, j’ai étudié l’influence de la dynamique de liaison à l’ADN dans la sélectivité minéralocorticoïde, en fonction des ligands.

Ce travail a permis d’identifier et de caractériser le premier cistrome du MR dans un modèle de cellules rénales humaines, permettant ainsi d’avoir un regard exhaustif sur les voies de signalisation régulées par l’aldostérone. De plus, l’approfondissement de nos connaissances des mécanismes moléculaires de la signalisation minéralocorticoïde, notamment au niveau de la sélectivité vis-à-vis des glucocorticoïdes, pourrait permettre la recherche de modulateur tissu- spécifiques de l’une des deux voies. Globalement, l’ensemble de ce travail permettra d’avoir une meilleure compréhension de la signalisation minéralocorticoïde et d’envisager une meilleure prise en charge des patients atteints des pathologies associées.

RÉSULTATS

1ère Partie :

Identification et caractérisation du premier cistrome du récepteur minéralocorticoïde dans une lignée rénale humaine

Résultats : Première Partie

A. Justification du projet

1. Contexte de l’étude

Comme nous l’avons vu dans l’introduction générale de ce manuscrit, l’aldostérone agit principalement par voie génomique en se liant au MR, et régule la transcription de gènes cibles et l'expression des produits de ces gènes. Dans le néphron, l’identification et la caractérisation de certains gènes cibles a permis de mettre en évidence un mécanisme d’action complexe et intriqué de l’aldostérone (Shibata, 2017) (pour rappel, voir la Figure 11). Le nombre de ces gènes identifiés est restreint, et il est vraisemblable que le complexe aldostérone-MR en régule de nombreux autres. Il semble aussi évident que, dans le rein, des aspects cinétiques et dynamiques dans la régulation des gènes cibles jouent un rôle majeur dans le contrôle du transport vectoriel ionique. Certains gènes serviraient les effets immédiats de l’aldostérone, d’autres des effets à plus long-terme. De plus, l’emballement de la signalisation minéralocorticoïde dans certaines pathologies rénales doit être sous-tendu par un dérèglement de la régulation de cibles jusque-là non-identifiées. Ces constats nous ont persuadé de la nécessité d’opérer une évaluation globale des cibles génomiques régulées par le complexe aldostérone-MR, et d’aborder l’étude des mécanismes moléculaires fins de la régulation transcriptionnelle relayée par le MR.

2. Modèle d’étude

Nous avions à notre disposition deux outils indispensables pour mener à bien notre projet. Le premier est une lignée cellulaire rénale humaine exprimant le MR, les cellules HK-GFP-hMR, développée par notre laboratoire (Deppe et al., 2002). A l’origine de cette lignée transfectée est une autre lignée, les cellules H5 (Prié et al., 1995) que nous avons nommées cellules HK (pour Human Kidney cells). Les cellules HK ont été isolées à partir d’un rein humain, initialement identifiées comme cellules principales du tubule contourné distal et immortalisées par le virus SV40. Elles forment à confluence sur boîte de Pétri une monocouche de cellules jointives et sont différenciées. Dans un premier temps, notre laboratoire s’était intéressé aux cellules HK dans le but d’étudier la navette cyto-nucléaire du MR induite par l’aldostérone. Des études ultérieures semblent avoir indiqué que les cellules HK auraient plutôt comme origine la branche ascendante large de l’anse de Henlé, en particulier parce qu’elles expriment la protéine de Tamm-Horsfall ou uromoduline (Bachmann et al., 2005) qui colocalise avec le cotransporteur NKKC2 dans ce segment néphronique (Nielsen et al., 1998) (Communication personnelle de Pierre Ronco). Par

Résultats : Première Partie

ailleurs, nos études, faites avec des sondes nucléotidiques spécifiques, nous a permis de préciser l’origine humaine de ces cellules alors que, dans la publication initiale de notre groupe, nous pensions avoir affaire à des cellules de lapin. Quoiqu’il en soit, dans la mesure où ces cellules rénales expriment un MR endogène en très faible quantité, et pour des raisons de sensibilité de la méthode de mesure de fluorescence utilisée, notre laboratoire a transfecté les cellules HK de façon stable avec le plasmide pcDNA3-hMR-EGFP (Enhanced Green Fluorescent Protein) (Deppe et al., 2002), et ainsi généré la lignée HK-GFP-hMR. Dans ces cellules HK-GFP-hMR, le MR est donc à la fois exprimé de façon endogène en très faible quantité, et à la fois surexprimé sous la forme d'une protéine de fusion GFP-hMR. Les cellules HK-GFP-hMR sont donc des cellules rénales différenciées qui expriment un MR sensible à l’aldostérone. Le second outil nécessaire et indispensable à l’identification des cibles génomiques du MR est un anticorps spécifique du MR, de haute affinité et avidité, capable d’immunoprécipiter le MR et sa version chimérique avec une très bonne efficacité. Notre laboratoire a développé l’anticorps polyclonal 39N, généré dans le lapin après immunisation par un peptide contenant les 18 acides aminés N- terminaux du MR humain (100% homologues avec les 18 premiers acides aminés du MR de souris et de rat) couplé à la keyhole limpet hemocyanin (KLH), puis purifié par chromatographie d’affinité sur le même peptide (programme de production d’anticorps Double X/XP Boosting ; Eurogentec, Seraing, Belgique). L’anticorps 39N avait été validé pour son utilisation pour les approches de Western blot, d’immunoprécipitation et d’immunocytochimie sur le MR de souris, de lapin et bien sûr d’Homme (Viengchareun et al., 2009, communication personnelle).

3. Hypothèses de travail

Notre première hypothèse était que l’aldostérone entraîne le recrutement du MR sur de nombreuses séquences génomiques, dont seulement une minorité d’entre elles avait déjà été caractérisée mais une majorité restait inconnue. Nous voulions faire une analyse systématique et la plus exhaustive possible, et cela grâce au ChIP-Seq qui permet d’identifier l’ensemble des sites de liaisons génomiques, ou cistrome, d’une protéine sur le génome d’une cellule (Barski et al., 2007). Le ChIP-Seq avait auparavant été appliqué au GR dans différents types cellulaires (Pan et al., 2011; Polman et al., 2012). Cela avait permis de mettre en évidence que le GR régule ses gènes cibles à de longues distances (plus de 10 kbp voire 100 kbp), et que sa liaison à l’ADN ne dépendait de la présence d’un motif GRE que dans 50% des cas. Il avait été démontré pour le GR que, en se fixant sur un certain type de GRE, il entraînait des effets transcriptionnels sur le

Résultats : Première Partie

long-terme plutôt qu’immédiats (Hess et al 1990). Notre seconde hypothèse était que le MR, en se liant à ses cibles génomiques, entraîne des effets transcriptionnels immédiats mais aussi différés dans le temps. Enfin, notre troisième hypothèse était que le recrutement du MR sur un locus donné soit associé au recrutement de partenaires transcriptionnels. Ce sont ces différents aspects qui nous ont intéressés après la réalisation du ChIP-Seq du MR dans les cellules HK- GFP-MR.

4. Objectifs du travail

Nous avons mis au point et appliqué l’approche de ChIP-Seq du MR dans les cellules HK- GFP-MR après exposition ou non à l’aldostérone. A partir de l’analyse des données de séquençage, nos objectifs ont été :

- d’identifier et de caractériser les sites de liaison génomiques du MR activé par l’aldostérone ;

- d’identifier des motifs présents au sein de ces sites, qui seraient récurrents et indispensables au recrutement du MR ;

- d’étudier le lien entre le recrutement du MR sur un site et la régulation transcriptionnelle du gène associé correspondant ; et enfin,

- de déterminer la survenue du recrutement de partenaires moléculaires transcriptionnels consécutivement au recrutement du MR sur ce site.

Les principaux résultats obtenus sont présentés dans l’Article 1.

Article 1

Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells

Florian Le Billan, Junaid A. Khan, Khadija Lamribet, Say Viengchareun, Jérôme Bouligand, Jérôme Fagart*, Marc Lombès*

* Ces auteurs ont contribué de façon équivalente.

FASEB J. 2015 Sep;29(9):3977-89

The FASEB Journal • Research Communication

Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells

† † † † Florian Le Billan,*, Junaid A. Khan,*, ,1 Khadija Lamribet,*, Say Viengchareun,*, † ‡ † † Jer´ omeˆ Bouligand,*, , Jer´ omeˆ Fagart,*, ,2,3 and Marc Lombes*` , ,§,2,3 *Unite´ 1185, Institut National de la Sante´ et de la Recherche Medicale,´ Le Kremlin-Bicetre,ˆ France; † FacultedeM´ edecine´ Paris-Sud, Unite´ Mixte de Recherche-S1185, Universite´ Paris-Sud, Le Kremlin- ‡ Bicetre,ˆ France; and Service de Gen´ etique´ Moleculaire,´ Pharmacogen´ etique´ et d’Hormonologie and §Service d’Endocrinologie et des Maladies de la Reproduction, Hopitalˆ de Bicetre,ˆ Assistance Publique-Hopitauxˆ de Paris, Le Kremlin Bicetre,ˆ France

ABSTRACT Aldosterone exerts its effects mainly by ac- ALDOSTERONE, THE MAIN MINERALOCORTICOID HORMONE in humans, tivating the mineralocorticoid receptor (MR), a transcrip- plays a critical role in maintaining sodium homeostasis by tion factor that regulates gene expression through complex regulating sodium reabsorption within the distal collecting and dynamic interactions with coregulators and transcrip- duct of the nephron (1). This steroid hormone primarily tional machinery, leading to fine-tuned control of vectorial exerts its genomic effects by binding to and activating the ionic transport in the distal nephron. To identify genome- mineralocorticoid receptor (MR), a ligand-induced tran- wide aldosterone-regulated MR targets in human renal scription factor belonging to the nuclear receptor superfamily cells, we set up a chromatin immunoprecipitation (ChIP) (2). In the absence of hormone, MR has been shown to be assaybyusingaspecific anti-MR antibody in a differenti- located mainly in the cytoplasm, as a part of a heat shock ated human renal cell line expressing green fluorescent protein (HSP)-containing heterooligomeric complex. Aldo- protein (GFP)-MR. This approach, coupled with high- sterone binding to MR leads to a conformational change in throughput sequencing, allowed identification of 974 ge- the receptor, triggering its nuclear translocation. Thus, it has nomic MR targets. Computational analysis identified an been proposed that the aldosterone-MR complex binds, as MR response element (MRE) including single or multiple adimer,tospecific DNA sequences, so-called hormone re- half-sites and palindromic motifs in which the AGtA- sponse elements (HREs), located in the regulatory sequences CAgxatGTtCt sequence was the most prevalent motif. Most of target genes. Subsequent recruitment of the basal tran- genomic MR-binding sites (MBSs) are located >10 kb from scriptional machinery, as well as several transcriptional cor- the transcriptional start sites of target genes (84%). Specific egulators, leads to fine-tuned regulation of gene transcription. aldosterone-induced recruitment of MR on the first most Altered mineralocorticoid signaling pathways have been relevant genomic sequences was further validated by ChIP- documented in numerous human diseases, such as arterial quantitative (q)PCR and correlated with concomitant and hypertension and cardiovascular and kidney diseases. positive aldosterone-activated transcriptional regulation of Thus, a better understanding of renal mineralocorticoid the corresponding gene, as assayed by RT-qPCR. It was signaling requires identification of aldosterone-regulated notable that most MBSs lacked MREs but harbored DNA genes and characterization of fine-tuned molecular mech- recognition motifs for other transcription factors (FOX, anisms of gene transactivation. During the past decades, EGR1, AP1, PAX5) suggesting functional interaction. This intensive research on MR target genes in several work provides new insights into aldosterone MR-mediated mineralocorticoid-sensitive tissues or cells has led many renal signaling and opens relevant perspectives for laboratories to develop various experimental approaches, mineralocorticoid-related pathophysiology.—Le Billan, F., including SAGE (3), microarrays (4), and transcriptomics Khan,J.A.,Lamribet,K.,Viengchareun,S.,Bouligand,J., (5). These approaches aided in the description of impor- Fagart, J., Lombes,` M. Cistrome of the aldosterone-activated tant aldosterone-regulated effectors, most notably those mineralocorticoid receptor in human renal cells. FASEB J. involved in sodium reabsorption in animal and cell models. 29, 3977–3989 (2015). www.fasebj.org For instance, the transcriptional regulation of classic MR target genes, such as sodium channel, non–voltage-gated 1 Key Words: chromatin immunoprecipitation sequencing • sodium • nuclear receptor • transcription factor 1 Current affiliation: Institute of Pharmacy, Physiology and Pharmacology, University of Agriculture, Faisalabad, Pakistan. 2 These authors contributed equally to this work. Abbreviations: aENaC, epithelial sodium channel, a-subunit; 3 Correspondence: INSERM U1185, FacultedeM´ edecine´ AP-1, activated protein 1; AR, androgen receptor; BSA, bovine Paris-Sud, UniversiteParis-Sud,63rueGabrielP´ eri,´ 94276, Le serum albumin; CCD, convoluted collecting duct; ChIP, chro- Kremlin-Bicetre,ˆ France. E-mail: [email protected] (M.L.); matin immunoprecipitation; ChIP-seq, sequencing of ChIP- [email protected] (J.F.) enriched fragments; DBD, DNA-binding domain; EGR1, early doi: 10.1096/fj.15-274266 growth response protein 1; ERGIC1, endoplasmic reticulum- This article includes supplemental data. Please visit http:// (continued on next page) www.fasebj.org to obtain this information.

0892-6638/15/0029-3977 © FASEB 3977 Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 a (SCNN1A), encoding for the a-subunit of the epithelial experimental tools undoubtedly helped deepen our un- sodium channel (aENaC), was first identified in the distal derstanding of renal mineralocorticoid signaling and convoluted tubule (6) and was subsequently studied by provided new insights into how MR participates in the measuring the activity of a promoter construct containing hormonal control of the ion vectorial transport. MR response elements (MREs) linked to a reporter gene (7). Afterward, SAGE was performed on aldosterone-treated MATERIALS AND METHODS cells from the distal convoluted tubule and identified new aldosterone target genes, such as serum glucocorticoid kinase Aldosterone, protease inhibitor cocktail (PIC), and Laemmli 1(SGK1) and glucocorticoid-induced leucine zipper (GILZ) buffer were purchased from Sigma-Aldrich (Lyon, France). (3, 8). More recently, Fakitsas et al. (4) identified 9 new DMEM high glucose with L-glutamine medium, trypsin, G418, aldosterone-activated genes, including ubiquitin-specific Fast SYBR Green Master Mix buffer, random primers, dNTP, and protease 2-45 (USP2-45), by using a DNA microarray ap- Superscript reverse polymerase were purchased from Life Tech- proach on complementary DNAs obtained from mouse nologies (Saint-Aubin, France). PBS and penicillin-streptomycin distal nephron segments. Another group identified and solution were purchased from GE Healthcare (Velizy-Villacoublay,´ characterized the gene connector enhancer of kinase sup- France). Western blot equipment was purchased from Bio-Rad (Marnes-la-Coquette, France). pressor of ras 3 (CNKSR3), as an aldosterone target with renal fi activity, by using chromatin immunoprecipitation (ChIP) Puri ed rabbit polyclonal 39N antibody was raised against the first amino acids (1–18) at the N terminus of the human MR (11). and reporter-coupled mutated promoter approaches (9). Rabbit anti-SRC1 antibody was from Santa Cruz Biotechnology All these results were validated at the transcriptional level (Santa Cruz, CA, USA), mouse anti-polymerase II antibody was by quantitative (q)PCR and Northern blot analysis and from Millipore (Paris, France), and control unrelated antibody at the protein level by Western blot analysis. These new was from the HighCell# ChIP kit (Diagenode, Seraing, Belgium). approaches have decidedly improved understanding of the mechanistic aspects of the renal MR pathway and have integrated that knowledge into the understanding of the Cell culture mechanisms of transepithelial electrolytic transport. In an effort to undertake a more comprehensive as- Human kidney GFP-hMR cells or parental cells [HK-GFP-MR or HK (10, 12)] were routinely cultured at 37°C, in a humidified incubator sessment of MR genomic targets in the human kidney, we gassed with 5% CO2, seeded on Petri dishes (BP100) with 10 ml of took advantage of the ChIP assay followed by deep high- DMEM (high-glucose medium with L-glutamine) containing 2.5% throughput sequencing (ChIP-seq). For the first time, we fetal bovine serum (FBS) (Biowest, Courtaboeuf, France), 100 U/ml applied ChIP-seq analysis to acute aldosterone exposure to penicillin, and 100 mg/ml streptomycin. For the HK-GFP-MR identify the genome-wide MR-binding regions in a human cells, the medium was supplemented with geneticin (200 mg/ml). aldosterone-sensitive renal cell line (10) using a recently generated anti-MR antibody (11). Thus, we set up an exhaustive genomic mapping of MR binding sites (MBSs) on ChIP approximately 1000 sequences, allowing extensive description of a consensus MRE motif. Furthermore, novel Five days before the experiments, geneticin was removed from fi the cell medium. Twenty-four hours before hormonal treatment, aldosterone target genes were identi ed correlating ge- complete medium was removed, HK-GFP-MR cells were washed nomic MR occupancy and target gene transactivation. This twice with 5 ml PBS and incubated with steroid-free medium first ChIP-Seq analysis on human cells and appropriate (dextran-coated charcoal medium), containing 2.5% dextran- coated charcoal–treated FBS. The next day, the cells were treated for 1 h at 37°C with 100 nM aldosterone or the same amount of (continued from previous page) vehicle (ethanol). Golgi intermediate compartment; FAM65B, family with se- Treated cells were fixed with 1% paraformaldehyde (Electron quence similarity 65, member B; FBS, fetal bovine serum; Microscopy Sciences, Saint-Germain-en-Laye, France) for 10 min FKBP5,FK506bindingprotein;FOX,forkheadbox;GR,glu- at room temperature. Paraformaldehyde fixation was quenched cocorticoid receptor; GRE, glucocorticoid response element; with 0.125 M glycine for 8 min. The cells were washed twice with HRE, hormone response element; HSP, heat shock protein; ice-cold PBS. Cell lysis and chromatin shearing were performed IGV, integrative genome viewer; LINC00963, long intergenic with the HighCell# ChIP kit (Diagenode) buffers, according to non–protein-coding RNA 963; MACS, model-based analysis for the manufacturer’s recommendations, with the following mod- ChIP-seq; MBS, MR-binding site; MR, mineralocorticoid re- ifications: chromatin shearing was performed in 500 ml shearing ceptor; MRE, mineralocorticoid response element; NFATC2, buffer S1 1 protease inhibitor mix, applying 2 runs of 10 cycles at nuclear factor of activated T cells, cytoplasmic, calcineurin- high intensity (Bioruptor; Diagenode). Each cycle was composed dependent 2; NFKBIA, nuclear factor of kappa light polypeptide of 30 s with effective application of ultrasounds (on) and 30 s gene enhancer in B-cells inhibitor, a; PAX5, paired box protein without (off). Between each run, heated water was replaced by 5; PER1, period circadian protein homolog 1; PIC, protease in- ice-cold water and ice. Concentrations of sheared chromatin hibitor cocktail; PR, progesterone receptor; PTPN1, protein ty- protein were measured, using the bicinchoninic acid assay rosine phosphatase, non-receptor type 1; qPCR, quantitative (Interchim, Montluçon, France) on a spectrophotometer (Victor3; PCR; RNA pol II, RNA polymerase II; SCNN1A, sodium channel, Perkin Elmer, Courtabœuf, France), in parallel with a bovine non–voltage-gated 1 a; SERPINE1, serpin peptidase inhibitor, serum albumin (BSA) standard range (Interchim). clade E (nexin, plasminogen activator inhibitor type 1), member Protein A-coated magnetic beads (25 ml of the stock suspen- 1; SGK1, serum glucocorticoid kinase 1; SRC1, steroid receptor sion) were washed 3 times in buffer C1 and resuspended in C1 coactivator 1; TBS-T, Tris-buffered saline-Tween; TPRG1,tumor buffer supplemented with 1% PIC (100 ml final volume). Sheared protein p63 regulated 1; TSS, transcription start site; ZBTB16, chromatin (total amount of 1.3 mg protein) and 7 mgofoneof zinc finger and BTB domain containing 16; ZMYND8 zinc fin- the tested antibodies were then added to the beads and the final ger, MYND-type containing 8 volume was adjusted to 500 ml with C1 buffer supplemented with

3978 Vol. 29 September 2015 The FASEB Journal x www.fasebj.org LE BILLAN ET AL. Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 1% PIC and 0.1% BSA (final concentrations). Samples were in- between 80 and 130 bp. Primers were from Eurogentec (www. cubated overnight at 4°C with a rotary incubator. Magnetic beads eurogentec.com), purified by the selective precipitation opti- were then isolated and washed 3 times with C1 buffer and once mized process (SePOP), desalted, and delivered at 100 mM with W1 buffer. DNA fragments from the immunoprecipitated concentration in water. chromatin were eluted with the DNA isolation buffer supplemented with 1% proteinase K for 15 min at 55°C and finally for 15 min at 100°C. Isolated DNA fragments were then sequenced qPCR (ChIP-Seq) or quantified by real-time qPCR. ChIP-resulting DNA samples were amplified by real-time qPCR, by using the QuantStudio 6 Flex System (Life Technologies), with cDNA libraries and ChIP sequencing a5mlDNAsample,6ml fluorescent buffer Fast SYBR Green Master Mix, and 0.5 ml forward and reverse primers (300 nM Library preparation and Illumina (San Diego, CA, USA) se- final) (primer sequences are provided in Supplemental Table quencing were performed at the Ecole Normale Supérieure Ge- S1). After 10 min preincubation at 95°C, 40 cycles were run. Each nomic Platform (ENS, Paris, France). Libraries were prepared by cycle was composed of 15 s denaturation phase at 95°C, followed using NEXTflex ChIP-Seq Kit (Bioo Scientific, Saint Marcel, by 1 min hybridization and amplification phase at 60°C. Each France), with 1 ng IP or input DNA. The libraries were multi- DNA sample was analyzed in triplicate. All results are expressed as plexed by 6 on 1 flow cell lane. A 50 bp read sequencing was a percentage of input (Percent Input Method, ChIP analysis; Life performed on a HiSeq 1500 device (Illumina). Technologies) and expressed as means 6 SEM of 3 independent experiments.

ChIP-seq bioinformatics analysis and data managing RT- and real-time-qPCR The analyses were performed with the Eoulsan pipeline (13), including read filtering and mapping, alignment filtering, and for- Treated HK-GFP-MR cells were washed twice with ice-cold PBS. matting. Before mapping, poly-N read tails were trimmed, reads Total RNA was extracted by the guanidium isothiocyanate 1 #11 bases were removed, and reads with quality mean #12 were phenol-chloroform method, with the TRI reagent (Molecular discarded. Reads were then aligned against the Human Genome Research Center, Inc., Euromedex, Mundolsheim, France), version 19 (hg19) annotation [Genome Reference Consortium; according to the manufacturer’s recommendations. The RNA National Center for Biotechnology Information (NCBI), Bethesda, pellet wasdissolved in 20 ml water andquantified with a Nanodrop MD, USA] using Bowtie (ver. 0.12.9) (14). Alignments from reads spectrophotometer (Thermo Scientific, Villebon, France). Total matching more than once on the reference genome were re- RNA (1 mg) was incubated for 10 min at 37°C with 0.5 mlDNaseI moved by using the Java version of SAMtools (15). PCR duplicates (Biolabs, Evry, France) in a total volume of 10 ml to remove po- were filtered out with the MarkDuplicates tool of the Picard suite tential genomic DNA, followed by a 10 min incubation at 75°C (http://broadinstitute.github.io/picard/; Broad Institute, Cambridge, with 1 ml 25mM EDTA(Life Technologies). For each sample, 9 ml MA, USA) and the peak calling step was performed with model- RT mix was incubated in the presence of Superscript reverse based analysis for ChIP-seq (MACS; ver. 1.4.2) (16). The raw fastq transcriptase (1 ml), random primers (2 ml), 10 mM dNTP (0.8 ml), files are available on the GEO repository (www.ncbi.nlm.nih.gov/ 103RT buffer (2 ml), and water (3.2 ml). After enzymatic activation geo/; NCBI; accession number GSE69777). for 10 min at 25°C, RT was performed for 2 h at 37°C, and the Sequencing data were analyzed with the MACS software (17), transcriptase was rapidly denatured at 85°C. Real-time qPCR available on the online platform Nebula (Curie Institute, Paris). was performed on the cDNA, as described above. Specific MACS aligned all the read sequences on the reference hg19. This primer sequences are provided in Supplemental Table S2. A alignment allowed comparison between the DNA fragments 10th dilution standard range was run in parallel to quantify obtained from aldosterone-treated and vehicle samples, permit- cDNA [attomole amount = f(Ct value)]. All samples were ting selection of the most significant MR genomic fixation sites quantified in duplicate. Relative expression in a given sample (peaks). A peak was considered significant when it differed from was normalized to the internal reference rRNA 18S values, 2 the background signal with P $ 10 5.Foreachsite,MACScalcu- where the control condition values are arbitrarily set at 1. The lated a score that corresponds to 210log(P). MACS classified the results are expressed as means 6 SEM. significant sites on a spreadsheet containing related information [chromosome, position, score, name of the nearest gene, distance Protein quantification and Western blot analysis from transcription start site (TSS), and type region)]. The In- tegrative Genomic Viewer software (IGV) was used to visualize the DNA fragment alignment on hg19 and to select the DNA sequence Total protein extracts were prepared from treated HK-GFP-MR of the significant sites. Identification of the MRE within significant cells, using the protein extraction buffer [150 mM NaCl, 50 mM ChIP-seq peaks was performed using Jaspar (http://jaspar.genereg. Tris-HCl (pH 7.5), 0.5 mM EDTA, 30 mM sodium pyrophosphate, fi and 50 mM NaF], extemporaneously supplemented with 1% net/) (18) and FIMO (http://meme-suite.org/tools/ mo)software.The 3 resemblance between the identified MRE was monitored by using Triton X-100 (Sigma-Aldrich), 1% PIC 100 , and 0.1% SDS. the Weblogo website (http://weblogo.berkeley.edu/logo.cgi; University Samples were kept at 4°C for 30 min and then centrifuged at fi 16,000 g for 20 min at 4°C. The supernatant was resuspended in of California, Berkeley, Berkeley, CA, USA) (19). Identi cation of fi half-MRE and other motifs was performed using the MEME suite water, and the protein concentrations were quanti ed with the web server (http://meme-suite.org/tools/meme). bicinchoninic acid assay. MR immunoprecipitation was performed from 500 mgtotal proteins with anti-MR 39N antibody (7 mg), 0.1% BSA, 1% PIC Primer design for genomic amplification and RT- 1003,100ml washed protein-A-coated magnetic beads (from qPCR assays 25 ml of the stock solution; HighCell# ChIP kit; Diagenode) and C1 buffer in a total volume of 500 ml. After an overnight incubation at Primer pairs encompassing significant MBSs were designed by 4°C, the supernatants were removed, and the immunoprecipi- using NCBI’s software Primer BLAST (http://www.ncbi.nlm. tated proteins were eluted from magnetic beads after addition of nih.gov/tools/primer-blast/;NCBI).Ampliconlengthwaskept 43 Laemmli buffer and incubation at 95°C for 5 min. Fifty

CISTROME OF HUMAN RENAL MINERALOCORTICOID RECEPTOR 3979 Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 micrograms of the proteins was processed in parallel runs for im- MRE Control munoblot analysis and considered to be input samples. 0.5 The samples were electrophoresed in a Trans-Blot SD tank * (Bio-Rad), ﬁrst into a concentration gel for 20 min at 120 V, and then into a 7.5% separation gel for 40 min at 200 V. The 0.4 proteins were then transferred on a membrane using a semi- dry method, for 45 min at 18 V, at room temperature. Mem- branes were blocked for 1 h at room temperature with 5% 0.3 * nonfat milk in Tris-buffered saline-Tween (TBS-T) and in-

cubated at 4°C overnight with 1:1,000 anti-MR 39N and input % 1:10,000 anti-a-tubulin (Sigma-Aldrich) for loading controls. 0.2 * The membranes were rinsed 3 times with TBS-T and incubated 1 h at room temperature with the DyLight Fluor secondary 0.1 antibodies Rabbit 680 and Mouse 800 (1:15,000; Thermo Sci- entiﬁc). After 3 washes, the membranes were analyzed with Odyssey Fc (Li-cor Biosciences, Lincoln, NE, USA). 0 CVAH3K4CVAH3K4

Statistical analysis Figure 1. MR recruitment on promoter region of the SCNN1A gene. ChIP assays on HK-GFP-MR cells, which were incubated fi 6 with ethanol (V) or 100 nM aldosterone (A) for 1 h, xed by Experimental data are presented as the means SEM.Statistical paraformaldehyde, and lysed, and the chromatin was sheared. analyses were performed with Prism 5 software (GraphPad Soft- The samples were then immunoprecipitated with the anti-MR ware, La Jolla, CA, USA), with the nonparametric Mann Whitney t 39N antibody, an antibody directed against the trimethylated test. Differences reaching P , 0.05 were considered significant, as 3 fi lysine 4 of the [ H] histone (H3K4me3) or control rabbit IgG shownindetailinthe gures. (C). After elution, the DNA was quantified by qPCR, using primers for the genomic fragment encompassing the MRE corresponding to the MBS located in the promoter region of RESULTS SCNN1A or a control negative region located at +1068 bp from the SCNN1A TSS (Control). Results are expressed as the Pilot MR and H3K4me3 ChIP experiments percentage of input before immunoprecipitation (means 6 SEM). *P , 0.05 vs. vehicle. To ensure appropriate experimental conditions before ChIP-seq analysis, we conducted pilot ChIP experiments. demonstrate that our experimental tools were suitable to We used the HK-GFP-MR cells, a human renal cell line identify genomic MR targets in human renal cells. originating from the distal convoluted tubule that was originally stably transfectedwithanexpressionvector encoding for the fusion protein GFP-hMR (10). This cell MR ChIP-seq analysis line expresses both endogenous MR and GFP-MR fusion protein that can be immunoprecipitated with the anti-MR To explore the whole-genome target genes of MR in HK- antibody 39N (11) (Supplemental Fig. S1A, B). Moreover, GFP-MR cells, we performed a ChIP-seq analysis with 100 nM as illustrated by a transactivation assay with a reporter aldosterone- or vehicle-treated cells. The bioinformatic plasmid encoding the luciferase gene placed under analysis of sequencing data, using the MACS software, the control of a promoter containing 2 glucocorticoid identified 974 peaks as putative MBSs. For each locus, response elements (GREs), or by the measurement of the MACS calculates a score that correlates directly to the aldosterone-induced expression of the SCNN1A gene, an probability that the number of reads in the aldosterone- endogenous and classic mineralocorticoid target gene, treated condition is significantly higher than in the ve- which encodes for aENaC, the GFP-MR fusion protein is hicle conditions [score = 210*log(P)]. A locus was transcriptionally active (Supplemental Fig. S1C, D). After regarded as a putative MBS when its score was higher 2 cross-linking, lysis, and sonication, HK-GFP-MR cell samples than 50 (i.e., P $ 10 5).These peaks were annotated to were immunoprecipitated with the anti-MR 39N, anti- flanking genes on the hg19 annotation of the human H3K4me3, or negative control IgG antibody. The trime- genome (GRCh37) by MACS, because the software had thylation of histone [3H]lysine 4 is known to mark active not been updated to include the latest version of the transcription sites, enabling the recruitment of transcrip- reference human genome GRCh38. Sequencing data tion factors. Isolated DNA was quantified by qPCR, with were submitted to the Integrative Genomics Viewer primers encompassing the well-documented MRE in the (IGV; Broad Institute, http://www.broadinstitute.org/igv/) SCNN1A promoter (2289 bp from the TSS) or a nearby software, which aligns immunoprecipitated and se- control region (+1068 bp from the TSS). Aldosterone quenced fragments on hg19. The sequencing profiles of treatment induced a 15-fold increase in MR recruitment on 2 MBSs, located on the SCNN1A gene promoter and on the MRE, as compared to that induced by the vehicle con- an intron of the ZBTB16 gene, showed, respectively, 1 trol (Fig. 1). Moreover, MR enrichment was not observed in and 2 peaks only in the aldosterone-treated condition the control region after aldosterone exposure, clearly (Fig. 2A). Adding that there is a peak in the H3K4me3- demonstrating that MR recruitment was locus specific. The immunoprecipitated sample, corresponding to an open strong H3K4me3 footprint enrichment on the MRE and reading frame, these peaks correspond to MBSs. It is im- control sequences indicated that the regions were tran- portant to note that the binding sites are found throughout scriptionally active. Taken together, these findings clearly the genome. Of the 974 identified MBSs, 84% were more

3980 Vol. 29 September 2015 The FASEB Journal x www.fasebj.org LE BILLAN ET AL. Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 A

BC30 30

25 25

20 20

15 15

10 % of peaks 10 % of total peaks

5 5

0 0 4 : 6 6 : 8 0 : 2 2 : 4 0 : 1 -1 : 0 -2 : 0 8 : 10 1 : 10 -8 : -6 -4 : -2 -6 : -4 -8 : -10 -10 : -1 10 : 100 -100 : -10 100 : 2,000

-2,000 : -100 Distance from TSS (kb) Distance from TSS (kb)

D Promoter 4%

≥5 kb downstream Enhancer 3% 11% Junction 2% Exon Intergenic 2% 39%

Intron 39%

Figure 2. Distribution of ChIP-Seq reads across the human genome. A) Snapshot showing IGV software windows of the loci corresponding to the SCNN1A and ZBTB16 genes in the hg19 annotation of the human genome. ChIP-seq reads were aligned to the whole human sequence. For both SCNN1A and ZBTB16, the chromosome annotation (name, arm, and loci) are shown, with a focus on the gene with its intron and exon organization and the aligned ChIP-seq reads for the vehicle- or aldosterone-treated samples immunoprecipitated by the anti-MR 39N antibody and the anti-H3K4me3-immunoprecipitated sample. Distribution of the reads by their distance from (B) the TSS and (C) a zoom on the zone at less than 10 kb from the TSS. D) Distribution of the reads according to locus type.

CISTROME OF HUMAN RENAL MINERALOCORTICOID RECEPTOR 3981 Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 than 10 kb from the nearest TSS, with almost half of them To determine the occurrence of other motifs in the more than 100 kb from the TSS (Fig. 2B). The remaining MBSs, we used the MEME suite software. Four motifs were 16% present a gaussian distribution centered on the TSS found to correspond to DNA binding recognition sites of position (Fig. 2C).Amongthe974identified MBSs, almost 4 family members of transcription factors, including early half were intragenic: 39% within introns, 2% in exon growth response protein 1 (EGR1), forkhead box (FOX), regions, and 2% within exon–intron junctions (Fig. 2D). For paired box protein 5 (PAX5), and activated protein 1 (AP-1) the others, 39% were intergenic and between 30 and (Fig. 4A). Their number and percentage are reported in 2000 kb from the TSS, 11% within enhancers (2–30 kb from a Venn diagram (Fig. 4B). Only 4.5% (54/974) displayed the TSS), 4% within promoter regions (.2kbfromthe a combination of an MRE with another motif, suggesting TSS), and 3% more than 5 kb downstream of the TSS. potential cooperation between these transcription factors and MR. Moreover, most of the MBSs (723 peaks; 74.2%) did not exhibit any MRE, indicating that MR did not directly MR binding motif analysis and definition of MRE bind to DNA but rather may have interacted with other transcription factors within multimeric transcriptional To evaluate the consensus motif on which the MR binds, complexesthatremaintobefurthercharacterized. we used FIMO software on our results of ChIP-seq analysis. We found 251 identified palindromic and half-MREs among the MBSs. More precisely, only 7.4% (70/974 Validation of genomic MBSs peaks) of the MBSs exhibited a palindromic MRE that was close (P , 0.0001) to the consensus classic palindromic To confirm the results of ChIP-seq, we focused on the first GRE, a 15 bp motif composed of 2 inverted hexanucleo- 15peakswiththehighestscores(Table 2). They were as- tides (half-sites) separated by 3 bp, commonly recognized sociated with 13 genes. Two of them, ZBTB16 and FKBP5, by MR, glucorticoid receptor (GR), androgen receptor (AR), contained 2 MBSs. All identified genes were scattered and progesterone receptor (PR) (AGAACAnnnTGTTCT; throughout the genome. Peaks are located upstream, Fig. 3A; Table 1). To our surprise, only 1 MBS, related to downstream, or within a gene, or in the intergenic region the FKBP5 gene, exhibited 2 well-conserved palindromic (94–223 kb from their TSSs). Four of the genes have al- MREs. It is interesting that palindromic MRE distribution ready been associated with mineralocorticoid signaling: throughout the whole genome was similar to that of the zinc finger and BTB domain containing 16 (ZBTB16), MBSs, in that 94% of them were located more than 10 kb FK506 binding protein (FKBP5), SCNN1A,andperiod away from the nearest TSS. Moreover, among all identi- circadian clock 1 (PER1). So far, the 9 others have not fied MREs, 58.6% (147) consisted of single conserved been identified as playing any significant role in renal half-MREs (AGAACA; 120/147; 81%) or more (2, 3, or 4 mineralocorticoid signaling: endoplasmic reticulum-Golgi half-sites). Some MBSs (16/251; 6.3%) even exhibited intermediate compartment 1 (ERGIC1); family with se- a combination of a palindromic and at least 1 half-MRE quence similarity 65, member B (FAM65B); long intergenic (Table 1. A detailed analysis of the identified MRE on non-protein coding RNA 963 (LINC00963); nuclear factor high-, medium-, and low-score MBSs was performed of activated T cells, cytoplasmic, calcineurin-dependent 2 with the Jaspar software (18). In each group, base var- (NFATC2);nuclearfactorofkappalightpolypeptidegene iability was analyzed with the Weblogo and compared enhancer in B-cells inhibitor, a (NFKBIA); protein tyrosine with the MRE (Fig. 3B). The highest scores (.200) phosphatase, non-receptor type 1 (PTPN1); serpin pepti- were associated with an MRE motif close to the con- dase inhibitor, clade E (nexin, plasminogen activator in- sensus response element, with a notable variability on hibitor type 1); member 1 (SERPINE1); tumor protein bases 3 and 13 (AGxACAnnnTGTxCT). Peak scores p63 regulated 1 (TPRG1); and zinc finger, MYND-type .80 were associated with relatively well-conserved MRE containing 8 (ZMYND8). It was thus essential to validate motifs, keeping a palindromic dyad in which the bases ChIP-seq data analysis. We first evaluated the aldosterone- G2, A4, C5, and A6 (and T10, G11, T12, and C14 by induced recruitment of MR on the sites corresponding to symmetry) seemed to be the most important for MR these 13 genes by performing additional ChIP experiments binding and occupancy (xGxACAnnnTGTxCx). In on HK-GFP-MR cells. To quantify DNA fragment enrich- contrast, peaks with the lowest scores (;50) were often ment after MR immunoprecipitation, we performed real- associatedwithverydegeneratedMREsinwhichthe time PCR with specific genomic primer pairs surrounding bases C5 and G11 remained essential. The recently the identified MREs on each site (Supplemental Table solved crystal structure of a dimer of the MR DNA- S1). The results are expressed as the percentage of input, binding domain (DBD), bound to the palindromic according to the formula in which the Ct value of each sequence AGAACAnnnTGTTCT, revealed the sequence- immunoprecipitated sample was normalized to its input fi fi speci c contacts between the MR DBD and the DNA Ct value. Of interest, a signi cant increase in MR en- bases (20). Consistent with our definition of a consensus richment (P , 0.05) was detected for all sites when the MRE and, as depicted in Fig. 3C, D, on 1 half-site, aldosterone-treated conditions were compared to the Lys624 contacts guanine2 (fG2) from the forward vehicle-treated conditions (Fig. 5). These results validate oligonucleotide and Val625 and Arg629 contact thymine12 aldosterone-induced MR occupancy on all 13 binding sites (rT12) and guanine11 (rG11) from the reverse oligonu- identified by ChIP-seq (Table 2). We also showed that MR cleotide, respectively. In sharp contrast, the bases at recruitment was significantly enhanced by aldosterone positions 1, 3, and 6 (numbered in the forward oligonu- stimulation for PIK3R1, a genomic target that lacks classic cleotide) do not establish any contact with the side chains MREs (Supplemental Fig. S2), a finding that validates the of the MR DBD (Fig. 3C, D). discovery of genomic MR targets by ChIP-seq analysis.

3982 Vol. 29 September 2015 The FASEB Journal x www.fasebj.org LE BILLAN ET AL. Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 2 B 500

A 450 bits 1 MRE 400 0 1 2 3 4 5 6 7 8 9

2 10 11 12 13 14 15 2 350

300 bits 1 1 bits 250 Score 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 2 0 200 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 150

bits 1

100

0 1 2 3 4 5 6 7 8 9

C 10 11 12 13 14 15 Forward monomer Reverse monomer 50

0 1 101 201 301 401 501 601 701 801 901 Peak ranking D R629 R629 K624 G621 G621 K624 K624 R629 V635 V635 V635 fG2 rG11 rT12 5' AGAACActcTGTTCT3' 123 4 56 7 8 910 11 12 13 14 15 3' TCTTGTgagACAAGA 5'

V635 R629 K624

Figure 3. Characterization of the MRE. A) Identification of an MRE and a half-MRE within the MBS by FIMO software, and their distribution alone or in combination (Table 1). B) Distribution profile of the scores [equal to 210log(P)] allotted by the MACS software to the identified MBSs. MREs were identified with Jaspar software on MBSs, according to 3 grades: high (#200), intermediate ($80), and low (;50). C) The crystal structure of a dimer of MR DBD bound to the canonical MRE (Protein Database identification number: 4TNT) (20). Forward (blue) and reverse (gold) MR DBD monomers are depicted. Only critical residues of the DBD interacting helix are shown with the nitrogen atoms in blue. The DBD is schematically represented with the nucleotides in red, blue, yellow, and green for the adenine, cytosine, guanine, and thymine bases, respectively. Dashed lines: interactions between the amino acids of the MR DBD and the DNA bases. The figure was generated using Open PyMol, ver. 0.93. D) Schematic representation of the key contacts between the residues from the DNA interacting helix of the MR DBD dimer with the nucleotide of the MRE. Bases are numbered from the 59 to the 39 end. Arrows: specific contacts between the MR residues and the DNA bases.

Correlation between genomic MR occupancy and stability of newly synthesized nascent transcripts, we transcriptional activation performed a time-dependent stimulation of HK-GFP- MR cells with 10 nM aldosterone. Total RNAs were To clarify whether the enhancement of MR binding on extracted, reverse transcribed, and quantified by real- gene regulatory sequences leads to a subsequent tran- time PCR with specific primer pairs (Supplemental Ta- scriptional regulation of the corresponding genes, we ble S1). Data analysis enabled us to classify genes into 4 determined mRNA levels of the corresponding gene categories, according to their mineralocorticoid re- after aldosterone treatment of human renal cells. Given sponsiveness, consisting of early, intermediate and late that MR-induced gene transactivation is a dynamic target genes or nonregulated genes (Fig. 6 and Table 3). process that depends not only on the complex inter- Among those, steady-state mRNA levels of the PER1 gene action between molecular partners but also on the significantly increased (P , 0.05) as early as 30 min after aldosterone stimulation, in comparison to the vehicle condition. Accordingly, PER1 a major actor in the en- TABLE 1. Distribution of palindromic MREs and half-MREs, alone fi or in combination dogenous intracellular gene clock, was classi ed as an early target gene of MR. Likewise, mRNA levels of FKBP5, Sites (n) SCNN1A, SERPINE1, NFATC2, NFKBIA,andFAM65B were significantly increased after 4 h of aldosterone treatment MRE Total 1 2 3 4 and thus were classified as intermediate MR-regulated target genes. Finally, PTPN1, TPRG1, ERGIC1, ZBTB16, Palindromic MRE 70 69 1 –– and ZMYND8 were considered to be late regulated Half-MRE 147 120 22 4 1 fi Combination 16 15 1 ––genes, because their expression levels were signi cantly increased after 24 h of treatment (P , 0.05). With respect The MRE, as identified by FIMO software, is shown in Fig. 3A. to LINC00963, its expression was not significantly modified

CISTROME OF HUMAN RENAL MINERALOCORTICOID RECEPTOR 3983 Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 AB Transcription Responsive factor element 2 FOX EGR1 1 bits 94 0 1 2 4 5 7 8 3 6 9 10 13 16 19 2 11 12 14 15 17 18 20 21 22 23 24 25 6

FOX bits

0 1 2 3 4 5 6 7 8 9 10 11 EGR1 2 2 18 MRE PAX5 19 1 251 PAX5 bits 72

0 1 2 4 5 7 8 3 6 9 11 10 13 16 19 12 14 15 17 18 20 21 22 23 24 28 2

AP-1 1 AP-1 bits 44 0 1 2 3 4 5 6 7

Figure 4. Identification of alternative response elements. A) Identification of other transcription factor response elements by the MEME suite web server and (B) association with a palindromic MRE or another half-MRE. after aldosterone exposure. Thus, although MR was found transcription process of target genes. Recruitment of the to bind to a sequence located in the intergenic region at preinitiation complex is an extremely intricate mechanism, 112,000 bp from the TSS of the nearest gene (i.e., in which hundreds of molecular partners are associated in LINC00963), it is very likely that MR occupancy on this a sequential, cyclic, combinatorial manner (21). Combin- specific motif affects transcription of another unidentified ing analysis of MR-binding, MR coactivator, and RNA gene located within a region .100 kb downstream or polymerase II (RNA pol II) occupancy aided us in evalu- upstream. ating the functional consequences of aldosterone treatment on preinitiation complex assembly in the context of ongoing transcription associated with mod- Composition of MR-mediated preinitiation complexes ifications of local chromatin landscape and remodeling and histone posttranscriptional signatures. As a first ap- MR recruitment on MRE in response to aldosterone treat- proach, we sought to determine the ability of MR to pro- ment is one of the first and most critical steps in the ongoing mote the recruitment of the SRC1 coactivator and of RNA

TABLE 2. Characteristics of the ﬁrst 15 genomic MR binding motifs

Gene Chromosome Localization Distance TSS Score Locus type MR response element

Consensus GRE AGAACAnnnTGTTCT ZBTB16 11 114,033,640 +102,353 497 Intron AGAACAcacTGTACC 114,030,889 +99,602 415 Intron GGTACAgtaTGTACA FKBP5 6 35,695,858 +502 427 Intron GGGACAttgTGTTCC 35,699,815 25,043 264 Intron GGCACAggaTGTTCT SCNN1A 12 6,485,465 21,075 424 Promoter AGAACAgaaTGTCCT PER1 17 8,057,797 22,044 383 Enhancer AGAACAtgaTGTTCC NFKBIA 14 35,873,155 +805 271 Intron AGTACAgggCGTTCC TPRG1 3 188,665,933 2223,829 262 Intergenic AGGACTgtaAGGCCC PTPN1 20 49,032,357 294,533 243 Intergenic GGGACAtaaTGTGCT NFATC2 20 49,948,239 +211,019 235 Intergenic AGAACGgcgCGTCCT FAM65B 6 25,006,801 295,606 227 Intergenic AGAACAgagAGTTCC ERGIC1 5 172,296,284 +35,062 223 Intron AGGACAgcgTGTGCT LINC00963 9 132,195,193 +111,899 216 Intergenic GTAACAcacTGTTCC ZMYND8 20 45,963,033 +22,441 200 Intron AGTACAgacAGTTCC SERPINE1 7 100,755,724 214,654 197 Enhancer AGGACTtcaTGTTCT Consensus MRE AGnACAnnnTGTnCC/T

The MR-binding motifs identiﬁedbyChIP-seqaresummarized.Thesequencelocalizationisaccordingtothehg19annotationofthehuman genome (GRCh37). ProposedMREsequencesareidentiﬁed by Jaspar. Nucleotides in uppercase letters correspond to the nucleotide bases of the 2 half-sites and those underlined correspond to the ones that are identical to the corresponding nucleotide of the canonical consensus GRE.

3984 Vol. 29 September 2015 The FASEB Journal x www.fasebj.org LE BILLAN ET AL. Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 ZBTB16 FKBP5 SCNN1A PER1 NFKBIA

0.6 * 1.2 0.8 0.6 * 0.2 ** 0.5 1.0 * * 0.5 0.6 0.4 0.8 0.4 0.3 0.6 0.4 0.3 0.1

% input % 0.2 0.4 0.2 0.2 0.1 0.2 0.1 0 0 0 0 0 CV A CV A CV A CV A CV A

TPRG1 PTPN1 NFATC2 FAM65B

0.7 0.2 0.5 0.4 * * * 0.6 * 0.4 0.5 0.3 0.4 0.3 0.1 0.2 0.3

% input 0.2 0.2 0.1 0.1 0.1 0 0 0 0 CV A CV A CV A CV A

ERGIC1 LINC00963 ZMYND8 SERPINE1

0.5 * 0.2 ** 0.8 0.8 * * 0.4 0.6 0.6 0.3 0.1 0.4 0.4 0.2 % input % 0.2 0.2 0.1

0 0 0 0 CV A CV A CV A CV A

Figure 5. MR recruitment on regulatory regions of identified target genes. HK-GFP-MR cells, treated for 1 h with vehicle (V) or 100 nM aldosterone (A), were fixed by paraformaldehyde and lysed. After they were sheared, chromatin extracts were immunoprecipitated by the anti-MR 39N antibody or by the control IgG antibody (C). Eluted DNAs were quantified by real-time qPCR, with primer pairs encompassing MBSs (Supplemental Table S1). Results are expressed as percentage of input, and are means 6 SEM of 3 independent experiments performed in triplicate. *P , 0.05 or **P , 0.01 vs. the vehicle condition.

Pol II. New ChIP experiments were performed on chro- cell. The availability of a human renal MR-overexpressing matin extracts from HK-GFP-MR cells treated for 1 h with cell type (HK-GFP-MR) and a specific and suitable anti-MR 100 nM aldosterone or vehicle or 1 mM of the mineralo- antibody (39N) enabled us to perform a ChIP-seq analysis for corticoid antagonist, spironolactone. ChIP was subsequently MR. This approach aided us in identifying 974 aldosterone- performed with anti-MR 39N, anti-SRC1, or anti-RNA specific MBSs, only 7% of which contained a classic pal- Pol II antibodies. MR, SRC1, and RNA pol II occupancies indromic MRE. The aldosterone-induced recruitment of were evaluated on the SCNN1A promoter by quantitative MR was further validated onto the first 15 highest scored genomicPCR.AsillustratedinFig. 7,aldosterone peaks together, which correlated with the time-dependent, treatment led to significant recruitment of MR but also mineralocorticoid-specific activation of the corresponding of SRC1 and RNA pol II, as compared with the vehicle- gene transcription. treated condition (P , 0.05). Of interest, under similar Identifying genome-wide MR targets is of major impor- experimental conditions, although the MR antagonist tance in providing a better understanding of renal min- promoted both MR and SRC1 recruitment on the eralocorticoid signaling. The bioinformatic analyses of our SCNN1A promoter (P , 0.05), spironolactone did not ChIP-seq data, by comparing reads in aldosterone- vs. induce substantial RNA pol II recruitment, which may vehicle-stimulated conditions, enabled us to identify ap- account for the repression of transcription initiation in proximately 1000 MR binding regions. We focused our response to this antagonist. attention and performed subsequent characterizations on the first 15 identified MBSs, related to 13 different genes spanning the whole genome and having the highest score DISCUSSION ($200) of aldosterone-induced MR recruitment. The specific MR recruitment was further confirmed by addi- In the present study, we report the first whole-genome tional ChIP qPCR experiments under 1 h aldosterone vs. identification and characterization of specific binding sites vehicle exposure, indicating that the ChIP-seq approach for the human MR on the chromatin of the human renal was a robust method for identifying the genome-wide

CISTROME OF HUMAN RENAL MINERALOCORTICOID RECEPTOR 3985 Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 ABUnregulated gene Early target gene LINC00963 PER1 1.5 ns 4 ***

3 1.0 **

ve mRNA ve

i 0.5 t * expression expression 1

Relative mRNA Relative Rela

0 0 V 30' 4h 24h V 30' 4h 24h A A C Intermediary target genes

FAM65B FKBP5 NFATC2 1.5 * 2.5 *** 2.0 2.0 ** ** 1.5 1.0 Figure 6. Aldosterone-induced 1.5 1.0 transcriptional activation of 1.0 ﬁ 0.5 identi ed MR target genes. expression

Relative mRNA Relative 0.5 HK-GFP-MR cells were trea- 0.5 ted at 3 time points (from 0 0 0 30 min to 24 h) with vehicle V 30' 4h 24h V 30' 4h 24h V30'4h24h (V) or 10 nM aldosterone (A) A A A and lysed, and total RNAs NFKBIA SCNN1A SERPINE1 were isolated. After RT, the 1.5 4 ﬁ * 2.5 ** cDNAs were quanti ed by * *** real-time qPCR (primer pairs 3 2.0 * in Supplemental Table S2). 1.0 ** 1.5 Relative gene expression val- 2 1.0 ues were normalized to that 0.5 expression 1 of 18S rRNA and expressed mRNA Relative 0.5 as fold induction compared 0 0 0 with vehicle, arbitrarily set V 30' 4h 24h V 30' 4h 24h V30'4h24h at 1. Data are means 6 SEM A A A of 3 independent experiments D Late target genes performed in duplicate. NS, ERGIC1 PTPN1 TPRG1 ﬁ 1.5 no signi cant difference; * 1.5 1.5 ** *P , 0.05, **P , 0.01, ** ***P , 0.001 vs. vehicle. 1.0 1.0 1.0

expression 0.5 0.5 0.5

Relative mRNA Relative

0 0 0 V30'4h24h V 30' 4h 24h V 30' 4h 24h A A A ZBTB16 ZMYND8 2.0 * 1.5 * 1.5 1.0 1.0

expression 0.5 Relative mRNA 0.5

0 0 V30'4h24h V 30' 4h 24h A A mapping of MR target genes. It is notable that the 6 highest an HSP90 cochaperone protein that participates in the scored MBSs were associated with 4 target genes, already stability of the cytosolic MR (23). ZBTB16 encodes a tran- deﬁned as important players in the renal MR signaling scriptional repressor of the b and g subunits of ENaC (24), pathway: SCNN1A, FKBP5, ZBTB16,andPER1. SCNN1A whereas PER1, belonging to the circadian clock gene encodes the a-subunit of the well-characterized epithelial family, is known to regulate the rhythmicity of renal sodium sodium channel (aENaC), which plays a major role in reabsorption through transcriptional activation of several transepithelial sodium reabsorption (22). FKBP5 encodes sodium transporters, including ENaC (25–27). The 9 other

3986 Vol. 29 September 2015 The FASEB Journal x www.fasebj.org LE BILLAN ET AL. Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 MR SRC1 RNA Polymerase II 0.2 0.3 2.5 * * 2.0 * 0.2 *# t 1.5 0.1 *# # inpu 1.0

% input

% input 0.1 % 0.5

0 0 0 CVAS CVAS CVAS

Figure 7. Ligand specificity of MR recruitment together with coactivator SRC1 and RNA pol II occupancy on the SCNN1A gene promoter sequence. HK-GFP-MR cells, treated for 1 h with vehicle (V), 100 nM aldosterone (A), or 1 mM spironolactone (S), were fixed and lysed. Chromatin extracts were sheared before being immunoprecipitated by a negative control antibody (C) or antibodies against MR, SRC1, or RNA pol II. Eluted and purified DNA fragments were quantified by real-time qPCR, using primers amplifying the genomic fragment of the SCNN1A promoter (Supplementary Table S1). Data are expressed as the ,# percentage of input, and are means 6 SEM of 3 independent experiments performed in triplicate. * P , 0.05 vs. vehicle and aldosterone, respectively. genes (NFATC2, FAM65B, NFKBIA, TPRG1, ERGIC1, The first 4 genes, displaying the highest MBS score ZMYND8, PTPN1, SERPINE1,andLINC00963)havenot (ZBTB16, FKBP5 , SCNN1A,andPER1), have been defined been reported so far to play any functional or mechanistic as MR target genes. As opposed to the results of Ueda et al. role in human renal mineralocorticoid signaling. Of note, (28), our ChIP-seq data unexpectedly did not identify any such MBSs have not been identified in the recently pub- MBSs on the SGK1, another classic and well-characterized lished ChIP-seq performed on a murine convoluted col- renal mineralocorticoid target (34). However, we were lecting duct (CCD) cell model expressing a 3xFLAG-tagged able to demonstrate significant MR recruitment onto the human MR (28). Despite the implication of these genes well-characterized SGK1-containing MBS by ChIP-qPCR in various biologic processes, such as cell differentiation analysis and to show that 1 h aldosterone exposure stim- [FAM65B (29)], mobility [NFATC2 (30)], and antiapoptotic ulated SGK1 expression in HK-GFP-MR cells, as measured actions [TPRG1 (31)], their function in sodium-transporting by RT-qPCR (data not shown). Such discrepant results polarized epithelial cells remains to be demonstrated. clearly indicate that the ChIP-seq approach has its own We were able to show that MR binding to genomic intrinsic limitations, depending on the experimental sequences was associated with transcriptional activation conditions used, and strongly suggest the imperative for of aldosterone-responsive genes whose expression was developing alternative and confirmatory methods in the differentially stimulated in a time-dependent manner. search of genomic MR-specific binding sequences and the The 13 target genes were classified into 3 categories of functional consequences of such MR recruitment. Iden- mineralocorticoid-responsive genes, according to their tification and characterization of transcription factor early (,1h)(PER1), intermediate (4 h) (FAM65B, FKBP5, binding sites are obviously highly dependent on the ex- NFATC2, NFKBIA, SCNN1A,andSERPINE1), or late (24 h) perimental conditions—notably, the cell type, the anti- (ERGIC1, PTPN1, TPRG1, ZBTB16,andZMYND8)stimu- body and its recognized epitope, and the endogenous lation by aldosterone exposure. The time-dependent nature of the studied DNA-binding protein. responsiveness is one of the main features of the tran- Studies have already established a canonical HRE for scriptional gene activation, consistent with the short- or the oxo-steroid receptors, referred as to GREs: AGAA- long-term effects of hormonal signaling, and is well sup- CAnnnTGTTCT. Among the 974 MBSs identified in the ported by the transcriptional clock defined as the cyclic, present study, one quarter contained a well-conserved ca- sequential, and combinatorial assembly of a transcription- nonical MRE or a half-MRE (70 palindromic and 147 half- ally productive complex onto a regulatory sequence (21). MRE motifs). However, sequence degeneration markedly It has to be pointed out that, among the 13 investigated increased as the peak scoring of the MBS decreased, the genes, LINC00963 was unexpectedly not regulated by MR, main conserved bases in the half-sites being xGxACx. even though a high-score peak was identified in a desert With respect to the MR binding motifs identified by our region, located 111 kb downstream from the nearest TSS of ChIP-seq analysis, it was somehow surprising to find that this gene, and the highly significant aldosterone-induced only ;15% of the MREs were located 10 kb from the TSS. MR recruitment was validated on this MBS by ChIP qPCR. This finding was in accordance with what was reported for The massive MR recruitment at this site unambiguously genomic binding sites of PRs (35) and GRs (36). Unlike demonstrated the validity of this MBS but clearly indicated MR, most AR binding sites were adjacent to their target that it is likely to be involved in the transcriptional regula- gene TSSs (37, 38). Most MBSs are located outside the tion of another target gene, very likely located far away 10 kb distance from the TSS, including 9 of the 13 genes we in the genome, as suggested by Hou and Corces (32). investigated. These findings have led us to propose that Even though such a regulated gene is presently unknown, the MR may directly bind a consensus MRE in a very re- the use of alternate methodology, such as the chromatin stricted number of promoter regions (4%) (either 1 or 2 interaction analysis by the paired-end tag sequenc- MRE or half-sites), whereas it more frequently interacts ing approach (ChIA-PET) (33) may actually facilitate its with a large number of other genomic motifs including identification. not only the MRE but also the response elements of other

CISTROME OF HUMAN RENAL MINERALOCORTICOID RECEPTOR 3987 Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 TABLE 3. Summarized relationship between genomic MR targets identiﬁed by ChIP-Seq and transcriptional activation of novel aldosterone-regulated genes

Recruitment Transactivation Gene Locus type Distance from TSS (fold enrichment) (fold induction)

Early PER1 Enhancer 22,044 19 3.5 Intermediary FAM65B Intergenic 295,606 9 1.3 FKBP5 Intron +502 39 1.6 Intron 25,043 ND NFATC2 Intergenic +211,019 15 1.6 NFKBIA Intron +805 3 1.2 SCNN1A Promoter 21,075 15 2.1 SERPINE1 Enhancer 214,654 18 2.2 Late ERGIC1 Intron +35,062 12 1.2 PTPN1 Intergenic 294,533 4 1.3 TPRG1 Intergenic 2223,829 12 1.3 ZBTB16 Intron +102,353 22 1.6 Intron +99,602 ND ZMYND8 Intron +22,441 18 1.4 Unregulated LINC00963 Intergenic +111,899 18 Unregulated

Recruitment is the fold induction of MR occupancy expressed as a percentage of the input ratio of the aldosterone vs. the vehicle sample. Transactivation is the aldosterone-induced transcriptional activation of the corresponding gene expressed as the relative gene expression ratio of the aldosterone vs.thevehiclesample. transcriptional factors with which it may interact through genomic, bioinformatic, and transcript analyses, we were a tethering mechanism, as previously described for other able to define specific MREs and to identify novel MR steroid receptors (39). This hypothesis is further sup- target genes on which we correlated genomic MR reported by our MEME suite motif analysis that highlighted cruitment and transcriptional activation. Our results the occurrence of 4 other binding sites, notably the EGR1, constitute a first step toward a better understanding of FOX, PAX5, and AP-1 recognition sites, suggesting co- the complex transcriptional regulation exerted by MR, operative interplay between specific transcription factors including functional and dynamic interplay with other and MR, even far away from the TSS. Identification of such transcription factors. This research should contribute to alternative MR binding genomic motifs, sometimes in as- future investigations exploring the pathophysiological sociation with a full or half-MRE, is consistent with the role of MR. combinatory and dynamic assembly of the preinitiation complex (40). This transcriptional clock described by The authors thank Stephane´ Le Crom (Ecole Normale Gannon’s group (21) relied on results obtained by ChIP- Superieure,´ Institut de Biologie de l’ENS, IBENS, Plateforme qPCR, in which ERa binding to DNA directs ordered Genomique,´ Paris, F-75005 France), Juliette Pouch (INSERM, recruitment of coactivators, such as SRC1, sequentially fol- U1024, Paris, F-75005 France), Sophie Lemoine (CNRS, UMR lowed by RNA pol II assembly, finally leading to competent 8197, Paris, F-75005 France), and their genomic platform for and productive transcriptional complexes. Experiments their help in the genomic sequencing and initial analysis of the results; and Florian Nadal (INSERM U1185 and Assistance investigating MR recruitment onto the SCNN1A promoter Publique-Hopitauxˆ de Paris, Service de Pharmacogénétique, demonstrated a coordinate recruitment of SRC1 and of Gen´ etique´ Moleculaire´ et Hormonologie, Hopitalˆ de Bicetre,ˆ RNA pol II with MR after 1 h of aldosterone stimulation. In F-94275 Le Kremlin Bicetre,ˆ France) for invaluable contribu- contrast, the MR antagonist, spironolactone, impaired the tions to the initial analysis of the ChIP-seq data. This work was preinitiation complex assembly, because it allowed supported by grants from INSERM, UniversiteParisSudandby´ SRC1 recruitment, yet prevented RNA pol II binding Grant 11-BSV1-028-01 Agence Nationale de la Recherche to the transcriptional complex, providing an initial view (ANR). The ChIP-Seq was supported by the France Genomique´ ’ fi national infrastructure, funded as part of the “Investissements of MR s regulatory mechanisms by antagonism. This nd- ’ ” ing, based on ChIP technology, differs from those obtained d Avenir program managed by ANR contract ANR-10-INBS- 0009. F.L.B. is the recipient of a doctoral fellowship from with glutathione S-transferase pull-down or mammalian 2- ’ fi Ministeredel` Enseignement Superieur´ et de la Recherche hybrid assays, using speci c regions of MR or SRC1 rather (MESR), and J.A.K. received ANR postdoctoral fellowship 11- than native full-length proteins, which have shown a lack of BSV1-028-01. The authors declare no conflicts of interest. MR-SRC1 interaction after spironolactone exposure (41, 42). A more thorough investigation of the preinitiation complex assembly should aid in identifying gene-specificMRpartners REFERENCES and in evaluating the influenceandthedynamicsofcor- egulator recruitment governing transcriptional regulation. fi 1. Palmer, L. G., Corthesy-Theulaz, I., Gaeggeler, H. P., Kraehenbuhl, In summary, the present study provides a rst genome- J. P., and Rossier, B. (1990) Expression of epithelial Na channels in wide mapping of the MR in human renal cells. By combining Xenopus oocytes. J. Gen. Physiol. 96,23–46

3988 Vol. 29 September 2015 The FASEB Journal x www.fasebj.org LE BILLAN ET AL. Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 2. Viengchareun, S., Le Menuet, D., Martinerie, L., Munier, M., 24. Naray-Fejes-T´ oth,´ A., Boyd, C., and Fejes-Toth,´ G. (2008) Regulation Pascual-Le Tallec, L., and Lombès, M. (2007) The mineralocorticoid of epithelial sodium transport by promyelocytic leukemia zinc finger receptor: insights into its molecular and (patho)physiological protein. Am.J.Physiol.RenalPhysiol.295,F18–F26 biology. Nucl. Recept. Signal. 5, e012 25. Gumz, M. L., Stow, L. R., Lynch, I. J., Greenlee, M. M., Rudin, A., 3. Robert-Nicoud, M., Flahaut, M., Elalouf, J. M., Nicod, M., Salinas, M., Cain, B. D., Weaver, D. R., and Wingo, C. S. (2009) The circadian Bens, M., Doucet, A., Wincker, P., Artiguenave, F., Horisberger, J. D., clock protein period 1 regulates expression of the renal epithelial Vandewalle, A., Rossier, B. C., and Firsov, D. (2001) Transcriptome sodium channel in mice. J. Clin. Invest. 119 ,2423–2434 of a mouse kidney cortical collecting duct cell line: effects of 26. Richards, J., Jeffers, L. A., All, S. C., Cheng, K. Y., and Gumz, M. L. aldosterone and vasopressin. Proc. Natl. Acad. Sci. USA 98, 2712–2716 (2013) Role of Per1 and the mineralocorticoid receptor in the 4. Fakitsas, P., Adam, G., Daidie,D.,vanBemmelen,M.X.,Fouladkou,´ coordinate regulation of aENaC in renal cortical collecting duct F.,Patrignani,A.,Wagner,U.,Warth,R.,Camargo,S.M.,Staub,O., cells. Front. Physiol. 4,253 and Verrey, F. (2007) Early aldosterone-induced gene product reg- 27. Richards, J., Ko, B., All, S., Cheng, K. Y., Hoover, R. S., and Gumz, ulates the epithelial sodium channel by deubiquitylation. J. Am. Soc. M. L. (2014) A role for the circadian clock protein Per1 in the Nephrol. 18, 1084–1092 regulation of the NaCl co-transporter (NCC) and the with-no-lysine 5. Sekizawa, N., Yoshimoto, T., Hayakawa, E., Suzuki, N., Sugiyama, T., kinase (WNK) cascade in mouse distal convoluted tubule cells. J. Biol. and Hirata, Y. (2011) Transcriptome analysis of aldosterone-regulated Chem. 289,11791–11806 genes in human vascular endothelial cell lines stably expressing min- 28. Ueda, K., Fujiki, K., Shirahige, K., Gomez-Sanchez, C. E., Fujita, eralocorticoid receptor. Mol. Cell. Endocrinol. 341,78–88 T., Nangaku, M., and Nagase, M. (2014) Genome-wide analysis 6. Johnson, J. P. (1992) Cellular mechanisms of action of mineralocorticoid of murine renal distal convoluted tubular cells for the target hormones. Pharmacol. Ther. 53,1–29 genes of mineralocorticoid receptor. Biochem. Biophys. Res. 7. Pearce, D., Bhargava, A., and Cole, T. J. (2003) Aldosterone: its Commun. 445, 132–137 receptor, target genes, and actions. Vitam. Horm. 66,29–76 29. Dakour, J., Li, H., and Morrish, D. W. (1997) PL48: a novel gene 8. Chen, S. Y., Bhargava, A., Mastroberardino, L., Meijer, O. C., Wang, J., associated with cytotrophoblast and lineage-specific HL-60 cell dif- Buse, P., Firestone, G. L., Verrey, F., and Pearce, D. (1999) Epithelial ferentiation. Gene 185,153–157 sodium channel regulated by aldosterone-induced protein sgk. Proc. 30. Amasaki, Y., Miyatake, S., Arai, N., and Arai, K. (2000) Regulation of Natl. Acad. Sci. USA 96, 2514–2519 nuclear factor of activated T-cell family transcription factors during 9. Ziera, T., Irlbacher, H., Fromm, A., Latouche, C., Krug, S. M., T-cell development in the thymus. J. Allergy Clin. Immunol. 106,S1–S9 Fromm, M., Jaisser, F., and Borden, S. A. (2009) Cnksr3 is a direct 31. Wang,X.,Zamolyi,R.Q.,Zhang,H.,Pannain,V.L.,Medeiros,F., mineralocorticoid receptor target gene and plays a key role in the Erickson-Johnson, M., Jenkins, R. B., and Oliveira, A. M. (2010) regulation of the epithelial sodium channel. FASEB J. 23,3936–3946 Fusion of HMGA1 to the LPP/TPRG1 intergenic region in a lipoma 10. Deppe, C. E., Heering, P. J., Viengchareun, S., Grabensee, B., identified by mapping paraffin-embedded tissues. Cancer Genet. Farman, N., and Lombes,` M. (2002) Cyclosporine a and FK506 Cytogenet. 196,64–67 inhibit transcriptional activity of the human mineralocorticoid 32. Hou, C., and Corces, V. G. (2012) Throwing transcription for a loop: receptor: a cell-based model to investigate partial aldosterone re- expression of the genome in the 3D nucleus. Chromosoma 121, sistance in kidney transplantation. Endocrinology 143, 1932–1941 107–116 11. Viengchareun, S., Kamenicky, P., Teixeira, M., Butlen, D., Meduri, 33. Li, G., Cai, L., Chang, H., Hong, P., Zhou, Q., Kulakova, E. V., G.,Blanchard-Gutton,N.,Kurschat,C.,Lanel,A.,Martinerie,L., Kolchanov, N. A., and Ruan, Y. (2014) Chromatin interaction Sztal-Mazer, S., Blot-Chabaud, M., Ferrary, E., Cherradi, N., and analysis with paired-end tag (ChIA-PET) sequencing technology and Lombes,` M. (2009) Osmotic stress regulates mineralocorticoid application. BMC Genomics 15(suppl 12), S11 receptor expression in a novel aldosterone-sensitive cortical collect- 34. Pearce, D. (2001) The role of SGK1 in hormone-regulated sodium ing duct cell line. Mol. Endocrinol. 23, 1948–1962 transport. Trends Endocrinol. Metab. 12,341–347 12. Prie,´ D., Friedlander, G., Coureau, C., Vandewalle, A., Cassingena,´ R., 35. Rubel,C.A.,Lanz,R.B.,Kommagani,R.,Franco,H.L.,Lydon,J.P., andRonco,P.M.(1995)Roleofadenosine on glucagon-induced cAMP and DeMayo, F. J. (2012) Research resource: genome-wide profiling in a human cortical collecting duct cell line. Kidney Int. 47, 1310– 1318 of progesterone receptor binding in the mouse uterus. Mol. Endo- 13. Jourdren, L., Bernard, M., Dillies, M. A., and Le Crom, S. (2012) crinol. 26, 1428–1442 Eoulsan: a cloud computing-based framework facilitating high 36. Pan, D., Kocherginsky, M., and Conzen, S. D.(2011) Activation of the throughput sequencing analyses. Bioinformatics 28,1542–1543 glucocorticoid receptor is associated with poor prognosis in estrogen 14. Langmead, B., Trapnell, C., Pop, M., and Salzberg, S. L. (2009) receptor-negative breast cancer. Cancer Res. 71,6360–6370 Ultrafastand memory-efficientalignmentofshortDNAsequencesto 37. Hu,S.,Yao,G.,Guan,X.,Ni,Z.,Ma,W.,Wilson,E.M.,French,F.S., the human genome. Genome Biol. 10,R25 Liu, Q., and Zhang, Y. (2010) Research resource: Genome-wide 15. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., mapping of in vivo androgen receptor binding sites in mouse epi- Marth, G., Abecasis, G., and Durbin, R.; 1000 Genome Project Data didymis. Mol. Endocrinol. 24,2392–2405 Processing Subgroup. (2009) The Sequence Alignment/Map for- 38. Need, E. F., Selth, L. A., Harris, T. J., Birrell, S. N., Tilley, W. D., and mat and SAMtools. Bioinformatics 25,2078–2079 Buchanan, G. (2012) Research resource: interplay between the 16. Zhang,Y.,Liu,T.,Meyer,C.A.,Eeckhoute,J.,Johnson,D.S.,Bernstein, genomic and transcriptional networks of androgen receptor and B. E., Nusbaum, C., Myers, R. M., Brown, M., Li, W., and Liu, X. S. (2008) estrogen receptor a in luminal breast cancer cells. Mol. Endocrinol. 26, Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 1941–1952 17. Feng,J.,Liu,T.,Qin,B.,Zhang,Y.,andLiu,X.S.(2012)Identifying 39. Polman, J. A., Welten, J. E., Bosch, D. S., de Jonge, R. T., Balog, J., ChIP-seq enrichment using MACS. Nat. Protoc. 7,1728–1740 vanderMaarel,S.M.,deKloet,E.R.,andDatson,N.A.(2012)A 18. Sandelin, A., and Wasserman, W. W. (2004) Constrained binding site genome-wide signature of glucocorticoid receptor binding in neu- diversity within families of transcription factors enhances pattern ronal PC12 cells. BMC Neurosci. 13,118 discovery bioinformatics. J. Mol. Biol. 338,207–215 40. Ratman, D., Vanden Berghe, W., Dejager, L., Libert, C., Tavernier, J., 19. Crooks, G. E., Hon, G., Chandonia, J. M., and Brenner, S. E. (2004) Beck, I. M., and De Bosscher, K. (2013) How glucocorticoid WebLogo: a sequence logo generator. Genome Res. 14,1188–1190 receptors modulate the activity of other transcription factors: 20. Hudson, W. H., Youn, C., and Ortlund, E. A. (2014) Crystal structure a scope beyond tethering. Mol. Cell. Endocrinol. 380,41–54 of the mineralocorticoid receptor DNA binding domain in complex 41. Hellal-Levy, C., Fagart, J., Souque, A., Wurtz, J. M., Moras, D., and with DNA. PLoS ONE 9, e107000 Rafestin-Oblin, M. E. (2000) Crucial role of the H11-H12 loop in 21. Metivier,´ R., Penot, G., Hübner, M. R., Reid, G., Brand, H., Kos, M., stabilizing the active conformation of the human mineralocorticoid and Gannon, F. (2003) Estrogen receptor-alpha directs ordered, receptor. Mol. Endocrinol. 14, 1210–1221 cyclical, and combinatorial recruitment of cofactors on a natural 42. Fagart, J., Hillisch, A., Huyet, J., Barfacker,¨ L., Fay, M., Pleiss, U., target promoter. Cell 115,751–763 Pook, E., Schafer,¨ S., Rafestin-Oblin, M. E., and Kolkhof, P. (2010) 22. Rossier,B.C.,Canessa,C.M.,Schild,L.,andHorisberger,J.D. A new mode of mineralocorticoid receptor antagonism by (1994) Epithelial sodium channels. Curr. Opin. Nephrol. a potent and selective nonsteroidal molecule. J. Biol. Chem. 285, Hypertens. 3, 487–496 29932–29940 23. Petrovich, E., Asher, C., and Garty, H. (2014) Induction of FKBP51 by aldosterone in intestinal epithelium. J. Steroid Biochem. Mol. Biol. Received for publication April 3, 2015. 139,78–87 Accepted for publication May 26, 2015.

CISTROME OF HUMAN RENAL MINERALOCORTICOID RECEPTOR 3989 Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells

Florian Le Billan, Junaid A. Khan, Khadija Lamribet, et al.

FASEB J 2015 29: 3977-3989 originally published online June 8, 2015 Access the most recent version at doi:10.1096/fj.15-274266

Supplemental http://www.fasebj.org/content/suppl/2015/06/08/fj.15-274266.DC1 Material

References This article cites 42 articles, 12 of which can be accessed free at: http://www.fasebj.org/content/29/9/3977.full.html#ref-list-1

Subscriptions Information about subscribing to The FASEB Journal is online at http://www.faseb.org/The-FASEB-Journal/Librarian-s-Resources.aspx

Permissions Submit copyright permission requests at: http://www.fasebj.org/site/misc/copyright.xhtml

Email Alerts Receive free email alerts when new an article cites this article - sign up at http://www.fasebj.org/cgi/alerts

Downloaded from www.fasebj.org to IP 193.54.110.33. The FASEB Journal Vol.29, No.9 , pp:3977-3989, March, 2017 Supplemental Figure 1

HK-GFP-MR cells stably express a functional human MR. A. Western blot analysis of HK (parental) and HK-GFP-MR cellular extracts. After migration on a 6% polyacrylamide gel in denaturing conditions, total proteins (50 µg) were transferred onto a nitrocellulose membrane and revealed by the 39N anti-MR (1/1000 dilution) or the anti-α-tubulin (1/10,000 dilution) antibodies. B. Immunoprecipitation of the GFP-MR chimeric protein. HK and HK-GFP-MR cells were lysed and soluble proteins (500 µg) were immunoprecipitated with anti-MR 39N antibody (7 µg) or control rabbit IgG. After elution of bead-antibody-protein complex, proteins were separated in denaturing conditions on a 6% polyacrylamide gel, then transferred onto a nitrocellulose membrane and revealed by the 39N antibody. Input: 10% of the clarified cellular extracts; IP: immunoprecipitation eluate; MW: molecular weight (Page Ruler Prestained Protein Ladder, Thermo Scientific). C. Transactivation activity of the GFP-MR chimeric protein. Parental HK cells and HK-GFP-MR cells, both transiently transfected with the reporter vector GRE2-luc, were treated with ethanol (V), 10 nM aldosterone alone (A) or 10 nM aldosterone in the presence of 1 µM spironolactone (A+S). After cell lysis, luciferase activity was measured and then normalized to the total protein quantity. Results are expressed as means ± SEM. ** or ##: P<0.01 in comparison to vehicle, arbitrarly set at 1, and aldosterone conditions, respectively. D. Transactivation of the endogenous SCNN1A and SGK1 genes. HK-GFP- MR cells were treated for 1, 4 or 24 h by ethanol (V) or 10 nM aldosterone (A), and lysed. Total RNAs were isolated and reverse transcribed. Complementary DNAs for SCNN1A were then quantified by qPCR as described in Material & Methods section. Relative gene expression values normalized to that of the 18S rRNA, are presented as means ± SEM of 3 independent determinations in which basal expression is arbitrarily set at 1 at 0 time. *: P<0.05 in comparison to the vehicle condition. Supplemental Figure S2.

PIK3R1

0.4 * 0.3 n p u t

i 0.2

% 0.1

0 C V A

MR recruitment on the regulatory region of the PIK3R1 gene, lacking MRE. HK-GFP-MR cells, treated for 1 h with vehicle (V) or 100 nM aldosterone (A), were fixed by PFA and lysed. After shearing, chromatin extracts were immunoprecipitated by the anti-MR 39N antibody (A and V), or by the control IgG antibody (C). Eluted DNAs were quantified by real-time qPCR, using primer pairs encompassing MR binding site (forward primer : 5'-CTCACTTTGATTTTGCAGT-3'; reverse primer: 5'-GGAGGATTAGCAGATTATGA-3'). Results are expressed as percentage of input, and are means ± SEM of three determinations. *: P<0.05 in comparison to the vehicle condition. Supplemental Table 1

Primers for ChIP qPCR

Amplicon Gene Forward primer Reverse primer (bp)

ZBTB16 80 CGAGCATTGCCTGTGTTTGT TTGGCTCAGCACTCACTGTACA

FKBP5 87 GAGCACACCCACTTACCCAG TGGAACACAATGTCCCGAGC

SCNN1A 90 TTCCTGCAACTCTGTGAC GCCCTAGGACATTCTGTT

SCNN1A (negative 130 ATGGGCATGGCCAGG CCTGCTCCTCACGCT control)

PER1 110 GAATCCCTGGCTTTGGGACA AGCGCACTTGGGAACATCAT

NFKBIA 86 TTCCCTCTCTTCCCCACAGG CTTCACCTGGCGGATCACTT

TPRG1 101 AGATGCACTGGATGTGCTCC CCAGTTAGCAGCTCTTGGCT

PTPN1 94 GAAGTGAAGCTTTGCTGCCA GAGAGGGAGTGCTCGACTTC

NFATC2 110 ATCTGTGGGAAGCTGGGAAC CTGAGGAGTCACGAAGGAGC

FAM65B 84 CCACTTGGTGGTACAGTCCG GTTCATCCCCTGTGTCCTCC

ERGIC1 99 CCTGCCAGGGAATTGCAAAA GGCTGCAGAGTCCTCAGTTT

LINC00963 108 CCTGGGGAGCTGTAACACAC CCTGGCACTGGGAGAATGTT

ZMYND8 110 CCTGACTTATAGTGGTGCGGAAGT GGCACCCCAAGAGAGTCTCA

SERPINE1 90 CCCCTACGCATTGTTTCCCT GTCTGGACAGGAGGAAACCG

Supplemental Table 2

Primers for RT qPCR

Gene Amplicon (bp) Forward primer Reverse primer

ZBTB16 110 AGACGTACCTCTACCTGTGCTATGTGT TGTCATAGTCCTTCCTTCATCTCACT

FKBP5 120 CCGGAGAACCAAACGGAAA TGAATGCCACATCTCTGCAGT

SCNN1A 120 CTGCACCTTTGGCATGATGTA TTCCGGGTACCTGTAGGGATT

PER1 80 CGGATACCCCCTGACAAGAG GCAGCCCTTTCATCCACATC

NFKBIA 110 CCTTCAGATGCTGCCAGAGAGT GGCCTCCAAACACACAGTCA

TPRG1 120 CCGAATCAACTCTTTACCCCAAT TCTCAGCTACGTGACCTTTCAAGT

PTPN1 85 AAAGACTGCCCCATCAAGGA CTTCAGTGTCTTGACTCATGCTTTC

NFATC2 110 AGCTGTTGGCTGACCAGAATAAA GGCCAATCAGAATGCTGTGA

FAM65B 120 TTTCCTGAACACCTCTGATTTTGA ACCGACCTGTAACTGTGTTTCTCA

ERGIC1 80 GCAGCAGCGGTAGAGACTTGA GGAACGAGGAGAAGAGAGGAAGA

LINC00963 130 CACGATGCCCTTTGACTTCAG ATGAAGAGGCAGCAGCAGATG

ZMYND8 80 CACAGCGATTCGGAGGATTC CCTCTGTGTCTTCTGGCTCGTT

SERPINE1 110 ACTTTTCAGAGGTGGAGAG AGTTGCTGATCATACCTTTT

18S 70 GTGCATGGCCGTTCTTAGTTG CATGCCAGAGTCTCGTTCGTT

Résultats : Première Partie

B. Données complémentaires et autres éléments de discussion

Dans la première partie de mon travail de thèse, grâce à l’approche de ChIP-Seq appliquée au MR dans les cellules rénales humaines HK-GFP-hMR, nous avons pu identifier 974 sites génomiques de liaison du complexe aldostérone-MR (MBS pour MR Binding Sites). Ceci correspond au premier cistrome décrit pour le MR, en particulier dans un modèle rénal et humain. Contrairement à l’idée communément admise d’une transrégulation de proximité, faite au niveau de la partie toute proximale du promoteur d’un gène (région 5’ flanquante le site d’initiation de la transcription (TSS) de ce gène), nous montrons que le MR se fixe majoritairement (>85% des MBS) dans des régions régulatrices à une distance de plus de 10 kbp du TSS du gène le plus proche, en 5’ ou en 3’. La recherche de motifs nucléotidiques au sein des MBS nous a permis d’identifier de novo un élément de réponse spécifique du MR, le MRE, mais aussi d’identifier d’autres motifs correspondant à d’autres facteurs de transcription. Ce dernier point suggère que le MR agit directement sur la transcription mais aussi indirectement, par ancrage (tethering) sur d’autres transrégulateurs. Enfin, nous avons caractérisé, plus en détail, les 15 premières cibles potentielles qui semblaient aussi les plus pertinentes. Nous avons notamment mis en évidence, pour la plupart des cibles, une corrélation positive entre recrutement du complexe aldostérone- MR sur un MBS et l’activation, à court ou à long-terme, de la transcription du gène associé. De façon intéressante, il semble que la corrélation entre le recrutement sur un MBS d’un gène et la transactivation de ce même gène ne soit pas toujours systématique. Par exemple, la transcription du gène LINC00963 n’est pas influencée par la fixation du MR sur un MBS localisé à 112 kbp en aval. Globalement, cette étude a permis de répondre à certaines de nos interrogations, mais en a surtout ouverte d’autres, et nous allons en discuter ci-après.

Comment établir le lien entre le recrutement du complexe aldostérone-MR sur un MBS et la transrégulation d’un gène en présence d’aldostérone ?

Dans notre étude, chaque MBS a d’abord été associé au gène dont le TSS était le plus proche. Pour 14 des 15 MBS, nous avons montré que le gène le plus proche du MBS était transactivé par le MR lié à l’aldostérone. Par contre, l’un des MBS identifiés avait pour plus proche TSS celui du gène LINC00963. Or, la transcription du gène LINC00963 n’est pas régulée par l’aldostérone, quelque soit la durée d’exposition à celle-ci. Le MBS en question se trouve dans une région génomique désertique, et LINC00963 se trouve à 112 kb en aval. Comme nous l’avons présenté dans l’article, la grande majorité (84%) des MBS se situent à plus de 10 kbp du TSS le plus proche,

Résultats : Première Partie

et près de 40% se situent même à plus de 100 kbp du plus proche TSS, dans de vastes régions intergéniques. Notre première hypothèse est que le MBS en aval de LINC00963 (en 3’) pouvait rendre compte de la régulation transcriptionnelle du premier gène en son aval (3’) qui s’avère être le gène C9orf106, même si ce dernier est à une distance plus importante que LINC00963. Or, nous avons montré que ce gène n’est pas non plus régulé par l’aldostérone (Figures 16). L’hypothèse la plus vraisemblable est donc que ce MBS serait responsable d’une régulation à très grande distance (> 100 Kbp) d’un gène qui reste à identifier. Les techniques de type 3C ou ChIA- PET (voir plus loin) permettraient de prendre en compte la conformation tridimensionnelle complexe et les repliements chromatiniens qui facilitent des boucles d’interaction indirecte entre des séquences d’ADN très distantes.

Figure 16 : Activité transrégulatrice associée à un MBS localisé dans une région génomique désertique. Le MBS est localisé à 112 kb en amont du gène LINC00963, et à 113 kb en amont du gène C9orf106. Aucun des deux gènes n’est transrégulé par l’aldostérone dans les cellules HK-GFP-hMR, quelque soit la durée du traitement (30 min, 4 h, 24 h).

Afin de mieux cerner le rôle de ce MBS, il faut revenir sur la définition d’un enhancer. Les enhancers sont de courtes séquences non codantes d’ADN, agissant en éléments de cis- régulation pour activer la transcription de gènes cibles. Leur action est spécifique du type cellulaire et du stade de développement. Les enhancers regroupent des motifs de recrutement de facteurs de transcription qui, une fois liés, vont interagirent avec des promoteurs cibles (Pennacchio et al., 2013). Nous pouvons faire l’hypothèse que le MBS compris entre LINC00963 et C9orf106 se trouverait dans un enhancer non-fonctionnel, et que le recrutement du complexe aldostérone-MR est un reliquat de l’histoire évolutive de ce locus. Pour tester cette hypothèse, l’étude de rapporteur d’enhancer, qui permet de tester l’activité d’un enhancer, pourrait être réalisée. Elle consiste à fusionner, dans un vecteur approprié, la séquence enhancer candidate à un promoteur minimal

Résultats : Première Partie

(nécessaire pour permettre l’expression du rapporteur mais pas suffisant) placé en amont d'un gène rapporteur (GFP, LacZ, luciférase). Le vecteur est transfecté dans les cellules d’intérêt et l’expression du gène rapporteur est mesurée. Si le gène rapporteur est activé, c’est que la séquence candidate agit comme un enhancer (Inoue and Ahituv, 2015). Cette approche de rapporteur d’enhancer a été adaptée à l’ultra-haut-débit (MPRA pour Massively Parallel enhancer Reporter Assay) où, grâce à des codes-barres spécifiques, tous les enhancers d’un génome peuvent être testés en parallèle. L’association du ChIP-Seq et du MPRA permet d’identifier l’ensemble des cibles génomiques d’un facteur de transcription et de déterminer si elles sont fonctionnelles sur le plan transcriptionnel.

Pour le cas du MBS compris entre LINC00963 et C9orf106, si nous faisons la contre- hypothèse que l’enhancer est fonctionnel, il faudrait encore déterminer quel gène il régule. Les enhancers ont été identifiés sur tout le génome, en amont et en aval de leur promoteur cible, dans des introns ou des régions intergéniques, et parfois jusqu’à 1 Mbp de leur cible. Il est important de noter que, comme dans le cas présent, leur cible n’est pas nécessairement le promoteur le plus proche. Quand l’enhancer se trouve à très grande distance du promoteur, une boucle de chromatine se forme et autorise les interactions entre les facteurs de transcription de l’enhancer et la machinerie transcriptionnelle sur le promoteur (Whalen et al., 2016). C’est cette hypothèse de régulation à longue distance que nous faisons pour le MBS compris entre LINC00963 et C9orf106, et afin de la tester, nous pourrions réaliser une expérience de ChIA-PET (Chromatin Interaction Analysis by Paired-End Tag Sequencing). Cette approche permet d’identifier, de novo et dans tout le génome, l’ensemble des interactions chromatiniennes à longue-distance (Fullwood et al., 2009). Elle a notamment été utilisée sur les récepteurs des hormones thyroïdiennes (TRα et β, NR1A1 et NR3A2), dont l’activation par l’hormone T3 est indispensable à la métamorphose des amphibiens (Grimaldi et al., 2013; Buisine et al., 2015). Le ChIA-PET, en combinaison avec le ChIP-Seq, a permis de connaître les cibles génomiques des TR dans le Xenopus tropicalis, et d’associer ces cibles génomiques aux cibles transcriptionnelles, notamment par mise en place de boucle chromatinienne. Une fois le gène cible identifié, la régulation transcriptionnelle par le complexe aldostérone-MR doit encore être établie, comme nous l’avons fait dans l’article pour les 15 premiers MBS.

Résultats : Première Partie

Quelles sont les limites de l’approche de ChIP-Seq auxquelles nous avons été confrontées ?

Le choix d’un modèle cellulaire humain s'est justifié par le fait de l’implémentation des génomes humains de référence dans l’ensemble des outils bioinformatiques d’analyse de ChIP-Seq. La première limite que l'on peut évoquer dans cette approche de ChIP-Seq est le choix du modèle cellulaire. Nous avons en effet utilisé une lignée cellulaire rénale surexprimant le MR, et sous la forme d'une fusion avec la GFP. Les cellules parentales HK (ou H5) expriment en effet un MR endogène (voir la figure supplémentaire de l’Article 1) mais les expériences de ChIP n'ont pas permis d’observer de recrutement du MR induit par l'aldostérone. Ce résultat est à mettre en relation avec le très faible niveau d’expression du MR endogène. Cette caractéristique de très faible niveau d'expression, si ce n'est de perte d'expression du MR, a très généralement été observée lors de l'établissement de lignées cellulaires rénales humaines, justifiant la stratégie de transfecter de façon stable le MR. Un autre biais pour lequel nous avons dû nous justifier lors de la publication de l’article, puis lors des présentations des travaux en congrès, est l’utilisation d’une protéine de fusion GFP-hMR. La présence de la GFP greffée au hMR, en plus d’être éloigné de la physiologie, pourrait perturber la reconnaissance par l’anticorps 39N des 18 acides aminés N- terminaux et ainsi diminuer le nombre de cibles immunoprécipitées au cours des expériences de ChIP. Pourtant, l’anticorps 39N a permis de reconnaître spécifiquement le MR dans de nombreuses approches et sur différents modèles (western blot (voir l’Article 2), immunocytochimie (Viengchareun et al., 2009), immunoprécipitation (Figure supplémentaire Article 1)), suggérant que la présence la GFP n'apporte pas de biais majeur.

L’approche de ChIP-Seq appliquée au MR dans les cellules rénales humaines HK-GFP-hMR a permis d’identifier un nombre important de nouvelles cibles génomiques du MR. Cependant, et de façon surprenante, le gène SGK1, qui est une cible bien caractérisée de la signalisation minéralocorticoïde (Pearce and Kleyman, 2007), n’a pas été identifié par cette approche de ChIP- Seq. Pourtant, nous avons validé le recrutement aldostérone-induit du MR sur le MRE présent dans le promoteur (-362 pb en amont) de ce gène (Lee et al., 2013), au cours d’expériences de ChIP qPCR effectuées dans les mêmes conditions que celles réalisées pour le séquençage (Figure 17). La visualisation des données de séquençage sur I’Integrative Genomics Viewer (Robinson et al., 2011; Thorvaldsdóttir et al., 2013), montre la présence de pics d’intensités équivalentes dans les conditions contrôle (Veh) et traitées par l’aldostérone (Aldo) (Figure 17). Cela suggère que le MR est fixé sur le promoteur de SGK1 en absence de ligand (liaison basale). De plus, lors de l’analyse bioinformatique des données de séquençage, nous avons fixé une limite

Résultats : Première Partie

de découverte de faux positifs (FDR pour False Discovery Rate) à une P-value < 10-5, ce qui est stringent. Puisque l’identification des MBS s’est faite en comparant la différence de profondeurs des pics entre les conditions Veh et Aldo, il ne peut pas être exclu que certaines cibles physiologiquement pertinentes aient été omises.

Figure 17 : Recrutement aldostérone-induit du MR sur le promoteur du gène SGK1. A, Les cellules HK-GFP-hMR ont été traitées 1 h par 100 nM d’aldostérone puis fixées au paraformaldéhyde. Après lyse cellulaire et sonication, les fragments de chromatine ont été immunoprécipités avec l’anticorps 39N (V et A), ou avec un IgG contrôle de Lapin (C). Enfin, l’ADN a été purifié et utilisé au cours de PCR quantitatives réalisées avec des amorces entourant le MRE présent dans le promoteur du gène SGK1. Les résultats sont exprimés en %input et représentent la moyenne ± écart- type de triplicats. * : P<0,05 vs V. B, Visualisation des données de séquençage de l’input, de l’immunoprécipitat de H3K4me3, marque histonique de chromatine transcriptionnellement active, et des immunoprécipitats des conditions Aldostérone et Véhicule, alignées avec le logiciel IGV, au niveau de la région promotrice du gène SGK1. Les données proviennent du ChIP-seq réalisé sur les cellules HK-GFP-hMR (numéro d’accès GSE69777). L’alignement est fait sur le génome humain de référence GRCh37 (hg19).

Résultats : Première Partie

Un autre biais peut être évoqué pour expliquer l’absence, ou la présence, de certaines cibles dans le cistrome du MR décrit ici. Il s’agit de la concentration de 100 nM d’aldostérone utilisée pour le traitement des cellules HK-GFP-hMR. Cette concentration est environ 200 fois supérieure à l’aldostéronémie moyenne à laquelle est exposé le néphron. Nous avions choisi de travailler avec cette concentration dans la mesure où le traitement des cellules HK-GFP-hMR par seulement 1 nM d’aldostérone ne permettait pas d’observer de recrutement du MR sur le promoteur de SCNN1A qui soit significativement différent du recrutement basal. Afin de pouvoir identifier de façon exhaustive les cibles du complexe aldostérone-MR, nous avons donc retenu la concentration supraphysiologique de 100 nM. Finalement, cette approche nous a permis d’avoir une vision exhaustive des cibles génomiques du MR dans le rein, mais elle est tout à fait indissociable de la validation in vitro et in vivo des cibles identifiées.

De façon surprenante, l’étude de la transrégulation des 15 MBS caractérisés n’a pas permis de mettre en évidence de gène réprimé par l’aldostérone. La transrépression de gènes par le MR avait été mis en évidence par des approches de transcriptomique, avec les glucocorticoïdes comme ligands, dans le système nerveux et dans les cardiomyocytes (Meijer et al., 2000; Latouche et al., 2010). Comme pour le GR, pour lequel les cistromes identifiés étaient corrélés à des gènes activés ou réprimés par les glucocorticoïdes (Pan et al., 2011 ; Polman et al., 2012), nous avons fait l’hypothèse que des gènes réprimés par le MR pouvaient être identifiés également. L’approche de RNA-Seq constitue incontestablement une stratégie pertinente pour identifier des gènes transréprimés par l’aldostérone. En effet, en séquençant l’ensemble des transcrits du MR sur un modèle approprié, cela permet d’obtenir une cartographie instantanée de l’effet de l’aldostérone à un instant donné. L’équipe du Dr Sachs a mis en évidence que le TR non-ligandé était recruté de façon basale sur la plupart des sites de liaison dans le cadre de la métamorphose (pattes et queue) chez le Xenopus (Sachs, 2015). Cette liaison basale du TR était associée à des effets transrépressifs. De façon surprenante, la T3 entraînait alors le détachement du TR des cibles génomiques, et la conversion des effets transrépressifs en transactivation. Nous avions aussi essayé d’identifier des MBS pour lesquels la stimulation par l’aldostérone inhiberait un recrutement basal et constitutif du MR. Avec le FDR que nous avions fixé (P<10-5), aucune cible ne ressortait significativement. Le RNA-Seq ici semble donc indispensable pour complémenter les informations du ChIP-Seq.

Si nous devions réaliser le RNA-Seq des cellules HK-GFP-hMR traitées par l’aldostérone, il nous faudrait au minimum reproduire les cinétiques de stimulation de 30 min, 4 h et 24 h. En effet,

Résultats : Première Partie

nous montrons ici que le recrutement du MR est suivi d’effets transcriptionnels à court, moyen ou long terme, et il serait donc indispensable d’évaluer le transcriptome du complexe aldostérone- MR à différents temps. De façon similaire, nous savons que le recrutement des facteurs de transcription n’est pas figé mais dynamique (voir la partie III de l’introduction). Ainsi, il serait tout à fait intéressant de réaliser le séquençage des MBS après plusieurs durées d’exposition à l’aldostérone sur les cellules HK-GFP-hMR. Il est plus probable que le cistrome du MR, que nous décrivons ici pour un traitement d’une heure, varie au cours du temps, et soit composé de MBS liés précocement, et d’autres plus tardivement. Cela pourrait d’ailleurs permettre d’identifier certaines cibles connues et bien caractérisées qui n’ont pas été initialement retrouvées. En étudiant en parallèle les marques d’ouverture de la chromatine (par exemple, la triméthylation de la lysine 4 de l’histone H3), nous pourrions corréler la dynamique de liaison du MR à un MBS avec l’ouverture ou non du locus. Il a en effet été montré que les loci transcrit tardivement étaient localisés majoritairement dans des zones de chromatine fermées, qui nécessitaient le recrutement de partenaires tels que les histones déacétylases pour être accessibles (Zhu et al., 2012; Love et al., 2017).

Est-ce que les cibles du complexe aldostérone-MR identifiées dans les cellules HK-GFP- MR, une lignée rénale humaine, sont conservées dans d’autres espèces ?

L’identification de cibles communes à deux espèces renforcerait la pertinence de ces nouveaux acteurs potentiels de la signalisation minéralocorticoïde rénale, que ce soit dans la fonction de réabsorption de sodium ou dans d’autres fonctions physiologiques. A l'inverse, l'identification de cibles spécifiques à une espèce, permettrait soit d'éliminer des cibles non pertinentes ou des faux positifs. Il apparait donc que la confrontation du cistrome que nous avons caractérisé dans les cellules rénales humaines HK-GFP-hMR avec le cistrome d'une lignée rénale mais appartenant à une autre espèce comme la souris serait de tout premier intérêt.

Pour ces raisons, nous avons envisagé d’utiliser les cellules murines KC3AC1. Ces cellules immortalisées ont été établies au laboratoire à partir de microdissection de tubes collecteurs corticaux d’une souris transgénique P1.hMR-TAg (Teixeira et al., 2006). Ces cellules ont les caractéristiques de cellules principales qui expriment de façon endogène un MR fonctionnel et sensible à l’aldostérone. Elles sont le siège d’un transport ionique transépithélial, préalablement et expérimentalement validé (Viengchareun et al, 2009). Ce transport a été démontré en mesurant la résistance transépithéliale et le courant de court-circuit avec un voltmètre positionné de part et

Résultats : Première Partie

d’autre d’un puits compartimenté, séparé par un filtre sur lequel poussent les cellules épithéliales polarisées (pour le protocole, voir (Viengchareun et al., 2009)). Avec les cellules KC3AC1, nous envisagions notamment d’utiliser la stratégie d’interférence de l’ARN, permettant d’inhiber spécifiquement l’expression d’une protéine, couplée à des mesures de courant transépithélial (selon le protocole décrit ci-avant). Cela aurait permis de caractériser le rôle de certaines cibles dans le transport ionique.

Enfin, la réalisation d’un ChIP-Seq à partir des cellules KC3AC1 devait permettre l’identification du premier cistrome du MR dans un modèle rénal où son expression du MR est endogène, par opposition aux systèmes de surexpression de protéines de fusion (Ueda et al., 2014 ; Le Billan et al., 2015). Nous avons cherché à développer l’approche de ChIP-Seq sur les cellules KC3AC1. Elles expriment les principaux gènes cibles de l’aldostérone participant à la régulation aldostérone-dépendante du transport de sodium (Sgk1, Gilz, Enac (Scnn1a), 11βHSD2 (Hsd11b2), etc…). J’ai mis au point les étapes critiques de ChIP sur les cellules rénales KC3AC1 (durée de la fixation intermoléculaire (greffage covalent des partenaires moléculaires) au paraformaldéhyde et durée de fragmentation de l’ADN par sonication) puis réalisé une expérience pilote après exposition des cellules à l’aldostérone ou au véhicule. L’immunoprécipitation du MR a été réalisée avec l’anticorps 39N. Puis, par PCR quantitative, j’ai observé l’enrichissement de deux cibles classiques dans le rein : Scnn1a et Sgk1. Comme on peut le voir sur la Figure 18, l’aldostérone induit, de façon significative, le recrutement du MR sur ces deux cibles dans les cellules KC3AC1. Cette expérience a été répliquée et nous avons fait séquencer les échantillons issus des différentes conditions par la plateforme Génomique de l’Institut de Biologie de l’ENS (IBENS, ENS Ulm, Paris). Malheureusement, la quantité très limitée de matériel immunoprécipité (quelques ng d’ADN) a rendu l’établissement des librairies de séquençage haut débit problématique. De plus, cette très faible quantité de matériel ne nous a donné qu'une très faible profondeur de lecture des résultats de séquençage. Par ailleurs, et plus grave encore, une erreur de traçabilité des échantillons (étiquetage par code-barres) a rendu impossible l’analyse bio-informatique fiable des données du séquençage.

En souhaitant répliquer ces expériences, et réaliser de nouveau le séquençage, nous nous sommes heurtés à l’épuisement de l’anticorps polyclonal du MR, 39N. Un autre anticorps, SY4649, avait été développé par notre laboratoire selon la même stratégie que 39N. Cet anticorps est dirigé contre le domaine AF-1 (résidus 1 à 167 N-terminaux) du MR humain, et nous l’avons utilisé extensivement pour les expériences présentées dans l’Article 3. Le domaine

Résultats : Première Partie

Figure 18 : Recrutement aldostérone-induit du MR sur le promoteur des gènes Scnn1a et Sgk1 dans les cellules KC3AC1. Les cellules KC3AC1 ont été traitées 1 h par 100 nM d’aldostérone puis fixées au paraformaldéhyde. Après lyse cellulaire et sonication, les fragments de chromatine ont été immunoprécipités avec l’anticorps 39N (V et A), ou avec un IgG contrôle de Lapin (C). Enfin, l’ADN a été purifié et utilisé au cours de PCR quantitatives réalisées avec des amorces entourant le MRE présent dans le promoteur des gènes Scnn1a et Sgk1. Les résultats sont exprimés en %input et représentent la moyenne ± écart-type de deux expériences réalisées en triplicats. * : P<0,05, ** : P<0,01 vs V.

AF-1a de l’Homme présente 84% d’identité avec celui de la Souris et du Rat. Sachant cela, nous avons testé l’anticorps SY4649 sur des extraits de cellules KC3AC1 en western blot et en immunoprécipitation. Aucun signal correspondant au MR n’était détectable, ce qui signifie que certains des résidus différents entre l’Homme et la Souris sont reconnus par cet anticorps, et en font un anticorps spécifique stricto sensu. D’autres anticorps anti-MR étaient commercialement disponibles. L’anticorps monoclonal 6G1, dirigé contre les acides aminés 1-18 N-terminaux du MR de Rat (Gomez-Sanchez et al., 2006), ne fonctionne pas en ChIP. L’anticorps monoclonal H10E4C9F (sc-53000, Santa Cruz Biotechnology) ne reconnaît que le MR humain, comme l’anticorps SY4649. Nous avons utilisé comme prestataire de nouveau la société Eurogentec afin de générer un nouvel anticorps dirigé contre les 18 acides aminés N-terminaux du MR humain, strictement identiques avec les mêmes résidus du MR murin et de rat. Deux nouveaux anticorps ont été développés mais aucun d’entre eux ne reconnaissait le MR murin dans les extraits de cellules KC3AC1. Enfin, nous avons essayé de générer de grandes quantités d’AF-1a du MR murin dans le but d’entreprendre une nouvelle immunisation de lapins avec ce polypeptide et d’obtenir un nouvel anticorps anti-mMR spécifique. Nous nous sommes malheureusement heurtés à des problèmes méthodologiques majeurs et à ce jour, nous n’avons toujours pas la possibilité de disposer d’un anticorps reconnaissant le MR murin de façon fiable. Dans ce contexte, il n’a pas été possible de comparer le cistrome rénal du MR humain et de souris.

Résultats : Première Partie

Existe-t-il un chevauchement ou une identité entre les sites de liaison du GR et ceux du MR ?

La comparaison des cibles génomiques du GR et celles du MR dans une même lignée cellulaire paraît extrêmement intéressante. En effet, comme nous l’avons décrit dans la troisième partie de l’introduction et comme nous le verrons dans la troisième partie des résultats, les deux récepteurs sont activés par des glucocorticoïdes et reconnaissent un motif GRE/MRE équivalent. Cette comparaison permettrait de déterminer les cibles communes et/ou spécifiques respectives à chaque récepteur. Nous n'avons pas encore effectué l’étude du cistrome du GR par ChIP-Seq dans la lignée cellulaire HK-GFP-hMR. Cependant, la comparaison des cistromes du GR déjà répertoriés pour d’autres modèles cellulaires (Speir et al., 2016) et le cistrome du MR effectué dans ce travail apparait en quelque sorte biaisée dans la mesure où les cibles génomiques d'un facteur de transcription sont hautement spécifiques d’un type cellulaire donné. Par exemple, la comparaison des cistromes de GR dans des cellules PC12 de type neuronal de rat (Polman et al., 2012), dans les cellules MCF10A-Myc de cancer du sein humain (Pan et al., 2011) ou dans les cellules A549 d'adénocarcinome pulmonaire humain (Vockley et al., 2016) a montré qu’ils sont tout à fait différents, même si, comme prévu, certains gènes régulés par les glucocorticoïdes sont toujours retrouvés (PER1, NFKBIA...). Une méta-analyse bioinformatique pourrait faciliter cette comparaison. Cependant, le premier cistrome du MR que nous avons décrit, représente une contribution importante à cette analyse et une référence sur laquelle d’autres cistromes du MR pourront être confrontés. Il faut noter que nous avons identifié certaines cibles potentielles qui semblent être spécifiquement et sélectivement régulées par MR, tels que KCNIP3, EML4, KCTD13, MED13L.… Ces gènes ne sont pas répertoriés dans les cistromes du GR et, de façon intéressante, ne contiennent pas de MRE palindromique. Dans la Figure 19, nous avons validé le recrutement du MR induit par l’aldostérone sur une des cibles spécifiques, le MBS localisé dans le gène KCNIP3. Ce MBS est localisé dans l’intron 2, à +19 kbp du TSS, et il contient deux hémi- MRE. Des études supplémentaires sont évidemment nécessaires pour explorer la fonction biologique des produits de ces gènes.

Résultats : Première Partie

Figure 19 : Recrutement aldostérone-induit du MR sur le promoteur du gène KCNIP3 dans les cellules HK-GFP-hMR. Les cellules HK-GFP-hMR ont été traitées 1 h par 100 nM d’aldostérone puis fixées au paraformaldéhyde. Après lyse cellulaire et sonication, les fragments de chromatine ont été immunoprécipités avec l’anticorps 39N (V et A), ou avec un IgG contrôle de Lapin (C). Enfin, l’ADN a été purifié et utilisé au cours de PCR quantitatives réalisées avec des amorces entourant le MRE présent dans l’intron 2 du gène KCNIP3. Les résultats sont exprimés en %input et représentent la moyenne ± écart-type de deux expériences réalisées en triplicats. * : P<0,05 vs V.

Est-ce que l’approche de ChIP-Seq peut permettre d’identifier des cibles génomiques impliquées dans une pathologie ?

Comme nous l’avons vu dans l’introduction, l’hyperaldostéronisme entraîne des pathologies cardiorénales. Dans ces pathologies, l’excès d’aldostérone suractive le MR. Il serait tout à fait intéressant d’identifier l’ensemble des cibles génomiques (ChIP-Seq) et l’ensemble des transcrits (RNA-Seq) qui sont régulés différemment entre un patient sain et un patient atteint d’hyperaldostéronisme, notamment dans le rein. Essentiellement pour des raisons de faisabilité et d’éthique, aucune étude n’a été réalisée à ce jour pour répondre à cette problématique.

Un article rapporte l’effet d’une expression anormale de MR et ses conséquences dans un modèle de cellules endothéliales, en les transfectant in vitro de façon stable avec le MR (Sekizawa et al., 2011). Par analyse sur puces à ADN, les auteurs ont identifié une vingtaine de gènes activés ou réprimés par le MR induit par l’aldostérone (dont Fkbp5, Nedd9 et SerpinD1). Les auteurs ont ensuite étudié l’expression de ces cibles dans l’endothélium aortique de rats sains ou hypertendus induite par l’aldostérone. L’expression de ces gènes qui étaient activés in vitro était systématiquement augmentée chez les rats hypertendus en comparaison des contrôles. Ceci

Résultats : Première Partie

confirme que le développement d’une pathologie est associé au changement de régulation transcriptionnelle par le complexe aldostérone-MR. Cette étude, parmi d’autres, valide l’idée que les approches haut-débit peuvent servir à identifier des candidats pouvant rendre compte de la pathogénie de certaines maladies.

Dans le cadre du projet collaboratif TAMIRAH (ANR), établi entre notre laboratoire et l’unité Inserm 999 (Dr Christophe Guignabert, UMR_S 999, Pr Marc Humbert, Centre Chirurgical Marie Lannelongue, Le Plessis-Robinson, France), nous étudions le rôle du complexe aldostérone-MR dans l’hypertension artérielle pulmonaire (HTAP). L’activation du MR ayant un rôle dans le remodelage du ventricule gauche et des vaisseaux systémiques (Catena et al., 2015) l’hypothèse a été faite que le MR contribuerait aussi au remodelage du ventricule droit et des vaisseaux pulmonaires, associée à l’HTAP. D’une part, l’équipe du Dr Guignabert a montré que l’activation du système rénine-angiotensine-aldostérone est augmentée en cas de HTAP idiopathique (HTAPi), et ce proportionnellement au mauvais pronostic de la pathologie (de Man et al., 2012). Au niveau cellulaire, cela se traduit par une activité accrue de l’ACE dans les cellules endothéliales pulmonaires, donc à une augmentation de l’angiotensine II circulante. Cette augmentation est perçue au niveau des cellules musculaires lisses de l’artère pulmonaire, où l’angiotensine II se lie

à son récepteur AT1, qui est lui-même surexprimé en cas de HTAPi. D’autre part, l’aldostérone seule a été décrite comme un marqueur de la sévérité de l’HTAP (Safdar et al., 2015). Une étude préclinique sur la souris et le rat (Preston et al., 2013), et une étude clinique de phase II sur des patients atteints d’HTAP (Elinoff et al., 2013), ont montré un bénéfice net du traitement par la spironolactone dans la capacité respiratoire, la morbidité et la mortalité dues à l’HTAP. C’est pour ces raisons que nous souhaitons étudier le rôle de la signalisation minéralocorticoïde dans les vaisseaux pulmonaires. Nous disposons de cultures primaires de cellules musculaires lisses (CML) de vaisseaux pulmonaires de sujets sains et de patients atteints d’HTAP. Afin de comparer les effets transcriptionnels de l’aldostérone dans ces deux situations, nous avons entrepris la réalisation du transcriptome (par RNA-Seq) et du cistrome (par ChIP-Seq) du complexe aldostérone-MR. L’identification de gènes différemment régulés dans les CML de patients HTAP par rapport aux contrôles devrait permettre d’avoir une vision plus globale des voies de signalisation mises en jeu dans le développement de l’HTAP. A moyen et long-terme, cette étude permettra d’envisager de nouvelles stratégies thérapeutiques dans la prise en charge de cette maladie pulmonaire gravissime (Humbert, 2008). La combinaison des approches de ChIP-Seq et de RNA-Seq, même si elle demande un lourd travail d’analyses bioinformatiques, apparaît être une stratégie intéressante pour identifier de nouvelles cibles pertinentes d’un facteur de

100

Résultats : Première Partie

transcription. Un long travail d’investigation fonctionnelle pourra alors débuter en se basant sur les résultats de ces approches.

101

2ème Partie :

Etude de la signalisation minéralocorticoïde par l’utilisation d’un nouvel antagoniste minéralocorticoïde non-stéroïdien

Résultats : Seconde Partie

A. Justification du projet

1. Contexte de l’étude

Comme nous l’avons présenté au cours de l’introduction, un nombre conséquent d’études in vitro et in vivo a montré que la suractivation pathologique de la signalisation minéralocorticoïde est impliquée dans des pathologies majeures du rein et du système cardiovasculaire (Jaisser and Farman, 2016; Funder, 2017b). L’utilisation d’antagonistes du MR, comme la spironolactone et l'éplérénone, qui inhibent la liaison de l’aldostérone au MR et ainsi diminuent son activité transcriptionnelle, s’est montrée bénéfique pour le traitement de ces pathologies. Au cours de deux grandes études cliniques, RALES pour la spironolactone et EPHESUS pour l’éplérénone, les bénéfices de ces molécules ont été démontré par une réduction de la mortalité et du nombre d’hospitalisations des patients insuffisants cardiaques (Pitt et al., 2017). Le premier des antagonistes du MR, la spironolactone, est un dérivé stéroïdien très efficace pour inhiber l'activité du MR induite par l'aldostérone, mais qui inhibe aussi le AR et qui active le PR (Fagart et al., 2010). Ce manque de sélectivité est important puisqu’un traitement par la spironolactone s’accompagne, dans 20% des cas, d’effets secondaires indésirables comme une gynécomastie ou une perte de libido (Ménard, 2004). Le second effet secondaire problématique est l’apparition d’une hyperkaliémie parfois sévère et symptomatique pour environ 10% des patients (Juurlink et al., 2004). Le deuxième antagoniste du MR mis sur le marché a été l’éplérénone, qui est un dérivé de la spironolactone et qui est beaucoup plus sélectif du MR que la spironolactone. Mais l’éplérénone, à doses égales, est moins efficace que la spironolactone pour inhiber le MR, et entraîne le même risque d’hyperkaliémie chez les patients (Yang and Young, 2016). Ces deux antagonistes font partie du traitement standard de l’insuffisance cardiaque et de l’hyperaldostéronisme (Gomez-Sanchez, 2016). La recherche d’une troisième génération d’antagonistes du MR avait pour but de trouver une molécule à la fois aussi sélective que l’éplérénone et plus efficace que la spironolactone, et qui n’augmenterait pas le risque d’hyperkaliémie (Kolkhof et al., 2015). C’est de cette recherche que sont issus le BR-4628 et la finérénone, développés par le groupe pharmaceutique Bayer Pharma AG.

102

Résultats : Seconde Partie

2. Etude initiale

Le BR-4628 est une molécule non-stéroïdienne issue d’un screening moléculaire ultra-haut-débit d'un million de molécules et ayant un fort potentiel antagoniste pour le MR in vitro (IC50 = 28 nM). En combinant des approches structurales, biochimiques, pharmacologiques et de mutagénèses dirigées, notre équipe a caractérisé le mode d’action de cette molécule en vue de son développement (Fagart et al., 2010). Le BR-4628 est à la fois plus sélectif que la spironolactone

(en transactivation, son IC50 est au moins 200 fois plus élevée pour le GR, l’AR et le PR que pour le MR), et plus efficace que l’éplérénone (IC50 = 28 nM contre 990 nM pour l’éplérénone). Au niveau de la cavité de liaison du ligand, le BR-4628 empêche le repliement de l’hélice H12 sur la poche de liaison du ligand, et forme un complexe transitoire et instable avec le MR, ne permettant pas le recrutement de corégulateurs transcriptionnels et donc l'activation de la transactivation. Notre équipe a qualifié ce mode d’antagonisme original de « passif encombrant » (bulky passive antagonism). Enfin, le BR-4628 est capable d’inhiber l’activité transactivatrice du mutant constitutivement actif du MR, le MRS810L, alors que les antagonistes stéroïdiens, la spironolactone et éplérénone activent ce mutant. La caractérisation du mode d’action du BR-4628 sur le MR a permis de confirmer le potentiel des molécules dérivées du noyau dihydropyridine (DHP) pour développer des antagonistes du MR. La structure du BR-4628 a été optimisée afin d’améliorer encore sa sélectivité pour le MR, et c’est dans cet effort qu’a été produit la finérénone (BAY 94- 8862).

3. Hypothèses de travail

Une caractérisation dans son ensemble du mode d’action d’un nouvel antagoniste, autant au niveau moléculaire que cellulaire, est indispensable pour mieux prédire ses effets bénéfiques et indésirables. Si, au cours des essais préliminaires in vivo, la finérénone a montré son efficacité à réprimer les conséquences physiopathologiques de l’activation de la signalisation minéralocorticoïde (Pitt et al., 2013 ; Kolkhof et al., 2014; Gueret et al., 2016 ; Lattenist et al., 2017), les mécanismes moléculaires de cet antagonisme et étapes clés sur lesquelles agit la finérénone restaient à déterminer. Comme nous l’avons décrit dans l’introduction, l’aldostérone agit à plusieurs niveaux pour induire et activer la signalisation minéralocorticoïde, notamment sur le transfert nucléaire du MR, sa liaison à l’ADN, le recrutement de partenaires transcriptionnels, et la dégradation du MR (Viengchareun et al., 2007). Notre première hypothèse a été que la finérénone agirait sur au moins une de ces étapes clés pour bloquer l’activité transactivatrice du MR. Puisque la spironolactone a une structure chimique et une sélectivité différentes de celles de

103

Résultats : Seconde Partie

la finérénone, notre seconde hypothèse a été que les deux antagonistes, pour au moins une des étapes de la signalisation minéralocorticoïde, n’auraient pas les mêmes effets.

4. Objectifs du travail

L’objectif de cette partie de mon travail de thèse a été de caractériser en détail les mécanismes moléculaires d’action de la finérénone, mis en jeu dans l’inhibition de la signalisation minéralocorticoïde, et ce en comparaison avec la spironolactone. Nous disposions d’un ensemble d’outils moléculaires (anticorps, vecteurs codant pour le MR et ses mutants, etc.), cellulaires (cellules HK-GFP-MR, HEK293…) et méthodologiques (HTM, ChIP, outils d’analyse de cristallographie…) pour identifier les étapes sur lesquelles la finérénone agit. Nous nous sommes en particulier demandés comment ces deux antagonistes, la finérénone et la spironolactone, agissent sur des étapes critiques induites par l’aldostérone, dont :

- le transfert nucléaire du MR,

- le mode de liaison dans le LBD du MR

- la liaison du MR à l’ADN,

- le recrutement consécutif de partenaires transcriptionnels,

- l’activité transactivatrice du MR, et

- la dégradation du MR induite par l’aldostérone.

Les principaux résultats obtenus sont présentés dans l’Article 2.

104

Article 2

Finerenone Impedes Aldosterone-dependent Nuclear Import of the Mineralocorticoid Receptor and Prevents Genomic Recruitment of Steroid Receptor Coactivator-1

Florian Le Billan*, Larbi Amazit*, Peter Kolkhof, Khadija Lamribet, Say Viengchareun, Michel R. Fay, Junaid A. Khan, Alexander Hillisch, Marc Lombès, Marie-Edith Rafestin-Oblin, Jérôme Fagart

* Ces auteurs ont contribué de façon équivalente.

J Biol Chem. 2015 Sep 4;290(36):21876-89

crossmark

Finerenone Impedes Aldosterone-dependent Nuclear Import of the Mineralocorticoid Receptor and Prevents Genomic Recruitment of Steroid Receptor Coactivator-1* Received for publication, April 10, 2015, and in revised form, July 16, 2015 Published, JBC Papers in Press, July 22, 2015, DOI 10.1074/jbc.M115.657957 Larbi Amazit‡§¶1, Florian Le Billan‡§1,2, Peter Kolkhofʈ, Khadija Lamribet‡§, Say Viengchareun‡§, Michel R. Fay**‡‡, Junaid A. Khan‡§3, Alexander Hillisch§§, Marc Lombès‡§, Marie-Edith Rafestin-Oblin**‡‡, and Jérôme Fagart‡§**‡‡4 From the ‡INSERM, UMR-S 1185, Le Kremlin-Bicêtre F-94276, France, the §Faculté de Médecine Paris-Sud, Université Paris-Sud, UMR-S 1185, Le Kremlin-Bicêtre F-94276, France, ¶UMS 32, Institut Biomédical de Bicêtre, Le Kremlin-Bicêtre F-94276, France, the Departments of ʈCardiology Research and §§Medicinal Chemistry, Bayer Pharma AG, Global Drug Discovery, 42113 Wuppertal, Germany, **INSERM U773, Centre de Recherche Biomédicale Bichat-Beaujon, CRB3, 75890 Paris, France, and the ‡‡Université Paris- Denis Diderot, Site Bichat, Paris, France

Background: Finerenone is a novel nonsteroidal mineralocorticoid antagonist, currently in clinical phase IIb trials. Results: Finerenone delays mineralocorticoid receptor nuclear import and inhibits its binding and transcriptional coactivator recruitment onto target gene promoters. Conclusion: Finerenone impedes three critical steps of the mineralocorticoid receptor signaling pathway. Significance: Finerenone, which behaves differently from currently available mineralocorticoid antagonists, is potentially a promising molecule to treat cardiorenal diseases.

Aldosterone regulates sodium homeostasis by activating coactivator-1, and RNA polymerase II binding at the regulatory the mineralocorticoid receptor (MR), a member of the sequence of the SCNN1A gene and also remarkably reduces nuclear receptor superfamily. Hyperaldosteronism leads to basal MR and steroid receptor coactivator-1 recruitment, deleterious effects on the kidney, blood vessels, and heart. unraveling a specific and unrecognized inactivating mecha- Although steroidal antagonists such as spironolactone and nism on MR signaling. Overall, our data demonstrate that the eplerenone are clinically useful for the treatment of cardiovas- highly potent and selective MR antagonist finerenone specif- cular diseases, they are associated with several side effects. ically impairs several critical steps of the MR signaling path- Finerenone, a novel nonsteroidal MR antagonist, is presently way and therefore represents a promising new generation MR being evaluated in two clinical phase IIb trials. Here, we charac- antagonist. terized the molecular mechanisms of action of finerenone and spironolactone at several key steps of the MR signaling pathway. Molecular modeling and mutagenesis approaches allowed iden- The mineralocorticoid receptor (MR)5 and its physiological tification of Ser-810 and Ala-773 as key residues for the high MR ligand aldosterone are main effectors of the renin-angiotensin- selectivity of finerenone. Moreover, we showed that, in contrast aldosterone system (1, 2). MR, a ligand-induced transcription to spironolactone, which activates the S810L mutant MR factor belonging to the nuclear receptor family, plays a critical responsible for a severe form of early onset hypertension, finere- physiological role in water-electrolyte homeostasis and regula- nonedisplaysstrictantagonisticproperties.Aldosterone-depen- tion of blood pressure. However, the past two decades have dent phosphorylation and degradation of MR are inhibited by brought compelling evidence that pathophysiological overacti- both finerenone and spironolactone. However, automated vation of MR signaling may also induce disorders like heart quantification of MR subcellular distribution demonstrated failure and chronic kidney disease (3, 4). All of these new that finerenone delays aldosterone-induced nuclear accumula- insights have spurred intense investigative interest in the use of tion of MR more efficiently than spironolactone. Finally, chro- MR antagonists as a new therapeutic strategy in controlling matin immunoprecipitation assays revealed that, as opposed blood pressure, chronic renal disease progression, and cardio- to spironolactone, finerenone inhibits MR, steroid receptor vascular remodeling and morbidity (5). Spironolactone is known as the first generation of potent MR antagonists (6). It has been shown to enhance survival in patients with heart fail- * This work was supported by grants from INSERM, by Université Paris Sud Agence Nationale de la Recherche Grant 11-BSV1–028-01, and by Bayer ure and to prevent the development of cardiac fibrosis (7). Pharma AG Grants 05112/A11 and SCCV2395. P. K. and A. H. are employees Although highly efficient, this molecule lacks selectivity of Bayer Pharma AG. because it is able to antagonize androgen receptor (8) and to act 1 Contributed equally to this work. 2 Recipient of a doctoral fellowship from the Ministère de l’Enseignement as a progesterone receptor agonist (9). Consequently, pro- Supérieur et de la Recherche. longed use of spironolactone is associated with gynecological 3 Present address: Inst. of Pharmacy, Physiology & Pharmacology, University of Agriculture, 38000 Faisalabad, Pakistan. 4 To whom correspondence should be addressed: Fac Med Paris Sud, INSERM 5 The abbreviations used are: MR, mineralocorticoid receptor; LBD, ligand- UMR-S 1185, 63 rue Gabriel Péri, 94276 Le Kremlin Bicêtre Cedex, France. binding domain; SRC-1, steroid receptor coactivator-1; NI, nuclear average E-mail: [email protected]. intensity; CI, cytoplasmic average intensity; Pol, polymerase.

21876 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290•NUMBER 36•SEPTEMBER 4, 2015 Blocking Mineralocorticoid Receptor with Finerenone

side effects such as gynecomastia and menstrual irregularities [3H]finerenone. Radiochemical purity was determined as being (10). More importantly, another known side effect of spirono- Ͼ98.1%. lactone administration is the induction of potentially life- Expression Vectors—The expression vectors pchMR, threatening hyperkalemia in patients with diminished kidney pchMRN770A, pchMRA773G, pchMRQ776A, pchMRS810A, function (11). Therefore, considerable efforts were made to pchMRS810L, pchMRS810M, pchMRR817A, pchMRM852A, develop a next generation of nonsteroidal antagonists that pchMRC942A, and pchMRT945A encode for the human MR,

would overcome the inherent limitation of steroidal antago- MRN770A,MRA773G,MRQ776A,MRS810A,MRS810L,MRS810M, nists by combining the high potency of spironolactone with MRR817A MRM852A,MRC942A, and MRT945A, respectively (20– better selectivity and less adverse secondary effects (12). 24). The plasmid pFC31Luc contains the mouse mammary Recently, a novel nonsteroidal MR antagonist, finerenone, has tumor virus promoter that drives the luciferase gene (25). been developed that combines potency and high selectivity and Cell Culture—Cells from the human cortical collecting duct demonstrated a more efficient protection from cardiorenal HK-GFP-MR cell line (human kidney GFP-MR, clone 20) (26) injuries in comparison with steroidal antagonists at equinatri- were routinely cultured at 37 °C, in an humidified incubator

uretic doses in preclinical models (13, 14). These remarkable gassed with 5% CO2. Cells were seeded on Petri dishes with 10 properties, together with the nonsteroidal nature of finerenone, ml of DMEM high glucose medium supplemented with L-glu- raise the question of the mechanisms by which this molecule tamine (Life Technologies), 2.5% FBS (Biowest, Courtaboeuf, interferes with aldosterone in the MR signaling. France), 1% penicillin/streptomycin (GE Healthcare), and 200 Aldosterone binding to MR, a ligand-induced transcription ␮g/ml Geneticin (Life Technologies). The murin cortical col- factor, promotes a receptor conformational change that allows lecting duct KC3AC1 cells (27) were seeded on collagen dissociation from chaperone heterocomplexes and a critical I-coated Petri dishes and cultured in a mixture of DMEM/ hyperphosphorylation that are associated with a rapid translo- Ham’s F-12 (1:1) supplemented with 2 mM glutamine, 50 nM cation into the nuclear compartment. Once in the nucleus, MR dexamethasone (Sigma), 50 nM sodium selenite (Sigma), 5 binds as a dimer to hormone response elements and recruits ␮g/ml transferrin, 5 ␮g/ml insulin (Sigma), 10 ng/ml EGF

transcriptional coregulators, allowing the transcription or (Tebu, Le Perray en Yvelines, France), 2 nM T3 (Sigma), 100 repression of its target genes (15). Modulation of MR activity units/ml penicillin/streptomycin, 20 mm HEPES, pH 7.4, and upon antagonist binding may thus occur at different steps of the 5% dextran charcoal-treated serum. HEK 293T cells (12,000 receptor signaling pathway such as at nucleocytoplasmic shut- cells/well) were cultured in high glucose Dulbecco’s minimal tling (16, 17), its post-translational modifications (phosphory- essential medium (Invitrogen) containing 2 mM glutamine, 100 lation, ubiquitinylation), and its interaction with the transcrip- IU/ml penicillin, 100 ␮g/ml streptomycin, and 10% FBS at tional machinery (18). In the present study, we investigated the 37 °C. molecular mechanism of action of finerenone by using struc- Immunocytochemistry—Cells were fixed with 4% paraformal- tural, biochemical, and cellular approaches and highlighted dehyde for 30 min at room temperature and permeabilized for that finerenone impairs MR signaling at the levels of nucleocy- 30 min with a 0.5% solution of PBS-Triton X-100. Cells were toplasmic shuttling, post-translational modification, turnover, then washed with PBS and incubated for1hatroom tempera- and coregulator recruitment. ture in PBS-Tween buffer containing 5% nonfat dry milk (PBS, 5% nonfat dry milk, 0.1% (v/v) Tween 20) before incubation Experimental Procedures with primary antibody. Cells were incubated with a rabbit anti- Compounds—Finerenone was synthesized as previously GFP antibody overnight at 4 °C (Millipore SAS, Guyancourt, described (13). Aldosterone and spironolactone were pur- France), followed by an Alexa Fluor 555 anti-rabbit secondary chased from Sigma-Aldrich. 18-Oxo-18-vinylprogesterone was antibody for 30 min at room temperature (Life Technologies). a gift from A. Marquet (19). After antibody labeling, cells were postfixed 10 min with 4% Synthesis—A mixture of 3.83 mg (10.1 ␮mol) finerenone and paraformaldehyde and nuclear counterstaining was performed 9.39 mg of (1,5-cyclooctadien)-(pyridine)-(tricyclohexylphos- with 0.5 ␮g/ml DAPI. phine)-iridium(I)-hexafluorophosphate dissolved in 1.0 ml of Automated High Throughput Microscopy—HK-GFP-MR dichloromethane was stirred with tritium gas at a partial pres- cells were seeded (6000 cells/well) on a 24-well tissue culture sure of ϳ80.6 kPa (806 mbar) for 60 min in a reaction vessel that plate in DMEM containing 2.5% dextran charcoal-stripped was connected to a tritium labeling apparatus. After freezing of FBS. Forty-eight hours later, a subsequent hormone withdrawal the reaction mixture with liquid nitrogen, the nonreacted trit- was achieved by rinsing the cells three times with DMEM con- ium and the solvent were adsorbed in a trap filled with platinum taining 2.5% dextran charcoal-stripped FBS prior to further oxide and charcoal at the temperature of liquid nitrogen. To incubation of the cells for 48 h within this medium. Ligand remove the labile tritium, the dry residue was dissolved in 1.0 treatment was then performed at the indicated concentrations ml of acetonitrile and 0.5 ml of ethanol, and the solvent was with ligands alone (aldosterone, finerenone, or spironolactone) evaporated in the vacuum. This process of removing labile trit- or with aldosterone plus a 100-fold excess of finerenone or spi- ium was repeated four times. The labeling position is in the ronolactone. Control vehicle condition was run in parallel with methylene group of the ethoxy moiety, which was determined DMEM containing 0.01% DMSO and 0.1% ethanol. Sequential by [3H]NMR spectroscopy. No other signals were detected. The images were acquired (20ϫ/0.4 NA), analyzed and quantified labeling degree was determined by LC MS, and the specific by the ArrayScan VTI imaging platform (Thermo Fisher Scien- activity was calculated as 312 MBq/mg (3.2 Ci/mmol) for tific). DAPI and GFP-hMR fluorescence were captured using

SEPTEMBER 4, 2015•VOLUME 290•NUMBER 36 JOURNAL OF BIOLOGICAL CHEMISTRY 21877 Blocking Mineralocorticoid Receptor with Finerenone

sequential acquisition to give separate image files for each. The sounds (ON) and 30 s without (OFF). Between each run, heated Molecular Translocation V4 Bioapplication algorithm (vHCS water had to be removed and replaced by ice-cold water and ice. Scan, version 6.3.1, Build 6586) was used to quantify the relative The total quantity of sheared chromatin protein was measured, distribution of GFP-hMR. Briefly, the DAPI staining identifying using the bicinchoninic acid assay (Interchim, Montluçon, the nuclear region was used for focusing during acquisition and France) and the spectrophotometer Victor3௡ (Perkin Elmer). to define a binary nuclear mask. This mask (CIRC mask) was Protein A-coated magnetic beads (25 ␮l of the stock suspen- used to quantify the amount of target channel fluorescence sion) were washed three times in buffer C1 and resuspended in within the nucleus (CircAvgIntensity or nuclear average inten- C1 buffer (100 ␮l of final volume). Sheared chromatin (1.3 mg sity, NI). The nuclear mask was then dilated to cover the max- of proteins) and 7 ␮g of one of the tested antibodies were then imum cytoplasmic region as possible without exceeding cell added to the beads, and the final volume was adjusted to 500 ␮l boundaries (RINGWidth ϭ 5 pixels). Subtraction of the nuclear with C1 buffer supplemented with 1% protease inhibitor mix- mask from this dilated mask creates a binary cytoplasmic mask ture and 0.1% BSA (final concentrations). Samples were incu- covering the cytoplasmic region. An automatic cut-off thresh- bated overnight at 4 °C using a rotary incubator. Magnetic old was applied to exclude pixels of the outside cell boundary beads were then isolated and washed three times with C1 buffer background signal (fixed threshold ϭ 55). The cytoplasmic and once with W1 buffer. DNA fragments from the immuno- mask (RING mask) was used to quantify the amount of target precipitated chromatin were eluted with the DNA isolating channel fluorescence within the cytoplasm (RingAvgIntensity buffer supplemented with 1% Proteinase K, for 15 min at 55 °C or cytoplasmic average intensity, CI). The translocation index and finally for 15 min at 100 °C and quantified by real time measurement (CircAvgInten/RingAvgIntensity or NI/CI) rep- quantitative PCR. resents the average value ratio of the nuclear intensity to the Real Time Quantitative PCR—ChIP-resulting DNA samples cytoplasmic intensity calculated for each selected cell per well were amplified by real time quantitative PCR, using the Quant- (n ϭ 3,000–12,000 cells) (28). Studio 6Flex System (Life Technologies) and 96-well plates. In Western Blot Analysis—Twenty-four h before the experi- each well were mixed 5 ␮l of a DNA sample, 6 ␮l of Fast SYBR ment, HK-GFP-MR cells were incubated in DMEM containing Green master Mix (Applied Biosystems, Saint-Aubin, France), 2.5% dextran-coated charcoal-treated FBS. Cells were then and 0.5 ␮l of forward (5Ј-TTCCTGCAACTCTGTGAC-3Ј) Ϫ8 incubated for 1, 4, or 24 h at 37 °C with either 10 M aldoster- and reverse (5Ј-GCCCTAGGACATTCTGTT-3Ј) primers (300 Ϫ6 one, 10 M finerenone or spironolactone, or vehicle. Total pro- nM final concentration) (SCNN1A promoter). After a 10-min tein extracts were then prepared using the protein extraction preincubation at 95 °C, 40 cycles were performed. Each cycle buffer (150 mM NaCl; 50 mM Tris-HCl, pH 7.5; 0.5 mM EDTA; was composed of 15-s denaturation phase at 95 °C, followed by 30 mM sodium pyrophosphate; 50 mM NaF), extemporaneously 1-min hybridization and amplification phase at 60 °C. Each supplemented with 1% Triton X-100, 1% protease inhibitor DNA sample was analyzed in triplicate. The results are cocktail 100ϫ (Sigma), and 0.1% SDS. Samples were kept at 4 °C expressed as percentages of input and are the mean Ϯ S.E. of for 30 min and then centrifuged at 16,000 ϫ g for 20 min at 4 °C. three independent measurements. Protein concentrations were quantified using the bicinchoninic Reverse Transcription—KC3AC1 cells were cultured for 48 h acid assay. After migration on a 6% polyacrylamide gel in dena- in minimal medium that has the same composition than the turing conditions, total proteins (50 ␮g) were transferred epithelial medium but that lacks dexamethasone, EGF and dex- onto a nitrocellulose membrane and revealed by the 39N tran charcoal-treated serum. Cells were then treated for 4 h Ϫ8 Ϫ6 anti-MR (27) (1:1000 dilution) or the anti-␣-tubulin with vehicle, 10 M aldosterone, or 10 M finerenone alone or Ϫ8 (1:10,000 dilution) antibodies. in combination with 10 M aldosterone. After twice washing of Chromatin Immunoprecipitation—Geneticin was removed cells with ice-cold PBS, total RNA was extracted by the phenol- from cell medium 8 days before experiments. Twenty-four chloroform method, using the TRI reagent (Molecular hours before ChIP, HK-GFP-MR cells were incubated in Research Center, Euromedex, Mundolsheim, France) following DMEM containing 2.5% dextran charcoal-stripped FBS. Cells the manufacturer’s recommendations, then recovered in 20 ␮l Ϫ7 were then incubated for1hat37°Cwith either 10 M aldos- of water, and quantified with Nanodrop spectrophotometer Ϫ6 terone, 10 M finerenone or spironolactone, vehicle, or a com- (Thermo Scientific, Villebon, France). Total RNA (1 ␮g) was Ϫ7 Ϫ6 bination of 10 M aldosterone plus 10 M spironolactone or first digested for 10 min at 37 °C with 0.5 ␮l of DNase I (Biolabs, finerenone, all in DMEM supplemented by 2.5% dextran char- Evry, France) in a total volume of 10 ␮l to remove potential coal-stripped FBS. Cells were then fixed for 10 min at room genomic DNA and then incubated for 10 min at 75 °C with 1 ␮l temperature by adding 1% paraformaldehyde to the medium. of 25 mM EDTA (Life Technologies). For each sample, 9 ␮lof After 8 min of neutralization of the medium by adding 0.125 M the reverse transcription mix was incubated in the presence of glycine, cells were washed twice with ice-cold PBS. Cell lysis Superscript reverse transcriptase (1 ␮l), random primers (2 ␮l), and chromatin shearing were carried out using the #High- 10 mM dNTP (0.8 ␮l), 10ϫ reverse transcriptase buffer (2 ␮l) CellChIP kit buffers (Diagenode, Seraing, Belgium), according to and water (3.2 ␮l). After 10 min of annealing at 25 °C, the the manufacturer’s recommendations, with the following modifi- reverse transcription was carried out for2hat37°C,followed cations. Chromatin shearing was performed in 500 ␮l of shearing by rapid denaturation of the enzyme at 85 °C. The real time buffer S1 ϩ protease inhibitor mixture (Sigma-Aldrich), applying quantitative PCR was performed on the complementary DNA 2 runs of 10 cycles at high intensity (Bioruptor௡; Diagenode). Each (cDNA), as described above. Specific primer sequences are cycle was composed of 30 s with effective application of ultra- 5Ј-CTGCACCTTTGGCATGATGTA and 5Ј-TTCCGGG-

21878 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290•NUMBER 36•SEPTEMBER 4, 2015 Blocking Mineralocorticoid Receptor with Finerenone

TACCTGTAGGGATT. A 1:10 dilution standard range was TABLE 1 run in parallel to quantify cDNA (attomol amount ϭ f(Ct Half-maximally inhibitory concentrations of finerenone for the wild- value)). All samples were quantified in duplicate. Relative type and mutant MRs HEK 293T cells were cultured and transfected. Twenty-four hours after transfec- Ϫ Ϫ expression in a given sample was normalized to the internal tion, finerenone was added (10 9 to 10 6 M) together with an agonist at the con- Ϫ centration able to maximally activate each receptor (10 9 M aldosterone for MR, reference 18S rRNA values where the control condition value Ϫ7 MRA773G,MRS810A,MRS810L and MRS810M;10 M aldosterone for MRQ776A, was arbitrarily set at 1. The results are expressed as means Ϯ Ϫ7 Ϫ8 MRC942A, and MRT945A;10 M 18OVP for MRN770A; and 10 M spironolactone S.E. for MRM852A), and after a 16-h incubation, cell extracts were assayed for luciferase ␤ and -galactosidase activities (29). The IC50 values were calculated using the Transactivation Assays in Transiently Transfected Cells— GraphPad Prism Software and are the means Ϯ S.E. of three independent experi- HEK 293T cells were cultured and transfected using the cal- ments performed in triplicate. NA, nonapplicable. cium phosphate method with the vectors allowing the expres- Finerenone Spironolactonea IC Fold IC Fold ED sion of the wild type or mutant MRs (MRWT,MRN770A, 50 50 50 MRA773G,MRQ776A,MRS810A,MRR817A MRM852A,MRC942A, nM nM nM b Ϯ Ϯ ␤ MRWT 58 9 1 74.0 15 1 and MRT945A), the reporter vector pFC31Luc, and the pc gal b Ϯ Ϯ MRN770A 1925 185 33.2 1313 167 17.7 b Ϯ Ϯ vector as previously described (29) or with Lipofectamine 2000 MRQ776A 74 8 1.3 301 77 4.1 b Ϯ Ϯ MRS810A 524 50 9.0 109 24 1.5 as recommended by the manufacturer (Invitrogen) (MRWT, b Ϯ Ϯ MRR817A 155 12 2.7 331 20 4.5 b Ϯ Ϯ MRA773G,MRS810L, and MRS810M) and the pMIR-REPORT MRC942A 321 49 5.5 506 55 6.8 b Ϯ Ϯ ␤ MRT945A 119 19 2.1 444 43 6.0 -gal (Applied Biosystems). Twenty-four hours after transfec- c Ϯ Ϯ Ϫ Ϫ MRWT 31.8 1.8 1 74.0 15 1 9 6 c Ϯ Ϯ tion, finerenone was added (10 to 10 M) together with an MRA773G 1370 280 43.1 84 15 17.7 MR c 5100 Ϯ 800 160.4 NA NA 6 agonist at the concentration able to maximally activate each S810M Ϫ9 a According to Ref. 29. receptor (10 M aldosterone for MR, MRA773G,MRS810A, b Ϫ Transfected using the calcium phosphate method. 7 c MRS810L, and MRS810M;10 M aldosterone for MRQ776A, Transfected using Lipofectamine 2000. Ϫ7 MRC942A, and MRT945A;10 M 18-oxo-18-vinylprogesterone Ϫ8 for MRN770A; and 10 M spironolactone for MRM852A), and and Gly-753–Asp-760. Helix 12 (Pro-957–His-982) was after a 16-h incubation, cell extracts were assayed for luciferase deleted. The resulting protein structure including crystallo- and ␤-galactosidase activities (29). The GraphPad Prism soft- graphic water molecules was protonated. Likely protonation ware (version 6; GraphPad Software Inc., San Diego, CA) was states and hydrogen bonding networks were predicted using used for curve fitting and calculation of the IC50 values. The the “protein preparation workflow” in Maestro (Schrödinger). IC50 values were determined from at least three independent Initial docking was carried out by manually placing the small experiments performed in triplicate. The IC50 values are given molecule x-ray-derived conformation of BR-4628 into the as means Ϯ S.E. binding site and varying the relative orientation of the ligand Finerenone Binding Characteristics at Equilibrium and (29). The conformation of Met-852, Ser-811, and Thr-945 side Kinetic Experiments—The human MR was expressed in vitro in chains were altered to enlarge the volume of the binding pocket. the rabbit reticulocyte lysate system as previously described The program Glide SP version 3.5 (32) (Schrödinger) was used (21). Lysates were diluted 4-fold with TEGWM buffer (20 mM to dock finerenone into the binding cleft. The ligand was placed Tris-HCl, 1 mM EDTA, 20 mM sodium tungstate, 1 mM ␤-mer- at the center of a 22 Å box to calculate the interaction grid. The captoethanol, and 10% glycerol (v/v), pH 7.4) and incubated van der Waals scaling factor was set at 0.8, and the partial 3 with 0.3 to 300 nM [ H]finerenone for4hat4°C.Bound and charge cutoff was set to 0.15. The ligands were docked flexibly, Unbound ligands were separated by the dextran-charcoal and nonplanar amide bonds were penalized; 10,000 poses per method (23). The change in bound/unbound as a function of docking run were sampled. The complex with the most proba-

bound was analyzed, and the Kd value was calculated as previ- ble binding pose was energy minimized using the OPLS2.1 ously described (30). force field (33) (dielectric constant, 1.0; constant dielectric, sol- Dissociation kinetics studies were performed using 4-fold vent water, Polak-Ribier conjugate gradient; convergence Ϫ8 3 diluted hMR-containing lysates incubated with 10 M [ H]fi- threshold, 0.5) in MacroModel (Schrödinger). nerenone for4hat4°C.One-half of the labeled lysate was kept Statistical Analysis—Experimental data are presented as at 4 °C and used to determine the stability of the [3H]finere- means Ϯ S.E. Statistical analyses were performed using the none/MR complexes, whereas the other half was incubated Prism 6 software (GraphPad Software). Statistical significance Ϫ6 with 10 M finerenone for various periods of time. Bound and was calculated with the Mann-Whitney nonparametric U test free ligands were separated using charcoal-dextran treatment. with unpaired data and two-tailed calculations. The data were corrected for receptor stability and were expressed as a percentage of the binding measured at time 0. Results Protein Modeling and Ligand Docking—The x-ray structure Finerenone Is a Potent Mineralocorticoid Antagonist That of the wild type MR ligand-binding domain complexed with Displays a High Affinity for MR—Finerenone was initially deoxycorticosterone (Protein Data Bank code 2ABI) (24) reported to strongly inhibit aldosterone-induced transcrip- served as a model for docking of finerenone. In contrast to other tional activity of the MR ligand-binding domain (LBD) fused to x-ray structures, it is missing the C808S mutation, leading to a the GAL4 DNA-binding domain (13). We investigated the slightly more natural side chain arrangement. The structure antagonistic properties of finerenone on the wild type full- was complemented for unresolved loops by superimposing it length human MR in comparison with the steroidal MR antag- with 2A3I (31) and transferring the loops Arg-904–Gln-919 onist spironolactone. HEK 293T cells transiently expressing

SEPTEMBER 4, 2015•VOLUME 290•NUMBER 36 JOURNAL OF BIOLOGICAL CHEMISTRY 21879 Blocking Mineralocorticoid Receptor with Finerenone

FIGURE 1. Finerenone binding characteristics at equilibrium and kinetic experiments. A, the human MR was expressed in vitro in the rabbit reticulocyte lysate system. Lysates were diluted 4-fold with TEGWM buffer (20 mM Tris-HCl, 1 mM EDTA, 20 mM sodium tungstate, 1 mM ␤-mercaptoethanol, and 10% glycerol (v/v), pH 7.4) and incubated with 3 ϫ 10Ϫ10 to 3 ϫ 10Ϫ7 [3H]finerenone for4hat4°C.Bound (B) and Unbound (U) ligands were separated by the dextran-charcoal method. The change in B/U as a function of B was analyzed, and the K value was calculated. B, dissociation kinetics studies were performed Ϫ d using 4-fold diluted hMR containing lysates incubated with 10 8 M [3H]finerenone for4hat4°C.One-half of the labeled lysate was kept at 4 °C and used to Ϫ determine the stability of the [3H]finerenone-MR complexes, whereas the other half was incubated with 10 6 M finerenone for various periods of time. Bound and free ligands were separated using charcoal-dextran treatment. The data were corrected for receptor stability and were expressed as percentages of the binding measured at time 0.

human MR and a reporter vector in which the luciferase gene specific mislocalization of the receptor. Control experiments was placed under the control of the mouse mammary tumor indicate that GFP-hMR was not detected in control parental virus promoter were treated by aldosterone in the presence of cell line (data not shown). Cells were treated for 1 h-24 h with increasing concentrations of finerenone or spironolactone. each ligand alone or by combining aldosterone and one of the Ϯ Luciferase activity was measured, and IC50 values of 58 9 and antagonists. Results show that 1 h aldosterone treatment 74.0 Ϯ 15 nM were determined for finerenone and spironolac- induces the complete accumulation of GFP-hMR into the tone, respectively (Table 1). These results indicate that finere- nuclear compartment (Fig. 2A). In contrast, in the presence of none is slightly more potent than spironolactone in vitro.We finerenone or spironolactone, hMR was only partially imported then evaluated the binding properties of [3H]finerenone on the into the nucleus, because a large fraction of GFP-hMR still recombinant MR by performing binding experiments at equi- remains detectable in the cytoplasmic compartment (Fig. 2A). librium. Scatchard plot analysis revealed that finerenone binds Precise quantification of the subcellular localization of the the in vitro translated full-length MR with a high affinity, as receptor after 1–24 h of treatment with various ligands was Ϯ determined by the Kd value of 1.52 0.01 nM (Fig. 1A), which is made possible by the use of an automated high throughput in the same range as that of aldosterone (0.5 nM) and the min- microscope, an analysis we previously developed for the char- eralocorticoid antagonist progesterone (1.0 nM) (22). We then acterization of progesterone receptor antagonists (34). As evaluated the dynamics of the finerenone-MR interaction. Dis- shown in Fig. 2B, the translocation index of GFP-hMR as sociation kinetic experiments, performed at 4 °C revealed a defined by the ratio between the averaged intensities of the half-life time of 50 min for the finerenone-MR complex (Fig. nuclei and cytoplasmic rings (NI/CI) (see “Experimental Proce- 1B), which is in the same order of magnitude as that for the dures”) had a value of 1.33 Ϯ 0.05 (n ϭ 2993) in the absence of complex between MR and the antagonist RU26752 (22). Alto- aldosterone, indicating a localization of the fusion protein gether, these results indicate that finerenone has a high affinity within the whole cell compartments. Upon1hofincubation for MR combined with a rapid receptor off rate. with 10 nM aldosterone, the translocation index of GFP-hMR The Ligand-induced Nuclear Import of MR Is Differentially drastically increased and reached a maximum value of 3.11 Ϯ Delayed by Finerenone and Spironolactone—Nuclear translo- 0.02 (n ϭ 3940; p Ͻ 0.0001). No significant additional increase cation is one of the critical steps that convert steroid receptors of the index value was observed after prolonged incubation into their transcriptionally active state. It was previously shown time with aldosterone (4–24 h), indicating that the that steroidal MR antagonists drastically affected intracellular aldosterone-dependent MR nuclear accumulation reaches its localization of MR as opposed to aldosterone that rapidly trig- maximum after 1 h treatment. In sharp contrast, the transloca- gered MR nuclear translocation within one hour (16, 17). We tion index only increases moderately in cells treated 1h with Ϫ6 Ϫ8 thus investigated the impact of finerenone and spironolactone antagonists alone (10 M) or with a mix of aldosterone (10 on the subcellular trafficking of MR to determine whether both M) and a 100-fold excess of each antagonist (1.84 Ϯ 0.01 (n ϭ antagonists could exert differential actions on MR cytoplasmic 2872), 1.76 Ϯ 0.01 (n ϭ 3746), 1.75 Ϯ 0.01 (n ϭ 4823) and sequestration and/or inhibition of aldosterone-induced MR 1.78 Ϯ 0.01 (n ϭ 2379)), for spironolactone, finerenone, aldos- nuclear import. A human renal cortical collecting duct terone plus spironolactone, and aldosterone plus finerenone, GFP-MR cell line (HK-GFP-MR) stably expressing low levels of respectively (p Ͻ 0.0001 versus vehicle, and versus aldosterone). GFP-hMR was selected for our experiments (26) to avoid non- These data are consistent with previous observations (Fig. 2A)

21880 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290•NUMBER 36•SEPTEMBER 4, 2015 Blocking Mineralocorticoid Receptor with Finerenone

A GFP-MR DAPI B 3.5 (For statistical significance, see text and Figure legend) 3.0

2.5 Vehicle 2.0

1.5

1.0 V F A A+S 0.5 S A+F Aldo

Nucleo/cytoplasmic intensity ratio intensity Nucleo/cytoplasmic 0.0 0 4 8 12 16 20 24 time (h)

400 C (For statistical significance, see text and Figure legend)

Spiro 350

300

250 Fine Nuclear fluorescence index Nuclear fluorescence V S A+S A F A+F 200 0 1 2 3 4 24 time (h) FIGURE 2. Finerenone and spironolactone delay the ligand-induced nuclear translocation of the mineralocorticoid receptor. A, HK-GFP-MR cells were Ϫ Ϫ cultured for 48 h in medium containing 2.5% charcoal-stripped fetal bovine serum, followed by1hofincubation with either 10 8 M aldosterone, 10 6 M finerenone, or spironolactone. Cells were processed for immunocytochemistry using an anti-GFP antibody, and fluorescence was captured with an automated ArrayScan VTI fluorescent microscope. DAPI staining delineates the nuclei. The left panel shows the raw images acquired in the GFP channel. The right panel shows the DAPI acquisition. B, automated quantification of GFP-hMR nuclear translocation kinetics by automated high throughput microscopy. HK-GFP-MR Ϫ cells were cultured in medium containing 2.5% charcoal-stripped fetal bovine serum. Forty-eight hours after, cells were treated with either 10 8 M aldosterone, Ϫ Ϫ Ϫ Ϫ 10 6 M finerenone, or 10 6 M spironolactone or incubated with a mix of aldosterone 10 8 M and antagonist at 10 6 M for 1, 4, or 24 h as indicated. The panel shows the translocation index that represents the ratio of the average nuclear intensity to the average cytoplasmic intensity (NI/CI) calculated in their respective binary mask (see “Experimental Procedures”). C, the panel shows the average nuclear fluorescence intensity (NI) values calculated for each indicated condition (CircAvgInten). Statistical significance was calculated with the Mann-Whitney nonparametric U test with unpaired data and two-tailed calculations. Because of the very large number of cells (3,000–12,000), p values Ͻ 0.0001 were obtained, with some exceptions. For the NI/CI, p values Ͻ 0.001 were obtained for S versus AϩF(1h),Sversus F (24 h), S versus AϩS (24 h), and F versus AϩF (24 h), p values Ͻ 0.01 for F versus AϩF(1h)andAversus S (4 h); p values Ͻ 0.05 for F versus AϩS (1 h) and AϩF versus AϩS (24 h), and nonsignificant values were obtained for AϩF versus AϩS(1h),Sversus AϩS (4 h), and S versus AϩF (24 h). For the NI, p values Ͻ 0.001 were obtained for S versus AϩS (24 h), and p values Ͻ 0.01 were obtained for A versus S(4h)andFversus AϩF (24 h); nonsignificant values were obtained for F versus AϩS(1h),Aversus V (24 h), and S versus F (24 h), F versus AϩS (24 h), and AϩS versus AϩF (24 h).

and demonstrate that both antagonists are able to compete with exposure (NI ϭ 315 Ϯ 2(4h)(n ϭ 12272) and 275 Ϯ 2 (24 h) aldosterone by inhibiting the hormone-dependent nuclear (n ϭ 6370); Fig. 2C), suggesting that a ligand-induced down- accumulation of GFP-hMR. However, a prolonged exposure to regulation of MR occurs in the presence of the agonist. In con- antagonists (4–24 h) further increases MR nuclear import trast, 1 h of finerenone exposure alone or in combination with (translocation index 2.71 Ϯ 0.01 (n ϭ 9095), 2.71 Ϯ 0.01 (n ϭ aldosterone only moderately increases the nuclear fluorescence 7972), 2.82 Ϯ 0.01 (n ϭ 7901) and 2.82 Ϯ 0.02 (n ϭ 2333)) for intensity (NI ϭ 275 Ϯ 3, n ϭ 3746) at a much lower extend than spironolactone, finerenone, aldosterone plus spironolactone, that observed with spironolactone (NI ϭ 313 Ϯ 3, n ϭ 2872), and aldosterone plus finerenone, respectively (p Ͻ 0.0001 ver- indicating that finerenone is more potent to inhibit the nuclear sus vehicle, and versus aldosterone; Fig. 2B), indicating that import of GFP-hMR than spironolactone. However, upon4hof both antagonists do not exert their inhibitory effects by seques- exposure with antagonist ligands (alone or in combination with tering MR into the cytoplasm but rather by delaying its nuclear aldosterone), NI values slightly increased to reach their maxi- import kinetics. To confirm these observations, we precisely mum value (311 Ϯ 2(n ϭ 9095), 329 Ϯ 2(n ϭ 7972), 344 Ϯ 2 quantified the average fluorescence intensity within the (n ϭ 7901), and 351 Ϯ 4(n ϭ 2333) for spironolactone, finere- nucleus for each condition (i.e. NI parameter; Fig. 2C). As none, aldosterone plus spironolactone, and aldosterone plus expected, the graph shows that the nuclear intensity increases finerenone, respectively). Thereafter, nuclear intensities dramatically after1hoftreatment with aldosterone (NI ϭ decreased by ϳ50% after 24 h of antagonist exposure, suggest- 390 Ϯ 3(n ϭ 3940) versus vehicle 250 Ϯ 3(n ϭ 2293), p Ͻ ing that antagonist-induced MR degradation might also occur 0.0001 versus vehicle; Fig. 2C). Strikingly, the nuclear fluores- in a delayed manner with a diminished efficacy. Taken together, cence intensity rapidly declines after 4 and 24 h of aldosterone our findings demonstrate that finerenone impedes MR nuclear

SEPTEMBER 4, 2015•VOLUME 290•NUMBER 36 JOURNAL OF BIOLOGICAL CHEMISTRY 21881 Blocking Mineralocorticoid Receptor with Finerenone

1h 1h A S0MW VA FS

GFP-MR

α-Tubulin D 100 89.4 ± 7.5105.1 ± 9.7 97.4 ± 14.1 130

4h B VAMW F S Vehicle 100 Spiro GFP-MR Fine

** # α-Tubulin 50 Aldo GFP-MR (%)

100 77.3 ± 6.3102.2 ± 5.1 104.1 ± 19.1 **§ 24h 10 # C MW VAMW F S 0 170 GFP-MR 048121620241 130 Time (h) 100 70

55 α-Tubulin

40 100 41.2 ± 9.186.2 ± 13.8 90.9 ± 11.8 FIGURE 3. GFP-MR degradation upon ligand binding. A, Western blot analysis of the ligand-induced degradation of the GFP-hMR fusion protein. A–C, Ϫ Ϫ HK-GFP-MR cells were treated for1h(A),4h(B), or 24 h (C) with vehicle (V), 10 8 M aldosterone (A), 10 6 M spironolactone (S), or finerenone (F). The upper bands, corresponding to the GFP-hMR fusion protein (150 kDa), were revealed by the 39N antibody directed toward MR and quantified with the Image Studio software. The values were normalized with those of the ␣-tubulin bands (55 kDa) and by the values for the vehicle conditions. The values are reported under each corresponding lanes and are the means Ϯ S.E. of three independent experiments with 1–4 measurements. D, GFP-hMR time course degradation. Statistical significance was calculated with the Mann-Whitney nonparametric U tests with unpaired data and two-tailed calculations. * (aldosterone versus vehicle), # (aldosterone versus finerenone), and § (aldosterone versus spironolactone), p Ͻ 0.05; **, p Ͻ 0.01.

translocation more efficiently than spironolactone and indicate Of particular interest, an upper shift of the GFP-hMR band was that MR degradation might be differentially regulated by ago- observed after 1, 4, and 24 h of aldosterone exposure, indicating nist and antagonist ligands. a ligand-induced phosphorylation of the receptor. This upper Finerenone and Spironolactone Impair Aldosterone-depen- shift was neither observed in the vehicle nor in antagonist- dent Down-regulation of the Mineralocorticoid Receptor—To treated conditions, suggesting that the receptor phosphoryla- better understand how ligands modulate MR nuclear fluores- tion is an agonist-dependent process. In addition, although MR cence intensity, we investigated whether MR protein levels level significantly decreased after4hofaldosterone treatment could be differentially affected after incubation with aldoster- (Fig. 3, B, lanes 3 and 4 versus lanes 1 and 2, and D), the receptor one or MR antagonists. Steroid receptor transcriptional activa- level remained stable in the presence of both antagonists (Fig. 3, tion has been shown to be directly coupled to the receptor deg- B, lanes 6 and 7 and lines 8 and 9 versus lanes 1 and 2, and D). radation by the ubiquitin-proteasome pathway, and it has been This result is consistent with the data obtained from the in situ also shown that gene transactivation could not occur when the nuclear fluorescence intensity quantification (Fig. 2C). Inter- receptor is not down-regulated (35–37). To analyze the effect of estingly, GFP-hMR level dramatically decreased after 24 h of ligands on MR expression level, HK-GFP-MR cells were incu- exposure to aldosterone (Fig. 3, C, lanes 4 and 5 versus lanes 2 bated for various periods of time (1–24 h) in the presence of and 3, and D), whereas no significant reduction of the receptor each molecule. An antibody directed against MR (27) was used level was observed after both antagonists treatment (Fig. 3C, to detect the 150-kDa band corresponding specifically to GFP- lanes 7 and 8 and lanes 9 and 10 versus lanes 2 and 3, and D). hMR. Western blot analyses of whole cell extracts revealed that Overall, these data clearly indicate that MR expression is GFP-hMR expression level did not significantly change upon reduced in an aldosterone-dependent manner and that both 1 h of ligand treatment (agonist or antagonist) (Fig. 3, A and D). antagonists are unable to promote such receptor degradation.

21882 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290•NUMBER 36•SEPTEMBER 4, 2015 Blocking Mineralocorticoid Receptor with Finerenone

MR tone is able to promote MR and SRC-1 recruitment but not that 8 **** of the RNA Pol II (38). We therefore compared the abilities of aldosterone, finerenone, or spironolactone to promote binding 6 of competent transcriptional complexes onto a genomic MR target by using similar ChIP experiments. As expected, Fig. 4 4 shows that aldosterone induces a significant increase of MR,

## SRC-1, and RNA Pol II recruitment onto the SCNN1A pro- **## 2 **** moter compared with the vehicle-treated condition or upon Fold induction Fold #### §§ control IgG immunoprecipitation as measured by ChIP exper- 0 iments. In addition, whereas aldosterone induced MR recruit- CVAS F A+F ment onto the SCNN1A promoter region, it did not promote a MR recruitment onto a nonpromoter region of the SCNN1A 4 SRC-1 gene nor onto the 18S gene (data not shown). In addition, aldos- * terone was incapable of inducing MR recruitment on the 3Ј-un- 3 * translated region of the SCNN1A gene, whereas a dramatic Pol # II recruitment was observed at this genomic region after aldos- 2 terone treatment (data not shown). These experiments indicate * that aldosterone promotes MR, SRC-1, and Pol II recruitment 1 * # Fold induction Fold # onto the promoter region of SCNN1A gene, allowing the MR- § mediated aldosterone-dependent transcriptional initiation and 0 elongation, as demonstrated by the presence of Pol II at both CVAS F A+F the 5Ј and 3Ј region of the gene. Spironolactone alone also pro- RNA Pol II moted a significant MR and SRC-1 recruitment onto the 2.0 * SCNN1A promoter but to a lesser extent than aldosterone. Spi- ronolactone did not promote RNA Pol II recruitment, suggest- 1.5 ing that although this compound displays an aldosterone-like # behavior, it was unable to favor recruitment of RNA Pol II pre- # venting active preinitiation complexes. In sharp contrast, 1.0 # finerenone alone not only impairs MR, SRC-1, and RNA Pol II recruitment but also remarkably reduces basal MR and SRC-1 0.5 Fold induction Fold binding onto the SCNN1A regulatory sequence as compared with vehicle-treated condition. In addition, finerenone also sig- 0.0 CVAS F A+F nificantly inhibited MR, SRC-1, and RNA Pol II recruitment induced by aldosterone. Collectively, these results indicate that FIGURE 4. MR, SRC-1, and RNA Pol II recruitment on the promoter region of the SCNN1A gene. HK-GFP-MR cells were incubated with ethanol (V), 10Ϫ7 the nonsteroidal MR antagonist finerenone acts as an inverse Ϫ Ϫ M aldosterone (A), 10 6 M spironolactone (S), or finerenone (F)or10 7 M aldos- mineralocorticoid receptor agonist. Ϫ6 terone plus 10 M finerenone (AϩF), fixed with paraformaldehyde, lysed, Finerenone Alters the Expression of an Endogenous Mineralo- and chromatin-sheared. Samples were then immunoprecipitated with the anti-MR 39N antibody or a control rabbit IgG (C)(top panel), SRC-1 (middle corticoid Receptor Target Gene—To further evaluate finere- panel), or an antibody directed against the RNA Pol II (bottom panel)as none’s molecular mechanism of action, we investigated the described under “Experimental Procedures.” After elution, DNA was quantified by quantitative PCR, using primers for the genomic fragment encom- ability of this molecule to inhibit expression of specific target passing mineralocorticoid responsive element corresponding to the MR gene. Using the murine renal cell line KC3AC1 that endoge- binding site located in the promoter region of the SCNN1A gene. The results nously expresses MR (27), we evaluated the influence of aldos- are expressed as percentages of input before immunoprecipitation. The data are means Ϯ S.E. of three independent experiments. Statistical significance terone and/or finerenone on the expression of the Sgk1 gene, a was calculated with the Mann-Whitney nonparametric U tests with unpaired well known MR target gene (39). KC3AC1 cells were treated 4 h data and two-tailed calculations. **** (versus vehicle), #### (versus aldoster- Ϫ6 Ϫ8 one), and §§§§ (versus spironolactone), p Ͻ 0.0001; ***, ###, and §§§, p Ͻ with 10 M finerenone alone or in combination with 10 M 0.001; **, ##, and §§, p Ͻ 0.01; *, #, and §, p Ͻ 0.05. aldosterone. Fig. 5 shows that aldosterone significantly stimulates expression of the Sgk1 gene. In contrast, finerenone alone Finerenone and Spironolactone Differentially Affect Recruit- inhibits the basal expression level of Sgk1 and is able to inhibit ment of Transcriptional Cofactors on a Mineralocorticoid the aldosterone-induced expression of this gene. Under similar Receptor Target Promoter—High throughput microscope experimental conditions, ␤-actin expression is not modified, as experiments indicated that finerenone and spironolactone have expected. different effects on MR nuclear translocation kinetics. We Finerenone Inhibits the S810L Mutant MR—The S810L recently demonstrated by using ChIP assays the aldosterone- mutant MR (MRS810L) was shown to be responsible for a severe induced recruitment of MR, SRC-1, and RNA polymerase (Pol) form of familial hypertension (40). Patients harboring this II onto the regulatory region of the SCNN1A gene that encodes mutation develop early onset hypertension before the age of 15. the ␣-subunit of the epithelial sodium channel (␣ENAC), a well Moreover, this arterial hypertension is exacerbated during known MR target gene. Moreover, we showed that spironolac- pregnancy. Functional studies revealed that progesterone acts

SEPTEMBER 4, 2015•VOLUME 290•NUMBER 36 JOURNAL OF BIOLOGICAL CHEMISTRY 21883 Blocking Mineralocorticoid Receptor with Finerenone

Sgk1 / 18S A 125 2.0 ** 100 1.5

#### 75 1.0 Aldo ####** Spiro 50 0.5 Fold induction Fold * 0.0 25

VAFA + F Transcriptional activity (%) *# ##Fine ## 0 2.0 βActin / 18S -11 -10 -9 -8 -7 Log [steroid] (M) 1.5 B 120

1.0 100

0.5 Aldo + Fine Fold induction Fold 80 $$

0.0 60 VAFA + F

FIGURE 5. Aldosterone-induced transcriptional activation of the Sgk1 Ϫ 40 gene. KC3AC1 cells were treated for 4 h with vehicle (V), 10 8 M aldosterone Ϫ Ϫ (A), 10 6 M finerenone alone (F), or finerenone in the presence of 10 8 M aldosterone (AϩF). Total RNAs were isolated and reverse transcribed. cDNAs 20

for Sgk1 and ␤-actin were quantified by real time quantitative PCR, using a Transactivation activity (%) specific primer pairs. Relative gene expression values were normalized to that of 18S rRNA and expressed as fold induction compared with vehicle condition 0 arbitrarily set at 1. The data are means Ϯ S.E. of six independent determina- -11 -10 -9 -8 -7 -6 -5 tions performed in duplicate. Statistical significance were calculated with Log [Fine] (M) Mann-Whitney nonparametric U tests with unpaired data and two-tailed calculations. **, p Ͻ 0.01 versus vehicle; ####, p Ͻ 0.0001 versus aldosterone. FIGURE 6. Finerenone inhibits the aldosterone-induced transactivation activity of MRS810L. HEK 293T cells transiently expressing MRS810L were incubated for 16 h with increasing concentrations aldosterone, finerenone, or Ϫ9 as a full MR agonist. This is also the case for the steroidal antag- spironolactone (A)or10 M aldosterone in the presence of increasing concentrations of finerenone (B). The activity of MRS810L to transactivate the lucif- onist spironolactone and eplerenone (24, 40). We thus evalu- erase gene, which is under the control of a glucocorticoid response element- ated the agonist or antagonist properties of finerenone on the containing promoter, was determined by measuring the luciferase activity, which was then normalized to the ␤-galactosidase activity and to the value S810L mutant MR. HEK 293T cells transiently expressing the Ϫ9 obtained with 10 M aldosterone. The values are means Ϯ S.E. of at least S810L mutant MR were treated with increasing concentrations three independent experiments performed in triplicate. GraphPad Prism soft- Ϫ11 Ϫ7 of aldosterone, finerenone, or spironolactone (10 to 10 M) ware was used to fit the curves and to calculate the EC50 and IC50 values. The Ϫ9 data are means Ϯ S.E. of three to four independent experiments performed in or with 10 M aldosterone plus increasing concentrations sextuplet. Statistical significance were calculated with the Mann-Whitney Ϫ9 Ϫ5 finerenone (10 to 10 M). As anticipated, aldosterone and nonparametric U tests with unpaired data and two-tailed calculations. * (spi- Ͻ spironolactone activate the MR in a dose-dependent man- ronolactone versus aldosterone) and # (finerenone versus aldosterone), p S810L 0.05; $$, p Ͻ 0.01 in comparison with aldosterone alone. Ϯ Ϫ10 Ϯ Ϫ11 ner with EC50 of 4.2 0.4 10 M and 25 210 M, respectively (Fig. 6A). In contrast, finerenone alone was not only unable to activate the MRS810L but more importantly was capa- mechanism of action and its binding mode within the MR bind- ble of inhibiting the aldosterone-induced activity of the ing pocket. The binding mode of dihydropyridine type MR Ϯ Ϫ6 MRS810L activity with an IC50 value of 16.1 3.1 10 M (Fig. 6, antagonists to MR was predicted for BR-4628 first (29). This A and B). These results clearly demonstrate that finerenone structural information was used to guide the optimization, ulti- does not display agonist activity on this mutant MR, providing mately leading to finerenone. Finerenone was docked within additional support for distinct steroidal and nonsteroidal the x-ray structure of the wild type MR LBD (Protein Data Bank ligand-MR interactions and their subsequent functional code 2ABI) (24). The binding niche of the MR LBD in its ago- consequences. nistic conformation appeared too small to accommodate the Finerenone Establishes Specific Contacts within Residues of nonsteroidal ligand. This result suggested that DHP-type MR the MR LBD—The crystal structures of the LBD of MR and antagonists, including finerenone, act as bulky antagonists.

MRS810L complexed with steroidal agonists have been recently Within the binding pocket, finerenone forms numerous van der solved, allowing their anchoring mode to be fully characterized Waals contacts with the neighboring amino acids (Fig. 7A) and (21, 24, 31, 41). The nonsteroidal nature of finerenone and its is anchored through four hydrogen bonds. The dihydronaph- peculiar behavior in ChIP experiments raised the question of its tyridine NH group is hydrogen bonded to the Asn-770 carbonyl

21884 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290•NUMBER 36•SEPTEMBER 4, 2015 Blocking Mineralocorticoid Receptor with Finerenone

B H3

Q776 A773 H5 S810 3 2 N770 1

R817

βturn

FIGURE 7. Accommodation mode of finerenone within the MR ligand-binding pocket. A, schematic representation of the contacts between finerenone and the residues lining the binding pocket of MR. The hydrogen bonds and van der Waals contacts are depicted as solid red arrows and black dashed lines, respectively. The numbers of the secondary structure elements are indicated in colored circles or ovals. The residue numbers are indicated in boxes and colored according to the secondary structure element to which they belong. B, superimposition of finerenone and spironolactone within the MR-binding pocket. Only residues that anchor the ligands are shown. Hydrogen bonds between finerenone or spironolactone, and the polar residues are depicted as dashed red lines. In the MR-spironolactone model, the protein is colored in light blue with its side chains atoms in light blue, blue, and red for the carbon, nitrogen, and oxygen atoms, respectively. Spironolactone atoms are colored in pink, red, and yellow for the carbon, oxygen, and sulfur atoms, respectively. In the MR-finerenone model, the protein is in white with its side chains atoms in white, blue, and red for the carbon, nitrogen, and oxygen atoms, respectively. Finerenone atoms are in gold, blue, and red for the carbon, nitrogen, and oxygen atoms, respectively. This figure was produced using DINO.

oxygen, the cyanide group is bonded to Gln-776 and Arg-817, Q776A, R817A, M852A, C942A, and T945A mutations have whereas the amide NH acts as H-bond donor to Ser-810 (Fig. little or no effect on the finerenone antagonistic potency, indi- 7A). Superimposition of docked finerenone and the x-ray struc- cating that these residues form moderate interactions with the

ture of spironolactone in complex with MRS810L suggests a par- ligand (Table 1). In sharp contrast, the substitution of an ala- tial overlap of the ligands (Fig. 7B). The methoxyl, cyanide, and nine for Asn-770 and Ser-810 drastically reduced by ϳ33- and phenyl groups of finerenone approximately occupy the same 9-fold, respectively, the antagonistic potency of finerenone, volume and space than the A and B rings of spironolactone (Fig. confirming that the hydrogen bonds between finerenone and 7B). In contrast, the dihydronaphtyridinyl ring adopts an Asn-770 and Ser-810 are critical for high potency and affinity orthogonal orientation to the steroidal “plane” of spironolac- (Table 1). tone. With this orientation, the ethoxyl substituent points in It has been previously reported that two residues from the the same direction than the spironolactone thioacethyl group, ligand-binding cavity strongly diverge between the oxo-steroid whereas the amide and the C2 methyl groups point in the direc- receptors. It concerns Ala-773 and Ser-810 in MR, which cor- tion of H12 helix and are in close contact with Ala-773. respond to a glycine and a methionine at the corresponding To validate such a docking mode, we analyzed the incidence positions in androgen receptor, glucocorticoid receptor, and of point mutations within the binding cavity. The residues were progesterone receptor (20, 42). Because finerenone is highly selected as being polar residues that anchor BR-4628 (28) and selective for MR and establishes a peculiar interaction with Ala- delimit the volume of the binding niche. The potency of finere- 773 and Ser-810 (a short van der Waals contact and a hydrogen none in antagonizing the agonist-induced activity of the result- bond, respectively), we wondered whether these residues are ing mutant MRs was tested. In a first set of experiments, HEK involved in the high MR selectivity. The A773G and S810M 293T cells were transiently cotransfected with or without the mutations have no effect on the aldosterone potency to activate vector allowing the expression of the wild type hMR and with a MR as illustrated by identical ED50 values (29). The A773G reporter vector in which the luciferase gene is under the control mutation has also no effect on the spironolactone antagonistic Ϫ9 of a MR-sensitive promoter and treated with vehicle or 10 M potency, whereas the S810M mutation converts this ligand as a ϫ Ϫ9 aldosterone. A 32-fold stimulation of the luciferase activity was full agonist (ED50:6 10 M) (29). In sharp contrast, both obtained in MR-expressing cells, whereas no significant stimu- A773G and S810M mutations lead to a dramatic decrease in the

lation of luciferase activity was obtained from cells devoid of antagonistic potency of finerenone (increase of the IC50 values transiently expressed MR (data not shown), indicating that the by ϳ24- and 88-fold, respectively; 1.4 Ϯ 0.3 ϫ 10Ϫ6 and 5.1 Ϯ ϫ Ϫ6 luciferase activity measured in transfected HEK 293T cells 0.8 10 M, for MRA773G and MRS810M, respectively; versus Ϯ ϫ Ϫ8 directly reflects the transactivation activity of the transiently 5.8 0.9 10 M for MRWT; Fig. 8). These results strongly expressed MR. HEK 293T cells were then transfected with the indicated that the presence of an alanine and a serine at the 773 luciferase reporter vector in combination with the expression and 810 positions favors finerenone binding to MR, whereas a vector of the wild type or mutant MRs and treated with increas- glycine and a methionine, as in the other oxo-steroid receptors, ing finerenone concentrations in the presence aldosterone. The impairs finerenone binding.

SEPTEMBER 4, 2015•VOLUME 290•NUMBER 36 JOURNAL OF BIOLOGICAL CHEMISTRY 21885 Blocking Mineralocorticoid Receptor with Finerenone

120 roidal MR antagonists by introducing various substituents at ␣ ␣ ␣ # the 7 and/or 9 -11 positions (6, 43–46). In sharp contrast, 100 finerenone is the result of an intensive chemical optimization * program on nonsteroidal dihydropyridine-based lead struc- 80 MR * S810M tures, which were identified in approximately one million # 60 MRWT screened molecules (13). The superimposition of finerenone and spironolactone indicated a global similar occupancy of the MRA773G 40 * ligand-binding pocket. However, finerenone protrudes from the binding pocket, a feature unobserved with steroidal spiro- 20 # lactones. Moreover, in sharp contrast to spirolactone type mol-

Transactivation activity (%) activity Transactivation 0 ecules, finerenone is able to establish highly stabilizing contacts with the Ala-773 and Ser-810 residues that are MR selective, -9 -8 -7 -6 -5 allowing this compound to display its remarkable MR selectiv- Log [Finerenone] (M) ity. Indeed, the A773G mutation has no effect on the MR response to spironolactone, whereas it dramatically impairs FIGURE 8. Transactivation properties of MR and MR in A773G S810M that of finerenone. Moreover, the S810M mutation converts response to finerenone. HEK 293T cells transiently expressing MRA773G or Ϫ9 MRS810M were incubated for 16 h with 10 M aldosterone in the presence of spironolactone to an agonist, whereas it almost completely increasing concentrations of finerenone. The activity of MR or MR A773G S810M abolishes MR sensitivity to finerenone. It has also to be noted to transactivate the luciferase gene, which is under the control of a GRE- containing promoter, was determined by measuring the luciferase activity, that Ser-810 is a key residue to define the agonist or antagonist which was then normalized to the ␤-galactosidase activity and to the value Ϫ behavior of the ligand. The MR Ala-773 methyl side chain is obtained with 10 9 M aldosterone alone. The values are means Ϯ S.E. of at least three independent experiments performed in triplicate. GraphPad surrounded by the phenyl moiety, the 2-methyl, and the car- Prism software was used to fit the curves and to calculate the IC50 values. boxamide groups of finerenone. This compound interacts with Statistical significance was calculated with the Mann-Whitney nonparametric Ala-773 like a socket on a joint ball. Indeed, its substitution by a U tests with unpaired data and two-tailed calculations. * (MRS810M versus Ͻ MRWT) and # (MRA773G versus MRWT), p 0.05. leucine residue has been identified in a North American family to be responsible for an early onset form of arterial hyperten- Discussion sion exacerbated during pregnancy (40). Progesterone, spironolactone, and eplerenone behave as full agonists at MR , In this study, we delineated the molecular mechanisms S810L preventing their use as therapeutic agents for patients harbor- underlying the antagonistic effects of the nonsteroidal coming this mutation (40). In sharp contrast, our results show that pound, finerenone, at the biochemical and cellular levels. Bind- finerenone does not display any agonistic activity when acting ing studies revealed that this molecule has a higher antagonistic through the MR and, more interestingly, inactivates this potency for MR than spironolactone. We provided evidence S810L mutant receptor. In comparison with the wild type MR, the that finerenone is able to impair several key steps of the MR MR ,MR , and MR mutant receptors have signaling pathway. In situ quantification of MR subcellular S810A S810M S810L localization under hormonal treatment showed that finerenone decreased sensitivities for finerenone by 9-, 88-, and 280-fold, alters nuclear translocation of the receptor more efficiently respectively. This is in line with the loss of a hydrogen bond (to than does spironolactone. The critical phosphorylation-in- Ser-810), burying the polar functionality of the carboxamide duced upshifting and the ligand-dependent down-regulation of side chain of finerenone in a more apolar environment and the MR following aldosterone treatment were both abrogated in introduction of steric hindrances (Met and Leu). the presence of finerenone. We also established that finerenone Upon aldosterone exposure, MR is shifted to the nucleus behaves as an inverse agonist ligand by demonstrating that consecutively to conformational modification (47). Our results RNA Pol II recruitment onto a regulatory sequence within the demonstrated that finerenone competes with aldosterone by promoter region of the SCNN1A gene was not only impaired by inhibiting the nuclear accumulation of GFP-hMR and also finerenone in the presence of aldosterone but also markedly impedes MR nuclear translocation slightly more efficiently diminished under basal conditions, i.e. in the absence of aldos- than spironolactone. Compromising MR nuclear import con- terone. Residues Asn-770 and Ser-810 within the LBD of MR stitutes a robust mechanism by which finerenone impairs tran- were identified as critical contacts responsible for prominent scriptional activation of MR target genes. Consistent with these potency and affinity of finerenone. observations, we and others have previously shown that Docking experiments showed that finerenone establishes other anti-mineralocorticoids like ZK91587, 18-vinylpro- contacts with the Ala-773 and Ser-810 residues from the bind- gesterone, or spironolactone decrease MR nuclear localiza- ing pocket, which are specific to MR as compared with the tion by slowing down its nuclear transfer (16, 48). Several other steroid receptors. Of particular interest, these specific antagonists for steroid receptor have been shown to act contacts are responsible for the high MR selectivity of this mol- through sequestration of the steroid receptor in the cyto- ecule because replacement of these residues by those present in plasmic compartment (34, 49–51). Our experiments indi- androgen receptor, glucocorticoid receptor, and progesterone cated that finerenone does not permanently sequestrate MR receptor (i.e. a glycine and a methionine) induces a dramatic into the cytoplasmic compartment because 24 h of antago- decrease in finerenone antagonistic potency. Many efforts have nist exposure led to comparable MR nuclear accumulation as been made over the last years to generate highly selective ste- with aldosterone treatment.

21886 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290•NUMBER 36•SEPTEMBER 4, 2015 Blocking Mineralocorticoid Receptor with Finerenone

Western blot analyses showed that aldosterone treatment, diminish the nuclear accumulation of MR, inhibits MR recruit- but not finerenone, rapidly induces an apparently higher ment onto DNA target sequences, suppresses MR recycling, molecular mass of both the endogenous and stably expressed and even inhibits the S810L mutant MR. Associated with these GFP-hMR, suggesting a change in the receptor phosphoryla- peculiar features, finerenone has remarkable pharmacological tion level (48, 52). Interestingly we also showed that this aldo- properties. sterone-induced MR phosphorylation is associated with a In vivo, finerenone treatment prevented DOCA/salt-chal- reduction in the MR protein level, as was previously described lenged rats from functional and structural heart and kidney (53). Interestingly, Tirard et al. (54) reported that a robust pro- damage at doses that did not reduce systemic blood pressure. It teasome activity is required for optimal MR transactivation. reduced cardiac hypertrophy, pro-B-type natriuretic peptide, Interestingly, finerenone likewise spironolactone totally and proteinuria more efficiently than eplerenone when com- blocked the aldosterone-induced MR phosphorylation, as well paring equinatriuretic doses (14). Moreover, finerenone dem- as its degradation, indicating that the antagonist compounds onstrated superior safety (i.e. less incidence of hyperkalemia not only regulate receptor subcellular trafficking but also and worsening of renal function) and efficacy compared with inhibit its turnover. spironolactone in patients with heart failure and CKD (57). All ChIP experiments demonstrated that MR antagonists differ- these features could be related to its peculiar ability to inhibit entially affect MR transcriptional complexes. Although spi- MR and transcriptional coregulators recruitment onto DNA ronolactone promoted MR and SRC-1 binding to the promoter target sequences. Overall, finerenone may selectively control of the SCNN1A gene, finerenone was unable to trigger such transcription of a subset of genes, conferring unique pharma- recruitment and moreover partly inhibited the basal MR and cological indication to this molecule for clinical use. The iden- SRC-1 positioning onto the promoter regulatory sequence. tification of this subset of genes will allow a deeper understand- These results indicated that spironolactone possesses at least ing of its mechanism of action. partial aldosterone-like activity, whereas finerenone acts as an inverse agonist, indicating a distinct mechanism of action for Author Contributions—M.-E. R.-O., M. L., and J. F. designed the both molecules. Three types of mechanism of antagonism have study. L. A., F. L. B., K. L., S. V., M. R. F., J. A. K., A. H., and J. F. per- been described. The first one, known as “active,” concerns mol- formed experiments. L. A., P. K., M. L., and J. F. wrote the paper. All ecules that are characterized by a bulky substituent that pro- authors analyzed the results, corrected, and approved the final ver- trudes from the binding pocket in the direction of the H12 sion of the manuscript. helix, impairing it to adopt the agonist conformation. In this conformation, the receptor is able to recruit transcriptional Acknowledgments—We thank Dr. Lars Bärfacker for providing BAY corepressors. These molecules are also known as selective ste- 94–8862 (finerenone) and Dr. Peter Schmitt and Prof. Ulrich Pleiss for providing us with [3H]BAY 94–8862 ([3H]finerenone). We also roid receptor modulators because, depending on the cellular thank Dr. Stuart Walsh for critical reading of the manuscript. context and the coactivator/corepressor ratio, they may promote the transcriptional coactivator recruitment (55). The second mechanism of antagonism is called “passive.” It concerns References small molecules such as spironolactone (22) or the progester- 1. Viengchareun, S., Le Menuet, D., Martinerie, L., Munier, M., Pascual-Le one receptor antagonist APR19 (34), which quickly dissociate Tallec, L., and Lombès, M. (2007) The mineralocorticoid receptor: in- from the receptor and are unable to maintain it in the agonist sights into its molecular and (patho)physiological biology. Nucl. Recept. conformation (the H12 helix being mobile and not stabilized in Signal. 5, e012 2. Funder, J. W. (2010) Aldosterone and mineralocorticoid receptors: past, the agonist conformation), impairing the recruitment of tran- present, and future. Endocrinology 151, 5098–5102 scriptional coregulators. However, these molecules do not 3. Tomaschitz, A., Pilz, S., Ritz, E., Obermayer-Pietsch, B., and Pieber, T. R. physically prevent the H12 helix from adopting the agonist con- (2010) Aldosterone and arterial hypertension. Nat. Rev. Endocrinol. 6, formation, suggesting that the equilibrium between mobile and 83–93 agonist conformations could be displaced in favor of the ago- 4. Rossi, G. P., Bernini, G., Desideri, G., Fabris, B., Ferri, C., Giacchetti, G., Letizia, C., Maccario, M., Mannelli, M., Matterello, M.-J., Montemurro, nistic one, allowing coactivator binding and explaining the D., Palumbo, G., Rizzoni, D., Rossi, E., Pessina, A. C., Mantero, F., and reported partial agonistic activity of spironolactone (56). This PAPY Study Participants (2006) Renal damage in primary aldosteronism: interpretation is consistent with the spironolactone-induced results of the PAPY Study. Hypertension 48, 232–238 recruitment of MR and SRC-1 onto the regulatory region of the 5. Epstein, M. (2006) Aldosterone blockade: an emerging strategy for abro- SCNN1A gene without promoting that of the RNA Pol II. The gating progressive renal disease. Am. J. Med. 119, 912–919 third mechanism of antagonism called “bulky passive” was pro- 6. Corvol, P., Claire, M., Rafestin-Oblin, M. E., Michaud, A., Roth-Meyer, C., and Menard, J. (1977) Spirolactones: clinical and pharmacologic studies. posed for BR-4628, another nonsteroidal MR antagonist Adv. Nephrol. Necker Hosp. 7, 199–215 belonging to the same dihydropyridine-derived compound 7. Pitt, B., Zannad, F., Remme, W. J., Cody, R., Castaigne, A., Perez, A., Palensky, family (29). Finerenone is characterized by a bulky substituent J., and Wittes, J. (1999) The effect of spironolactone on morbidity and mor- most probably altering MR H12 helix conformation, and like- tality in patients with severe heart failure. N. Engl. J. Med. 341, 709–717 wise, the BR-4628 compound rapidly dissociates from the 8. Corvol, P., Michaud, A., Menard, J., Freifeld, M., and Mahoudeau, J. (1975) receptor. These pharmacological properties of finerenone Antiandrogenic effect of spirolactones: mechanism of action. Endocrinol- ogy 97, 52–58 combined with specific molecular characteristics make this 9. Schane, H. P., and Potts, G. O. (1978) Oral progestational activity of spi- novel nonsteroidal MR ligand a full antagonistic compound ronolactone. J. Clin. Endocrinol. Metab. 47, 691–694 with a mixed mechanism of antagonism. Finerenone is able to 10. Brass, E. P. (1984) Effects of antihypertensive drugs on endocrine function.

SEPTEMBER 4, 2015•VOLUME 290•NUMBER 36 JOURNAL OF BIOLOGICAL CHEMISTRY 21887 Blocking Mineralocorticoid Receptor with Finerenone

Drugs 27, 447–458 28. Williams, R. G., Kandasamy, R., Nickischer, D., Trask, O. J., Jr., Laethem, 11. Juurlink, D. N., Mamdani, M. M., Lee, D. S., Kopp, A., Austin, P. C., Lau- C., Johnston, P. A., and Johnston, P. A. (2006) Generation and character- pacis, A., and Redelmeier, D. A. (2004) Rates of hyperkalemia after publi- ization of a stable MK2-EGFP cell line and subsequent development of a cation of the Randomized Aldactone Evaluation Study. N. Engl. J. Med. high-content imaging assay on the Cellomics ArrayScan platform to 351, 543–551 screen for p38 mitogen-activated protein kinase inhibitors. Methods En- 12. Kolkhof, P., and Borden, S. A. (2012) Molecular pharmacology of the min- zymol. 414, 364–389 eralocorticoid receptor: prospects for novel therapeutics. Mol. Cell Endo- 29. Fagart, J., Hillisch, A., Huyet, J., Bärfacker, L., Fay, M., Pleiss, U., Pook, E., crinol. 350, 310–317 Schäfer, S., Rafestin-Oblin, M. E., and Kolkhof, P. (2010) A new mode of 13. Bärfacker, L., Kuhl, A., Hillisch, A., Grosser, R., Figueroa-Pérez, S., Heck- mineralocorticoid receptor antagonism by a potent and selective non- roth, H., Nitsche, A., Ergüden, J.-K., Gielen-Haertwig, H., Schlemmer, steroidal molecule. J. Biol. Chem. 285, 29932–29940 K.-H., Mittendorf, J., Paulsen, H., Platzek, J., and Kolkhof, P. (2012) Dis- 30. Claire, M., Rafestin-Oblin, M. E., Michaud, A., Corvol, P., Venot, A., Roth- covery of BAY 94–8862: a nonsteroidal antagonist of the mineralocorti- Meyer, C., Boisvieux, J. F., and Mallet, A. (1978) Statistical test of models coid receptor for the treatment of cardiorenal diseases. ChemMedChem. and computerised parameter estimation for aldosterone binding in rat 7, 1385–1403 kidney. FEBS Lett. 88, 295–299 14. Kolkhof, P., Delbeck, M., Kretschmer, A., Steinke, W., Hartmann, E., Bär- 31. Li, Y., Suino, K., Daugherty, J., and Xu, H. E. (2005) Structural and bio- facker, L., Eitner, F., Albrecht-Küpper, B., and Schäfer, S. (2014) Finerenone, a chemical mechanisms for the specificity of hormone binding and coacti- novel selective nonsteroidal mineralocorticoid receptor antagonist protects vator assembly by mineralocorticoid receptor. Mol. Cell 19, 367–380 from rat cardiorenal injury. J. Cardiovasc. Pharmacol. 64, 69–78 32. Friesner, R. A., Banks, J. L., Murphy, R. B., Halgren, T. A., Klicic, J. J., 15. Pascual-Le Tallec, L., and Lombès, M. (2005) The mineralocorticoid re- Mainz, D. T., Repasky, M. P., Knoll, E. H., Shelley, M., Perry, J. K., Shaw, ceptor: a journey exploring its diversity and specificity of action. Mol. D. E., Francis, P., and Shenkin, P. S. (2004) Glide: a new approach for rapid, Endocrinol. 19, 2211–2221 accurate docking and scoring: 1. method and assessment of docking accu- 16. Lombès, M., Binart, N., Delahaye, F., Baulieu, E. E., and Rafestin-Oblin, racy. J. Med. Chem. 47, 1739–1749 M. E. (1994) Differential intracellular localization of human mineralocor- 33. Jorgensen, W. L., Maxwell, D. S., and Tirado-Rives, J. (1996) Development ticosteroid receptor on binding of agonists and antagonists. Biochem. J. and testing of the OPLS all-atom force field on conformational energetics 302, 191–197 and properties of organic liquids. J. Am. Chem. Soc. 118, 11225–11236 17. Grossmann, C., Ruhs, S., Langenbruch, L., Mildenberger, S., Strätz, N., 34. Khan, J. A., Tikad, A., Fay, M., Hamze, A., Fagart, J., Chabbert-Buffet, N., Schumann, K., and Gekle, M. (2012) Nuclear shuttling precedes dimeriza- Meduri, G., Amazit, L., Brion, J. D., Alami, M., Lombès, M., Loosfelt, H., tion in mineralocorticoid receptor signaling. Chem. Biol. 19, 742–751 and Rafestin-Oblin, M. E. (2013) A new strategy for selective targeting of 18. Tallec, L. P., Kirsh, O., Lecomte, M. C., Viengchareun, S., Zennaro, M. C., progesterone receptor with passive antagonists. Mol. Endocrinol. 27, Dejean, A., and Lombès, M. (2003) Protein inhibitor of activated signal 909–924 transducer and activator of transcription 1 interacts with the N-terminal 35. Shen, T., Horwitz, K. B., and Lange, C. A. (2001) Transcriptional hyperac- domain of mineralocorticoid receptor and represses its transcriptional tivity of human progesterone receptors is coupled to their ligand-depen- activity: implication of small ubiquitin-related modifier 1 modification. dent down-regulation by mitogen-activated protein kinase-dependent Mol. Endocrinol. 17, 2529–2542 phosphorylation of serine 294. Mol. Cell Biol. 21, 6122–6131 19. Coustal, S., Fagart, J., Davioud, E., and Marquet, A. (1995) Synthesis of 36. Lonard, D. M., Nawaz, Z., Smith, C. L., and O’Malley, B. W. (2000) The 26S potential cytochrome P45011␤-gererated intermediates. Tetrahedron 51, proteasome is required for estrogen receptor-alpha and coactivator turn- 3559–3570 over and for efficient estrogen receptor-alpha transactivation. Mol. Cell 5, 20. Auzou, G., Fagart, J., Souque, A., Hellal-Lévy, C., Wurtz, J. M., Moras, D., 939–948 and Rafestin-Oblin, M. E. (2000) A single amino acid mutation of Ala-773 37. Amazit, L., Roseau, A., Khan, J. A., Chauchereau, A., Tyagi, R. K., Loosfelt, in the mineralocorticoid receptor confers agonist properties to 11␤-sub- H., Leclerc, P., Lombès, M., and Guiochon-Mantel, A. (2011) Ligand-de- stituted spirolactones. Mol. Pharmacol. 58, 684–691 pendent degradation of SRC-1 is pivotal for progesterone receptor tran- 21. Fagart, J., Huyet, J., Pinon, G. M., Rochel, M., Mayer, C., and Rafestin- scriptional activity. Mol. Endocrinol. 25, 394–408 Oblin, M. E. (2005) Crystal structure of a mutant mineralocorticoid recep- 38. Le Billan, F., Khan, J. A., Lamribet, K., Viengchareun, S., Bouligand, J., tor responsible for hypertension. Nat. Struct. Mol. Biol. 12, 554–555 Fagart, J., and Lombes, M. (2015) Cistrome of the aldosterone-activated 22. Fagart, J., Wurtz, J. M., Souque, A., Hellal-Levy, C., Moras, D., and Rafes- mineralocorticoid receptor in human renal cells. FASEB J. 10.1096/ tin-Oblin, M. E. (1998) Antagonism in the human mineralocorticoid re- fj.15-274266 ceptor. EMBO J. 17, 3317–3325 39. Robert-Nicoud, M., Flahaut, M., Elalouf, J. M., Nicod, M., Salinas, M., 23. Fagart, J., Seguin, C., Pinon, G. M., and Rafestin-Oblin, M. E. (2005) The Bens, M., Doucet, A., Wincker, P., Artiguenave, F., Horisberger, J. D., Met852 residue is a key organizer of the ligand-binding cavity of the hu- Vandewalle, A., Rossier, B. C., and Firsov, D. (2001) Transcriptome of a man mineralocorticoid receptor. Mol. Pharmacol. 67, 1714–1722 mouse kidney cortical collecting duct cell line: effects of aldosterone and 24. Huyet, J., Pinon, G. M., Fay, M. R., Fagart, J., and Rafestin-Oblin, M. E. vasopressin. Proc. Natl. Acad. Sci. U.S.A. 98, 2712–2716 (2007) Structural basis of spirolactone recognition by the mineralocorti- 40. Geller, D. S., Farhi, A., Pinkerton, N., Fradley, M., Moritz, M., Spitzer, A., coid receptor. Mol. Pharmacol. 72, 563–571 Meinke, G., Tsai, F. T., Sigler, P. B., and Lifton, R. P. (2000) Activating 25. Gouilleux, F., Sola, B., Couette, B., and Richard-Foy, H. (1991) Coopera- mineralocorticoid receptor mutation in hypertension exacerbated by tion between structural elements in hormono-regulated transcription pregnancy. Science 289, 119–123 from the mouse mammary tumor virus promoter. Nucleic Acids Res. 19, 41. Bledsoe, R. K., Madauss, K. P., Holt, J. A., Apolito, C. J., Lambert, M. H., 1563–1569 Pearce, K. H., Stanley, T. B., Stewart, E. L., Trump, R. P., Willson, T. M., 26. Deppe, C. E., Heering, P. J., Viengchareun, S., Grabensee, B., Farman, N., and Williams, S. P. (2005) A ligand-mediated hydrogen bond network and Lombès, M. (2002) Cyclosporine a and FK506 inhibit transcriptional required for the activation of the mineralocorticoid receptor. J. Biol. activity of the human mineralocorticoid receptor: a cell-based model to Chem. 280, 31283–31293 investigate partial aldosterone resistance in kidney transplantation. Endo- 42. Zhang, J., and Geller, D. S. (2008) Helix 3-helix 5 interactions in steroid crinology 143, 1932–1941 hormone receptor function. J. Steroid Biochem. Mol. Biol. 109, 279–285 27. Viengchareun, S., Kamenicky, P., Teixeira, M., Butlen, D., Meduri, G., 43. Rossier, B. C., Claire, M., Rafestin-Oblin, M. E., Geering, K., Gäggeler, Blanchard-Gutton, N., Kurschat, C., Lanel, A., Martinerie, L., Sztal-Ma- H. P., and Corvol, P. (1983) Binding and antimineralocorticoid activities of zer, S., Blot-Chabaud, M., Ferrary, E., Cherradi, N., and Lombès, M. (2009) spirolactones in toad bladder. Am. J. Physiol. 244, C24–C31 Osmotic stress regulates mineralocorticoid receptor expression in a novel 44. Casals-Stenzel, J., Buse, M., Wambach, G., and Losert, W. (1984) The aldosterone-sensitive cortical collecting duct cell line. Mol. Endocrinol. renal action of spirorenone and other 6␤,7␤;15␤,16␤-dimethylene-17- 23, 1948–1962 spirolactones, a new type of steroidal aldosterone antagonists. Arzneimit-

21888 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290•NUMBER 36•SEPTEMBER 4, 2015 Blocking Mineralocorticoid Receptor with Finerenone

telforschung 34, 241–246 52. Faresse, N., Vitagliano, J.-J., and Staub, O. (2012) Differential ubiquityla- 45. Chinn, L. J., Salamon, K. W., and Desai, B. N. (1981) A structure-activity tion of the mineralocorticoid receptor is regulated by phosphorylation. relationship study of spirolactones: contribution of the cyclopropane ring FASEB J. 26, 4373–4382 to antimineralocorticoid activity. J. Med. Chem. 24, 1103–1107 53. Yokota, K., Shibata, H., Kobayashi, S., Suda, N., Murai, A., Kurihara, I., 46. de Gasparo, M., Joss, U., Ramjoué, H. P., Whitebread, S. E., Haenni, H., Saito, I., and Saruta, T. (2004) Proteasome-mediated mineralocorticoid Schenkel, L., Kraehenbuehl, C., Biollaz, M., Grob, J., and Schmidlin, J. receptor degradation attenuates transcriptional response to aldosterone. (1987) Three new epoxy-spirolactone derivatives: characterization in vivo Endocr. Res. 30, 611–616 and in vitro. J. Pharmacol. Exp. Ther. 240, 650–656 54. Tirard, M., Almeida, O. F., Hutzler, P., Melchior, F., and Michaelidis, T. M. 47. Gekle, M., Bretschneider, M., Meinel, S., Ruhs, S., and Grossmann, C. (2007) Sumoylation and proteasomal activity determine the transactiva- 81, (2014) Rapid mineralocorticoid receptor trafficking. Steroids 103–108 tion properties of the mineralocorticoid receptor. Mol. Cell Endocrinol. 48. Fejes-Tóth, G., Pearce, D., and Náray-Fejes-Tóth, A. (1998) Subcellular 268, 20–29 localization of mineralocorticoid receptors in living cells: effects of recep- 55. Liu, Z., Auboeuf, D., Wong, J., Chen, J. D., Tsai, S. Y., Tsai, M.-J., and tor agonists and antagonists. Proc. Natl. Acad. Sci. U.S.A. 95, 2973–2978 O’Malley, B. W. (2002) Coactivator/corepressor ratios modulate PR-me- 49. Tyagi, R. K., Lavrovsky, Y., Ahn, S. C., Song, C. S., Chatterjee, B., and Roy, diated transcription by the selective receptor modulator RU486. Proc. A. K. (2000) Dynamics of intracellular movement and nucleocytoplasmic recycling of the ligand-activated androgen receptor in living cells. Mol. Natl. Acad. Sci. U.S.A. 99, 7940–7944 Endocrinol. 14, 1162–1174 56. Cargnelli, G., Trevisi, L., Debetto, P., Luciani, S., and Bova, S. (2001) Effects 50. Dauvois, S., White, R., and Parker, M. G. (1993) The antiestrogen ICI of canrenone on aorta and right ventricle of the rat. J. Cardiovasc. Phar- 182780 disrupts estrogen receptor nucleocytoplasmic shuttling. J. Cell Sci. macol. 37, 540–547 106, 1377–1388 57. Pitt, B., Kober, L., Ponikowski, P., Gheorghiade, M., Filippatos, G., Krum, 51. Devin-Leclerc, J., Meng, X., Delahaye, F., Leclerc, P., Baulieu, E. E., and H., Nowack, C., Kolkhof, P., Kim, S.-Y., and Zannad, F. (2013) Safety and Catelli, M. G. (1998) Interaction and dissociation by ligands of estrogen tolerability of the novel nonsteroidal mineralocorticoid receptor antago- receptor and Hsp90: the antiestrogen RU 58668 induces a protein nist BAY 94–8862 in patients with chronic heart failure and mild or synthesis-dependent clustering of the receptor in the cytoplasm. Mol. En- moderate chronic kidney disease: a randomized, double-blind trial. Eur. docrinol. 12, 842–854 Heart J. 34, 2453–2463

SEPTEMBER 4, 2015•VOLUME 290•NUMBER 36 JOURNAL OF BIOLOGICAL CHEMISTRY 21889 Résultats : Seconde Partie

B. Données supplémentaires et autres éléments de discussion

Dans cette seconde partie de ma thèse, nous avons explicité le mécanisme moléculaire par lequel la finérénone inhibe la signalisation du complexe aldostérone-MR. D’abord, en étudiant in situ par microscopie haut-débit automatisée la localisation intracellulaire du MR après exposition à différents ligands, nous avons montré que, si l’aldostérone induit bien le transfert nucléaire du MR, la finérénone maintient le MR dans le compartiment cytoplasmique plus efficacement et durablement que la spironolactone. De plus, l’aldostérone induit la phosphorylation et la dégradation au long-terme (24 h) du MR, ce qui est efficacement inhibé par la finérénone et la spironolactone. Ensuite, la finérénone inhibe le recrutement induit en 1 h par le complexe aldostérone-MR de SRC-1 et de l’ARN Pol II sur le promoteur de SCNN1A, mais de façon très intéressante, réduit aussi le niveau basal (i.e. sans aldostérone) du recrutement du MR et de SRC- 1 sur ce même promoteur, permettant de proposer que la finérénone soit considérée comme un agoniste inverse. Enfin, nous avons établi, par modélisation moléculaire en utilisant les données cristallographiques du LBD du MR que notre laboratoire avait récemment publié, que les acides aminés Ala773 et Ser810 du LBD du MR font des contacts avec la finérénone qui sont responsables de son affinité et de sa grande sélectivité sur le MR en comparaison des autres récepteurs des oxo-stéroïdes. Si cette étude a permis de préciser le mode d’action de la finérénone sur la signalisation minéralocorticoïde, de nombreuses questions restent posées et certains des aspects non résolus permettent d'envisager des perspectives.

Quels effets ont les antagonistes sur le recrutement par le MR des corégulateurs transcriptionnels ?

Dans la présente étude, les expériences de ChIP ont été réalisées après 1 h d’exposition aux ligands. Elles nous ont permis de montrer que la finérénone inhibe le recrutement concomitant du MR, de SRC-1 et de l’ARN Pol II induit par l’aldostérone sur le promoteur de SCNN1A, mais aussi que cette molécule réduit le niveau basal de recrutement du MR et de SRC-1 sur ce locus. Dans l’introduction de ce manuscrit, nous avons vu que le positionnement et le recrutement des récepteurs stéroïdiens sur leurs cibles génomiques ainsi que la génération des complexes d’initiation de la transcription opérationnels sont des phénomènes dynamiques (Métivier et al., 2003). Dans la 3ème partie des résultats, nous verrons que le recrutement du complexe aldostérone-MR sur le promoteur de PER1 est cyclique et dynamique. Il serait donc tout à fait pertinent d’étudier l’effet de la finérénone sur ce phénomène dynamique et cela en termes de délai

105

Résultats : Seconde Partie

et de durée d'action. Il serait par ailleurs extrêmement intéressant de préciser comment cet antagoniste agit sur le recrutement des partenaires transcriptionnels du MR, notamment si cette molécule favorise le recrutement de corépresseurs.

La purification par immunoprécipitation suivie par spectrométrie de masse (APMS pour Affinity Purification Mass Spectrometry) est une approche expérimentale particulièrement adaptée à l’identification des corégulateurs transcriptionnels d’un facteur de transcription (Li et al., 2015). Le principe est d’abord d’immunopurifier avec un anticorps spécifique une protéine et l’ensemble des partenaires avec lesquels elle interagit, aussi appelé interactome. Puis, les complexes protéiques sont partiellement digérés, et la séquence des fragments peptidiques obtenus est déterminée par spectrométrie de masse par mesure du rapport masse/charge de chacun de leurs fragments. L’équipe du Pr Weisz a étudié l’interactome du ERα dans les cellules du cancer du sein MCF-7 exposées à un agoniste (E2), un modulateur sélectif (Tamoxifène) ou un antagoniste pur du ERα (Fulvestrant). De façon intéressante, les interactomes formés par les trois complexes ERα-ligand sont tout à fait différents, avec des ensembles de protéines très peu chevauchants (7 partenaires communs entre E2 et Tamoxifène, 6 entre E2 et Fulvestrant) (Cirillo et al., 2013). En étudiant les interactions que chaque ligand forme avec les résidus de la cavité du LBD de ERα, les auteurs ont émis l’hypothèse que la conformation qu’adopte le récepteur en fonction du ligand est le facteur clé pour le choix de l’interactome ensuite recruté. En utilisant les cellules KC3AC1, l’anticorps anti-MR 39N et l’assistance d’une plateforme de spectrométrie de masse, nous avons tenté d’identifier l’interactome du MR en présence d’aldostérone, de spironolactone et/ou de finérénone. Comme nous l’avons souligné dans la discussion de l’Article 1, les limites que nous avons rencontrées sont le faible niveau d’expression du MR endogène dans les cellules KC3AC1, ainsi que la rupture de stock de l’anticorps 39N qui n’est actuellement pas palliée par le développement d’un autre anticorps reconnaissant le MR murin. Nous pouvons néanmoins faire l’hypothèse que la finérénone, en tant qu’antagoniste pur, et à l’inverse de l’aldostérone, entraverait tout recrutement d’un interactome, et/ou qu’il modifierait la nature des corégulateurs interactants afin de contrecarrer les effets délétères du MR dans les tissus cardiovasculaires et rénaux. En effet, les antagonistes du ERα (les modulateurs sélectifs et les antagonistes purs) sont considérés comme des antagonistes "bulky actif" qui stabilisent le LBD du ERα dans une conformation distincte de celle des agonistes, et qui permet le recrutement des corépresseurs transcriptionnels. A l'inverse, la finérénone tout comme le BR-4628 est un antagoniste bulky mais passif, qui ne stabilise le LBD ni dans une conformation active ni dans une conformation inactive empêchant le recrutement de corégulateurs transcriptionnels.

106

Résultats : Seconde Partie

Comment la finérénone altère le recrutement du MR sur ses cibles génomiques in vitro et in vivo ?

Dans la première partie des résultats, nous avons caractérisé le cistrome du MR activé par l’aldostérone dans les cellules HK-GFP-hMR. Dans cette seconde partie, nous avons montré dans ces mêmes cellules que la finérénone inhibe à la fois le recrutement aldostérone-induit du MR mais aussi son recrutement basal sur le promoteur de SCNN1A. L’étude de l’effet d’un antagoniste sur le cistrome d’un récepteur nucléaire a déjà été réalisée, en particulier pour le AR par Zhu et coll. (Zhu et al., 2012). Réalisée sur un modèle cellulaire de cancer de la prostate, leur étude a notamment montré que le PF-848, un antagoniste du AR, diminue de façon dose-dépendante le pourcentage de sites de liaison du complexe agoniste-AR (de 10%, 70% et 90% pour 0,1, 1 et 10 µM respectivement). De façon intéressante, les cibles sur lesquelles le AR continue de se fixer en présence de PF-848 sont celles où le AR se lie avec la plus grande abondance en présence d’agoniste. Pour aller plus loin dans la compréhension des effets pharmacologiques de la finérénone, il serait tout à fait intéressant d’identifier le cistrome du complexe finérénone-MR, et de le comparer à celui du complexe aldostérone-MR. Pour cela, l’approche de ChIP-Seq du MR pourrait être appliquée selon le protocole utilisé dans la première partie des résultats (Le Billan et al., 2015). L’identification des cibles différemment reconnues et régulées en présence de finérénone pourrait notamment faciliter la compréhension des effets bénéfiques dans le traitement de l’insuffisance cardiaque.

Nous envisagions de transposer in vivo l’approche de ChIP-Seq, sur le modèle de souris surrénalectomisées. Plusieurs objectifs étaient visés par ce projet. 1) Identifier les premiers cistromes du MR in vivo sur les différents tissus cibles de l’aldostérone (dont le cœur et le rein) des souris sauvages. Cette approche jamais encore réalisée dans la littérature constituerait une base solide pour les études de physiopathologie du MR entreprises chez la souris. 2) Identifier les effets des antiminéralocorticoïdes sur le recrutement du MR dans chacun des tissus qui l’expriment. La comparaison des effets entre la spironolactone, agoniste partiel, et la finérénone, antagoniste pur du MR, serait tout à fait intéressante. Les souris surrénalectomisées pourraient être traitées pendant 4 h par l’aldostérone seule (1 mg/kg) ou en association avec la finérénone (10 mg/kg), ou la spironolactone (10 mg/kg). Les tissus cibles de l’aldostérone seraient prélevés et techniqués pour des expériences de ChIP-Seq. Nous avons mis au point, non sans difficulté, les différentes étapes de préparation de deux tissus (cœur et rein) de souris sauvages contrôles (fragmentation tissulaire, fixation, lyse cellulaire), ainsi que les étapes critiques du ChIP (fragmentation de la chromatine). Nous avons testé l’immunoprécipitation de la chromatine par le

107

Résultats : Seconde Partie

MR avec l’anticorps 39N, en comparaison à un anticorps contrôle négatif (IgG de Lapin), puis mesuré par qPCR la quantité relative du promoteur de Scnn1a immunoprécipité (Figure 20). Même si un recrutement hormono-induit a pu être mis en évidence, les premiers essais ont montré que seule une très faible quantité d’ADN génomique avait été immunoprécipitée dans ces conditions expérimentales. Ce résultat est probablement en rapport avec le très faible niveau d’expression du MR dans les tissus testés. L’utilisation de souris surrénalectomisées traitées ou non par l’aldostérone permettrait d’optimiser le niveau du signal aldostérone-MR par rapport à une condition non traitée et de pouvoir ainsi identifier des cibles génomiques du MR. Dans la mesure où les concentrations circulantes d’aldostérone et de cortisol sont alors quasiment nulles dans les modèles de souris surrénalectomisées, le traitement par l’aldostérone devrait augmenter significativement le recrutement du MR et faciliter l’identification de cibles pertinentes. Ce projet, comme pour le projet de ChIP-Seq sur les cellules rénales KC3AC1 de souris, a été interrompu faute d’anticorps anti-MR murin efficace, le stock initial d’anticorps anti-MR 39N étant épuisé.

Figure 20 : Recrutement du MR sur le promoteur du gène Scnn1a dans le rein et du gène Sgk1 dans le cœur de souris. Les souris ont été sacrifiées et leur reins et leur cœur ont été prélevés, lavés, découpés finement (morceaux <1 mm de diamètre) et fixés au paraformaldéhyde. Après lyse cellulaire et sonication, les fragments de chromatine ont été immunoprécipités avec l’anticorps 39N (MR), ou avec un IgG contrôle de Lapin (IgG). Enfin, l’ADN a été purifié et utilisé au cours de PCR quantitatives réalisées avec des amorces entourant le MRE présent dans le promoteur des gènes Scnn1a et Sgk1. Les résultats sont exprimés en %input et représentent la moyenne ± écart-type de trois expériences indépendantes mesurées en triplicats. * : P<0,05 vs V.

108

Résultats : Seconde Partie

Qu’apporte la finérénone dans le traitement des maladies cardiorénales ?

Les études pharmacologiques, précliniques et cliniques sur la finérénone ont avancé en parallèle de notre étude. La cartographie de la répartition de la finérénone marquée au carbone 14 ([14C]-finérénone) a été réalisée par autoradiographie de l’animal entier, chez le Rat, 1 h après une administration orale (Kolkhof et al., 2014), et comparée à celle de la spironolactone tritiée et de la [14C]-éplérénone. La [3H]-spironolactone et la [14C]-éplérénone sont associées à un signal au moins trois fois plus important dans le rein que dans le cœur, ce qui signifie qu’elles ont tendance à s’accumuler dans le rein. Le signal cardiaque de la [3H]-spironolactone est même inférieur à la limite de la détection. Par contre, la [14C]-finérénone est répartie de façon équivalente entre le rein et le cœur. Cela peut en partie expliquer que la finérénone a un tropisme particulier pour le système cardiorénal à l’origine de ses effets bénéfiques dans ces tissus. Cette observation peut aussi expliquer le faible risque d’hyperkaliémie portée par cet antagoniste, avec des conséquences minimes sur l’homéostasie hydro-électrolytique.

Il a été montré sur un modèle murin de rétrécissement aortique que la finérénone, en comparaison au véhicule et à l’éplérénone, entraînait une réduction de l’hypertrophie ventriculaire gauche (Grune et al., 2016). Ces effets sont associés à une modification de l’expression de gènes cardiaques, en particulier Bnp (Brain Natriuretic Peptide) et Tnnt2 (Troponin T type 2), comme l’indique l’analyse transcriptomique. Une seconde étude préclinique s’est intéressée au rôle du MR dans la lésion rénale aiguë (AKI pour Acute Kidney Injury) induite par l’ischémie/reperfusion (I/R) chez la souris, sauvage ou KO-MR CMLV (décrites dans l’introduction (Gueret et al., 2016)), et chez le porc (Barrera-Chimal et al., 2017). Dans le modèle murin, l’I/R entraîne une surproduction d’espèces réactives de l’oxygène (ROS) dans les cellules musculaires lisses vasculaires (CMLV), ainsi qu’une augmentation de l’expression rénale de Rac1-GTP. Rac1 est une sous-unité de la NADPH oxydase, une enzyme qui produit des ROS et qui est impliquée dans le développement des lésions rénales aiguës. La finérénone, ou l’absence de MR dans les CMLV, restreignent l’AKI induite par I/R en bloquant la signalisation de Rac1 activée par le complexe aldostérone-MR. Dans le modèle porcin, modèle physiologiquement proche de l’Homme, la finérénone prévient aussi les lésions rénales induites par I/R. Ainsi, l’ensemble des études précliniques montrent que des doses faibles de finérénone sont aussi efficaces que la spironolactone et l’éplérénone dans les pathologies cardiorénales.

L’innocuité, la tolérance et la pharmacocinétique de la finérénone ont été testés lors de trois essais cliniques, à la fois sur des volontaires sains (phase I) et chez des patients atteints d’insuffisance rénale modérée ou sévère (phase IIa) mais aussi dans la néphropathie diabétique.

109

Résultats : Seconde Partie

Dans le premier essai, l’administration par voie orale de doses croissantes de finérénone (de 1 à 40 mg) chez les volontaires sains conduit à son absorption quasi totale en moins d’une heure, sa demi-vie maximale étant estimée à 3 h (Lentini et al., 2016). Dans un second essai, les études pharmacocinétiques chez le volontaire sain ont permis de montrer l’équivalence des voies d’administration orale ou IV (Lentini et al., 2016). Enfin, et surtout, dans ces deux études, la finérénone n’entraîne pas de modifications des paramètres cliniques (pression artérielle, rythme cardiaque, etc…) ni d’effets indésirables immédiats. Le troisième essai compare les paramètres pharmacocinétiques et la tolérance de la finérénone chez les patients insuffisants rénaux de degré variable, présentant ou non un diabète (Heinig et al., 2016). Trois métabolites hépatiques à élimination rénale de la finérénone ont été identifiés. En cas d’insuffisance rénale, l’élimination rénale de la finérénone est ralentie, augmentant sa biodisponibilité de 50%, ce qui doit être pris en compte lors de prescription chez de tels patients.

Deux essais cliniques avec la finérénone (ARTS-DN (Diabetic Nephropathy) et ARTS-HF Japan) ont été menées selon la même approche que l’étude ARTS-HF présentée en introduction (Pitt et al., 2015 ; Filippatos et al., 2016). L’objectif de l’étude multicentrique ARTS-DN réunissant 821 patients était de préciser l’indication de la finérénone chez les diabétiques de type 2 (T2DM) avec néphropathie diabétique (Ruilope et al., 2014). Des doses croissantes de finérénone (de 1,5 à 20 mg) ont été administrés pendant 3 mois et le rapport albumine/créatinine urinaire (UACR), reflétant la sévérité de la néphropathie diabétique, a été évalué (Bakris et al., 2015). La finérénone améliore de façon significative et dose-dépendante la progression de la néphropathie diabétique. L’étude ARTS-HF Japan compare les effets de la finérénone vs l’éplérénone chez les insuffisants cardiaques sévères, les diabétiques avec ou sans néphropathie (Sato et al., 2016). La finérénone a été bien tolérée et réduit d’au moins 30% la concentration de NT-proBNP, marqueur de l’insuffisance cardiaque, sans effet secondaire, en particulier, pas d’hyperkaliémie. L’ensemble de ces résultats ont permis d’envisager des études de phase III.

Comment améliorer encore l’antagonisme sélectif et thérapeutique du MR ?

Une quatrième génération d’antagonistes du MR est déjà envisagée. Il pourrait s’agir du développement de modulateurs sélectifs tissu-spécifiques du MR. Ces modulateurs seraient des molécules qui agiraient sélectivement selon le contexte cellulaire comme agoniste ou comme antagoniste. Un exemple bien connu est le tamoxifène, qui est un antagoniste sélectif du ERα dans les cellules mammaires cancéreuses, mais un agoniste dans le tissu osseux et l’endomètre.

110

Résultats : Seconde Partie

Cette spécificité tissulaire pourrait être expliquée par les partenaires moléculaires du ER qui diffèrent selon les cellules (Cirillo et al., 2013). Pour le MR, le modulateur idéal inhiberait les dysfonctionnements vasculaires, tout en autorisant l’effet kaliurétique du MR (Funder, 2009) ou l’effet neuroprotecteur du MR sur les neurones de l’hippocampe (Munier et al., 2012; Gomez- Sanchez, 2016). Les modulateurs sélectifs des récepteurs des hormones stéroïdes sont, comme nous l'avons vu plus haut, des composés stabilisant le LBD dans une conformation inactive capable de recruter des corépresseurs transcriptionnels mais qui, selon le contexte cellulaire et notamment le rapport entre coactivateurs et corépresseurs, autorisent le recrutement de coactivateurs. A ce jour, il n'existe pas de composé capable d'inactiver le MR selon un mécanisme comparable à celui décrit pour le tamoxifène, le fulvestrant ou le RU486. Pourtant, d'autres molécules non stéroïdiennes, autres que la finérénone, sont actuellement en cours d’évaluation clinique. Leur structure chimique n'a pas été dévoilée. La caractérisation de leur mécanisme d'action permettrait de savoir si ces molécules pourraient correspondre à ce type de molécule.

111

3ème Partie :

Etude de la contribution relative des récepteurs minéralocorticoïde et glucocorticoïde dans la signalisation des corticostéroïdes dans des cellules n’exprimant pas la 11βHSD2

Résultats : Troisième Partie

A. Justification du projet

1. Contexte de l’étude

Comme nous l’avons vu dans l’introduction générale, le MR relaye majoritairement les effets physiopathologiques de l’aldostérone. Les dysfonctionnements liés à l’hyperaldostéronisme sont efficacement améliorés par des antagonistes sélectifs du MR (Funder, 2015; Bramlage et al., 2016). Pourtant, le MR est aussi activé par les glucocorticoïdes (le cortisol chez l’Homme), ces hormones stéroïdiennes dites « du stress » qui agissent principalement en se liant au GR (Oakley and Cidlowski, 2013). Le MR a la même affinité pour l’aldostérone et pour le cortisol (Gomez- Sanchez and Gomez-Sanchez, 2014). Il a néanmoins été montré que le MR a une sensibilité intrinsèque 500 fois supérieure pour l’aldostérone (ED50 de 0,01 nM) en comparaison au cortisol

(ED50 de 5 nM) (Lombes et al., 1994). Cette discrimination serait, au moins en partie, dictée par 4 acides aminés de la cavité de liaison du MR (au sein de la séquence 804-874) qui diffèrent dans le GR (Rogerson et al., 2007; Mani et al., 2016). Pourtant, le cortisol circulant dans le sang est à une concentration moyenne de 400 nM, soit un excès de 1000 fois par rapport à l’aldostérone (0,35 nM) (Rafestin-Oblin et al., 2003; Travers et al., 2017) posant la question de l'accessibilité du MR à l'aldostérone. Ainsi, alors même que le MR serait plus sensible à l'aldostérone qu'au cortisol, les différences de concentrations plasmatiques se traduiraient par une occupation quasi totale du MR par le cortisol. Il a été montré qu’une enzyme, la 11βHSD2, exprimée dans les tissus épithéliaux de façon concomitante avec le MR, selon un même schéma développemental (Martinerie et al., 2012), métabolise le cortisol en cortisone, qui est un composé inactif sur le MR, favorisant ainsi un accès privilégié de l’aldostérone au MR. Pourtant, Funder et ses collaborateurs ont proposé que la 11βHSD2 ne métabolisait que 90% le cortisol, ce qui n'exclurait pas totalement l'action des glucocorticoïdes sur le MR (Funder, 2017a). Pourtant, ce pourcentage de 90% n’a pas été expérimentalement validé et invite donc à rester prudent quuant à l’interprétation qu’il faut en faire. La situation est beaucoup plus extrême dans les tissus non-épithéliaux, comme le cœur, les adipocytes ou les neurones, puisqu'ils n'expriment pas la 11βHSD2, et où il existerait donc une dualité d'action entre l'aldostérone et le cortisol avec, en corollaire, une coexpression des deux récepteurs MR et GR.

En parallèle de cette dualité hormonale, le MR est aussi confronté à la présence ubiquitaire du GR (Kino, 2000), phylogénétiquement et fonctionnellement le récepteur stéroïdien le plus proche du MR. Même si le GR a des affinités comparables pour l'aldostérone et pour les glucocorticoïdes, comme l’ont montré les expériences de liaison de ligand tritié, le GR est très peu

112

Résultats : Troisième Partie

sensible à l'action de l'aldostérone sur des tests de transactivation de gène rapporteur (Hellal- Levy et al., 1999). Par ailleurs, le MR et le GR partagent 94% d’identité de séquence dans le DBD, reconnaissant sur l'ADN des motifs GRE identiques ou quasi-identiques (Hudson et al., 2014). Se pose ainsi la question de la contribution respective de l'aldostérone, du cortisol et des deux récepteurs dans la signalisation minéralocorticoïde. Des modèles d'invalidation totale du MR ou du GR ont montré qu'aucun des deux récepteurs ne peut compenser l'absence de l'autre, confirmant l'implication de chacun dans la régulation de fonctions biologiques distinctes (Berger et al., 1998; Cole et al., 1995).

De façon intéressante, les études de van Weert et coll. dans l'hippocampe montrent, qu'après traitement par la corticostérone, les deux récepteurs ont une centaine de cibles communes identifiées en ChIP-Seq, mais ont surtout plus de mille cibles spécifiques chacun (van Weert et al., 2017). Un des mécanismes permettant au MR de discriminer des sites de liaison spécifiques et préférentiels est la présence de motifs associés aux GRE, comme le motif Atoh1 au niveau de l’hippocampe (van Weert et al., 2017). Il a été montré que certains corégulateurs interagissaient sélectivement avec le MR (comme PIAS3 (Tirard et al., 2004)), ou avec le GR (comme MDFIC (Oakley et al., 2017)), de façon tissu-spécifique. En fonction des tissus, trois cas de figures sont rencontrés : 1) le MR et la 11βHSD2 sont exprimés, alors l’aldostérone a une fonction définie (tissus épithéliaux) ; 2) le MR est exprimé, mais pas la 11βHSD2 et l’aldostérone est présente, alors le MR est peut être activé par deux types d’hormones et entre en concurrence avec le GR sur certaines cibles génomiques (e.g. le cœur) ; 3) le MR est exprimé, mais pas la 11βHSD2 et l’aldostérone est absente, alors le cortisol, ou les glucocorticoïdes plus généralement, agit via deux types de récepteurs (e.g. l’hippocampe).

2. Hypothèses de travail

Nous nous sommes intéressés à cette dualité de voie de signalisation très importante en physiopathologie. Dans l’hippocampe, nous venons de le voir, le MR et le GR activés par la corticostérone possèdent une centaine de cibles génomiques communes (van Weert et al., 2017). Nous-mêmes, en comparant le cistrome dans une lignée rénale humaine dans l’Article 1 (Le Billan et al., 2015) et les cistromes du GR disponibles en ligne (Gerstein et al., 2012), nous avons remarqué que les 15 MBS que nous avions caractérisés étaient communs aux deux récepteurs. Il est donc tout à fait envisageable que le MR et le GR régulent simultanément des cibles génomiques communes en fonction des contextes cellulaires et moléculaires (Ou et al., 2001). Notre première hypothèse est que, pour un gène commun donné, les transrégulations par le MR

113

Résultats : Troisième Partie

et le GR puissent coexister. L’importance des phénomènes dynamiques dans la transrégulation a été mise en évidence à partir du ERα. En présence d'œstradiol, le ERα se lie à la chromatine de façon dynamique et cyclique (Métivier et al., 2003). Dans l’Article 2, nous avons vu que la nature du ligand (agoniste, antagoniste partiel/pur) influait sur le recrutement du MR sur des cibles génomiques (Amazit et al., 2015). Ainsi, notre seconde hypothèse est que le MR et le GR seraient recrutés de façon dynamique et séquentielle, mais selon des rythmes différents en fonction du récepteur et de la nature du ligand. Enfin, plusieurs études ont montré que le MR et le GR pouvaient agir en formant des hétérodimères (Liu et al., 1995; Nishi et al., 2004; Nishi and Kawata, 2007; Mifsud and Reul, 2016). Ainsi, notre hypothèse est que la formation de tels hétérodimères entre le MR et le GR apporterait un élément supplémentaire permettant de moduler l'activité de transrégulation de ces deux récepteurs. Ces trois possibilités ne sont pas mutuellement exclusives.

3. Objectifs du travail

Dans cette troisième partie des résultats, nous avons cherché à expliciter la contribution relative du MR et du GR dans la signalisation de l’aldostérone et du cortisol dans des cellules rénales humaines. Pour cela, nous avons mis à profit les cellules HK-GFP-hMR qui, nous le verrons, expriment de façon endogène le MR et le GR, mais aussi surexpriment la protéine de fusion GFP-hMR. De plus, ces cellules n’expriment pas la 11βHSD2, ce qui nous permettra de nous affranchir du métabolisme des glucocorticoïdes. En exposant ces cellules avec un agoniste (aldostérone, cortisol), ou un antagoniste sélectif du MR ou du GR (finérénone ou RU486, respectivement), nous avons étudié :

- l’effet agoniste-spécifique sur le transfert nucléaire du MR,

- la participation du MR et du GR à la transactivation d’un gène cible commun,

- le recrutement du MR et du GR sur un site de liaison génomique commun,

- la dynamique des complexes transcriptionnels dans le recrutement différentiel des deux récepteurs, et de leurs partenaires moléculaires associés et, enfin,

- l’occurrence d’homodimères et d’hétérodimères MR-GR sur l’ADN.

Les principaux résultats obtenus sont présentés dans l’Article 3 (en préparation).

114

Article 3

Differential dynamic kinetics of Mineralocorticoid and Glucocorticoid Receptors genomic interaction

Florian Le Billan, Larbi Amazit, Qiong-Yao Xue, Eric Pussard, Peter Kolkhof, Say Viengchareun, Jérôme Fagart*, Marc Lombès*

* Ces auteurs ont contribué de façon équivalente.

Manuscrit en cours de préparation

Résultats : Troisième Partie

Article 3

Differential dynamic kinetics of Mineralocorticoid and Glucocorticoid Receptors genomic interaction

Florian Le Billan1,2, Larbi Amazit1,2,3, Qiong-Yao Xue1,4, Eric Pussard1,4, Peter Kolkhof5, Say Viengchareun1,2, Jérôme Fagart1,2*, Marc Lombès1,2,6*

1 Inserm, U1185, Le Kremlin-Bicêtre, 94276, France;

2.Université Paris-Saclay, Faculté de Médecine Paris-Sud, UMR-S1185, Le Kremlin-Bicêtre, 94276, France;

3 UMS 32, Institut Biomédical de Bicêtre, Le Kremlin-Bicêtre, 94276, France;

4 Assistance Publique-Hôpitaux de Paris, Hôpital de Bicêtre, Service de Génétique Moléculaire, Pharmacogénomique et Hormonologie, Le Kremlin Bicêtre, 94275, France;

5.Department of Cardiology Research, Bayer Pharma AG, Global Drug Discovery, 42113 Wuppertal, Germany;

6 Assistance Publique-Hôpitaux de Paris, Hôpital de Bicêtre, Service d'Endocrinologie et des Maladies de la Reproduction, Le Kremlin Bicêtre, 94275, France.

* equally contributed

Corresponding author: Marc Lombès, MD, PhD; Jérôme Fagart, PhD

Inserm U1185, Faculté de Médecine Paris-Sud, Université Paris-Sud

63 rue Gabriel Péri, 94276, Le Kremlin-Bicêtre, France

Phone: +33-149596702

Fax: +33-149596732 e-mail: [email protected]; [email protected]

Short title: Differential MR and GR genomic interaction

Words count:

115

Résultats : Troisième Partie

Abstract

The mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) are closely related hormone-activated transcription factors regulating major pathophysiological functions. The homology between these two receptors results in crossbinding of their corresponding ligands, MR being activated by both aldosterone and cortisol, while GR is essentially activated by cortisol. Their coexpression together with their ability to bind similar DNA motifs raises the question of the respective contribution of MR and GR and of their ligands in the mineralocorticoid signaling. We aim at elucidating the transcriptional regulatory mechanisms underlying the selective effects of MR and GR on a common genomic target in a human renal cellular model, the HK-GFP-MR cells. These cells overexpressed the GFP-hMR fusion protein, with endogenously expressed MR and GR, but lacked the MR-protective enzyme, the 11β- hydroxysteroid dehydrogenase type 2, allowing to use cortisol as an activating ligand. We showed that both MR and GR in response to aldosterone or cortisol transactivated the PER1 gene. Using selective ChIP approaches, we showed that both receptors concomitantly bind the same genomic fragment into the PER1 gene promoter through homo and heterodimers. Kinetic ChIP experiments upon agonist exposure revealed that both receptors cyclically interacted with DNA yet with distinct dynamic parameters. Altogether, these results demonstrate a novel level of mineralocorticoid selectivity on MR-GR target genes, which may be taken into consideration for future therapeutic strategies in corticosteroid related-diseases.

Keywords

Chromatin immunoprecipitation / Kinetics / Transcription

116

Résultats : Troisième Partie

1. Introduction

Aldosterone, the main mineralocorticoid hormone in Humans, is involved in pleiotropic actions, of which the best characterized is the regulation of transepithelial sodium reabsorption in epithelial tissues (Terker & Ellison, 2015). This hormone is also involved in several pathophysiological conditions, as many clinical studies have linked hyperaldosteronism to major dysfunctions, notably in the cardiorenal system (Jaisser & Farman, 2016). Aldosterone acts through its binding to the mineralocorticoid receptor (MR, encoded by the NR3C2 gene), a ligand-activated transcription factor, belonging to the Nuclear Receptor superfamily (Nuclear Receptors Nomenclature Committee, 1999). This receptor is composed of three main domains, a N-terminal domain involved in transcriptional coregulator binding and harboring two ligand-independent activation functions AF1a and AF1b, a central DNA-binding domain (DBD) and a C-terminal ligand-binding domain (LBD) harboring the ligand-dependent activation function AF2 (Baker & Katsu, 2017). Aldosterone binding to the cytoplasmic MR triggers its dissociation from the hetero-oligomeric complex that includes the heat shock protein hsp90, its translocation into the nucleus, the binding as a dimer to hormone response elements, the recruitment of transcriptional coregulators, allowing the activation of MR target genes (Viengchareun et al, 2007).

However, several lines of evidence suggest that the mineralocorticoid signaling is much more complex than this simplistic scheme initially thought. Indeed, glucocorticoids, cortisol in Humans and corticosterone in rodents, act as MR agonists and possess the same affinity for MR than aldosterone (Arriza et al, 1987). Despite these similar affinities, MR is more sensitive to aldosterone than to glucocorticoids (Lombes et al, 1994; Hellal-Levy et al, 1999). This is mainly due to an imperfect accommodation of glucocorticoids within the ligand-binding pocket of MR, forming unstable complexes which are less productive. However, given that plasma levels of cortisol are 100 to 1000-fold higher than those of aldosterone, it has been suggested that MR would be fully and permanently bound by glucocorticoids (Funder, 2017). The epithelial tissues which are MR targets express the 11β-hydroxysteroid dehydrogenase type 2 enzyme (11βHSD2), which converts glucocorticoids into their 11-dehydroderivatives (cortisol to cortisone and corticosterone to 11-dehydrocorticosterone) that are almost unable to transactivate MR, allowing selective access and specific activation of MR by aldosterone (Funder et al, 1988; Odermatt & Atanasov, 2009). However, it has been reported that despite 11βHSD2 action, cortisol is not entirely metabolized and is still present at a concentration at least ten times higher than that of aldosterone (Funder & Myles, 1996; Funder, 2007), suggesting that MR signaling in epithelial cells could be promoted by both hormones. Moreover, 11βHSD2 is not expressed in non-epithelial MR

117

Résultats : Troisième Partie

target tissues such as the heart, the brain and the adipocytes, thus unprotecting MR from glucocorticoids (Funder, 2017).

In addition to this potential duality in ligands able to activate and promote MR signaling, the glucocorticoid receptor (GR, encoded by the NR3C1 gene), the closest steroid receptor of MR is ubiquitously expressed (Oakley & Cidlowski, 2013). MR and GR display 94% sequence identity at the DBD allowing both receptors to bind same DNA sequences, the glucocorticoid response element (GRE) (Fuller et al, 2000). However, although MR and GR share almost the same ligands, bind the same DNA sequences and the same molecular partners including coregulators (Pascual- Le Tallec et al, 2005), they exert similar but not overlapping and sometimes opposite effects. Supporting this notion, specific gene inactivation leads to distinct phenotypes, consistent with the lack of redundant actions. Indeed, MR total knock-out (KO) and GR KO mice die within the first days of life, the first ones from massive sodium and fluid loss (Berger et al, 1998), the second ones from severely atelectatic and nonfunctional lungs formation (Cole et al, 1995).

Thus, in this context, the main question that remains is, owing to the coexpression of both MR and GR, what are the molecular determinants allowing differential, selective and hormone-activated signaling pathways leading to distinct physiological responses?

To decipher the respective contribution of both receptors and both hormones in the renal signaling involved in the regulation of sodium reabsorption, we used the HK-GFP-hMR cells, a human renal cell line expressing both endogenous MR and GR together with a fusion protein between GFP and hMR but are devoid of 11βHSD2, allowing us to evaluate the direct contribution of cortisol in the mineralocorticoid and glucocorticoid pathways. We investigated the interaction of MR and GR onto a common target gene, Period circadian protein 1 (PER1). We correlated receptor occupancy and their kinetics, together with their interaction with SRC1 and RNA Polymerase type II, by serial or tandem ChIP experiments with the corresponding gene transactivation as a function of the nature of the ligand. Our study identifies distinct MR and GR recruitment with dissimilar genomic binding kinetics and provides evidence for homodimers as well as MR-GR heterodimer formation that may account for specific receptor-mediated gene activation.

118

Résultats : Troisième Partie

2. Results

Validation of cellular and molecular tools

To accurately investigate the renal MR and GR signaling, it was necessary to appropriately control experimental conditions. To this aim, we selected a relevant in vitro cell model by using the HK- GFP-hMR cells, a human renal cell line derived from the distal convoluted tubule (parental HK cells (Prié et al, 1995)) that has been stably transfected with an expression vector encoding for the fusion protein GFP-hMR (Deppe et al, 2002). This cell line previously allowed us to describe the human MR cistrome and to further characterize MR signaling pathway in human renal cells (Le Billan et al, 2015; Amazit et al, 2015). To evaluate the relative expression level of each receptor (MR and GR) in both HK and HK-GFP-hMR cells, binding assays were performed using [3H]- cortisol as a common ligand for both corticosteroid receptors and selective antagonists. Preliminary experiments demonstrated our ability to discriminate the binding of cortisol to MR or GR. In vitro translated hMR or hGR were incubated with 20 nM [3H]-cortisol in the absence (total binding) or presence of a 500-fold excess of unlabeled cortisol to quantify nonspecific binding. In parallel, reticulocyte lysates were incubated with [3H]-cortisol plus a 500-fold excess of finerenone, the highly selective MR antagonist (Amazit et al, 2015) that, as expected, displaced [3H]-cortisol binding from MR but not from GR (Fig EV1). Lysates were also incubated with [3H]-cortisol plus a 500 fold excess of RU486 which was unable to bind MR (Petit-Topin et al, 2014). As expected RU486 displaced [3H]-cortisol binding from GR but not from MR (Fig EV1). Clarified cytosolic fractions from parental HK and HK-GFP-hMR cells were incubated with 20 nM [3H]-cortisol in the absence (total binding) or presence of a 500-fold excess of unlabeled cortisol (non-specific binding) or finerenone (non-specific plus GR binding) or RU486 (non-specific plus MR binding). As showed in Fig 1A (left histograms), MR and GR were both expressed at relative low levels in parental HK cells (estimated at approximately 8 fmol/mg protein) whereas, as anticipated, MR levels were 10-times higher in HK-GFP-hMR cells (Fig 1A, right histograms) measured at 80 fmol/mg protein with GR expression level remaining unchanged. To further validate the presence of both MR and GR, western blot analysis showed that HK-GFP-hMR cells and parental HK cells expressed both endogenous MR (107 kDa) (Fig 1B) and GR (94 kDa) (Fig 1C), as revealed by using the anti-MR antibody SY4649 antibody, generated against the AF-1 domain (1-167 N- terminal amino acids) of hMR and a commercially available anti-GR antibody, respectively. As anticipated, HK-GFP-hMR cells also expressed the GFP-hMR fusion protein (Fig 1B) detected as a 150 kDa band. Rabbit reticulocyte lysates expressing either full length hMR (107 kDa) or the 1- 602 aa N terminal domain (80 kDa) of the hMR were used as positive controls while empty vector

119

Résultats : Troisième Partie

in vitro transcribed and translated served as negative control (Fig 1B). Prior to perform chromatin immunoprecipitation (ChIP) targeting MR, we examined the ability of the SY4649 antibody to immunoprecipitate the hMR and GFP-hMR proteins from cytosolic extracts of HK-GFP-hMR cells. As shown in Fig 1D, IP followed by western blot analysis demonstrated that the SY4649 antibody was able to specifically immunoprecipitate hMR and GFP-hMR as compared to control IgG. Finally, we investigated whether an 11β-HSD2 activity was detected in HK-GFP-hMR cells by monitoring the conversion of cortisol or corticosterone into their keto-derivatives, quantified by liquid chromatography followed by tandem mass spectrometry (LC-MS/MS) (Travers et al, 2017). The murine renal KC3AC1 cells, known to express 11β-HSD2 enzyme (Fig EV2)(Viengchareun et al, 2009, 2014), was used as positive control. As illustrated in Fig 1E, while KC3AC1 cells almost completely metabolized corticosteroid hormones during overnight incubation, a minute amount of conversion of glucocorticoids (< 3%) was detected in HK-GFP-hMR cells, reflecting the absence of 11β-HSD2. These results are concordant with the absence of HSD11B2 transcripts in HK-GFP-hMR cells (Fig EV2). Taken together, these results revealed that HK-GFP-MR cells endogenously express both MR and GR, overexpress GFP-hMR fusion protein, and are lacking the 11β-HSD2 enzyme, indicating that the HK-GFP-MR cell line is a suitable cell-based system to investigate the relative contribution of MR and GR in corticosteroid signaling. Moreover, the new generated SY4649 anti-hMR antibody could efficiently immunoprecipitate hMR, thus allowing further investigation of MR recruitment on genomic targets.

The ligand-induced nuclear import kinetics of MR is not delayed in presence of cortisol

Nuclear translocation is a critical step that converts MR into its transcriptionally active state. We have previously shown that aldosterone treatment induces the rapid and complete accumulation of MR into the nuclear compartment within 1 h (Amazit et al, 2015). To exclude the possibility that MR nuclear import could be slightly delayed in presence of cortisol, we investigated the impact of aldosterone vs cortisol on the subcellular trafficking of MR. We performed in vivo real-time monitoring of the HK-GFP-hMR cells. Cells were cultured in charcoal-stripped medium and next incubated during 1 h in presence of vehicle (data not shown), 100 nM aldosterone or 100 nM cortisol. The results indicate that GFP-hMR is almost completely translocated in the nuclear compartment within 15 min for both ligands, aldosterone and cortisol (Fig 2, 15 min) and that only minor labeling was still observed in the cytoplasm for this time-point. Further incubation with both ligands (15-60 min) showed no clear-cut differences between the 2 hormonal conditions since GFP-hMR was fully localized into the nuclear compartment. These findings demonstrate that both

120

Résultats : Troisième Partie

hormones induce similar nucleocytoplasmic dynamics of the GFP-hMR in this cell model with no apparent kinetic differences.

PER1 transactivation upon MR or GR agonist and antagonist exposure

We next wanted to evaluate the respective contribution of MR and GR in transactivating a given endogenous gene. We and others have previously identified PER1, a major player of the intracellular endogenous gene clock, as a renal MR target gene (Gumz et al, 2009; Richards et al, 2013, 2014; Le Billan et al, 2015). Moreover, some studies have reported a direct link between GR and the circadian clock (Conway-Campbell et al, 2012; Fujihara et al, 2014). We, therefore, decided to examine the expression level of PER1 mRNA after treating cells for 1 h with increasing concentrations of aldosterone or cortisol in the absence or presence of a 100-fold excess of the selective MR antagonist finerenone or of the GR antagonist RU486. As shown in Fig 3A, the level of the PER1 transcripts increases in a dose-dependent manner after aldosterone or cortisol stimulation. Interestingly, the aldosterone-induced transactivation of the PER1 gene was almost totally inhibited by the presence of finerenone (P<0.05), demonstrating that MR mediates aldosterone action. RU486 also significantly (P<0.05) reduces the aldosterone-induced PER1 transactivation, but to a lesser extent than did finerenone, indicating that GR is also involved in PER1 transcriptional activation. Likewise, after cortisol treatment, PER1 transcript levels significantly increased in a dose-dependent manner to reach a two-fold induction after 1 h treatment with 10-7 M cortisol (P<0.05, Fig 3B). The cortisol-stimulated transactivation at high concentrations was inhibited by finerenone, and also by RU486 (P<0.05). Collectively, these results indicate that both MR and GR transactivate the PER1 gene, cortisol being able to bind to and activate both receptors in HK-GFP-hMR cells. These findings also suggest that both receptors might bind to common regulatory sequences within the same target locus, thus enabling us to examine, in this cell-based system, the specific, concomitant, synergistic or competitive recruitment of MR and GR onto a common and presumably unique hormone response element (HRE).

Involvement of MR and GR in the PER1 gene regulation

We next examined whether MR and GR were directly involved in the PER1 transactivation. We have previously identified and characterized a mineralocorticoid binding sequence (MBS)

121

Résultats : Troisième Partie

containing a mineralocorticoid response element (MRE) located at -2,044 bp upstream of the TSS, on the promoter of the PER1 gene (Le Billan et al, 2015). The same locus has been previously identified as a glucocorticoid target (Reddy et al, 2009; Cheon et al, 2013). Therefore, we performed ChIP qPCR experiments on chromatin extracted from HK-GFP-hMR cells treated by MR or GR agonists and antagonists. As shown in Fig 4A, aldosterone induced a strong MR recruitment on the PER1 promoter (88-fold increase, P<0.001) which was partly inhibited by a 10- fold excess of finerenone. As anticipated, cortisol also increased MR recruitment on the PER1 promoter (65-fold increase, P<0.01), which was significantly reduced by 3.5 in presence of finerenone (P<0.01), consistent with a cortisol-stimulated MR activation. In parallel, GR recruitment onto the same regulatory element located in PER1 promoter was enhanced after cortisol exposure (84-fold increase, P<0.001), and inhibited by RU486 cotreatment (3.3-fold reduction, P<0.01, Fig 4B). Interestingly, aldosterone, which acts as a weak GR agonist (Hellal- Levy et al, 1999), also promoted GR enrichment (50-fold increase, P<0.001), a recruitment that was surprisingly reduced by 50% in the presence of RU486 (P<0.05). It is worth noting that RU486 alone (1 µM) significantly promotes GR recruitment (28-fold increase, P<0.001), indicating that GR-RU486 complexes are able to bind DNA, as previously reported (Zhang et al, 2007). These MR and GR recruitments are sequence-specific, since no recruitment was observed on a negative control region located at +1068 bp from the SCNN1A TSS (Fig EV3, (Le Billan et al, 2015)). In summary, after 1 h treatment, both aldosterone and cortisol promoted MR and GR recruitment onto the same target sequence to comparable extent, accompanied by subsequent transactivation of the PER1 gene in HK-GFP-hMR cells.

Dynamic kinetics of the recruitment of MR, GR, and their transcriptional partners

It has been previously demonstrated that, while activated by estradiol (E2), the estrogen receptor isoform α (ERα) and its transcriptional partners are recruited to DNA in a dynamic and cyclical manner (Métivier et al, 2003). We thus explored the potential time-dependent MR recruitment and its molecular partners (SRC1 and RNA polymerase type II) as a function of the nature of ligand (aldosterone or cortisol). We also compared such kinetics with that of cortisol-bound GR onto the same GRE identified in the promoter of the PER1 gene. For this purpose, sequential ChIP experiments were performed on HK-GFP-hMR cells that were previously synchronized by a 2 h α-amanitin exposure. Such an experimental condition was required to clear active promoters of any transcription factors (Reid et al, 2003). As demonstrated in three independent experiments and illustrated in Fig 5, recruitment of the aldosterone-activated MR greatly varies over a 120 min

122

Résultats : Troisième Partie

period in a cyclic and dynamic manner. Automatic fitting the data to a sine curve using the GraphPad Prism software and manual optimization of the sine curve parameters (amplitude, frequency, phase) were required. Surprisingly, all the experimental data set did not fit into a unique sine curve (one frequency over all data). Rather, a closer refinement of sine curve parameters revealed that the data fit well into two successive sine curves with a minimized sum of the squares of the distances of the data from the curves. Thus, we were able to define a two-component model composed of a first sine curve within the first 50 min followed by a second sine curve for the remaining 70 min. From the curve fittings, it could be proposed that MR recruitment follows two phases: the first one composed of 3 short cycles of 14 ± 0.1 min, and the second one constituted by 2 larger cycles of 25 ± 1.4 min. We next addressed the question on the potential consequences of these two dynamic phases on the MR capacity to promote transcriptional partners recruitment. ChIP experiments performed with the corresponding antibodies demonstrated that SRC-1 enrichment onto the PER1 promoter also cyclically varied upon aldosterone exposure with cycles directly superimposable to those observed for MR (Fig 6, upper panel), suggesting a concomitant recruitment of both proteins. RNA Pol II binding to the PER1 promoter also followed a cyclic rhythm, with two successive phases of approximately 60 min. Interestingly, the RNA Pol II recruitment was shifted by 10 min (10 min phase delay) compared to that of MR and SRC-1 resulting in 3 short cycles of 15 min and 2 cycles of 31 min (Fig 6, lower panel). These results indicate that MR and SRC-1 corecruitment is a prerequisite for RNA Pol II functional positioning into an operative pre-initiation complex onto this locus.

It has been previously shown that transactivation efficiency of MR and GR in response to mineralocorticoid and glucocorticoid hormones is highly dependent on the nature of the bound hormone; MR being more sensitive to aldosterone than to cortisol and conversely, GR being more sensitive to cortisol than to aldosterone (Lombès et al, 1994; Hellal-Levy et al, 1999). These differences in receptor sensitivities were directly related to the stability of the hormone-receptor complexes. The aldosterone-MR complexes are much more stable than those involving cortisol, and conversely, GR forms much more stable complexes with cortisol than with aldosterone (Hellal- Levy et al, 1999). Thus, we wondered whether aldosterone or cortisol may differently influence dynamic patterns of MR and/or GR recruitment on the PER1 promoter. Therefore, sequential ChIP experiments were performed on HK-GFP-hMR cells treated by 100 nM cortisol or aldosterone. Likewise aldosterone, statistical analyses indicated that cortisol induced a similar cyclic MR recruitment divided into two successive phases of 50 and 70 min, respectively. However, the two phases were composed of cycles shorter than those observed after aldosterone treatment (12.5 min vs 14 min for the first phase; 12.5 min vs 25 min for the second phase). The two phases were

123

Résultats : Troisième Partie

different according to their amplitude (Fig 7A and 7B). In both cases, aldosterone or cortisol- bound MR leads to an activation of PER1 transcription as shown in Fig 3. These differences in the recruitment kinetics after cortisol treatment as compared to aldosterone-bound MR led us to compare if GR and MR complexes have similar DNA binding kinetics, owing to the fact that both MR and GR stimulated PER1 mRNA expression. As illustrated in Fig 7C and 7D, GR-cortisol complexes also bind the PER1 promoter in a cyclic-dependent manner, that could be divided into two phases. The two phases of the GR-cortisol complexes had similar frequencies than those of the MR-cortisol complexes (12.1 min vs 12.5 min) but the amplitude variations are inversed. Altogether, these observations indicated that both receptors are recruited on the PER1 promoter through two phases but with differential kinetic parameters that are highly dependent on the nature of the receptor as well as that of the bound ligand.

Selectivity of MR and GR binding to GRE within the PER1 regulatory sequence

From the above findings, we hypothesized that upon aldosterone and cortisol stimulation in HK- GFP-hMR, both MR and GR participate to the transactivation of the endogenous PER1 gene via, at least in part, recruitment onto the same PER1 regulatory sequences. We next asked whether MR or GR bind separately as homodimers or whether heterodimers between MR and GR may also account for specific regulatory pattern of an endogenously expressed target gene under controlled conditions. If MR and GR homodimers exist, each homodimer should be immunoprecipitated independently from the other one, and conversely. We hypothesized that if heterodimers do exist, immunoprecipitating one receptor should lead to co-immunoprecipitate the other partner. Therefore, a first ChIP experiment was performed on agonist-treated HK-GFP-hMR cells by taking MR as bait, and the unbound chromatin was assessed for its ability to be immunoprecipitated using the anti-GR antibody (serial ChIP experiment). As showed in Fig 8A and 8B, aldosterone treatment allowed MR recruitment, and the serial ChIP experiment on the unbound chromatin revealed a GR recruitment, demonstrating that MR and GR are able to bind DNA independently from each other, presumably through homodimer formation (see control GR recruitment in Fig EV4A). These independent recruitments of MR and GR were confirmed by performing the reverse experiment (ChIP GR and then serial ChIP MR on the unbound chromatin, Fig 8D and 8E; see control cortisol-MR recruitment in Fig EV4D). We next investigated the hypothesis of the formation of MR-GR heterodimers, by performing tandem ChIP experiments. After the MR ChIP assays, the chromatin was eluted and then assessed for its ability to be immunoprecipitated by the anti-GR antibody. As showed in Fig 8C, the MR-immunoprecipitated

124

Résultats : Troisième Partie

chromatin could be re-ChIPed by the anti-GR antibody, indicating that MR and GR formed heterodimers. The reverse experiment showed that after a ChIP on GR, the chromatin was re- precipitated using the anti-MR antibody, confirming MR and GR heterodimer formation (Fig 8F). These above observations are related to the PER1 promoter GRE, and are locus-specific since no recruitment of any homodimers or heterodimers was observed on a negative control region (Fig EV5). Taken together, these results indicate that MR and GR are concomitantly recruited onto the PER1 promoter predominantly as homodimers but that MR-GR heterodimers may also interact with genomic targets.

125

Résultats : Troisième Partie

3. Discussion

4. Materials and Methods

Compounds.

Aldosterone, Cortisol, RU486, Protease Inhibitor Cocktail (PIC), α-amanitin and Laemmli buffer were purchased from Sigma (Lyon, France). [3H]-Cortisol was purchased from Perkin-Elmer (Villebon-sur-Yvette, France). DMEM High Glucose with L-glutamine medium, trypsin, geneticin (G418), Fast SYBR Green Master Mix buffer, random primers, dNTP, Superscript reverse polymerase were purchased from Life Technologies (Saint-Aubin, France). Phosphate buffered saline (PBS) and Penicillin-Streptomycin solution were purchased from GE Healthcare (Vélizy- Villacoublay, France). Western blot equipment was purchased from Biorad (Marnes-la-Coquette, France). FluoroBrite DMEM and Hoechst 33342 were purchased from ThermoFisher Scientific (Montigny-le-Bretonneux, France). Finerenone was provided by Dr Peter Kolkhof from Bayer Pharma AG (Wuppertal, Germany).

Purified rabbit polyclonal SY4649 antibody was raised against and purified with the AF1a domain (residues 1-167) at the N-terminus of the human MR. (Double X/XP Boosting antibody production program; Eurogentec, Seraing, Belgium). The hAF1a domain was expressed in E. coli as a fusion protein with GST. After loading onto a 5 mL GSTrap column (GE Healthcare), the fusion protein was cleaved in situ by the PreScission protease (GE Healthcare) and the hAF1a recovered in the flow through and further purified on an anion exchange chromatography. Rabbit anti-SRC1 M-341 (sc-8995 X) and anti-RNA Pol II H-224 (sc-9001 X) antibodies were from Santa Cruz Biotechnology (California, USA), Rabbit anti-GR PA1-516 antibody was from ThermoFisher Scientific (Montigny-le-Bretonneux, France), and control unrelated antibody from the iDeal ChIP- seq kit for Transcription Factors (Diagenode, Seraing, Belgium).

Cell culture.

Human Kidney GFP-hMR cells (HK-GFP-MR clone 20) or parental cells or HK cells (Prié et al, 1995; Deppe et al, 2002; Le Billan et al, 2015; Amazit et al, 2015) were routinely cultured at 37°C, in a humidified incubator gassed with 5% CO2, seeded on petri dishes (BP100) with 10 mL of DMEM (DMEM High Glucose medium with L-glutamine) containing 2.5% fetal bovine serum (FBS)

126

Résultats : Troisième Partie

(Biowest, Courtaboeuf, France), 100 U/mL penicillin, and 100 µg/mL streptomycin. For the HK- GFP-MR cells, the medium was supplemented with geneticin G418 (200 µg/mL).

Western blot.

Total protein extracts were prepared from parental HK or HK-GFP-MR cells, using the protein extraction buffer (150 mM NaCl; 50 mM Tris-HCl, pH 7.5; 0.5 mM EDTA; 30 mM sodium pyrophosphate; 50 mM NaF), extemporaneously supplemented with 1% Triton 100X, 1% PIC 100X and 0.1% SDS. Samples were kept at 4°C for 30 min and then centrifuged at 16,000 g for 20 min and 4°C. The supernatant was recovered and protein concentrations were quantified using the bicinchoninic acid assay (Interchim, Montluçon, France). Fifty µg proteins were prepared in 4X Laemmli buffer by incubation at 95°C for 5 min. Samples were electrophoresed in a Trans-Blot SD tank (Biorad) first into a stacking gel for 20 min at 120 V, and then into a 7.5% separation gel for 40 min at 200 V. Proteins were then transferred on a membrane using a semi-dry method, for 45 min at 18 V, at RT. Membranes were blocked during 1 h at room temperature (RT) with 5% non-fat milk in TBST (Tris-Buffered Saline Tween) and incubated at 4°C overnight with 1/600 dilution of anti-MR SY4649 and 1/10,000 anti-α-tubulin (Sigma) for loading controls. Membranes were rinsed three times with TBS-Tween and incubated 1 h at RT with DyLight Fluor Secondary Antibodies, Rabbit 680 and Mouse 800 (1/15,000, ThermoFisher Scientific). After three washes, membranes were analyzed with Odyssey Fc (Li-cor Biosciences, Lincoln, NE).

Ligand binding assay.

Forty-eight hours before their collection, parental HK and HK-GFP-MR cells were washed twice with 1X PBS and placed in DMEM containing 2.5% dextran charcoal-stripped-FBS (DCC FBS) for steroid starvation. After two washes with ice-cold 1X PBS, cells were collected and frozen at - 150°C. Cells were ground in a mortar under liquid nitrogen and resuspended in TEG-Mo buffer (20 mM Tris-HCl, 1 mM EDTA, 20 mM sodium molybdate, and 10% glycerol (v/v), pH 7.4), supplemented by 1% PIC 100X. Cells were disrupted using a Teflon-glass potter. Cell homogenates were then centrifugated at 16,000 g for 30 min at 4°C and the supernatants were considered as cytosolic fractions. Reticulocyte lysates were prepared as in (Fagart et al, 2005a) and diluted twice with TEG-Mo buffer. Samples were incubated for 4 h at 4°C with 20 nM [3H]- cortisol alone or in the presence of a 500-fold excess of unlabeled cortisol, finerenone or RU486. Bound and free ligands were separated by the dextran-charcoal method (Fagart et al, 2005b).

127

Résultats : Troisième Partie

Bound [3H]-cortisol was measured by counting the radioactivity of the supernatant and expressed in fmol/mg of proteins. Results are mean ± SEM of triplicate from one experiment.

Measurement of the 11β hydroxysteroid dehydrogenase type 2 activity by Liquid Chromatography - tandem Mass Spectrometry (LC MS/MS).

After forty-eight hours of steroid starvation, HK-GFP-MR cells were incubated in DMEM 2.5% DCC FBS medium containing 100 nM aldosterone or 100 nM cortisol for 16 h. Supernatants were recovered and cortisol (F compound), cortisone (E compound), corticosterone (B compound) and 11-dehydrocorticosterone (A compound) concentrations were assayed by LC MSMS method (Travers et al, 2017). Conversion was calculated as the ratio between the ratio E/F+E (or A/B+B) before and after incubation. Results are expressed as means ± SEM of three independent measurements.

MR live-cell monitoring

HK-GFP-hMR cells were seeded (15,000 cells/well) on a 24-well tissue culture plate in DMEM containing 2.5% FBS. Three days later, a subsequent hormone withdrawal was achieved by rinsing the cells twice during 5 min at 37°C in DMEM containing 2.5% DCC FBS. This process was repeated 24 hours later. Videomicroscopy experiments were performed on 20 fields with the Arrayscan VTI microscope (Thermo Fisher Scientific) combined with live cell monitoring module (binning 2x2, 5% CO2 and 37± 0,1°C). Briefly, cells were pre-incubated in FluoroBrite DMEM containing 20 mM Hepes and 1mg/ml Hoechst 33342 during 15 min at 37°C and then loaded in the Arrayscan VTI microscope. A first acquisition (t=0) was performed on 20 fields before incubation with 100 nM aldosterone or 100 nM cortisol during 1 h. Control vehicle condition was run in parallel with medium containing 0.1% ethanol. Images of Hoechst 33342 and GFP-hMR fluorescence were captured for 20 fields/well using sequential acquisition every 2 min to give separate image files for each channel (40×/0.75 NA). Images were analyzed and quantified by the vHCS Studio v6.6.0 software (Thermo Fisher Scientific). The kinetics mode of the Molecular Translocation V4 Bioapplication was used to quantify the relative distribution of GFP-hMR. The channel 1 (Hoechst) was used to identify the nuclear region and to define a binary nuclear mask. This mask (CIRC mask) was used to quantify the amount of target channel fluorescence (GFP- hMR) within the nucleus (CircAvgIntensity or nuclear average intensity). The nuclear mask was then dilated to cover the maximum cytoplasmic region as possible without exceeding cell

128

Résultats : Troisième Partie

boundaries. Subtraction of the nuclear mask from this dilated mask creates a binary cytoplasmic mask covering the cytoplasmic region. The cytoplasmic mask (RING mask) was used to quantify the amount of GFP-hMR fluorescence within the cytoplasm (RingAvgIntensity). The translocation index measurement (CircAvgIntensity/RingAvgIntensity) represents the average value ratio of the nuclear intensity to the cytoplasmic intensity calculated for each selected cell per well (Williams et al, 2006; Amazit et al, 2015).

Reverse transcription and real-time qPCR.

Treated HK-GFP-MR cells were washed twice with ice-cold PBS. Total RNA extraction, reverse transcription and real-time qPCR were performed as previously described (Le Billan et al, 2015). Primers were used at 300 nM final concentration: PER1 Forward: 5’- CGGATACCCCCTGACAAGAG-3’, Reverse: 5’-GCAGCCCTTTCATCCACATC-3’; GAPDH: Forward: 5’-TGCACCACCAACTGCTTAGC-3’, Reverse: 5‘-GGCATGGACTGTGGTCATGAG-3’. Relative expression in a given sample was normalized to the internal reference mRNA GAPDH values where the control condition values are arbitrarily set at 1. Results are expressed as means ± SEM.

Chromatin immunoprecipitation (ChIP).

Geneticin was omitted from cell medium five days before experiments. Forty-eight hours before the experiment, HK-GFP-MR cells were washed twice with 1X PBS and incubated in DMEM containing 2.5% FBS DCC (step A). Cells were then incubated for 1 h at 37°C with either 100 nM aldosterone, 100 nM cortisol, 10 µM finerenone or spironolactone, vehicle or a combination of ligands as indicated on the figure legend, all in DMEM supplemented by 2.5% DCC FBS (step B). The next steps were carried out using the iDeal ChIP-seq kit for Transcription Factors according to manufacturer’s recommendations, with the following modifications. During cells treatment, protein A-coated magnetic beads (30 μL of the stock suspension) were washed twice in prepared buffer C1 (4.2 mL molecular grade water, 0.8 mL iC1b and 80 µL 5% BSA) and finally resuspended in 30 µL prepared C1 buffer. Pre-coating mix were prepared with these beads, 5 µg of one of the antibodies, plus Proteinase Inhibitor Cocktail (PIC) and 5% BSA (final volume 100µL), and incubated 4 h on a rotating wheel (40 rpm) at 4°C (step C). Treated cells were fixed for 10 min at RT by adding one-tenth fixation solution (10% PFA in fixation buffer) to the medium. After

129

Résultats : Troisième Partie

5 min neutralization of the medium by adding 0.125 M glycine, cells were washed once with a large volume of ice-cold 1X PBS. After cell lysis, extracted chromatin was sheared in 300 μL of shearing buffer iS1b + PIC transferred in 1.5 ml Bioruptor® Pico Microtubes with Caps, by applying 1 run of 8 cycles (Bioruptor® Pico, Diagenode). Each cycle was composed of 30 s with effective application of ultrasounds (ON) and 30 s without (OFF) (step D). Sheared chromatin (250 µL) were then added to the pre-coated beads. Samples were incubated overnight at 4°C and at 40 rpm (step E). 2.5 µL of sheared chromatin from each sample were kept aside to constitute an input. The next day, magnetic beads were washed and immunoprecipitated DNA was eluted. Then, eluted DNA and DNA from input were purified and recovered in 50 µL of buffer C (step F). One-quarter dilution of purified DNA was used for quantification by genomic qPCR (step G).

Kinetics experiments for ChIP analysis.

During kinetics experiments of ChIP, only the step B from the protocol above changes. HK-GFP- MR cells treatment were started countdown every 5 min, from 120 min to 0 min, according to the following steps. Cells were pre-treated for 2 h with DMEM 2.5% FBS DCC medium containing 2.5 µM α-amanitin, washed twice with 1X PBS, and then treated 0-120 min with DMEM 2.5% FBS DCC containing 100 nM aldosterone or 100 nM cortisol. Every time conditions were stopped simultaneously by adding one-tenth fixation solution (10% PFA in fixation buffer) to the medium for 10 min at RT.

Serial ChIP.

After the step E from the ChIP protocol above, samples were placed on the magnetic rack for 1 min and supernatants were recovered in new tubes. These supernatants correspond to unbound chromatin from the ChIP experiment. The step C was repeated with new magnetic beads and antibody. Then, the unbound chromatin was incubated with the pre-coated beads overnight at 4°C and at 40 rpm. 3.5 µL of unbound chromatin were kept aside to constitute an input. Finally, steps F and G were performed as described above.

Tandem ChIP.

130

Résultats : Troisième Partie

After the step E from the ChIP protocol above, samples were washed four times as described in the kit. The magnetic beads were resuspended in 50 µL SDS-DTT Elution buffer (50 mM Tris-HCl, 10 mM EDTA, 1% SDS, 10 mM DTT, pH 7.0) and incubated for 30 min at 37°C. The eluted immunoprecipitated chromatin was recovered in a new tube and diluted to the tenth in Dilution buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 0.1% Na-deoxycholate, 5 mM sodium butyrate, pH 8.0) extemporaneously completed with 1% Triton, 1 mM serine protease inhibitor AESBF and 1% PIC. The step C was repeated with new magnetic beads and antibody. Then, the eluted chromatin (490 µL) was incubated with the pre-coated beads overnight at 4°C and at 40 rpm. 4.9 µL of unbound chromatin were kept aside to constitute an input. Finally, steps F and G were followed.

Genomic qPCR.

Purified DNA from ChIP, kinetic ChIP, serial ChIP and tandem ChIP were analyzed by genomic qPCR, in triplicates, as previously described (Le Billan et al, 2015). Results are expressed as means ± SEM.

Statistical analysis.

Experimental data are presented as the means ± SEM. Statistical analyses were performed with Prism 5 software (GraphPad Software, La Jolla, CA, USA), with the nonparametric Mann Whitney t-test. Differences reaching P values <0.05 were considered significant, as shown in detail in the figures. For the kinetics experiments for ChIP analysis, we used the sine wave fitting option of GraphPad Prism software, allowing automatic and manual definition of sine curve parameters (amplitude, frequency, phase).

131

Résultats : Troisième Partie

5. Acknowledgments

6. Author contributions

7. Conflicts of interest

8. References

Amazit L, Le Billan F, Kolkhof P, Lamribet K, Viengchareun S, Fay MR, Khan JA, Hillisch A, Lombès M, Rafestin-Oblin M-E & Fagart J (2015) Finerenone Impedes Aldosterone-dependent Nuclear Import of the Mineralocorticoid Receptor and Prevents Genomic Recruitment of Steroid Receptor Coactivator-1. J. Biol. Chem. 290: 21876–21889

Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE & Evans RM (1987) Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237: 268–275

Baker ME & Katsu Y (2017) 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Evolution of the mineralocorticoid receptor: sequence, structure and function. J. Endocrinol. 234: T1–T16

Berger S, Bleich M, Schmid W, Cole TJ, Peters J, Watanabe H, Kriz W, Warth R, Greger R & Schütz G (1998) Mineralocorticoid receptor knockout mice: pathophysiology of Na+ metabolism. Proc. Natl. Acad. Sci. U. S. A. 95: 9424–9429

Cato AC & Weinmann J (1988) Mineralocorticoid regulation of transcription of transfected mouse mammary tumor virus DNA in cultured kidney cells. J. Cell Biol. 106: 2119–2125

Cheon S, Park N, Cho S & Kim K (2013) Glucocorticoid-mediated Period2 induction delays the phase of circadian rhythm. Nucleic Acids Res. 41: 6161–6174

Cole TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi A, Fantuzzi G, Hummler E, Unsicker K & Schütz G (1995) Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev. 9: 1608–1621

Conway-Campbell BL, Pooley JR, Hager GL & Lightman SL (2012) Molecular dynamics of ultradian glucocorticoid receptor action. Mol. Cell. Endocrinol. 348: 383–393

Deppe CE, Heering PJ, Viengchareun S, Grabensee B, Farman N & Lombe S M (2002) Cyclosporine A and FK506 Inhibit Transcriptional Activity of the Human Mineralocorticoid Receptor: A Cell-Based Model to Investigate Partial Aldosterone Resistance in Kidney Transplantation. Endocrinology 143: 1932–1941

Fagart J, Huyet J, Pinon GM, Rochel M, Mayer C & Rafestin-Oblin M-E (2005a) Crystal structure of a mutant mineralocorticoid receptor responsible for hypertension. Nat. Struct. Mol. Biol. 12: 554–555

Fagart J, Seguin C, Pinon GM & Rafestin-Oblin M-E (2005b) The Met852 residue is a key organizer of the ligand-binding cavity of the human mineralocorticoid receptor. Mol. Pharmacol. 67: 1714–1722

132

Résultats : Troisième Partie

Fujihara Y, Kondo H, Noguchi T & Togari A (2014) Glucocorticoids mediate circadian timing in peripheral osteoclasts resulting in the circadian expression rhythm of osteoclast-related genes. Bone 61: 1–9

Fuller PJ, Lim-Tio SS & Brennan FE (2000) Specificity in mineralocorticoid versus glucocorticoid action. Kidney Int. 57: 1256–1264

Funder J (2017) 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Mineralocorticoid receptor activation and specificity-conferring mechanisms: a brief history. J. Endocrinol. 234: T17– T21

Funder J & Myles K (1996) Exclusion of corticosterone from epithelial mineralocorticoid receptors is insufficient for selectivity of aldosterone action: in vivo binding studies. Endocrinology 137: 5264–5268

Funder JW (2007) Mineralocorticoid receptor activation and oxidative stress. Hypertens. Dallas Tex 1979 50: 840–841

Funder JW, Pearce PT, Smith R & Smith AI (1988) Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242: 583–585

Govindan MV, Leclerc S, Roy R, Rathanaswami P & Xie BX (1991) Differential regulation of mouse mammary tumor virus-bacterial chloramphenicol acetyltransferase chimeric gene by human mineralocorticoid hormone-receptor complexes. J. Steroid Biochem. Mol. Biol. 39: 91–103

Gumz ML, Stow LR, Lynch IJ, Greenlee MM, Rudin A, Cain BD, Weaver DR & Wingo CS (2009) The circadian clock protein Period 1 regulates expression of the renal epithelial sodium channel in mice. J. Clin. Invest. 119: 2423–2434

Hellal-Levy C, Couette B, Fagart J, Souque A, Gomez-Sanchez C & Rafestin-Oblin M (1999) Specific hydroxylations determine selective corticosteroid recognition by human glucocorticoid and mineralocorticoid receptors. FEBS Lett. 464: 9–13

Jaisser F & Farman N (2016) Emerging Roles of the Mineralocorticoid Receptor in Pathology: Toward New Paradigms in Clinical Pharmacology. Pharmacol. Rev. 68: 49–75

Le Billan F, Khan JA, Lamribet K, Viengchareun S, Bouligand J, Fagart J & Lombès M (2015) Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 29: 3977–3989

Lombès M, Binart N, Delahaye F, Baulieu EE & Rafestin-Oblin ME (1994) Differential intracellular localization of human mineralocorticosteroid receptor on binding of agonists and antagonists. Biochem. J. 302 ( Pt 1): 191–197

Lombes M, Kenouch S, Souque A, Farman N & Rafestin-Oblin ME (1994) The mineralocorticoid receptor discriminates aldosterone from glucocorticoids independently of the 11 beta- hydroxysteroid dehydrogenase. Endocrinology 135: 834–840

Métivier R, Penot G, Hübner MR, Reid G, Brand H, Kos M & Gannon F (2003) Estrogen receptor- alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115: 751–763

133

Résultats : Troisième Partie

Mifsud KR & Reul JMHM (2016) Acute stress enhances heterodimerization and binding of corticosteroid receptors at glucocorticoid target genes in the hippocampus. Proc. Natl. Acad. Sci. U. S. A. 113: 11336–11341

Nuclear Receptors Nomenclature Committee (1999) A unified nomenclature system for the nuclear receptor superfamily. Cell 97: 161–163

Oakley RH & Cidlowski JA (2013) The biology of the glucocorticoid receptor: new signaling mechanisms in health and disease. J. Allergy Clin. Immunol. 132: 1033–1044

Odermatt A & Atanasov AG (2009) Mineralocorticoid receptors: emerging complexity and functional diversity. Steroids 74: 163–171

Ou XM, Storring JM, Kushwaha N & Albert PR (2001) Heterodimerization of mineralocorticoid and glucocorticoid receptors at a novel negative response element of the 5-HT1A receptor gene. J. Biol. Chem. 276: 14299–14307

Petit-Topin I, Fay M, Resche-Rigon M, Ulmann A, Gainer E, Rafestin-Oblin M-E & Fagart J (2014) Molecular determinants of the recognition of ulipristal acetate by oxo-steroid receptors. J. Steroid Biochem. Mol. Biol. 144 Pt B: 427–435

Presman DM, Ganguly S, Schiltz RL, Karpova T & Hager GL (2016) DNA-binding Triggers the Tetramerization of the Glucocorticoid Receptor in Live Cells. FASEB J. 30: 582.2-582.2

Prié D, Friedlander G, Coureau C, Vandewalle A, Cassingéna R & Ronco PM (1995) Role of adenosine on glucagon-induced cAMP in a human cortical collecting duct cell line. Kidney Int. 47: 1310–1318

Reddy TE, Pauli F, Sprouse RO, Neff NF, Newberry KM, Garabedian MJ & Myers RM (2009) Genomic determination of the glucocorticoid response reveals unexpected mechanisms of gene regulation. Genome Res. 19: 2163–2171

Reid G, Hübner MR, Métivier R, Brand H, Denger S, Manu D, Beaudouin J, Ellenberg J & Gannon F (2003) Cyclic, proteasome-mediated turnover of unliganded and liganded ERalpha on responsive promoters is an integral feature of estrogen signaling. Mol. Cell 11: 695–707

Richards J, Jeffers LA, All SC, Cheng K-Y & Gumz ML (2013) Role of Per1 and the mineralocorticoid receptor in the coordinate regulation of αENaC in renal cortical collecting duct cells. Front. Physiol. 4: 253

Richards J, Ko B, All S, Cheng K-Y, Hoover RS & Gumz ML (2014) A role for the circadian clock protein Per1 in the regulation of the NaCl co-transporter (NCC) and the with-no-lysine kinase (WNK) cascade in mouse distal convoluted tubule cells. J. Biol. Chem. 289: 11791–11806

Takahashi JS (2017) Transcriptional architecture of the mammalian circadian clock. Nat. Rev. Genet. 18: 164–179

Terker AS & Ellison DH (2015) Renal mineralocorticoid receptor and electrolyte homeostasis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 309: R1068-1070

134

Résultats : Troisième Partie

Travers S, Martinerie L, Bouvattier C, Boileau P, Lombès M & Pussard E (2017) Multiplexed steroid profiling of gluco- and mineralocorticoids pathways using a liquid chromatography tandem mass spectrometry method. J. Steroid Biochem. Mol. Biol. 165, Part B: 202–211

Viengchareun S, Kamenicky P, Teixeira M, Butlen D, Meduri G, Blanchard-Gutton N, Kurschat C, Lanel A, Martinerie L, Sztal-Mazer S, Blot-Chabaud M, Ferrary E, Cherradi N & Lombès M (2009) Osmotic stress regulates mineralocorticoid receptor expression in a novel aldosterone-sensitive cortical collecting duct cell line. Mol. Endocrinol. Baltim. Md 23: 1948–1962

Viengchareun S, Le Menuet D, Martinerie L, Munier M, Pascual-Le Tallec L & Lombès M (2007) The mineralocorticoid receptor: insights into its molecular and (patho)physiological biology. Nucl. Recept. Signal. 5: e012

Viengchareun S, Lema I, Lamribet K, Keo V, Blanchard A, Cherradi N & Lombès M (2014) Hypertonicity compromises renal mineralocorticoid receptor signaling through Tis11b-mediated post-transcriptional control. J. Am. Soc. Nephrol. JASN 25: 2213–2221 van Weert LTCM, Buurstede JC, Mahfouz A, Braakhuis PSM, Polman JAE, Sips HCM, Roozendaal B, Balog J, de Kloet ER, Datson NA & Meijer OC (2017) NeuroD factors discriminate mineralocorticoid from glucocorticoid receptor DNA binding in the male rat brain. Endocrinology

Weikum ER, Knuesel MT, Ortlund EA & Yamamoto KR (2017) Glucocorticoid receptor control of transcription: precision and plasticity via allostery. Nat. Rev. Mol. Cell Biol. 18: 159–174

Williams RG, Kandasamy R, Nickischer D, Trask OJ, Laethem C, Johnston PA & Johnston PA (2006) Generation and characterization of a stable MK2-EGFP cell line and subsequent development of a high-content imaging assay on the Cellomics ArrayScan platform to screen for p38 mitogen-activated protein kinase inhibitors. Methods Enzymol. 414: 364–389

Zhang S, Jonklaas J & Danielsen M (2007) The glucocorticoid agonist activities of mifepristone (RU486) and progesterone are dependent on glucocorticoid receptor levels but not on EC50 values. Steroids 72: 600–608

135

Résultats : Troisième Partie

9. Figure legends

Figure 1. HK-GFP-hMR cells stably express endogenous and functional MR and GR, overexpress GFP-hMR fusion protein, but do not express 11βHSD2. A, Binding assays on parental HK and HK-GFP-hMR cell extracts incubated with 20 nM [3H]- cortisol and a 500-fold excess of cortisol, finerenone or RU486 for 4 h at 4°C. Bound and unbound ligands were separated by the dextran-charcoal method. Bound steroid was measured by counting the radioactivity of the supernatant and expressed in fmol/mg of proteins. Specific binding corresponds was calculated by subtracting to total binding values those obtained in the [3H]- cortisol plus 500-fold excess of cortisol conditions. Results are mean ± SEM of triplicate from one experiment. B and C, Western blot analysis of MR, GFP-hMR and GR expression in the parental HK and HK- GFP-hMR cells. The MR (107 kDa) and the GFP-hMR fusion protein (134 kDa) were detected by the 1:2000 SY4649 antibody (B), and the GR (90 kDa) by 1:500 PA1-516 antibody (ThermoFisher) (C). The 1:10000 anti-α-tubulin antibody (DM1A, Sigma-Aldrich) serves as loading control. In vitro transcribed/translated hMR, 1-602 hMR or an empty pcDNA3 vector in reticulocyte lysates were used as controls. D, Immunoprecipitation of GFP-hMR and MR, from homogenates of HK-GFP-hMR cells, by 5 µg of SY4649 antibody, or by negative control Rabbit IgG, and revelation by Western blot analysis using 1:2000 SY4649 antibody. E, Enzymatic conversion of cortisol (F compound) and corticosterone (B compound) in positive control renal KC3AC1 cells (Viengchareun et al, 2009) and HK-GFP-MR cells. Cells were incubated at 37°C with 100 nM cortisol or corticosterone for 16 h in steroid-free medium. Cortisol and its metabolite cortisone (E compound), corticosterone and its metabolite 11- dehydrocorticosterone (A compound) concentrations were measured in the cell supernatants by LC-MS/MS method (Travers et al, 2017). Conversion was calculated as the ratio [E/(E+F)] (or [A/(A+B)]). Results are expressed as means ± SEM of three independent measurements.

Figure 2. Aldosterone and cortisol induced nuclear translocation of the GFP-hMR. Automated quantification of GFP-hMR nuclear translocation kinetics by automated High- Throughput Microscopy (Amazit et al, 2015). HK-GFP-MR cells were cultured in medium supplemented with 2.5% charcoal-stripped fetal bovine serum. Forty-eight h after, cells were treated with either 10-7 M aldosterone (higher panels) or 10-7 M cortisol (lower panels) for 1 h and fluorescence signal was captured every 15 min.

136

Résultats : Troisième Partie

Figure 3. Transcriptional activation of the PER1 gene under MR and GR agonist or antagonist exposure in HK-GFP-MR cells. After 48 h steroid deprivation, HK-GFP-MR cells were treated for 1 h with different treatments. A, Cells were treated with 1, 10 or 100 nM aldosterone (A) or cortisol (F). B, Cells were treated with 100 nM aldosterone (A), alone or in combination with 10 µM finerenone (φ) or RU486 (RU). C, Cells were treated with 100 nM cortisol (F), alone or in combination with 10 µM finerenone (φ) or RU486 (RU). A, B and C, RNAs were extracted and reverse transcribed, relative PER1 expression levels were quantified by quantitative PCR using specific primers for PER1. Data are means ± SEM of 1 experiment performed in triplicates. Statistical significance was calculated with the Kruskal-Wallis nonparametric tests followed by post test of Dunns. * or $ or § P < 0.05 vs. vehicle (*), aldosterone ($), or cortisol (#).

Figure 4. Ligand-induced MR and GR recruitment on PER1 promoter in HK-GFP-MR cells. After 48 h steroid deprivation, HK-GFP-MR cells were treated for 1 h with 1:1000 ethanol (V), 100 nM aldosterone (A), 100 nM cortisol (F), 1 µM finerenone (φ) or 1 µM RU486 (RU), alone or in combination. Cells were fixed by paraformaldehyde and lysed. After shearing, chromatin extracts were immunoprecipitated by the anti-MR SY4649 antibody (panel A) or anti-GR H-300 antibody (panel B) or by the negative control Rabbit IgG. Eluted and purified DNAs were quantified by real- time qPCR, with primer pairs encompassing the PER1 promoter’s GRE. Data are expressed as %input, and are means ± SEM of 3 independent experiments performed in triplicate. Statistical significance was calculated with the Kruskal-Wallis nonparametric test followed by post test of Dunns. * or $ P < 0,05, ** or §§ P < 0.01, *** or $$$ P < 0.001 vs. vehicle (*), aldosterone ($) or cortisol (#). ns: not significant vs. vehicle.

Figure 5. Dynamics of aldosterone-bound MR recruitment on the PER1 promoter. After 48 h steroid deprivation and 2 h pretreatment with 2.5 µM α-amanitin, cells were washed and incubated in media supplemented with 2.5% DCC FBS including 100 nM aldosterone. Then, chromatin was prepared on sampled cells at 5 min intervals for 120 min. ChIP experiments were performed using the anti-MR SY4649 antibody. The amount of immunoprecipitated PER1 promoter was quantified by quantitative PCR. Values, expressed as % input, are means ± SEM of one sample quantified in triplicate. Graphs illustrated three independent experiments (#1, #2, and #3). Red dotted lines represent the fitted sine curves.

137

Résultats : Troisième Partie

Figure 6. Dynamics of aldosterone-induced SRC-1 and RNA Polymerase II recruitment on the PER1 promoter. After 48 h steroid deprivation and 2 h pretreatment with 2.5 µM α-amanitin, cells were washed and incubated in media supplemented with 2.5% DCC FBS including 100 nM aldosterone. Then, chromatin was prepared on sampled cells at 5 min intervals for 120 min. ChIP experiments were performed using the anti-MR SY4649 antibody (upper and lower panels, red dotted lines) or the anti-SRC1 M-341 antibody (upper panel, green dotted line) or the anti-Pol II H-224 antibody (lower panel, green dotted line). The amount of immunoprecipitated PER1 promoter was quantified by quantitative PCR. Values, expressed as % input, are means ± SEM of one experiment performed in triplicate. Solid lines represent the raw data, and red and green dotted lines represent the fitted sine curves.

Figure 7. Dynamics of cortisol-liganded MR and GR recruitment on the PER1 promoter. After 48 h steroid deprivation and 2 h treatment with 2.5 µM α-amanitin, cells were washed and incubated in media supplemented with 2.5% DCC FBS including 100 nM aldosterone (A) or 100 nM cortisol (B, C and D). Then, chromatin was prepared on sampled cells at 5 min intervals for 120 min. ChIP experiments were performed using the anti-MR SY4649 antibody (A, B and C) or the anti-GR H-300 (D). The amount of immunoprecipitated PER1 promoter was quantified by quantitative PCR. Values, expressed as % input, are means ± SEM of one experiment where each sample was quantified in triplicate. Solid lines represent raw data. Red dotted lines represent the fitted sine curves for MR bound to aldosterone (A) or cortisol (B and C), or GR bound to cortisol (D).

Figure 8. MR and GR co-recruitment or MR-GR heterodimerization on the PER1 promoter in HK-GFP-MR treated by agonist ligands. Forty-eight h after steroid deprivation, HK-GFP-MR cells were treated 1 h by 1:1000 ethanol (V), 100 nM aldosterone (abbreviated as A) or 100 nM cortisol (F compound). Cells were fixed by paraformaldehyde and lysed. Left panels (A and D), After shearing, chromatin extracts were assayed for ChIP using the anti- MR SY4649 antibody (A), the anti-GR H-300 antibody (D) or the negative control Rabbit IgG (abbreviated as C in all panels). The next day, MR or GR bound and unbound chromatin were assayed by tandem ChIP and serial ChIP experiments, respectively. Middle panels, Serial ChIP. B, MR-unbound chromatin was used for a new ChIP experiment using the anti-GR H-300 antibody. E, GR-unbound chromatin was used for a new ChIP experiment using the anti-MR SY4649 antibody.

138

Résultats : Troisième Partie

Right panels, Tandem ChIP. C, MR-bound chromatin was eluted and re-immunoprecipitated by the anti-GR H-300 antibody or by the negative control Rabbit IgG. F, GR-bound chromatin was eluted and re-immunoprecipitated by the anti-MR SY4649 antibody or by the negative control Rabbit IgG. All panels, Eluted and purified DNAs were quantified by real-time qPCR, using a primer pair encompassing the PER1 promoter’s GRE. Data are expressed as % input of the corresponding chromatin and are means ± SEM of 2 independent experiments performed in triplicate. Statistical significance was calculated with the Mann-Whitney nonparametric test. * P < 0.05 vs. vehicle (*).

139

Résultats : Troisième Partie

10. Expanded View Figure legends

Figure EV1. Binding assays on reticulocytes lysates expressing hMR or hGR. Reticulocyte lysates were prepared as described in Materials and Methods section, and incubated with 20 nM [3H]-cortisol and a 500-fold excess of cortisol (F compound), finerenone (φ) or RU486 for 4 h at 4°C. Bound and unbound ligands were separated by the dextran-charcoal method (see Material and Methods section). Bound steroid was measured by counting the radioactivity of the supernatant and expressed in nM. Results are mean ± SEM of triplicate from one experiment.

Figure EV2. Expression of the HSD11B2 gene at the transcript level in HK-GFP-hMR and KC3AC1 cells. RNAs were extracted and reverse transcribed. PCR were performed using specific primers for HSD11B2 or a control housekeeping gene (ACTB for HK-GFP-hMR cells, 36b4 for KC3AC1 cells). Transcript levels were assessed by agarose gel electrophoresis.

Figure EV3. Ligand-induced MR and GR recruitment on a negative control locus in HK-GFP- MR cells. After 48 h steroid deprivation, HK-GFP-MR cells were treated for 1 h with 1:1000 ethanol (V), 100 nM aldosterone (A), 100 nM cortisol (F), 1 µM finerenone (φ) or 1 µM RU486 (RU), alone or in combination. Cells were fixed by paraformaldehyde and lysed. After shearing, chromatin extracts were immunoprecipitated by the anti-MR SY4649 antibody (panel A), anti-GR H-300 antibody (panel B) or by the negative control Rabbit IgG. Eluted and purified DNAs were quantified by real-time qPCR, with primer pairs encompassing the negative control near the SCNN1A promoter GRE. Data are expressed as % input, and are means ± SEM of 3 independent experiments performed in triplicate. Note that the y-axis scale (% input) was identical to as in Figure 4 to ease comparison. Statistical analysis was performed using the Kruskal-Wallis nonparametric test followed by post test of Dunns and revealed no significant difference (ns).

Figure EV4. MR and GR co-recruitment or MR-GR heterodimerization on the PER1 promoter in HK-GFP-MR treated by agonist ligands. Forty eight h after steroid deprivation, HK-GFP-MR cells were treated 1 h by 1:1000 ethanol (V), 100 nM aldosterone (abbreviated as A) or 100 nM cortisol (F compound). Cells were fixed by paraformaldehyde and lysed. Left panels (A and D), After shearing, chromatin extracts were assayed for ChIP using the anti- GR H-300 antibody (A), the anti-MR SY4649 antibody (D) or the negative control Rabbit IgG

140

Résultats : Troisième Partie

(abbreviated as C in all panels). The next day, GR or MR bound and unbound chromatin were assayed by tandem ChIP and serial ChIP experiments respectively. Middle panels, Serial ChIP. B, MR-unbound chromatin was used for a new ChIP experiment using the anti-MR SY4649 antibody. E, GR-unbound chromatin was used for a new ChIP experiment using the anti-GR H-300 antibody. Right panels, Tandem ChIP. C, MR-bound chromatin was eluted and re-immunoprecipitated by the anti-MR SY4649 antibody or by the negative control Rabbit IgG. F, GR-bound chromatin was eluted and re-immunoprecipitated by the anti-GR H-300 antibody or by the negative control Rabbit IgG. All panels, Eluted and purified DNAs were quantified by real-time qPCR, using a primer pair encompassing the PER1 promoter’s GRE. Data are expressed as % input of the corresponding chromatin and are means ± SEM of 2 independent experiments performed in triplicate. Statistical significance was calculated with the Mann-Whitney nonparametric test. * P < 0.05 vs. vehicle (*).

Figure EV5. MR and GR co-recruitment or heterodimerization on a negative control locus in HK-GFP-MR treated by agonist ligands. Forty-eight hours after steroid deprivation, HK-GFP-MR cells were treated 1 h by 1:1000 ethanol (V), 100 nM aldosterone (abbreviated as A) or 100 nM cortisol (F compound). Cells were fixed by paraformaldehyde and lysed. Panels A, D, G and J, After shearing, chromatin extracts were assayed for ChIP using the anti-MR SY4649 antibody (A and J), the anti-GR H-300 antibody (D and G) or the negative control Rabbit IgG (abbreviated as C in all panels). The next day, MR or GR bound and unbound chromatin were assayed by tandem ChIP and serial ChIP experiments respectively. Panels B, E, H and K, Tandem ChIP: MR-bound chromatin (B and E) or GR-bound chromatin (H and K) were eluted and re-immunoprecipitated by the anti-MR SY4649 antibody (B and K), the anti-GR H-300 antibody (E and H) or by the negative control Rabbit IgG. Panels C, F, I and L, Serial ChIP: MR-unbound chromatin (C and F) or GR-unbound chromatin (I and L) were used for a new ChIP experiment using the anti-MR SY4649 antibody (C and L) or the anti-GR H-300 antibody (F and I).

141

Résultats : Troisième Partie

All panels, Eluted and purified DNAs were quantified by real-time qPCR, using a primer pair encompassing a negative control locus located near the SCNN1A promoter’s GRE. Data are expressed as % input of the corresponding chromatin and are means ± SEM of 2 independent experiments performed in triplicate. Note that the y-axis scale (% input) was identical as in panels A’, D’, G’ and J’ to ease comparison. Statistical analysis was performed using the Mann-Whitney nonparametric test and reached no significant difference (ns).

142

Résultats : Troisième Partie

Figure 1. HK-GFP-hMR cells stably express endogenous and functional MR and GR, overexpress GFP-hMR fusion protein, but do not express 11βHSD2.

143

Résultats : Troisième Partie

Figure 2. Aldosterone and cortisol induced nuclear translocation of the GFP-hMR.

144

Résultats : Troisième Partie

Figure 3. Transcriptional activation of the PER1 gene under MR and GR agonist or antagonist exposure in HK-GFP-MR cells.

145

Résultats : Troisième Partie

Figure 4. Ligand-induced MR and GR recruitment on PER1 promoter in HK-GFP-MR cells.

146

Résultats : Troisième Partie

Figure 5. Dynamics of aldosterone-bound MR recruitment on the PER1 promoter.

147

Résultats : Troisième Partie

Figure 6. Dynamics of aldosterone-induced SRC-1 and RNA Polymerase II recruitment on the PER1 promoter.

148

Résultats : Troisième Partie

Figure 7. Dynamics of cortisol-liganded MR and GR recruitment on the PER1 promoter.

149

Résultats : Troisième Partie

Figure 8. MR and GR co-recruitment or MR-GR heterodimerization on the PER1 promoter in HK-GFP- MR treated by agonist ligands.

150

Résultats : Troisième Partie

Figure EV1. Binding assays on reticulocytes lysates expressing hMR or hGR.

151

Résultats : Troisième Partie

Figure EV2. Expression of the HSD11B2 gene at the transcript level in HK-GFP-hMR and KC3AC1 cells.

152

Résultats : Troisième Partie

Figure EV3. Ligand-induced MR and GR recruitment on a negative control locus in HK-GFP-MR cells.

153

Résultats : Troisième Partie

Figure EV4. MR and GR co-recruitment or MR-GR heterodimerization on the PER1 promoter in HK- GFP-MR treated by agonist ligands.

154

Résultats : Troisième Partie

Figure EV5. MR and GR co-recruitment or heterodimerization on a negative control locus in HK-GFP- MR treated by agonist ligands.

155

Résultats : Troisième Partie

B. Données complémentaires et autres éléments de discussion

Dans cette troisième partie de ma thèse, nous avons apporté de nouveaux éléments sur la compréhension de la sélectivité minéralocorticoïde dans les tissus cibles de l’aldostérone. Nous avons montré que dans des cellules rénales humaines dépourvues de 11βHSD2, exprimant la protéine de fusion GFP-hMR ainsi que le MR et le GR endogène, le cortisol comme l’aldostérone entraînent l’activation de la transcription du gène PER1. Cette activation est associée au recrutement du MR et du GR sur le GRE localisé dans le promoteur de PER1. Nous avons mis en évidence pour la première fois que le recrutement du MR sur la chromatine est dynamique et cyclique. Ce recrutement du MR est concomitant à celui du coactivateur transcriptionnel SRC-1 alors que celui de l’ARN Pol II est différé d'une dizaine de minutes. Nous avons également montré que la dynamique de recrutement du MR suit deux phases et que le rythme de la phase initiale est sensiblement plus rapide en présence de cortisol qu'en présence d'aldostérone. Enfin, nous montrons grâce à des approches de ChIP séquentiels que, après stimulation par l’aldostérone ou le cortisol, le MR et le GR se lient sur le promoteur du gène PER1 sous la forme d’homodimères mais aussi d’hétérodimères. L’ensemble de ces résultats permet de mieux comprendre les mécanismes de sélectivité des hormones et de leurs récepteurs corticostéroïdes dans un contexte non-physiologique où les deux hormones sont à égales concentrations. Cependant, nos choix expérimentaux présentent certaines limites, et de nombreuses interrogations restent malgré tout sans réponse.

Comment interpréter des variations dans le temps des dynamiques de recrutement génomique ? Quelles incidences cela a-t-il sur l’efficacité transcriptionnelle ?

Dans l’Article 3, nous montrons pour la première fois que le MR et le GR sont recrutés de façon dynamique et cyclique sur un promoteur endogène et dans des cellules rénales humaines. L’identification par ChIP d’une interaction entre un facteur de transcription et une région génomique régulatrice ne présente qu’une vue statique d’une régulation. Cela est utile pour la recherche de gènes cibles candidats pour un facteur de transcription, comme nous l’avons fait pour le MR dans l’Article 1 en développant l’approche de ChIP-Seq. Cependant, la transrégulation par les récepteurs nucléaires est un phénomène dynamique, qui varie de façon gène-spécifique

156

Résultats : Troisième Partie

et tissu-spécifique (Takahashi, 2017; Weikum et al., 2017). Ainsi, nos résultats de ChIP cinétique représentent une avancée majeure dans la compréhension de la signalisation du MR.

Métivier et al. ont été les premiers à étudier la dynamique de recrutement d’un récepteur stéroïdien, le ERα, par ChIP cinétique (Métivier et al., 2003). Ils démontrent que, sur le promoteur du gène pS2 après transfection, le recrutement du ERα induit par l’œstradiol se compose d’un premier cycle de 30 min où l’ARN Pol II n’est pas recrutée, donc supposé transcriptionnellement improductif, et lors duquel la chromatine est ouverte et marquée pour rester accessible. Puis suivent des cycles de 40 min induisant le recrutement de l’ARN Pol II. Ils ont alors défini le concept d’horloge transcriptionnelle pour désigner l’assemblage séquentiel et combinatoire d’un complexe de pré-initiation de transcription qui soit productif sur un promoteur. Afin de valider la mise en place du complexe transactivateur sur le promoteur de pS2, l’expression du gène a été mesurée par RT qPCR à un temps fixe : après 3 h de traitement par l’œstradiol. Le nombre de transcrit du gène est bien augmenté en présence d’œstradiol. Dans notre Article 1, nous démontrons que le recrutement aldostérone-induit du MR, de SRC-1 et de l’ARN Pol II sur le promoteur de SCNN1A induit sa transactivation en 4 h. Nous avons été plus loin avec PER1, et avons montré que 30 min de stimulation par l’aldostérone suffisent à induire une augmentation significative du niveau d’expression des transcrits (Figure 21). Cela impliquait une mise en place rapide de la machinerie transcriptionnelle liée au MR sur le promoteur de PER1. Dans le présent article, nous montrons que 20 min suffisent, en effet, au complexe aldostérone-MR pour induire le recrutement de l’ARN Pol II. Nous pouvons donc conclure que l’assemblage de l’horloge transcriptionnelle productive sur le promoteur de PER1 est un phénomène extrêmement précoce, tout au moins pour ce locus et ce gène. Dans l’Article 1, nous montrons plus globalement que le recrutement du complexe aldostérone-MR en 1 h sur un locus est positivement corrélé à une transactivation à court, moyen ou long terme du gène correspondant (entre 30 min et 24 h). On peut ainsi émettre l’hypothèse que pour un gène tardif, comme PTPN1, l’assemblage de l’horloge transcriptionnelle productive serait plus retardé par rapport au gène induit précocement comme PER1, ou le gène intermédiaire SCNN1A. Pour vérifier cette hypothèse, nous pourrions utiliser la stratégie de ChIP cinétique, appliquée au MR, à ses corégulateurs et aux enzymes modifiant le code histonique (Reid et al., 2009), et réaliser les qPCR avec les amorces spécifiques des gènes cités ci-dessus.

157

Résultats : Troisième Partie

Figure 21 : Expression des ARNm du gène PER1 en fonction de la durée d’exposition à l’aldostérone. Les cellules HK-GFP-hMR ont été traitées durant des temps variables par 100 nM d’aldostérone ou par le véhicule, puis lysées. Les ARN totaux ont été isolés, rétrotranscrits et quantifiés par PCR en temps réel en utilisant des primers spécifiques du transcrit de PER1. Les résultats sont corrigés par la valeur de référence du gène 18S, et normalisés par celle de la condition véhicule correspondante. Les résultats sont exprimés sous la forme de moyennes ± l’erreur standard. * P<0,05, ** P<0,01, *** P<0,001 vs V.

Nous démontrons dans cette étude que la dynamique de recrutement du complexe- aldostérone est coordonnée avec celle du recrutement de SRC-1, et coïncide avec un recrutement dynamique, cyclique et différé de l’ARN Pol II. Pour les expériences de ChIP avec l’ARN Pol II, nous avons utilisé l’anticorps polyclonal H-224 (scbt-9001X, Santa Cruz Biotechnology) qui reconnaît toutes les formes d’ARN Pol II. Or, il a été montré que le recrutement et l’activité de cette enzyme sont soumis à un code de phosphorylation bien spécifique de certaines sérines dans son domaine C-terminal (Chapman et al., 2007; Phatnani and Greenleaf, 2006). La sérine 5 est phosphorylée pendant l’initiation de la transcription, la sérine 2 phosphorylée marque une ARN Pol II active et positionnée en 3’ d’un gène, et enfin la phosphorylation de la sérine 7 est le signe repéré pendant l’élongation. Le passage d’une forme à l’autre est notamment dirigée par un signal hormonal, comme cela a été montré pour ERα activé par l’oestradiol (Welboren et al., 2009). Il serait intéressant de réaliser les ChIP cinétiques dirigées sur l’ARN Pol II avec des anticorps reconnaissants spécifiquement ces formes phosphorylées. Pour le gène PER1, il est alors probable que nous aurions observé un recrutement précoce des trois formes de l’ARN Pol II, puis la persistance de la forme contenant la phosphosérine 7 sur une plus longue durée. Ces informations renforceraient l’importance des PTM sur le recrutement des complexes de pré- initiation de la transcription, et la dynamique de celui-ci.

158

Résultats : Troisième Partie

Dans la présente étude, nous avons mis en évidence par ChIP cinétique que les complexes aldostérone-MR, cortisol-MR et cortisol-GR se lient au MRE du promoteur de PER1 de façon dynamique et cyclique. L'analyse des données a suggéré la présence de deux phases dans le recrutement des récepteurs au cours des 120 min qu'ont duré les expériences. Les 50 premières minutes sont composées de cycles de faible amplitude, et de fréquence plus rapide (cycles courts), notamment en présence de cortisol (12,6 min pour le MR et le GR) en comparaison à l’aldostérone (14 min pour le MR). Ensuite, les cycles ont une amplitude plus importante et une fréquence supérieure (cycles plus longs de 25 min). Nous avons essayé d’appliquer des modèles statistiques pour l’analyse de nos données, en utilisant le logiciel dédié GraphPad Prism. Or, la recherche automatique de courbes pouvant modéliser les variations que nous observons a été infructueuse. C’est seulement en modifiant manuellement les paramètres cinétiques de courbes ondulatoires, tel que la fréquence, la phase et l’amplitude, que nous avons obtenu les courbes d'ajustement présentées dans l’article. Pourtant, ni les différences d’amplitude et de fréquence entre les deux phases, ni les différences entre les conditions (aldostérone vs cortisol, MR vs GR) n'ont pu être validées sur le plan statistique. Face à cette limite, nous avons choisi de demander l’aide d’un biostatisticien ou d’un mathématicien, qui pourrait tester la validité de nos interprétations et conclusions.

Mieux caractériser les mécanismes de l’horloge transcriptionnelle liée au MR dans le rein servirait à la fois à caractériser les effets à court et à long terme de l’aldostérone, et à mieux comprendre les effets pathologiques d’un dérèglement de la signalisation minéralocorticoïde. Cela permettrait aussi de servir de référence à ce qui pourrait être également étudié dans d’autres cellules cibles ou tissus cibles de l’aldostérone.

Existe-t-il un hétérodimère MR-GR ? Si oui, quel est son rôle ?

Dans l’Article 3, les approches de ChIP et de tandem ChIP ont permis de montrer que sur le promoteur de PER1 une partie des complexes aldostérone-MR se lie de façon concomitante avec ceux du GR, et vice-versa pour le complexe cortisol-GR avec le MR. Puisqu’un seul GRE palindromique est présent dans ce locus, cela suggère fortement que le MR et le GR se lient sous forme d’hétérodimères. Comme présenté en introduction, plusieurs études ont démontré l’existence de ces hétérodimères MR-GR in vitro, dans des modèles neuronaux majoritairement (Trapp et al., 1994; Liu et al., 1995; Ou et al., 2001; Nishi et al., 2004). L’utilisation du promoteur artificiel du MMTV contenant un GRE palindromique et 3 hémi-GRE a d’abord permis de montrer

159

Résultats : Troisième Partie

que le MR se lier sous forme homodimérique, et ensuite sous forme d’hétérodimères MR-GR (Cato and Weinmann, 1988; Govindan et al., 1991). Nous montrons que ces structures MR-GR peuvent aussi être retrouvées dans des cellules épithéliales du néphron, où leur rôle reste à définir. Dans des modèles cellulaires hippocampaux, en situation de stress, l’hétérodimère MR- GR transactive certaines cibles, comme Per1, Sgk1 ou Fkbp5 en se liant à des GRE palindromiques (Mifsud and Reul, 2016), et transréprime d’autres cibles, comme Htr1a (codant pour le récepteur à la sérotonine), via des GRE négatifs (nGRE) (Ou et al., 2001). Les glucocorticoïdes dans l’hippocampe agissent à faibles doses sur le MR, et aux fortes doses (situation de stress) sur le MR et le GR : le rôle de l’hétérodimère MR-GR est probablement impliqué dans une régulation fine de la réponse au stress. Dans les cellules HK-GFP-hMR, on peut supposer que l’hétérodimère a une part active dans la transrégulation de PER1. Dans le rein, on peut supposer plus globalement qu’il régule de façon plus fine la transrégulation de certaines des cibles génomiques de l’aldostérone et du cortisol.

Plusieurs stratégies peuvent être développées pour mieux appréhender le rôle des hétérodimères MR-GR. La première consisterait en l’utilisation d’antagonistes sélectifs du MR (finérénone) ou du GR (CORT125134). In vitro, dans les cellules HK-GFP-hMR, le traitement par l’un de ces antagonistes serait réalisé en amont d’expériences de ChIP et tandem ChIP. La finérénone est un antagoniste passif qui ne permet pas le recrutement de corégulateur transcriptionnel (Amazit et al., 2015). De plus, nous avons montré dans l'Article 2 que la finérénone se comporterait comme un agoniste inverse en diminuant la liaison basale du MR sur l'ADN. Ainsi, un cotraitement des cellules par le cortisol et la finérénone, permettrait de s'affranchir au moins en partie du MR. L'étude de la dynamique de recrutement du GR dans ces conditions serait donc particulièrement informative. Plusieurs autres combinaisons de ligands pourraient être testées et viendraient solidement soutenir ou invalider l’hypothèse d’un hétérodimère MR-GR. L’inconvénient des expériences de ChIP est que le fait de fixer la chromatine avec le PFA, ce qui ne permet pas de distinguer les interactions protéine-protéine directes et indirectes. Même si la possibilité d’une structure hétérodimérique est très forte, notamment de par la présence d’un unique GRE/MRE palindromique, d’autres approches doivent compléter ces expériences.

La seconde stratégie pour observer l’occurrence d’hétérodimère est l’utilisation de siRNA, ou petits ARN interférents. Ces ARN double brin de 20 à 35 pb, en collaboration avec un complexe enzymatique RISC (pour RNA-induced silencing complex), vont cibler des ARNm cibles et entraîner leur dégradation par des exonucléases. En incubant les cellules HK-GFP-hMR avec un siRNA spécifique du MR, ou du GR, et en renouvelant les expériences de ChIP et tandem ChIP,

160

Résultats : Troisième Partie

nous pourrions affirmer ou infirmer l’hypothèse d’hétérodimérisation. Dans le cas d’une cible génomique commune, il faudrait aussi analyser la transcription des gènes cibles et voir si les niveaux de transcrits sont identiques en l’absence d’un des récepteurs. La limite de la distinction entre hétérodimérisation et interaction indirecte resterait posée.

Pour dépasser cette limite, une troisième stratégie peut compléter les deux stratégies décrites précédemment. Il s’agit de l’étude de récepteurs mutés dans la boucle de dimérisation, ou boucle D, présente et identique dans le DBD du MR et du GR. Cette boucle est indispensable pour la dimérisation des récepteurs, mais pas suffisante (Jewell et al., 2012). L’équipe du Pr Pearce avait déjà généré des mutants « dim » du GR (D481R) et du MR (R643D) de rat empêchant l’homodimérisation, n’ayant pas d’influence sur la capacité à lier l’ADN, et favorisant la formation d’hétérodimère (Liu et al., 1995) (Figure 22). Dans des cellules comportant un vecteur rapporteur luciférase et traitées avec 10 nM de corticostérone, chaque mutant transfecté seul présentait une activité transcriptionnelle très faible en comparaison du récepteur sauvage. Par contre, les deux mutants transfectés ensemble possédaient une activité similaire à celle des récepteurs sauvages. Il s’agissait d’un argument fort in vitro en faveur de la possibilité de l’hétérodimérisation MR-GR. Il serait particulièrement pertinent de générer trois mutants stables : un mutant MR D645R (MR +/+), un mutant GR D481R (GR -/-) et un double mutant GR R479D- D481R (GR -/+). La nécessité de générer des mutants stables, malgré les difficultés que cela représente, est surtout motivée par l’absence de biais d’efficacité qui survient lors des transfections transitoires. Les mutants MR +/+ et GR -/- cotransfectés ne pourront former que des hétérodimères alors que la cotransfection du MR sauvage et du double mutant GR -/+ ne pourrait conduire qu'à la formation d'homodimères. Des expériences de ChIP et de tandem ChIP avec ces mutants pourraient valider ou invalider l’occurrence des hétérodimères sur un locus particulier. Ces différentes expériences permettraient de démontrer, de façon certaine, la présence ou l’absence d’hétérodimères MR-GR in vitro.

161

Résultats : Troisième Partie

Figure 22 : Stratégie des mutants dim du MR et du GR de rat pour l’étude des hétérodimères MR- GR. A, Séquence du DBD (ou ZFR pour Zing Fingers Region) du MR et du GR de rat, qui sont identiques. La boucle P est encadrée. L’arginine et l’aspartate de la boucle D impliqués dans la formation de pont salin entre les deux récepteurs sont indiqués, et mis entre parenthèse pour le GR, ainsi que leur mutation. B, Les différentes combinaisons de mutants dim du DBD. (i) Les deux récepteurs sauvages (wild type) forment des ponts salins. (ii) et (iii) Une population de récepteur portant une mutation de l’un des deux acides aminés (MR R643D ou GR D481R) ne peut pas former de dimères. (iv) La cotransfection des deux mutants ensemble entraînent la formation obligatoire d’hétérodimères. Figure extraite de la référence (Liu et al., 1995).

Il serait intéressant de comprendre comment un GRE peut être ciblé préférentiellement par un homodimère ou un hétérodimère. Ou et al. ont identifié un GRE négatif (nGRE, 2 hexanucléotides en répétition directe séparés par six pb) dans le promoteur de Htr1a où un hétérodimère MR-GR est susceptible d’interagir. Dans les HK-GFP-hMR, l’hétérodimère se lie théoriquement sur un palindrome classique dans le promoteur de PER1, où les deux hémi-sites sont séparés par trois paires de bases. Il est vraisemblable que le MR et le GR puissent reconnaitre les deux types de motifs et adopter des postures différentes selon les loci. Dans leurs travaux sur les cistromes du MR et du GR dans l’hippocampe, van Weert et al. ont noté que les

162

Résultats : Troisième Partie

loci identifiés comme communs au MR et au GR présentent tous un GRE palindromique et un hémi-GRE. Les auteurs suggèrent alors que le MR et le GR peuvent se lier sous forme homo- ou hétérodimériques sur le GRE, et collaborer avec un monomère de proximité (van Weert et al., 2017). L’équipe du Dr Hager travaille sur l’importance de la séquence d’ADN sur la structure quaternaire qu’adopte le GR. En utilisant des approches d’imagerie dans un système cellulaire artificiel, ils ont récemment montré que le GR était capable de former des homotétramères, ainsi que des homodimères et des monomères, selon la séquence d’ADN étudiée (Presman et al., 2016). De façon tout à fait intéressante, ils suggèrent que l’homotétramère pourrait se former entre deux homodimères liés à des loci distants de plusieurs kilobases. La proximité entre les deux loci s’expliquerait par une boucle chromatinienne maintenue par l’homotétramère en conformation tête-bêche (Figure 23). Il serait donc particulièrement intéressant d'évaluer la capacité du MR à former des tétramères et, en intégrant la capacité du MR et du GR à former des hétérodimères, d'évaluer l'occurrence de la formation d'hétérotétramères (MR2-GR2 ou (MR-GR)2).

Figure 23 : Modèle d’une structure quaternaire de GR en homotétramère. Le GR activé par le cortisol (représenté par une étoile) forme des dimères à travers d’interactions DBD- DBD et LBD-LBD. Le dimère se lie dans le génome, souvent à très longue distance du gène cible, sur des GRE. Le changement de conformation que l’ADN entraîne dans le DBD se propagerait jusqu’au LBD et permettrait au dimère de GR de former des tétramères. Le tétramère, tête-bêche, pourrait alors via un phénomène de boucle chromatinienne, se lier à d’autres facteurs de transcription (TF) à proximité du TSS de la cible. Selon l’hypothèse de (Presman et al., 2016).

163

Résultats : Troisième Partie

Enfin, des études ont mis en évidence un autre mode de transrégulation du GR : le tethering ou ancrage. En étudiant chez la souris le mutant dim du GR, incapable de former un homodimère ou un hétérodimère et par conséquent ne liant pas directement l’ADN, il a été montré que le GR régule certaines cibles génomiques en se liant à d’autres facteurs de transcription, ou tethering. Par ce mécanisme, le GR monomérique favorise des effets transrépresseurs (Robertson et al., 2010). L’hypothèse a été faite que le tethering pouvait être une des activités majeures du GR et qu’une partie de son activité transcriptionnelle consiste à réguler l’activité d’autres facteurs de transcription (Reichardt et al., 2001).

En conclusion, il serait donc possible pour le MR et le GR, d’imaginer un certain nombre de structures quaternaires non explorées jusqu’à présent, qui représenteraient chacune un niveau supplémentaire de régulation fine de l’activité d’un locus particulier dans un tissu donné à un état physiologique précis (Figure 24). L’ensemble de ces résultats met en avant la complexité des mécanismes de transrégulation mis en jeu dans les voies de signalisation minéralocorticoïde et glucocorticoïde, seules ou associées.

Qu’en est-il des cibles génomiques spécifiques du MR et du GR dans le rein ?

Les résultats que nous présentons ont été obtenus sur le gène PER1, cible commune au MR et au GR (Mifsud and Reul, 2016). Nous avions montré dans l’Article 1 que, dans les cellules HK- GFP-hMR que nous avons également utilisées dans la présente étude, le recrutement aldostérone-induit du MR sur le GRE du promoteur de PER1 est corrélé à une transactivation précoce de ce gène par l’aldostérone (Le Billan et al., 2015). Le but de notre étude était ici d’étudier la similitude ou la divergence des signalisations impliquant le MR et le GR, d’où le choix de ce site commun de liaison. Nonobstant, il sera intéressant d’étudier l’activité transrégulatrice et la dynamique de recrutement du MR et du GR sur des gènes sélectifs pour l’un des deux récepteurs. Pour le MR, l’exemple du gène KCNIP3, présenté dans le premier chapitre des résultats, pourrait être utilisé. Nous pourrions notamment vérifier l’absence de recrutement du GR sur ce locus.

164

Résultats : Troisième Partie

Figure 24 : Différentes hypothèses de structures quaternaires proposées pour le MR et le GR. Le récepteur, MR ou GR, (illustré en vert) activé par l’aldostérone ou le cortisol (schématisé sous la forme d’une étoile) se lie à l’ADN au niveau de GRE (rectangle rouge) ou par tethering sous différentes structures quaternaires. A, Le monomère, formant une interaction N/C intramoléculaire, peut se lier directement sur des demi-GRE. B, L’homodimère ou l’hétérodimère, lié par les DBD et par les LBD, peut se lier indirectement, en interagissant avec d’autres facteurs de transcription (TF), ou tethering. C et D, Le dimère peut se former via le DBD, et se lier directement sur un GRE en formant des interactions N/C intramoléculaires (C) ou intermoléculaires (D). E, Le dimère peut se lier sur un GRE à une longue distance du gène régulé et agir au sein d’une boucle chromatinienne. F et G, Un homo- ou hétéro-tétramère se lie directement au GRE en conformation tête-à-tête sur un seul GRE (F) ou tête-bêche sur deux GRE distants (G). H, Le tétramère peut aussi se positionner tête-bêche et interagir par tethering avec d’autres facteurs de transcription en formant une boucle chromatinienne. Dans toutes ces configurations, les liaisons intra et intermoléculaires sont vraisemblablement maintenues par des partenaires transcriptionnels qui ne sont pas représentés ici.

165

Résultats : Troisième Partie

Les 15 MBS caractérisés dans l’Article 1, communs au MR et au GR, contiennent tous des motifs GRE/MRE palindromique, tandis que le MBS du gène KCNIP3 contient deux hémi-sites MRE/GRE. En étudiant des cibles sélectives, il aurait été également intéressant de rechercher les motifs génomiques présents. En effet, si les GRE sont reconnus par le MR et le GR, il existe peut- être des motifs non identifiés qui expliqueraient la sélectivité d’un locus pour l’un des récepteurs. Van Weert et al. ont identifié les cistromes du MR et du GR par ChIP-Seq dans l'hippocampe de rats surrénalectomisés traités 1 h par de la corticostérone (van Weert et al., 2017). Leur analyse a mis en évidence 918 sites de liaison sélectifs du MR, 1450 sites sélectifs du GR, et 475 sites occupés de façon concomitante par les deux récepteurs. Une recherche de motif de novo leur a permis d’identifier un GRE plus ou moins dégénéré dans chacun des sites de liaison, mais aussi un motif Atoh1/NeuroD présent uniquement dans les sites sélectifs du MR. Ce motif Atoh1 est reconnu dans l’hippocampe par les facteurs de transcription NeuroD, qui lient indirectement le MR et le GR et agissent alors comme coactivateurs. La présence d’un motif Atoh1 à proximité des GRE des sites sélectifs du MR semble correspondre à un nouveau mécanisme de sélectivité du MR dans l’hippocampe. Nous avions identifié dans l’Article 1 des motifs récurrents dans les MBS identifiés dans les cellules rénales HK-GFP-hMR, correspondant aux facteurs de transcription AP- 1, EGR1, ou encore PAX5. Il serait intéressant, avec ce modèle, d’identifier le cistrome du GR, ce qui permettrait d’avoir une vision globale des cibles du GR dans des cellules rénales, de les comparer à celles identifiées dans le cistrome du MR, et d'identifier des motifs de liaison récepteur-sélectifs. La comparaison avec les cistromes du MR et du GR de l'hippocampe permettrait aussi de préciser des cibles tissu-spécifiques.

Afin d’aller plus loin dans la compréhension des rôles respectifs du MR et du GR dans le rein, nous pourrions envisager de réaliser des expériences in vivo. De la même façon que celle proposée dans le second chapitre des résultats, l’application du ChIP-Seq sur les reins de souris surrénalectomisées serait une bonne stratégie. Nous pourrions alors fixer les doses circulantes de corticostérone et d’aldostérone, et aussi utiliser des antagonistes sélectifs (finérénone pour le MR, CORT125134 (Hunt et al., 2017) pour le GR). L’identification des cibles transcriptionnelles en parallèle des cibles génomiques seraient tout à fait informative. Chadwick et al. avaient déjà entrepris d’identifier in vitro les transcrits régulés à la fois par l’aldostérone et par la prednisolone (agoniste du GR) dans les myotubes de muscle squelettique par microarray (Chadwick et al., 2017). Ils avaient alors montré que, dans ces cellules exprimant le MR, le GR et la 11βHSD2, les deux molécules entraînent une régulation de nombreux gènes communs (189), alors que seulement 11 gènes étaient spécifiques à l’aldostérone. La réalisation in vivo, sur les souris surrénalectomisées, d’analyses par RNA-Seq en parallèle des ChIP-Seq permettraient d’étudier

166

Résultats : Troisième Partie

à la fois les cibles génomiques et transcriptionnelles du GR, et de les comparer à celles du MR. En réalisant des études ontologiques, ces données serviraient de base pour de futures études sur l’implication en physiopathologie des nouveaux acteurs identifiés.

L’effet transcriptionnel relatif au MR et au GR sur leurs cibles génomiques communes dépend aussi de la quantité relative de chaque récepteur exprimée dans le tissu. Selon la loi d’action de masse, le récepteur le plus représenté est probablement celui qui aura l’effet transcriptionnel le plus fort. Dans les cellules du tubule contourné distal, le fait que le MR soit plus exprimé que le GR peut être un mécanisme majeur de sélectivité entre les deux signalisations corticostéroïdiennes. Dans l’hippocampe, où les deux récepteurs sont en quantité équivalente, il semble que ce soit la quantité de glucocorticoïde qui régit l’implication relative de chaque récepteur dans la réponse transcriptionnelle apportée (Joëls and de Kloet, 2017). L’hormone dans l’hippocampe régule aussi la quantité des récepteurs en modulant leur recyclage, ce qui ajoute à la régulation fine de cette signalisation (Conway-Campbell et al., 2007)

Quels sont les partenaires transcriptionnels des complexes aldostérone-MR et cortisol- GR ?

Une des limites de notre approche est l’étude du recrutement du seul coactivateur, SRC-1. La démonstration d’un recrutement dynamique et coordonné de SRC-1 avec le complexe aldostérone-MR est un résultat inédit et important pour avancer dans notre compréhension des mécanismes transcriptionnels impliquant le MR. Elle a demandé un travail important au niveau expérimental et analytique. Cependant, il serait tout à fait intéressant d’identifier l’ensemble des acteurs inclus dans les complexes de pré-initiation de la transcription du MR et du GR, en particulier dans les tissus épithéliaux. En effet, nous l’avons vu lors de l’introduction, peu de partenaires sélectifs d’un des récepteurs ont été identifiés (famille PIAS, RHA, Tesmine…) (Kitagawa et al., 2002; Tirard et al., 2004; Pascual-Le Tallec et al., 2005; Rogerson et al., 2014; Oakley et al., 2017). L’approche d’APMS, présentée dans la seconde partie des résultats (Cirillo et al., 2013), pourrait ici encore permettre de répondre à deux problématiques : 1) quels sont les partenaires transcriptionnels du MR et du GR liés au cortisol ? 2) Quels sont les corégulateurs du MR lié à l’aldostérone ou lié au cortisol ?

Nous avions mis au point l’approche d’APMS sur des extraits protéiques totaux de cellules HK-GFP-hMR traitées 1 h par 100 nM d’aldostérone, ou par le véhicule (Véhicule).

167

Résultats : Troisième Partie

L’immunoprécipitation du MR et de la GFP-hMR par l’anticorps 39N (Résultats Chapitre 1 (Viengchareun et al., 2009; Le Billan et al., 2015)) était validé par western blot, puis les échantillons étaient analysés par spectrométrie de masse, en collaboration avec la plateforme Protéomique Paris 5 (Dr Mayeux et Dr Guillonneau, 3P5, Université Paris-Descartes, Paris). L’analyse des résultats a montré que le MR et la GFP-hMR étaient détectés dans la condition Aldostérone. Par contre, certains des partenaires bien définis du MR, comme SRC-1, n’étaient pas détectés. En cela, l’analyse paraissait limitée et la comparaison entre les échantillons peu fiable. Des mises au point supplémentaires doivent encore être faites quant aux conditions d’IP, notamment l’étape finale d’élution des extraits protéiques.

Il semble évident que la nature et la combinaison de ces partenaires sont spécifiques du tissu et du locus (O’Malley et al., 2012). Appliquée dans le rein, l’APMS associée à des approches dynamiques comme les ChIP cinétiques devraient permettre de mieux caractériser les mécanismes de la sélectivité minéralocorticoïde.

168

DISCUSSION GÉNÉRALE

Discussion Générale

Mon travail de thèse a permis d’identifier des cibles génomiques du MR dans un modèle rénal humain, de caractériser certains mécanismes de la régulation transcriptionnelle par le complexe aldostérone-MR et d’éclaircir certains aspects des dualités aldostérone/cortisol et MR/GR.

Le développement de l’approche de ChIP-Seq sur le MR dans les cellules HK-GFP-hMR a permis d’identifier un set original et relativement exhaustif des cibles génomiques du complexe aldostérone-MR (MBS) dans un modèle rénal humain. L’analyse bioinformatique des MBS a permis de préciser l’élément de réponse spécifique aux minéralocorticoïdes (MRE), présent dans 25% des MBS, et ayant une séquence similaire de celle du GRE consensus. Elle a aussi permis l’identification d’autres motifs, correspondant à d’autres facteurs de transcription comme FOX, EGR1, AP-1 et PAX5, nous amenant à proposer un mode de liaison indirecte, ou «tethering», du MR sur certains loci. En parallèle, les investigations menées sur 15 MBS nous ont permis de mettre en évidence une corrélation positive entre le recrutement aldostérone-induit du MR sur les MBS et la transactivation, à court ou à long terme, des gènes correspondants (Le Billan et al., 2015).

Par ailleurs, nous avons caractérisé les mécanismes moléculaires de l’inhibition de la signalisation du complexe aldostérone-MR par la finérénone. Cet antagoniste sélectif non- stéroïdien, non seulement retarde la translocation nucléaire du MR, mais aussi prévient la phosphorylation et la dégradation du récepteur, induites par l’aldostérone. En 1 h, l’aldostérone active le recrutement concomitant du MR, de SRC-1 et de l’ARN Pol II sur le promoteur de SCNN1A. Ce phénomène est inhibé par la finérénone qui, de façon surprenante, inhibe également le niveau basal de recrutement du MR et de SRC-1. Ces données, supportées par la détermination du mode d’accommodation de la finérénone dans la cavité de liaison du MR, ont permis de définir le mode d’antagonisme "bulky passif" de la finérénone sur le MR (Amazit et al., 2015).

Enfin, l’utilisation d’une lignée exprimant le MR et le GR et exposée à des concentrations égales d’aldostérone et de cortisol a permis d’apporter des éléments nouveaux dans le décryptage des dualités aldostérone/cortisol et MR/GR dans les tissus cibles de l’aldostérone. Sur une cible génomique commune au MR et au GR, PER1, l’aldostérone et le cortisol sont tous deux capables d’induire une transactivation équivalente du gène. Le MR et le GR sont recrutés sur le GRE du promoteur de PER1, sous forme d’homodimères et d’hétérodimères. Enfin, nous avons mis en évidence que les deux récepteurs interagissent avec la chromatine de façon cyclique en mettant en jeu des paramètres dynamiques distincts, et variables selon la nature du ligand (Article 3). L’ensemble de ces résultats a permis d’apporter un faisceau d’arguments facilitant une meilleure compréhension de différentes étapes de la signalisation minéralocorticoïde.

169 Discussion Générale

A partir des données obtenues au cours de ce travail de thèse et des données de la littérature, il est possible de proposer un mécanisme de signalisation minéralocorticoïde rénale. Ce dernier peut se décrire schématiquement en 4 grandes étapes : les évènements cytoplasmiques, la liaison à l’ADN, le recrutement des corégulateurs transcriptionnels et enfin le recyclage du MR.

Les évènements cytoplasmiques

En l’absence de ligand, le MR est localisé principalement dans le cytoplasme. Il est monoubiquitinylé par interaction avec Tsg101, et est au sein d’un complexe hétéro-oligomérique comprenant les chaperonnes, la Hsp90 désacétylée, la Hsp70 et la cochaperonne FKBP-52, lui permettant d'être maintenu dans une conformation capable de lier ses ligands (Couette et al., 1996; Bruner et al., 1997; Faresse et al., 2012; Amazit et al., 2015; Jiménez-Canino et al., 2016b). La cochaperonne FKBP-52 module l’affinité du MR pour ses ligands (Jääskeläinen et al., 2011) et, de façon intéressante, son gène (FKBP5) est transactivé par le complexe aldostérone-MR (Le Billan et al., 2015). La liaison de l’aldostérone au MR entraîne plusieurs PTM indispensables au transfert nucléaire du MR et à son activité transcriptionnelle : des phosphorylations dans le NTD et sur le NLS0 (Walther et al., 2005; Kino et al., 2010; Amazit et al., 2015), une déphosphorylation dans le LBD (Shibata et al., 2013) et une désubiquitination (Faresse et al., 2012). Le cortisol se lie également au MR (Hellal-Levy et al., 1999; Dey et al., 2001). Néanmoins, les complexes MR- cortisol sont beaucoup plus labiles que ceux impliquant l'aldostérone. Cette différence pourrait se traduire par des PTM distinctes favorisant une signalisation minéralocorticoïde relayée par l'aldostérone plutôt que par le cortisol. Le complexe aldostérone-MR-Hsp90 se dissocie du complexe hétéro-oligomérique et passe à travers les pores nucléaires par liaison aux importines (Nishi and Kawata, 2007). Nous avons montré que dans les cellules HK-GFP-hMR, la quasi- totalité du MR est transférée dans le noyau après une heure d’exposition à l’aldostérone (Amazit et al., 2015). Des expériences à des temps plus précoces montrent que dès 15 min l’aldostérone comme le cortisol induit le transfert nucléaire du MR (Article 3). Des expériences sur des cinétiques encore plus courtes permettraient éventuellement de mettre en évidence des cinétiques de transfert différentes entre les deux hormones. Une fois dans le noyau, le complexe aldostérone-MR se dissocie de la Hsp90 et se dimérise (Grossmann et al., 2012). Aucune étude n’a été réalisée sur les dynamiques d’interaction entre les complexes hormone-MR et la Hsp90, et nous pouvons émettre l’hypothèse qu'en fonction de l'hormone liée, ces interactions soient plus ou moins labiles comme cela a été mis en évidence dans le cas des antagonistes (Rafestin-Oblin et al., 1992). La nature de l'hormone pourrait également influencer l'interaction avec l'ADN: des

170 Discussion Générale dynamiques d'interaction hormone-récepteur très rapides comme dans le cas du cortisol pourraient induire des dynamiques d'interactions avec les GRE très rapides (liaison/dissociation) et ainsi se traduire par une efficacité de transactivation réduite. Les observations obtenues grâce aux expériences de ChIP cinétiques vont effectivement dans ce sens (Article 3). Pour tester ces hypothèses, il faudrait identifier les PTM portées par le MR lié au cortisol, notamment par immunomarquage avec des anticorps spécifiques s’ils existent. Par ailleurs, l'utilisation d'approches par résonance plasmonique de surface (de type Biacore) permettraient de mesurer les paramètres dynamiques des interactions récepteur-Hsp90, et cela selon l'hormone liée.

La liaison à l’ADN

Le complexe hormone-MR dans le noyau forme des dimères se liant à l'ADN. Deux aspects dynamiques doivent être pris en compte : la dynamique d’interactions entre le récepteur et le ligand pouvant influencer celle entre le récepteur et l’ADN. L’étude de la dynamique d’interaction du récepteur avec l’ADN a récemment bénéficiée d’avancées technologiques majeures par le biais du suivi de molécules uniques (SMT pour Single-Molecule Tracking). Cette approche permet d’analyser à l’échelon de la seconde individuellement dans des cellules vivantes les paramètres de liaison d’un récepteur à l’ADN, notamment la durée de résidence et les fractions liées (Presman et al., 2014). Appliquée au GR greffé à différents fluorophores (EGFP, HaloTag, SNAP, CLIP), cette approche a mis en évidence l’existence de trois populations de récepteur : le GR non lié (56 à 75% du total), le GR à liaison-dissociation rapide (environ 1 s, 23 à 38% du total), i.e. lié à des loci non spécifiques, et le GR à liaison-dissociation lente (7 à 8 s, 1 à 7% du total). La proportion de GR non lié indique qu’il existe une réserve de récepteur ligandé dans le noyau qui ne se fixe pas à l’ADN. En comparaison avec nos résultats de ChIP cinétiques dont la cinétique est beaucoup plus longue (minutes), on peut faire l’hypothèse que les variations de recrutement du MR et du GR sur l’ADN sur de longues durées (120 min) sont la résultante à la fois du transfert cytonucléaire des récepteurs, mais aussi de la mobilisation de cette population non liée de récepteur nucléaire. L’approche de SMT pourrait être appliquée aux cellules HK-GFP-hMR qui devraient alors être transfectées de façon stable avec une protéine de fusion du GR associée à un fluorophore. Il serait alors très intéressant de comparer les durées de résidence sur l’ADN entre le MR et le GR, activé par différents ligands agonistes et antagonistes. Il est probable que des différences soient observées, notamment entre les complexes aldostérone-MR et cortisol-MR, le premier restant probablement plus longtemps associé à l’ADN que le second. La résidence d’une proportion importante de récepteur à proximité des cibles génomiques a déjà été observée pour

171 Discussion Générale une autre protéine primordiale : l’ARN Pol II (Welboren et al., 2009). Le phénomène, appelé «pausing» ou enrichissement du promoteur en RNA Pol II proximale (PPEP), pourrait être transposé au MR et au GR. Une certaine proportion de récepteur, variable selon la nature du ligand, serait à proximité des promoteurs de gènes cibles, et mobilisée en fonction des partenaires transcriptionnels présents et de l’état de la chromatine.

Du fait de l'identité d'acides aminés entre le MR et le GR au niveau de l'interface de dimérisation du DBD, ces deux récepteurs peuvent former des homodimères MR-MR et GR-GR ou bien des hétérodimères MR-GR. En effet, dans les cellules cibles du MR comme les cellules rénales HK-GFP-hMR, le GR est exprimé. Comme le MR, le GR est cytoplasmique en absence de ligand et est activé par la liaison du cortisol. Il est alors transféré dans le noyau au sein duquel il forme des homodimères GR-GR ou des hétérodimères MR-GR (Oakley and Cidlowski, 2013; Mifsud and Reul, 2016). Les différents dimères de MR et/ou de GR se lient à l’ADN, en particulier sur des séquences de type MRE/GRE, et sur certaines cibles, à proximité immédiate de motifs reconnus par d’autres facteurs de transcription. Les cibles génomiques du MR, ou MBS, sont réparties sur l’ensemble du génome, et localisées majoritairement (84%) à plus de 10 kb du TSS le plus proche, dans des régions intergéniques ou des introns. A ce jour, les cibles génomiques du GR dans des cellules rénales ne sont pas connues. Cette démarche d'identification des gènes cibles du MR et du GR a été entreprise dans l’hippocampe de rat et en réponse à une hormone commune, la corticostérone (van Weert et al., 2017). Cette étude a mis en évidence que parmi les sites identifiés pour le MR et pour le GR, seulement 46% et 59% d'entre eux leur étaient spécifiques. La comparaison du cistrome du MR dans les cellules rénales HK-GFP-hMR avec ceux du GR dans d'autres types cellulaires a montré qu'un certain nombre des gènes cibles du MR étaient aussi des gènes cibles du GR, comme FKBP5, PER1, SCNN1A, SGK1,... Afin d'avoir une vision non biaisée de la comparaison de cistromes dans différents types cellulaires, il serait indispensable de déterminer le cistrome du GR dans les cellules HK-GFP-hMR. De telles données permettraient de connaitre avec précision les gènes cibles du MR, ceux du GR et ceux communs aux deux récepteurs.

L'existence de gènes cibles communs au MR et au GR pose évidemment la question du mode d'action de ces deux récepteurs sur un même gène. L'action pourrait être distincte, au travers d'homodimères, ou conjointe via des hétérodimères. Nous avons montré grâce à d'expériences de ChIP séquentiels ou en tandem, que, pour le gène PER1, gène cible des deux récepteurs, le MR et le GR se lient sous la forme d'homodimères mais également sous la forme d'hétérodimères. Ainsi, il pourrait coexister des signalisations spécifiques de chaque récepteur via des

172 Discussion Générale homodimères et/ou, par l’intermédiaire d’hétérodimères. Il pourrait ainsi exister un niveau supplémentaire de régulation de la transcription de ces gènes communs. Dans le contexte d'hétérodimères, il serait sans doute nécessaire d'intégrer des aspects allostériques. La nature de l'hormone liée à un des monomères pourraient influencer la conformation du second monomère et ainsi l'activité transcriptionnelle du complexe quaternaire formé. Par ailleurs, il a été proposé que le GR était capable de former des tétramères. Il serait donc tout à fait imaginable que le MR et le GR forment de tels hétérotétramères, apportant un niveau encore supérieur de régulation transcriptionnelle. L'utilisation de mutants du MR ou du GR, notamment des mutants basés sur la mutation "dim" localisée dans la boucle de dimérisation du DBD, permettrait d'aller plus loin dans la compréhension de ces aspects mécanistiques.

Pour aller plus loin dans ces approches, il serait également intéressant de développer des approches de ChIP-Seq sur le MR et le GR sur des modèles animaux. Par exemple, il serait pertinent de travailler sur des souris surrénalectomisées traitées par des doses fixes ou variables mais proches des concentrations physiologiques de l’aldostérone et de la corticostérone. Les néphrons distaux seraient microdisséqués et utilisés pour ces approches expérimentales.

Le recrutement des corégulateurs transcriptionnels

Le dimère (MR-MR, GR-GR ou MR-GR) lié à l’ADN, recrute des corégulateurs transcriptionnels pour former un complexe de pré-initiation de la transcription (PIC) fonctionnel. Le recrutement de coactivateurs facilite aussi celui de l’ARN Pol II et l’activation de la transcription d’un gène. Le recrutement de corépresseurs ne permet pas le recrutement de l’ARN Pol II, la transcription du gène est alors réprimée. Le complexe aldostérone-MR régule ses gènes cibles de façon précoce, intermédiaire ou tardive (Le Billan et al., 2015). Cela implique que le PIC soit recruté de façon dynamique et que les facteurs le composant varient, comme cela a été démontré pour le PIC associé au ERα (Métivier et al., 2003). Nous avons montré que le complexe aldostérone-MR induit le recrutement de SRC-1 et de l’ARN Pol II sur le promoteur de SCNN1A (Amazit et al., 2015) et sur celui de PER1 (Article 3) en 1 h. Puis, nous avons montré pour la première fois que l’aldostérone entraîne un recrutement dynamique et cyclique de SRC-1 et de l’ARN Pol II sur le GRE du promoteur de PER1. Celui de SRC-1 est superposé à celui du MR, tandis que l’ARN Pol II semble différé de 10 min par rapport à celui du MR. Une de nos hypothèses est que le MR et le GR, en fonction de leur structure quaternaire, du ligand et du locus, ne recrutent pas strictement les mêmes composants du PIC. Quelques approches de protéomique

173 Discussion Générale permettraient d’identifier les partenaires de chaque dimère. Nous avions évoqué certains aspects de ces approches dans la discussion du chapitre 3 des résultats, comme l’utilisation d’antagonistes sélectifs du MR (finérénone) ou du GR (CORT125134) sur les cellules HK-GFP- hMR, suivie d’APMS. Cela nous permettrait d’identifier les partenaires moléculaires au sein du PIC associés aux homodimères exclusivement, ce qui serait déjà informatif et intéressant. Pour préciser les partenaires de l’hétérodimère MR-GR, il faudrait d’abord générer des mutants dim du

MR (MRR645R) et du GR (GRR481D), une mutation localisée dans le boucle D de chacun qui n’autorise que la formation d’hétérodimère, et les transfecter de façon stable dans une lignée cellulaire exprimant peu ou pas de MR et de GR fonctionnels, comme dans les cellules rénales humaines HK par exemple. Après avoir vérifié que ces mutations n’entravent pas la liaison de l’hétérodimère à l’ADN, en étudiant la transactivation d’un promoteur GRE-luciférase, nous pourrions réaliser une expérience d’APMS, et comparer les données à celles obtenues pour les deux homodimères. Un nombre croissant de données alloue aux interactomes des facteurs de transcription une importance capitale dans le sens et l’intensité de la réponse transcriptionnelle commandée à un locus donnée (Fuller et al., 2017).

Le recyclage du MR

Finalement, le MR est phosphorylé et ubiquitinité en partie dans le noyau, ce qui favorise son adressage au protéasome où il est dégradé. Nous avons montré dans l’Article 2 (Amazit et al., 2015) qu’une exposition prolongée à l’aldostérone entraîne la phosphorylation du MR (en 4 h) et sa dégradation (en 24 h). Cette phosphorylation a lieu dans le cytoplasme via l’activation non- génomique de la voie ERK1/2 par l’aldostérone (Faresse et al., 2012). Alors que le MR lié aux chaperonnes est maintenu dans un état monoubiquitiné grâce à Tsg101, sa phosphorylation sur plusieurs sérines entraînent son activation mais aussi sa dégradation, en rendant le MR plus vulnérable aux ubiquitine ligases nucléaires (Faresse et al., 2010). Dans le noyau, le MR semble polyubiquitiné et adressé au protéasome et dégradé. De plus, le complexe aldostérone-MR transactive le gène codant pour USP2-45 dans les cellules rénales. Cette ubiquitine ligase est localisée dans le cytoplasme, où elle entre en concurrence avec Tsg101 pour favoriser la polyubiquitination du stock de MR inactif et sa prise en charge par le protéasome (Faresse et al., 2013). Il serait pertinent de déterminer si le cortisol entraîne les mêmes effets sur la phosphorylation activatrice, la polyubiquitination nucléaire et la prise en charge par le protéasome. Il est probable que la cinétique de ces différents évènements change en fonction de la nature du ligand, comme nous l’avons vu pour la spironolactone ou la finérénone sur la phosphorylation et

174 Discussion Générale dégradation du MR (Amazit et al., 2015). Ainsi, une diminution progressive de la disponibilité du MR, via USP2-45, permettrait d’exercer un rétrocontrôle négatif sur la signalisation de l’aldostérone.

Perspectives

De cette description plus complète de la signalisation, plusieurs questions restent ouvertes, conduisant à proposer de nombreuses perspectives. Parmi elles, une perspective s’inscrit directement dans la suite du projet et correspond à d’autres intérêts de notre équipe : l’implication des hétérodimères MR-GR dans la régulation fine de la transcription des cibles génomiques communes au MR et au GR dans le rein.

Il est communément admis que le GR ne joue qu’un rôle mineur dans le néphron distal adulte, en particulier puisque la 11βHSD2 métabolise son ligand physiologique, le cortisol en cortisone pour laquelle le GR a peu d’affinité. Notre équipe a établi un certain nombre d’arguments en faveur d’un rôle du GR dans le rein pendant une fenêtre temporelle bien particulière : la période néonatale. A la naissance, les concentrations d’aldostérone sont très élevées (approx 0,5 ng/ml mesurées par LC-MS/MS, manuscrit en préparation) mais qui restent largement inférieures à celles du cortisol circulant mesurées dans le sang du cordon (52,0 ng/ml). L’expression rénale de la 11βHSD2, du MR et de certains de ses gènes cibles (Scnn1a, Sgk1, Tsc22d3) est très basse à la naissance par rapport à la vie fœtale (15-24ème SG) puis adulte (Martinerie et al., 2009a; Dumeige et al., 2017). A l’inverse, l’expression rénale du GR reste relativement constante pendant cette période périnatale au cours du développement, ce qui indique qu’il existe pendant cette période une fenêtre d’activation potentielle de la signalisation glucocorticoïde. Néanmoins, il est établi que le GR ne participe peu ou pas à la régulation de la réabsorption de sodium, donc ne peut pas se substituer au MR pendant cette période (Martinerie et al., 2011). Il est proposé que le GR activé par le cortisol non métabolisé par la 11βHSD2, participerait alors à la programmation développementale des cellules rénales par des mécanismes épigénétiques (Wyrwoll et al., 2007). Il a aussi été montré que le GR est impliqué dans la maturation du rein pendant la période néonatale, (Fowden and Forhead, 2009). Un effet délétère de cette fenêtre temporelle d’activation glucocorticoïde dans la période périnatale et de l’absence de 11βHSD2 est la susceptibilité des cellules à un excès de glucocorticoïdes, maternelles ou exogènes. Cela aurait notamment comme conséquence risque accru de développer de l’hypertension durant la vie adulte (Benediktsson et al., 1993; Huh et al., 2008), ce qui est directement à mettre en rapport avec le récent concept

175 Discussion Générale d’origine développementale de la santé et des maladies chez l’Homme (Developmental origin of health and disease; DoHAD) (Hanson and Gluckman, 2011).

Dans le rein adulte, le GR est exprimé dans les cellules épithéliales de tous les segments du néphron, mais également dans les cellules interstitielles et endothéliales et dans le glomérule (Martinerie et al., 2009a). Si la 11βHSD2 est exprimée et efficace (Morris et al., 2009), il a été proposé que seul 90% du cortisol serait métabolisé, ce qui conduit alors à un excès relatif de 10 fois par rapport à la concentration d’aldostérone (Funder, 2017a). On peut alors faire l’hypothèse qu’il existe un excès de cortisol au niveau du néphron, notamment pendant les pics circadiens de sécrétion ou en cas de stress. Quelques études se sont intéressées au rôle physiologique des glucocorticoïdes dans le rein à l’âge adulte. Au niveau mécanistique, les dérivés 11β- déshydrogénés des glucocorticoïdes agissent comme des antagonistes faibles du MR en entrant en compétition avec l’aldostérone dans la pochette du LBD (Bocchi et al., 2003; Morris et al., 2009). Physiologiquement, cela confère à la 11βHSD2 une double fonction : garantir la sélectivité du MR vis-à-vis de l’aldostérone, mais aussi générer des antagonistes faibles du MR pour réguler son activité transrégulatrice (Morris et al., 2009). Pourtant, quelques études ont mis en évidence une action directe des glucocorticoïdes dans le rein, notamment dans la régulation de réabsorption du sodium et de l’hémodynamique (Mangos et al., 2003), mais peu d’équipes se sont intéressées récemment à l’intérêt physiologique de cette régulation. Enfin, l’hypercortisolisme caractéristique du syndrome de Cushing est associé à de l’hypertension artérielle qui augmente le risque de complications cardiorénales (Smets et al., 2010). L’ensemble de ces données montre l’intérêt que représente l’étude de la fonction physiopathologique du GR dans le rein.

Nos résultats permettent de proposer un rôle du GR dans le rein, en particulier dans son implication dans la signalisation minéralocorticoïde (Article 3). In vitro, nous avons confirmé dans les cellules HK-GFP-hMR que le cortisol est capable d’induire le recrutement du MR et du GR sur le promoteur de PER1, et d’activer la transcription de ce gène. La comparaison des cistromes du MR, dans le rein (Le Billan et al., 2015) et l’hippocampe, et du GR dans l’hippocampe, ainsi que dans une lignée cellulaire neuronale et une lignée de tumeur mammaire (Pan et al., 2011; Polman et al., 2012; van Weert et al., 2017) suggère fortement que le MR et le GR ont un certain nombre de cibles communes dans le néphron distal, dont PER1. De plus, nous avons montré que dans un modèle rénal humain, le MR et le GR sont capables de former des homodimères et des hétérodimères MR-GR sur le GRE du promoteur de PER1 (Article 3). Il a été montré que cet hétérodimère, selon les cibles génomiques, permettait un effet synergique activateur ou inhibiteur (Ou et al., 2001; Mifsud and Reul, 2016). La régulation de l’activité d’un récepteur nucléaire par

176 Discussion Générale un autre est un mécanisme commun et bien caractérisé, en particulier pour le récepteur des rétinoïdes, RXR. Le RXR agit sur de nombreux autres récepteurs nucléaires (LXR, PPAR, RAR, TR, VDR…) par hétérodimérisation pour moduler l’expression de façon tissu-spécifique et gène- spécifique (Lefebvre et al., 2010). Un dialogue croisé entre des récepteurs stéroïdiens a déjà été établi, notamment entre ERα et MR, où ERα inhibe l’activité transcriptionnelle du complexe aldostérone-MR dans les cellules endothéliales par hétérodimérisation, prévenant ainsi les effets minéralocorticoïdes délétères dans les vaisseaux (Barrett Mueller et al., 2014).

L’ensemble de ces observations nous amène à nous poser deux questions. Comment interagissent les signalisations minéralocorticoïde et glucocorticoïde dans le rein adulte ? Quel est le rôle physiologique de l’hétérodimère MR-GR ?

Dans un premier temps, pour appréhender ces problématiques, il nous semble nécessaire d’identifier les cibles génomiques du GR dans le rein, ce qui n’a pas été fait à ce jour. Les cellules HK-GFP-hMR expriment le GR et le MR de façon endogène, ainsi que la protéine de fusion GFP- hMR, et le premier cistrome rénal humain du MR a été identifié dans ces cellules (Le Billan et al., 2015). Etant donné la rareté des modèles cellulaires humains de segments néphroniques sensibles à l’aldostérone, une première étape consisterait à réaliser un ChIP-Seq du GR et du MR dans les cellules HK-GFP-hMR traitées par le cortisol. Une étude ontologique de ces cibles, par exemple avec le logiciel Ingenuity Pathway Analysis (Quiagen Bioinformatics), permettrait de voir les processus cellulaires régulés par les deux récepteurs en fonction de l’hormone. La recherche des motifs de liaison génomiques, en utilisant les outils de la MEME suite (http://meme- suite.org, (Bailey et al., 2009)), pourrait permettre d’identifier, en plus des MRE/GRE, des co- motifs spécifiques du MR, du GR ou de l’hétérodimère. Cette démarche nous a déjà permis d’identifier le MRE et les motifs correspondant à d’autres facteurs de transcription dans l’Article 1 (Le Billan et al., 2015), et a permis à l’équipe du Pr Meijer d’identifier le motif Atoh1 comme co- motif spécifique du MR dans l’hippocampe de Rat (van Weert et al., 2017). Certaines cibles génomiques seraient validées du point de vue recrutement, et surtout étudiées sur le plan transcriptionnel, pour déterminer l’existence d’une transrégulation associée au recrutement du MR et/ou du GR.

Il nous semble essentiel d’aller ensuite plus loin et d’identifier les cibles du MR et du GR dans le rein in vivo (voir Chapitre 3 des Résultats). Nous avons déjà mis au point les conditions expérimentales propices à la réalisation de ChIP sur des reins de souris. Notre volonté d’identifier et de comparer les cibles à la fois du MR et du GR est confrontée à un problème critique : la disposition d’un anticorps anti-mMR. L’anticorps polyclonal 39N reconnaissait le MR humain et

177 Discussion Générale murin lors de nombreuses approches (Viengchareun et al., 2009; Le Billan et al., 2015), mais il est épuisé. Un anticorps monoclonal anti-MR, 6G1, reconnaît spécifiquement le mMR, mais ne fonctionne pas en ChIP. Il nous faudrait générer un nouvel anticorps anti-mMR, et plusieurs approches sont en cours au laboratoire. Il serait alors tout à fait intéressant de comparer les cibles identifiées dans le modèle humain et chez la souris, afin de voir si les cibles sont conservées entre les deux espèces.

Dans un second temps, une fois les cibles de chaque récepteur identifiées, il nous faudrait aller plus loin dans l’implication du MR, du GR et de l’hétérodimère MR-GR dans la transrégulation des cibles communes. Comme le ERα inhibe le complexe aldostérone-MR dans les cellules endothéliales vasculaires (Barrett Mueller et al., 2014), il est envisageable que le GR inhibe, ou potentialise l’activité transcriptionnelle du MR, et vice-versa, de façon gène-spécifique. Plusieurs stratégies sont possibles pour bloquer l’action de l’un des récepteurs et en étudier les conséquences fonctionnelles sur la transcription. Dans les cellules HK-GFP-hMR, l’utilisation de siRNA spécifiques du GR ou du MR, permettrait d’abolir efficacement l’expression d’un des récepteurs. Nous pourrions alors étudier les conséquences sur le recrutement, la dynamique et l’activité transcriptionnelle de chacun des récepteurs sur certaines cibles communes. Le passage au modèle animal semble une nouvelle fois essentiel pour comprendre l’implication physiologique respective du MR et du GR dans le rein. Les souris ayant une invalidation spécifique du MR dans le néphron survivent à l’âge adulte avec un régime alimentaire approprié, présentent un tableau de PHA-1 sévère et meurent lors d’un régime pauvre en sodium (Canonica et al., 2016; Terker et al., 2016). Les souris avec une invalidation spécifique du GR dans le néphron distal n’ont aucun déséquilibre électrolytique, mais présentent une pression artérielle supérieure à celle des souris sauvages à l’âge adulte (à partir de 3 mois) (Goodwin et al., 2010). Ces deux souches, théoriquement accessibles, seraient de bons modèles pour réaliser des études cistromiques et transcriptomiques dans le rein afin d’identifier les cibles génomiques impactées par l’absence du GR ou du MR. La comparaison entre les cibles rénales identifiées sur ces souris et celles identifiées avec les souris sauvages surrénalectomisées, complémentée par les données transcriptomiques, devraient permettre de préciser la contribution relative de chacun des deux récepteurs et leur synergie/antagonisme fonctionnel. Il sera alors tout à fait intéressant d’étudier plus en détail le rôle des cibles ainsi identifiées dans la fonction rénale, notamment dans le rôle sur le transport hydroélectrolytique (surtout la réabsorption du sodium) et/ou la prolifération cellulaire. Cet aspect pourrait s’appuyer sur le modèle des cellules rénales murines KC3AC1, développées et utilisées dans notre laboratoire, qui sont le siège d’un transport transépithélial vectorialisé hydroélectrolytique (Viengchareun et al., 2009). De plus, l’expression des cibles

178 Discussion Générale dérégulées en absence de GR, présentant un rôle dans la maturation rénale, le marquage épigénétique ou impliquées dans la susceptibilité à l’hypertension, pourraient être étudiée dans des échantillons de rein prélevées à différents stades du développement (vie embryonnaire, fœtale, post-natale, adulte) disponibles au laboratoire (Martinerie et al., 2009a, 2011; Dumeige et al., 2017). L’ensemble de ces expériences fait appel à des expertises acquises au sein de notre équipe, et à du matériel et des modèles théoriquement accessibles.

Dans un troisième temps, le rôle de l’hétérodimère MR-GR pourra être étudié de façon spécifique. Il serait intéressant de développer des lignées cellulaires transfectées de façon stable avec les mutants dim du MR et/ou du GR à partir des cellules HK (voir la Discussion du Chapitre 3 des Résultats). L’activité transcriptionnelle des mutants dans les différentes lignées établies serait validée par des approches de transactivation sur rapporteur GRE-luciférase, en présence d’aldostérone, de cortisol ou d’un antagoniste sélectif du MR ou du GR. Dans la lignée MR D645R x GR D481R, il serait intéressant d’observer si les deux hormones entraînent la même activité que sur l’hétérodimère. Cette lignée serait aussi rapidement utilisée pour une étude cistromique et transcriptomique, en parallèle des lignées MR sauvage seul, GR sauvage seul, et MR sauvage x GR R479D-D481R. L’analyse bioinformatique des données générées permettrait évidemment d’identifier les cibles régulées par les différentes structures quaternaires. Il serait intéressant d’analyser la localisation des cibles par rapport au TSS, afin de savoir si les hétérodimères sont impliqués préférentiellement dans la transrégulation de proximité, dans le promoteur, ou à longue distance, dans les boucles chromatiniennes. En analysant la transcription des cibles de l’hétérodimère identifiées après ChIP-Seq sur différentes durées (comme dans (Le Billan et al., 2015)), nous pourrions déterminer si ceux-ci sont impliqués majoritairement dans des effets précoces ou tardifs. Evidemment, les approches d’ontologies seraient ici indispensables pour savoir dans quelques grandes fonctions biologiques sont impliquées les gènes que régulent l’hétérodimère MR-GR.

De façon globale, ces perspectives permettraient de mieux comprendre le rôle de la signalisation glucocorticoïde rénale, sa relation avec la signalisation minéralocorticoïde, et leurs points d’interactions au travers de l’hétérodimère MR-GR. L’hyperaldostéronisme et l’hypercortisolisme sont tous deux associés au développement de l’hypertension artérielle. Ces études pourraient permettre d’identifier de nouveaux acteurs majeurs dans cette pathologie et ainsi donner de nouvelles bases de recherche thérapeutique.

179

CONCLUSION GÉNÉRALE

Conclusion Générale

Le MR est un récepteur nucléaire dont l’activité transrégulatrice est activée par deux classes d’hormones : l’aldostérone, son ligand préférentiel, et les glucocorticoïdes. C’est un facteur de transcription qui est exprimé dans les tissus épithéliaux, en particulier la partie distale du néphron, dans lesquels il participe à la régulation de l’homéostasie hydroélectrolytique et le contrôle de la pression artérielle. Le MR est aussi exprimé dans des tissus non-épithéliaux, notamment le cœur, les vaisseaux, le système nerveux central, ou les adipocytes dans lesquels il exerce de nombreuses fonctions pléïotropes impliquées notamment sur la physiopathologie cardiovasculaire, la mémorisation, la réponse au stress, la thermorégulation et le métabolisme. Des dysfonctionnements de la signalisation minéralocorticoïde ont été rapportés dans de nombreux processus pathologiques telles que l’hypertension artérielle, les fibroses cardiorénales ou le syndrome métabolique. Une meilleure connaissance des cibles génomiques du MR et de ses mécanismes de régulation transcriptionnelle restait donc un enjeu primordial.

Notre laboratoire s’intéresse depuis de nombreuses années aux mécanismes moléculaires de la signalisation minéralocorticoïde. Depuis l’identification des partenaires transcriptionnels spécifiques du MR (Pascual-Le Tallec et al., 2005) jusqu’à l’étude plus récente de ses cibles génomiques impliquées dans la différenciation adipocytaire (Viengchareun et al., 2001), en passant par l’analyse moléculaire et structurale des mécanismes d'activation et d'inactivation par des antiminéralocorticoïdes (Fagart et al., 2010) et de la démonstration d’une absence d’expression rénale de MR dans la période périnatale (Martinerie et al., 2013), notre travail a déjà permis des avancées majeures dans la caractérisation du mode d’action du complexe aldostérone-MR. Un aspect crucial de cette voie de signalisation nous intéressait particulièrement : l’identité des cibles génomiques du complexe aldostérone-MR dans le rein. Quelques équipes avaient développé des approches d’identification globale de transcriptome (hybridation sur puces, SAGE, puces à ADN) avec succès et identifié ainsi quelques nouvelles cibles de l’aldostérone (Pearce, 2001; Robert-Nicoud et al., 2001; Fakitsas et al., 2007). Cependant, cet aspect restait très incomplètement caractérisé. L’avènement de la technique de ChIP-sequencing et des outils d’analyses bioinformatiques ont été tout à fait cruciaux pour venir combler ce besoin. Notre équipe et d’autres se sont aussi intéressées à l’énigme que représente la sélectivité minéralocorticoïde dans le cadre des dualités d’hormone (aldostérone vs glucocorticoïdes) (Rafestin-Oblin et al., 1986; Lombes et al., 1994; Zennaro et al., 1996) et de récepteur (MR vs GR) (Hellal-Levy et al., 1999; Pascual-Le Tallec et al., 2005; Fuller et al., 2017). Les aspects dynamiques du recrutement du MR et du GR, essentiels à tout processus transcriptionnel (Miranda et al., 2013), n’avaient pas été caractérisés jusqu’à présent.

180 Conclusion Générale

L’utilisation combinée d’une lignée cellulaire rénale humaine différenciée, les cellules HK- GFP-hMR, surexprimant la protéine de fusion GFP-hMR, et d’un anticorps anti-MR hautement spécifique, le 39N, m’ont permis de mettre au point l’approche de ChIP pour étudier le recrutement génomique du MR dans un modèle rénal. Mon travail de thèse, de par la maitrise de ces outils, a permis d’établir le premier cistrome rénal humain du MR. Ce cistrome, constitué de presque 1000 cibles génomiques, met en évidence la diversité non explorée des gènes cibles de l’aldostérone. Ce travail a également permis d’identifier de novo l’élément de réponse des minéralocorticoïdes, jusqu’alors défini par homologie avec les autres récepteurs des oxo-stéroïdes. De plus, l’étude des motifs retrouvés dans le cistrome a permis de préciser deux modes d’action du complexe aldostérone-MR : soit par liaison directe à l’ADN, soit par interaction indirecte avec d’autres facteurs de transcription ou tethering, un mécanisme inédit pour le MR.

Les expertises en biologie moléculaire et cellulaire du laboratoire dans l’étude de la signalisation minéralocorticoïde ont été mises à profit pour caractériser un nouvel antagoniste sélectif du MR, la finérénone. J’ai notamment mis en évidence que la finérénone retarde la phosphorylation et la dégradation aldostérone-induite du MR, et qu’elle inhibe le recrutement hormono-dépendant et basal du MR, ainsi que le recrutement des partenaires transcriptionnels (SRC-1, ARN Polymérase II) sur ses cibles génomiques. Cet outil pharmacologique précieux, et potentiellement thérapeutique, en cours d’étude de phase III d’essais cliniques, devrait permettre d’améliorer la prise en charge notamment de patients atteints de néphropathie diabétique. Cet antagoniste facilitera aussi la discrimination des effets du MR dans la dualité MR vs GR.

Enfin, dans la troisième partie du travail de thèse, j’ai contribué à préciser la contribution relative du MR et du GR dans le contexte la double dualité hormonale et de récepteur (MR vs GR) sur une cible commune, PER1, dans la lignée rénale humain HK-GFP-hMR. L’aldostérone et le cortisol induisent le transfert nucléaire rapide du MR, avec une cinétique comparable. Nous avons montré pour la première fois que les deux hormones entraînent le recrutement du MR sur le GRE du promoteur de PER1 de façon dynamique et cyclique, avec des cinétiques sensiblement différentes. Cette dynamique différentielle semble se répercuter sur le recrutement du complexe de pré-initiation de la transcription, en particulier de SRC-1 et de l’ARN Pol II, et entraîne la transactivation du gène PER1. Le complexe GR-cortisol est également recruté sur le GRE du promoteur de PER1 de façon dynamique et cyclique, avec une cinétique sensiblement différente de celle du complexe cortisol-MR. Nous avons enfin démontré que, sur ce locus, les deux récepteurs agissent à la fois comme homodimères, mais aussi comme hétérodimères, ce qui vient soutenir un petit nombre d’études réalisées sur ce phénomène in vitro et dans des modèles

181 Conclusion Générale

neuronaux (Ou et al., 2001; Nishi et al., 2004; Kiilerich et al., 2015; Mifsud and Reul, 2016). Dans ce contexte, il serait nécessaire de caractériser plus en détail les phénomènes dynamiques et d’identifier plus précisément les partenaires transcriptionnels potentiellement impliqués dans la sélectivité minéralocorticoïde rénale. L’étude du rôle de la signalisation glucocorticoïde, en particulier au travers de l’hétérodimère MR-GR, dans les segments néphroniques distaux, nous semble être une perspective de recherche impérieuse, ouvrant la voie à de nouvelles stratégies de prise en charge de problèmes de santé publique.

Nous espérons avoir contribué de façon significative à une meilleure compréhension de la signalisation minéralocorticoïde, en éclairant certains aspects jusque-là inexplorés d’un mécanisme extrêmement complexe. Il nous semble, en effet, essentiel d’avoir une connaissance approfondie de la physiopathologie du MR, dans le but de faire émerger de nouvelles cibles thérapeutiques innovantes.

182

RÉFÉRENCES BIBLIOGRAPHIQUES

Références Bibliographiques

Adams, B.P., and Bose, H.S. (2012). Alteration in accumulated aldosterone synthesis as a result of N-terminal cleavage of aldosterone synthase. Mol. Pharmacol. 81, 465–474.

Amador, C.A., Barrientos, V., Peña, J., Herrada, A.A., González, M., Valdés, S., Carrasco, L., Alzamora, R., Figueroa, F., Kalergis, A.M., et al. (2014). Spironolactone decreases DOCA-salt- induced organ damage by blocking the activation of T helper 17 and the downregulation of regulatory T lymphocytes. Hypertens. Dallas Tex 1979 63, 797–803.

Amazit, L., Le Billan, F., Kolkhof, P., Lamribet, K., Viengchareun, S., Fay, M.R., Khan, J.A., Hillisch, A., Lombès, M., Rafestin-Oblin, M.-E., et al. (2015). Finerenone Impedes Aldosterone- dependent Nuclear Import of the Mineralocorticoid Receptor and Prevents Genomic Recruitment of Steroid Receptor Coactivator-1. J. Biol. Chem. 290, 21876–21889.

Anttila, L., Ruutiainen, K., and Erkkola, R. (1987). Spironolactone in the treatment of hirsutism. Ann. Chir. Gynaecol. Suppl. 202, 32–34.

Arai, K., Homma, T., Morikawa, Y., Ubukata, N., Tsuruoka, H., Aoki, K., Ishikawa, H., Mizuno, M., and Sada, T. (2015a). Pharmacological profile of CS-3150, a novel, highly potent and selective non-steroidal mineralocorticoid receptor antagonist. Eur. J. Pharmacol. 761, 226–234.

Arai, K., Tsuruoka, H., and Homma, T. (2015b). CS-3150, a novel non-steroidal mineralocorticoid receptor antagonist, prevents hypertension and cardiorenal injury in Dahl salt-sensitive hypertensive rats. Eur. J. Pharmacol. 769, 266–273.

Arriza, J.L., Weinberger, C., Cerelli, G., Glaser, T.M., Handelin, B.L., Housman, D.E., and Evans, R.M. (1987). Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237, 268–275.

Artunc, F., Amann, K., Nasir, O., Friedrich, B., Sandulache, D., Jahovic, N., Risler, T., Vallon, V., Wulff, P., Kuhl, D., et al. (2006). Blunted DOCA/high salt induced albuminuria and renal tubulointerstitial damage in gene-targeted mice lacking SGK1. J. Mol. Med. Berl. Ger. 84, 737– 746.

Augereau, P., Badia, E., Carascossa, S., Castet, A., Fritsch, S., Harmand, P.-O., Jalaguier, S., and Cavaillès, V. (2006). The nuclear receptor transcriptional coregulator RIP140. Nucl. Recept. Signal. 4, e024.

Azibani, F., Fazal, L., Chatziantoniou, C., Samuel, J.-L., and Delcayre, C. (2013). Aldosterone mediates cardiac fibrosis in the setting of hypertension. Curr. Hypertens. Rep. 15, 395–400.

Bachmann, S., Mutig, K., Bates, J., Welker, P., Geist, B., Gross, V., Luft, F.C., Alenina, N., Bader, M., Thiele, B.J., et al. (2005). Renal effects of Tamm-Horsfall protein (uromodulin) deficiency in mice. Am. J. Physiol. Renal Physiol. 288, F559-567.

Bailey, T.L., Boden, M., Buske, F.A., Frith, M., Grant, C.E., Clementi, L., Ren, J., Li, W.W., and Noble, W.S. (2009). MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res. 37, W202-208.

183

Baker, M.E., and Katsu, Y. (2017). 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Evolution of the mineralocorticoid receptor: sequence, structure and function. J. Endocrinol. 234, T1–T16.

Baker, M.E., Funder, J.W., and Kattoula, S.R. (2013). Evolution of hormone selectivity in glucocorticoid and mineralocorticoid receptors. J. Steroid Biochem. Mol. Biol. 137, 57–70.

Bakris, G.L., Agarwal, R., Chan, J.C., Cooper, M.E., Gansevoort, R.T., Haller, H., Remuzzi, G., Rossing, P., Schmieder, R.E., Nowack, C., et al. (2015). Effect of Finerenone on Albuminuria in Patients With Diabetic Nephropathy: A Randomized Clinical Trial. JAMA 314, 884–894.

Bärfacker, L., Kuhl, A., Hillisch, A., Grosser, R., Figueroa-Pérez, S., Heckroth, H., Nitsche, A., Ergüden, J.-K., Gielen-Haertwig, H., Schlemmer, K.-H., et al. (2012). Discovery of BAY 94-8862: a nonsteroidal antagonist of the mineralocorticoid receptor for the treatment of cardiorenal diseases. ChemMedChem 7, 1385–1403.

Barrera-Chimal, J., André-Grégoire, G., Nguyen Dinh Cat, A., Lechner, S.M., Cau, J., Prince, S., Kolkhof, P., Loirand, G., Sauzeau, V., Hauet, T., et al. (2017). Benefit of Mineralocorticoid Receptor Antagonism in AKI: Role of Vascular Smooth Muscle Rac1. J. Am. Soc. Nephrol. JASN 28, 1216–1226.

Barrett Mueller, K., Lu, Q., Mohammad, N.N., Luu, V., McCurley, A., Williams, G.H., Adler, G.K., Karas, R.H., and Jaffe, I.Z. (2014). Estrogen receptor inhibits mineralocorticoid receptor transcriptional regulatory function. Endocrinology 155, 4461–4472.

Barski, A., Cuddapah, S., Cui, K., Roh, T.-Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome. Cell 129, 823–837.

Bassett, M.H., Zhang, Y., White, P.C., and Rainey, W.E. (2000). Regulation of human CYP11B2 and CYP11B1: comparing the role of the common CRE/Ad1 element. Endocr. Res. 26, 941–951.

Benediktsson, R., Lindsay, R.S., Noble, J., Seckl, J.R., and Edwards, C.R. (1993). Glucocorticoid exposure in utero: new model for adult hypertension. Lancet Lond. Engl. 341, 339–341.

Bénitah, J.P., and Vassort, G. (1999). Aldosterone upregulates Ca(2+) current in adult rat cardiomyocytes. Circ. Res. 85, 1139–1145.

Berger, S., Bleich, M., Schmid, W., Cole, T.J., Peters, J., Watanabe, H., Kriz, W., Warth, R., Greger, R., and Schütz, G. (1998). Mineralocorticoid receptor knockout mice: pathophysiology of Na+ metabolism. Proc. Natl. Acad. Sci. U. S. A. 95, 9424–9429.

Bhalla, V., Oyster, N.M., Fitch, A.C., Wijngaarden, M.A., Neumann, D., Schlattner, U., Pearce, D., and Hallows, K.R. (2006). AMP-activated kinase inhibits the epithelial Na+ channel through functional regulation of the ubiquitin ligase Nedd4-2. J. Biol. Chem. 281, 26159–26169.

Binart, N., Lombes, M., Rafestin-Oblin, M.E., and Baulieu, E.E. (1991). Characterization of human mineralocorticosteroid receptor expressed in the baculovirus system. Proc. Natl. Acad. Sci. U. S. A. 88, 10681–10685.

184

Binart, N., Lombès, M., and Baulieu, E.E. (1995). Distinct functions of the 90 kDa heat-shock protein (hsp90) in oestrogen and mineralocorticosteroid receptor activity: effects of hsp90 deletion mutants. Biochem. J. 311, 797.

Bledsoe, R.K., Madauss, K.P., Holt, J.A., Apolito, C.J., Lambert, M.H., Pearce, K.H., Stanley, T.B., Stewart, E.L., Trump, R.P., Willson, T.M., et al. (2005). A ligand-mediated hydrogen bond network required for the activation of the mineralocorticoid receptor. J. Biol. Chem. 280, 31283–31293.

Bleich, M., Warth, R., Schmidt-Hieber, M., Schulz-Baldes, A., Hasselblatt, P., Fisch, D., Berger, S., Kunzelmann, K., Kriz, W., Schütz, G., et al. (1999). Rescue of the mineralocorticoid receptor knock-out mouse. Pflugers Arch. 438, 245–254.

Bocchi, B., Fagart, J., Cluzeaud, F., Fay, M., Rafestin-Oblin, M.-E., and Farman, N. (2003). Glucocorticoid metabolism by 11-β hydroxysteroid dehydrogenase type 2 modulates human mineralocorticoid receptor transactivation activity. J. Steroid Biochem. Mol. Biol. 84, 239–244.

Bollag, W.B. (2014). Regulation of aldosterone synthesis and secretion. Compr. Physiol. 4, 1017– 1055.

Bonny, O., Vinciguerra, M., Gumz, M.L., and Mazzoccoli, G. (2013). Molecular bases of circadian rhythmicity in renal physiology and pathology. Nephrol. Dial. Transplant. Off. Publ. Eur. Dial. Transpl. Assoc. - Eur. Ren. Assoc. 28, 2421–2431.

Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H., and Moras, D. (1995). Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-α. Nature 375, 377–382.

Bramlage, P., Swift, S.L., Thoenes, M., Minguet, J., Ferrero, C., and Schmieder, R.E. (2016). Non- steroidal mineralocorticoid receptor antagonism for the treatment of cardiovascular and renal disease. Eur. J. Heart Fail. 18, 28–37.

Brodie, J., and McEwan, I.J. (2005). Intra-domain communication between the N-terminal and DNA-binding domains of the androgen receptor: modulation of androgen response element DNA binding. J. Mol. Endocrinol. 34, 603–615.

Brophy, P.D., and Robillard, J.E. (2004). Chapter 126 - Functional Development of the Kidney In Utero. In Fetal and Neonatal Physiology (Third Edition), R.A. Polin, W.W. Fox, and S.H. Abman, eds. (W.B. Saunders), pp. 1229–1241.

Brouard, M., Casado, M., Djelidi, S., Barrandon, Y., and Farman, N. (1999). Epithelial sodium channel in human epidermal keratinocytes: expression of its subunits and relation to sodium transport and differentiation. J. Cell Sci. 112 ( Pt 19), 3343–3352.

Bruner, K.L., Derfoul, A., Robertson, N.M., Guerriero, G., Fernandes-Alnemri, T., Alnemri, E.S., and Litwack, G. (1997). The unliganded mineralocorticoid receptor is associated with heat shock proteins 70 and 90 and the immunophilin FKBP-52. Recept. Signal Transduct. 7, 85–98.

Buisine, N., Ruan, X., Bilesimo, P., Grimaldi, A., Alfama, G., Ariyaratne, P., Mulawadi, F., Chen, J., Sung, W.-K., Liu, E.T., et al. (2015). Xenopus tropicalis Genome Re-Scaffolding and Re- Annotation Reach the Resolution Required for In Vivo ChIA-PET Analysis. PloS One 10, e0137526.

185

Bulynko, Y.A., and O’Malley, B.W. (2011). Nuclear receptor coactivators: structural and functional biochemistry. Biochemistry (Mosc.) 50, 313–328.

Callera, G.E., Touyz, R.M., Tostes, R.C., Yogi, A., He, Y., Malkinson, S., and Schiffrin, E.L. (2005). Aldosterone activates vascular p38MAP kinase and NADPH oxidase via c-Src. Hypertens. Dallas Tex 1979 45, 773–779.

Campbell, D.J., Mitchelhill, K.I., Schlicht, S.M., and Booth, R.J. (2000). Plasma amino-terminal pro-brain natriuretic peptide: a novel approach to the diagnosis of cardiac dysfunction. J. Card. Fail. 6, 130–139.

Canessa, C.M., Schild, L., Buell, G., Thorens, B., Gautschi, I., Horisberger, J.D., and Rossier, B.C. (1994). Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature 367, 463–467.

Canonica, J., Sergi, C., Maillard, M., Klusonova, P., Odermatt, A., Koesters, R., Loffing-Cueni, D., Loffing, J., Rossier, B., Frateschi, S., et al. (2016). Adult nephron-specific MR-deficient mice develop a severe renal PHA-1 phenotype. Pflugers Arch. 468, 895–908.

Caprio, M., Fève, B., Claës, A., Viengchareun, S., Lombès, M., and Zennaro, M.-C. (2007). Pivotal role of the mineralocorticoid receptor in corticosteroid-induced adipogenesis. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 21, 2185–2194.

Capurro, C., Coutry, N., Bonvalet, J.P., Escoubet, B., Garty, H., and Farman, N. (1997). Specific expression and regulation of CHIF in kidney and colon. Ann. N. Y. Acad. Sci. 834, 562–564.

Catena, C., Colussi, G., Brosolo, G., Novello, M., and Sechi, L.A. (2015). Aldosterone and Left Ventricular Remodeling. Horm. Metab. Res. Horm. Stoffwechselforschung Horm. Metab. 47, 981– 986.

Cato, A.C., and Weinmann, J. (1988). Mineralocorticoid regulation of transcription of transfected mouse mammary tumor virus DNA in cultured kidney cells. J. Cell Biol. 106, 2119–2125.

Catt, K.J., Balla, T., Baukal, A.J., Hausdorff, W.P., and Aguilera, G. (1988). Control of glomerulosa cell function by angiotensin II: transduction by G-proteins and inositol polyphosphates. Clin. Exp. Pharmacol. Physiol. 15, 501–515.

Cejka, V., de VRIES, L., and Borst, J.G. (1960). The diuretic effect of spirolactone SC-9420 in a case of secondary aldosteronism. Lancet Lond. Engl. 1, 312–314.

Chadwick, J.A., Hauck, J.S., Gomez-Sanchez, C.E., Gomez-Sanchez, E.P., and Rafael-Fortney, J.A. (2017). Gene expression effects of glucocorticoid and mineralocorticoid receptor agonists and antagonists on normal human skeletal muscle. Physiol. Genomics 49, 277–286.

Chan, H., Babayan, V., Blyumin, E., Gandhi, C., Hak, K., Harake, D., Kumar, K., Lee, P., Li, T.T., Liu, H.Y., et al. (2010). The p-type ATPase superfamily. J. Mol. Microbiol. Biotechnol. 19, 5–104.

Chang, S.S., Grunder, S., Hanukoglu, A., Rösler, A., Mathew, P.M., Hanukoglu, I., Schild, L., Lu, Y., Shimkets, R.A., Nelson-Williams, C., et al. (1996). Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1. Nat. Genet. 12, 248–253.

186

Chapman, R.D., Heidemann, M., Albert, T.K., Mailhammer, R., Flatley, A., Meisterernst, M., Kremmer, E., and Eick, D. (2007). Transcribing RNA polymerase II is phosphorylated at CTD residue serine-7. Science 318, 1780–1782.

Chen, L., Zhang, X., and Zhang, W. (2015). Regulation of αENaC transcription. Vitam. Horm. 98, 101–135.

Chen, S.Y., Bhargava, A., Mastroberardino, L., Meijer, O.C., Wang, J., Buse, P., Firestone, G.L., Verrey, F., and Pearce, D. (1999). Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc. Natl. Acad. Sci. U. S. A. 96, 2514–2519.

Cheon, S., Park, N., Cho, S., and Kim, K. (2013). Glucocorticoid-mediated Period2 induction delays the phase of circadian rhythm. Nucleic Acids Res. 41, 6161–6174.

Cirillo, F., Nassa, G., Tarallo, R., Stellato, C., De Filippo, M.R., Ambrosino, C., Baumann, M., Nyman, T.A., and Weisz, A. (2013). Molecular mechanisms of selective estrogen receptor modulator activity in human breast cancer cells: identification of novel nuclear cofactors of antiestrogen-ERα complexes by interaction proteomics. J. Proteome Res. 12, 421–431.

Cole, T.J., Blendy, J.A., Monaghan, A.P., Krieglstein, K., Schmid, W., Aguzzi, A., Fantuzzi, G., Hummler, E., Unsicker, K., and Schütz, G. (1995). Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev. 9, 1608–1621.

Connell, J.M.C., MacKenzie, S.M., Freel, E.M., Fraser, R., and Davies, E. (2008). A lifetime of aldosterone excess: long-term consequences of altered regulation of aldosterone production for cardiovascular function. Endocr. Rev. 29, 133–154.

Conway-Campbell, B.L., McKenna, M.A., Wiles, C.C., Atkinson, H.C., de Kloet, E.R., and Lightman, S.L. (2007). Proteasome-dependent down-regulation of activated nuclear hippocampal glucocorticoid receptors determines dynamic responses to corticosterone. Endocrinology 148, 5470–5477.

Conway-Campbell, B.L., Pooley, J.R., Hager, G.L., and Lightman, S.L. (2012). Molecular dynamics of ultradian glucocorticoid receptor action. Mol. Cell. Endocrinol. 348, 383–393.

Couette, B., Fagart, J., Jalaguier, S., Lombes, M., Souque, A., and Rafestin-Oblin, M.E. (1996). Ligand-induced conformational change in the human mineralocorticoid receptor occurs within its hetero-oligomeric structure. Biochem. J. 315 ( Pt 2), 421–427.

Couette, B., Jalaguier, S., Hellal-Levy, C., Lupo, B., Fagart, J., Auzou, G., and Rafestin-Oblin, M.E. (1998). Folding requirements of the ligand-binding domain of the human mineralocorticoid receptor. Mol. Endocrinol. Baltim. Md 12, 855–863.

Couloigner, V., Fay, M., Djelidi, S., Farman, N., Escoubet, B., Runembert, I., Sterkers, O., Friedlander, G., and Ferrary, E. (2001). Location and function of the epithelial Na channel in the cochlea. Am. J. Physiol. Renal Physiol. 280, F214-222.

Darimont, B.D., Wagner, R.L., Apriletti, J.W., Stallcup, M.R., Kushner, P.J., Baxter, J.D., Fletterick, R.J., and Yamamoto, K.R. (1998). Structure and specificity of nuclear receptor-coactivator interactions. Genes Dev. 12, 3343–3356.

187

Debonneville, C., Flores, S.Y., Kamynina, E., Plant, P.J., Tauxe, C., Thomas, M.A., Münster, C., Chraïbi, A., Pratt, J.H., Horisberger, J.D., et al. (2001). Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na(+) channel cell surface expression. EMBO J. 20, 7052–7059.

Delyani, J.A., Rocha, R., Cook, C.S., Tobert, D.S., Levin, S., Roniker, B., Workman, D.L., Sing, Y.L., and Whelihan, B. (2001). Eplerenone: a selective aldosterone receptor antagonist (SARA). Cardiovasc. Drug Rev. 19, 185–200.

Deppe, C.E., Heering, P.J., Viengchareun, S., Grabensee, B., Farman, N., and Lombe S, M. (2002). Cyclosporine A and FK506 Inhibit Transcriptional Activity of the Human Mineralocorticoid Receptor: A Cell-Based Model to Investigate Partial Aldosterone Resistance in Kidney Transplantation. Endocrinology 143, 1932–1941.

Dey, R., Roychowdhury, P., and Mukherjee, C. (2001). Homology modelling of the ligand-binding domain of glucocorticoid receptor: binding site interactions with cortisol and corticosterone. Protein Eng. 14, 565–571.

Dietz, J.D., Du, S., Bolten, C.W., Payne, M.A., Xia, C., Blinn, J.R., Funder, J.W., and Hu, X. (2008). A number of marketed dihydropyridine calcium channel blockers have mineralocorticoid receptor antagonist activity. Hypertens. Dallas Tex 1979 51, 742–748.

Dooley, R., Angibaud, E., Yusef, Y.R., Thomas, W., and Harvey, B.J. (2013). Aldosterone-induced ENaC and basal Na+/K+-ATPase trafficking via protein kinase D1-phosphatidylinositol 4- kinaseIIIβ trans Golgi signalling in M1 cortical collecting duct cells. Mol. Cell. Endocrinol. 372, 86– 95.

Duc, C., Farman, N., Canessa, C.M., Bonvalet, J.P., and Rossier, B.C. (1994). Cell-specific expression of epithelial sodium channel alpha, beta, and gamma subunits in aldosterone- responsive epithelia from the rat: localization by in situ hybridization and immunocytochemistry. J. Cell Biol. 127, 1907–1921.

Dumeige, L., Storey, C., Decourtye, L., Nehlich, M., Lhadj, C., Viengchareun, S., Kappeler, L., Lombès, M., and Martinerie, L. (2017). Sex-Specificity of Mineralocorticoid Target Gene Expression during Renal Development, and Long-Term Consequences. Int. J. Mol. Sci. 18.

Duval, D., and Funder, J.W. (1974). The binding of tritiated aldosterone in the rat liver cytosol. Endocrinology 94, 575–579.

Eaton, D.C., Malik, B., Saxena, N.C., Al-Khalili, O.K., and Yue, G. (2001). Mechanisms of aldosterone’s action on epithelial Na + transport. J. Membr. Biol. 184, 313–319.

Echeverria, P.C., and Picard, D. (2010). Molecular chaperones, essential partners of steroid hormone receptors for activity and mobility. Biochim. Biophys. Acta 1803, 641–649.

Edman, K., Hosseini, A., Bjursell, M.K., Aagaard, A., Wissler, L., Gunnarsson, A., Kaminski, T., Köhler, C., Bäckström, S., Jensen, T.J., et al. (2015). Ligand Binding Mechanism in Steroid Receptors: From Conserved Plasticity to Differential Evolutionary Constraints. Struct. Lond. Engl. 1993 23, 2280–2290.

Edwards, C.R., Stewart, P.M., Burt, D., Brett, L., McIntyre, M.A., Sutanto, W.S., de Kloet, E.R., and Monder, C. (1988). Localisation of 11 beta-hydroxysteroid dehydrogenase--tissue specific protector of the mineralocorticoid receptor. Lancet Lond. Engl. 2, 986–989.

188

Elinoff, J.M., Rame, J.E., Forfia, P.R., Hall, M.K., Sun, J., Gharib, A.M., Abd-Elmoniem, K., Graninger, G., Harper, B., Danner, R.L., et al. (2013). A pilot study of the effect of spironolactone therapy on exercise capacity and endothelial dysfunction in pulmonary arterial hypertension: study protocol for a randomized controlled trial. Trials 14, 91.

Engelen, E., Brandsma, J.H., Moen, M.J., Signorile, L., Dekkers, D.H.W., Demmers, J., Kockx, C.E.M., Ozgür, Z., van IJcken, W.F.J., van den Berg, D.L.C., et al. (2015). Proteins that bind regulatory regions identified by histone modification chromatin immunoprecipitations and mass spectrometry. Nat. Commun. 6, 7155.

Fagart, J., Wurtz, J.M., Souque, A., Hellal-Levy, C., Moras, D., and Rafestin-Oblin, M.E. (1998). Antagonism in the human mineralocorticoid receptor. EMBO J. 17, 3317–3325.

Fagart, J., Huyet, J., Pinon, G.M., Rochel, M., Mayer, C., and Rafestin-Oblin, M.-E. (2005a). Crystal structure of a mutant mineralocorticoid receptor responsible for hypertension. Nat. Struct. Mol. Biol. 12, 554–555.

Fagart, J., Seguin, C., Pinon, G.M., and Rafestin-Oblin, M.-E. (2005b). The Met852 residue is a key organizer of the ligand-binding cavity of the human mineralocorticoid receptor. Mol. Pharmacol. 67, 1714–1722.

Fagart, J., Hillisch, A., Huyet, J., Bärfacker, L., Fay, M., Pleiss, U., Pook, E., Schäfer, S., Rafestin- Oblin, M.-E., and Kolkhof, P. (2010). A new mode of mineralocorticoid receptor antagonism by a potent and selective nonsteroidal molecule. J. Biol. Chem. 285, 29932–29940.

Fakitsas, P., Adam, G., Daidié, D., van Bemmelen, M.X., Fouladkou, F., Patrignani, A., Wagner, U., Warth, R., Camargo, S.M.R., Staub, O., et al. (2007). Early aldosterone-induced gene product regulates the epithelial sodium channel by deubiquitylation. J. Am. Soc. Nephrol. JASN 18, 1084– 1092.

Faresse, N. (2014). Post-translational modifications of the mineralocorticoid receptor: How to dress the receptor according to the circumstances? J. Steroid Biochem. Mol. Biol. 143, 334–342.

Faresse, N., Ruffieux-Daidie, D., Salamin, M., Gomez-Sanchez, C.E., and Staub, O. (2010). Mineralocorticoid receptor degradation is promoted by Hsp90 inhibition and the ubiquitin-protein ligase CHIP. Am. J. Physiol. Renal Physiol. 299, F1462-1472.

Faresse, N., Vitagliano, J.-J., and Staub, O. (2012). Differential ubiquitylation of the mineralocorticoid receptor is regulated by phosphorylation. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 26, 4373–4382.

Faresse, N., Debonneville, A., and Staub, O. (2013). USP2-45 represses aldosterone mediated responses by decreasing mineralocorticoid receptor availability. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 31, 462–472.

Farrelly, R.O., Howie, R.N., and North, J.D. (1960). Use of spironolactone and hydrochlorothiazide in treatment of oedema. Br. Med. J. 2, 339–343.

Fejes-Tóth, G., and Náray-Fejes-Tóth, A. (2007). Early aldosterone-regulated genes in cardiomyocytes: clues to cardiac remodeling? Endocrinology 148, 1502–1510.

189

Fejes-Tóth, G., Pearce, D., and Náray-Fejes-Tóth, A. (1998). Subcellular localization of mineralocorticoid receptors in living cells: effects of receptor agonists and antagonists. Proc. Natl. Acad. Sci. U. S. A. 95, 2973–2978.

Fernandes-Rosa, F.L., Hubert, E.-L., Fagart, J., Tchitchek, N., Gomes, D., Jouanno, E., Benecke, A., Rafestin-Oblin, M.-E., Jeunemaitre, X., Antonini, S.R., et al. (2011). Mineralocorticoid receptor mutations differentially affect individual gene expression profiles in pseudohypoaldosteronism type 1. J. Clin. Endocrinol. Metab. 96, E519-527.

Filippatos, G., Anker, S.D., Böhm, M., Gheorghiade, M., Køber, L., Krum, H., Maggioni, A.P., Ponikowski, P., Voors, A.A., Zannad, F., et al. (2016). A randomized controlled study of finerenone vs. eplerenone in patients with worsening chronic heart failure and diabetes mellitus and/or chronic kidney disease. Eur. Heart J. 37, 2105–2114.

Fowden, A.L., and Forhead, A.J. (2009). Endocrine regulation of feto-placental growth. Horm. Res. 72, 257–265.

Fujihara, Y., Kondo, H., Noguchi, T., and Togari, A. (2014). Glucocorticoids mediate circadian timing in peripheral osteoclasts resulting in the circadian expression rhythm of osteoclast-related genes. Bone 61, 1–9.

Fuller, P.J. (2015). Novel interactions of the mineralocorticoid receptor. Mol. Cell. Endocrinol. 408, 33–37.

Fuller, P.J., Lim-Tio, S.S., and Brennan, F.E. (2000). Specificity in mineralocorticoid versus glucocorticoid action. Kidney Int. 57, 1256–1264.

Fuller, P.J., Yang, J., and Young, M.J. (2017). 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Coregulators as mediators of mineralocorticoid receptor signalling diversity. J. Endocrinol. 234, T23–T34.

Fullwood, M.J., Liu, M.H., Pan, Y.F., Liu, J., Xu, H., Mohamed, Y.B., Orlov, Y.L., Velkov, S., Ho, A., Mei, P.H., et al. (2009). An oestrogen-receptor-alpha-bound human chromatin interactome. Nature 462, 58–64.

Funder, J. (2017a). 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Mineralocorticoid receptor activation and specificity-conferring mechanisms: a brief history. J. Endocrinol. 234, T17– T21.

Funder, J.W. (2007). Mineralocorticoid receptor activation and oxidative stress. Hypertens. Dallas Tex 1979 50, 840–841.

Funder, J.W. (2009). Reconsidering the roles of the mineralocorticoid receptor. Hypertens. Dallas Tex 1979 53, 286–290.

Funder, J.W. (2012). Primary aldosteronism: are we missing the wood for the trees? Horm. Metab. Res. Horm. Stoffwechselforschung Horm. Metab. 44, 251–253.

Funder, J.W. (2015). Primary Aldosteronism: New Answers, New Questions. Horm. Metab. Res. Horm. Stoffwechselforschung Horm. Metab. 47, 935–940.

190

Funder, J.W. (2017b). Aldosterone and Mineralocorticoid Receptors-Physiology and Pathophysiology. Int. J. Mol. Sci. 18.

Funder, J., and Myles, K. (1996). Exclusion of corticosterone from epithelial mineralocorticoid receptors is insufficient for selectivity of aldosterone action: in vivo binding studies. Endocrinology 137, 5264–5268.

Funder, J.W., Pearce, P.T., Smith, R., and Smith, A.I. (1988). Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242, 583–585.

Furuta, H., Mori, N., Sato, C., Hoshikawa, H., Sakai, S., Iwakura, S., and Doi, K. (1994). Mineralocorticoid type I receptor in the rat cochlea: mRNA identification by polymerase chain reaction (PCR) and in situ hybridization. Hear. Res. 78, 175–180.

Fuse, H., Kitagawa, H., and Kato, S. (2000). Characterization of Transactivational Property and Coactivator Mediation of Rat Mineralocorticoid Receptor Activation Function-1 (AF-1). Mol. Endocrinol. 14, 889–899.

Galigniana, M.D. (1998). Native rat kidney mineralocorticoid receptor is a phosphoprotein whose transformation to a DNA-binding form is induced by phosphatases. Biochem. J. 333 ( Pt 3), 555– 563.

Garnier, A., Bendall, J.K., Fuchs, S., Escoubet, B., Rochais, F., Hoerter, J., Nehme, J., Ambroisine, M.-L., De Angelis, N., Morineau, G., et al. (2004). Cardiac specific increase in aldosterone production induces coronary dysfunction in aldosterone synthase-transgenic mice. Circulation 110, 1819–1825.

Geerling, J.C., and Loewy, A.D. (2008). Central regulation of sodium appetite. Exp. Physiol. 93, 177–209.

Geerling, J.C., and Loewy, A.D. (2009). Aldosterone in the brain. Am. J. Physiol. Renal Physiol. 297, F559-576.

Geller, D.S., Rodriguez-Soriano, J., Vallo Boado, A., Schifter, S., Bayer, M., Chang, S.S., and Lifton, R.P. (1998). Mutations in the mineralocorticoid receptor gene cause autosomal dominant pseudohypoaldosteronism type I. Nat. Genet. 19, 279–281.

Geller, D.S., Farhi, A., Pinkerton, N., Fradley, M., Moritz, M., Spitzer, A., Meinke, G., Tsai, F.T., Sigler, P.B., and Lifton, R.P. (2000). Activating mineralocorticoid receptor mutation in hypertension exacerbated by pregnancy. Science 289, 119–123.

Georgopoulos, A.J., Dustan, H., and Page, I.H. (1961). Spironolactone in hypertensive patients. Oligemic and antihypertensive effects. Arch. Intern. Med. 108, 389–392.

Gerstein, M.B., Kundaje, A., Hariharan, M., Landt, S.G., Yan, K.-K., Cheng, C., Mu, X.J., Khurana, E., Rozowsky, J., Alexander, R., et al. (2012). Architecture of the human regulatory network derived from ENCODE data. Nature 489, 91–100.

Gomez-Sanchez, E.P. (2016). Third-generation Mineralocorticoid Receptor Antagonists: Why Do We Need a Fourth? J. Cardiovasc. Pharmacol. 67, 26–38.

191

Gomez-Sanchez, E., and Gomez-Sanchez, C.E. (2014). The multifaceted mineralocorticoid receptor. Compr. Physiol. 4, 965–994.

Gomez-Sanchez, C.E., de Rodriguez, A.F., Romero, D.G., Estess, J., Warden, M.P., Gomez- Sanchez, M.T., and Gomez-Sanchez, E.P. (2006). Development of a panel of monoclonal antibodies against the mineralocorticoid receptor. Endocrinology 147, 1343–1348.

Gómez-Sánchez, E.P., Venkataraman, M.T., Thwaites, D., and Fort, C. (1990). ICV infusion of corticosterone antagonizes ICV-aldosterone hypertension. Am. J. Physiol. 258, E649-653.

Gong, Y., Cao, R., Ding, G., Hong, S., Zhou, W., Lu, W., Damle, M., Fang, B., Wang, C.C., Qian, J., et al. (2017). Integrated omics approaches to characterize a nuclear receptor corepressor- associated histone deacetylase in mouse skeletal muscle. Mol. Cell. Endocrinol.

Goodwin, J.E., Zhang, J., Velazquez, H., and Geller, D.S. (2010). The glucocorticoid receptor in the distal nephron is not necessary for the development or maintenance of dexamethasone- induced hypertension. Biochem. Biophys. Res. Commun. 394, 266–271.

Govindan, M.V., Leclerc, S., Roy, R., Rathanaswami, P., and Xie, B.X. (1991). Differential regulation of mouse mammary tumor virus-bacterial chloramphenicol acetyltransferase chimeric gene by human mineralocorticoid hormone-receptor complexes. J. Steroid Biochem. Mol. Biol. 39, 91–103.

Grimaldi, A.G., Buisine, N., Bilesimo, P., and Sachs, L.M. (2013). High-throughput sequencing will metamorphose the analysis of thyroid hormone receptor function during amphibian development. Curr. Top. Dev. Biol. 103, 277–303.

Gross, F., and Gysel, H. (1954). The Action of Electrocortin in the Adrenalectomized Dog. Acta Endocrinol. (Copenh.) 15, 199–209.

Grossmann, C., Husse, B., Mildenberger, S., Schreier, B., Schuman, K., and Gekle, M. (2010). Colocalization of mineralocorticoid and EGF receptor at the plasma membrane. Biochim. Biophys. Acta 1803, 584–590.

Grossmann, C., Ruhs, S., Langenbruch, L., Mildenberger, S., Strätz, N., Schumann, K., and Gekle, M. (2012). Nuclear shuttling precedes dimerization in mineralocorticoid receptor signaling. Chem. Biol. 19, 742–751.

Grune, J., Benz, V., Brix, S., Salatzki, J., Blumrich, A., Höft, B., Klopfleisch, R., Foryst-Ludwig, A., Kolkhof, P., and Kintscher, U. (2016). Steroidal and Nonsteroidal Mineralocorticoid Receptor Antagonists Cause Differential Cardiac Gene Expression in Pressure Overload-induced Cardiac Hypertrophy. J. Cardiovasc. Pharmacol. 67, 402–411.

Guazzi, M.D., Barbier, P., Loaldi, A., Montorsi, P., Polese, A., Tosi, E., and Fiorentini, C. (1985). Intrarenal beta-receptor and renal baroreceptor interaction in the control of the renin response to transient reduction of the renal perfusion pressure in man. J. Hypertens. 3, 39–45.

Gueret, A., Harouki, N., Favre, J., Galmiche, G., Nicol, L., Henry, J.-P., Besnier, M., Thuillez, C., Richard, V., Kolkhof, P., et al. (2016). Vascular Smooth Muscle Mineralocorticoid Receptor Contributes to Coronary and Left Ventricular Dysfunction After Myocardial Infarction. Hypertens. Dallas Tex 1979 67, 717–723.

192

Guichard, J.L., Clark, D., Calhoun, D.A., and Ahmed, M.I. (2013). Aldosterone receptor antagonists: current perspectives and therapies. Vasc. Health Risk Manag. 9, 321–331.

Gumz, M.L., Stow, L.R., Lynch, I.J., Greenlee, M.M., Rudin, A., Cain, B.D., Weaver, D.R., and Wingo, C.S. (2009). The circadian clock protein Period 1 regulates expression of the renal epithelial sodium channel in mice. J. Clin. Invest. 119, 2423–2434.

Gumz, M.L., Cheng, K.-Y., Lynch, I.J., Stow, L.R., Greenlee, M.M., Cain, B.D., and Wingo, C.S. (2010). Regulation of αENaC expression by the circadian clock protein Period 1 in mpkCCD(c14) cells. Biochim. Biophys. Acta 1799, 622–629.

Guo, C., Ricchiuti, V., Lian, B.Q., Yao, T.M., Coutinho, P., Romero, J.R., Li, J., Williams, G.H., and Adler, G.K. (2008). Mineralocorticoid receptor blockade reverses obesity-related changes in expression of adiponectin, peroxisome proliferator-activated receptor-gamma, and proinflammatory adipokines. Circulation 117, 2253–2261.

Hanson, M., and Gluckman, P. (2011). Developmental origins of noncommunicable disease: population and public health implications. Am. J. Clin. Nutr. 94, 1754S–1758S.

Hanukoglu, A. (1991). Type I pseudohypoaldosteronism includes two clinically and genetically distinct entities with either renal or multiple target organ defects. J. Clin. Endocrinol. Metab. 73, 936–944.

Hanukoglu, I., and Hanukoglu, A. (2016). Epithelial sodium channel (ENaC) family: Phylogeny, structure-function, tissue distribution, and associated inherited diseases. Gene 579, 95–132.

Harvey, A.P., Montezano, A.C., Hood, K.Y., Lopes, R.A., Rios, F., Ceravolo, G., Graham, D., and Touyz, R.M. (2017). Vascular dysfunction and fibrosis in stroke-prone spontaneously hypertensive rats: The aldosterone-mineralocorticoid receptor-Nox1 axis. Life Sci. 179, 110–119.

Heinig, R., Kimmeskamp-Kirschbaum, N., Halabi, A., and Lentini, S. (2016). Pharmacokinetics of the Novel Nonsteroidal Mineralocorticoid Receptor Antagonist Finerenone (BAY 94-8862) in Individuals With Renal Impairment. Clin. Pharmacol. Drug Dev. 5, 488–501.

Hellal-Levy, C., Couette, B., Fagart, J., Souque, A., Gomez-Sanchez, C., and Rafestin-Oblin, M. (1999). Specific hydroxylations determine selective corticosteroid recognition by human glucocorticoid and mineralocorticoid receptors. FEBS Lett. 464, 9–13.

Hellal-Levy, C., Fagart, J., Souque, A., Wurtz, J.M., Moras, D., and Rafestin-Oblin, M.E. (2000a). Crucial role of the H11-H12 loop in stabilizing the active conformation of the human mineralocorticoid receptor. Mol. Endocrinol. Baltim. Md 14, 1210–1221.

Hellal-Levy, C., Fagart, J., Souque, A., and Rafestin-Oblin, M.E. (2000b). Mechanistic aspects of mineralocorticoid receptor activation. Kidney Int. 57, 1250–1255.

Helzer, K.T., Hooper, C., Miyamoto, S., and Alarid, E.T. (2015). Ubiquitylation of nuclear receptors: new linkages and therapeutic implications. J. Mol. Endocrinol. 54, R151-167.

Herman, J.P., and Watson, S.J. (1995). Stress regulation of mineralocorticoid receptor heteronuclear RNA in rat hippocampus. Brain Res. 677, 243–249.

193

Herman, J.P., Patel, P.D., Akil, H., and Watson, S.J. (1989). Localization and regulation of glucocorticoid and mineralocorticoid receptor messenger RNAs in the hippocampal formation of the rat. Mol. Endocrinol. Baltim. Md 3, 1886–1894.

Hirasawa, G., Sasano, H., Suzuki, T., Takeyama, J., Muramatu, Y., Fukushima, K., Hiwatashi, N., Toyota, T., Nagura, H., and Krozowski, Z.S. (1999). 11β-Hydroxysteroid Dehydrogenase Type 2 and Mineralocorticoid Receptor in Human Fetal Development. J. Clin. Endocrinol. Metab. 84, 1453–1458.

Hirata, A., Maeda, N., Nakatsuji, H., Hiuge-Shimizu, A., Okada, T., Funahashi, T., and Shimomura, I. (2012). Contribution of glucocorticoid-mineralocorticoid receptor pathway on the obesity-related adipocyte dysfunction. Biochem. Biophys. Res. Commun. 419, 182–187.

Hong, H., Kohli, K., Trivedi, A., Johnson, D.L., and Stallcup, M.R. (1996). GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc. Natl. Acad. Sci. U. S. A. 93, 4948–4952.

Hong, H., Kohli, K., Garabedian, M.J., and Stallcup, M.R. (1997). GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol. Cell. Biol. 17, 2735–2744.

Hoppmann, J., Perwitz, N., Meier, B., Fasshauer, M., Hadaschik, D., Lehnert, H., and Klein, J. (2010). The balance between gluco- and mineralo-corticoid action critically determines inflammatory adipocyte responses. J. Endocrinol. 204, 153–164.

Horisberger, J.-D. (2004). Recent insights into the structure and mechanism of the sodium pump. Physiol. Bethesda Md 19, 377–387.

Hu, X., and Funder, J.W. (2006). The evolution of mineralocorticoid receptors. Mol. Endocrinol. Baltim. Md 20, 1471–1478.

Hudson, W.H., Youn, C., and Ortlund, E.A. (2014). Crystal structure of the mineralocorticoid receptor DNA binding domain in complex with DNA. PloS One 9, e107000.

Huh, S.Y., Andrew, R., Rich-Edwards, J.W., Kleinman, K.P., Seckl, J.R., and Gillman, M.W. (2008). Association between umbilical cord glucocorticoids and blood pressure at age 3 years. BMC Med. 6, 25.

Hultman, M.L., Krasnoperova, N.V., Li, S., Du, S., Xia, C., Dietz, J.D., Lala, D.S., Welsch, D.J., and Hu, X. (2005). The ligand-dependent interaction of mineralocorticoid receptor with coactivator and corepressor peptides suggests multiple activation mechanisms. Mol. Endocrinol. Baltim. Md 19, 1460–1473.

Humbert, M. (2008). Book Review. N. Engl. J. Med. 359, 2180–2181.

Hunt, H.J., Belanoff, J.K., Walters, I., Gourdet, B., Thomas, J., Barton, N., Unitt, J., Phillips, T., Swift, D., and Eaton, E. (2017). Identification of the Clinical Candidate (R)-(1-(4-Fluorophenyl)-6- ((1-methyl-1H-pyrazol-4-yl)sulfonyl)-4,4a,5,6,7,8-hexahydro-1H-pyrazolo[3,4-g]isoquinolin-4a- yl)(4-(trifluoromethyl)pyridin-2-yl)methanone (CORT125134): A Selective Glucocorticoid Receptor (GR) Antagonist. J. Med. Chem. 60, 3405–3421.

194

Huyet, J., Pinon, G.M., Fay, M.R., Rafestin-Oblin, M.-E., and Fagart, J. (2012). Structural determinants of ligand binding to the mineralocorticoid receptor. Mol. Cell. Endocrinol. 350, 187– 195.

Ikonen, T., Palvimo, J.J., and Jänne, O.A. (1997). Interaction between the amino- and carboxyl- terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J. Biol. Chem. 272, 29821–29828.

Inoue, F., and Ahituv, N. (2015). Decoding enhancers using massively parallel reporter assays. Genomics 106, 159–164.

Jääskeläinen, T., Makkonen, H., and Palvimo, J.J. (2011). Steroid up-regulation of FKBP51 and its role in hormone signaling. Curr. Opin. Pharmacol. 11, 326–331.

Jaisser, F., and Farman, N. (2016). Emerging Roles of the Mineralocorticoid Receptor in Pathology: Toward New Paradigms in Clinical Pharmacology. Pharmacol. Rev. 68, 49–75.

Jewell, C.M., Scoltock, A.B., Hamel, B.L., Yudt, M.R., and Cidlowski, J.A. (2012). Complex human glucocorticoid receptor dim mutations define glucocorticoid induced apoptotic resistance in bone cells. Mol. Endocrinol. Baltim. Md 26, 244–256.

Jia, G., Jia, Y., and Sowers, J.R. (2016). Role of mineralocorticoid receptor activation in cardiac diastolic dysfunction. Biochim. Biophys. Acta.

Jiang, G., Yang, F., Sanchez, C., and Ehrlich, M. (2004). Histone modification in constitutive heterochromatin versus unexpressed euchromatin in human cells. J. Cell. Biochem. 93, 286–300.

Jiménez-Canino, R., Fernandes, M.X., and Alvarez de la Rosa, D. (2016a). Phosphorylation of Mineralocorticoid Receptor Ligand Binding Domain Impairs Receptor Activation and Has a Dominant Negative Effect over Non-phosphorylated Receptors. J. Biol. Chem. 291, 19068–19078.

Jiménez-Canino, R., Lorenzo-Díaz, F., Jaisser, F., Farman, N., Giraldez, T., and Alvarez de la Rosa, D. (2016b). Histone Deacetylase 6–Controlled Hsp90 Acetylation Significantly Alters Mineralocorticoid Receptor Subcellular Dynamics But Not its Transcriptional Activity. Endocrinology 157, 2515–2532.

Joëls, M., and De Kloet, E.R. (1992). Coordinative mineralocorticoid and glucocorticoid receptor- mediated control of responses to serotonin in rat hippocampus. Neuroendocrinology 55, 344–350.

Joëls, M., and de Kloet, E.R. (2017). 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: The brain mineralocorticoid receptor: a saga in three episodes. J. Endocrinol. 234, T49–T66.

John, S., Sabo, P.J., Thurman, R.E., Sung, M.-H., Biddie, S.C., Johnson, T.A., Hager, G.L., and Stamatoyannopoulos, J.A. (2011). Chromatin accessibility pre-determines glucocorticoid receptor binding patterns. Nat. Genet. 43, 264–268.

Jørgensen, P.L. (1986). Structure, function and regulation of Na,K-ATPase in the kidney. Kidney Int. 29, 10–20.

Juurlink, D.N., Mamdani, M.M., Lee, D.S., Kopp, A., Austin, P.C., Laupacis, A., and Redelmeier, D.A. (2004). Rates of hyperkalemia after publication of the Randomized Aldactone Evaluation Study. N. Engl. J. Med. 351, 543–551.

195

Kamar, R.I., Banigan, E.J., Erbas, A., Giuntoli, R.D., Olvera de la Cruz, M., Johnson, R.C., and Marko, J.F. (2017). Facilitated dissociation of transcription factors from single DNA binding sites. Proc. Natl. Acad. Sci. U. S. A.

Karagianni, P., and Wong, J. (2007). HDAC3: taking the SMRT-N-CoRrect road to repression. Oncogene 26, 5439–5449.

Katayama, S., Yamada, D., Nakayama, M., Yamada, T., Myoishi, M., Kato, M., Nowack, C., Kolkhof, P., Yamasaki, Y., and ARTS-DN Japan study group (2017). A randomized controlled study of finerenone versus placebo in Japanese patients with type 2 diabetes mellitus and diabetic nephropathy. J. Diabetes Complications 31, 758–765.

Kellenberger, S., and Schild, L. (2002). Epithelial sodium channel/degenerin family of ion channels: a variety of functions for a shared structure. Physiol. Rev. 82, 735–767.

Kenouch, S., Lombes, M., Delahaye, F., Eugene, E., Bonvalet, J.P., and Farman, N. (1994). Human skin as target for aldosterone: coexpression of mineralocorticoid receptors and 11 beta- hydroxysteroid dehydrogenase. J. Clin. Endocrinol. Metab. 79, 1334–1341.

Kerscher, O., Felberbaum, R., and Hochstrasser, M. (2006). Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell Dev. Biol. 22, 159–180.

Kiilerich, P., Triqueneaux, G., Christensen, N.M., Trayer, V., Terrien, X., Lombès, M., and Prunet, P. (2015). Interaction between the trout mineralocorticoid and glucocorticoid receptors in vitro. J. Mol. Endocrinol. 55, 55–68.

Kino, T. (2000). Glucocorticoid Receptor. In Endotext, L.J. De Groot, G. Chrousos, K. Dungan, K.R. Feingold, A. Grossman, J.M. Hershman, C. Koch, M. Korbonits, R. McLachlan, M. New, et al., eds. (South Dartmouth (MA): MDText.com, Inc.), p.

Kino, T., Jaffe, H., Amin, N.D., Chakrabarti, M., Zheng, Y.-L., Chrousos, G.P., and Pant, H.C. (2010). Cyclin-dependent kinase 5 modulates the transcriptional activity of the mineralocorticoid receptor and regulates expression of brain-derived neurotrophic factor. Mol. Endocrinol. Baltim. Md 24, 941–952.

Kitagawa, H., Yanagisawa, J., Fuse, H., Ogawa, S., Yogiashi, Y., Okuno, A., Nagasawa, H., Nakajima, T., Matsumoto, T., and Kato, S. (2002). Ligand-selective potentiation of rat mineralocorticoid receptor activation function 1 by a CBP-containing histone acetyltransferase complex. Mol. Cell. Biol. 22, 3698–3706.

Kleinewietfeld, M., Manzel, A., Titze, J., Kvakan, H., Yosef, N., Linker, R.A., Muller, D.N., and Hafler, D.A. (2013). Sodium chloride drives autoimmune disease by the induction of pathogenic TH17 cells. Nature 496, 518–522.

Kohler, S., Pradervand, S., Verdumo, C., Mérillat, A.M., Bens, M., Vandewalle, A., Beermann, F., and Hummler, E. (2001). Analysis of the mouse Scnn1a promoter in cortical collecting duct cells and in transgenic mice. Biochim. Biophys. Acta 1519, 106–110.

Kolkhof, P., and Bärfacker, L. (2017). 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Mineralocorticoid receptor antagonists: 60 years of research and development. J. Endocrinol. 234, T125–T140.

196

Kolkhof, P., Delbeck, M., Kretschmer, A., Steinke, W., Hartmann, E., Bärfacker, L., Eitner, F., Albrecht-Küpper, B., and Schäfer, S. (2014). Finerenone, a novel selective nonsteroidal mineralocorticoid receptor antagonist protects from rat cardiorenal injury. J. Cardiovasc. Pharmacol. 64, 69–78.

Kolkhof, P., Nowack, C., and Eitner, F. (2015). Nonsteroidal antagonists of the mineralocorticoid receptor. Curr. Opin. Nephrol. Hypertens. 24, 417–424.

Kolla, V., and Litwack, G. (2000). Inhibition of mineralocorticoid-mediated transcription by NF- kappaB. Arch. Biochem. Biophys. 383, 38–45.

Kolla, V., Robertson, N.M., and Litwack, G. (1999). Identification of a mineralocorticoid/glucocorticoid response element in the human Na/K ATPase alpha1 gene promoter. Biochem. Biophys. Res. Commun. 266, 5–14.

Koopman, M.G., Krediet, R.T., and Arisz, L. (1985). Circadian rhythms and the kidney. A review. Neth. J. Med. 28, 416–423.

Kovacs, J.J., Murphy, P.J.M., Gaillard, S., Zhao, X., Wu, J.-T., Nicchitta, C.V., Yoshida, M., Toft, D.O., Pratt, W.B., and Yao, T.-P. (2005). HDAC6 regulates Hsp90 acetylation and chaperone- dependent activation of glucocorticoid receptor. Mol. Cell 18, 601–607.

Krozowski, Z., and Funder, J.W. (1981). Mineralocorticoid Receptors in the Rat Lung. Endocrinology 109, 1811–1813.

Krozowski, Z.S., Rundle, S.E., Wallace, C., Castell, M.J., Shen, J.H., Dowling, J., Funder, J.W., and Smith, A.I. (1989). Immunolocalization of renal mineralocorticoid receptors with an antiserum against a peptide deduced from the complementary deoxyribonucleic acid sequence. Endocrinology 125, 192–198.

Kuhn, E., Bourgeois, C., Keo, V., Viengchareun, S., Muscat, A., Meduri, G., Le Menuet, D., Fève, B., and Lombès, M. (2014). Paradoxical resistance to high-fat diet-induced obesity and altered macrophage polarization in mineralocorticoid receptor-overexpressing mice. Am. J. Physiol. Endocrinol. Metab. 306, E75-90.

Kusche-Vihrog, K., Sobczak, K., Bangel, N., Wilhelmi, M., Nechyporuk-Zloy, V., Schwab, A., Schillers, H., and Oberleithner, H. (2008). Aldosterone and amiloride alter ENaC abundance in vascular endothelium. Pflugers Arch. 455, 849–857.

LaCagnin, L.B., Lutsie, P., and Colby, H.D. (1987). Conversion of spironolactone to 7 alpha- thiomethylspironolactone by hepatic and renal microsomes. Biochem. Pharmacol. 36, 3439–3444.

Lai, W.K.M., and Pugh, B.F. (2017). Understanding nucleosome dynamics and their links to gene expression and DNA replication. Nat. Rev. Mol. Cell Biol. von Langen, J., Fritzemeier, K.-H., Diekmann, S., and Hillisch, A. (2005). Molecular basis of the interaction specificity between the human glucocorticoid receptor and its endogenous steroid ligand cortisol. Chembiochem Eur. J. Chem. Biol. 6, 1110–1118.

Latouche, C., Sainte-Marie, Y., Steenman, M., Castro Chaves, P., Naray-Fejes-Toth, A., Fejes- Toth, G., Farman, N., and Jaisser, F. (2010). Molecular signature of mineralocorticoid receptor signaling in cardiomyocytes: from cultured cells to mouse heart. Endocrinology 151, 4467–4476.

197

Lattenist, L., Lechner, S.M., Messaoudi, S., Le Mercier, A., El Moghrabi, S., Prince, S., Bobadilla, N.A., Kolkhof, P., Jaisser, F., and Barrera-Chimal, J. (2017). Nonsteroidal Mineralocorticoid Receptor Antagonist Finerenone Protects Against Acute Kidney Injury-Mediated Chronic Kidney Disease: Role of Oxidative Stress. Hypertens. Dallas Tex 1979 69, 870–878.

Le Billan, F., Khan, J.A., Lamribet, K., Viengchareun, S., Bouligand, J., Fagart, J., and Lombès, M. (2015). Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 29, 3977–3989.

Le Menuet, D., and Lombès, M. (2014). The neuronal mineralocorticoid receptor: from cell survival to neurogenesis. Steroids 91, 11–19.

Le Menuet, D., Viengchareun, S., Penfornis, P., Walker, F., Zennaro, M.C., and Lombès, M. (2000). Targeted oncogenesis reveals a distinct tissue-specific utilization of alternative promoters of the human mineralocorticoid receptor gene in transgenic mice. J. Biol. Chem. 275, 7878–7886.

Le Menuet, D., Isnard, R., Bichara, M., Viengchareun, S., Muffat-Joly, M., Walker, F., Zennaro, M.C., and Lombès, M. (2001). Alteration of cardiac and renal functions in transgenic mice overexpressing human mineralocorticoid receptor. J. Biol. Chem. 276, 38911–38920.

Le Menuet, D., Munier, M., Meduri, G., Viengchareun, S., and Lombès, M. (2010). Mineralocorticoid receptor overexpression in embryonic stem cell-derived cardiomyocytes increases their beating frequency. Cardiovasc. Res. 87, 467–475.

Le Moëllic, C., Ouvrard-Pascaud, A., Capurro, C., Cluzeaud, F., Fay, M., Jaisser, F., Farman, N., and Blot-Chabaud, M. (2004). Early nongenomic events in aldosterone action in renal collecting duct cells: PKCalpha activation, mineralocorticoid receptor phosphorylation, and cross-talk with the genomic response. J. Am. Soc. Nephrol. JASN 15, 1145–1160.

Lee, J.H., and Lee, M.J. (2012). Emerging roles of the ubiquitin-proteasome system in the steroid receptor signaling. Arch. Pharm. Res. 35, 397–407.

Lee, H.-A., Lee, D.-Y., Cho, H.-M., Kim, S.-Y., Iwasaki, Y., and Kim, I.K. (2013). Histone deacetylase inhibition attenuates transcriptional activity of mineralocorticoid receptor through its acetylation and prevents development of hypertension. Circ. Res. 112, 1004–1012.

Lefebvre, H., Thomas, M., Duparc, C., Bertherat, J., and Louiset, E. (2016). Role of ACTH in the Interactive/Paracrine Regulation of Adrenal Steroid Secretion in Physiological and Pathophysiological Conditions. Front. Endocrinol. 7, 98.

Lefebvre, P., Benomar, Y., and Staels, B. (2010). Retinoid X receptors: common heterodimerization partners with distinct functions. Trends Endocrinol. Metab. TEM 21, 676–683.

Lek, M., Karczewski, K.J., Minikel, E.V., Samocha, K.E., Banks, E., Fennell, T., O’Donnell-Luria, A.H., Ware, J.S., Hill, A.J., Cummings, B.B., et al. (2016). Analysis of protein-coding genetic variation in 60,706 humans. Nature 536, 285–291.

Lema, I., Amazit, L., Lamribet, K., Fagart, J., Blanchard, A., Lombès, M., Cherradi, N., and Viengchareun, S. (2017). HuR-Dependent Editing of a New Mineralocorticoid Receptor Splice Variant Reveals an Osmoregulatory Loop for Sodium Homeostasis. Sci. Rep. 7, 4835.

198

Lentini, S., Heinig, R., Kimmeskamp-Kirschbaum, N., and Wensing, G. (2016). Pharmacokinetics, safety and tolerability of the novel, selective mineralocorticoid receptor antagonist finerenone - results from first-in-man and relative bioavailability studies. Fundam. Clin. Pharmacol. 30, 172– 184.

Leroy, V., De Seigneux, S., Agassiz, V., Hasler, U., Rafestin-Oblin, M.-E., Vinciguerra, M., Martin, P.-Y., and Féraille, E. (2009). Aldosterone activates NF-kappaB in the collecting duct. J. Am. Soc. Nephrol. JASN 20, 131–144.

Li, X., Wang, W., and Chen, J. (2015). From pathways to networks: connecting dots by establishing protein-protein interaction networks in signaling pathways using affinity purification and mass spectrometry. Proteomics 15, 188–202.

Li, Y., Suino, K., Daugherty, J., and Xu, H.E. (2005). Structural and biochemical mechanisms for the specificity of hormone binding and coactivator assembly by mineralocorticoid receptor. Mol. Cell 19, 367–380.

Lim, H.-Y., van den Brandt, J., Fassnacht, M., Allolio, B., Herold, M.J., and Reichardt, H.M. (2008). Silencing of the mineralocorticoid receptor by ribonucleic acid interference in transgenic rats disrupts endocrine homeostasis. Mol. Endocrinol. Baltim. Md 22, 1304–1311.

Lin, B., Wang, J., Hong, X., Yan, X., Hwang, D., Cho, J.-H., Yi, D., Utleg, A.G., Fang, X., Schones, D.E., et al. (2009). Integrated expression profiling and ChIP-seq analyses of the growth inhibition response program of the androgen receptor. PloS One 4, e6589.

Liu, W., Wang, J., Sauter, N.K., and Pearce, D. (1995). Steroid receptor heterodimerization demonstrated in vitro and in vivo. Proc. Natl. Acad. Sci. U. S. A. 92, 12480–12484.

Loffing, J., Zecevic, M., Féraille, E., Kaissling, B., Asher, C., Rossier, B.C., Firestone, G.L., Pearce, D., and Verrey, F. (2001). Aldosterone induces rapid apical translocation of ENaC in early portion of renal collecting system: possible role of SGK. Am. J. Physiol. Renal Physiol. 280, F675- 682.

Lombès, M., Farman, N., Oblin, M.E., Baulieu, E.E., Bonvalet, J.P., Erlanger, B.F., and Gasc, J.M. (1990). Immunohistochemical localization of renal mineralocorticoid receptor by using an anti- idiotypic antibody that is an internal image of aldosterone. Proc. Natl. Acad. Sci. U. S. A. 87, 1086– 1088.

Lombès, M., Oblin, M.E., Gasc, J.M., Baulieu, E.E., Farman, N., and Bonvalet, J.P. (1992). Immunohistochemical and biochemical evidence for a cardiovascular mineralocorticoid receptor. Circ. Res. 71, 503–510.

Lombès, M., Binart, N., Delahaye, F., Baulieu, E.E., and Rafestin-Oblin, M.E. (1994). Differential intracellular localization of human mineralocorticosteroid receptor on binding of agonists and antagonists. Biochem. J. 302 ( Pt 1), 191–197.

Lombes, M., Kenouch, S., Souque, A., Farman, N., and Rafestin-Oblin, M.E. (1994). The mineralocorticoid receptor discriminates aldosterone from glucocorticoids independently of the 11 beta-hydroxysteroid dehydrogenase. Endocrinology 135, 834–840.

Lombès, M., Farman, N., Bonvalet, J.P., and Zennaro, M.C. (2000). Identification and role of aldosterone receptors in the cardiovascular system. Ann. Endocrinol. 61, 41–46.

199

Love, M.I., Huska, M.R., Jurk, M., Schöpflin, R., Starick, S.R., Schwahn, K., Cooper, S.B., Yamamoto, K.R., Thomas-Chollier, M., Vingron, M., et al. (2017). Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation. Nucleic Acids Res. 45, 1805–1819.

MacKenzie, S.M., Huda, S.S., Sattar, N., Fraser, R., Connell, J.M.C., and Davies, E. (2008a). Depot-specific steroidogenic gene transcription in human adipose tissue. Clin. Endocrinol. (Oxf.) 69, 848–854.

MacKenzie, S.M., Dewar, D., Stewart, W., Fraser, R., Connell, J.M.C., and Davies, E. (2008b). The transcription of steroidogenic genes in the human cerebellum and hippocampus: a comparative survey of normal and Alzheimer’s tissue. J. Endocrinol. 196, 123–130.

Maeda, M., Hamano, K., Hirano, Y., Suzuki, M., Takahashi, E., Terada, T., Futai, M., and Sato, R. (1998). Structures of P-type transporting ATPases and chromosomal locations of their genes. Cell Struct. Funct. 23, 315–323. de Man, F.S., Tu, L., Handoko, M.L., Rain, S., Ruiter, G., François, C., Schalij, I., Dorfmüller, P., Simonneau, G., Fadel, E., et al. (2012). Dysregulated renin-angiotensin-aldosterone system contributes to pulmonary arterial hypertension. Am. J. Respir. Crit. Care Med. 186, 780–789.

Mangos, G.J., Whitworth, J.A., Williamson, P.M., and Kelly, J.J. (2003). Glucocorticoids and the kidney. Nephrol. Carlton Vic 8, 267–273.

Mani, O., Nashev, L.G., Livelo, C., Baker, M.E., and Odermatt, A. (2016). Role of Pro-637 and Gln-642 in human glucocorticoid receptors and Ser-843 and Leu-848 in mineralocorticoid receptors in their differential responses to cortisol and aldosterone. J. Steroid Biochem. Mol. Biol. 159, 31–40.

Martinerie, L., Viengchareun, S., Delezoide, A.-L., Jaubert, F., Sinico, M., Prevot, S., Boileau, P., Meduri, G., and Lombès, M. (2009a). Low renal mineralocorticoid receptor expression at birth contributes to partial aldosterone resistance in neonates. Endocrinology 150, 4414–4424.

Martinerie, L., Pussard, E., Foix-L’Hélias, L., Petit, F., Cosson, C., Boileau, P., and Lombès, M. (2009b). Physiological partial aldosterone resistance in human newborns. Pediatr. Res. 66, 323– 328.

Martinerie, L., Viengchareun, S., Meduri, G., Kim, H.-S., Luther, J.M., and Lombès, M. (2011). Aldosterone postnatally, but not at birth, is required for optimal induction of renal mineralocorticoid receptor expression and sodium reabsorption. Endocrinology 152, 2483–2491.

Martinerie, L., Pussard, E., Meduri, G., Delezoide, A.-L., Boileau, P., and Lombès, M. (2012). Lack of renal 11 beta-hydroxysteroid dehydrogenase type 2 at birth, a targeted temporal window for neonatal glucocorticoid action in human and mice. PloS One 7, e31949.

Martinerie, L., Munier, M., Le Menuet, D., Meduri, G., Viengchareun, S., and Lombès, M. (2013). The mineralocorticoid signaling pathway throughout development: expression, regulation and pathophysiological implications. Biochimie 95, 148–157.

Martín-Martínez, M., Pérez-Gordillo, F.L., Álvarez de la Rosa, D., Rodríguez, Y., Gerona-Navarro, G., González-Muñiz, R., and Zhou, M.-M. (2017). Modulating Mineralocorticoid Receptor with

200

Non-steroidal Antagonists. New Opportunities for the Development of Potent and Selective Ligands without Off-Target Side Effects. J. Med. Chem. 60, 2629–2650.

Marver, D., Stewart, J., Funder, J.W., Feldman, D., and Edelman, I.S. (1974). Renal aldosterone receptors: studies with (3H)aldosterone and the anti-mineralocorticoid (3H)spirolactone (SC- 26304). Proc. Natl. Acad. Sci. U. S. A. 71, 1431–1435.

Marzolla, V., Armani, A., Zennaro, M.-C., Cinti, F., Mammi, C., Fabbri, A., Rosano, G.M.C., and Caprio, M. (2012). The role of the mineralocorticoid receptor in adipocyte biology and fat metabolism. Mol. Cell. Endocrinol. 350, 281–288.

Marzolla, V., Armani, A., Feraco, A., De Martino, M.U., Fabbri, A., Rosano, G., and Caprio, M. (2014). Mineralocorticoid receptor in adipocytes and macrophages: a promising target to fight metabolic syndrome. Steroids 91, 46–53.

Masiakowski, P., Breathnach, R., Bloch, J., Gannon, F., Krust, A., and Chambon, P. (1982). Cloning of cDNA sequences of hormone-regulated genes from the MCF-7 human breast cancer cell line. Nucleic Acids Res. 10, 7895.

Masilamani, S., Kim, G.H., Mitchell, C., Wade, J.B., and Knepper, M.A. (1999). Aldosterone- mediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney. J. Clin. Invest. 104, R19-23.

Massie, C.E., and Mills, I.G. (2011). Global identification of androgen response elements. Methods Mol. Biol. Clifton NJ 776, 255–273.

Matulich, D.T., Spindler, B.J., Schambelan, M., and Baxter, J. (1976). Mineralocorticoid Receptors in Human Kidney. J. Clin. Endocrinol. Metab. 43, 1170–1174.

Maturana, A., Lenglet, S., Python, M., Kuroda, S. ’ichi, and Rossier, M.F. (2009). Role of the T- type calcium channel CaV3.2 in the chronotropic action of corticosteroids in isolated rat ventricular myocytes. Endocrinology 150, 3726–3734.

Mazur, E.C., Vasquez, Y.M., Li, X., Kommagani, R., Jiang, L., Chen, R., Lanz, R.B., Kovanci, E., Gibbons, W.E., and DeMayo, F.J. (2015). Progesterone receptor transcriptome and cistrome in decidualized human endometrial stromal cells. Endocrinology 156, 2239–2253.

McEneaney, V., Harvey, B.J., and Thomas, W. (2008). Aldosterone regulates rapid trafficking of epithelial sodium channel subunits in renal cortical collecting duct cells via protein kinase D activation. Mol. Endocrinol. Baltim. Md 22, 881–892.

McEneaney, V., Dooley, R., Yusef, Y.R., Keating, N., Quinn, U., Harvey, B.J., and Thomas, W. (2010a). Protein kinase D1 modulates aldosterone-induced ENaC activity in a renal cortical collecting duct cell line. Mol. Cell. Endocrinol. 325, 8–17.

McEneaney, V., Dooley, R., Harvey, B.J., and Thomas, W. (2010b). Protein kinase D stabilizes aldosterone-induced ERK1/2 MAP kinase activation in M1 renal cortical collecting duct cells to promote cell proliferation. J. Steroid Biochem. Mol. Biol. 118, 18–28.

McNeill, H., Whitworth, E., Vinson, G.P., and Hinson, J.P. (2005). Distribution of extracellular signal-regulated protein kinases 1 and 2 in the rat adrenal and their activation by angiotensin II. J. Endocrinol. 187, 149–157.

201

Meijer, O.C. (2011). Corticosteroid receptor signalling modes and stress adaptation in the brain. Horm. Mol. Biol. Clin. Investig. 7, 317–326.

Meijer, O.C., Williamson, A., Dallman, M.F., and Pearce, D. (2000). Transcriptional repression of the 5-HT1A receptor promoter by corticosterone via mineralocorticoid receptors depends on the cellular context. J. Neuroendocrinol. 12, 245–254.

Meijer, O.C., Kalkhoven, E., van der Laan, S., Steenbergen, P.J., Houtman, S.H., Dijkmans, T.F., Pearce, D., and de Kloet, E.R. (2005). Steroid receptor coactivator-1 splice variants differentially affect corticosteroid receptor signaling. Endocrinology 146, 1438–1448.

Meijsing, S.H., Pufall, M.A., So, A.Y., Bates, D.L., Chen, L., and Yamamoto, K.R. (2009). DNA Binding Site Sequence Directs Glucocorticoid Receptor Structure and Activity. Science 324, 407.

Melchior, F. (2000). SUMO--nonclassical ubiquitin. Annu. Rev. Cell Dev. Biol. 16, 591–626.

Ménard, J. (2004). The 45-year story of the development of an anti-aldosterone more specific than spironolactone. Mol. Cell. Endocrinol. 217, 45–52.

Meredith, P.A., and Elliott, H.L. (2004). Dihydropyridine calcium channel blockers: basic pharmacological similarities but fundamental therapeutic differences. J. Hypertens. 22, 1641– 1648.

Messaoudi, S., Gravez, B., Tarjus, A., Pelloux, V., Ouvrard-Pascaud, A., Delcayre, C., Samuel, J., Launay, J.-M., Sierra-Ramos, C., Alvarez de la Rosa, D., et al. (2013). Aldosterone-specific activation of cardiomyocyte mineralocorticoid receptor in vivo. Hypertens. Dallas Tex 1979 61, 361–367.

Mészáros, K., Pruess, L., Szabó, A.J., Gondan, M., Ritz, E., and Schaefer, F. (2014). Development of the circadian clockwork in the kidney. Kidney Int. 86, 915–922.

Métivier, R., Penot, G., Hübner, M.R., Reid, G., Brand, H., Kos, M., and Gannon, F. (2003). Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115, 751–763.

Mick, V.E., Itani, O.A., Loftus, R.W., Husted, R.F., Schmidt, T.J., and Thomas, C.P. (2001). The alpha-subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5’- flanking region of the gene. Mol. Endocrinol. Baltim. Md 15, 575–588.

Mifsud, K.R., and Reul, J.M.H.M. (2016). Acute stress enhances heterodimerization and binding of corticosteroid receptors at glucocorticoid target genes in the hippocampus. Proc. Natl. Acad. Sci. U. S. A. 113, 11336–11341.

Miranda, T.B., Morris, S.A., and Hager, G.L. (2013). Complex genomic interactions in the dynamic regulation of transcription by the glucocorticoid receptor. Mol. Cell. Endocrinol. 380, 16–24.

Mirshahi, M., Mirshahi, A., Sedighian, R., Hecquet, C., Faure, J.P., and Agarwal, M.K. (1997). Immunochemical demonstration of the mineralocorticoid receptor in ocular tissues. Neuroendocrinology 65, 70–78.

202

Montalescot, G., Pitt, B., Lopez de Sa, E., Hamm, C.W., Flather, M., Verheugt, F., Shi, H., Turgonyi, E., Orri, M., Vincent, J., et al. (2014). Early eplerenone treatment in patients with acute ST-elevation myocardial infarction without heart failure: the Randomized Double-Blind Reminder Study. Eur. Heart J. 35, 2295–2302.

Morris, D.J., Latif, S.A., and Brem, A.S. (2009). Interactions of mineralocorticoids and glucocorticoids in epithelial target tissues revisited. Steroids 74, 1–6.

Mottis, A., Mouchiroud, L., and Auwerx, J. (2013). Emerging roles of the corepressors NCoR1 and SMRT in homeostasis. Genes Dev. 27, 819.

Moura, A.M., and Worcel, M. (1984). Direct action of aldosterone on transmembrane 22Na efflux from arterial smooth muscle. Rapid and delayed effects. Hypertens. Dallas Tex 1979 6, 425–430.

Mundade, R., Ozer, H.G., Wei, H., Prabhu, L., and Lu, T. (2014). Role of ChIP-seq in the discovery of transcription factor binding sites, differential gene regulation mechanism, epigenetic marks and beyond. Cell Cycle Georget. Tex 13, 2847–2852.

Munier, M., Law, F., Meduri, G., Le Menuet, D., and Lombès, M. (2012). Mineralocorticoid receptor overexpression facilitates differentiation and promotes survival of embryonic stem cell-derived neurons. Endocrinology 153, 1330–1340.

Murai-Takeda, A., Shibata, H., Kurihara, I., Kobayashi, S., Yokota, K., Suda, N., Mitsuishi, Y., Jo, R., Kitagawa, H., Kato, S., et al. (2010). NF-YC functions as a corepressor of agonist-bound mineralocorticoid receptor. J. Biol. Chem. 285, 8084–8093.

Naccache, A., Louiset, E., Duparc, C., Laquerrière, A., Patrier, S., Renouf, S., Gomez-Sanchez, C.E., Mukai, K., Lefebvre, H., and Castanet, M. (2016). Temporal and spatial distribution of mast cells and steroidogenic enzymes in the human fetal adrenal. Mol. Cell. Endocrinol. 434, 69–80.

Nakamura, Y., Yamazaki, Y., Konosu-Fukaya, S., Ise, K., Satoh, F., and Sasano, H. (2015). Aldosterone biosynthesis in the human adrenal cortex and associated disorders. J. Steroid Biochem. Mol. Biol. 153, 57–62.

Náray-Fejes-Tóth, A., Canessa, C., Cleaveland, E.S., Aldrich, G., and Fejes-Tóth, G. (1999). sgk is an aldosterone-induced kinase in the renal collecting duct. Effects on epithelial na+ channels. J. Biol. Chem. 274, 16973–16978.

Náray-Fejes-Tóth, A., Snyder, P.M., and Fejes-Tóth, G. (2004). The kidney-specific WNK1 isoform is induced by aldosterone and stimulates epithelial sodium channel-mediated Na+ transport. Proc. Natl. Acad. Sci. U. S. A. 101, 17434–17439.

Narikiyo, T., Kitamura, K., Adachi, M., Miyoshi, T., Iwashita, K., Shiraishi, N., Nonoguchi, H., Chen, L.-M., Chai, K.X., Chao, J., et al. (2002). Regulation of prostasin by aldosterone in the kidney. J. Clin. Invest. 109, 401–408.

Nguyen Dinh Cat, A., Antunes, T.T., Callera, G.E., Sanchez, A., Tsiropoulou, S., Dulak-Lis, M.G., Anagnostopoulou, A., He, Y., Montezano, A.C., Jaisser, F., et al. (2016). Adipocyte-Specific Mineralocorticoid Receptor Overexpression in Mice Is Associated With Metabolic Syndrome and Vascular Dysfunction: Role of Redox-Sensitive PKG-1 and Rho Kinase. Diabetes 65, 2392–2403.

203

Nielsen, S., Maunsbach, A.B., Ecelbarger, C.A., and Knepper, M.A. (1998). Ultrastructural localization of Na-K-2Cl cotransporter in thick ascending limb and macula densa of rat kidney. Am. J. Physiol. 275, F885-893.

Nishi, M., and Kawata, M. (2007). Dynamics of glucocorticoid receptor and mineralocorticoid receptor: implications from live cell imaging studies. Neuroendocrinology 85, 186–192.

Nishi, M., Tanaka, M., Matsuda, K., Sunaguchi, M., and Kawata, M. (2004). Visualization of glucocorticoid receptor and mineralocorticoid receptor interactions in living cells with GFP-based fluorescence resonance energy transfer. J. Neurosci. Off. J. Soc. Neurosci. 24, 4918–4927.

Nishiyama, A., Yao, L., Fan, Y., Kyaw, M., Kataoka, N., Hashimoto, K., Nagai, Y., Nakamura, E., Yoshizumi, M., Shokoji, T., et al. (2005). Involvement of aldosterone and mineralocorticoid receptors in rat mesangial cell proliferation and deformability. Hypertens. Dallas Tex 1979 45, 710–716.

Nogueira, E.F., and Rainey, W.E. (2010). Regulation of aldosterone synthase by activator transcription factor/cAMP response element-binding protein family members. Endocrinology 151, 1060–1070.

Nuclear Receptors Nomenclature Committee (1999). A unified nomenclature system for the nuclear receptor superfamily. Cell 97, 161–163.

Oakley, R.H., and Cidlowski, J.A. (2013). The biology of the glucocorticoid receptor: new signaling mechanisms in health and disease. J. Allergy Clin. Immunol. 132, 1033–1044.

Oakley, R.H., Busillo, J.M., and Cidlowski, J.A. (2017). Cross-talk between the Glucocorticoid Receptor and MyoD Family Inhibitor Domain Containing Protein Provides a New Mechanism for Generating Tissue-Specific Responses to Glucocorticoids. J. Biol. Chem.

Obradović, D., Tirard, M., Némethy, Z., Hirsch, O., Gronemeyer, H., and Almeida, O.F.X. (2004). DAXX, FLASH, and FAF-1 modulate mineralocorticoid and glucocorticoid receptor-mediated transcription in hippocampal cells--toward a basis for the opposite actions elicited by two nuclear receptors? Mol. Pharmacol. 65, 761–769.

Odermatt, A., and Atanasov, A.G. (2009). Mineralocorticoid receptors: emerging complexity and functional diversity. Steroids 74, 163–171.

Oeckinghaus, A., Hayden, M.S., and Ghosh, S. (2011). Crosstalk in NF-κB signaling pathways. Nat. Immunol. 12, 695–708.

O’Hara, B., Alvarez de la Rosa, D., and Rajendran, V.M. (2014). Multiple mineralocorticoid response elements localized in different introns regulate intermediate conductance K+ (Kcnn4) channel expression in the rat distal colon. PloS One 9, e98695.

O’Malley, B.W., Malovannaya, A., and Qin, J. (2012). Minireview: nuclear receptor and coregulator proteomics--2012 and beyond. Mol. Endocrinol. Baltim. Md 26, 1646–1650.

Oñate, S.A., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W. (1995). Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354–1357.

204

Ou, X.M., Storring, J.M., Kushwaha, N., and Albert, P.R. (2001). Heterodimerization of mineralocorticoid and glucocorticoid receptors at a novel negative response element of the 5- HT1A receptor gene. J. Biol. Chem. 276, 14299–14307.

Ouvrard-Pascaud, A., Sainte-Marie, Y., Bénitah, J.-P., Perrier, R., Soukaseum, C., Nguyen Dinh Cat, A., Royer, A., Le Quang, K., Charpentier, F., Demolombe, S., et al. (2005). Conditional mineralocorticoid receptor expression in the heart leads to life-threatening arrhythmias. Circulation 111, 3025–3033.

Overdiek, H.W., Hermens, W.A., and Merkus, F.W. (1985). New insights into the pharmacokinetics of spironolactone. Clin. Pharmacol. Ther. 38, 469–474.

Palmer, L.G., and Frindt, G. (1986). Amiloride-sensitive Na channels from the apical membrane of the rat cortical collecting tubule. Proc. Natl. Acad. Sci. U. S. A. 83, 2767–2770.

Palmgren, M.G., and Nissen, P. (2011). P-type ATPases. Annu. Rev. Biophys. 40, 243–266.

Pan, D., Kocherginsky, M., and Conzen, S.D. (2011). Activation of the glucocorticoid receptor is associated with poor prognosis in estrogen receptor-negative breast cancer. Cancer Res. 71, 6360–6370.

Pascual-Le Tallec, L., and Lombès, M. (2005). The mineralocorticoid receptor: a journey exploring its diversity and specificity of action. Mol. Endocrinol. Baltim. Md 19, 2211–2221.

Pascual-Le Tallec, L., Kirsh, O., Lecomte, M.-C., Viengchareun, S., Zennaro, M.-C., Dejean, A., and Lombès, M. (2003). Protein inhibitor of activated signal transducer and activator of transcription 1 interacts with the N-terminal domain of mineralocorticoid receptor and represses its transcriptional activity: implication of small ubiquitin-related modifier 1 modification. Mol. Endocrinol. Baltim. Md 17, 2529–2542.

Pascual-Le Tallec, L., Simone, F., Viengchareun, S., Meduri, G., Thirman, M.J., and Lombès, M. (2005). The elongation factor ELL (eleven-nineteen lysine-rich leukemia) is a selective coregulator for steroid receptor functions. Mol. Endocrinol. Baltim. Md 19, 1158–1169.

Pearce, D. (2001). The role of SGK1 in hormone-regulated sodium transport. Trends Endocrinol. Metab. TEM 12, 341–347.

Pearce, D., and Kleyman, T.R. (2007). Salt, sodium channels, and SGK1. J. Clin. Invest. 117, 592–595.

Pedram, A., Razandi, M., Deschenes, R.J., and Levin, E.R. (2012). DHHC-7 and -21 are palmitoylacyltransferases for sex steroid receptors. Mol. Biol. Cell 23, 188–199.

Penfornis, P., Viengchareun, S., Le Menuet, D., Cluzeaud, F., Zennaro, M.C., and Lombès, M. (2000). The mineralocorticoid receptor mediates aldosterone-induced differentiation of T37i cells into brown adipocytes. Am. J. Physiol. Endocrinol. Metab. 279, E386-394.

Pennacchio, L.A., Bickmore, W., Dean, A., Nobrega, M.A., and Bejerano, G. (2013). Enhancers: five essential questions. Nat. Rev. Genet. 14, 288–295.

205

Petit-Topin, I., Fay, M., Resche-Rigon, M., Ulmann, A., Gainer, E., Rafestin-Oblin, M.-E., and Fagart, J. (2014). Molecular determinants of the recognition of ulipristal acetate by oxo-steroid receptors. J. Steroid Biochem. Mol. Biol. 144 Pt B, 427–435.

Phatnani, H.P., and Greenleaf, A.L. (2006). Phosphorylation and functions of the RNA polymerase II CTD. Genes Dev. 20, 2922–2936.

Pinon, G.M., Fagart, J., Souque, A., Auzou, G., Vandewalle, A., and Rafestin-Oblin, M.-E. (2004). Identification of steroid ligands able to inactivate the mineralocorticoid receptor harboring the S810L mutation responsible for a severe form of hypertension. Mol. Cell. Endocrinol. 217, 181– 188.

Pippal, J.B., Yao, Y., Rogerson, F.M., and Fuller, P.J. (2009). Structural and functional characterization of the interdomain interaction in the mineralocorticoid receptor. Mol. Endocrinol. Baltim. Md 23, 1360–1370.

Pitt, B., Zannad, F., Remme, W.J., Cody, R., Castaigne, A., Perez, A., Palensky, J., and Wittes, J. (1999). The effect of spironolactone on morbidity and mortality in patients with severe heart failure. Randomized Aldactone Evaluation Study Investigators. N. Engl. J. Med. 341, 709–717.

Pitt, B., Remme, W., Zannad, F., Neaton, J., Martinez, F., Roniker, B., Bittman, R., Hurley, S., Kleiman, J., Gatlin, M., et al. (2003). Eplerenone, a selective aldosterone blocker, in patients with left ventricular dysfunction after myocardial infarction. N. Engl. J. Med. 348, 1309–1321.

Pitt, B., Filippatos, G., Gheorghiade, M., Kober, L., Krum, H., Ponikowski, P., Nowack, C., Kolkhof, P., Kim, S.-Y., and Zannad, F. (2012). Rationale and design of ARTS: a randomized, double-blind study of BAY 94-8862 in patients with chronic heart failure and mild or moderate chronic kidney disease. Eur. J. Heart Fail. 14, 668–675.

Pitt, B., Kober, L., Ponikowski, P., Gheorghiade, M., Filippatos, G., Krum, H., Nowack, C., Kolkhof, P., Kim, S.-Y., and Zannad, F. (2013). Safety and tolerability of the novel non-steroidal mineralocorticoid receptor antagonist BAY 94-8862 in patients with chronic heart failure and mild or moderate chronic kidney disease: a randomized, double-blind trial. Eur. Heart J. 34, 2453– 2463.

Pitt, B., Anker, S.D., Böhm, M., Gheorghiade, M., Køber, L., Krum, H., Maggioni, A.P., Ponikowski, P., Voors, A.A., Zannad, F., et al. (2015). Rationale and design of MinerAlocorticoid Receptor antagonist Tolerability Study-Heart Failure (ARTS-HF): a randomized study of finerenone vs. eplerenone in patients who have worsening chronic heart failure with diabetes and/or chronic kidney disease. Eur. J. Heart Fail. 17, 224–232.

Pitt, B., Pedro Ferreira, J., and Zannad, F. (2017). Mineralocorticoid receptor antagonists in patients with heart failure: current experience and future perspectives. Eur. Heart J. Cardiovasc. Pharmacother. 3, 48–57.

Polman, J.A.E., Welten, J.E., Bosch, D.S., de Jonge, R.T., Balog, J., van der Maarel, S.M., de Kloet, E.R., and Datson, N.A. (2012). A genome-wide signature of glucocorticoid receptor binding in neuronal PC12 cells. BMC Neurosci. 13, 118.

Presman, D.M., Ogara, M.F., Stortz, M., Alvarez, L.D., Pooley, J.R., Schiltz, R.L., Grøntved, L., Johnson, T.A., Mittelstadt, P.R., Ashwell, J.D., et al. (2014). Live cell imaging unveils multiple

206

domain requirements for in vivo dimerization of the glucocorticoid receptor. PLoS Biol. 12, e1001813.

Presman, D.M., Ganguly, S., Schiltz, R.L., Karpova, T., and Hager, G.L. (2016). DNA-binding Triggers the Tetramerization of the Glucocorticoid Receptor in Live Cells. FASEB J. 30, 582.2- 582.2.

Pressley, L., and Funder, J.W. (1975). Glucocorticoid and mineralocorticoid receptors in gut mucosa. Endocrinology 97, 588–596.

Preston, I.R., Sagliani, K.D., Warburton, R.R., Hill, N.S., Fanburg, B.L., and Jaffe, I.Z. (2013). Mineralocorticoid receptor antagonism attenuates experimental pulmonary hypertension. Am. J. Physiol. Lung Cell. Mol. Physiol. 304, L678-688.

Prié, D., Friedlander, G., Coureau, C., Vandewalle, A., Cassingéna, R., and Ronco, P.M. (1995). Role of adenosine on glucagon-induced cAMP in a human cortical collecting duct cell line. Kidney Int. 47, 1310–1318.

Quinkler, M., Johanssen, S., Grossmann, C., Bähr, V., Müller, M., Oelkers, W., and Diederich, S. (1999). Progesterone metabolism in the human kidney and inhibition of 11beta-hydroxysteroid dehydrogenase type 2 by progesterone and its metabolites. J. Clin. Endocrinol. Metab. 84, 4165– 4171.

Quinkler, M., Meyer, B., Bumke-Vogt, C., Grossmann, C., Gruber, U., Oelkers, W., Diederich, S., and Bahr, V. (2002). Agonistic and antagonistic properties of progesterone metabolites at the human mineralocorticoid receptor. Eur. J. Endocrinol. 146, 789–799.

Quinkler, M., Meyer, B., Oelkers, W., and Diederich, S. (2003). Renal inactivation, mineralocorticoid generation, and 11beta-hydroxysteroid dehydrogenase inhibition ameliorate the antimineralocorticoid effect of progesterone in vivo. J. Clin. Endocrinol. Metab. 88, 3767–3772.

Quintin, J., Le Péron, C., Palierne, G., Bizot, M., Cunha, S., Sérandour, A.A., Avner, S., Henry, C., Percevault, F., Belaud-Rotureau, M.-A., et al. (2014). Dynamic estrogen receptor interactomes control estrogen-responsive trefoil Factor (TFF) locus cell-specific activities. Mol. Cell. Biol. 34, 2418–2436.

Rafestin-Oblin, M.E., Lombes, M., Michiel, J.B., Michaud, A., and Claire, M. (1984). Mineralocorticoid receptors in the epithelial cells of human colon and ileum. J. Steroid Biochem. 20, 311–315.

Rafestin-Oblin, M.E., Lombes, M., Lustenberger, P., Blanchardie, P., Michaud, A., Cornu, G., and Claire, M. (1986). Affinity of corticosteroids for mineralocorticoid and glucocorticoid receptors of the rabbit kidney: Effect of steroid substitution. J. Steroid Biochem. 25, 527–534.

Rafestin-Oblin, M.E., Couette, B., Radanyi, C., Lombes, M., and Baulieu, E.E. (1989). Mineralocorticosteroid receptor of the chick intestine. Oligomeric structure and transformation. J. Biol. Chem. 264, 9304–9309.

Rafestin-Oblin, M.E., Lombes, M., Couette, B., and Baulieu, E.E. (1992). Differences between aldosterone and its antagonists in binding kinetics and ligand-induced hsp90 release from mineralocorticosteroid receptor. J. Steroid Biochem. Mol. Biol. 41, 815–821.

207

Rafestin-Oblin, M.-E., Souque, A., Bocchi, B., Pinon, G., Fagart, J., and Vandewalle, A. (2003). The severe form of hypertension caused by the activating S810L mutation in the mineralocorticoid receptor is cortisone related. Endocrinology 144, 528–533.

Raikwar, N.S., and Thomas, C.P. (2017). Aldosterone regulates a 5’ variant sgk1 transcript via a shared hormone response element in the sgk1 5’ regulatory region. Physiol. Rep. 5.

Rashmi, P., Colussi, G., Ng, M., Wu, X., Kidwai, A., and Pearce, D. (2017). Glucocorticoid-induced leucine zipper protein regulates sodium and potassium balance in the distal nephron. Kidney Int. 91, 1159–1177.

Reddy, T.E., Pauli, F., Sprouse, R.O., Neff, N.F., Newberry, K.M., Garabedian, M.J., and Myers, R.M. (2009). Genomic determination of the glucocorticoid response reveals unexpected mechanisms of gene regulation. Genome Res. 19, 2163–2171.

Reichardt, H.M., Tuckermann, J.P., Göttlicher, M., Vujic, M., Weih, F., Angel, P., Herrlich, P., and Schütz, G. (2001). Repression of inflammatory responses in the absence of DNA binding by the glucocorticoid receptor. EMBO J. 20, 7168–7173.

Reid, G., Hübner, M.R., Métivier, R., Brand, H., Denger, S., Manu, D., Beaudouin, J., Ellenberg, J., and Gannon, F. (2003). Cyclic, proteasome-mediated turnover of unliganded and liganded ERalpha on responsive promoters is an integral feature of estrogen signaling. Mol. Cell 11, 695– 707.

Reid, G., Gallais, R., and Métivier, R. (2009). Marking time: the dynamic role of chromatin and covalent modification in transcription. Int. J. Biochem. Cell Biol. 41, 155–163.

Reinhard, L., Tidow, H., Clausen, M.J., and Nissen, P. (2013). Na(+),K (+)-ATPase as a docking station: protein-protein complexes of the Na(+),K (+)-ATPase. Cell. Mol. Life Sci. CMLS 70, 205– 222.

Renard, S., Voilley, N., Bassilana, F., Lazdunski, M., and Barbry, P. (1995). Localization and regulation by steroids of the alpha, beta and gamma subunits of the amiloride-sensitive Na+ channel in colon, lung and kidney. Pflugers Arch. 430, 299–307.

Renaud, J.P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H., and Moras, D. (1995). Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic acid. Nature 378, 681–689.

Richards, J., Jeffers, L.A., All, S.C., Cheng, K.-Y., and Gumz, M.L. (2013). Role of Per1 and the mineralocorticoid receptor in the coordinate regulation of αENaC in renal cortical collecting duct cells. Front. Physiol. 4, 253.

Richards, J., Ko, B., All, S., Cheng, K.-Y., Hoover, R.S., and Gumz, M.L. (2014). A role for the circadian clock protein Per1 in the regulation of the NaCl co-transporter (NCC) and the with-no- lysine kinase (WNK) cascade in mouse distal convoluted tubule cells. J. Biol. Chem. 289, 11791– 11806.

Rickard, A.J., Morgan, J., Tesch, G., Funder, J.W., Fuller, P.J., and Young, M.J. (2009). Deletion of mineralocorticoid receptors from macrophages protects against deoxycorticosterone/salt- induced cardiac fibrosis and increased blood pressure. Hypertens. Dallas Tex 1979 54, 537–543.

208

Robert-Nicoud, M., Flahaut, M., Elalouf, J.M., Nicod, M., Salinas, M., Bens, M., Doucet, A., Wincker, P., Artiguenave, F., Horisberger, J.D., et al. (2001). Transcriptome of a mouse kidney cortical collecting duct cell line: effects of aldosterone and vasopressin. Proc. Natl. Acad. Sci. U. S. A. 98, 2712–2716.

Robertson, S., Allie-Reid, F., Vanden Berghe, W., Visser, K., Binder, A., Africander, D., Vismer, M., De Bosscher, K., Hapgood, J., Haegeman, G., et al. (2010). Abrogation of glucocorticoid receptor dimerization correlates with dissociated glucocorticoid behavior of compound a. J. Biol. Chem. 285, 8061–8075.

Robinson, J.T., Thorvaldsdóttir, H., Winckler, W., Guttman, M., Lander, E.S., Getz, G., and Mesirov, J.P. (2011). Integrative genomics viewer. Nat. Biotechnol. 29, 24–26.

Rogerson, F.M., and Fuller, P.J. (2003). Interdomain interactions in the mineralocorticoid receptor. Mol. Cell. Endocrinol. 200, 45–55.

Rogerson, F.M., Dimopoulos, N., Sluka, P., Chu, S., Curtis, A.J., and Fuller, P.J. (1999). Structural determinants of aldosterone binding selectivity in the mineralocorticoid receptor. J. Biol. Chem. 274, 36305–36311.

Rogerson, F.M., Brennan, F.E., and Fuller, P.J. (2003). Dissecting mineralocorticoid receptor structure and function. J. Steroid Biochem. Mol. Biol. 85, 389–396.

Rogerson, F.M., Yao, Y.-Z., Elsass, R.E., Dimopoulos, N., Smith, B.J., and Fuller, P.J. (2007). A critical region in the mineralocorticoid receptor for aldosterone binding and activation by cortisol: evidence for a common mechanism governing ligand binding specificity in steroid hormone receptors. Mol. Endocrinol. Baltim. Md 21, 817–828.

Rogerson, F.M., Yao, Y.-Z., Young, M.J., and Fuller, P.J. (2014). Identification and characterization of a ligand-selective mineralocorticoid receptor coactivator. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 28, 4200–4210.

Rostgaard, J., and Møller, O. (1980). Localization of Na+, K+ -ATPase to the inside of the basolateral cell membranes of epithelial cells of proximal and distal tubules in rabbit kidney. Cell Tissue Res. 212, 17–28.

Rothbart, S.B., and Strahl, B.D. (2014). Interpreting the language of histone and DNA modifications. Biochim. Biophys. Acta 1839, 627–643.

Rotin, D. (2000). Regulation of the epithelial sodium channel (ENaC) by accessory proteins. Curr. Opin. Nephrol. Hypertens. 9, 529–534.

Rotin, D., and Staub, O. (2012). Nedd4-2 and the regulation of epithelial sodium transport. Front. Physiol. 3, 212.

Roy, A., Al-Qusairi, L., Donnelly, B.F., Ronzaud, C., Marciszyn, A.L., Gong, F., Chang, Y.P.C., Butterworth, M.B., Pastor-Soler, N.M., Hallows, K.R., et al. (2015). Alternatively spliced proline- rich cassettes link WNK1 to aldosterone action. J. Clin. Invest. 125, 3433–3448.

Rubel, C.A., Lanz, R.B., Kommagani, R., Franco, H.L., Lydon, J.P., and DeMayo, F.J. (2012). Research resource: Genome-wide profiling of progesterone receptor binding in the mouse uterus. Mol. Endocrinol. Baltim. Md 26, 1428–1442.

209

Rudd, M.D., and Luse, D.S. (1996). Amanitin Greatly Reduces the Rate of Transcription by RNA Polymerase II Ternary Complexes but Fails to Inhibit Some Transcript Cleavage Modes. J. Biol. Chem. 271, 21549–21558.

Ruhs, S., Nolze, A., Hübschmann, R., and Grossmann, C. (2017). 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Nongenomic effects via the mineralocorticoid receptor. J. Endocrinol. 234, T107–T124.

Ruilope, L.M., Agarwal, R., Chan, J.C., Cooper, M.E., Gansevoort, R.T., Haller, H., Remuzzi, G., Rossing, P., Schmieder, R.E., Nowack, C., et al. (2014). Rationale, design, and baseline characteristics of ARTS-DN: a randomized study to assess the safety and efficacy of finerenone in patients with type 2 diabetes mellitus and a clinical diagnosis of diabetic nephropathy. Am. J. Nephrol. 40, 572–581.

Sachs, L.M. (2015). Unliganded thyroid hormone receptor function: amphibian metamorphosis got TALENs. Endocrinology 156, 409–410.

Safdar, Z., Thakur, A., Singh, S., Ji, Y., Guffey, D., Minard, C.G., and Entman, M.L. (2015). Circulating Aldosterone Levels and Disease Severity in Pulmonary Arterial Hypertension. J. Pulm. Respir. Med. 5.

Sala, G., and Luetscher, J.A. (1954). The effect of sodium-retaining corticoid, electrocortin, desoxycorticosterone, and cortisone on renal function and excretion of sodium and water in adrenalectomized rats. Endocrinology 55, 516–518.

Sartorato, P., Khaldi, Y., Lapeyraque, A.-L., Armanini, D., Kuhnle, U., Salomon, R., Caprio, M., Viengchareun, S., Lombès, M., and Zennaro, M.-C. (2004a). Inactivating mutations of the mineralocorticoid receptor in Type I pseudohypoaldosteronism. Mol. Cell. Endocrinol. 217, 119– 125.

Sartorato, P., Cluzeaud, F., Fagart, J., Viengchareun, S., Lombès, M., and Zennaro, M.-C. (2004b). New naturally occurring missense mutations of the human mineralocorticoid receptor disclose important residues involved in dynamic interactions with deoxyribonucleic acid, intracellular trafficking, and ligand binding. Mol. Endocrinol. Baltim. Md 18, 2151–2165.

Sasano, H., Fukushima, K., Sasaki, I., Matsuno, S., Nagura, H., and Krozowski, Z.S. (1992). Immunolocalization of mineralocorticoid receptor in human kidney, pancreas, salivary, mammary and sweat glands: a light and electron microscopic immunohistochemical study. J. Endocrinol. 132, 305–NP.

Sato, N., Ajioka, M., Yamada, T., Kato, M., Myoishi, M., Yamada, T., Kim, S.-Y., Nowack, C., Kolkhof, P., Shiga, T., et al. (2016). A Randomized Controlled Study of Finerenone vs. Eplerenone in Japanese Patients With Worsening Chronic Heart Failure and Diabetes and/or Chronic Kidney Disease. Circ. J. Off. J. Jpn. Circ. Soc. 80, 1113–1122.

Sayegh, R., Auerbach, S.D., Li, X., Loftus, R.W., Husted, R.F., Stokes, J.B., and Thomas, C.P. (1999). Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the 5’-flanking region of the human epithelial sodium channel alpha subunit gene. J. Biol. Chem. 274, 12431–12437.

210

Schmidt, M.V., Oitzl, M., Steenbergen, P., Lachize, S., Wurst, W., Müller, M.B., de Kloet, E.R., and Meijer, O.C. (2007). Ontogeny of steroid receptor coactivators in the hippocampus and their role in regulating postnatal HPA axis function. Brain Res. 1174, 1–6.

Sekizawa, N., Yoshimoto, T., Hayakawa, E., Suzuki, N., Sugiyama, T., and Hirata, Y. (2011). Transcriptome analysis of aldosterone-regulated genes in human vascular endothelial cell lines stably expressing mineralocorticoid receptor. Mol. Cell. Endocrinol. 341, 78–88.

Shibata, S. (2017). 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Mineralocorticoid receptor and NaCl transport mechanisms in the renal distal nephron. J. Endocrinol. 234, T35–T47.

Shibata, H., Ogishima, T., Mitani, F., Suzuki, H., Murakami, M., Saruta, T., and Ishimura, Y. (1991). Regulation of aldosterone synthase cytochrome P-450 in rat adrenals by angiotensin II and potassium. Endocrinology 128, 2534–2539.

Shibata, S., Nagase, M., Yoshida, S., Kawachi, H., and Fujita, T. (2007). Podocyte as the target for aldosterone: roles of oxidative stress and Sgk1. Hypertens. Dallas Tex 1979 49, 355–364.

Shibata, S., Rinehart, J., Zhang, J., Moeckel, G., Castañeda-Bueno, M., Stiegler, A.L., Boggon, T.J., Gamba, G., and Lifton, R.P. (2013). Mineralocorticoid receptor phosphorylation regulates ligand binding and renal response to volume depletion and hyperkalemia. Cell Metab. 18, 660– 671.

Silvestre, J.S., Robert, V., Heymes, C., Aupetit-Faisant, B., Mouas, C., Moalic, J.M., Swynghedauw, B., and Delcayre, C. (1998). Myocardial production of aldosterone and corticosterone in the rat. Physiological regulation. J. Biol. Chem. 273, 4883–4891.

Simpson, S.A., Tait, J.F., Wettstein, A., Neher, R., Von Euw, J., and Reichstein, T. (1953). [Isolation from the adrenals of a new crystalline hormone with especially high effectiveness on mineral metabolism]. Experientia 9, 333–335.

Smets, P., Meyer, E., Maddens, B., and Daminet, S. (2010). Cushing’s syndrome, glucocorticoids and the kidney. Gen. Comp. Endocrinol. 169, 1–10.

Sõber, S., Laan, M., and Annilo, T. (2010). MicroRNAs miR-124 and miR-135a are potential regulators of the mineralocorticoid receptor gene (NR3C2) expression. Biochem. Biophys. Res. Commun. 391, 727–732.

Soundararajan, R., Zhang, T.T., Wang, J., Vandewalle, A., and Pearce, D. (2005). A Novel Role for Glucocorticoid-induced Leucine Zipper Protein in Epithelial Sodium Channel-mediated Sodium Transport. J. Biol. Chem. 280, 39970–39981.

Spät, A., and Hunyady, L. (2004). Control of aldosterone secretion: a model for convergence in cellular signaling pathways. Physiol. Rev. 84, 489–539.

Spät, A., Rohács, T., Horváth, A., Szabadkai, G., and Enyedi, P. (1996). The role of voltage- dependent calcium channels in angiotensin-stimulated glomerulosa cells. Endocr. Res. 22, 569– 576.

Speir, M.L., Zweig, A.S., Rosenbloom, K.R., Raney, B.J., Paten, B., Nejad, P., Lee, B.T., Learned, K., Karolchik, D., Hinrichs, A.S., et al. (2016). The UCSC Genome Browser database: 2016 update. Nucleic Acids Res. 44, D717-725.

211

Spencer, T.E., Jenster, G., Burcin, M.M., Allis, C.D., Zhou, J., Mizzen, C.A., McKenna, N.J., Onate, S.A., Tsai, S.Y., Tsai, M.J., et al. (1997). Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389, 194–198.

Starick, S.R., Ibn-Salem, J., Jurk, M., Hernandez, C., Love, M.I., Chung, H.-R., Vingron, M., Thomas-Chollier, M., and Meijsing, S.H. (2015). ChIP-exo signal associated with DNA-binding motifs provides insight into the genomic binding of the glucocorticoid receptor and cooperating transcription factors. Genome Res. 25, 825–835.

Stow, L.R., Gumz, M.L., Lynch, I.J., Greenlee, M.M., Rudin, A., Cain, B.D., and Wingo, C.S. (2009). Aldosterone Modulates Steroid Receptor Binding to the Endothelin-1 Gene (edn1). J. Biol. Chem. 284, 30087–30096.

Stowasser, M., and Gordon, R.D. (2013). The renaissance of primary aldosteronism: what has it taught us? Heart Lung Circ. 22, 412–420.

Summa, V., Mordasini, D., Roger, F., Bens, M., Martin, P.Y., Vandewalle, A., Verrey, F., and Féraille, E. (2001). Short term effect of aldosterone on Na,K-ATPase cell surface expression in kidney collecting duct cells. J. Biol. Chem. 276, 47087–47093.

Sun, Z., Bello-Roufai, M., and Wang, X. (2008). RNAi inhibition of mineralocorticoid receptors prevents the development of cold-induced hypertension. Am. J. Physiol. Heart Circ. Physiol. 294, H1880-1887.

Suzuki, S., Suzuki, T., Tsubochi, H., Koike, K., Tateno, H., Krozowski, Z.S., and Sasano, H. (2000). Expression of 11 beta-hydroxysteroid dehydrogenase type 2 and mineralocorticoid receptor in primary lung carcinomas. Anticancer Res. 20, 323–328.

Takahashi, J.S. (2017). Transcriptional architecture of the mammalian circadian clock. Nat. Rev. Genet. 18, 164–179.

Takahashi, H., and Sakamoto, T. (2013). The role of “mineralocorticoids” in teleost fish: relative importance of glucocorticoid signaling in the osmoregulation and “central” actions of mineralocorticoid receptor. Gen. Comp. Endocrinol. 181, 223–228.

Teixeira, M., Viengchareun, S., Butlen, D., Ferreira, C., Cluzeaud, F., Blot-Chabaud, M., Lombès, M., and Ferrary, E. (2006). Functional IsK/KvLQT1 potassium channel in a new corticosteroid- sensitive cell line derived from the inner ear. J. Biol. Chem. 281, 10496–10507.

Terker, A.S., and Ellison, D.H. (2015). Renal mineralocorticoid receptor and electrolyte homeostasis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 309, R1068-1070.

Terker, A.S., Yarbrough, B., Ferdaus, M.Z., Lazelle, R.A., Erspamer, K.J., Meermeier, N.P., Park, H.J., McCormick, J.A., Yang, C.-L., and Ellison, D.H. (2016). Direct and Indirect Mineralocorticoid Effects Determine Distal Salt Transport. J. Am. Soc. Nephrol. JASN 27, 2436–2445.

Thanigaimani, S., Lau, D.H., Agbaedeng, T., Elliott, A.D., Mahajan, R., and Sanders, P. (2017). Molecular mechanisms of atrial fibrosis: implications for the clinic. Expert Rev. Cardiovasc. Ther. 15, 247–256.

212

Thomas, A.L., Coarfa, C., Qian, J., Wilkerson, J.J., Rajapakshe, K., Krett, N.L., Gunaratne, P.H., and Rosen, S.T. (2015). Identification of potential glucocorticoid receptor therapeutic targets in multiple myeloma. Nucl. Recept. Signal. 13, e006.

Thomas, W., McEneaney, V., and Harvey, B.J. (2008). Aldosterone-induced signalling and cation transport in the distal nephron. Steroids 73, 979–984.

Thomas-Chollier, M., Watson, L.C., Cooper, S.B., Pufall, M.A., Liu, J.S., Borzym, K., Vingron, M., Yamamoto, K.R., and Meijsing, S.H. (2013). A naturally occuring insertion of a single amino acid rewires transcriptional regulation by glucocorticoid receptor isoforms. Proc. Natl. Acad. Sci. 110, 17826–17831.

Thorvaldsdóttir, H., Robinson, J.T., and Mesirov, J.P. (2013). Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief. Bioinform. 14, 178–192.

Tirard, M., Jasbinsek, J., Almeida, O.F.X., and Michaelidis, T.M. (2004). The manifold actions of the protein inhibitor of activated STAT proteins on the transcriptional activity of mineralocorticoid and glucocorticoid receptors in neural cells. J. Mol. Endocrinol. 32, 825–841.

Tirard, M., Almeida, O.F.X., Hutzler, P., Melchior, F., and Michaelidis, T.M. (2007). Sumoylation and proteasomal activity determine the transactivation properties of the mineralocorticoid receptor. Mol. Cell. Endocrinol. 268, 20–29.

Trapp, T., and Holsboer, F. (1995). Ligand-induced conformational changes in the mineralocorticoid receptor analyzed by protease mapping. Biochem. Biophys. Res. Commun. 215, 286–291.

Trapp, T., Rupprecht, R., Castrén, M., Reul, J.M., and Holsboer, F. (1994). Heterodimerization between mineralocorticoid and glucocorticoid receptor: a new principle of glucocorticoid action in the CNS. Neuron 13, 1457–1462.

Travers, S., Martinerie, L., Bouvattier, C., Boileau, P., Lombès, M., and Pussard, E. (2017). Multiplexed steroid profiling of gluco- and mineralocorticoids pathways using a liquid chromatography tandem mass spectrometry method. J. Steroid Biochem. Mol. Biol. 165, Part B, 202–211.

Turner, J.D., Schote, A.B., Macedo, J.A., Pelascini, L.P.L., and Muller, C.P. (2006). Tissue specific glucocorticoid receptor expression, a role for alternative first exon usage? Biochem. Pharmacol. 72, 1529–1537.

Ueda, K., Fujiki, K., Shirahige, K., Gomez-Sanchez, C.E., Fujita, T., Nangaku, M., and Nagase, M. (2014). Genome-wide analysis of murine renal distal convoluted tubular cells for the target genes of mineralocorticoid receptor. Biochem. Biophys. Res. Commun. 445, 132–137.

Urbanet, R., Nguyen Dinh Cat, A., Feraco, A., Venteclef, N., El Mogrhabi, S., Sierra-Ramos, C., Alvarez de la Rosa, D., Adler, G.K., Quilliot, D., Rossignol, P., et al. (2015). Adipocyte Mineralocorticoid Receptor Activation Leads to Metabolic Syndrome and Induction of Prostaglandin D2 Synthase. Hypertens. Dallas Tex 1979 66, 149–157.

Vallet, V., Chraibi, A., Gaeggeler, H.P., Horisberger, J.D., and Rossier, B.C. (1997). An epithelial serine protease activates the amiloride-sensitive sodium channel. Nature 389, 607–610.

213

Vallon, V., Wyatt, A.W., Klingel, K., Huang, D.Y., Hussain, A., Berchtold, S., Friedrich, B., Grahammer, F., Belaiba, R.S., Görlach, A., et al. (2006). SGK1-dependent cardiac CTGF formation and fibrosis following DOCA treatment. J. Mol. Med. Berl. Ger. 84, 396–404.

Van Eekelen, J.A., Jiang, W., De Kloet, E.R., and Bohn, M.C. (1988). Distribution of the mineralocorticoid and the glucocorticoid receptor mRNAs in the rat hippocampus. J. Neurosci. Res. 21, 88–94.

Van Eekelen, J.A., Bohn, M.C., and de Kloet, E.R. (1991). Postnatal ontogeny of mineralocorticoid and glucocorticoid receptor gene expression in regions of the rat tel- and diencephalon. Brain Res. Dev. Brain Res. 61, 33–43.

Vandevyver, S., Dejager, L., and Libert, C. (2012). On the trail of the glucocorticoid receptor: into the nucleus and back. Traffic Cph. Den. 13, 364–374.

Viengchareun, S., Penfornis, P., Zennaro, M.C., and Lombès, M. (2001). Mineralocorticoid and glucocorticoid receptors inhibit UCP expression and function in brown adipocytes. Am. J. Physiol. Endocrinol. Metab. 280, E640-649.

Viengchareun, S., Le Menuet, D., Martinerie, L., Munier, M., Pascual-Le Tallec, L., and Lombès, M. (2007). The mineralocorticoid receptor: insights into its molecular and (patho)physiological biology. Nucl. Recept. Signal. 5, e012.

Viengchareun, S., Kamenicky, P., Teixeira, M., Butlen, D., Meduri, G., Blanchard-Gutton, N., Kurschat, C., Lanel, A., Martinerie, L., Sztal-Mazer, S., et al. (2009). Osmotic stress regulates mineralocorticoid receptor expression in a novel aldosterone-sensitive cortical collecting duct cell line. Mol. Endocrinol. Baltim. Md 23, 1948–1962.

Viengchareun, S., Lema, I., Lamribet, K., Keo, V., Blanchard, A., Cherradi, N., and Lombès, M. (2014). Hypertonicity compromises renal mineralocorticoid receptor signaling through Tis11b- mediated post-transcriptional control. J. Am. Soc. Nephrol. JASN 25, 2213–2221.

Vockley, C.M., D’Ippolito, A.M., McDowell, I.C., Majoros, W.H., Safi, A., Song, L., Crawford, G.E., and Reddy, T.E. (2016). Direct GR Binding Sites Potentiate Clusters of TF Binding across the Human Genome. Cell 166, 1269–1281.e19.

Wachter, R., Schmidt-Schweda, S., Westermann, D., Post, H., Edelmann, F., Kasner, M., Lüers, C., Steendijk, P., Hasenfuss, G., Tschöpe, C., et al. (2009). Blunted frequency-dependent upregulation of cardiac output is related to impaired relaxation in diastolic heart failure. Eur. Heart J. 30, 3027–3036.

Wald, H., Goldstein, O., Asher, C., Yagil, Y., and Garty, H. (1996). Aldosterone induction and epithelial distribution of CHIF. Am. J. Physiol. 271, F322-329.

Wald, H., Popovtzer, M.M., and Garty, H. (1997). Differential regulation of CHIF mRNA by potassium intake and aldosterone. Am. J. Physiol. 272, F617-623.

Wallace, A.D., and Cidlowski, J.A. (2001). Proteasome-mediated glucocorticoid receptor degradation restricts transcriptional signaling by glucocorticoids. J. Biol. Chem. 276, 42714– 42721.

214

Walther, R.F., Atlas, E., Carrigan, A., Rouleau, Y., Edgecombe, A., Visentin, L., Lamprecht, C., Addicks, G.C., Haché, R.J.G., and Lefebvre, Y.A. (2005). A serine/threonine-rich motif is one of three nuclear localization signals that determine unidirectional transport of the mineralocorticoid receptor to the nucleus. J. Biol. Chem. 280, 17549–17561.

Wang, E.B., Chaudhary, A., Waterhouse, T.H., and Dickinson, G.L. (2017). Population Pharmacokinetics of LY2623091 in Patients With Hypertension and Chronic Kidney Disease. J. Clin. Pharmacol. 57, 739–746.

Wang, J., Zhuang, J., Iyer, S., Lin, X., Whitfield, T.W., Greven, M.C., Pierce, B.G., Dong, X., Kundaje, A., Cheng, Y., et al. (2012). Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, 1798–1812.

Wang, J., Zhuang, J., Iyer, S., Lin, X.-Y., Greven, M.C., Kim, B.-H., Moore, J., Pierce, B.G., Dong, X., Virgil, D., et al. (2013). Factorbook.org: a Wiki-based database for transcription factor-binding data generated by the ENCODE consortium. Nucleic Acids Res. 41, D171–D176.

Wang, Q., Anzick, S., Richter, W.F., Meltzer, P., and Simons, S.S. (2004). Modulation of transcriptional sensitivity of mineralocorticoid and estrogen receptors. J. Steroid Biochem. Mol. Biol. 91, 197–210.

Wang, X., Skelley, L., Cade, R., and Sun, Z. (2006). AAV delivery of mineralocorticoid receptor shRNA prevents progression of cold-induced hypertension and attenuates renal damage. Gene Ther. 13, 1097–1103.

Watson, L.C., Kuchenbecker, K.M., Schiller, B.J., Gross, J.D., Pufall, M.A., and Yamamoto, K.R. (2013). The glucocorticoid receptor dimer interface allosterically transmits sequence-specific DNA signals. Nat. Struct. Mol. Biol. 20, 876–883.

Watson, P.J., Fairall, L., and Schwabe, J.W.R. (2012). Nuclear hormone receptor co-repressors: structure and function. Mol. Cell. Endocrinol. 348, 440–449.

Weaver, I.C.G., Korgan, A.C., Lee, K., Wheeler, R.V., Hundert, A.S., and Goguen, D. (2017). Stress and the Emerging Roles of Chromatin Remodeling in Signal Integration and Stable Transmission of Reversible Phenotypes. Front. Behav. Neurosci. 11, 41.

Webster, M.K., Goya, L., Ge, Y., Maiyar, A.C., and Firestone, G.L. (1993). Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol. Cell. Biol. 13, 2031–2040. van Weert, L.T.C.M., Buurstede, J.C., Mahfouz, A., Braakhuis, P.S.M., Polman, J.A.E., Sips, H.C.M., Roozendaal, B., Balog, J., de Kloet, E.R., Datson, N.A., et al. (2017). NeuroD factors discriminate mineralocorticoid from glucocorticoid receptor DNA binding in the male rat brain. Endocrinology.

Wehling, M., Käsmayr, J., and Theisen, K. (1991). Rapid effects of mineralocorticoids on sodium- proton exchanger: genomic or nongenomic pathway? Am. J. Physiol. 260, E719-726.

Weikum, E.R., Knuesel, M.T., Ortlund, E.A., and Yamamoto, K.R. (2017). Glucocorticoid receptor control of transcription: precision and plasticity via allostery. Nat. Rev. Mol. Cell Biol. 18, 159–174.

215

Welboren, W.-J., van Driel, M.A., Janssen-Megens, E.M., van Heeringen, S.J., Sweep, F.C., Span, P.N., and Stunnenberg, H.G. (2009). ChIP-Seq of ERalpha and RNA polymerase II defines genes differentially responding to ligands. EMBO J. 28, 1418–1428.

Whalen, S., Truty, R.M., and Pollard, K.S. (2016). Enhancer-promoter interactions are encoded by complex genomic signatures on looping chromatin. Nat. Genet. 48, 488–496.

Williams, R.G., Kandasamy, R., Nickischer, D., Trask, O.J., Laethem, C., Johnston, P.A., and Johnston, P.A. (2006). Generation and characterization of a stable MK2-EGFP cell line and subsequent development of a high-content imaging assay on the Cellomics ArrayScan platform to screen for p38 mitogen-activated protein kinase inhibitors. Methods Enzymol. 414, 364–389.

Wilson, F.H., Disse-Nicodème, S., Choate, K.A., Ishikawa, K., Nelson-Williams, C., Desitter, I., Gunel, M., Milford, D.V., Lipkin, G.W., Achard, J.M., et al. (2001). Human hypertension caused by mutations in WNK kinases. Science 293, 1107–1112.

Wong, L., Hsu, T.H.S., Perlroth, M.G., Hofmann, L.V., Haynes, C.M., and Katznelson, L. (2008). Reninoma: case report and literature review. J. Hypertens. 26, 368–373.

Wu, P., Liang, X., Dai, Y., Liu, H., Zang, Y., Guo, Z., Zhang, R., Lai, W., Zhang, Y., and Liu, Y. (1999). Aldosterone biosynthesis in extraadrenal tissues. Chin. Med. J. (Engl.) 112, 414–418.

Wurtz, J.M., Bourguet, W., Renaud, J.P., Vivat, V., Chambon, P., Moras, D., and Gronemeyer, H. (1996). A canonical structure for the ligand-binding domain of nuclear receptors. Nat. Struct. Biol. 3, 87–94.

Wyrwoll, C.S., Mark, P.J., and Waddell, B.J. (2007). Developmental programming of renal glucocorticoid sensitivity and the renin-angiotensin system. Hypertens. Dallas Tex 1979 50, 579– 584.

Xu, J., Liao, L., Ning, G., Yoshida-Komiya, H., Deng, C., and O’Malley, B.W. (2000). The steroid receptor coactivator SRC-3 (p/CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty, female reproductive function, and mammary gland development. Proc. Natl. Acad. Sci. U. S. A. 97, 6379–6384.

Yamada, M., Takei, M., Suzuki, E., Takakusa, H., Kotsuma, M., Washio, T., Murayama, N., Inoue, S.-I., and Izumi, T. (2016). Pharmacokinetics, distribution, and disposition of esaxerenone, a novel, highly potent and selective non-steroidal mineralocorticoid receptor antagonist, in rats and monkeys. Xenobiotica Fate Foreign Compd. Biol. Syst. 1–14.

Yang, J., and Fuller, P.J. (2012). Interactions of the mineralocorticoid receptor--within and without. Mol. Cell. Endocrinol. 350, 196–205.

Yang, J., and Young, M.J. (2009). The mineralocorticoid receptor and its coregulators. J. Mol. Endocrinol. 43, 53–64.

Yang, J., and Young, M.J. (2016). Mineralocorticoid receptor antagonists-pharmacodynamics and pharmacokinetic differences. Curr. Opin. Pharmacol. 27, 78–85.

Yang, X.-J., and Chiang, C.-M. (2013). Sumoylation in gene regulation, human disease, and therapeutic action. F1000prime Rep. 5, 45.

216

Yang, J., Chang, C., Safi, R., Morgan, J., McDonnell, D.P., Fuller, P.J., Clyne, C.D., and Young, M.J. (2011). Identification of ligand-selective peptide antagonists of the mineralocorticoid receptor using phage display. Mol. Endocrinol. Baltim. Md 25, 32–43.

Yang, J., Fuller, P.J., Morgan, J., Shibata, H., McDonnell, D.P., Clyne, C.D., and Young, M.J. (2014). Use of phage display to identify novel mineralocorticoid receptor-interacting proteins. Mol. Endocrinol. Baltim. Md 28, 1571–1584.

Yang, J., Fuller, P.J., Morgan, J., Shibata, H., Clyne, C.D., and Young, M.J. (2015). GEMIN4 functions as a coregulator of the mineralocorticoid receptor. J. Mol. Endocrinol. 54, 149–160.

Yokota, K., Shibata, H., Kobayashi, S., Suda, N., Murai, A., Kurihara, I., Saito, I., and Saruta, T. (2004). Proteasome-mediated mineralocorticoid receptor degradation attenuates transcriptional response to aldosterone. Endocr. Res. 30, 611–616.

Yokota, K., Shibata, H., Kurihara, I., Kobayashi, S., Suda, N., Murai-Takeda, A., Saito, I., Kitagawa, H., Kato, S., Saruta, T., et al. (2007). Coactivation of the N-terminal transactivation of mineralocorticoid receptor by Ubc9. J. Biol. Chem. 282, 1998–2010.

York, B., and O’Malley, B.W. (2010). Steroid receptor coactivator (SRC) family: masters of systems biology. J. Biol. Chem. 285, 38743–38750.

Zannad, F., Alla, F., Dousset, B., Perez, A., and Pitt, B. (2000). Limitation of excessive extracellular matrix turnover may contribute to survival benefit of spironolactone therapy in patients with congestive heart failure: insights from the randomized aldactone evaluation study (RALES). Rales Investigators. Circulation 102, 2700–2706.

Zannad, F., McMurray, J.J.V., Drexler, H., Krum, H., van Veldhuisen, D.J., Swedberg, K., Shi, H., Vincent, J., and Pitt, B. (2010). Rationale and design of the Eplerenone in Mild Patients Hospitalization And SurvIval Study in Heart Failure (EMPHASIS-HF). Eur. J. Heart Fail. 12, 617– 622.

Zennaro, M.C. (1998). Syndromes of glucocorticoid and mineralocorticoid resistance. Eur. J. Endocrinol. 139, 127–138.

Zennaro, M.-C., and Fernandes-Rosa, F.L. (2017). Mineralocorticoid receptor mutations. J. Endocrinol.

Zennaro, M.-C., Keightley, M.-C., Kotelevtsev, Y., Conway, G.S., Soubrier, F., and Fuller, P.J. (1995). Human Mineralocorticoid Receptor Genomic Structure and Identification of Expressed Isoforms. J. Biol. Chem. 270, 21016–21020.

Zennaro, M.C., Le Menuet, D., and Lombès, M. (1996). Characterization of the human mineralocorticoid receptor gene 5’-regulatory region: evidence for differential hormonal regulation of two alternative promoters via nonclassical mechanisms. Mol. Endocrinol. Baltim. Md 10, 1549– 1560.

Zennaro, M.C., Le Menuet, D., Viengchareun, S., Walker, F., Ricquier, D., and Lombès, M. (1998). Hibernoma development in transgenic mice identifies brown adipose tissue as a novel target of aldosterone action. J. Clin. Invest. 101, 1254–1260.

217

Zennaro, M.C., Souque, A., Viengchareun, S., Poisson, E., and Lombès, M. (2001). A new human MR splice variant is a ligand-independent transactivator modulating corticosteroid action. Mol. Endocrinol. Baltim. Md 15, 1586–1598.

Zhang, S., Jonklaas, J., and Danielsen, M. (2007a). The glucocorticoid agonist activities of mifepristone (RU486) and progesterone are dependent on glucocorticoid receptor levels but not on EC50 values. Steroids 72, 600–608.

Zhang, W., Xia, X., Reisenauer, M.R., Rieg, T., Lang, F., Kuhl, D., Vallon, V., and Kone, B.C. (2007b). Aldosterone-induced Sgk1 relieves Dot1a-Af9–mediated transcriptional repression of epithelial Na+ channel α. J. Clin. Invest. 117, 773–783.

Zhang, X., Zhou, Q., Chen, L., Berger, S., Wu, H., Xiao, Z., Pearce, D., Zhou, X., and Zhang, W. (2013). Mineralocorticoid receptor antagonizes Dot1a-Af9 complex to increase αENaC transcription. Am. J. Physiol. - Ren. Physiol. 305, F1436–F1444.

Zhu, Z., Shi, M., Hu, W., Estrella, H., Engebretsen, J., Nichols, T., Briere, D., Hosea, N., Los, G., Rejto, P.A., et al. (2012). Dose-dependent effects of small-molecule antagonists on the genomic landscape of androgen receptor binding. BMC Genomics 13, 355.

Ziera, T., Irlbacher, H., Fromm, A., Latouche, C., Krug, S.M., Fromm, M., Jaisser, F., and Borden, S.A. (2009). Cnksr3 is a direct mineralocorticoid receptor target gene and plays a key role in the regulation of the epithelial sodium channel. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 23, 3936–3946.

(2014). Retraction for Kitagawa et al., Ligand-selective potentiation of rat mineralocorticoid receptor activation function 1 by a CBP-containing histone acetyltransferase complex. Mol. Cell. Biol. 34, 916.

218

ANNEXES

Article 4

Ulipristal Acetate Inhibits Progesterone Receptor Isoform A-Mediated Human Breast Cancer Proliferation and BCl2-L1 Expression

Nathalie Esber, Florian Le Billan, Michèle Resche-Rigon, Hugues Loosfelt, Marc Lombès, Nathalie Chabbert-Buffet

PLoS One. 2015 Oct 16;10(10):e0140795

RESEARCH ARTICLE Ulipristal Acetate Inhibits Progesterone Receptor Isoform A-Mediated Human Breast

Cancer Proliferation and BCl2-L1 Expression

Nathalie Esber1,2,3, Florian Le Billan1,2, Michèle Resche-Rigon3, Hugues Loosfelt1,2, Marc Lombès1,2,4, Nathalie Chabbert-Buffet5,6*

1 Institut National de la Santé et de la Recherche Médicale, Unité Mixte de Recherche-Scientifique 1185, Faculté de Médecine Paris Sud, Le Kremlin-Bicêtre, France, 2 Université Paris-Sud, Faculté de Médecine Paris Sud, Unité Mixte de Recherche-Scientifique 1185, Le Kremlin-Bicêtre, France, 3 HRA-Pharma, Paris, France, 4 Service d’Endocrinologie et des Maladies de la Reproduction, assistance Publique-Hôpitaux de Paris, Hôpital Bicêtre, Le Kremlin Bicêtre, France, 5 Service de Gynécologie Obstétrique Médecine de la Reproduction, Hôpitaux Universitaires Est Parisien site Tenon, AP-HP, Paris, France, 6 Institut National de la Santé et de la Recherche Médicale, Unité Mixte de Recherche-Scientifique 938, Centre de Recherche Saint Antoine, Université Pierre et Marie Curie, Paris, France

* [email protected]

OPEN ACCESS Citation: Esber N, Le Billan F, Resche-Rigon M, Abstract Loosfelt H, Lombès M, Chabbert-Buffet N (2015) Ulipristal Acetate Inhibits Progesterone Receptor The progesterone receptor (PR) with its isoforms and ligands are involved in breast tumori- Isoform A-Mediated Human Breast Cancer genesis and prognosis. We aimed at analyzing the respective contribution of PR isoforms, Proliferation and BCl2-L1 Expression. PLoS ONE 10 (10): e0140795. doi:10.1371/journal.pone.0140795 PRA and PRB, in breast cancer cell proliferation in a new estrogen-independent cell based- model, allowing independent PR isoforms analysis. We used the bi-inducible human breast Editor: Wei Xu, University of Wisconsin—Madison, UNITED STATES cancer cell system MDA-iPRAB. We studied the effects and molecular mechanisms of action of progesterone (P4) and ulipristal acetate (UPA), a new selective progesterone Received: August 20, 2015 receptor modulator, alone or in combination. P4 significantly stimulated MDA-iPRA Accepted: September 30, 2015 expressing cells proliferation. This was associated with P4-stimulated expression of the Published: October 16, 2015 anti-apoptotic factor BCL2-L1 and enhanced recruitment of PRA, SRC-1 and RNA Pol II Copyright: © 2015 Esber et al. This is an open onto the +58 kb PR binding motif of the BCL2-L1 gene. UPA decreased cell proliferation and access article distributed under the terms of the repressed BCL2-L1 expression in the presence of PRA, correlating with PRA and SRC1 but Creative Commons Attribution License, which permits not RNA Pol II recruitment. These results bring new information on the mechanism of action unrestricted use, distribution, and reproduction in any medium, provided the original author and source are of PR ligands in controlling breast cancer cell proliferation through PRA in an estrogen inde- credited. pendent model. Evaluation of PR isoforms ratio, as well as molecular signature studies Data Availability Statement: All relevant data are based on PRA target genes could be proposed to facilitate personalized breast cancer ther- within the paper and its Supporting Information files. apy. In this context, UPA could be of interest in endocrine therapy. Further confirmation in Funding: The funder HRA Pharma provided support the clinical setting is required. in the form of salary for one author [MRR], joint grant together with the national agency for Research (ANRT/HRA pharma CIFRE i.e. Conventions Industrielles de Formation par la Recherche, in English Research Training Industrial Grant Contract) Introduction [NE] but did not have any additional role in the study design, data collection and analysis, or preparation of Breast cancer, the most frequent cancer in women, is a hormone-dependent disease, with over the manuscript. Data from the paper have been 70% of sporadic breast tumors expressing estrogen and/or progesterone receptors (PR) [1]. discussed twice a year with MRR, as required in the Systemic anti-hormonal treatments used in clinical practice target the estrogen signaling

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 1/19 PRA and Breast Cancer joint ANRT /HRAPharma CIFRE. The final MS has pathway [2]. However, in the last decades, significant progress has been made in the under- been approved by all coauthors before submission. standing of the role of PR and its ligands in breast carcinogenesis [3–5]. The specific roles of these authors are articulated in Progesterone and progestins actions are mediated through their specific nuclear PR, with its the ‘author contributions’ section two main isoforms PRA and PRB, in a tissue-specific, isoform-selective and ligand-dependent Competing Interests: MRR is an employee of HRA manner [3, 6]. Transcriptional activities of PRA and PRB isoforms are not similar, and both Pharma. This does not alter the authors' adherence PR isoforms differentially regulate expression of a subset of target genes [7]. PRB functions as a to PLOS ONE policies on sharing data and materials. strong transactivator and its transcriptional activity is down-regulated by the trans-dominant Abbreviations: P4, progesterone; PR, progesterone repressor PRA [8–9]. Progestin-induced cell spreading in ER-positive T47D cells expressing receptor; UPA, ulipristal acetate. PR-A and PR-B isoforms was observed in cells overexpressing PRA by affecting cytoskeleton pathways and cell morphology [10]. Data obtained in MDA-MB 231 cells devoid of ER expression showed that PRA-transfected cells exhibited distinct morphological changes under antiprogestin ligands exposure as compared to PRB-transfected cells [11]. In this model cotransfection of ERα did not modify PRA vs PRB isoforms differences, suggesting an ERα- independent mechanism. PR isoforms have an equimolar and coordinated expression in mammary epithelial cells under normal physiological conditions [12–13]. Dysregulation of the PRA/PRB ratio with high PRA expression levels in tumors leads to an impaired PR and ER signaling [12, 14]. Unbal- anced PRA/B ratio has also been associated with tumor aggressiveness and poorer disease-free survival, and is observed in pre-neoplastic lesions from patients with breast cancer [3, 7, 12]. PRA is overexpressed as compared to PRB in 40% of ductal in situ carcinoma and invasive breast lesions [12]. Mutations in BRCA1/2 genes are associated with PRA overexpression in tumor tissue [15–16] as well as in peritumoral normal breast tissue. Finally, recent data demonstrated in a large cohort that PRA overexpression is related to a shorter disease free survival in tamoxifen treated breast cancer patients [17]. These data suggest a direct role of PR in breast carcinogenesis with a differential contribution of PR isoforms. New insights into the role of PR ligands in breast carcinogenesis have been highlighted in the past 20 years. Two large clinical studies have shown an increased risk of breast cancer in postmenopausal women treated with synthetic progestins combined to estrogens [18–19]as compared to women receiving estrogen-only treatment, suggesting a tumorigenic role of synthetic progestins. Furthermore, clinical trials conducted in patients with metastatic, antiestrogen-resistant breast cancer, showed some efficacy of the antiprogestin mifepristone. In a preliminary study, administration of mifepristone decreased normal breast cell proliferation in women [20]. Finally, in a BRCA1/P53 conditional breast knock-out mouse model, mifepristone was shown to prevent mammary tumorigenesis [15]. These data suggested that PR antagonists may contribute to control breast cancer development. Ulipristal acetate is a recently released selective progesterone receptor modulator routinely used for emergency contraception [21] and mid to long term leiomyoma treatment [22–23]. This compound exerts mixed agonist/antagonist activities depending on the cellular context and has been shown to induce apoptosis in cultured leiomyoma cells [24] and in leiomyoma in vivo [25]. In a model of normal human breast cell culture, the selective progesterone receptor modulator (SPRM), ulipristal acetate (UPA), did not induce cell proliferation [26]. We used the newly established bi-inducible, basal breast cancer cell model, MDA-iPRAB, where ER expression is absent and PR is expressed independently of estrogens action [6, 27]to further evaluate the role of PR isoforms in breast carcinogenesis as well as the effects and mechanism of action of ulipristal acetate in breast cancer cells. We evaluated the effects of progester-

one and UPA on cell proliferation, and the regulation of the anti-apoptotic marker BCL2-L1,as well as the molecular mechanisms involved. Overall, our findings propose that UPA induces a

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 2/19 PRA and Breast Cancer

PRA mediated anti-proliferative effect and could be of interest in the management of human breast cancer patients.

Materials and Methods Cell cultures and treatments Bi-inducible MDA-iPRAB cell line was derived from human basal breast cancer MDA-MB- 231 cell line (PR-,ERα-) (American Type Culture Collection, Manassas, VA, USA) as previously described [6]. Briefly, PRA and/or PRB expression could be induced at will by RSL1 (0.5 μM) (Exclusive Chemistry Ltd, Obninsk, Russia) and/or Dox (2 μM) (SigmaAldrich, Saint-Quentin Fallavier, France), respectively. Cells were grown in DMEM High Glucose with L-glutamine medium (Life Technologies, Saint-Aubin, France), 100 UI/mL penicillin, and 100 μg/mL streptomycin (GE Healthcare,Vélizy-Villacoublay, France) supplemented with 10% fetal calf serum (Biowest, Nuaille, France). For each experiment, cells were preincubated in steroid-free medium containing 2.5% dextran-coated charcoal treated serum (with DMSO or inducers) for at least 24 h before hormonal treatment. Ulipristal acetate (UPA) was from HRA Pharma (Paris, France). Progesterone and mifepristone (RU486) were from Sigma-Aldrich.

Proliferation assays Parental cells “clone 250” and MDA-iPRAB cells (iPRAB clone 38) (4,000 cells/ per well) were cultured in 96-well plates in steroid-free medium for 24 h. On day 0, 2, 4, RSL1 (0.5 μM) and/ or Dox (2 μM) were added to fresh steroid-free medium to induce PRA and/or PRB expression, respectively. Cells were treated at the same time by Vehicle, P4 (1 nM) and/or UPA (1 μM) for 24 h. Cell proliferation assays were performed at day 1, 3, 5 by adding 20 μL of Cell Titer96 AqueousOne solution (Promega, Charbonnières-Les-Bains, France) into each well containing 100 μL of phenol red free culture medium (Life Technologies, Saint-Aubin, France). The plates were incubated at 37°C for 1 h and absorbance values were measured at 490 nm (A490) using a photometer (Victor 378, Perkin Elmer, Courtabœuf, France).

Quantitative Real Time PCR Total RNA was extracted from cells with TRI Reagent (Applied Biosystem) according to the manufacturer’s recommendations. One μg of total RNA was processed for reverse-transcribed- qPCR. Briefly, total RNA was treated with DNase I (Biolabs, Evry, France), then reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). cDNA were analyzed by quantitative RT-PCR using the Power SYBR Green PCR Master Mix (Life Technologies) with the indicated primers (300 nM, final concentration) (S1 Table) and a Ste- pOne Real-Time PCR System (Life Technologies). Relative gene expression was calculated as a ratio of attomoles normalized by ribosomal rRNA 18S expression in femtomoles or by glyceral- dehyde-3-phosphate-dehydrogenase (GAPDH) in attomoles.

Immunoblotting Cells were lysed in lysis buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 30 mM Na pyrophosphate, 50 mM Na fluoride, 1% Triton X-100, protease and phosphatase inhibitor cocktails (Sigma) for 30 min on rotation at 4°C, followed by a centrifugation at 12,000 x g for 15 min at 4°C to clear debris. Samples were resolved by 7.5% sodium dodecyl sulfate gel electrophoresis and transferred onto nitrocellulose membranes. Antibodies used were anti-PR (NCL-L-PGR-312/2, Novocastra Laboratories, île Saint Martin, Nanterre, France), dilution 1:10,000; anti-Bcl-XL antibody (E18, ab32370, Abcam, France), dilution 1:1,000.

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 3/19 PRA and Breast Cancer

Control antibodies: anti-α-tubulin antibody (Sigma) and anti-GAPDH (Sigma). Secondary antibodies: Goat anti-Mouse IgG (H+L) Cross Adsorbed Secondary Antibody (DyLight 800 conjugated, 680 conjugated) and Goat anti-Rabbit IgG (H+L) DyLight 800 conjugated, dilution 1:10,000 (Thermo Fisher Scientific, Rockford, IL, USA). These antibodies were diluted in Phos- phate Buffered Saline and 0.1% Tween 20 buffer supplemented with 5% nonfat milk and added to the membranes for 1 h at room temperature or overnight at 4°C followed by incubation with the indicated secondary antibody for 1 h at room temperature. Target proteins were detected using Odyssey1 Fc, Dual-Mode Western Imaging (Li-Cor, Lincoln, NE, USA) by Fluores- cence and quantified.

Chromatin Immunoprecipitation (ChIP) MDA-iPRA cells were cultured for 36–48 h in DMEM/charcoal-stripped fetal bovine serum followed by 1 h treatment with P4 (10 nM) and/or UPA (1 μM). ChIP assays were performed as previously described [28] (#HighCellChIP kit, Diagenode, Seraing, Belgium) with 5 μg of the appropriate ChIP grade antibodies: Human anti-PR (Anti-PR, sc-7208, Santa Cruz Biotechnol- ogy, CA); Rabbit anti-SRC1 antibody (M-341, sc-8995,Santa Cruz Biotechnology), rabbit anti- Polymerase II antibody (H-224, sc-9001, Santa Cruz Biotechnology) and control unrelated antibody from the #HighCellChIP kit (Diagenode).

Primer design for genomic amplification assays Design of primer pairs containing PRbs (Progesterone receptor binding sites) was achieved with the NCBI software Primer BLAST. Human genome was used as database (hg19). Ampli- con length was kept between 80 and 150 bp. Primers were from Eurogentec (Angers, France).

Statistical Analysis All data are mean ± SEM. Non-parametric Mann-Whitney statistical U-tests and ANOVA test (Kruskal-Wallis) were applied to determine all significant differences between experimental conditions, using the software Prism 5 (GraphPad Software, San Diego, CA). Statistical signifi- cances are indicated by Ã or x (1–3 symbols corresponding to P<0.05 or <0.01 or <0.001, respectively).

Results PRA mediated MDA-iPRAB Cell Proliferation We used the recently established bi-inducible MDA-iPRAB cell model to study the impact of PR isoform on human breast cancer cell proliferation [6]. This model results from genetically modified MDA-MB-231 human breast cancer cell line (PR-), generating various stable cell lines, MDA-iPR-, iPRA and/or iPRB cells. Two non-steroidal inducible systems, Rheoswitch and T-Rex were inserted into the same plasmid pZX-TR [6](S1A Fig) and transfected into MDA-MB-231 cells generating parental and stable “clone 250” cell line. Subsequently, clone 250 cells were stably transfected with the bi-inducible system, pRheoswitch-PRA and pTRex-PRB, as schematically depicted on Fig 1A and S1B Fig. This bi-inducible system allows a bi-conditional expression of both PR isoforms, PRA at 94 kDa and/or PRB at 114 kDa, upon addition of RSL1 and/or Doxycy- cline (Dox) for 24 h, respectively (Fig 1B), while in the non-induced DMSO vehicle condition, no PR isoform expression was detected. Given that the impact of P4 on cell proliferation was reported to be highly dependent on the cellular context [5, 29], we examined the influence of P4 on MDA-iPRAB cell proliferation. Unexpectedly, and unlike what we had published before with P4 at 10 nM, here we showed

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 4/19 PRA and Breast Cancer

Fig 1. Progesterone-dependent activation of MDA-iPRA cell proliferation. (a) Schematic representation of the bi-inducible system inserted into the MDA-iPRAB cell line in which RSL1 and Dox selectively trigger expression of PRA and PRB isoform respectively, as previously described [6]. (b) PRA and/or PRB expression in MDA-iPRAB cell lines. MDA-iPRAB cells were incubated with DMSO or inducers, RheoSwitch Ligand (RSL1, 0.5 μM) and/or doxycycline (Dox, 2 μM) during 24 h. Western blot analysis of whole cell extracts was performed using anti-PR antibody recognizing both PR isoforms (Novocastra) or anti-tubulin antibody for sample loading control. (c) MDA-iPRAB cell proliferation assays were analyzed on day 1, 3 and 5. Data are expressed as fold induction compared to vehicle condition arbitrarily set at 1, and are means ± SEM from five independent cell cultures (n = 6 for each experiment. ** indicates p<0.01 compared to the vehicle-treated cells for each MDA-iPRAB cell line (non-parametric Mann Whitney t-tests). doi:10.1371/journal.pone.0140795.g001

through repeated cell proliferation tests that P4 (1 nM) significantly increased MDA-iPRA cell proliferation at Day 5 (Fig 1C, S2A Fig). Of note, no effect of RSL1 and P4 was observed on cell proliferation of the parental clone 250, excluding a potential non-specific effect of these compounds (Fig 1C, left histograms). Moreover, P4 did not induce cell proliferation when none of the PR isoform was induced. In contrast, MDA-iPRB cell proliferation was significantly

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 5/19 PRA and Breast Cancer

Fig 2. Ulipristal acetate (UPA) inhibits P4-dependent MDA-iPRA cell proliferation. MDA-iPRA cultured on 96-well plates, were treated with vehicle or P4 (1 nM) and/or UPA (1 μM) in fresh steroid-free medium containing DMSO or RSL1 (0.5 μM) on day 0, 2 and 4. Cell proliferation assays were performed using CellTiter96H AqueousOne Solution as described in Materials and Methods. The 490 nm absorbance was determined on day 1, 3 and 5. Data are expressed as fold induction compared to vehicle condition arbitrarily set at 1, and are means ± SEM from five independent cell cultures (n = 6 for each experiment). ** indicates p<0.01 compared to the vehicle-treated cells for each MDA-iPRA cell line while xx indicates p<0.01 compared to the P4-treated cells (non-parametric Mann Whitney t-tests). doi:10.1371/journal.pone.0140795.g002

reduced in the presence of P4 (Fig 1C, right histograms), demonstrating that PRA specifically mediated cell proliferation in this model. Interestingly, co-expression of both PRA and PRB isoforms impeded P4-dependent MDA-iPRAB cell proliferation. These results are consistent with a PRA-mediated proliferative effect and PRB-mediated antiproliferative effect of P4 (Fig 1C).

Anti-proliferative effect of UPA on MDA-iPRA cells We next examined the effect of the SPRM, UPA, on MDA-iPRA cell proliferation (Fig 2) and found that UPA at 1 μM alone or in association with P4 significantly inhibited cell proliferation as early as Day 3 (see also S2A Fig). This was consistent with our previous report showing that RU486 (Mifepristone) inhibits MDA-iPRA cell proliferation [6]. Of note, in the absence of PR, UPA has no effect, while UPA inhibited PRB-expressing cells and PRAB-expressing cells proliferation (S2B and S2C Fig). UPA has synergistic effects with P4 in MDA-iPRB cells. Taken together, we reported the first cellular model in which P4 triggers PRA mediated human breast cancer cell proliferation in vitro. In this model, we unambiguously demonstrated that PRA isoform mediated P4-induced cell proliferation that was antagonized by UPA, highlighting the anti-proliferative role of UPA on human breast cancer cells.

Key PRA target genes involved in human breast cancer cell proliferation: Effects of P4 and UPA We have previously identified by microarray analysis on the same MDA-iPRAB cell model, a subset of potential target gene candidates regulated in a P4-dependent and/or PR isoform specific manner [6]. Given the importance of PRA isoform, its impact on P4 signaling in

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 6/19 PRA and Breast Cancer

Table 1. Up-regulated PRA–target genes in the presence of P4.

Class Gene Name FC FI Function A+&AB+ DUSP6 Dual speciﬁcity phosphatase 6 2 1.5 Transcriptional target of P53 Interaction with PRB: proliferative transcriptional programs

A+&AB+ BCL2-L1 Bcl-2-like protein 1 1.5 1.2 Overexpression of Bcl-xL: loss of apoptosis A+&AB+ TNFRSF11A Receptor Activator of Nuclear Factor κ 1.9 1.6 Mammary cell proliferation, migration, cell invasion. B (RANK) A+&AB+ WNT5A Wingless-type MMTV integration site 1.8 1.3 Tumor suppressor gene Proliferation, differentiation, family, member 5A migration, adhesion, polarity A+&AB+ LGR4 Leucine-rich repeat-containing G-protein 1.8 1.6 Promoting cancer cell proliferation (Wnt signaling), coupled receptor 4 (GPR48) Invasiveness and metastasis A+&AB+ FOSB FBJ murine osteosarcoma viral oncogene 1.8 1.5 Reduced FosB expression: dedifferentiation (breast homolog B tumorigenesis) A+&AB+ TFPI2 Tissue factor pathway inhibitor 2 2.2 2.6 Low expression: breast cancer progression and poor outcome A+&B+ & DUSP1 Dual speciﬁcity phosphatase 1 1.6 1.6 Cell cycle, dephosphorylation of MAP kinase. AB+ Antiproliferative actions of PR

MDA-iPRAB cells were cultured during 24 h in steroid-free medium containing RSL1 (0.5 μM) and/or Dox (2 μM) to induce expression of PRA and/or PRB. Cells were treated by vehicle or P4 (1 nM) for 6 hours and a genome wide transcriptomic studies was performed as described in [6]. A total of 999 genes were affected by PR expression. These genes were separated into three groups: A and B and AB (co-expressed at similar levels relative to physiological conditions) regrouping genes that are regulated by either by PRA, PRB or PRAB. Tables above represent class A+ genes regulated by PRA in the presence of the ligand; Class A+&AB+, genes responsive to liganded PRA and their expression may or may not be inﬂuenced by PRB co-expression; Class A±&AB± genes responsive to both liganded and unliganded PRA, and their expression may be inﬂuenced by PRB co-expression; Class A+&B+& AB+, genes that are commonly regulated by liganded PRA, PRB and PRAB. FC calculated either by microarray studies or by RT-qPCR analysis and their function in the cancer. FC: Transcriptional Fold Change calculated by microarray studies (FC*) and by RT-qPCR (FI, Fold Induction).

doi:10.1371/journal.pone.0140795.t001

mammary tumorigenesis processes such as cell growth, death and migration, and taking into account its role in mediating cell proliferation, we chose to focus our attention on some PRA- dependent upregulated (Table 1) or downregulated genes (Table 2) in the presence of P4. It would be thus possible to correlate P4-stimulated MDA-iPRA cell proliferation to the corresponding gene expression and to further evaluate the activity of the antiprogestin UPA in these processes. Among PRA-targeted genes transcriptionally stimulated (Fig 3) or inhibited by P4 β (Fig 4), we examined the expression of few genes (BCL2-L1, DUSP6, WNT5A, LGR4, TGF 2, EREG, F3, F2RL1), owing to their role in apoptosis, cell proliferation, metastasis, invasiveness, angiogenesis (Tables 1 and 2). We first validated the regulated expression of these genes by RT- qPCR analysis, after a 6 hr treatment by P4 following the same experimental duration as previ-

ously described [6]. We found that P4 significantly enhanced expression of BCL2-L1 by 25% (Fig 3A), that of DUSP6 by 50% (Fig 3B), that of WNT5A by 30% (Fig 3C) while LGR4 expression was increased by 60% (Fig 3D). Interestingly, we demonstrated that the expression of these P4-upregulated genes was repressed by UPA alone or in combination with P4, confirming the antagonistic activity of UPA (Fig 3). In contrast, P4 treatment significantly reduced the expression of TGFβ2 by 60% (Fig 4A), and that of EREG, F3 and F2RL1 by 70% (Fig 4B, 4C and 4D) in MDA-iPRA cells, as revealed RT-qPCR analysis. Unexpectedly, UPA alone also inhibited the expression of TGFβ2, F3 and

F2RL1 (Fig 4A, 4C and 4D) but not that of EREG (Fig 4B). However, the P4-dependent down- regulation of EREG expression was completely prevented by UPA (Fig 4B), consistent with a full PR antagonist activity of UPA. Of note, a strict correlation was observed between gene expression in transcriptomic and RT-qPCR analysis (Tables 1 and 2).

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 7/19 PRA and Breast Cancer

The expression of PRA-regulated genes was also analyzed in MDA-iPRB expressing cells. As shown in S3 and S4 Figs, expression of these genes did not vary in the presence of P4 and/or β UPA treatment. Thus, we confirmed that BCL2-L1, DUSP6, WNT5A, LGR4, TGF 2, EREG, F3, F2RL1 are indeed PRA specific genes and that UPA exerts an inhibitory effect by down regulating their expression only when PRA is expressed (MDA-iPRA). Collectively, we demonstrated that the selected genes were specifically regulated by PRA isoform in the presence of its natural ligand P4. In addition, we also showed that UPA generally displayed PRA antagonist properties while, in some cases, UPA exerted a partial progesterone agonist activity consistent with the SPRM feature of his compound [11, 30].

Regulation of BCL2-L1 protein expression by P4 and UPA in MDA-iPRA cells

Since P4 stimulated BCL2-L1 mRNA levels (Fig 3A), we next examined the hormone regulation of the anti-apoptotic factor BCL2-L1, at the protein level. As illustrated in Fig 5A, the 26 kDa band corresponding to BCL2-L1 protein was significantly increased by 23% in MDA-iPRA cells upon 24 h exposure to P4 as revealed to quantification of band intensities relative to GAPDH

(36 kDa) (Fig 5B). We also found that P4-stimulated BCL2-L1 expression was antagonized by UPA treatment which, when applied alone, significantly reduced by 2 fold factor the basal

BCL2-L1 expression (Fig 5B). PRA expression was also quantified relative to loading control GAPDH (Fig 5C). As anticipated, PRA was significantly downregulated upon P4 exposure while UPA alone was ineffective in modulating PRA expression in MDA-iPRA cells. Taken together, we provide direct evidence of P4-stimulated MDA-iPRA cell proliferation, associated

with BCL2-L1 expression, both being fully antagonized by UPA.

PRA recruitment on BCL2-L1 gene

To better elucidate the molecular mechanisms by which P4-activated PRA regulated BCL2-L1 gene expression in MDA-iPRA cells and based on previous studies performed in T47D cells

Table 2. Down-regulated PRA–target genes in the presence of P4.

Class Gene Name FC FI Function A+ F2RL1 Coagulation factor II receptor- -1.9 0.7 Constitutive migration of MDA MB-231 Up regulation of VEGF like 1 A+&AB EREG Epiregulin -1.7 0.7 Breast tumor progression (paracrine mechanism) + A+&AB F3 Coagulation factor III (tissue -2.4 0.7 Promigratory, invasive, proangiogenic phenotype + factor) A+&AB TGFB2 Transforming growth factor- -1.8 0.6 Breast cancer invasion Tumor suppressive (early stages) Malignant + beta 2 conversion and progression (later stages) A+&AB ADRB2 Beta-2 adrenergic receptor -1.7 0.6 Genetic variation and polymorphism: risk for breast cancer + A+&AB GJB2 Gap junction beta-2 protein, -1.8 0.5 Invasion of ductal breast carcinomas + connexin 26

doi:10.1371/journal.pone.0140795.t002

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 8/19 PRA and Breast Cancer

Fig 3. Hormonal regulation of P4-PRA-upregulated genes. (a) BCL2-L1,(b) DUSP6,(c) WNT5A,(d) LGR4 mRNA expression levels were determined in MDA-iPRA cells. Cells were treated for 6 h with vehicle, P4 (1 nM) and/or UPA (1 μM) in steroid-free medium, following 24 h induction of PRA expression using RSL1 (0.5 μM). RT-qPCR analyses were performed as described in Materials and Methods. Data are expressed as fold induction compared to vehicle condition arbitrarily set at 1, and are means ± SEM from three independent cell cultures measured in duplicate. *, **, *** symbols indicate p< 0.05, 0.01 and 0.001 respectively compared to the vehicle-treated MDA-iPR- cells while x, xx, xxx symbols indicate p<0.05, 0.01 and 0.001 respectively compared to the V or P4-treated MDA-iPRA cells (non-parametric Mann Whitney t-tests). doi:10.1371/journal.pone.0140795.g003

[27], ChIP assays were performed to examine PRA recruitment on one genomic target motif,

already established on BCL2-L1 gene [31]. We chose the intragenic PR-binding sequence located at +58 kb downstream Transcription Start Site (TSS) of BCL2-L1 gene as schematically depicted in the genomic structure of the human BCL2-L1 gene (Fig 6A). P4 treatment induced a significant 40-fold increase in PRA recruitment on the well-documented +58 kb response ele-

ment of the BCL2-L1 gene, in comparison to the vehicle condition. Furthermore, UPA in combination with P4 markedly reduced P4-stimulated PRA enrichment on this PR-binding site (P< 0.001). Interesting enough, UPA alone was able to stimulate PRA recruitment by a 10-fold factor (Fig 6) as well as a substantial recruitment of the well-known SRC1 coactivator however to a lesser extent than that induced by P4 (2 vs 8 Fold) (S5A Fig). However, under these experimental conditions, as opposed to P4, UPA was unable to promote RNA Polymerase type II

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 9/19 PRA and Breast Cancer

Fig 4. Hormonal regulation of P4-PRA-downregulated genes. (a) TGFβ2,(b) EREG,(c) F3,(d) F2RL1mRNA expression levels were in MDA-iPRA cells. Cells were treated for 6 h with vehicle, P4 (1 nM) and/or UPA (1 μM) in steroid-free medium, following 24 h induction of PRA expression using RSL1 (0.5 μM). RT-qPCR analyses were performed as described in Materials and Methods. Data are expressed as fold induction compared to vehicle condition arbitrarily set at 1, and are means ± SEM from three independent cell cultures measured in duplicate. *, **, *** symbols indicate p<0.05, 0.01 and 0.001 respectively compared to the vehicle-treated MDA-iPR- cells while x, xx, xxx symbols indicate p< 0.05, 0.01 and 0.001 respectively compared to the V or P4-treated MDA-iPRA cells (non-parametric Mann Whitney t-tests). doi:10.1371/journal.pone.0140795.g004

recruitment into the pre-initiation complex assembly (S5B Fig), required for transcriptional

regulation. This finding is consistent with the UPA-dependent repression of BCL2-L1 expression (see Figs 3 and 5).

Discussion We have exploited an original human breast cancer cell-based system in which cell proliferation is stimulated by progesterone through PR, using the recently established bi-inducible, ER negative, MDA-iPRAB cell line [6]. Several breast cancer cell models have been generated to study steroid effects, mostly focusing on the impact of estrogens and anti-estrogens [32–34]. The effects of progesterone and progestins on breast cancer cell proliferation in vitro drew con- tradictory results [35], although proliferative effects of progesterone have been reported in the ER+,PR+ T47D and MCF-7 breast cancer cells, without distinction between PR isoforms

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 10 / 19 PRA and Breast Cancer

Fig 5. Hormonal regulation of BCL2-L1 protein expression in MDA-iPRA cells. Following 24 h induction of PRA expression using RSL1 (0.5 μM), MDA- iPRA cells were incubated in the presence or absence of P4 (1 nM) and/or UPA(1 μM) in steroid-free medium for 24 h. (a) Western blot analysis of whole cell extracts (35 μg Protein) loaded on a 12% acrylamide gel, membranes were incubated overnight with a 1:1,000 dilution of anti-BCL2-L1 antibody (anti-Bcl-XL antibody, E18, ab32370, Abcam, France), and an anti-PR antibody recognizing both PR isoforms (Novocastra) or anti-GAPDH antibody (G9545—anti- GAPDH antibody produced in rabbit). (b) Band intensities of BCL2-L1 (26 kDa) and GAPDH (36 kDa) used as a sample loading control were quantified and BCL2-L1/GAPDH ratio were determined and expressed in arbitrary units and normalized to vehicle. Relative BCL2L1 protein expression is presented. (c) Band intensities of PRA (94 kDa) and GAPDH (36 kDa) used as a sample loading control were quantified and PRA/GAPDH ratio were determined and expressed in arbitrary units and normalized to vehicle. Relative PRA expression is presented as well. Histograms are means ± SEM of three independent experiments. ** Symbol indicates p<0.01 compared to the vehicle-treated MDA-iPRA cells while xx symbol indicates p<0.01 compared to the P4-treated MDA-iPRA cells (non-parametric Mann Whitney t-tests). doi:10.1371/journal.pone.0140795.g005

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 11 / 19 PRA and Breast Cancer

Fig 6. Progesterone enhances PRA recruitment on the intragenic region of BCL2-L1 gene. (a) Schematic representation of BCL2-L1 gene structure. It contains 3 exons. The genomic PR target motif previously identified [31] is located downstream the 3’end at position +58 kb of the transcription start site of BCL2-L1 gene. The proposed PR response element (PRE) is illustrated on which the pre-initiation complex containing PR isoform, steroid receptor coactivator 1 (SRC1) as well as the RNA polymerase type 2 (Pol II) binds. (b) MDA-iPRA cells treated for 1 h with P4 (10 nM) and/or UPA (1 μM), were fixed and lysed and chromatin extracts subjected to ChIP assays using PR antibody (Anti-PR, sc-7208, Santa Cruz Biotechnology, CA) or unrelated rabbit IgG antibodies used as negative control. Immunoprecipitated and eluted DNA fragments were analyzed by real-time qPCR using primer pair encompassing genomic sequence of the +58 kb site of the BCL2-L1 gene. Histograms represent the fold induction of PRA enrichment compared to vehicle condition arbitrary set at 1 and are means ± SEM of four independent experiments performed in triplicates. Statistical difference is indicated as compared to vehicle condition for PRA-induced cells treated by V (***,p<0.001), or by P4 (xxx,p<0.001) (Non-parametric Mann Whitney t-tests). doi:10.1371/journal.pone.0140795.g006

(review in [36]). Cell proliferation was evaluated in ER negative MDA-MB 231 cells transfected with each PR isoforms and cell proliferation inhibition by progesterone was observed in both cases [11]. In this report, progesterone was used at 0.1 μM and cells cultured in red phenol free DMEM supplemented with 5% charcoal treated fetal calf serum, while we used 2.5% FCS and 1 nM progesterone [11]. Progestin-stimulated cell proliferation has been reported to depend on progesterone concentration, mode of administration (continuous vs discontinuous) and may involve cross-talks with growth factors [36]. This may explain the discrepancy between our results and this study. We previously published that unliganded MDA-iPRA cells prolifer- ate to a lesser extent than MDA-iPRB cells [6], in this study, we confirmed these findings (data not shown). We repeatedly and reproducibly observed that progesterone stimulated MDA- iPRA cell proliferation in 6 independent experiments (n = 6 per experiment). This is in accordance with PRA cells expressing increased responsiveness to stimulatory effects of progestins, as compared to cells expressing PRB reported by others [36–37].

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 12 / 19 PRA and Breast Cancer

One major advantage of our cell-based system is that one might selectively evaluate the effects of PR, its isoforms and ligands independently of estrogenic effects, since proliferation of this ER- cell line is estrogen-independent. Moreover, the bi-inducible PR expression by non- steroid inducers is genomically stable, the non-induced cell line constituting a reliable negative control [6]. We cannot exclude that the absence of ERα (and estrogens) might modify the expression of co-regulators required for PR signaling and thus influencing transcriptional responses to PR isoforms. However data from previous reports did not show any influence of ERα transfection on PR ligands induced morphological changes in PR transfected MDA-MB 231 cells [11]. Taking into account these limitations, our studies provide new insights into the understanding of the functional consequences of imbalanced PRA/PRB ratio in the context of human breast cancer cells. Interestingly, as opposed to the already known P4-biphasic regulation of cell proliferation observed in estrogen dependent T47D-YB cell line constitutively expressing PR-B [38], we report that P4 stimulates cell proliferation of bi-inducible MDA-iPRAB cells only when PRA isoform is expressed, while P4 exerts an anti-proliferative effect in PRB-expressing cells, without any biphasic effect. This underlines intrinsic differences in cell lines, in particular the MDA MB cell line is derived from a basal breast cancer [39] while the T47D cell line is derived from a luminal breast cancer [40]. In this model as well, PRA and PRB exhibit distinct transcriptional activities and regulate specific gene transcription. We have previously shown that PRA coexpression potentiated PRB-mediated cancer cell migration and that PR isoforms differentially regulated expression of major players of cell migration [41] such as urokinase plasminogen activator (uPA), its inhibitor plasminogen activator inhibitor type 1 (PAI-1), uPA receptor (uPAR), and β1-integrin, which affect focal adhesion kinase (FAK) signaling. PRA, as well as PRB, interacted with FAK complexes, whose degradation was coupled to a progestin-dependent turnover of PRA and PRB. Our previous transcriptomic data allowed us to select PRA specific target genes [6]. Among PRA-modulated genes involved in breast tumorigenesis (Tables 1 and 2), we more specifically

evaluated by quantitative RT-PCR and confirmed that BCL2-L1, DUSP6, WNT5A, LGR4 expression were upregulated in the presence of progesterone, and that TGFβ2, EREG, F3, F2RL1 were down regulated in the presence of progesterone.

BCL2-L1 is one of the most important regulators of programmed cell death. Deregulation of – BCL2-L1 expression contributes to oncogenic transformation of normal cells [42 43]. In our MDA-iPRA model, P4 stimulates BCL2-L1 transcript and protein expression, while BCL2-L1 expression was not regulated by P4 in the MDA-iPRB cell line. Induction of anti-apoptotic factors of the Bcl family by progestins has been reported in endogenously PR-expressing T47D cells [35, 44], however the specific role of PR isoforms has not been directly evaluated. WNT5A and LGR4 regulate cell polarity, proliferation, survival and aberrant regulation often leads to pathological conditions including cancer [45]. In T47D cells, it has been demonstrated that PRB-induced transcriptional up-regulation of WNT1 leading to activation of epidermal growth factor receptor (EGFR) and c-Src and Erk1/2 [46]. Here, we report that PRA mediates the P4-induction and UPA-inhibition of the expression of both WNT5A and LGR4, suggesting an essential function of PRA-mediated, P4 triggered- breast cancer cell proliferation. DUSP6 (the dual specificity phosphatase 6, MKP3) is a negative regulator of the MAPK pathway [47]. Previous studies demonstrated a direct interaction between PRB and DUSP6 [47], our study confirms that DUSP6 is a PRA-target gene up-regulated by P4 in MDA cells. TGFβ2 and EREG (Epiregulin) were shown to be down regulated by progesterone in the presence of PRA in our model [48–49]. This is in accordance with previous data suggesting

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 13 / 19 PRA and Breast Cancer

that PR isoforms expression correlated negatively with other members of the same gene family associated with tumor aggressiveness such as EREG and TGF alpha [50]. Our results thus suggest a specific role of PRA in breast carcinogenesis, including modulation of regulatory factors of cell proliferation, invasion, apoptosis, and angiogenesis. This may constitute a trail for further molecular characterization of breast tumors, where the evaluation of a panel of specific PRA target genes could be used to further identify poor prognosis tumors. Indeed, breast cancer is now considered as a plural disease whose molecular signature analysis is routinely used to define personalized therapeutic schemes [51]. In addition, our data bring new insights in the isoform specific molecular mechanisms of action of PR and its ligands. It has been shown that over 60% of PR binding sites are located more than 10 kb from the transcription start site [52]. Here we showed that PRA is recruited to an intragenic PR-binding site (PRbs) located at +58 Kb downstream transcription start site of ’ BCL2-L1 and close to the 3 -end of the gene. This PRb was previously reported to serve as a highly active hormone-dependent binding site [31]. The canonical coactivator SRC1 and the Pol II were also recruited to this +58 Kb site, in a P4 enhanced way. To our knowledge, this is the first report of a direct evaluation of PRA interaction with molecular partners in PR+ basal breast cancer cells, while almost all previous PR microarrays studies were performed on luminal breast cancer cells [53]. This issue has been only addressed once [54], functional analyses were conducted in estrogen-dependent T47D cells, however ChIP experiments were conducted in non mammary HeLa cells and did not specifically evaluate PRA recruitment. To evaluate the potential activity of PR antagonists on PRA-mediated cell proliferation, we used the recently marketed selective progesterone receptor modulator (SPRM), ulipristal acetate (UPA), a specific, highly selective PR antagonist with no agonist activity towards other steroid receptors [55], with mixed PR agonist/antagonist properties depending on the tissue [56]. Of interest, we showed that UPA inhibited MDA-iPRA cell proliferation. The anti-proliferative effect of UPA was restricted to PRA-expressing cells, independently of the presence of P4 while it exerts partial agonist activity on MDA-iPRB cells. ChIP experiments demonstrated that UPA

partially inhibited PRA, SRC1 and Pol II recruitment on BCL2-L1 PR-binding site in the presence of P4, while UPA alone weakly enhanced PRA and SRC1 recruitment only. This absence of Pol II recruitment in the presence of UPA correlated with the lack of UPA-induced PRA-

mediated BCL2-L1expression, and is consistent with UPA inhibitory effect on both P4-induced BCL2-L1 transcript and protein. This may be correlated as well to the inhibition of cell proliferation in the presence of UPA, as already observed for other tumor types in vivo [24]. PRB interaction with SRC1 in the presence of a non-commercially available SPRM (asoprisnil) has been reported using transactivation assays in T47D cells [57]. To our knowledge this is the first report on the molecular mechanism of action of UPA. Our data suggest that PRA expression is associated with increased human breast cancer cell proliferation, further stimulated by P4. We also show that UPA is able to decrease cell proliferation in this PRA expressing model. This effect of UPA includes basal as well as progesterone stimulated cell proliferation. Thus, our findings suggest that UPA might be of interest in the adjuvant treatment of breast cancer, more specifically in ER- PR+ tumors. In sum, we propose that future characterization of breast cancer should include PR isoforms evaluation to better specify tumor phenotype, and/or its molecular signature independently of estrogen signaling. Most notably, this should evaluate PRA target genes to identify poor prognosis tumors, and potential candidates for SPRM adjuvant therapy. This obviously requires prior confirmation in the clinical setting.

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 14 / 19 PRA and Breast Cancer

Supporting Information S1 Fig. Schematic representation of stably transfected plasmids inserted into the parental clone 250 and the bi-inducible system applied to generate MDA-iPRAB cells for the conditional PR isoform expression in MDA-MB-231 cells [6]. (a) The two regulatory proteins systems RheoSwitch and T-Rex were inserted in the same plasmid pZX-TR besides the zeocin resistance gene. (b) PRA and/or PRB expression was induced under the control of two promoters used to establish the secondary stable MDA-iPRAB cell line. Addition of RSL1 and/or Dox selectively induces PRA or PRB isoform, respectively. In their absence, no PR expression is induced. (EPS) S2 Fig. P4 and UPA regulation of MDA-iPRA cell proliferation (a), MDA-iPRB cell proliferation (b) and MDA-iPRAB cell proliferation (c). Following 24 h induction of PRA expression using RSL1 (0.5 μM), and PRB expression using Dox (2 μM) cultured MDA-iPRA in 96-well plates, were treated with vehicle, P4 (1 nM) and/or UPA (1 μM) for 5 d. Cell proliferation assays were performed on day 0, 3 and 5 using CellTiter 96H AqueousOne Solution as described in Materials and Methods. Data are expressed as fold induction (a) and absorbances (b, c) compared to vehicle-treated MDA-iPRA cells (a) and vehicle-treated MDA-iPRB cells (b) and vehicle treated MDA-iPRAB cells (c) and are mean of 6 independent determinations. Ã, ÃÃ, ÃÃÃ symbols indicate p<0.05, 0.01 and 0.001 respectively compared to the vehicle-treated MDA cells (non-parametric ANOVA test (Kruskal-Wallis). (EPS)

S3 Fig. Regulation of P4-dependent and PRA-selective upregulated genes (a) BCL2-L1, (b) DUSP6, (c) WNT5A, (d) LGR4 mRNA expression levels were determined in MDA-iPRB cells. Cells were treated for 6 h with vehicle, P4 (1 nM) and/or UPA (1 μM) in steroid-free medium, following 24 h induction of PRB expression using Dox (2 μM). RT-qPCR analyses were performed as described in Materials and Methods. Data are expressed as fold induction compared to vehicle condition arbitrarily set at 1, and are means ± SEM from three independent cell cultures measured in duplicate. Ã, symbol indicates p< 0.05 compared to the vehicle- treated MDA-iPRB cells while x, xx, xxx symbols indicate p< 0.05, 0.01 and 0.001 respectively compared to the V or P4-treated MDA-iPRB cells (non-parametric Mann Whitney t-tests). (EPS) S4 Fig. Regulation of P4-dependent and PRA-selective downregulated genes (a) TGFβ2, (b) EREG, (c) F3, (d) F2RL1 mRNA expression levels were determined in MDA-iPRB cells. Cells were treated for 6 h with vehicle, P4 (1 nM) and/or UPA (1 μM) in steroid-free medium, following 24 h induction of PRB expression using Dox (2μM). RT-qPCR analyses were performed as described in Materials and Methods. Data are expressed as fold induction compared to vehicle condition arbitrarily set at 1, and are means ± SEM from three independent cell cultures measured in duplicate. No statistical difference was detected. (EPS)

S5 Fig. SRC1 and Pol II recruitment to the BCL2-L1 gene. MDA-iPRA cells treated for 1 h with P4 (10 nM) or UPA (1 μM), were fixed and lysed and chromatin extracts subjected to ChIP assays using SRC1 antibody (Rabbit anti-SRC1 antibody, M-341, sc-8995, Santa Cruz Biotechnology) or Pol II antibody (Rabbit anti-Polymerase II antibody, H-224, sc-9001, Santa Cruz Biotechnology). Immunoprecipitated and eluted DNA fragments were analyzed by real-

time qPCR using primer pair encompassing genomic sequence of the +58 kb site of the BCL2L1 gene. Histograms represent the fold induction of SRC1 (a) or Pol II (b) enrichment compared

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 15 / 19 PRA and Breast Cancer

to vehicle condition arbitrary set at 1 and are means ± SEM of three independent determinations. (EPS) S6 Fig. Regulation of FKBP5, a PRB-dependent gene. mRNA expression levels were determined in MDA-iPRB cells. Cells were treated for 6 h with vehicle, P4 (1 nM) and/or UPA (1 μM) in steroid-free medium, following 24 h induction of PRB expression using Dox (2μM). RT-qPCR analyses were performed as described in Materials and Methods. Data are expressed as fold change compared to vehicle condition arbitrarily set at 1, and are means ± SEM from three independent cell cultures measured in duplicate. Ã, ÃÃ, ÃÃÃ symbols indicate p<0.05, 0.01 and 0.001 respectively compared to the vehicle-treated MDA-iPRB- cells, while x, xx, xxx symbols indicate p< 0.05, 0.01 and 0.001 respectively compared to the V or P4-treated MDA-iPRB cells (non-parametric ANOVA test (Kruskal-Wallis). (EPS) S1 Table. List of Primer sequences of genes. (DOCX)

Acknowledgments We thank Dr Junaid A Khan (present address Institute of Pharmacy, Physiology & Pharmacol- ogy, University of Agriculture, Faisalabad, Pakistan) for his help in the initial part of this work.

Author Contributions Conceived and designed the experiments: NE FLB HL ML NCB. Performed the experiments: NE FLB HL. Analyzed the data: NE FLB HL ML NCB. Contributed reagents/materials/analysis tools: NE FLB MRR HL ML NCB. Wrote the paper: NE FLB HL ML NCB.

References 1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013; 63(1):11–30. Epub 2013/01/22. doi: 10.3322/caac.21166 PMID: 23335087 2. Shah R, Rosso K, Nathanson SD. Pathogenesis, prevention, diagnosis and treatment of breast cancer. World J Clin Oncol. 2014; 5(3):283–98. Epub 2014/08/13. doi: 10.5306/wjco.v5.i3.283 PMID: 25114845 3. Hagan CR, Lange CA. Molecular determinants of context-dependent progesterone receptor action in breast cancer. BMC Med. 2014; 12:32. Epub 2014/02/21. doi: 10.1186/1741-7015-12-32 PMID: 24552158 4. Knutson TP, Lange CA. Tracking progesterone receptor-mediated actions in breast cancer. Pharmacol Ther. 2014; 142(1):114–25. Epub 2013/12/03. doi: 10.1016/j.pharmthera.2013.11.010 PMID: 24291072 5. Brisken C. Progesterone signalling in breast cancer: a neglected hormone coming into the limelight. Nat Rev Cancer. 2013; 13(6):385–96. Epub 2013/05/25. doi: 10.1038/nrc3518 PMID: 23702927 6. Khan JA, Bellance C, Guiochon-Mantel A, Lombes M, Loosfelt H. Differential regulation of breast cancer-associated genes by progesterone receptor isoforms PRA and PRB in a new bi-inducible breast cancer cell line. PLoS ONE. 2012; 7(9):e45993. Epub 2012/10/03. doi: 10.1371/journal.pone.0045993 PMID: 23029355 7. Diep CH, Daniel AR, Mauro LJ, Knutson TP, Lange CA. Progesterone action in breast, uterine, and ovarian cancers. J Mol Endocrinol. 2015; 54(2):R31–53. Epub 2015/01/15. doi: 10.1530/JME-14-0252 PMID: 25587053 8. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O'Malley BW, McDonnell DP. Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrinol. 1993; 7(10):1244–55. PMID: 8264658

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 16 / 19 PRA and Breast Cancer

9. Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS, Horwitz KB. A third transactivation function (AF3) of human progesterone receptors located in the unique N-terminal segment of the B-isoform. Mol Endocrinol. 1994; 8(10):1347–60. PMID: 7854352 10. McGowan EM, Weinberger RP, Graham JD, Hill HD, Hughes JA, O'Neill GM, et al. Cytoskeletal responsiveness to progestins is dependent on progesterone receptor A levels. J Mol Endocrinol. 2003; 31(2):241–53. Epub 2003/10/02. PMID: 14519093 11. Leo JC, Lin VC. The activities of progesterone receptor isoform A and B are differentially modulated by their ligands in a gene-selective manner. Int J Cancer. 2008; 122(1):230–43. Epub 2007/09/26. PMID: 17893877 12. Mote PA, Bartow S, Tran N, Clarke CL. Loss of co-ordinate expression of progesterone receptors A and B is an early event in breast carcinogenesis. Breast Cancer Res Treat. 2002; 72(2):163–72. PMID: 12038707 13. Mote PA, Graham JD, Clarke CL. Progesterone receptor isoforms in normal and malignant breast. Ernst Schering Found Symp Proc. 2007(1: ):77–107. PMID: 18540569 14. McGowan EM, Clarke CL. Effect of overexpression of progesterone receptor A on endogenous progestin-sensitive endpoints in breast cancer cells. Mol Endocrinol. 1999; 13(10):1657–71. PMID: 10517668 15. Poole AJ, Li Y, Kim Y, Lin SC, Lee WH, Lee EY. Prevention of Brca1-mediated mammary tumorigenesis in mice by a progesterone antagonist. Science (New York, NY). 2006; 314(5804):1467–70. 16. Mote PA, Leary JA, Avery KA, Sandelin K, Chenevix-Trench G, Kirk JA, et al. Germ-line mutations in BRCA1 or BRCA2 in the normal breast are associated with altered expression of estrogen-responsive proteins and the predominance of progesterone receptor A. Genes Chromosomes Cancer. 2004; 39 (3):236–48. PMID: 14732925 17. Mote PA, Gompel A, Howe C, Hilton HN, Sestak I, Cuzick J, et al. Progesterone receptor A predominance is a discriminator of benefit from endocrine therapy in the ATAC trial. Breast Cancer Res Treat. 2015; 151(2):309–18. Epub 2015/04/29. doi: 10.1007/s10549-015-3397-0 PMID: 25917868 18. Chlebowski RT, Kuller LH, Prentice RL, Stefanick ML, Manson JE, Gass M, et al. Breast cancer after use of estrogen plus progestin in postmenopausal women. The New England journal of medicine. 2009; 360(6):573–87. Epub 2009/02/07. doi: 10.1056/NEJMoa0807684 PMID: 19196674 19. Beral V. Breast cancer and hormone-replacement therapy in the Million Women Study. Lancet (Lon- don, England). 2003; 362(9382):419–27. 20. Engman M, Skoog L, Soderqvist G, Gemzell-Danielsson K. The effect of mifepristone on breast cell proliferation in premenopausal women evaluated through fine needle aspiration cytology. Human reproduction (Oxford, England). 2008; 23(9):2072–9. Epub 2008/06/27. 21. Glasier AF, Cameron ST, Fine PM, Logan SJ, Casale W, Van Horn J, et al. Ulipristal acetate versus levonorgestrel for emergency contraception: a randomised non-inferiority trial and meta-analysis. Lan- cet (London, England). 2010; 375(9714):555–62. Epub 2010/02/02. 22. Donnez J, Tomaszewski J, Vazquez F, Bouchard P, Lemieszczuk B, Baro F, et al. Ulipristal acetate versus leuprolide acetate for uterine fibroids. The New England journal of medicine. 2012; 366(5):421– 32. Epub 2012/02/03. doi: 10.1056/NEJMoa1103180 PMID: 22296076 23. Donnez J, Vazquez F, Tomaszewski J, Nouri K, Bouchard P, Fauser BC, et al. Long-term treatment of uterine fibroids with ulipristal acetate. Fertil Steril. 2014; 101(6):1565–73 e1-18. Epub 2014/03/19. doi: 10.1016/j.fertnstert.2014.02.008 PMID: 24630081 24. Xu Q, Takekida S, Ohara N, Chen W, Sitruk-Ware R, Johansson ED, et al. Progesterone receptor modulator CDB-2914 down-regulates proliferative cell nuclear antigen and Bcl-2 protein expression and upregulates caspase-3 and poly(adenosine 5'-diphosphate-ribose) polymerase expression in cultured human uterine leiomyoma cells. J Clin Endocrinol Metab. 2005; 90(2):953–61. Epub 2004/12/02. PMID: 15572421 25. Yun BS, Seong SJ, Cha DH, Kim JY, Kim ML, Shim JY, et al. Changes in proliferating and apoptotic markers of leiomyoma following treatment with a selective progesterone receptor modulator or gonado- tropin-releasing hormone agonist. Eur J Obstet Gynecol Reprod Biol. 2015; 191:62–7. Epub 2015/06/ 21. doi: 10.1016/j.ejogrb.2015.05.022 PMID: 26093349 26. Communal L, Vilasco M, Hugon-Rodin J, Courtin A, Mourra N, Lahlou N, et al. Ulipristal acetate does not impact human normal breast tissue. Human reproduction (Oxford, England). 2012; 27(9):2785–98. Epub 2012/06/29. 27. Alvarez LD, Dansey MV, Marti MA, Bertucci PY, Di Chenna PH, Pecci A, et al. Biological activity and ligand binding mode to the progesterone receptor of A-homo analogues of progesterone. Bioorg Med Chem. 2011; 19(5):1683–91. Epub 2011/02/15. doi: 10.1016/j.bmc.2011.01.033 PMID: 21315613 28. Le Billan F, Khan JA, Lamribet K, Viengchareun S, Bouligand J, Fagart J, et al. Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells. FASEB J. 2015.

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 17 / 19 PRA and Breast Cancer

29. Horwitz KB, Sartorius CA. Progestins in hormone replacement therapies reactivate cancer stem cells in women with preexisting breast cancers: a hypothesis. J Clin Endocrinol Metab. 2008; 93(9):3295–8. doi: 10.1210/jc.2008-0938 PMID: 18647813 30. Wargon V, Helguero LA, Bolado J, Rojas P, Novaro V, Molinolo A, et al. Reversal of antiprogestin resistance and progesterone receptor isoform ratio in acquired resistant mammary carcinomas. Breast Can- cer Res Treat. 2009; 116(3):449–60. doi: 10.1007/s10549-008-0150-y PMID: 18677559 31. Bertucci PY, Nacht AS, Allo M, Rocha-Viegas L, Ballare C, Soronellas D, et al. Progesterone receptor induces bcl-x expression through intragenic binding sites favoring RNA polymerase II elongation. Nucleic Acids Res. 2013; 41(12):6072–86. Epub 2013/05/04. doi: 10.1093/nar/gkt327 PMID: 23640331 32. Darbre PD, Daly RJ. Transition of human breast cancer cells from an oestrogen responsive to unre- sponsive state. The Journal of steroid biochemistry and molecular biology. 1990; 37(6):753–63. Epub 1990/12/20. PMID: 2285587 33. Whittle JR, Lewis MT, Lindeman GJ, Visvader JE. Patient-derived xenograft models of breast cancer and their predictive power. Breast Cancer Res. 2015; 17:17. Epub 2015/04/08. doi: 10.1186/s13058- 015-0523-1 PMID: 25849559 34. Comsa S, Cimpean AM, Raica M. The Story of MCF-7 Breast Cancer Cell Line: 40 years of Experience in Research. Anticancer Res. 2015; 35(6):3147–54. Epub 2015/05/31. PMID: 26026074 35. Moore MR, Conover JL, Franks KM. Progestin effects on long-term growth, death, and Bcl-xL in breast cancer cells. Biochem Biophys Res Commun. 2000; 277(3):650–4. Epub 2000/11/04. PMID: 11062008 36. Giulianelli S, Molinolo A, Lanari C. Targeting progesterone receptors in breast cancer. Vitamins and hormones. 2013; 93:161–84. Epub 2013/07/03. doi: 10.1016/B978-0-12-416673-8.00009-5 PMID: 23810006 37. Wargon V, Riggio M, Giulianelli S, Sequeira GR, Rojas P, May M, et al. Progestin and antiprogestin responsiveness in breast cancer is driven by the PRA/PRB ratio via AIB1 or SMRT recruitment to the CCND1 and MYC promoters. Int J Cancer. 2015; 136(11):2680–92. Epub 2014/11/05. doi: 10.1002/ijc. 29304 PMID: 25363551 38. Groshong SD, Owen GI, Grimison B, Schauer IE, Todd MC, Langan TA, et al. Biphasic regulation of breast cancer cell growth by progesterone: role of the cyclin-dependent kinase inhibitors, p21 and p27 (Kip1). Mol Endocrinol. 1997; 11(11):1593–607. PMID: 9328342 39. Cailleau R, Young R, Olive M, Reeves WJ, Jr. Breast tumor cell lines from pleural effusions. J Natl Can- cer Inst. 1974; 53(3):661–74. Epub 1974/09/01. PMID: 4412247 40. Keydar I, Chen L, Karby S, Weiss FR, Delarea J, Radu M, et al. Establishment and characterization of a cell line of human breast carcinoma origin. European journal of cancer (Oxford, England: 1990). 1979; 15(5):659–70. Epub 1979/05/01. 41. Bellance C, Khan JA, Meduri G, Guiochon-Mantel A, Lombes M, Loosfelt H. Progesterone receptor isoforms PRA and PRB differentially contribute to breast cancer cell migration through interaction with focal adhesion kinase complexes. Mol Biol Cell. 2013; 24(9):1363–74. Epub 2013/03/15. doi: 10.1091/ mbc.E12-11-0807 PMID: 23485561 42. Leibowitz B, Yu J. Mitochondrial signaling in cell death via the Bcl-2 family. Cancer Biol Ther. 2010; 9 (6):417–22. Epub 2010/03/02. PMID: 20190564 43. Kirkin V, Joos S, Zornig M. The role of Bcl-2 family members in tumorigenesis. Biochim Biophys Acta. 2004; 1644(2–3):229–49. Epub 2004/03/05. PMID: 14996506 44. Yin P, Roqueiro D, Huang L, Owen JK, Xie A, Navarro A, et al. Genome-wide progesterone receptor binding: cell type-specific and shared mechanisms in T47D breast cancer cells and primary leiomyoma cells. PLoS ONE. 2012; 7(1):e29021. Epub 2012/01/25. doi: 10.1371/journal.pone.0029021 PMID: 22272226 45. Clevers H. Wnt/beta-catenin signaling in development and disease. Cell. 2006; 127(3):469–80. Epub 2006/11/04. PMID: 17081971 46. Faivre EJ, Lange CA. Progesterone receptors upregulate Wnt-1 to induce epidermal growth factor receptor transactivation and c-Src-dependent sustained activation of Erk1/2 mitogen-activated protein kinase in breast cancer cells. Mol Cell Biol. 2007; 27(2):466–80. Epub 2006/11/01. PMID: 17074804 47. Hagan CR, Knutson TP, Lange CA. A Common Docking Domain in Progesterone Receptor-B links DUSP6 and CK2 signaling to proliferative transcriptional programs in breast cancer cells. Nucleic Acids Res. 2013; 41(19):8926–42. Epub 2013/08/08. doi: 10.1093/nar/gkt706 PMID: 23921636 48. Derynck R, Akhurst RJ. Differentiation plasticity regulated by TGF-beta family proteins in development and disease. Nat Cell Biol. 2007; 9(9):1000–4. Epub 2007/09/01. PMID: 17762890 49. Massague J. TGFbeta in Cancer. Cell. 2008; 134(2):215–30. Epub 2008/07/30. doi: 10.1016/j.cell. 2008.07.001 PMID: 18662538

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 18 / 19 PRA and Breast Cancer

50. Lindet C, Revillion F, Lhotellier V, Hornez L, Peyrat JP, Bonneterre J. Relationships between progesterone receptor isoforms and the HER/ErbB receptors and ligands network in 299 primary breast cancers. Int J Biol Markers. 2012; 27(2):e111–7. Epub 2012/04/17. doi: 10.5301/JBM.2012.9198 PMID: 22505232 51. Jackson SE, Chester JD. Personalised cancer medicine. Int J Cancer. 2015; 137(2):262–6. Epub 2014/05/03. doi: 10.1002/ijc.28940 PMID: 24789362 52. Clarke CL, Graham JD. Non-overlapping progesterone receptor cistromes contribute to cell-specific transcriptional outcomes. PLoS ONE. 2012; 7(4):e35859. Epub 2012/05/01. doi: 10.1371/journal.pone. 0035859 PMID: 22545144 53. Ballare C, Castellano G, Gaveglia L, Althammer S, Gonzalez-Vallinas J, Eyras E, et al. Nucleosome- driven transcription factor binding and gene regulation. Mol Cell. 2013; 49(1):67–79. Epub 2012/11/28. doi: 10.1016/j.molcel.2012.10.019 PMID: 23177737 54. Tung L, Abdel-Hafiz H, Shen T, Harvell DM, Nitao LK, Richer JK, et al. Progesterone receptors (PR)-B and -A regulate transcription by different mechanisms: AF-3 exerts regulatory control over coactivator binding to PR-B. Mol Endocrinol. 2006; 20(11):2656–70. PMID: 16762974 55. Attardi BJ, Burgenson J, Hild SA, Reel JR, Blye RP. CDB-4124 and its putative monodemethylated metabolite, CDB-4453, are potent antiprogestins with reduced antiglucocorticoid activity: in vitro comparison to mifepristone and CDB-2914. Mol Cell Endocrinol. 2002; 188(1–2):111–23. PMID: 11911951 56. Chabbert-Buffet N, Meduri G, Bouchard P, Spitz IM. Selective progesterone receptor modulators and progesterone antagonists: mechanisms of action and clinical applications. Hum Reprod Update. 2005; 11(3):293–307. PMID: 15790602 57. Madauss KP, Grygielko ET, Deng SJ, Sulpizio AC, Stanley TB, Wu C, et al. A structural and in vitro characterization of asoprisnil: a selective progesterone receptor modulator. Mol Endocrinol. 2007; 21 (5):1066–81. PMID: 17356170

PLOS ONE | DOI:10.1371/journal.pone.0140795 October 16, 2015 19 / 19

Article 5

Three Novel Heterozygous Point Mutations of NR3C1 Causing Glucocorticoid Resistance

Géraldine Vitellius, Jérôme Fagart, Brigitte Delemer, Larbi Amazit, Nelly Ramos, Jérôme Bouligand, Florian Le Billan, Frédéric Castinetti, Anne Guiochon-Mantel, Séverine Trabado*, Marc Lombès*

* Ces auteurs ont contribué de façon équivalente.

Hum Mutat. 2016 Aug;37(8):794-803

RESEARCH ARTICLE

OFFICIAL JOURNAL Three Novel Heterozygous Point Mutations of NR3C1 Causing Glucocorticoid Resistance

www.hgvs.org Geraldine´ Vitellius,1 Jer´ omeˆ Fagart,1 Brigitte Delemer,2 Larbi Amazit,1,3 Nelly Ramos,1 Jer´ omeˆ Bouligand,1,4 Florian Le Billan,1 Fred´ eric´ Castinetti,5 Anne Guiochon-Mantel,1,4 Severine´ Trabado,1,4 † and Marc Lombes` 1,6∗ † 1INSERM UMR S 1185, Fac Med Paris Sud, Univ. Paris Sud, Universite´ Paris-Saclay, Le Kremlin Bicetreˆ F-94276, France; 2Service d’Endocrinologie, Hopitalˆ Robert Debre,´ CHU Reims, Reims F-51100, France; 3INSERM UMS-32, Institut Biomedical´ de Bicetre,ˆ Univ. Paris Sud, Universite´ Paris-Saclay, Le Kremlin Bicetreˆ F-94275, France; 4ServicedeGen´ etique´ Moleculaire,´ Pharmacogen´ etique´ et Hormonologie, Hopitauxˆ Universitaires Paris Sud, CHU Bicetreˆ F-94275, France; 5Service d’Endocrinologie, Hopitalˆ de la Timone, CHU Marseille, Marseille F-13385, France; 6Service d’Endocrinologie et des Maladies de la Reproduction, Hopitauxˆ Universitaires Paris Sud, CHU Bicetre,ˆ Le Kremlin Bicetreˆ F-94275, France Communicated by Sergio Ottolenghi Received 14 January 2016; accepted revised manuscript 12 April 2016. Published online 27 April 2016 in Wiley Online Library (www.wiley.com/humanmutation). DOI: 10.1002/humu.23008

ABSTRACT: Generalized glucocorticoid resistance is as- Hum Mutat 37:794–803, 2016. C 2016 Wiley Periodicals, Inc. sociated with glucocorticoid receptor (GR; NR3C1)mu- KEY WORDS: NR3C1; glucocorticoid signaling; adrenal tations. Three novel heterozygous missense NR3C1 mu- masses; glucocorticoid resistance tations (R477S, Y478C, and L672P) were identified in patients presenting with adrenal incidentalomas, glucocorticoid excess without Cushing syndrome. Dexametha- sone (DXM) binding studies demonstrated that the affinity of GRR477S and GRY478C mutants, located in the DNA- Introduction binding domain (DBD) of GR, was similar to wild-type Glucocorticoids regulate many essential biological functions in- GR (Kd = 2–3 nM). In contrast, GRL672P mutant, located in the ligand-binding domain (LBD) of GR, was cluding metabolism, inflammatory processes, and stress by interact- unable to bind glucocorticoids and was more sensitive to ing with the ubiquitously expressed glucocorticoid receptor (GR) protein degradation. GR subcellular distribution revealed [Gross and Cidlowski, 2008]. Human GR (hGR), encoded by the a marked decrease in DXM-induced nuclear transloca- NR3C1 gene (MIM# 138040), is a ligand-dependent transcription factor. NR3C1 mutations have been associated with primary gluco- tion of GRR477S and GRY478C mutants, whereas GRL672P remained exclusively cytoplasmic. Chromatin immuno- corticoid resistance (MIM# 615962), characterized by a generalized precipitation demonstrated impaired recruitment of DBD partial insensitivity to glucocorticoid action [Charmandari et al., mutants onto the regulatory sequence of FKBP5. Trans- 2008]. However, up to date, only 17 hGR mutations have been activation assays disclosed the lack of transcriptional ac- described [Bouligand et al., 2010; Nicolaides et al., 2015; Trebble et al., 2010]. Fourteen GR mutations found heterozygous were lo- tivity of GRR477S and GRL672P, whereas GRY478C had a reduced transactivation capacity. Three-dimensional mod- cated in the ligand-binding domain (LBD) of GR, most of them eling indicated that R477S lost two essential hydrogen being familial and discovered in adulthood with variable clinical bonds with DNA, Y478C resulted in altered interac- presentation from severe symptoms to mild or subclinical hypercor- tion with surrounding amino-acids, destabilizing DBD, ticism. Glucocorticoids synthesized by the adrenal cortex are mostly whereas L672P altered the H8 helix folding, leading to un- under the dependence of the hypothalamic–pituitary–adrenal axis structured LBD. This study identifies novel NR3C1 mu- (HPA). The loss-of-function GR mutations results in the loss of tations with their molecular consequences on altered GR the negative feedback loop of cortisol on the hypothalamus and the signaling and suggests that genetic screening of NR3C1 pituitary gland, thereby driving an increase in hypothalamic cor- should be conducted in patients with subclinical hyper- ticotropin releasing hormone (CRH) and pituitary corticotropin corticism. hormone (ACTH). Subsequently, the inappropriate ACTH secretion results in adrenal hyperplasia and increased production of adrenal steroids. Androgen excess can be responsible of hyperan- drogenic signs (hirsutism, acne) [Vottero et al., 2002] or ambigu- ous genitalia at birth [Mendonca et al., 2002]. Arterial hyperten- Additional Supporting Information may be found in the online version of this article. sion may constitute the first sign of primary glucocorticoid resis- †These authors contributed equally to this work. tance syndrome, due to hyperaldosteronism [Charmandari et al., ∗Correspondence to: Marc Lombes,` Inserm U1185, FacultedeM´ edecine´ Paris–Sud, 2007], hypermineralocorticism or apparent mineralocorticoid ex- 63, Rue Gabriel Peri,´ Le Kremlin Bicetreˆ Cedex F-94276, France. E-mail: marc.lombes@ cess [Bouligand et al., 2010]. This syndrome can be revealed in a u-psud.fr context of adrenal hyperplasia, either unilateral [Zhu et al., 2011], Contract grant sponsor: French Ministry of Health (Programme Hospitalier de or bilateral [Bouligand et al., 2010; Nicolaides et al., 2014], al- Recherche Clinique National) (PHRC-2011-N11-01); Institut National de la Santeet´ though the underlying mechanism remains unclear. All patients de la Recherche Medicale´ (Inserm); Universite´ Paris Sud; Agence Regionale´ de Sante´ have hypercortisolism with increased 24 hr urinary free cortisol Champagne Ardennes; French Endocrine Society (SFE)/Novartis Pharma. (UFC) excretion and inappropriate ACTH (normal or elevated but

C 2016 WILEY PERIODICALS, INC. not suppressed concentrations). Dexamethasone (DXM) suppres- man. Abdominal CT performed for abdominal pain revealed bilat- sion test failed to completely suppress plasma cortisol demonstrat- eral adrenal hyperplasia. All of them have primary generalized glu- ing the lack of the glucocorticoid feedback inhibition to suppress cocorticoid resistance. The hGR gene sequencing discovered three ACTH. original heterozygous missense mutations. hGRismainlyexpressedastwomRNAisoforms,hGRα and hGRβ, generated by alternative splicing, the latter lacking ligand binding capacity and exerting dominant negative effect upon hGRα Material and Methods [Bamberger et al., 1995]. It has been reported a third, minor hGRγ isofom originating from tandem splice donor site, leading to a single Sequencing hGR Gene (NR3C1) arginine insertion between the two zing fingers of the DNA-binding domain (DBD) of the GR [Rivers et al., 2009; Thomas-Chollier et al., Genomic DNA was extracted from peripheral lymphocytes 2013]. hGRα is virtually expressed in all cell types, resides predom- and the entire coding exons and exon–intron junctions of the inantly in the cytoplasm, and is sequestered in an heterooligomeric, NR3C1 gene were sequenced by Sanger method, as previously de- multiprotein chaperon complex (hsp90, hsp70, immunophillins) scribed [Bouligand et al., 2010] and compared with NCBI ref- through interaction with the H1 helix of GR LBD [Xu et al., 1998], erences (NG 016367.1 RefSeqGene, NM 000176.2 Transcript and thus preventing its degradation [Cheung and Smith, 2000]. Upon NP 000167.1 Protein). glucocorticoid binding, a critical GR conformational change occurs, notably leading to the repositioning of the H12 helix of the LBD and to the activation of the two nuclear localization sequences Site-Directed Mutagenesis (NL1and NL2), facilitating binding to importins and accelerating PcDNA3hGRα (c.1429C > A, p.R477S), pcDNA3hGRα (c.1433A > ligand-activated GR translocation into the nucleus [Wagstaff and G, p.Y478C), or pcDNA3hGRα (c.2015T>C, p.L672P) were obtained Jans, 2009]. Several studies suggest that GR dissociation from the using the Quick Change Site directed Mutagenesis Kit (Stratagene, chaperon complexes does not precede nuclear translocation [Elbi La Jolly, CA) with pcDNA3hGRα (NM 000176.2) as a template. et al., 2004]. Within the nuclear compartment, GR homo- or hetero- dimerizes and acts as a transcription factor through direct binding to specific DNA sequences, referred to as glucocorticoid response Cell Culture elements (GREs) located in the regulatory sequences of target genes, through two highly conserved zinc finger motifs present in the DBD Embryonic human kidney HEK293T and African green monkey of GR. GR may also modulate gene transcription by tethering to kidney COS-7 cells were grown in DMEM (Life Technologies, Saint- other transcription factors, independently of its direct DNA binding Aubin, France) with 10% fetal calf serum (Biowest, Nuaille,´ France) [Jonat et al., 1990]. The proximal P-box within the first zinc finger is and penicillin/streptomycin (GE Healthcare, Velizy-Villacoublay,´ responsible for specific GREs recognition, whereas the second zinc France), and incubated at 37°C in a humidified atmosphere con- finger is implicated in the dimerization interface of the DBD. hGRα taining 5% CO2. interacts with nuclear receptor coactivators through multiple am- phipathic LXXLL motifs and chromatin-remodeling complexes, facilitates the preinitiation complex assembly of the RNA polymerase Transactivation Assays II, allowing transcription initiation. Most GR mutations impair one HEK293T cells were transfected with wild-type (WT) or mutated or several steps of GR signaling pathway. GR expressing plasmids (0.04 μg/well), reporter luciferase plas- Recently, the first heterozygous nonsense R469X mutation of GR mid pMMTV-luc (0.04 μg/well) and pMIRβ gal encoding the β- was discovered in a family (eight affected individuals, spanning galactosidase used as normalizing vector (0.035 μg/well) using Lipo- three generations) exhibiting subclinical hypercorticism associated fectamine 2000 (Thermo Fisher Scientific, Saint-Aubin, France). Six with bilateral adrenal incidentalomas [Bouligand et al., 2010]. This hours later, the transfection medium was replaced with steroid-free prompted us to set up a National Clinical Research Program (PHRC) DMEM medium. Twenty hours after transfection, ethanol or in- referred to as Muta-GR, which aims at determining the prevalence creasing concentration of DXM (10–10 to 10–6 M) was added into of GR mutations in patients with adrenal incidentalomas without the medium. Luciferase and β-galactosidase activities were mea- Cushing’s syndrome. During the course of this clinical research pro- sured in cell lysates as previously described [Bouligand et al., 2010]. gram in which approximately 100 patients were enrolled, we identified three novel heterozygous missense NR3C1 mutations. We have carried out the in-depth characterization of these GR mutants to in- Western Blot Analysis vestigate the defective molecular events of GR signaling, responsible for the pathophysiological consequences in these patients. Twenty hours after transfection with the corresponding plasmids, HEK293Tcells were lysed and protein extracts submitted to electrophoresis. After electroblotting onto C nitrocellulose mem- Case Reports branes, and incubation with blocking solution, immunoblotting was performed overnight at 4°C, using rabbit polyclonal anti-hGRα All patients gave their written informed consent for clinical, hor- antibody directed against the C-ter part of the protein (PA1-516, monal and genetic analyses with approval from the local ethics com- Thermo Fisher Scientific) at 1 μg/ml or anti-hGRα antibody di- mittee (ComitedeProtectiondesPersonnesIledeFrance,H´ opitalˆ rected against the N-ter part of the protein (C15200010; Diagen- Bicetre,ˆ France). ode, Seraing, Belgium) with the loading control (β-actin; Sigma, Patient #1, 30-year-old woman, was referred to the Endocrinology St Quentin-Falavier, France). Membranes were incubated with sec- Department for obesity. Patient #2, 51-year-old man, was hospital- ondary antibody (Pierce; Dyelight 680 or 800). Bands were visual- ized after a road accident. Abdominal computerized tomography ized and quantified using OdysseyR Fc, Dual-Mode Western Imag- (CT) disclosed a left adrenal mass. Patient #3 was a 60-year-old ing (Li-Cor, Lincoln, NE).

HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 795 DXM Binding and Scatchard Plot Representation of the GR antibody (SC 8992X; Santa Cruz Biotechnology, INC, Heidelberg, Germany), as previously described [Le Billan et al., In vitro translated WT and mutated GR were prepared using 2015]. the reticulocyte lysate method with the TnT-T7 Quick Coupled Transcription/Translation kit (Promega, Charbonnieres-les-Bains,` France). One microgram of the corresponding plasmids was incu- qPCR bated at 30°C for 90 min. Lysates were diluted fourfold in TEGW buffer (20 mM Tris–HCl, 1 mM EDTA, 10% glycerol (v/v), 20 mM Chromatin immunoprecipitation (ChIP)-resulting DNA samples sodium tungstate pH 7.4) and incubated with increasing concen- were amplified by real-time qPCR by using the QuantStudio6 Flex trations of [3H]-DXM (1,517 GBq/mmol; Perkin Elmer) for 4 hr System (Life Technologies). Each cycle was composed of 15 sec ° at 4°C, in the presence or absence of 100-fold molar excess of un- denaturation phase at 95 C, followed by 1 min hybridization and ° labeled DXM. Bound and unbound DXM were separated using amplification phase at 60 C. Each DNA sample was analyzed in the dextran-charcoal method. Specific [3H]-DXM was determined triplicate. All results are expressed as a percentage of input (Percent as the difference between total and nonspecific binding, whereas Input Method, ChIP analysis; Life Technologies) and expressed as means ± SEM of three independent experiments. the dissociation constant Kd was calculated as previously described [Amazit et al., 2015]. 3D Molecular Modeling Immunocytochemistry and Fluorescence Deconvolution Microscopy The R477S, Y478C, and L672P mutations were introduced within the hGR DBD and LBD (Protein data bank identifica- Transfected COS-7 cells were treated or not for 2 hr with 10–7 M tion 3FYL [DBD], and 1M2Z [LBD]) using the Pymol software DXM and processed for immunocytochemistry as previously de- (www.rcsb.org/pdb). For each residue, the orientation of the side scribed [Amazit et al., 2015]. Briefly, cells were fixed, permeabilized chain was adjusted by using the rotamer function. and incubated overnight at 4°C with a rabbit anti-GR antibody (AbC10-G015; Eurobio, Courtaboeuf, France) followed by 30-min incubation with an anti-rabbit Alexa 555-coupled secondary anti- Statistical Analysis body (Thermo Fisher Scientific). After 10 min post-fixation, nu- μ Statistical analyses were performed using the Prism 6 software clear counterstaining was performed with 0.5 g/mL DAPI (4 , (GraphPad software Inc.). Statistical significance was calculated us- 6-diamidino-2-phenylindole) for 1 min. Chambers were mounted ing Mann–Whitney non-parametric U-tests. A value of P < 0.05 was using ProLong Gold mounting medium (Thermo Fisher Scientific). considered significant. Fluorescence deconvolution microscopy was performed using Im- age Pro Plus AMS software (Media Cybernetics Inc., Marlow, UK) on a Mono Q Imaging Retiga 2000R Fast 1394 camera (Q Imaging Results Inc., Surrey, British Columbia, Canada). Images were acquired with an automated upright BX61 microscope (Olympus, Rungis, France) Generalized Glucocorticoid Resistance in Three equipped with a X100 objective (1.4 NA). A z-series of focal planes Independent Patients Associated with Novel Heterozygous was digitally imaged and deconvolved with the three-dimensional GR Mutations (3D) blind iterative algorithm (Image Pro Plus AMS) to generate high-resolution images. All clinical and biological parameters of three affected individuals are summarized in Figure 1A. All patients had no obvious clinical Automated High-Throughput Microscopy sign of Cushing’s syndrome. Patient #1 was obese, whereas patients #2 and #3 were slightly overweight. They had neither hypertension Sequential images were acquired (20×/0.4 NA), analyzed, and nor hypokalemia. Patient #1 had no hirsutism with normal an- quantified by the ArrayScan VTI imaging platform (Thermo Fisher drogen concentrations. They all had a biological hypercortisolism Scientific). DAPI and GR fluorescence were captured using sequen- (1.5 to 2.5-fold increased 24 hr UFC, 8 am cortisol concentra- tial acquisition. The Molecular Translocation V4 Bioapplication al- tion > 50 nmol/l after overnight 1 mg DXM suppression test). 8 am gorithm (vHCS Scan, version 6.3.1, Build 6586) was used to quantify plasma ACTH concentrations remained normal. CT revealed nor- the relative distribution of immunodetected GR essentially as de- mal adrenal gland for the patient #1, a left adrenal incidentaloma scribed in Amazit, et al. [2015] and Williams, et al. [2006]. The for patient #2, and a bilateral adrenal hyperplasia for patient #3. translocation index measurement represents the average value ratio Patient #1 harbored a novel heterozygous missense mutation of the nuclear intensity to the cytoplasmic intensity calculated for (c.1429C>A) that resulted in arginine (R) to serine (S) substitution each selected cell per well. at amino-acid position 477(p.R477S). Her mother, presenting with an obese phenotype, android fat distribution and facial erythrosis, Chromatin Immunoprecipitation carried the same heterozygous mutation. NR3C1 sequencing of patient #2 revealed a heterozygous missense GR mutation (c.1433A Tranfected H293T cells were incubated with 10–7 MDXMor > G) in the fourth exon of NR3C1 gene, substituting a tyrosine (Y) vehicle (ethanol) for 1 and 2 hr at 37°C.Cellswerefixedwith1% by a cysteine (C) at amino acid 478 (p.Y478C). His daughter har- paraformaldehyde (ElectronMicroscopy Sciences, Saint-Germain- bored the same mutation. As shown in Figure 1B, these two original en-Laye, France) for 10 min at room temperature. Paraformaldehyde mutations are located in the DBD, at the C-terminal end of the fixation was quenched with 0.125 M glycine for 8 min. Cells were second zinc finger. Patient #3 had a heterozygous non-synonymous washed once with ice-cold PBS. Cell lysis and chromatin shearing mutation in the seventh exon of NR3C1, introducing a change from were performed with the HighCell# ChIP kit (Diagenode) buffers thymidine to cytosine (c.2015T > C) which resulted in leucine (L) according to the manufacturer’s recommendations and using 7 μg to proline (P) substitution at amino-acid position 672, located in

796 HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 Figure 1. Clinical characteristics and hormonal parameters of the three affected patients. Identification and localization of novel heterozygous NR3C1 mutations. A: Clinical and biochemical parameters of the three affected patients. N means that values are in the normal range; NA, data non-available; DOC, 11-deoxycorticosterone; DHEAS, dehydroepiandrosterone sulfate. B: Localization of R477S, Y478C, L672P mutations on GR protein (left panel). R477 and Y478 residues are located in the DBD, just after the second zinc finger in the DNA-binding domain (right panel). L672 residue is located in the ligand-binding domain of hGRα. the LBD (p.L672P). These three novel NR3C1 variants have been cleavage by encoding caspase 1 responsible for glucocorticoid resis- submitted to the LOVD database (http://www.lovd.nl/NR3C1). tance in leukemia cells [Paugh et al., 2015]. Similarly, this 70 kDa band was not observed when GRL672P mutantwasexpressedinthe reticulocyte lysate (Fig. 2C, lower panels). DXM binding assays on The Functional Properties of GR Mutants GR expressed in the reticulocyte lysate revealed no difference in the maximum specific binding between GRWT (451 pM) and GRR477S Western blot analyses demonstrated that all mutated GR proteins (318 pM), or GRY478C (308 pM) (Fig. 2D). At the opposite, GRL672P were fully expressed in HEK293T cells after transient transfection was unable to bind DXM. Scatchard representation of DXM bind- of corresponding plasmids (Fig. 2A), using an antibody targeting ing shown in Figure 2E revealed that the affinity of GRWT,GRR477S, α C-terminal part of hGR .EndogenousGRproteinlevelwashardly and GRY478C for DXM were in the same range with a dissociation detected in untransfected HEK293T cells. After transfection, pro- constant Kd calculated at 1.9, 4.6, and 2.3 nM, respectively. tein levels of overexpressed GRWT, GRR477S,andGRY478C mutants were very similar (Fig. 2B). In contrast, the 100 kDa band of GRL672P mutant was weak compared with controls while a second Subcellular Localization of GR Mutants 70 kDa band was detected. This band was not found with an antibody directed against N-terminal part of GR (Fig. 2C), suggesting Nuclear translocation is one of the critical steps that convert a N-terminal truncated form of hGRα as recently proposed for GR GR into its transcriptionally active state. We thus investigated

HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 797 Figure 2. Protein expression and DXM Binding of mutated GR. A: H293T cells were transiently transfected with 0.4 μg plasmid encoding GRWT, GRR477S,GRY478C, and GRL672P. Transfected cells were lysed, and protein extracts analyzed by SDS-PAGE. hGR proteins were detected by Western blot analyses using a rabbit polyclonal antibody targeting hGRα C-terminal part. β-Actin was used as a loading control. Representative images of R five independent experiments are shown. B: Quantification of GRWT and GRL672P protein levels. Specific bands were quantified by Odyssey Fc, Dual-Mode Western Imaging. Results normalized to β-actin loading controls are mean ± SEM of three independent experiments. C: Comparison of GRWT and GRL672P protein detection with either a N-ter Anti-GR antibody (left panel) or a C-ter anti-GR antibody (right panel). Beside the 100 kDa ∗∗∗ band of GRL672, note the presence of a 70 kDa band. A non-parametric Mann–Whitney U test was used to compare GR protein level. P < 0.001 versus GRWT. D: DXM binding at saturation. One microgram of plasmids encoding GRWT,GRR477S, and GRY478C mutants were incubated for 90 min in the reticulocyte lysate. Lysates were diluted fourfold in TEGW buffer (20 mM Tris–HCl, 1 mM EDTA, 20 mM sodium tungstate, and 10% glycerol (v/v), pH 7.4) and incubated with 10−7 M 3H-DXM in the absence or presence of a 100-fold excess of unlabeled DXM. Specific binding was calculated as the difference between total binding and nonspecific binding. Data are means ± SD of three independent determinations and are expressed in pM. DXM binding was not different for GRWT,GRR477S,GRY478C, while GRL672P was not able to bind DXM (P < 0.001). E: Scatchard analysis of DXM binding in GRWT,GRR477S, and GRY478C expressed lysates. DXM binding was expressed as a function of total DXM concentrations and the corresponding dissociation constant value (Kd) calculated. The apparent Kd of GRWT,GRR477S, and GRY478C for DXM was not statistically different.

the subcellular localization of GR mutants using immunofluo- DNA Binding and Transcriptional Activity of GR Mutants rescence and high-throughput microscopy quantification. As expected, unliganded GRWT and all mutants were mainly local- We next evaluated the ability of GR mutants to interact with ized in the cytoplasmic compartment while, upon 2 hr expo- DNA by ChIP experiments. As illustrated in Figure 4A, 1 hr DXM –7 sure to 10 M DXM, GRWT was entirely located into the nucleus exposure leads a ninefold increase in the recruitment of GRWT (Fig. 3A) with a nucleo-cytoplasmic index (see Materials and Meth- onto the regulatory genomic sequence of FKBP5,awell-known ods section) measured at 3(Fig.3B).Incontrast,GRR477S and glucocorticoid target gene [U et al., 2004]. Interestingly, GRWT GRY478C mutants were incompletely translocated into the nucleus recruitment was only enhanced by a threefold factor after 2 hr with a lower nucleo-cytoplasmic ratio of 2.67 and 2.40, respec- DXM exposure, consistent with the dynamic and cyclic assembly –5 tively (P < 10 ) (Fig. 3B). Finally, GRL672P mutant remains exclu- of nuclear receptors within the preinitiation complexes, already de- sively cytoplasmic upon DXM exposure (Fig. 3A), consistent with scribed [Metivier et al., 2003]. In sharp contrast, GRR477S mutant was its inability to bind ligand. Collectively, these results indicate that unable to bind DNA whatever the experimental conditions used. R477S and Y478C mutations impair the ligand-induced GR nuclear Likewise, no significant GRY478C mutant enrichment was observed translocation. after 1 hr DXM treatment, whereas it became slightly (1.6-fold)

798 HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 Figure 3. Impaired nuclear translocation of GR mutants. COS-7 cells were transfected with the indicated expression vector and incubated or not for 2 hr with 10−7 M DXM. Cells were fixed and processed for immunochemistry as described in the Materials and Methods section. A: Representative images of the subcellular localization of GRWT,GRR477S,GRY478C, and GRL672P in the absence or presence of DXM. A z-series of focal planes was digitally imaged and deconvolved using Image Pro Plus AMS iterative algorithm to generate high-resolution images. DAPI staining delineates the nuclei (blue). B: Automated high-throughput microscopy quantification of the molecular translocation of GRWT,GRR477S, and GRY478C mutants. Cells were treated as described in (A) and fluorescence acquisition was performed with the ArrayScan VTI fluorescent microscope (see the Materials and Methods section). The translocation index (nucleo-cytoplasmic ratio) represents the average ratio of the nuclear fluorescence intensity to the cytoplasmic fluorescence intensity calculated for each transfected cell (n > 1000). A non-parametric Mann–Whitney U test was ∗∗∗ used to compare GR subcellular distribution. P < 0.001 versus GRWT. significant (P < 0.05) after 2 hr DXM stimulation, in agreement with Waals contacts and a hydrogen bond with the surrounding residues the reduced ligand-dependent nuclear translocation of the GRY478C, of the DBD (Phe445, Ala448, Val449, Leu482, and His453) creating demonstrated above (see Fig. 3B). Finally, we demonstrated that a stabilizing network of contacts (Fig. 5A and D). Replacement of a GRWT transactivated mouse mammary tumor virus (MMTV)-Luc Tyr478 by a Cys led to a loss of contacts, which consequently desta- reporter gene, in a dose-dependent manner (10–10 to 10–6 M DXM), bilized the 3D structure of the DBD (Fig. 5E). Leu672 is located in the maximum transactivation activity being achieved with 10–8 M the H8 helix of the LBD of GR, into the hydrophobic core of the DXM and an half maximal effective concentration (EC50) value ligand-binding pocket (Fig. 5F and G). Leu672 established two sta- –10 calculated at 5.46 × 10 M (Fig. 4B). As anticipated, GRR477S mu- bilizing hydrogen bonds with the H8 helix, which were lost with the tant that lacks DNA binding capacity, and GRL672P mutant unable Pro substitution (Fig. 5H), thus conferring major conformational to bind DXM, had no transactivation property. Consistent with the changes of the upper part of the LBD and an overall unstructured previous ChIP experiments, GRY478C mutant displayed a significant ligand-binding pocket. decreased ability to transactivate MMTV-Luc with an EC50 being –9 –10 20-fold higher than GRWT EC50 (9.95 × 10 M vs. 5.46 × 10 M, P = 0.0025). None of the three mutants exerted dominant negative Discussion effect on GRWT activity (Supp. Fig. S1). We have identified three novel missense heterozygous NR3C1 mutations and characterized in details the functional consequences α 3D Molecular Modeling on hGR signaling (summarized in Table 1). Clinical and biological presentations of the mutated patients bring Arg477 and Tyr478 are located after the second zinc finger of the new information on how heterozygous NR3C1 mutations associated DBD (Fig. 5A). As shown in Fig. 5B, Arg477 established two essen- with decreased GR signal transduction may affect normal physiol- tial hydrogen bonds with DNA, which are totally lost with the Arg ogy. Among 20 hGRα mutations described to date including ours, to Ser substitution (Fig. 5C). The Tyr478 forms numerous van der five had been discovered in a context of adrenal hyperplasia. Patients

HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 799 Figure 4. DNA Binding and transactivation assays of GR mutants. A: HEK293T cells were transiently transfected with GRWT,GRR477S, and GRY478C encoding plasmids and treated for 1 or 2 hr with DXM (10−7 M) or vehicle (ethanol). Cells were fixed, lysed, and chromatin immunoprecipitation was performed using an anti-GR antibody (see the Materials and Methods section). After elution, DNA was quantified by quantitative real time PCR, using primers for the genomic fragment encompassing GRE in the promoter region of the FKBP5 GR target gene. Data expressed as fold induction compared with vehicle, arbitrarily set at 1, are means ± SEM of four independent experiments. Statistical significance was calculated with the Mann–Whitney non-parametric U tests. B: HEK 293T cells were co-transfected with plasmids encoding GRWT,GRR477S,GRY478C, and −10 −6 GRL672P, a reporter luciferase plasmid pMMTV-luc and pMIRβ gal. Cells were treated 24 hr with increasing concentration of DXM (10 to 10 M). −7 Transactivation activity is expressed relatively to the maximum transactivational activity obtained for GRWT with 10 M DXM, arbitrarily set a` 100%. Data are means ± SEM of at least six independent experiments performed in sextuplet. Statistical significance was calculated with the Mann–Whitney non-parametric U tests. ∗∗∗P < 0.001, ∗P < 0.05.

Table 1. Functional Characteristics of the Three Novel NR3C1 Mutations

Protein Cytoplasm-to- Dominant NR3C1 mutations expres- nuclear DNA negative 3D molecular transcript, protein Clinical signs sion DXM Binding translocation Binding effect Transactivation modeling c.1429C>A p.R477S Obesity Normal Normal Decreased No No No Loss of contacts with DNA c.1433A>G p.Y478C Left adrenal Normal Normal Decreased Weak and No Decreased Destabilization mass delayed of the 3D DBD structure c.2015T>C p.L672P Bilateral Decreased No No No No No Unstructured H8 adrenal helix hyperplasia

According to the NR3C1 accession number: Transcript NM_000176.2, Protein NP_000167.1. with Y478C and L672P mutations presented with adrenal inciden- an altered ACTH-GR relationship that requires further studies to talomas. We wonder whether and how GR signaling defect could af- explore the pathophysiologic role of GR mutations in adrenocortical fect adrenocortical cell proliferation or sensitivity to ACTH. Several function. On the other hand, the high body mass index (BMI) of lines of evidence suggest the involvement of HPA dysregulation in the patients strongly suggest that hypercorticism, in spite of GR the pathogenesis of adrenal hyperplasia. Heterozygous GR+/– knock- signaling defect, could impair adipocyte physiology and metabolic out mice displayed adrenal gland hyperplasia and increased HPA homeostasis. This obviously requires additional investigation. sensitivity [Michailidou et al., 2008], in accordance with the posi- Although GRR477S mutant had similar afﬁnity for DXM than tive regulatory loop exerted by GR on human adrenocortical H295R GRWT, this mutant exhibited a decrease in DXM-induced nuclear cell function [Asser et al., 2014]. Moreover, ectopic expression of translocation and was unable to bind the regulatory sequence of the pro-opio-melanocortin (POMC) gene by steroidogenic cells was FKBP5, in accordance with 3D molecular modeling and the loss of shown to be responsible for intra-adrenal ACTH overexpression stabilizing hydrogen bonds between the Ser477 and DNA. Finally, and subsequently adrenal hyperplasia [Lefebvre et al., 2003]. ACTH as expected, this GRR477S mutant had no transcriptional activity. A concentrations in the macronodular adrenal hyperplastic tumors previous study showed that an Arg to His substitution at residue were 1,000-fold higher than in plasma. Accordingly, it suggested 477 impaired hGR functionality, owing to the lack of DNA binding that in patients with bilateral macronodular adrenal hyperplasia, [Charmandari et al., 2006]. Mutant R477H was not able to trans- cortisol production were controlled by both aberrant membrane activate MMTV-GRE reporter gene, in accordance with the results receptors and corticotropin, produced within the adrenocortical obtained for GRR477S. Moreover, another mutant R493C in mouse tissue [Louiset et al., 2013]. Patients with bilateral incidentalomas GR [Banuelos et al., 2015], which corresponds to a R477C mutation had higher ACTH and cortisol responses to the combined DXM- in hGR, had no transcriptional activity, whereas an Arg to Lys re- CRH test compared with both controls and patients with unilat- placement at position 493 did not affect GR function. Lysine lateral eral adrenal incidentaloma [Vassiliadi et al., 2015]. Altogether, our chain, holder of a positive electric charge, can restore DBD–DNA present ﬁndings and previous reports provide additional support for interaction, and therefore the transactivation ability. Taken together,

800 HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 Figure 5. Three-dimensional models of the hGR LBD and DBD harboring the R477S, Y478C, and L672P point mutations. A: Overall view of a dimer of hGR DBD bound to an oligonucleotide (Protein data bank identification 3FYL). From the N to the C-terminus of the domain, the secondary structure elements are represented as ribbons with a blue-green-red color gradient. Are only showed residues involved in DNA recognition, in the zinc fingers and those for which a mutation was identified in this study. Close up views are provided showing the R477S (B and C) and Y478C (D and E) substitutions together with the surrounding residues. Red, light purple, and black dashed lines indicate hydrogen bonds, zinc coordination, and van der Waals contacts, respectively. F: Overall view of the hGR LBD (Protein data bank identification 1M2Z). Only Leu 692 is showed. Close up views showing the L692P (G and H) substitutions. Red and blue dashed lines indicate hydrogen bonds and unfavorable contacts, respectively. The figures were generated using the Pymol software. these findings clearly demonstrate the major role of Arg477 for GR et al. [2001] have shown that Phe444 and 445 were two essential functionality. amino acids for the nuclear-to-cytoplasm GR export. 3D molecular Of interest, the two DBD GRR477S and GRY478C mutants exhibited modeling of GRY478C, demonstrated a loss in Van der Waals bond a decrease in nuclear translocation compared with GRWT.AllDBD between Tyr478 and Phe445. Overexposed NES in this mutant could mutants described to date exhibited defect in nuclear translocation. thus lead to an unbalanced DXM-induced GR trafficking towards The truncated GRR469X [Bouligand et al., 2010], lacking the LBD, the cytoplasm compartment localization. The two original DBD remains in the cytoplasm compartment, while GRR477H (Ruiz et al., mutations underlined the absolute requirement of intact DBD for 2001) had 2.1-fold delay in nuclear translocation. The R477S and ligand-induced cyto-nuclear translocation. Y478C mutations were located in the nuclear localization sequence On the other hand, GRL672P mutant lost its ability to bind gluco- 1 (NL1) in hGRα structure, as defined by Picard and Yamamoto corticoids, owing to the loss of stabilizing hydrogen bonds between [1987] and Savory, et al. [1999). Thus, NL1 integrity seems to be Leu672 and H8 helix of the LBD. Leu to Pro substitution at residue absolutely required for appropriate cytoplasm-to-nuclear transloca- 672 profoundly alters the folding of H8 helix, leading to an unstruc- tion. Indeed, Savory et al. [1999] reported in a rat GR lacking NL1 tured LBD. Although Leu672 does not contribute directly to the (rGRNL1-), that mutated receptor remained into the cytoplasm non-covalent interaction with the ligand, the loss of DXM binding compartment after DXM treatment. R477S and Y478C mutations in this mutant GR is the consequence of the overall destabilization could modify NL1 structure and/or activity and thus reduce DXM- of the LBD. Such destabilizing effects have already been described induced nuclear translocation. for the mineralocorticoid receptor (MR; NR3C2). The destruction An alternative hypothesis is the overexposure of the nuclear export of the beta sheet between the strand s3 at the C-ter of H8 and the signal (NES) that may be induced by DBD destabilization. Black strand s4 at the C-ter of the domain (the beta strands 3 and 4 of the

HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 801 LBD) by the substitution of a proline for a leucine in the strand s4 is France); Pr. T. Brue (AP-HM, CHU La Timone, Marseille, France); Pr. P. responsible for a complete loss of function of the receptor resulting Caron(CHULarrey,Toulouse,France);Pr.O.Chabre(CHUGrenoble, in a syndrome of pseudohypoaldosteronism [Sartorato et al., 2004]. France); Pr. R. Dessailloud (CHU Amiens, Franc); Pr B. Estour (CHU Saint- Moreover, L672P protein expression in HEK293T transfected cells Etienne, France); Dr. F.Illouz (CHU Angers, France); Pr. N. Jeandidier (CHU Strasbourg, France); Pr. V. Kerlan (CHU Brest, France); Pr. M. Klein (CHU was much lower than that of GRWT and other mutated GR, prob- Nancy,France);Pr.P.Lecomte(CHUTours,France);Pr.H.Lefebvre(CHU ably due to a higher degradation propensity. The 70 kDa band α Rouen, France); Pr A. Penfornis (CHU Besançon, France); Pr. I. Tauveron observed for GRL672P mutant did not correspond to any hGR A, (CHU ST Etienne, France); Pr. P. Touraine (AP-HP, CHU Pitie-Salpetri´ ere,` B, C, D isoforms, previously reported by Cidlowski’s group [Duma ParisFrance);Pr.J.Young(CHUBicetre,ˆ Le Kremlin Bicetre,ˆ France); Pr. et al., 2006] but is likely related to degradation product that remains C. Hoeffel (CHU Robert Debre,´ Reims, France); Pr. A. Tabarin (CHU Bor- to be further identified. Our experiments suggested the essential deaux, Pessac, France); Dr. F. Amiot (CH Troyes, France); and Dr. D. Ancelle role of the H8 helix for DXM binding. Deng et al. [2015], had intro- (CH St Lo,ˆ France). The authors are also indebted to Edith Kassa (URC, Ho- duced several mutations on the leucine repeated amino-acids 687 pital Robert Debre´ Reims, France) for her help in coordinating this clinical to 690, in the rat GR, corresponding to L672P mutation in hGRα investigation program. H8 helix. Mutant L687-690A lost its transcriptional activity by impaired ligand binding and had a decreased association to heat shock Disclosure statement: The authors declare no conflict of interest. protein 90 (Hsp90). Moreover, Xu et al. [1998] demonstrated that the loss of Hsp binding were responsible for a decreased steroid binding activity. In hGRWT, Hsp interacts with amino acids located in LBD H1 helix, spatially very close from H8 helix. Disrupted LBD References folding by Leu to Pro substitution in H8 helix could account for Amazit L, Le Billan F, Kolkhof P, Lamribet K, Viengchareun S, Fay MR, Khan JA, Hillisch altered DXM binding and the lack of Hsp interaction, responsible A, Lombes M, Rafestin-Oblin ME, Fagart J. 2015. Finerenone impedes aldosterone- for higher degradation propensity of GRL672P. This remains to be dependent nuclear import of the mineralocorticoid receptor and prevents genomic experimentally validated. recruitment of steroid receptor coactivator-1. J Biol Chem 290(36):21876–21889. In conclusion, we showed the essential role of the Arg477 in the Asser L, Hescot S, Viengchareun S, Delemer B, Trabado S, Lombes M. 2014. Autocrine GR functionality for DNA binding, the central role of the H8 helix in positive regulatory feedback of glucocorticoid secretion: glucocorticoid receptor directly impacts H295R human adrenocortical cell function. Mol Cell Endocrinol the DXM binding and the necessary integrity of DBD in cytoplasm- 395(1–2):1–9. to-nuclear translocation. We identified three original GR mutations Bamberger CM, Bamberger AM, de Castro M, Chrousos GP. 1995. Glucocorticoid rein the context of glucocorticoid resistance and believe that the preva- ceptor beta, a potential endogenous inhibitor of glucocorticoid action in humans. lence of GR mutations is probably much more frequent than initially J Clin Invest 95(6):2435–2441. Banuelos J, Shin SC, Lu NZ. 2015. A hotspot in the glucocorticoid receptor DNA- thought among patients with subclinical hypercorticism. binding domain susceptible to loss of function mutation. Steroids 96:115–120. Black BE, Holaska JM, Rastinejad F, Paschal BM. 2001. DNA binding domains in diverse Abbreviations nuclear receptors function as nuclear export signals. Curr Biol 11(22):1749–1758. Bouligand J, Delemer B, Hecart AC, Meduri G, Viengchareun S, Amazit L, Trabado S, 3D, three-dimensional; ACTH, corticotropin hormone; BMI, Feve B, Guiochon-Mantel A, Young J, Lombes` M, et al. 2010. Familial glucocor- body mass index; ChIP, chromatin immunoprecipitation; COS- ticoid receptor haploinsufficiency by non-sense mediated mRNA decay, adrenal 7, embryonic African green monkey kidney cells; CRH, cor- hyperplasia and apparent mineralocorticoid excess. PLoS One 5(10):e13563. ticotropin releasing hormone; CT, computarized tomography; Charmandari E, Kino T, Ichijo T, Chrousos GP. 2008. Generalized glucocorticoid DAPI, 4’,6’-diamidino-2-phenylindole; DBD, DNA-binding do- resistance: clinical aspects, molecular mechanisms, and implications of a rare genetic disorder. J Clin Endocrinol Metab 93(5):1563–1572. main; DXM, dexamethasone; EC50, half maximal effective con- Charmandari E, Kino T, Ichijo T, Jubiz W, Mejia L, Zachman K, Chrousos GP. 2007. centration; GR, glucocorticoid receptor; GRE, glucocorticoid re- A novel point mutation in helix 11 of the ligand-binding domain of the human sponse element; HEK, embryonic human kidney; hGR, human GR; glucocorticoid receptor gene causing generalized glucocorticoid resistance. J Clin HPA, hypothalamic—pituitary–adrenal axis; Hsp, heat shock pro- Endocrinol Metab 92(10):3986–3990. Charmandari E, Kino T, Ichijo T, Zachman K, Alatsatianos A, Chrousos GP. 2006. tein; LBD, ligand-binding domain; MMTV, mouse mammary tu- Functional characterization of the natural human glucocorticoid receptor (hGR) mor virus; MER, mineralocorticoid receptor; NES, nuclear export mutants hGRalphaR477H and hGRalphaG679S associated with generalized glu- signal; NL, nuclear localization sequence; PHRC, National Clinical cocorticoid resistance. J Clin Endocrinol Metab 91(4):1535–1543. Research Program; UFC, urinary free cortisol; WT, wild-type Cheung J, Smith DF. 2000. Molecular chaperone interactions with steroid receptors: an update. Mol Endocrinol 14(7):939–946. Deng Q, Waxse B, Riquelme D, Zhang J, Aguilera G. 2015. Helix 8 of the ligand binding Author Contributions domain of the glucocorticoid receptor (GR) is essential for ligand binding. Mol Cell Endocrinol 408:23–32. B.D., S.T., and M.L. contributed to the study concept and de- Duma D, Jewell CM, Cidlowski JA. 2006. Multiple glucocorticoid receptor isoforms sign; B.D. and F.C. referred the patients; G.V., J.F., F.LB., L.A., N.R., and mechanisms of post-translational modification. J Steroid Biochem Mol Biol B.D., F.C., J.B., A.G.M., S.T., and M.L. performed the analysis and 102(1–5):11–21. Elbi C, Walker DA, Romero G, Sullivan WP, Toft DO, Hager GL, DeFranco DB. 2004. contributed to the interpretation of data; G.V., S.T., and M.L. con- Molecular chaperones function as steroid receptor nuclear mobility factors. Proc tributed to the drafting of the manuscript and shared responsibility Natl Acad Sci USA 101(9):2876–2881. for the decision to submit for publication. All the authors revised Gross KL, Cidlowski JA. 2008. Tissue-specific glucocorticoid action: a family affair. the manuscript critically for important intellectual content, and also Trends Endocrinol Metab 19(9):331–339. read and approved the final version submitted for publication. S.T. Jonat C, Rahmsdorf HJ, Park KK, Cato AC, Gebel S, Ponta H, Herrlich P. 1990. An- titumor promotion and antiinflammation: down-modulation of AP-1 (Fos/Jun) and M.L. were responsible for study supervision. activity by glucocorticoid hormone. Cell 62(6):1189–1204. Le Billan F, Khan JA, Lamribet K, Viengchareun S, Bouligand J, Fagart J, Lombes M. 2015. Cistrome of the aldosterone-activated mineralocorticoid receptor in human Acknowledgments renal cells. FASEB J 29(9):3977–3989. Lefebvre H, Duparc C, Chartrel N, Jegou S, Pellerin A, Laquerriere A, Ivell R, Vaudry H, The authors would like to thank the associate investigators of the PHRC Kuhn JM. 2003. Intraadrenal adrenocorticotropin production in a case of bilateral MUTA-GR program, notably Pr. F. Borson-Chazot (HCL, Lyon, France); macronodular adrenal hyperplasia causing Cushing’s syndrome. J Clin Endocrinol Pr.P.BouchardandPr.S.Christin-Maitre(APHP,CHUStAntoine,Paris, Metab 88(7):3035–3042.

802 HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 Louiset E, Duparc C, Young J, Renouf S, Tetsi Nomigni M, Boutelet I, Libe R, Sartorato P, Cluzeaud F, Fagart J, Viengchareun S, Lombes M, Zennaro MC. 2004. Bram Z, Groussin L, Caron P, Tabarin A, Grunenberger F, et al. 2013. Intraa- New naturally occurring missense mutations of the human mineralocorticoid drenal corticotropin in bilateral macronodular adrenal hyperplasia. N Engl J Med receptor disclose important residues involved in dynamic interactions with de- 369(22):2115–2125. oxyribonucleic acid, intracellular trafficking, and ligand binding. Mol Endocrinol Mendonca BB, Leite MV, de Castro M, Kino T, Elias LL, Bachega TA, Arnhold IJ, 18(9):2151–2165. Chrousos GP, Latronico AC. 2002. Female pseudohermaphroditism caused by a Savory JG, Hsu B, Laquian IR, Giffin W, Reich T, Hache RJ, Lefebvre YA. 1999. Discrimi- novel homozygous missense mutation of the GR gene. J Clin Endocrinol Metab nation between NL1- and NL2-mediated nuclear localization of the glucocorticoid 87(4):1805–1809. receptor. Mol Cell Biol 19(2):1025–1037. Metivier R, Penot G, Hubner¨ MR, Reid G, Brand H, Kos M, Gannon F. 2003. Es- Thomas-Chollier M, Watson LC, Cooper SB, Pufall MA, Liu JS, Borzym K, Vingrom M, trogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of Yamamoto KR, Meijsing SH. 2013. A naturally occring insertion of a single amino cofactors on a natural target promoter. Cell 115(6):751–763. acid rewires transcriptional regulation by glucocorticoid receptor isoforms. Proc Michailidou Z, Carter RN, Marshall E, Sutherland HG, Brownstein DG, Owen E, Natl Acad Sci USA 110(44):17826–17831. Cockett K, Kelly V, Ramage L, Al-Dujaili EA, et al. 2008. Glucocorticoid receptor Trebble P, Matthews L, Blaikley J, Wayte AW, Black GC, Wilton A, Ray DW. 2010. haploinsufficiency causes hypertension and attenuates hypothalamic-pituitary- Familial glucocorticoid resistance caused by a novel frameshift glucocorticoid adrenal axis and blood pressure adaptions to high-fat diet. FASEB J 22(11):3896– receptor mutation. J Clin Endocrinol Metab 95(12):E490–E499. 3907. U M, Shen L, Oshida T, Miyauchi J, Yamada M, Miyashita T. 2004. Identification of novel Nicolaides NC, Geer EB, Vlachakis D, Roberts ML, Psarra AM, Moutsatsou P, Sertedaki direct transcriptional targets of glucocorticoid receptor. Leukemia 18(11):1850– A, Kossida S, Charmandari E. 2015. A novel mutation of the hGR gene causing 1856. Chrousos syndrome. Eur J Clin Invest 45(8):782–791. VassiliadiDA, Tzanela M, Tsatlidis V, Margelou E, TampourlouM, Mazarakis N, Piaditis Nicolaides NC, Roberts ML, Kino T, Braatvedt G, Hurt DE, Katsantoni E, Sertedaki G, Tsagarakis S. 2015. Abnormal Responsiveness to Dexamethasone-Suppressed A, Chrousos GP, Charmandari E. 2014. A novel point mutation of the human CRH Test in Patients With Bilateral Adrenal Incidentalomas. J Clin Endocrinol glucocorticoid receptor gene causes primary generalized glucocorticoid resistance Metab 100(9):3478–3485. through impaired interaction with the LXXLL motif of the p160 coactivators: Vottero A, Kino T, Combe H, Lecomte P, Chrousos GP. 2002. A novel, C-terminal dissociation of the transactivating and transreppressive activities. J Clin Endocrinol dominant negative mutation of the GR causes familial glucocorticoid resistance Metab 99(5):E902–E907. through abnormal interactions with p160 steroid receptor coactivators. J Clin Paugh SW, Bonten EJ, Savic D, Ramsey LB, Thierfelder WE, Gurung P, Malireddi Endocrinol Metab 87(6):2658–2667. RK, Actis M, Mayasundari A, Min J, Coss DR, Laudermilk LT, et al. 2015. Wagstaff KM, Jans DA. 2009. Importins and beyond: non-conventional nuclear trans- NALP3 inflammasome upregulation and CASP1 cleavage of the glucocorticoid port mechanisms. Traffic 10(9):1188–1198. receptor cause glucocorticoid resistance in leukemia cells. Nat Genet 47(6):607– Williams RG, Kandasamy R, Nickischer D, Trask OJ Jr., Laethem C, Johnston PA. 2006. 614. Generation and characterization of a stable MK2-EGFP cell line and subsequent Picard D, Yamamoto KR. 1987. Two signals mediate hormone-dependent nuclear lo- development of a high-content imaging assay on the Cellomics ArrayScan platform calization of the glucocorticoid receptor. EMBO J 6(11):3333–3340. to screen for p38 mitogen-activated protein kinase inhibitors. Methods Enzymol Rivers C, Flynn A, Qian X, Matthews L, Lightman S, Ray D, Norman M. 2009. Char- 414:364–389. acterization of conserved tandem donor sites and intronic motifs required for Xu M, Dittmar KD, Giannoukos G, Pratt WB, Simons SS Jr. 1998. Binding of hsp90 to alternative splicing in corticosteroid receptor genes. Endocrinology 150(11):4958– the glucocorticoid receptor requires a specific 7-amino acid sequence at the amino 4967. terminus of the hormone-binding domain. J Biol Chem 273(22):13918–13924. Ruiz M, Lind U, Gafvels˚ M, Eggertsen G, Carlstedt-Duke J, Nilsson L, Holtmann M, Zhu HJ, Dai YF, Wang O, Li M, Lu L, Zhao WG, Xing XP, Pan H, Li NS, Gong FY. Stierna P, Wikstrom¨ AC, Werner S. 2001. Characterization of two novel mutations 2011. Generalized glucocorticoid resistance accompanied with an adrenocortical in the glucocorticoid receptor gene in patients with primary cortisol resistance. adenoma and caused by a novel point mutation of human glucocorticoid receptor Clin Endo (Oxf) 55(3):636–671. gene. Chin Med J (Engl) 124(4):551–555.

HUMAN MUTATION, Vol. 37, No. 8, 794–803, 2016 803

Titre : Identification et Régulation Transcriptionnelle des Gènes Cibles du Récepteur Minéralocorticoïde dans les Cellules Rénales Mots clés : Récepteur Minéralocorticoïde, Aldostérone, Immunoprécipitation de la Chromatine, Cistrome, Glucocorticoïdes, Dynamique transcriptionnelle

Résumé : Le récepteur minéralocorticoïde (MR), cibles génomiques, dont le gène PER1. Sur ce activé par l’aldostérone, exerce de nombreuses dernier, les deux récepteurs se distinguent par fonctions pléïotropes, notamment au niveau des recrutements dynamiques et cycliques rénal où il régule l’homéostasie hydrosodée. Des différents, variants selon l’hormone, et dysfonctionnements de la signalisation contemporains de celui de partenaires minéralocorticoïde sont impliqués dans des transcriptionnels, régulant ainsi des effets à court pathologies majeures chez l’Homme. Dans ce ou à long-terme. Enfin, par ChIP en série et en travail, nous avons identifié par ChIP sequencing tandem, nous avons montré que le MR et le GR le premier cistrome du MR dans une lignée agissent sous forme d’homodimères ou cellulaire rénale humaine. La caractérisation des d’hétérodimères. cibles génomiques a permis de décrire l’élément L’identification du cistrome du MR, et la de réponse spécifique du MR, et de démontrer caractérisation de ses mécanismes d’action l’existence de deux modes d’action pour le MR : moléculaires, améliore notre compréhension de par liaison directe à l’ADN, ou indirecte via la la physiopathologie de la signalisation liaison à d’autres facteurs de transcription. Le minéralocorticoïde, et pourrait aboutir, MR est physiologiquement confronté à une notamment par le développement d’antagonistes dualité face au récepteur glucocorticoïde (GR) sélectifs du MR comme la Finérénone, à de avec lequel il partage un ligand, le cortisol, et des nouvelles stratégies thérapeutiques.

Title: Identification and Transcriptional Regulation of the Mineralocorticoid Receptor Target Genes in Renal Cells Keywords: Mineralocorticoid Receptor, Aldosterone, Chromatin immunoprecipitation, Cistrome, Glucocorticoids, Transcriptional dynamic

Abstract: The mineralocorticoid receptor (MR), targets, whose PER1 gene. On the latter, MR activated by aldosterone, exhibits numerous and GR are distinguished by different dynamic pleiotropic functions, most notably at the renal and cyclical recruitment, varying according to level where it regulates electrolytic homeostasis. hormone, and coordinated with the one of Dysfunctions in the mineralocorticoid signaling transcriptional partners, translating into the pathway are involved in major diseases in regulation of short-term and long-term effects. Human. During this work, we have identified by Finally, by serial and tandem ChIP experiment, ChIP sequencing the first MR cistrome in a we have demonstrated that MR and GR act as human renal cell lineage. The characterization homodimer and as heterodimer. of the identified genomic targets allowed us to Identification of new MR genomic targets and define a specific MR responsive element, and to characterization of its molecular mechanisms of demonstrate the existence of two transactivation action, improve our understanding of the processes for MR: through direct binding to DNA pathophysiology of the mineralocorticoid or through indirect interaction via binding to signaling pathway. This could ultimately, notably other transcription factors. MR is physiologically through the development of selective MR confronted with a duality with the glucocorticoid antagonists like Finerenone, lead to new receptor (GR), since they share a common therapeutic strategies. ligand, cortisol, and some of their genomic

Laboratoire où la thèse a été effectuée : Inserm U1185, Signalisation Hormonale, Physiopathologie Endocrinienne et Métabolique Faculté de Médecine Paris Sud, 63, rue Gabriel Péri, 94276, Le Kremlin-Bicêtre Cedex, France Directeur : Dr Marc Lombès

Université Paris-Saclay Espace Technologique / Immeuble Discovery Route de l’Orme aux Merisiers RD 128 / 91190 Saint-Aubin, France