Downloaded from Genome.Cshlp.Org on March 28, 2013 - Published by Cold Spring Harbor Laboratory Press
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name zinc finger protein 161 Gene Symbol Zfp161 Organism Mouse Gene Summary Description Not Available Gene Aliases ZF5 RefSeq Accession No. NC_000083.6, NT_039649.8 UniGene ID Mm.29434 Ensembl Gene ID ENSMUSG00000049672 Entrez Gene ID 22666 Assay Information Unique Assay ID qMmuCID0009626 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000112674, ENSMUST00000062369, ENSMUST00000112676 Amplicon Context Sequence GATCAGCCTGAGTCTGATCTGAAGATTTTGGTGTTTAAGGCATTAAGAACATAGC CTGAATTGTTCATGGAGTTTTTCATCAGTATGTCTGAAACCATAAAATATAATGAT GATGATCATAAAACGCTGTTTCTGAAAACACTGAACGAACAGCGCCTGGAGGGA GAATTCTGCGACATCGCCATCGTGGTTGAAGATGTAAAGTTCCGAGCCCACCGG TGTGTCCTCGC Amplicon Length (bp) 200 Chromosome Location 17:69385436-69387472 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 104 R2 0.9993 cDNA Cq 24.19 cDNA Tm (Celsius) 82 gDNA Cq 35.48 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Zfp161, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. -
Molecular Effects of Isoflavone Supplementation Human Intervention Studies and Quantitative Models for Risk Assessment
Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis committee Promotors Prof. Dr Pieter van ‘t Veer Professor of Nutritional Epidemiology Wageningen University Prof. Dr Evert G. Schouten Emeritus Professor of Epidemiology and Prevention Wageningen University Co-promotors Dr Anouk Geelen Assistant professor, Division of Human Nutrition Wageningen University Dr Lydia A. Afman Assistant professor, Division of Human Nutrition Wageningen University Other members Prof. Dr Jaap Keijer, Wageningen University Dr Hubert P.J.M. Noteborn, Netherlands Food en Consumer Product Safety Authority Prof. Dr Yvonne T. van der Schouw, UMC Utrecht Dr Wendy L. Hall, King’s College London This research was conducted under the auspices of the Graduate School VLAG (Advanced studies in Food Technology, Agrobiotechnology, Nutrition and Health Sciences). Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Friday 20 June 2014 at 13.30 p.m. in the Aula. Vera van der Velpen Molecular effects of isoflavone supplementation: Human intervention studies and quantitative models for risk assessment 154 pages PhD thesis, Wageningen University, Wageningen, NL (2014) With references, with summaries in Dutch and English ISBN: 978-94-6173-952-0 ABSTRact Background: Risk assessment can potentially be improved by closely linked experiments in the disciplines of epidemiology and toxicology. -
Supp Material.Pdf
Supplementary Material for: Accurate inference of transcription factor binding from DNA sequence and chromatin accessibility data. Roger Pique-Regi1;y;∗, Jacob F. Degner 1;2;y;∗, Athma A. Pai1, Daniel J. Gaffney1;3, Yoav Gilad1;∗, Jonathan K. Pritchard1;3;∗ 1Department of Human Genetics, University of Chicago 2Committee on Genetics, Genomics and Systems Biology, University of Chicago 3Howard Hughes Medical Institute, University of Chicago yThese authors contributed equally. ∗To whom correspondence should be addressed: [email protected], [email protected], [email protected], [email protected] 1 Contents 1 Overview 3 2 Data sources and processing 4 2.1 PWM scanning. .4 2.2 Data for the prior. .5 2.3 Experimental data. .5 2.4 Models for experimental data. .6 3 The CENTIPEDE model 7 3.1 The model. .7 3.2 Implementation details. 11 4 Validation of the CENTIPEDE predicted TF-bound sites 12 4.1 Validation with ChIP-seq. 12 4.2 Relationship to other methods.................................... 19 4.3 Conservation as validation of the CENTIPEDE predictions. 20 5 Motif analysis 20 5.1 De novo motif discovery. 20 5.2 Identification of groups of overlapping motifs. 21 5.3 Novel words that have a match in existing protein binding microarray data . 22 5.4 GO analysis of putative gene-targets of each TF. 22 5.5 Co-occurrence analysis of binding locations for each TF. 23 5.6 Linear modeling of steady state mRNA levels. 24 5.7 Analysis of multi-tissue expression for TF target genes. 25 5.8 Estimating enrichment/depletion of histone modifications at TF binding locations. -
Refinement of Regions with Allelic Loss on Chromosome 18P11.2 and 18Q12.2 in Esophageal Squamous Cell Carcinoma1
Vol. 6, 3565–3569, September 2000 Clinical Cancer Research 3565 Refinement of Regions with Allelic Loss on Chromosome 18p11.2 and 18q12.2 in Esophageal Squamous Cell Carcinoma1 Jayaprakash D. Karkera,2 Saleh Ayache,2 more frequently in African-Americans than in Caucasians, Rodman J. Ransome, Jr., Marvin A. Jackson, whereas adenocarcinoma is more prevalent among Caucasians Ahmed F. Elsayem, Rajagopalan Sridhar, (2). Tobacco and alcohol consumption represents major envi- ronmental risk factors for this malignancy (3), but the molecular Sevilla D. Detera-Wadleigh, and events leading to esophageal cancer and the genetic components 3 Robert G. Wadleigh that are mutated at the inception and course of the neoplasm are Medical Oncology Section, Department of Veterans Affairs Medical largely unknown. Unraveling the genetic factors could provide Center, Washington, DC 20422 [J. D. K., S. A., R. G. W.]; targets for the development of more effective therapeutic agents. Departments of Pathology [R. J. R., M. A. J.], Medicine [A. F. E.], A variety of tumor suppressor genes have been implicated and Radiation Therapy and Cancer Center [R. S.], Howard University, Washington, DC 20060; and National Institute of Mental Health, in esophageal cancer (4, 5). Chromosomal abnormalities and NIH, Bethesda, MD 20892 [S. D. D.] LOH4 in which random isolated markers are used have been associated with esophageal tumors (6, 7). Analysis of chromo- some 18 has focused mainly on 18q21, where two known tumor ABSTRACT suppressor genes, DCC (8) and DPC4 (9) have been mapped. Esophageal cancer ranks among the 10 most common However, only infrequent deletions of DCC and DPC4 have cancers worldwide and is almost invariably fatal. -
Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility. -
Conservation and Regulatory Associations of a Wide Affinity Range of Mouse Transcription Factor Binding Sites
2.73 95 ISSN 0888-7543 4 Volume 95, Issue 4, April 2010 Vol. 95/4 (2010) 185–Vol. 246 GENOMICS GENOMICS Conservation & Twin Guard Series™ with regulatory -86 Dual˚Cool Technology associations of TF binding sites Nothing Beats 100% Protection. Natural selection role in mouse genetic variation If you’reyoou’re preservingpreesservvin thee workwwork of a lifetime,liffetime, tthis -8-86°C6°C ffreezerreezeer iss fforor youyyou. Human specifi c -86˚C SANYOSAN introduces Twin GGuard Series™, the most reliableb dual,l redundant autocascade freezer for the most critical -86°C ultra-low applications ever. The V.I.P.™ insulated gene duplications MDF-U500VXC is powered by two completely separate -86 Dual˚Cool refrigeration relative to other systems, each built to run effi ciently – alone or even better together in primates energy-saving EcoMode™ – to safely preserve whatever you put inside. A B Learn more. Visit www.twinguardseries.com or call 800-858-8442. Selective capture Pictured: The 18.3 cu.ft. V.I.P.™ insulated MDF-U500VXC. Includes integrated LCD performance monitor and digital controller for comprehensive system management, data logging, remote communications, alarms, predictive performance and and sequencing of validation. Maintenance free, fi lterless design. exome subsets LimitedLimiitted TimeTime FreeFree Offer.Offferr. ($3,795($3,7795 Value)Vallue) GREEN ForFthidllfi a third level of securityt duringdi brief bif power outagest SANYO offers ff a ffree, ELSEVIER FREE product built-in Liquid N or Liquid CO back-up system with the purchase of any ! 2 2 Available online at www.sciencedirect.com OFFER ] MDF-U500VXC now through June 30, 2010. -
Distinct Transcriptomes Define Rostral and Caudal 5Ht Neurons
DISTINCT TRANSCRIPTOMES DEFINE ROSTRAL AND CAUDAL 5HT NEURONS by CHRISTI JANE WYLIE Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Dr. Evan S. Deneris Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY May, 2010 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of ______________________________________________________ candidate for the ________________________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS TABLE OF CONTENTS ....................................................................................... iii LIST OF TABLES AND FIGURES ........................................................................ v ABSTRACT ..........................................................................................................vii CHAPTER 1 INTRODUCTION ............................................................................................... 1 I. Serotonin (5-hydroxytryptamine, 5HT) ....................................................... 1 A. Discovery.............................................................................................. -
Refinement of Regions with Allelic Loss on Chromosome 18P11.2 and 18Q12.2 in Esophageal Squamous Cell Carcinoma1
Vol. 6, 3565–3569, September 2000 Clinical Cancer Research 3565 Refinement of Regions with Allelic Loss on Chromosome 18p11.2 and 18q12.2 in Esophageal Squamous Cell Carcinoma1 Jayaprakash D. Karkera,2 Saleh Ayache,2 more frequently in African-Americans than in Caucasians, Rodman J. Ransome, Jr., Marvin A. Jackson, whereas adenocarcinoma is more prevalent among Caucasians Ahmed F. Elsayem, Rajagopalan Sridhar, (2). Tobacco and alcohol consumption represents major envi- ronmental risk factors for this malignancy (3), but the molecular Sevilla D. Detera-Wadleigh, and events leading to esophageal cancer and the genetic components 3 Robert G. Wadleigh that are mutated at the inception and course of the neoplasm are Medical Oncology Section, Department of Veterans Affairs Medical largely unknown. Unraveling the genetic factors could provide Center, Washington, DC 20422 [J. D. K., S. A., R. G. W.]; targets for the development of more effective therapeutic agents. Departments of Pathology [R. J. R., M. A. J.], Medicine [A. F. E.], A variety of tumor suppressor genes have been implicated and Radiation Therapy and Cancer Center [R. S.], Howard University, Washington, DC 20060; and National Institute of Mental Health, in esophageal cancer (4, 5). Chromosomal abnormalities and NIH, Bethesda, MD 20892 [S. D. D.] LOH4 in which random isolated markers are used have been associated with esophageal tumors (6, 7). Analysis of chromo- some 18 has focused mainly on 18q21, where two known tumor ABSTRACT suppressor genes, DCC (8) and DPC4 (9) have been mapped. Esophageal cancer ranks among the 10 most common However, only infrequent deletions of DCC and DPC4 have cancers worldwide and is almost invariably fatal. -
HHS Public Access Provided by Iupuischolarworks Author Manuscript
View metadata, citation and similar papers at core.ac.uk brought to you by CORE HHS Public Access provided by IUPUIScholarWorks Author manuscript Author Manuscript Author ManuscriptPharmacol Author Manuscript Biochem Behav Author Manuscript . Author manuscript; available in PMC 2015 July 27. Published in final edited form as: Pharmacol Biochem Behav. 2008 June ; 89(4): 481–498. doi:10.1016/j.pbb.2008.01.023. Differential gene expression in the nucleus accumbens with ethanol self-administration in inbred alcohol-preferring rats Zachary A. Rodd1,6, Mark W. Kimpel1,6, Howard J. Edenberg2,4,5, Richard L. Bell1,6, Wendy N. Strother1,6, Jeanette N. McClintick2,5, Lucinda G. Carr3, Tiebing Liang3, and William J. McBride1,6 1Department of Psychiatry, Indiana University School of Medicine, Indianapolis, IN 46202-4887 2Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202-4887 3Department of Medicine, Indiana University School of Medicine, Indianapolis, IN 46202-4887 4Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN 46202-4887 5Center for Medical Genomics, Indiana University School of Medicine, Indianapolis, IN 46202-4887 6Institute of Psychiatric Research, Indiana University School of Medicine, Indianapolis, IN 46202-4887 Abstract The current study examined the effects of operant ethanol (EtOH) self-administration on gene expression in the nucleus accumbens (ACB) and amygdala (AMYG) of inbred alcohol-preferring (iP) rats. Rats self-trained on a standard two-lever operant paradigm to administer either water- water, EtOH (15% v/v)-water, or saccharin (SAC; 0.0125% g/v)-water. Animals were killed 24 hr after the last operant session, and the ACB and AMYG dissected; RNA was extracted and purified for microarray analysis. -
Supplementary Information
Supplementary Information Table S1. Regions of CNV data excluded from CNV analysis due to poor density of probe coverage. Region Centromere Telomere Chr. p q p q 1 p11.1, p11.2, q11, q12, q21.1 p36.33, p36.32, p36.31, q44 p12, p13.1 p36.23, p36.22, p36.21 2 p11.1, p11.2 q11.1 p25.3 q37.3 3 p11.1 q11.1, q11.2 none excluded q29 4 p11 q11 p16.1, p16.2, p16.3 q35.2, q35.1 5 p12 q11.1 p15.33 q35.3, q35.2, q35.1 6 p11.1 q11.1 p25.3, p35.2 q27 7 p11.1 q11.1, q11.21 p22.3 q36.3 8 p11.1 q11.1 p23.3, p23.2, p23.1 q24.3 9 p11.1, p11.2 q11, q12, q13 p24.3 q34.3, q34.2, q34.13, q34.12, q34.11 10 p11.1 q11.1, q11.21, q11.22 none excluded q26.3 11 p11.11, p11.12 q11 p15.5 q25 12 p11.1, p11.21 q11 p13.33, p13.32 q24.33, q24.32, q24.31 13 no probes q11 no probes q34 14 no probes q11.1, q11.2 no probes q32.33 15 no probes q11.1, q11.2, q12, no probes q26.3 q13.1, q13.2, q13.3 16 p11.1, p11.2 q11.1, q11.2 p13.3 q24.3, q24.2, q24.1 17 none excluded none excluded p13.3 q25.3 18 p11.1, p11.21 q11.1 none excluded q23 19 p11 q11 p13.3 q13.43 20 p11.1, p11.21 q11.1, q11.21 none excluded q13.33 21 no probes q11.1, q11.2 no probes q22.3 22 no probes q11.1, q11.21, q11.22 no probes q13.33, q13.32 Table S2. -
A Systems Approach to Mapping Transcriptional Networks Controlling
Xu et al. BMC Genomics 2010, 11:451 http://www.biomedcentral.com/1471-2164/11/451 RESEARCH ARTICLE Open Access A systems approach to mapping transcriptional networks controlling surfactant homeostasis Yan Xu1,2*, Minlu Zhang2,3, Yanhua Wang1, Pooja Kadambi4, Vrushank Dave1, Long J Lu2,3, Jeffrey A Whitsett1 Abstract Background: Pulmonary surfactant is required for lung function at birth and throughout life. Lung lipid and surfactant homeostasis requires regulation among multi-tiered processes, coordinating the synthesis of surfactant proteins and lipids, their assembly, trafficking, and storage in type II cells of the lung. The mechanisms regulating these interrelated processes are largely unknown. Results: We integrated mRNA microarray data with array independent knowledge using Gene Ontology (GO) similarity analysis, promoter motif searching, protein interaction and literature mining to elucidate genetic networks regulating lipid related biological processes in lung. A Transcription factor (TF) - target gene (TG) similarity matrix was generated by integrating data from different analytic methods. A scoring function was built to rank the likely TF-TG pairs. Using this strategy, we identified and verified critical components of a transcriptional network directing lipogenesis, lipid trafficking and surfactant homeostasis in the mouse lung. Conclusions: Within the transcriptional network, SREBP, CEBPA, FOXA2, ETSF, GATA6 and IRF1 were identified as regulatory hubs displaying high connectivity. SREBP, FOXA2 and CEBPA together form a common core regulatory module that controls surfactant lipid homeostasis. The core module cooperates with other factors to regulate lipid metabolism and transport, cell growth and development, cell death and cell mediated immune response. Coordinated interactions of the TFs influence surfactant homeostasis and regulate lung function at birth. -
Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression Kathryn H
Longwood University Digital Commons @ Longwood University Biology and Environmental Sciences Faculty Biology and Environmental Sciences Publications 11-2008 Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter through Differential Repression of Constitutive Expression Kathryn H. Shows Longwood University, [email protected] Rita Shiang Virginia Commonwealth University Follow this and additional works at: http://digitalcommons.longwood.edu/bio_facpubs Part of the Life Sciences Commons Recommended Citation Shows, Kathryn H. and Shiang, Rita, "Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter through Differential Repression of Constitutive Expression" (2008). Biology and Environmental Sciences Faculty Publications. Paper 1. http://digitalcommons.longwood.edu/bio_facpubs/1 This Article is brought to you for free and open access by the Biology and Environmental Sciences at Digital Commons @ Longwood University. It has been accepted for inclusion in Biology and Environmental Sciences Faculty Publications by an authorized administrator of Digital Commons @ Longwood University. For more information, please contact [email protected]. DNA AND CELL BIOLOGY Volume 27, Number 11, 2008 ª Mary Ann Liebert, Inc. Pp. 589–600 DOI: 10.1089=dna.2008.0766 Original Papers Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression Kathryn H. Shows and Rita Shiang Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis