Sulfatide-Reactive Natural Killer T Cells Abrogate Ischemia-Reperfusion Injury

BASIC RESEARCH www.jasn.org

Seung Hee Yang,* Jung Pyo Lee,† Hye Ryoun Jang,‡ Ran-hui Cha,§ Seung Seok Han,§ ʈ Un Sil Jeon, Dong Ki Kim,§ Junghan Song,¶ Dong-Sup Lee,** and Yon Su Kim*§

*Kidney Research Institute, Seoul National University, Seoul, Korea; †Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul, Korea; ‡Department of Internal Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea; §Department of Internal Medicine, Seoul ʈ National University College of Medicine, Seoul, Korea; Department of Internal Medicine, Korea University Guro Hospital, Seoul, Korea; ¶Department of Laboratory Medicine, Seoul National University College of Medicine, Seoul, Korea; and **Department of Anatomy, Seoul National University College of Medicine, Seoul, Korea

ABSTRACT There is a significant immune response to ischemia-reperfusion injury (IRI), but the role of immunomodulatory natural killer T (NKT) cell subtypes is not well understood. Here, we compared the severity of IRI Ϫ Ϫ Ϫ Ϫ in mice deficient in type I/II NKT cells (CD1d / ) or type I NKT cells (J␣18 / ). The absence of NKT cells, especially type II NKT cells, accentuated the severity of renal injury, whereas repletion of NKT cells attenuated injury. Adoptively transferred NKT cells trafficked into the tubulointerstitium, which is the primary area of injury. Sulfatide-induced activation of type II NKT cells protected kidneys from IRI, but inhibition of NKT cell recruitment enhanced injury. In co-culture experiments, sulfatide-induced activation of NKT cells from either mice or humans attenuated apoptosis of renal tubular cells after transient hypoxia via hypoxia-inducible factor (HIF)-1␣ and IL-10 pathways. Renal tissue of patients with acute tubular necrosis (ATN) frequently contained NKT cells, and the number of these cells tended to negatively correlate with ATN severity. In summary, sulfatide-reactive type II NKT cells are renoprotective in IRI, suggesting that pharmacologic modulation of NKT cells may protect against ischemic injury.

J Am Soc Nephrol 22: 1305–1314, 2011. doi: 10.1681/ASN.2010080815

Acute kidney injury may predispose the high mor- disease and allogeneic immune response.9–11 How- bidity and mortality of patients and can induce the ever, only a few reports have investigated the role of progressive loss of kidney function.1 Ischemia-rep- NKT cells in kidney IRI, despite the fact that these erfusion injury (IRI), a major cause of acute kidney cells are known to traffic into postischemic kidneys injury, is characterized by the participation of a as early as 3 hours after IRI.12,13 NKT cells have been prominent inflammatory response. Various com- proposed as a bridge between the innate and adap- ponents of the innate and adaptive immune systems tive immune systems.14–16 NKT cell recruitment are known to play a role in kidney IRI.2–4 Therefore, into the site of injury was directed by the interaction immunomodulatory and anti-inflammatory mea- sures for IRI were evaluated.5,6 Recently, the role of Received August 7, 2010. Accepted March 28, 2011. Foxp3ϩCD4ϩCD25ϩ regulatory T cells (Tregs) in IRI were exploited, and Tregs revealed the protec- Published online ahead of print. Publication date available at www.jasn.org. tive activity against IRI by ischemic precondition- 7,8 Correspondence: Dr. Yon Su Kim, Department of Internal Med- ing and by promoting tubular repair. icine, Seoul National University College of Medicine, 101 Dae- Natural killer T (NKT) cells, expressing both T hang-ro, Jongro-gu, Seoul, 110-799, Korea. Phone: 82-2-2072- cell receptors (TCRs) and natural killer cell recep- 2264; Fax: 82-2-745-2264; E-mail: [email protected] tors, have been reported to regulate autoimmune Copyright © 2011 by the American Society of Nephrology

J Am Soc Nephrol 22: 1305–1314, 2011 ISSN : 1046-6673/2208-1305 1305 BASIC RESEARCH www.jasn.org

between CXCL16 and CXCR6, which is expressed on NKT cells and activated Th1 cells.17 Previously, we have presented that glomerulus-expressed CXCL16 upon the stimuli in experimental crescentic glomerulonephritis and the blocking of CXCL16 decreased NKT cell recruitment.18 Most NKT cells recognize antigens presented by CD1d, and CD1d is expressed on dendritic cells, macrophages, and various other cell types.14,19,20 CD1d-restricted NKT cells can be broadly catego- rized into type I and type II NKT cells. Type I NKT cells recog- nizes glycolipid antigen through an invariant TCR that is en- coded by the V␣14J␣218 gene in mice and the V␣24J␣18 gene in humans.16 Stimulation of type I NKT cells by ␣-galactosylceramide results in cytokine secretion, TCR downregulation, and apoptosis. Depending on the surrounding milieu and the antigens involved, the type I NKT cells may demonstrate either the Th1-type or the Th2-type cytokine secretion profile.19 In animal models, NKT cells (mainly type I) have been reported to affect the development and progression of diabetes mellitus, experimental autoimmune encephalitis (EAE), experimental anterior uveitis, and systemic lupus erythematosus.21–24 Type II NKT cells have variable TCR-V gene rearrangements that are distinct from those of type I NKT cells.16 Type II NKT cells recognize the self-glycolipid 3-sulfated galactosylceramide (sulfatide) and can be identified by sulfatide/CD1d-tetram- Figure 1. Sulfatide-reactive NKT cells protected kidney from 25 ischemia-reperfusion injury. (A) Renal function was deteriorated ers. Although type II NKT cells have not been studied exten- Ϫ Ϫ substantially after IRI. In B6.J␣18 / mice, the severity of renal sively, the activation of type II NKT cells by sulfatide prevents Ϫ Ϫ dysfunction was similar to wild-type mice, but B6.CD1d / mice EAE and concanavalin A-induced hepatitis.25,26 Type II NKT revealed severe dysfunction. (B) Type II NKT-cell activation by cells may regulate type I NKT cells, inhibit effector functions of sulfatide attenuated the degree of IRI in B6 as well as in 26 Ϫ Ϫ conventional T cells, and modify dendritic cell functions. B6.J␣18 / mice in a dose-dependent manner. However, it was Ϫ Ϫ On the basis of the knowledge of the robust inflammatory not effective in B6.CD1d / mice. (C) Adoptive transfer of sul- process that occurs in postischemic kidneys after IRI and the fatide-activated NKT cells protected the kidney from IRI, espe- regulatory functions of sulfatide-reactive type II NKT cell, we cially when the transferred cells were preactivated by sulfatide hypothesized that NKT cells may modulate the initial injury (n ϭ 6/group at each experiment; ns, not significant; *P Ͻ 0.05; process in postischemic kidneys. We compared renal func- **P Ͻ 0.01). tional and structural injury status in a mouse IRI model in which NKT cells were manipulated via in vivo and ex vivo ac- mg/dl [175.03 Ϯ 6.188 ␮mol/L]; P Ͻ 0.05 compared with B6 tivation, depletion, or blocking. Then we analyzed the effect of disease control) (Figure 1A). The in vivo activation of type II NKT cell manipulation on the changes of histology and of mol- NKT cells by sulfatide administration lessened the degree of ecules that may be involved. IRI in B6 as well as in B6.J␣18Ϫ/Ϫ mice in a dose-dependent manner. However, sulfatide was not effective in B6.CD1dϪ/Ϫ mice (Figure 1B). To verify the reno-protective effects of sul- RESULTS fatide-reactive NKT cells, we adoptively transferred NKT cells with ex vivo activation to B6 mice and B6.J␣18Ϫ/Ϫ mice. The Sulfatide-reactive NKT Cells Attenuate Ischemia- adoptive transfer of NKT cells, especially sulfatide-activated Reperfusion Injury cell, induced significant renal protection against IRI in the To determine the specific role of sulfatide-reactive NKT cells both mice (Figure 1C). on IRI in the kidney, renal ischemia was induced. Renal function deteriorated substantially after IRI (sham control versus Changes in the Cytokine Milieu and the Effect of NKT disease control; Cr mg/dl [␮mol/L]; 0.46 Ϯ 0.03 [40.66 Ϯ Cell Activation 2.652] versus 1.59 Ϯ 0.03 [140.56 Ϯ 2.652]; P Ͻ 0.05). In To examine the expression patterns of cytokines that may af- B6.J␣18Ϫ/Ϫ mice, which are deficient in type I NKT cells, the fect the extent of renal damage by IRI, we quantified mRNA severity of renal dysfunction was similar to that of wild-type B6 levels using real-time PCR 1 day after IRI. The proinflamma- mice (Cr 1.67 Ϯ 0.04 mg/dl [147.63 Ϯ 3.536 ␮mol/L]). How- tory cytokines, such as TGF-␤, IFN-␥, monocyte chemotactic ever, in B6.CD1dϪ/Ϫ mice (deficient for both type I and type II protein-1, and IL-6, were upregulated by IRI in B6 and NKT NKT cells), severe renal dysfunction occurred (Cr 1.98 Ϯ 0.07 cell-deficient mice. However, after the adoptive transfer of sul-

1306 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1305–1314, 2011 www.jasn.org BASIC RESEARCH

fatide-activated NKT cells before IRI, the upregulation of pro- IRI in B6 and B6.J␣18Ϫ/Ϫ mice, but not in B6.CD1dϪ/Ϫ mice. inflammatory cytokines was significantly suppressed. Al- Again, the adoptive transfer of sulfatide-activated NKT cells though IRI induced the upregulation of regulatory cytokines attenuated the ischemic changes (Figure 2B), irrespective of (IL-4, IL-10, and IL-13), the sulfatide-activated NKT cell trans- mouse strains. Tubular necrosis was quantified in blinded way. fer enhanced the expression of these cytokines in mice ren- As shown in Figure 2C, the activation of NKT cells significantly dered IRI (Figure 2A). protected tubular necrosis especially in the outer medulla area. The histologic changes were very consistent with the func- When IRI was induced in B6.J␣18Ϫ/Ϫ mice, the degree of ap- tional changes. IRI induced tubular necrosis, which involved optosis was found to be prominent by terminal deoxynucleotidyl disruption and sloughing of tubular epithelial cells. The dam- transferase–mediated digoxigenin-deoxyuridine nick-end label- age was more extensive in B6.J␣18Ϫ/Ϫ and B6.CD1dϪ/Ϫ mice ing (TUNEL) staining. However, the in vivo administration of than in B6 mice. However, the administration of sulfatide re- sulfatide or adoptive transfer of sulfatide-activated NKT cells duced the severity of the pathologic changes that occurred after markedly inhibited apoptosis after IRI in these mice (Figure 2D).

Figure 2. Changes in cytokines, renal histology, and apoptosis induced by the activation of natural killer T (NKT) cells. (A) The expression patterns of intrarenal cytokines were significantly altered by the adoptive transfer of sulfatide-activated NKT cells (n ϭ 6/group at each experiment; *P Ͻ 0.05; **P Ͻ 0.01). (B and C) Ischemia-reperfusion injury (IRI) induced tubular necrosis. The damage Ϫ Ϫ Ϫ Ϫ was more extensive in B6.J␣18 / and B6.CD1d / mice (second column). Administration of sulfatide reduced the necrotic changes Ϫ Ϫ Ϫ Ϫ significantly in B6 and B6.J␣18 / mice but not in B6.CD1d / mice (third column). The adoptive transfer of sulfatide-activated NKT cells attenuated the ischemic damage in mice (fourth column) (magnification, ϫ200). The histologic changes were quantified in blinded way by a renal pathologist. Outer medulla area was the main site that showed significant protection by sulfatide activation (*P Ͻ 0.05; Ϫ Ϫ **P Ͻ 0.01). (D) IRI on B6.J␣18 / mice revealed prominent apoptosis assessed by TUNEL staining, but administration of sulfatide markedly blocked apoptosis process. For each experimental condition, six visual fields were randomly selected for counting the surviving cells with normal nuclear morphology. (*P Ͻ 0.05; **P Ͻ 0.01; magnification, ϫ400).

J Am Soc Nephrol 22: 1305–1314, 2011 Type II NKT Cells Attenuate IRI 1307 BASIC RESEARCH www.jasn.org

Active Participation of NKT Cells at the Site of recruitment after IRI was further confirmed using fluores- Ischemia cently-tagged, sorted NKT cells. When fluorescently-tagged Next, we assessed the notion that NKT cells were involved at cells were introduced via the tail vein after IRI, the transferred the site of inflammation induced by IRI. After IRI, NKT cells cells were detectable in tubulointerstitial area (Figure 3C). were recruited to the kidney, as evidenced by the upregulation The degree of IRI was drastically decreased by the adminis- of V␣14 mRNA expression. In addition, sulfatide-activated tration of sulfatide, but this beneficial effect disappeared when NKT cell transfer enhanced V␣14 mRNA expression in the NKT recruitment was blocked. When anti-CD1d Ab or anti- kidneys (Figure 3A). The number of NK1.1ϩCD3ϩ cells in- CXCL16 Ab were administered after IRI, the protective effect creased in all mice after IRI compared with the sham controls of NKT-cell activation by sulfatide was marginal or abolished as traced by confocal microscopy. However, the number of (Figure 3D). In line with the functional derangement described NK1.1ϩCD3ϩ cells was obviously lower in B6.J␣18Ϫ/Ϫ and in above, ischemic necrosis was worsened when NKT cell recruit- B6.CD1dϪ/Ϫ than in wild-type mice (Figure 3B). NKT cell ment was blocked (Supplemental Figure 1). The blocking of

Figure 3. Recruitment of natural killer T (NKT) cells to the site of injury. (A) V␣14 mRNA expression was upregulated after ischemia-reperfusion injury (IRI). NKT cell transfer after sulfatide activation enhanced the upregulation of intrarenal V␣14 mRNA expression more (n ϭ 6/each group; ns, ϩ ϩ not significant; *P Ͻ 0.05). (B) Trafficking of NKT cells was traced. The number of NK1.1 CD3 cells was increased after IRI compared with sham controls (magnification, ϫ800). (C) CM-DiI-tagged NKT cells were transferred into mice via tail vein after IRI. The transferred NKT cells were detectable at tubulointerstitial area (magnification, ϫ800). DIC, differential interference contrast. (D) The severity of renal injury was significantly reduced by the administration of sulfatide compared with disease control mice, but the beneficial effect of sulfatide disappeared by injection of anti-CD1d Ab (300 ␮g/mouse) or anti-CXCL16 Ab (500 ␮g/mouse) (n ϭ 6/each group; *P Ͻ 0.05; **P Ͻ 0.01). (E) The blocking of cellular trafficking was assessed by V␣14 mRNA expression. Administration of anti-CD1d Ab significantly suppressed intrarenal expression of V␣14. V␣14 mRNA expression was not recovered by the administration of sulfatide (upper panel). Sulfatide administration enhanced the expression of IL-10 after IRI, but it was downregulated by the blocking of NKT cell recruitment regardless of cellular activation (lower panel) (*P Ͻ 0.05). DAPI, 4’,6’diamino-2- phenylindole-2HCl; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

1308 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1305–1314, 2011 www.jasn.org BASIC RESEARCH

cellular trafficking was further confirmed by V␣14 mRNA expression. By the administration of anti-CD1d Ab, the intrarenal expression of V␣14 was almost completely inhibited and could not be restored by the administration of sulfatide. IL-10 expression was enhanced by sulfatide-induced activation of NKT cells, but it was downregulated by the blocking of NKT cell recruitment, regardless of cellular activation (Figure 3E).

Cellular and Molecular Mechanisms of the Protective Effect of Sulfatide-reactive NKT Cells against IRI In sham-operated mice (B6), CD44ϩ T cells constituted 36 to 38% of the intrarenal mononuclear cells, but IRI induced the in- crement of intrarenal T cell population. In vivo administration of sulfatide significantly reduced the number of T cells in wild-type and B6.J␣18Ϫ/Ϫ mice but not in B6.CD1dϪ/Ϫ mice. Again, the adoptive transfer of NKT cells reduced the intrarenal T cell population (Figure 4A). The intrarenal infiltration of inflammatory cells showed kinetics similar to that of T cells. Macrophage infiltration, which was prominent after IRI, was markedly inhibited by in vivo administration of sulfatide. However, the blocking of NKT cell recruitment by an anti-CD1d Ab induced a prominent macrophage infiltration (Figure 4B). The molecular mechanism of the beneficial effect of sulfatide-reactive NKT cells was probed in the context of HIF pathway. HIF-1␣ expression was enhanced by IRI, and NKT- cell activation by sulfatide further increased HIF-1␣ expression. By the administration of anti-CD1d Ab, HIF-1␣ expression was downregulated irrespective of NKT-cell activation (Figure 5A). The target genes of HIF-1␣ showed similar patterns of expression. Glucose transporter-1 (GLUT-1), vascular endothelial growth factor (VEGF), and erythropoietin (EPO) were upregulated by IRI and were further enhanced by sulfatide Figure 4. Effect of natural killer T (NKT)-cell activation on cellular administration, but the inhibition of NKT cell recruitment de- ϩ creased the expression levels of target genes (Figure 5B). recruitment. (A) In sham controls (B6), CD44 T cells were 36 to 38% of intrarenal mononuclear cells. Ischemia-reperfusion injury (IRI) increased the number of intrarenal T cells. In vivo adminis- Activation of NKT Cells Prevents Hypoxic Damage in ϩ tration of sulfatide reduced the number of CD44 T cells after IRI Ϫ Ϫ Ϫ Ϫ Tubular Epithelial Cells (TECs) via HIF-1 and IL-10 in wild-type and B6.J␣18 / mice but not in B6.CD1d / mice. Pathways The adoptive transfer of NKT cells reduced the intrarenal T cell ϩ The physiologic role of sulfatide-reactive NKT cells was further population. (B) Macrophage (F4/80 ) infiltration was prominent evaluated using an in vitro cell culture system. Mouse TECs and after IRI (first row) and was markedly inhibited by in vivo admin- NKT cells were grown separately using the TranswellTM sys- istration of sulfatide (second row). The blocking of NKT cell re- tem. TECs proliferated well under normoxic conditions, and cruitment by anti-CD1d Ab induced prominent macrophage infil- their proliferation was significantly hampered under hypoxic tration regardless of sulfatide administration (third and fourth row) ϫ conditions, but sulfatide-activated NKT cells partially restored (magnification, 200). DIC, differential interference contrast. the proliferation of TECs (Figure 6A). The changes of various cytokine expression were measured using the Bio-Plex tokines (such as IL-8 and IL-6) and upregulation of IL-10 method. IFN-␥ and IL-12, which were upregulated by hypoxia, (Supplemental Figure 2). were downregulated by sulfatide-activated NKT cells, but the The crosstalk between NKT cells and HIF-1␣ was further concentration of IL-10 was increased by NKT-cell activation delineated. When human TECs were exposed to hypoxia, the (Figure 6B). Under hypoxia, human TECs showed reduced apoptotic process progressed with little change in HIF-1␣ ex- proliferation. However, sulfatide-induced activation of pression. The sulfatide-induced activation of human NKT sorted human NKT cells restored their proliferative capacity cells, however, prevented hypoxic TECs from undergoing ap- to a level similar to that observed under normoxia (Figure optosis with an increase in the expression level of HIF-1␣ (Fig- 6C). Like in a murine in vitro system, human NKT-cell ac- ure 6D). The role of IL-10 pathway in NKT cell was also further tivation resulted in downregulation of proinflammatory cy- investigated. Sulfatide-activated type II NKT cells (sorted from

J Am Soc Nephrol 22: 1305–1314, 2011 Type II NKT Cells Attenuate IRI 1309 BASIC RESEARCH www.jasn.org

Ischemia-reperfusion injury is the result of multi-step reactions, including nonim- mune and immune responses. Accumula- tion of neutrophils and macrophages is a hallmark of acute kidney injury.27 Also, the adaptive immunity contributes to renal IRI,3,28 and skewing to Th1 or Th2 environment dictated the degree of severity by IRI.6 Also the regulation of injury by certain cell types such as Foxp3ϩCD4ϩCD25ϩ Tregs is highlighted recently.7,8 Figure 5. Changes of HIF-1 and its target genes in ischemia-reperfusion injury (IRI). We assumed that the distinctive role of (A) HIF-1␣ expression was enhanced by IRI, and sulfatide administration after IRI NKT cell subsets might be critical for deter- ␣ increased HIF-1 expression further. Administration of anti-CD1d Ab reduced mining the magnitude of inflammation ␣ Ͻ Ͻ HIF-1 expression irrespective of sulfatide administration (*P 0.05; **P 0.01). caused by IRI. Although NKT cells have (B) GLUT-1, VEGF, and EPO were upregulated by IRI and were further enhanced by been shown to be important regulators of sulfatide administration. NKT cell blocking by anti-CD1d Ab diminished the ex- the immune response, there are several pression of the target genes (*P Ͻ 0.05; **P Ͻ 0.01). functionally distinct types of cells present. Type II NKT cells have not been investi- B6.J␣18Ϫ/Ϫ mice) rescued TEC proliferation under hypoxia, but gated as thoroughly as type I NKT cells, but several studies have with the use of blocking anti-IL-10 antibody (Ab), the protective shown that these cells are protective against the development capacity of NKT cells was abolished (Figure 6E). The relationship of autoimmune diseases.26,29 The activation of type II NKT between HIF and IL-10 was further examined using a mouse cell cells by sulfatide prevented the development of EAE and hep- line. DN32.D3, a murine NKT cell line, showed the significant atitis in mice.25 Plasma concentration of sulfatide was in- upregulation of HIF-1␣ after sulfatide activation or by rIL-10 un- creased rapidly after IRI and decreased thereafter. Therefore der hypoxic conditions. Again, IL-10 blocking using an anti-IL-10 ischemic insult may provide the chance of NKT-cell activation Ab abolished the upregulation of HIF-1␣ that was induced by (Supplemental Figure 3). sulfatide activation (Figure 6F, left panel). VEGF, one of the target Activated NKT cells have been shown to secrete soluble fac- genes of HIF-1␣, showed expression patterns similar to those of tors in situ and to migrate directly to and act at the site of HIF-1␣ (Figure 6F, right panel). injury.10,30 We further confirmed the notion that NKT cells Finally, we investigated the role of NKT cells in human dis- might suppress inflammation at the site of injury. Usually, IRI ease. Very few NKT cells (CD3ϩV␣24ϩ) were found in normal induces tubular necrosis in outer medullary area. As shown in human kidney specimens, but in kidney biopsy tissues from our work, the transferred NKT cells were localized at the tubu- patients with acute tubular necrosis (ATN), NKT cells were lointerstitial area where the ischemic insult was most promi- observed with an increased frequency (Figure 7). The number nent. In addition, we observed that the ischemic injury was of NKT cells observed in human renal tissue varied according worsened by blocking of NKT cell recruitment, and the degree to the severity of ATN. In patients with severe renal dysfunc- of renal infiltration of NKT cells in ATN patients seemed to be tion, for whom renal replacement therapy was instituted, NKT inversely correlated with the severity of ATN. These results cells were found less frequently than in patients for whom renal suggest that NKT cells recruited in the injured tissues might replacement therapy was not necessary (Table 1 and Figure 8). reduce the extent of injury. Although the results we have acquired appear to differ from those obtained by Li et al.,13 this study do not produce contradictory outcomes. They aimed to DISCUSSION prove the hypothesis that the early activation of type I NKT cell increases IFN-␥ production, which plays a role in the kidney In this study, we demonstrated the protective effects of NKT damage caused by IRI. In this study, on the other hand, we cells, especially sulfatide-reactive type II NKT cells against IRI. tried to evaluate the functional importance of type I and II The trafficking of NKT cells into the site of injury occurred, NKT cells, and we investigated the effect of the specific activa- and the activation of type II NKT cells modulated the cytokine tion of NKT cells on postischemic kidney and scrutinized dif- secretion and inflammatory cell infiltration. The protective ca- ferential roles of type I and type II NKT cells in the early injury pacity of sulfatide-reactive type II NKT cells was associated phase of IRI. Another important point is that the severity of with their ability to enhance the HIF-1␣ and IL-10 pathways. disease is quite different between two works, i.e. in previous Finally, we demonstrated that NKT cells were present and ac- work, the peak serum creatinine at 24 hours was 0.7 mg/dl, tively participated in the process of ATN in human disease. whereas our study yielded a higher level of damage at 1.59 These findings suggest that NKT cells, especially type II NKT mg/dl with wild-type mice. Also, we did not find significant cells, are feasible therapeutic targets for human disease. protective effects by anti-CD1d mAb, although the recruit-

1310 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1305–1314, 2011 www.jasn.org BASIC RESEARCH

Figure 6. Effect of NKT-cell activation on hypoxia. (A) Mouse TECs (3ϫ104/well) and NKT cells (6ϫ104/well) were grown separately in a TranswellTM system. Hypoxia hampered cell proliferation measured by MTS assay, but sulfatide-induced activation of natural killer T (NKT) cells significantly rescued cell proliferation in hypoxic condition (*P Ͻ 0.05). (B) Sulfatide-induced activation of NKT cells differentially regulated the expression of various cytokines measured using the Bio-Plex method. IFN-␥ and IL-12, which were upregulated by hypoxia, were downregulated by sulfatide-activated NKT cells, but the concentration of IL-10 was increased by NKT-cell activation. (C) Sulfatide- induced activation of human NKT cells rescued human TEC proliferation under hypoxic condition (*P Ͻ 0.05). (D) Apoptosis of human TECs was assessed by TUNEL method. Hypoxia induced the apoptosis of human TECs, but the activation of NKT cells by sulfatide reduced the apoptosis with the enhancement of HIF-1␣ (magnification, ϫ600; *P Ͻ 0.05; **P Ͻ 0.01). (E) Activated type II NKT cells rescued cell proliferation of mouse TECs under hypoxic conditions, but the rescued cell proliferation was hampered by the blocking of IL-10 signaling (*P Ͻ 0.05; **P Ͻ 0.01). (F) DN32.D3, murine NKT cell line, were activated by sulfatide in the presence and absence of IL-10 signals. Enhanced expression of HIF-1␣ and VEGF was suppressed by the blocking of IL-10 signaling (*P Ͻ 0.05; **P Ͻ 0.01). ns, not significant.

J Am Soc Nephrol 22: 1305–1314, 2011 Type II NKT Cells Attenuate IRI 1311 BASIC RESEARCH www.jasn.org

Figure 7. Presence of NKT cells in human renal tissues of acute tubular necrosis (ATN). CD3 and V␣24 were traced by confocal ϩ ϩ microscopy (magnification ϫ800). CD3 V␣24 cell were more frequently found in patients with ATN. DIC, differential interference contrast. Figure 8. Requirement of dialysis therapy in patients with ATN compared according to the number of total NKT cells in kidney ment of NKT cells was significantly blocked (Figure 3, D and tissues. Dialysis was instituted more frequently when fewer NKT E). The same cells may have exerted the differential effect ac- cells were present in kidney. cording to the degree of stimuli.10 Key factors in the cellular adaptation to hypoxia include only in our study, NKT activation by sulfatide increased HIF-1 and HIF-2, which are heterodimeric transcription fac- HIF-1␣ expression significantly. Also, the target genes showed tors that consist of an oxygen-sensitive ␣-subunit and a con- similar patterns of expression. This result is consistent with the stitutively expressed ␤-subunit.31 Renal oxygen concentration results of earlier studies. IRI contributes to the innate and adap- may vary by site, which offers more a vulnerable environment tive immune responses that occur during transplantation. IRI for renal medulla in hypoxia. HIF-1 and HIF target genes such may induce acute allograft dysfunction via dendritic cell matura- as EPO, VEGF, and GLUT-1 are upregulated as an adaptive tion that is influenced by HIF regulation. Previous work showed response to hypoxia.32–34 Previous studies have demonstrated that rapamycin attenuated dendritic cell differentiation, HIF-1␣ that chemical preactivation of HIF protected renal IRI and expression, and its target gene expression in a dose-dependent induced upregulation of HIF-target genes.35,36 Although manner.37 The link between hypoxia and immune response was HIF-1␣ expression was marginally enhanced by IRI or hypoxia recently evaluated.38 Hypoxia induced an increase of HIF-1␣ in T

Table 1. Acute tubular necrosis and natural killer T (NKT) cell infiltration in human kidney Case Age Gender Comorbid Condition RRT Number of NKT Cellsa 1 48 Male Diabetic nephropathy No 2 2 63 Female Minimal change disease Yes 3 3 80 Male Minimal change disease No 3 4 72 Male Diabetes mellitus Yes 3 5 46 Female Sepsis Yes 4 6 41 Female Immune mediated glomerulonephritis No 5 7 76 Female Hypertension Yes 6 8 37 Female Thrombotic microangiopathy No 7 9 46 Female Hepatitis A Yes 8 10 31 Female Hypercalcemia No 9 11 18 Female Focal segmental glomerulosclerosis No 9 Calcineurin inhibitor toxicity 12 25 Female None No 11 13 37 Male Henoch Schönlein nephritis No 12 14 69 Female Minimal change disease No 12 15 67 Female Minimal change disease No 14 16 53 Female Diabetes mellitus Yes 15 17 28 Female Hepatitis A Yes 16 18 45 Male Focal segmental glomerulosclerosis No 16 19 81 Female Focal segmental glomerulosclerosis Yes 16 20 78 Female IgA nephropathy No 17 21 24 Female Hepatitis A No 31 22 60 Female Bronchiectasis No 40 23 62 Male Diabetes Mellitus No 77 ATN, acute tubular necrosis; RRT, renal replacement therapy. aNumber of total NKT cells counted in five randomly selected fields.

1312 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1305–1314, 2011 www.jasn.org BASIC RESEARCH cells and increased the potency of regulatory T cells. Furthermore, tal; Abbott, Wiesbaden, Germany). After bilateral flank incisions, HIF-1␣ itself induced an increase in Foxp3 expression as well as in both renal pedicles were crossclamped for 30 minutes with microan- the number of functionally active Tregs. In our study, the sul- eurysm clamps (Roboz Surgical Instrument Co., Gaithersburg, fatide-induced activation of type II NKT cells enhanced HIF-1␣ MD).42 During the procedure, the animals were placed on heating pad and IL-10 expression. Clearly, blocking of NKT cell recruitment (37°C). Prewarmed (37°C) PBS (400 ␮l) was administered subcuta- and IL-10 signaling abolished the beneficial effects of activated neously for optimal fluid balance. The mice were sacrificed 24 hours type II NKT cells with the downregulation of HIF-1␣ expression. after reperfusion (n ϭ 6 to 8/group). Sham-operated mice received IL-10 is also indispensable for exerting the protective property of the same surgical procedure except for the clamping of renal pedicles. Tregs.39 In another set of experiments, anti-CD1d mAb (clone 1B1; 300 ␮g/ Finally, we demonstrated the significance of the presence of mouse per day for Ϫ1 and 0 days, purified from hybridomas) or NKT cells in human renal tissue with ATN. We performed anti-CXCL16 mAb (500 ␮g/mouse for Ϫ1 and 0 days; R & D, Min- kidney biopsy in these ATN patients because the patients neapolis, MN) was used to inhibit CD1d-restricted NKT cell recruit- showed atypical clinical manifestations or had unknown etiol- ment (controls were treated with rIgG2b) or neutralize CXCL16 bio- ogy of ATN. NKT cells (CD3ϩV␣24ϩ) were found rarely in activity. Renal function was evaluated by serum creatinine levels. normal human kidney tissue but frequently found in kidney Creatinine concentration (␮mol/L [mg/dl]) was measured with the tissue from patients suffering from ATN. The number of NKT modified Jaffe´ rate reaction using autoanalyzer (Hitachi Chemical cells varied according to the severity of ATN and the timing of Industries, Ltd., Osaka, Japan). kidney biopsy. Although the causes and severity of ATN were For a detailed explanation of methods relative to in vitro and in diverse in the tissue samples we studied, NKT cells were clearly vivo manipulations, immunohistochemistry, Western blot, flow cy- present in human renal tissues after ischemic damage oc- tometry, quantitative real-time PCR, confocal microscopy, hypoxia- curred. In patients with severe renal dysfunction, for whom the reoxygenation procedure, human and mouse tubular epithelial cell renal replacement therapy was instituted, NKT cells were isolation, and culture, please see the online supplemental data. found less frequently than in patients with less severe renal dysfunction for whom renal replacement therapy was not nec- Statistical Analyses Ϯ Ϯ essary. The result supports our observations that NKT cells The results are expressed as the means SD or the means SEM play a beneficial role in the renal IRI. where appropriate. Statistical analysis was performed using GraphPad In conclusion, our data demonstrate a significant protective Prism 5.0 (GraphPad Software, Inc., San Diego, CA). To compare role for NKT cells, especially sulfatide-reactive type II NKT more than two groups, one- or two-way ANOVA statistical analysis cells, in acute kidney injury caused by ischemia-reperfusion. using Tukey test was performed. Statistical significance was deter- Ͻ Modulation of cellular infiltration and cytokine expressions mined at P 0.05. along with molecular changes such as HIF-1 and IL-10 are the main mechanisms for the protection. In the future, large-scale prospective investigations should be undertaken to provide a ACKNOWLEDGMENTS more comprehensive understanding of the role of NKT cells in human disease. This work was supported by a grant from the Korea Healthcare Tech- nology R & D Project, Ministry for Health and Welfare, Republic of Korea Grant A080656. CONCISE METHODS

All of the experiments were performed under the approval of the Institu- DISCLOSURES tional Animal Care and Use Committee of Clinical Research Institute at None. Seoul National University Hospital and in accordance with the Guide- lines for the Care and Use of Laboratory Animals of the National Re- search Council. All of the experiments dealing with human products were REFERENCES also approved by the internal review board of our institution. 1. Ishani A, Xue JL, Himmelfarb J, Eggers PW, Kimmel PL, Molitoris BA, Experimental Animals Collins AJ: Acute kidney injury increases risk of ESRD among elderly. Male C57BL/6 (B6; 7- to 8-week-old) mice were purchased from Ori- J Am Soc Nephrol 20: 223–228, 2009 Ϫ Ϫ ent Company (Seoul, Korea). B6.CD1d-deficient (B6.CD1d / ) and 2. Kelly KJ, Williams WW, Jr., Colvin RB, Meehan SM, Springer TA, B6.J␣18-deficient (B6.J␣18Ϫ/Ϫ) mice were originally generated by Gutierrez-Ramos JC, Bonventre JV: Intercellular adhesion molecule- 1-deficient mice are protected against ischemic renal injury. J Clin Van Ker and Taniguchi.40,41 All of the mice were raised in a specific Invest 97: 1056–1063, 1996 pathogen-free animal facility. 3. Burne MJ, Daniels F, El Ghandour A, Mauiyyedi S, Colvin RB, O’Donnell MP, Rabb H: Identification of the CD4(ϩ) T cell as a major Induction of Renal IRI pathogenic factor in ischemic acute renal failure. J Clin Invest, 108: The mice were anesthetized with ketamine (100 mg/kg of body 1283–1290, 2001 weight) and pentobarbital sodium (50 mg/kg of body weight Nembu- 4. Jo SK, Sung SA, Cho WY, Go KJ, Kim HK: Macrophages contribute to

J Am Soc Nephrol 22: 1305–1314, 2011 Type II NKT Cells Attenuate IRI 1313 BASIC RESEARCH www.jasn.org

the initiation of ischaemic acute renal failure in rats. Nephrol Dial hydrocarbon oil-induced model of lupus nephritis. J Immunol 171: Transplant, 21: 1231–1239, 2006 2142–2153, 2003 5. Takada M, Chandraker A, Nadeau KC, Sayegh MH, Tilney NL: The role 25. Jahng A, Maricic I, Aguilera C, Cardell S, Halder RC, Kumar V: Prevention of the B7 costimulatory pathway in experimental cold ischemia/rep- of autoimmunity by targeting a distinct, noninvariant CD1d-reactive T cell erfusion injury. J Clin Invest, 100: 1199–1203, 1997 population reactive to sulfatide. J Exp Med 199: 947–957, 2004 6. Yokota N, Burne-Taney M, Racusen L, Rabb H: Contrasting roles for 26. Halder RC, Aguilera C, Maricic I, Kumar V: Type II NKT cell-mediated STAT4 and STAT6 signal transduction pathways in murine renal ischemia- anergy induction in type I NKT cells prevents inflammatory liver disease. reperfusion injury. Am J Physiol Renal Physiol 285: F319–F325, 2003 J Clin Invest 117: 2302–2312, 2007 7. Kinsey GR, Huang L, Vergis AL, Li L, Okusa MD: Regulatory T cells 27. Day YJ, Huang L, Ye H, Linden J, Okusa MD: Renal ischemia-reperfusion contribute to the protective effect of ischemic preconditioning in the injury and adenosine 2A receptor-mediated tissue protection: Role of kidney. Kidney Int 77: 771–780, 2010 macrophages. Am J Physiol Renal Physiol 288: F722–F731, 2005 8. Gandolfo MT, Jang HR, Bagnasco SM, Ko GJ, Agreda P, Satpute SR, 28. Burne-Taney MJ, Ascon DB, Daniels F, Racusen L, Baldwin W, Rabb H: Crow MT, King LS, Rabb H: Foxp3ϩ regulatory T cells participate in B cell deficiency confers protection from renal ischemia reperfusion repair of ischemic acute kidney injury. Kidney Int 76: 717–729, 2009 injury. J Immunol 171: 3210–3215, 2003 9. Taniguchi M, Seino K, Nakayama T: The NKT cell system: Bridging 29. Duarte N, Stenstrom M, Campino S, Bergman ML, Lundholm M, innate and acquired immunity. Nat Immunol 4: 1164–1165, 2003 Holmberg D, Cardell SL: Prevention of diabetes in nonobese diabetic 10. Oh K, Kim S, Park SH, Gu H, Roopenian D, Chung DH, Kim YS, Lee DS: mice mediated by CD1d-restricted nonclassical NKT cells. J Immunol Direct regulatory role of NKT cells in allogeneic graft survival is de- 173: 3112–3118, 2004 pendent on the quantitative strength of antigenicity. J Immunol 174: 30. Campos RA, Szczepanik M, Itakura A, Akahira-Azuma M, Sidobre S, 2030–2036, 2005 Kronenberg M, Askenase PW: Cutaneous immunization rapidly acti- 11. Yang SH, Jin JZ, Lee SH, Park H, Kim CH, Lee DS, Kim S, Chung NH, vates liver invariant Valpha14 NKT cells stimulating B-1 B cells to Kim YS: Role of NKT cells in allogeneic islet graft survival. Clin Immu- initiate T cell recruitment for elicitation of contact sensitivity. J Exp nol 124: 258–266, 2007 Med 198: 1785–1796, 2003 12. Ascon DB, Lopez-Briones S, Liu M, Ascon M, Savransky V, Colvin RB, 31. Haase VH: Hypoxia-inducible factors in the kidney. Am J Physiol Renal Soloski MJ, Rabb H: Phenotypic and functional characterization of Physiol 291: F271–F281, 2006 kidney-infiltrating lymphocytes in renal ischemia reperfusion injury. 32. Rosenberger C, Mandriota S, Jurgensen JS, Wiesener MS, Horstrup J Immunol 177: 3380–3387, 2006 JH, Frei U, Ratcliffe PJ, Maxwell PH, Bachmann S, Eckardt KU: Expres- 13. Li L, Huang L, Sung SS, Lobo PI, Brown MG, Gregg RK, Engelhard VH, sion of hypoxia-inducible factor-1alpha and -2alpha in hypoxic and Okusa MD: NKT cell activation mediates neutrophil IFN-gamma pro- ischemic rat kidneys. J Am Soc Nephrol 13: 1721–1732, 2002 duction and renal ischemia-reperfusion injury. J Immunol 178: 5899– 33. Rosenberger C, Rosen S, Shina A, Bernhardt W, Wiesener MS, Frei U, 5911, 2007 Eckardt KU, Heyman SN: Hypoxia-inducible factors and tubular cell 14. Benlagha K, Weiss A, Beavis A, Teyton L, Bendelac A: In vivo identi- survival in isolated perfused kidneys. Kidney Int 70: 60–70, 2006 fication of glycolipid antigen-specific T cells using fluorescent CD1d 34. Nangaku M, Eckardt KU: Hypoxia and the HIF system in kidney dis- tetramers. J Exp Med 191: 1895–1903, 2000 ease. J Mol Med 85: 1325–1330, 2007 15. Stein-Streilein J: Invariant NKT cells as initiators, licensors, and facilitators 35. Matsumoto M, Makino Y, Tanaka T, Tanaka H, Ishizaka N, Noiri E, of the adaptive immune response. J Exp Med, 198: 1779–1783, 2003 Fujita T, Nangaku M: Induction of renoprotective gene expression by 16. Arrenberg P, Halder R, Kumar V: Cross-regulation between distinct cobalt ameliorates ischemic injury of the kidney in rats. JAmSoc natural killer T cell subsets influences immune response to self and Nephrol 14: 1825–1832, 2003 foreign antigens. J Cell Physiol, 218: 246–250, 2009 36. Ma D, Lim T, Xu J, Tang H, Wan Y, Zhao H, Hossain M, Maxwell PH, 17. Jiang X, Shimaoka T, Kojo S, Harada M, Watarai H, Wakao H, Ohko- Maze M: Xenon preconditioning protects against renal ischemic-rep- hchi N, Yonehara S, Taniguchi M, Seino K: Cutting edge: Critical role erfusion injury via HIF-1alpha activation. J Am Soc Nephrol 20: 713– of CXCL16/CXCR6 in NKT cell trafficking in allograft tolerance. J Im- 720, 2009 munol 175: 2051–2055, 2005 37. Rama I, Bruene B, Torras J, Koehl R, Cruzado JM, Bestard O, Fran- 18. Yang SH, Kim SJ, Kim N, Oh JE, Lee JG, Chung NH, Kim S, Kim YS: quesa M, Lloberas N, Weigert A, Herrero-Fresneda I, Gulias O, Grinyo NKT cells inhibit the development of experimental crescentic glomer- JM: Hypoxia stimulus: An adaptive immune response during dendritic ulonephritis. J Am Soc Nephrol 19: 1663–1671, 2008 cell maturation. Kidney Int 73: 816–825, 2008 19. Bendelac A: Selection and adaptation of cells expressing major histo- 38. Ben-Shoshan J, Maysel-Auslender S, Mor A, Keren G, George J: compatibility complex class I-specific receptors of the natural killer Hypoxia controls CD4ϩCD25ϩ regulatory T-cell homeostasis via hy- complex. J Exp Med 186: 349–351, 1997 poxia-inducible factor-1alpha. Eur J Immunol 38: 2412–2418, 2008 20. Porcelli SA, Modlin RL: The CD1 system: Antigen-presenting mole- 39. Kinsey GR, Sharma R, Huang L, Li L, Vergis AL, Ye H, Ju ST, Okusa MD: cules for T cell recognition of lipids and glycolipids. Annu Rev Immu- Regulatory T cells suppress innate immunity in kidney ischemia-rep- nol 17: 297–329, 1999 erfusion injury. J Am Soc Nephrol 20: 1744–1753, 2009 21. Hong S, Wilson MT, Serizawa I, Wu L, Singh N, Naidenko OV, Miura T, 40. Cui J, Shin T, Kawano T, Sato H, Kondo E, Toura I, Kaneko Y, Koseki Haba T, Scherer DC, Wei J, Kronenberg M, Koezuka Y, Van Kaer L: The H, Kanno M, Taniguchi M: Requirement for Valpha14 NKT cells in natural killer T-cell ligand alpha-galactosylceramide prevents autoim- IL-12-mediated rejection of tumors. Science 278: 1623–1626, 1997 mune diabetes in non-obese diabetic mice. Nat Med 7: 1052–1056, 2001 41. Kawano T, Cui J, Koezuka Y, Toura I, Kaneko Y, Motoki K, Ueno H, 22. Singh AK, Wilson MT, Hong S, Olivares-Villagomez D, Du C, Stanic Nakagawa R, Sato H, Kondo E, Koseki H, Taniguchi M: CD1d-re- AK, Joyce S, Sriram S, Koezuka Y, Van Kaer L: Natural killer T cell stricted and TCR-mediated activation of valpha14 NKT cells by glyco- activation protects mice against experimental autoimmune encepha- sylceramides. Science 278: 1626–1629, 1997 lomyelitis. J Exp Med 194: 1801–1811, 2001 42. Okusa MD, Linden J, Macdonald T, Huang L: Selective A2A adenosine 23. Oh K, Byoun O, Ham DI, Kim YS, Lee DS: Invariant NKT cells regulate receptor activation reduces ischemia-reperfusion injury in rat kidney. experimental autoimmune uveitis through inhibition of Th17 differen- Am J Physiol 277: F404–F412, 1999 tiation. Eur J Immunol 41: 392–402, 2011 24. Yang JQ, Singh AK, Wilson MT, Satoh M, Stanic AK, Park JJ, Hong S, Gadola SD, Mizutani A, Kakumanu SR, Reeves WH, Cerundolo V, Supplemental information for this article is available online at http://www.jasn. Joyce S, Van Kaer L, Singh RR: Immunoregulatory role of CD1d in the org/.

1314 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1305–1314, 2011 Supplemental information

Expanded Methods

Administration of Sulfatide

To identify the protective effect of sulfatide-reactive NKT cells, sulfatide (10 μg or 20 μg, Sigma-Aldrich, St. Louis, MO, USA) or PBS (300 μl/mouse) was introduced intraperitoneally (i.p.) three hours before IR surgery.

Isolation and adoptive transfer of hepatic NKT cells

For reconstitution of NKT cells, hepatic mononuclear cells (HMCs) were prepared from B6 and B6.Jα18-/- mice as followings. Mice were injected i.p. with/without 20 μg sulfatide (Sigma-Aldrich). After three hours, mice were perfused with chilled PBS. The liver of the mice was smashed, dispersed in loading buffer (1PBS plus 10% FBS and 1mM EDTA), passed through a stainless steel mesh, overlaid onto lympholyte M (Cedarlane, Hornby, Ontario,

Canada), and centrifuged at 950 g at 25oC for 20 minutes. More than 20% of isolated HMCs was identified as NKT cells defined by double positivity against

NK1.1 and TCR-β. Sorted NKT cells were determined using rat anti-mouse PE- conjugated anti-NK1.1 and PE-Cy5-conjugated anti-TCR-β (BD PharMingen,

San Diego, CA, USA). Flow cytometric sorting was performed with FACS

Calibur instrument using CellQuest software (BD Biosciences, Franklin Lakes,

NJ, USA) and the purity of sorted cells was > 98%. Sorted NKT cells were transferred into B6, B6.Jα18-/- and B6.CD1d-/- mice intravenously, 1 x 106 in 300

μl of PBS/mouse at 3 hours before renal IRI.

Human kidney evaluation

We collected unstained slides from 10 patients who were diagnosed as biopsy- proven ATN to evaluate whether NKT cells have a beneficial effect for ischemia reperfusion injury in human.

The number of CD3+Vα24+cells was measured by con-focal microscopic examination. The number of NKT cell was counted in five randomly selected fields per biopsy tissue. Sections were evaluated in a blinded fashion.

Histological analysis For histological analysis, 4 μm thick paraffin sections were stained with periodic acid-Schiff reagent. Tubular injury was with the percentage of necrotic tubules and cast among total tubules by a renal pathologist in a blind fashion.

Con-focal microscopic examination

Confocal microscopy was performed with LSM510 META laser confocal microscope (Carl Zeiss, Jena, Germany). Paraffin sections of the kidney were obtained 24 hours after administration of sulfatide (20 μg/mouse, i.p.). For the immunofluorescence study, paraffin-embedded kidney was cut into 4 μm slices.

Xylene and ethanol were used for depraffinization and hydration. Apoptosis was estimated by detecting fragmented chromosomal DNA by TUNEL (Roche

Mannheim, Mannheim, Germany) assay according to the manufacturer’s instructions. TUNEL-positive nuclei were expressed as a percentage of total nuclei per six fields. Nuclei were visualized using 4'-6-Diamidino-2-phenylindole

(DAPI, Molecular Probes, Eugene, OR). In another set of experiments, the sections were stained with rabbit anti-mouse CD3 (BD Biosciences), mouse anti-mouse NK1.1 (Biolegend, San Diego, USA), rabbit anti-mouse HIF-1α, rat anti-mouse F4/80 (Serotec, Raleigh, NC, USA), and mouse anti-human Vα24 (Beckman coulter, Marseille, France) in a blocking reagent overnight at 4oC. A second layer of Alexa Fluor® 488-conjugated goat anti-rabbit antibody, Alexa

Fluor® 555-conjugated goat anti-rabbit antibody, Alexa Fluor® 555-conjugated anti-mouse antibody, and Alexa Fluor® 555-conjugated anti-rat antibody

(Molecular Probes) were used as secondary antibodies, respectively. All sections were washed and incubated for an additional 5 minutes with DAPI for counterstaining. For negative control, primary antibodies were omitted from sections.

Intra-renal localization of NKT cells

The sorted NKT cells were labeled with a fluorescence Cell TrackerTM, CM-DiI

(Molecular Probes), by incubation in Hank’s balanced salt solution (HBSS) that contained 3 μg/ml CM-DiI and DAPI for 5 minutes at 37oC, and then for an additional 15 minutes at 4oC. Labeled NKT cells were transferred into B6.Jα18-/- mice or B6.CD1d-/- mice intravenously, 1106 in 300 μl of PBS/mouse 3 hours before IRI. The kidneys were snap-frozen in OCT embedding medium (Miles

Inc., Elkhart, IN), cooled to −80oC and 5 μm thick sections were made with cryostat (Leica, Heidelberger, Germany). Frozen sections were fixed for 10 minutes in cold aceton. Intra-renal localization of NKT cells was measured by con-focal microscopic examination.

Flow cytometry analysis

For quantitative flow cytometry analysis, intra-renal mononuclear cells were isolated from B6 mouse kidney homogenates using Stomacher 80 Biomaster

(Seward, Worthing, West Sussex, UK). Single-cell suspensions were created by passing tissue through a 40 μm cell strainer. Kidneys were resuspended in 36%

Percoll (Amersham Pharmacia Biotech, Piscataway, NJ, USA) and overlaid onto

72% Percoll. After 30 minutes of centrifuge at 1000 g at 25oC, renal mononuclear cells were isolated from the interface. Isolated renal mononuclear cells were incubated with PE-conjugated anti-CD44T (BD PharMingen).

Blood was collected from 5 healthy volunteers, and human peripheral blood mononuclear cells (PBMCs) were isolated directly by using Ficolpaque Plus density gradient centrifugation (Amersham Biosciences, Roosendaal,

Netherlands). PBMCs were washed in RPMI1640 medium with 1% fetal bovine serum and 1 mM EDTA. Human NKT cells were identified by surface markers

[ie., anti-CD3 (for T lymphocytes, BD PharMingen) and anti-CD56 (for NK cells, BD PharMingen)]. Stained cells were sorted and analyzed using FACS Calibur instrument (BD Biosciences).

Quantitative real-time PCR

Renal tissues were harvested from mice 24 hours after the induction of IRI.

Total RNA was extracted from renal tissues and the cytokine mRNA level was assayed by real-time PCR. Briefly, total RNA was isolated from the kidney using the RNeasy kit (Qiagen GmBH, Hilden, Germany) and 1 μg of total RNA was reverse-transcribed using oligo-d(T) primers and AMV-RT Taq polymerase

(Promega, Madison, WI, USA). Real-time PCR was performed using Assay-on-

Demend TaqMan probes and primers for TGF-β1, IFN-γ, MCP-1, IL-6, IL-4, IL-

10, IL-13, HIF-1α, GLUT-1, VEGF, EPO, and GAPDH (Applied Biosystems,

Foster City, CA, USA) and ABI PRISM 7500 Sequence Detection System.

Vα14Jα18 TCR primers were synthesized by Applied Biosystems Vα14Jα18

TCR: forward, GTGTGGTGGGCGATAGAGGT, reverse,

ACAACCAGCTGAGTCCCAGC, and probe, FAM-

CAGCCTTAGGGAGGCTGCATTTTGG-TAMRA. The level of mRNA expression of each cytokine was normalized with respect to the level of GAPDH mRNA expression.

Western blot analysis

Western immunoblot analysis was performed using primary antibodies against to HIF-1α (Novus Biologicals, Littleton, CO, USA) and β-actin (Sigma-Aldrich,

Saint Louis, MO, USA). Briefly, Equal amounts (80 μg) of extracted protein were separated by 10% SDS-polyacrylamide gels and transferred onto Immobilon-FL

0.4 μM polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The anti-rabbit IgG (Vector Laboratories, Burlingame, CA, USA) were used as secondary antibodies. The blots were developed and enhanced using the Super

Signal West Pico Chemiluminescent Substrate (Pierce, Woburn, MA, USA). The intensity of the bands was analyzed by Gel documentation system (Bio-Rad Gel

Doc 1000 and Multi-Analyst® version 1.1).

Isolation of renal tubular epithelial cells (TECs)

B6 kidneys were flushed with 1PBS in vivo to remove red blood cells. Kidneys were cut into pieces and then digested with HBSS containing 3 mg/ml of collagenase (Sigma). The kidney digest was washed through a series of sieves (120, 75, 40 μm) with 1PBS. Cortical tubular cells were isolated by centrifugation at 500 g over 5 minutes. The cells were incubated in DMEM/F12 medium. After 4 hours, the non-adherent tubules were collected and cultured on collagen-coated petridishes (BD Biosciences) in medium until epithelial colonies were established.1 Passages 3 to 4 were used for the study. Primary human

TECs (hTECs) were isolated from unaffected specimens from surgically resected kidneys in patients diagnosed as renal cell carcinoma, and kidney cortex was dissected mechanically. The same protocol for isolation of mouse cells was applied.

Hypoxia and re-oxygenation hTECs were grown to confluence in 24-well chamber slides. Cells were placed in serum-free DMEM/F12 medium for 24 hours, and then washed twice with

PBS. Transwells with 0.02 μm pore membranes in 24-well plates (Nunc,

Roskilde, Denmark) were used. hTECs (1105/well) were incubated in the lower chamber and sorted human NKT cells [2105/well, added sulfatide (20

μg/ml)] were incubated in the upper chamber at a hypoxic condition (1% O2, 6 hours). After the hypoxic period, cells were placed under a normoxic condition (20% O2) for 18 hours. After total 24 hours, cells were harvested. In another set of experiments, Vα14 CD1d-specific NKT hybridoma DN32.D3 (ATCC) cells

(1105/well) were cultured with sulfatide (20 μg/ml), with/without an anti-IL-10

Ab (40 μg/ml, R&D), and recombinant IL-10 (500 ng/ml, R&D) in a hypoxic condition. Goat IgG (40 μg/ml, R&D) was used as a control. Cells were also placed back to a normoxic condition. Thereafter, cells were maintained in medium for 24 hours.

Cell proliferation and measurement of cytokine production assay

TECs (3104/well) were co-cultured with B6 or B6.Jα18-/- hepatic NKT cells

(6104/well) by Transwell in 96-well plates. Cells were incubated in hypoxia/reoxygenation condition. After a total of 24 hours in culture, proliferation of TECs was determined using colorimetric MTS assay kits (Promega

Corporation, Madison, WI, USA) according to the manufacturer’s instructions.

NKT cells were activated by sulfatide (10 or 20 μg/ml) and rIL-10 (500 ng/ml).

Supernatants were collected after 24 hours of culture. For blocking assay, TECs were incubated with an anti-IL-10 neutralizing antibody (40 μg/ml, R&D) for 1 hour at 37°C before adding sulfatide. Supernatants were then assayed for cytokines using a multiplex cytokine bead array system (Bio-Plex; Bio-Rad,

Hercules, CA, USA) according to the manufacturer's instructions. The same protocol was applied for hTECs.

Quantification of systemic sulfatide concentration

To measure the systemic concentration of sulfatide, we obtained plasma samples 1.5 and 3 hours after the induction of IRI from mice treated with sulfatide (20 μg i.p.). Sulfatide concentrations were quantified using a validated high-performance liquid chromatography/mass spectrometry/mass spectrometry/mass (HPLC/MS/MS) method, as previously described.2 Briefly, plasma sulfatides was measured with 3-Sulfo-β-D-C18-galactosylceramide and

N-C18:0-D3-sulfatide, purchased from Matreya LLC (Pleasant Gap, PA, USA) using a method described elsewhere with minor modification. For extraction of serum lipids, 50 μL of plasma or calibrators were extracted with 100 μL of

methanol, 50 μL of KH2PO4 and 300 μL of chloroform containing 48 nmol of N-

C18:0-D3-sulfatide as an internal standard. After vortexing 5 min, lower chloroform layer containing sulfatides was dried under a gently stream of nitrogen. The lipid extract was then reconstituted in 100 μL of methanol. Ten microliters of each sample was analyzed in a Waters ACQUITY UPLC® (Waters,

MA, USA) using a C18 guard cartridge eluted with 5 mmol/L of ammonium acetate in chloroform-methanol-acetic acid (97:2:0.5 by volume) at a constant flow rate of 70 μL/min. Quantification of sulfatides was performed by multiple- reaction monitoring (MRM) in negative ion mode using the transitions of m/z

778>97, m/z 794>97, m/z 806>97, m/z 806>97 (internal standard), m/z 822>97, m/z 834>97, m/z 850>97, m/z 862>97, m/z 876>97, m/z 878>97, m/z 888>97, m/z 890>97, m/z 892>97, m/z 904>97 and m/z 906>97. A XevoTM TQ mass spectrometry (Waters) was operated with the following settings; capillary voltage, 3.0 kV; cone voltage, 100 V; collision energy 70 V. Quantification was achieved by relating the peak areas of plasma sulfates to the peak area of the internal standard. The sulfatide concentration was calculated from the summed values of each of molecular species. A six-point external calibration was performed in all experiment with the use of 3-sulfo-β-D-C18-galactosylceramide.

References

1. Wu H, Chen G, Wyburn KR, Yin J, Bertolino P, Eris JM, Alexander SI, Sharland AF,

Chadban SJ: TLR4 activation mediates kidney ischemia/reperfusion injury. J

Clin Invest, 117: 2847-59, 2007.

2. Hsu FF, Turk J: Studies on sulfatides by quadrupole ion-trap mass spectrometry

with electrospray ionization: structural characterization and the fragmentation

processes that include an unusual internal galactose residue loss and the

classical charge-remote fragmentation. J Am Soc Mass Spectrom, 15: 536-46,

2004.

Supplemental figure 1. Blocking of NKT cell recruitment induced severe tubular necrosis B6 mice were injected with anti-CD1d Ab (300 μg/mouse for −1 and 0 days, i.p) or anti-CXCL16 Ab (500 μg/mouse for −1 and 0 days, i.p). NKT cells were activated by sulfatide (20 μg/mouse, i.p) 3 hours before renal IRI. (magnification 

200). Blocking of NKT cell recruitment induced severe tubular necrosis (original magnification  200). The histological changes were quantified in blinded way by a renal pathologist. IM; Inner Medulla, OM; Outer Medulla

Supplemental figure 2. The changes of various cytokines were traced using culture supernatant in co-culture of human tubular epithelial cells (6104/well) and NKT cells (3104/well). Cells were stimulated with sulfatide (20 μg/ml) for 24 hours. The measurement of IL-8, IL-6, IL-4 and IL-10 productions level by Bio-Plex assay.

Samples were triplicated. The changes of various cytokines were traced using culture supernatant in co-culture of human tubular epithelial cells and NKT cells.

Supplemental figure 3.

Plasma concentration of sulfatide was measured by HPLC/MS/MS. Induction of IRI elevated the plasma concentration of endogenous sulfatide at the early period of IRI, and it was decreased at 3 hours after IRI induction. When we injected exogenous sulfatide, the serum level was maintained as elevated up to 3 hours after IRI. (*

P<0.05, ** P<0.01)