DOCSLIB.ORG

X Chromosomal Mutations and Spermatogenic Failure☆

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
X Chromosomal Mutations and Spermatogenic Failure☆ View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1822 (2012) 1864–1872 Contents lists available at SciVerse ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis Review X chromosomal mutations and spermatogenic failure☆ Katrien Stouffs ⁎, Willy Lissens Center for Medical Genetics, Universitair Ziekenhuis Brussel, Laarbeeklaan 101, 1090 Brussels, Belgium Research Group Reproduction and Genetics, Vrije Universiteit Brussel, Laarbeeklaan 101, 1090 Brussels, Belgium article info abstract Article history: The X and Y chromosomes, the sex chromosomes, are important key players in germ cell development. Both Received 6 November 2011 chromosomes contain genes that are uniquely expressed in male spermatogenesis. Furthermore, these chromo- Received in revised form 24 February 2012 somes are special because men only have a single copy of them. These features make the sex chromosomes in- Accepted 14 May 2012 teresting for studying in view of spermatogenesis defects. The role of the Y chromosome, together with the Available online 23 May 2012 presence of Yq microdeletions, in male infertility is well established. Less well-understood are the X-linked genes, their expression patterns and potential impact on male infertility. This review provides an overview of Keywords: X chromosome the current knowledge on potential spermatogenesis genes that are located on the mouse and human X chromo- Spermatogenesis somes. A summary is given on knock-out mice models in which X-linked genes have been shown to alter sper- Infertility matogenesis, and on genes that have been studied in humans. Finally, new research areas like miRNA analysis, Genome Wide Association Studies (GWAS) and array comparative genomic hybridisation (CGH) studies are dis- cussed. This article is part of a Special Issue entitled: Molecular Genetics of Human Reproductive Failure. © 2012 Elsevier B.V. All rights reserved. 1. Introduction — why study the X chromosome? that the X chromosome is associated with syndromes involving men- tal retardation or muscle disorders. The X and Y chromosomes, the sex chromosomes, are special Typically, X-linked disorders are more common in men. One of the since men only have a single copy of these chromosomes. most common X-linked recessive disorders, is congenital color blind- Women, on the other hand, have two copies of the X chromosome ness, affecting ~8% of males, but only 0.5% of females [4]. The increased and lack the Y chromosome. These sex chromosomes are derived frequency of recessive disorders in males is caused by hemizygous ex- from an autosomal chromosome pair 300 myr ago [1]. While the posure: men only have a single copy of the X chromosome, and there- Y chromosome decreased to ~one third the size of the X chromo- fore compensation by a second, normal allele is not possible. some, the X chromosome remained more or less stable in size. Keeping in mind the hemizygous presence of the X chromosome However,thegenecontentoftheXchromosomehaschanged in men, it is also interesting to study this chromosome in view of largely. Under various selection processes, the sex chromosomes male infertility. Changes in X-linked spermatogenesis genes can be have obtained their current content. It is well known that both passed on through women for several generations: the “effect” or sex chromosomes play a pivotal role in sex determination. The phenotype will only become visible in males. Since infertility is affect- major functions of the Y chromosome are related to sex determina- ing 10–15% of couples, and a male factor is responsible for about half tion and spermatogenesis. Mutations of, or alterations in the SRY of the cases, it is worthwhile to study the origin of male infertility. For gene on the short arm of the Y chromosome lead (in most cases) infertile men producing a few spermatozoa, intracytoplasmic sperm to sex reversal [2]. The long arm of the Y chromosome is involved injection (ICSI) with the patient's own sperm might be a solution to in male infertility: deletions of one or more azoospermia factor overcome the fertility problems. In many cases where genetic causes (AZF) regions lead to spermatogenic failure. of infertility would be selected out naturally, the introduction of arti- Abnormalities in/of X linked genes are causing a much wider range ficial reproductive technologies such as ICSI might circumvent this of diseases/syndromes. The X chromosome is enriched for genes natural selection, and consequently genetic alterations might be expressed in brain, skeletal muscle, and as explained later, in sex- transmitted to subsequent generations. Therefore it is important to and reproduction-related tissues [3]. Therefore, it is not surprising identify genetic causes of male infertility for both diagnostic purposes and genetic counseling. ☆ This article is part of a Special Issue entitled: Molecular Genetics of Human Repro- 2. Testicular genes on the X chromosome ductive Failure. ⁎ Corresponding author at: Center for Medical Genetics, Universitair Ziekenhuis Brussel, Laarbeeklaan 101, 1090 Brussels, Belgium. Tel.: +32 2 4749149; fax: +32 2 4776860. There has been, and still is, much debate on the gene content of the E-mail address: [email protected] (K. Stouffs). X chromosome. While some authors claim that the X chromosome has 0925-4439/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.bbadis.2012.05.012 K. Stouffs, W. Lissens / Biochimica et Biophysica Acta 1822 (2012) 1864–1872 1865 a small number of male-specific genes, others believe that the X chro- presence of inverted repeats on the X chromosome could protect mosome is rather enriched for spermatogenesis genes. The gain/loss genes in these regions from X inactivation [14]. The X chromosome of male-specific genes can be explained by different evolutionary carries 24 of these repeats, containing a large part of the cancer-testis strategies. (CT) genes [13]. These genes are in normal conditions only expressed Evolutionary selection processes that are leading to demasculinization in testis, but are also detected in multiple cancers (Table 2). of the X chromosome (i.e. causing a decrease in the number of spermato- Based on these ‘characteristics’, the genes on the X chromosome genesis genes on the X chromosome) include the sexual antagonism driv- can be subdivided into two major groups: single copy and multicopy en X inactivation (SAXI) hypothesis and meiotic sex chromosome genes (Table 1 and Table 2). One further group of genes that we will inactivation (MSCI). MSCI, also referred to as meiotic silencing of consider here are X-linked genes with a homologue on the Y chromo- unsynapsed chromatin (MSUC), is a process through which the X chro- some (Table 4). mosome is inactivated during male meiosis. The process behind this inac- tivation is not well understood. MSCI is different from X chromosome 3. Differences between mice and humans inactivation (lyonization) in women by which one of the X chromosomes is inactivated, and is independent of the XIST gene. Due to the MSCI, the From Tables 1 and 2, it is obvious that especially for multicopy majority of genes on the X chromosome are repressed from meiosis on- genes, large differences are observed between mice and humans. wards. This makes the X chromosome an unlikely place for meiotic and This can probably be explained by the fact that these genes arose post-meiotic genes. As a consequence, part of the genes involved in late in evolution and are presumably still actively changing. Further- meiosis has changed their location by retroposition from the X to an auto- more, part of the human ‘single’ copy genes is present in multiple somal chromosome [5]. The SAXI hypothesis suggests that sexual antago- copies in mice and vice versa (Table 2). Gmcl1 and Zfp161-rs1 are lo- nism is determining the chromosomal localization of genes: since the X cated on the X chromosome in mice, but are autosomal in humans. chromosome is present twice as much in females, X-linked mutations The Tsga8 gene is a testis-specific gene expressed in post-meiotic that are of benefit to females are much more likely to accumulate, even germ cells. This gene is present only in mice, although a potential ho- if they are deleterious for men. mologue was found in rat [15,16]. It has been shown, however, that In contrast to the SAXI theory, the hemizygous exposure theory this gene is evolving rapidly, even within different mouse subspecies. predicts an accumulation of spermatogenesis genes on the X chromo- It should be noted that the list of CT genes is increasing rapidly, and some. This theory suggests that recessive mutations with a positive or that probably not all CT genes are listed in Table 2. Presumably, the beneficial effect for men will accumulate on the X chromosome. Men number of genes having different copy numbers in human and have only one copy of the X chromosome, and therefore the beneficial mouse will also increase as more genomic research will be performed. effect will immediately become visible. For women, two mutations For part of these genes, a more specific function in spermatogene- would then be necessary in order to be beneficial. If deleterious for sis or a role in male infertility has already been reported. These results women, these effects would initially be masked since two mutations are described in the next paragraphs. We focus on X-linked genes that need to be present in women in order to have a negative effect. This are uniquely or preferentially expressed in testicular tissues. would lead to masculinization of the X chromosome. This theory is also referred to as Rice's hypothesis [6]. 4. X-linked testis-specific or testis-enriched genes studied by The origin of the different theories concerning the gene content of generating knock-out mice (Tables 1 and 2) the X chromosome is a result of the selection of the species under examination and the gene pool studied.
Load more

Recommended publications
  • Mitochondrial Dynamics During Spermatogenesis Grigor Varuzhanyan and David C
    © 2020. Published by The Company of Biologists Ltd | Journal of Cell Science (2020) 133, jcs235937. doi:10.1242/jcs.235937 REVIEW SUBJECT COLLECTION: MITOCHONDRIA Mitochondrial dynamics during spermatogenesis Grigor Varuzhanyan and David C. Chan* ABSTRACT Mitophagy is an additional layer of quality control that utilizes Mitochondrial fusion and fission (mitochondrial dynamics) are autophagy (Mizushima, 2007; Mizushima et al., 1998; Tsukada and homeostatic processes that safeguard normal cellular function. This Ohsumi, 1993) to remove excessive mitochondria or damaged relationship is especially strong in tissues with constitutively high energy mitochondria that are beyond repair (Pickles et al., 2018). During demands, such as brain, heart and skeletal muscle. Less is known about mitophagy, microtubule-associated protein 1A/1B light chain 3 the role of mitochondrial dynamics in developmental systems that involve (collectively LC3; also known as MAP1LC3A, MAP1LC3B and changes in metabolic function. One such system is spermatogenesis. MAP1LC3C) is recruited to the autophagosomal membrane and binds The first mitochondrial dynamics gene, Fuzzy onions (Fzo), was to mitochondria that selectively express mitophagy receptors on their discovered in 1997 to mediate mitochondrial fusion during Drosophila outer membrane. This molecular recognition designates damaged spermatogenesis. In mammals, however, the role of mitochondrial fusion mitochondria as cargo for autophagosomes, and the resulting during spermatogenesis remained unknown for nearly two decades after mitophagosomes subsequently fuse with lysosomes for degradation discovery of Fzo. Mammalian spermatogenesis is one of the most and recycling of the engulfed organelles. Much of the molecular complex and lengthy differentiation processes in biology, transforming workings of mitophagy have been parsed in cultured cells, and spermatogonial stem cells into highly specialized sperm cells over a recently developed mouse models are enabling the analysis of 5-week period.
    [Show full text]
  • Transcriptional Regulation of RKIP in Prostate Cancer Progression
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Sciences Transcriptional Regulation of RKIP in Prostate Cancer Progression Submitted by: Sandra Marie Beach In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences Examination Committee Major Advisor: Kam Yeung, Ph.D. Academic William Maltese, Ph.D. Advisory Committee: Sonia Najjar, Ph.D. Han-Fei Ding, M.D., Ph.D. Manohar Ratnam, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: May 16, 2007 Transcriptional Regulation of RKIP in Prostate Cancer Progression Sandra Beach University of Toledo ACKNOWLDEGMENTS I thank my major advisor, Dr. Kam Yeung, for the opportunity to pursue my degree in his laboratory. I am also indebted to my advisory committee members past and present, Drs. Sonia Najjar, Han-Fei Ding, Manohar Ratnam, James Trempe, and Douglas Pittman for generously and judiciously guiding my studies and sharing reagents and equipment. I owe extended thanks to Dr. William Maltese as a committee member and chairman of my department for supporting my degree progress. The entire Department of Biochemistry and Cancer Biology has been most kind and helpful to me. Drs. Roy Collaco and Hong-Juan Cui have shared their excellent technical and practical advice with me throughout my studies. I thank members of the Yeung laboratory, Dr. Sungdae Park, Hui Hui Tang, Miranda Yeung for their support and collegiality. The data mining studies herein would not have been possible without the helpful advice of Dr. Robert Trumbly. I am also grateful for the exceptional assistance and shared microarray data of Dr.
    [Show full text]
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
    [Show full text]
  • Biochemical Characterization of DDX43 (HAGE) Helicase
    Biochemical Characterization of DDX43 (HAGE) Helicase A Thesis Submitted to the College of Graduate Studies and Research In Fulfillment of the Requirements For the Degree of Master of Science In the Department of Biochemistry University of Saskatchewan Saskatoon By Tanu Talwar © Copyright Tanu Talwar, March, 2017. All rights reserved PERMISSION OF USE STATEMENT I hereby present this thesis in partial fulfilment of the requirements for a postgraduate degree from the University of Saskatchewan and agree that the Libraries of this University may make it freely available for inspection. I further agree that permission for copying of this thesis in any manner, either in whole or in part, for scholarly purposes may be granted by the professor or professors who supervised this thesis or, in their absence, by the Head of the Department or the Dean of the College in which my thesis work was done. It is understood that any copying or publication or use of this thesis or parts of it for any financial gain will not be allowed without my written permission. It is also understood that due recognition shall be given to me and to the University of Saskatchewan in any scholarly use which may be made of any material in my thesis. Requests for permission to copy or to make other use of material in this thesis in whole or part should be addressed to: Head of the Department of Biochemistry University of Saskatchewan 107 Wiggins Road Saskatoon, Saskatchewan, Canada S7N 5E5 i ABSTRACT DDX43, DEAD-box polypeptide 43, also known as HAGE (helicase antigen gene), is a member of the DEAD-box family of RNA helicases.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Ageing-Associated Changes in DNA Methylation in X and Y Chromosomes
    Kananen and Marttila Epigenetics & Chromatin (2021) 14:33 Epigenetics & Chromatin https://doi.org/10.1186/s13072-021-00407-6 RESEARCH Open Access Ageing-associated changes in DNA methylation in X and Y chromosomes Laura Kananen1,2,3,4* and Saara Marttila4,5* Abstract Background: Ageing displays clear sexual dimorphism, evident in both morbidity and mortality. Ageing is also asso- ciated with changes in DNA methylation, but very little focus has been on the sex chromosomes, potential biological contributors to the observed sexual dimorphism. Here, we sought to identify DNA methylation changes associated with ageing in the Y and X chromosomes, by utilizing datasets available in data repositories, comprising in total of 1240 males and 1191 females, aged 14–92 years. Results: In total, we identifed 46 age-associated CpG sites in the male Y, 1327 age-associated CpG sites in the male X, and 325 age-associated CpG sites in the female X. The X chromosomal age-associated CpGs showed signifcant overlap between females and males, with 122 CpGs identifed as age-associated in both sexes. Age-associated X chro- mosomal CpGs in both sexes were enriched in CpG islands and depleted from gene bodies and showed no strong trend towards hypermethylation nor hypomethylation. In contrast, the Y chromosomal age-associated CpGs were enriched in gene bodies, and showed a clear trend towards hypermethylation with age. Conclusions: Signifcant overlap in X chromosomal age-associated CpGs identifed in males and females and their shared features suggest that despite the uneven chromosomal dosage, diferences in ageing-associated DNA methylation changes in the X chromosome are unlikely to be a major contributor of sex dimorphism in ageing.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name zinc finger protein 161 Gene Symbol Zfp161 Organism Mouse Gene Summary Description Not Available Gene Aliases ZF5 RefSeq Accession No. NC_000083.6, NT_039649.8 UniGene ID Mm.29434 Ensembl Gene ID ENSMUSG00000049672 Entrez Gene ID 22666 Assay Information Unique Assay ID qMmuCID0009626 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000112674, ENSMUST00000062369, ENSMUST00000112676 Amplicon Context Sequence GATCAGCCTGAGTCTGATCTGAAGATTTTGGTGTTTAAGGCATTAAGAACATAGC CTGAATTGTTCATGGAGTTTTTCATCAGTATGTCTGAAACCATAAAATATAATGAT GATGATCATAAAACGCTGTTTCTGAAAACACTGAACGAACAGCGCCTGGAGGGA GAATTCTGCGACATCGCCATCGTGGTTGAAGATGTAAAGTTCCGAGCCCACCGG TGTGTCCTCGC Amplicon Length (bp) 200 Chromosome Location 17:69385436-69387472 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 104 R2 0.9993 cDNA Cq 24.19 cDNA Tm (Celsius) 82 gDNA Cq 35.48 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Zfp161, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Molecular Effects of Isoflavone Supplementation Human Intervention Studies and Quantitative Models for Risk Assessment
    Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis committee Promotors Prof. Dr Pieter van ‘t Veer Professor of Nutritional Epidemiology Wageningen University Prof. Dr Evert G. Schouten Emeritus Professor of Epidemiology and Prevention Wageningen University Co-promotors Dr Anouk Geelen Assistant professor, Division of Human Nutrition Wageningen University Dr Lydia A. Afman Assistant professor, Division of Human Nutrition Wageningen University Other members Prof. Dr Jaap Keijer, Wageningen University Dr Hubert P.J.M. Noteborn, Netherlands Food en Consumer Product Safety Authority Prof. Dr Yvonne T. van der Schouw, UMC Utrecht Dr Wendy L. Hall, King’s College London This research was conducted under the auspices of the Graduate School VLAG (Advanced studies in Food Technology, Agrobiotechnology, Nutrition and Health Sciences). Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Friday 20 June 2014 at 13.30 p.m. in the Aula. Vera van der Velpen Molecular effects of isoflavone supplementation: Human intervention studies and quantitative models for risk assessment 154 pages PhD thesis, Wageningen University, Wageningen, NL (2014) With references, with summaries in Dutch and English ISBN: 978-94-6173-952-0 ABSTRact Background: Risk assessment can potentially be improved by closely linked experiments in the disciplines of epidemiology and toxicology.
    [Show full text]
  • Environmental and Genetic Factors in Autism Spectrum Disorders: Special Emphasis on Data from Arabian Studies
    International Journal of Environmental Research and Public Health Review Environmental and Genetic Factors in Autism Spectrum Disorders: Special Emphasis on Data from Arabian Studies Noor B. Almandil 1,† , Deem N. Alkuroud 2,†, Sayed AbdulAzeez 2, Abdulla AlSulaiman 3, Abdelhamid Elaissari 4 and J. Francis Borgio 2,* 1 Department of Clinical Pharmacy Research, Institute for Research and Medical Consultation (IRMC), Imam Abdulrahman Bin Faisal University, Dammam 31441, Saudi Arabia; [email protected] 2 Department of Genetic Research, Institute for Research and Medical Consultation (IRMC), Imam Abdulrahman Bin Faisal University, Dammam 31441, Saudi Arabia; [email protected] (D.N.A.); [email protected] (S.A.) 3 Department of Neurology, College of Medicine, Imam Abdulrahman Bin Faisal University, Dammam 31441, Saudi Arabia; [email protected] or [email protected] 4 Univ Lyon, University Claude Bernard Lyon-1, CNRS, LAGEP-UMR 5007, F-69622 Lyon, France; [email protected] * Correspondence: [email protected] or [email protected]; Tel.: +966-13-333-0864 † These authors contributed equally to this work. Received: 26 January 2019; Accepted: 19 February 2019; Published: 23 February 2019 Abstract: One of the most common neurodevelopmental disorders worldwide is autism spectrum disorder (ASD), which is characterized by language delay, impaired communication interactions, and repetitive patterns of behavior caused by environmental and genetic factors. This review aims to provide a comprehensive survey of recently published literature on ASD and especially novel insights into excitatory synaptic transmission. Even though numerous genes have been discovered that play roles in ASD, a good understanding of the pathophysiologic process of ASD is still lacking.
    [Show full text]
  • Non-Synonymous Mutations Mapped to Chromosome X Associated With
    de Camargo et al. BMC Genomics (2015) 16:384 DOI 10.1186/s12864-015-1595-0 RESEARCH ARTICLE Open Access Non-synonymous mutations mapped to chromosome X associated with andrological and growth traits in beef cattle Gregório Miguel Ferreira de Camargo1,2,3, Laercio R Porto-Neto2, Matthew J Kelly3, Rowan J Bunch2, Sean M McWilliam2, Humberto Tonhati1, Sigrid A Lehnert2, Marina R S Fortes3* and Stephen S Moore4 Abstract Background: Previous genome-wide association analyses identified QTL regions in the X chromosome for percentage of normal sperm and scrotal circumference in Brahman and Tropical Composite cattle. These traits are important to be studied because they are indicators of male fertility and are correlated with female sexual precocity and reproductive longevity. The aim was to investigate candidate genes in these regions and to identify putative causative mutations that influence these traits. In addition, we tested the identified mutations for female fertility and growth traits. Results: Using a combination of bioinformatics and molecular assay technology, twelve non-synonymous SNPs in eleven genes were genotyped in a cattle population. Three and nine SNPs explained more than 1% of the additive genetic variance for percentage of normal sperm and scrotal circumference, respectively. The SNPs that had a major influence in percentage of normal sperm were mapped to LOC100138021 and TAF7L genes; and in TEX11 and AR genes for scrotal circumference. One SNP in TEX11 was explained ~13% of the additive genetic variance for scrotal circumference at 12 months. The tested SNP were also associated with weight measurements, but not with female fertility traits.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • ATAC-Seq Footprinting Unravels Kinetics of Transcription
    bioRxiv preprint doi: https://doi.org/10.1101/869560; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Beyond accessibility: ATAC-seq footprinting unravels kinetics 2 of transcription factor binding during zygotic genome 3 activation 4 Authors 5 Mette Bentsen1, Philipp Goymann1, Hendrik Schultheis1, Kathrin Klee1, Anastasiia Petrova1, 6 René Wiegandt1, Annika Fust1, Jens Preussner1,3, Carsten Kuenne1, Thomas Braun2,3, 7 Johnny Kim2,3, Mario Looso1,3 8 Affiliation 9 1 Bioinformatics Core Unit (BCU), Max Planck Institute for Heart and Lung Research, Bad 10 Nauheim, Germany 11 2 Department of Cardiac Development and Remodeling, Max-Planck-Institute for Heart and 12 Lung Research, Bad Nauheim, Germany 13 3 German Centre for Cardiovascular Research (DZHK), Partner site Rhein-Main, Frankfurt am 14 Main, 60596 Germany 15 Corresponding author email address 16 [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/869560; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 17 Abstract 18 While footprinting analysis of ATAC-seq data can theoretically enable investigation of 19 transcription factor (TF) binding, the lack of a computational tool able to conduct different 20 levels of footprinting analysis has so-far hindered the widespread application of this method. 21 Here we present TOBIAS, a comprehensive, accurate, and fast footprinting framework 22 enabling genome-wide investigation of TF binding dynamics for hundreds of TFs 23 simultaneously.
    [Show full text]