DOCSLIB.ORG

Lactic Acid Axis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Lactic Acid Axis The Journal of Neuroscience, October 21, 2015 • 35(42):14353–14369 • 14353 Neurobiology of Disease Metabolic Connection of Inflammatory Pain: Pivotal Role of a Pyruvate Dehydrogenase Kinase-Pyruvate Dehydrogenase- Lactic Acid Axis Mithilesh Kumar Jha,1 Gyun Jee Song,1 Maan Gee Lee,1 Nam Ho Jeoung,2 Younghoon Go,3 Robert A. Harris,4 Dong Ho Park,5 Hyun Kook,6 In-Kyu Lee,3 and Kyoungho Suk1 1Department of Pharmacology, Brain Science and Engineering Institute, BK21 Plus KNU Biomedical Convergence Program, Kyungpook National University School of Medicine, Daegu, 700-422, Republic of Korea, 2Department of Pharmaceutical Science and Technology, Catholic University of Daegu, Gyeongsan, Republic of Korea, 3Department of Internal Medicine, Division of Endocrinology and Metabolism, Kyungpook National University School of Medicine, Daegu, 700-422, Republic of Korea, 4Roudebush Veterans Administration Medical Center and the Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana 46202, 5Department of Ophthalmology, Kyungpook National University School of Medicine, Daegu, 700-422, Republic of Korea, and 6Department of Pharmacology, Chonnam National University Medical School, Gwangju, 501-746, Republic of Korea Pyruvate dehydrogenase kinases (PDK1–4) are mitochondrial metabolic regulators that serve as decision makers via modulation of pyruvate dehydrogenase (PDH) activity to convert pyruvate either aerobically to acetyl-CoA or anaerobically to lactate. Metabolic dysregulation and inflammatory processes are two sides of the same coin in several pathophysiological conditions. The lactic acid surge associated with the metabolic shift has been implicated in diverse painful states. In this study, we investigated the role of PDK- PDH-lactic acid axis in the pathogenesis of chronic inflammatory pain. Deficiency of Pdk2 and/or Pdk4 in mice attenuated complete Freund’s adjuvant (CFA)-induced pain hypersensitivities. Likewise, Pdk2/4 deficiency attenuated the localized lactic acid surge along with hallmarks of peripheral and central inflammation following intraplantar administration of CFA. In vitro studies supported the role of PDK2/4 as promoters of classical proinflammatory activation of macrophages. Moreover, the pharmacological inhibition of PDKs or lactic acid production diminished CFA-induced inflammation and pain hypersensitivities. Thus, a PDK-PDH-lactic acid axis seems to mediate inflammation-driven chronic pain, establishing a connection between metabolism and inflammatory pain. Key words: chronic inflammatory pain; inflammation; macrophages; metabolism; pain; PDK-PDH-lactic acid axis Significance Statement The mitochondrial pyruvate dehydrogenase (PDH) kinases (PDKs) and their substrate PDH orchestrate the conversion of pyru- vate either aerobically to acetyl-CoA or anaerobically to lactate. Lactate, the predominant end product of glycolysis, has recently been identified as a signaling molecule for neuron-glia interactions and neuronal plasticity. Pathological metabolic shift and subsequent lactic acid production are thought to play an important role in diverse painful states; however, their contribution to inflammation-driven pain is still to be comprehended. Here, we report that the PDK-PDH-lactic acid axis constitutes a key component of inflammatory pain pathogenesis. Our findings establish an unanticipated link between metabolism and inflamma- tory pain. This study unlocks a previously ill-explored research avenue for the metabolic control of inflammatory pain pathogenesis. Introduction 2011). Emerging evidence has outlined the crosstalk between in- Chronic inflammation has been identified as a central feature of flammatory processes and metabolic dysregulation under patho- the metabolic syndrome (Hotamisligil, 2006; Lumeng and Saltiel, logical conditions (Palomer et al., 2013). Cells participating in Received May 18, 2015; revised Sept. 14, 2015; accepted Sept. 14, 2015. This work was supported by Korea Healthcare Technology R&D Project, Ministry of Health and Welfare, Republic Author contributions: M.K.J. and K.S. designed research; M.K.J. performed research; G.J.S., M.G.L., N.H.J., Y.G., of Korea Grants A111345 and HI14C3331 and the Basic Science Research Program through the National Research R.A.H., D.H.P., H.K., and I.-K.L. contributed unpublished reagents/analytic tools; M.K.J., G.J.S., N.H.J., Y.G., R.A.H., Foundation funded by the Korean Ministry of Education, Science, and Technology 2008-0062282. D.H.P., H.K., I.-K.L., and K.S. analyzed data; M.K.J. and K.S. wrote the paper. The authors declare no competing financial interests. 14354 • J. Neurosci., October 21, 2015 • 35(42):14353–14369 Jha et al. • PDK-PDH-Lactic Acid Axis in Inflammatory Pain inflammation experience diverse metabolic changes, including a a different reactivity for these three sites, and phosphorylation at shift toward enhanced glucose uptake and glycolysis. Altered me- any site leads to the inhibition of PDH activity. Dysregulation of tabolism may participate in signal-directed programs that pro- the PDH/PDK system has been implicated in life-threatening mote or inhibit inflammation (O’Neill and Hardie, 2013). neurometabolic disorders, including Alzheimer’s disease, trau- Mitochondrial metabolic shift has been identified as a hallmark matic brain injury, brain aging, and glioblastoma (Jha et al., 2012; of highly prevalent diseases, such as obesity/diabetes, cancer Palamiuc et al., 2015). PDK-induced phosphorylation and sub- (Ramos-Nino, 2013), and cardiovascular disease (Nisoli et al., sequent inactivation of PDC result in metabolic shift toward gly- 2007). Mitochondrial malfunction, aberrant glucose metabo- colysis and lactate production, which led us to hypothesize that lism, and the subsequent dysregulation of bioenergetics are con- lactic acid produced under this condition may have tremendous sistent antecedents to the pathophysiology of the nervous system effects on inflammation and pain behaviors. Thus, a PDK-PDH- as well (Jha et al., 2012). Accumulating evidence has implicated lactic acid axis may be a key component that governs chronic the metabolic shift (Joseph and Levine, 2006), reactive oxygen inflammatory pain development. This possibility was tested us- species (Kim et al., 2004), genetic defects (Joseph and Levine, ing Pdk2- and Pdk4-deficient mice and chemical inhibitors of 2010), diabetes (Fernyhough et al., 2010), chemotherapeutics PDK or lactic acid production in the complete Freund’s adjuvant (Bennett, 2010), and HIV infection (Ferrari and Levine, 2010)in (CFA)-injected rodent model of inflammatory pain. Macro- the pathogenesis of painful peripheral neuropathies. These stud- phages in culture were also used to examine the mechanistic re- ies suggest that modulation of mitochondrial function is a prom- lationship between PDKs and proinflammatory phenotypes. ising therapeutic strategy for the management of diverse pain states (Baloh, 2008). Materials and Methods Pain hypersensitivity that results from infection, inflamma- Mouse breeding and maintenance. All experiments were conducted in tion, or peripheral injury to tissue is collectively called inflamma- accordance with approved animal protocols and guidelines established tory pain (Kopach et al., 2012). The development of pain by the Animal Care Committee of Kyungpook National University (ap- hypersensitivity in response to inflammatory insults/stimuli is proval no. KNU-2012–73/66). All efforts were made to minimize the due to peripheral (Basbaum et al., 2009) and central sensitiza- number of animals used and animal suffering. Male wild-type (WT, ϩ ϩ ϩ ϩ Ϫ Ϫ tions (Kuner, 2010). Recruitment of immune/inflammatory cells Pdk2 / Pdk4 / ), Pdk2 knock-out (Pdk2 / ), Pdk4 knock-out Ϫ/Ϫ Ϫ/Ϫ Ϫ/Ϫ in response to inflammatory insult and the subsequent release of (Pdk4 ), and Pdk2/4 double knock-out (DKO, Pdk2 Pdk4 ) proinflammatory/algesic mediators activate peripheral nocicep- mice 8–10 weeks of age were used. Pdk2 KO and Pdk4 KO mice were tors resulting in peripheral sensitization, whereas the long-term generated as previously described (Jeoung et al., 2012). Pdk2 KO mice were crossed with Pdk4 KO mice to produce Pdk2/4 DKO mice. Age- potentiation in the spinal cord is regarded as a unique form of matched WT mice were produced from the C57BL/6J black mice (The central sensitization (Ji et al., 2013). Lactic acid, the predominant Jackson Laboratory) that were used to stabilize the genetic backgrounds end product of glycolysis (Rogatzki et al., 2015), has recently been of the Pdk2 KO and Pdk4 KO mice. Heterozygous animals were crossed identified as a signaling molecule for neuron–glia interactions to generate littermate control animals, which were used to confirm the (Tang et al., 2014) and neuronal plasticity (Yang et al., 2014). findings of behavioral studies. Genotypes were confirmed by PCR of the Lactic acid also contributes to pathological pain by facilitating genomic DNA as described previously (Herbst et al., 2014). Animals were nociceptor activation via lowered pH (Kim et al., 2007). Muscle housed under a 12 h light/dark cycle (lights on 07:00–19:00) at a constant Ϯ ischemia or microvascular dysfunction generates lactic acid and ambient temperature of 23 2°C with food and water provided ad inflammatory mediators that play a crucial role in the develop- libitum. Each individual animal was used in only one experiment. ment of cutaneous tactile allodynia by activating acid sensing ion CFA-induced chronic/persistent inflammation.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Pparδ and FOXO1 Mediate Palmitate-Induced Inhibition of Muscle Pyruvate Dehydrogenase Complex and CHO Oxidation, Events Reversed by Electrical Pulse Stimulation
    International Journal of Molecular Sciences Article PPARδ and FOXO1 Mediate Palmitate-Induced Inhibition of Muscle Pyruvate Dehydrogenase Complex and CHO Oxidation, Events Reversed by Electrical Pulse Stimulation Hung-Che Chien 1,2 , Paul L. Greenhaff 1 and Dumitru Constantin-Teodosiu 1,* 1 School of Life Sciences, University of Nottingham, Queen’s Medical Centre, Nottingham NG7 2UH, UK; [email protected] (H.-C.C.); paul.greenhaff@nottingham.ac.uk (P.L.G.) 2 Department of Physiology and Biophysics, National Defense Medical Centre, Taipei 11490, Taiwan * Correspondence: [email protected]; Tel.: +44-115-8230111 Received: 20 July 2020; Accepted: 15 August 2020; Published: 18 August 2020 Abstract: The mechanisms behind the reduction in muscle pyruvate dehydrogenase complex (PDC)-controlled carbohydrate (CHO) oxidation during chronic high-fat dietary intake are poorly understood, as is the basis of CHO oxidation restoration during muscle contraction. C2C12 myotubes were treated with (300 µM) palmitate or without (control) for 16 h in the presence and absence of electrical pulse stimulation (EPS, 11.5 V, 1 Hz, 2 ms). Compared to control, palmitate reduced cell glucose uptake (p < 0.05), PDC activity (p < 0.01), acetylcarnitine accumulation (p < 0.05) and glucose-derived mitochondrial ATP production (p < 0.01) and increased pyruvate dehydrogenase kinase isoform 4 (PDK4) (p < 0.01), peroxisome proliferator-activated receptor alpha (PPARα)(p < 0.01) and peroxisome proliferator-activated receptor delta (PPARδ)(p < 0.01) proteins, and reduced the whole-cell p-FOXO1/t-FOXO1 (Forkhead Box O1) ratio (p < 0.01). EPS rescued palmitate-induced inhibition of CHO oxidation, reflected by increased glucose uptake (p < 0.01), PDC activity (p < 0.01) and glucose-derived mitochondrial ATP production (p < 0.01) compared to palmitate alone.
    [Show full text]
  • ROS Production Induced by BRAF Inhibitor Treatment Rewires
    Cesi et al. Molecular Cancer (2017) 16:102 DOI 10.1186/s12943-017-0667-y RESEARCH Open Access ROS production induced by BRAF inhibitor treatment rewires metabolic processes affecting cell growth of melanoma cells Giulia Cesi, Geoffroy Walbrecq, Andreas Zimmer, Stephanie Kreis*† and Claude Haan† Abstract Background: Most melanoma patients with BRAFV600E positive tumors respond well to a combination of BRAF kinase and MEK inhibitors. However, some patients are intrinsically resistant while the majority of patients eventually develop drug resistance to the treatment. For patients insufficiently responding to BRAF and MEK inhibitors, there is an ongoing need for new treatment targets. Cellular metabolism is such a promising new target line: mutant BRAFV600E has been shown to affect the metabolism. Methods: Time course experiments and a series of western blots were performed in a panel of BRAFV600E and BRAFWT/ NRASmut human melanoma cells, which were incubated with BRAF and MEK1 kinase inhibitors. siRNA approaches were used to investigate the metabolic players involved. Reactive oxygen species (ROS) were measured by confocal microscopy and AZD7545, an inhibitor targeting PDKs (pyruvate dehydrogenase kinase) was tested. Results: We show that inhibition of the RAS/RAF/MEK/ERK pathway induces phosphorylation of the pyruvate dehydrogenase PDH-E1α subunit in BRAFV600E and in BRAFWT/NRASmut harboring cells. Inhibition of BRAF, MEK1 and siRNA knock-down of ERK1/2 mediated phosphorylation of PDH. siRNA-mediated knock-down of all PDKs or the use of DCA (a pan-PDK inhibitor) abolished PDH-E1α phosphorylation. BRAF inhibitor treatment also induced the upregulation of ROS, concomitantly with the induction of PDH phosphorylation.
    [Show full text]
  • PDK1 Acquires PDK2 Activity in the Presence of a Synthetic Peptide
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Research Paper 393 PDK1 acquires PDK2 activity in the presence of a synthetic peptide derived from the carboxyl terminus of PRK2 Anudharan Balendran*†, Antonio Casamayor*†, Maria Deak†, Andrew Paterson†, Piers Gaffney‡, Richard Currie§, C. Peter Downes§ and Dario R. Alessi† Background: Protein kinase B (PKB) is activated by phosphorylation of Thr308 Addresses: *MRC Protein Phosphorylation Unit, and of Ser473. Thr308 is phosphorylated by the 3-phosphoinositide-dependent Department of Biochemistry, University of Dundee, ‡ protein kinase-1 (PDK1) but the identity of the kinase that phosphorylates Dundee DD1 5EH, UK. Ludwig Institute of Cancer Research, London W1P 8BY, UK. §Department of Ser473 (provisionally termed PDK2) is unknown. Biochemistry, University of Dundee, Dundee DD1 5EH, UK. Results: The kinase domain of PDK1 interacts with a region of protein kinase C-related kinase-2 (PRK2), termed the PDK1-interacting fragment (PIF). PIF is Correspondence: Dario R. Alessi E-mail: [email protected] situated carboxy-terminal to the kinase domain of PRK2, and contains a consensus motif for phosphorylation by PDK2 similar to that found in PKBα, †A.B. and A.C. contributed equally to this work. except that the residue equivalent to Ser473 is aspartic acid. Mutation of any of the conserved residues in the PDK2 motif of PIF prevented interaction of PIF Received: 12 January 1999 Revised: 18 February 1999 with PDK1. Remarkably, interaction of PDK1 with PIF, or with a synthetic Accepted: 3 March 1999 peptide encompassing the PDK2 consensus sequence of PIF, converted PDK1 from an enzyme that could phosphorylate only Thr308 of PKBα to one that Published: 8 April 1999 phosphorylates both Thr308 and Ser473 of PKBα in a manner dependent on Current Biology 1999, 9:393–404 phosphatidylinositol (3,4,5) trisphosphate (PtdIns(3,4,5)P3).
    [Show full text]
  • AGC Kinases in Mtor Signaling, in Mike Hall and Fuyuhiko Tamanoi: the Enzymes, Vol
    Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book, The Enzymes, Vol .27, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: ESTELA JACINTO, AGC Kinases in mTOR Signaling, In Mike Hall and Fuyuhiko Tamanoi: The Enzymes, Vol. 27, Burlington: Academic Press, 2010, pp.101-128. ISBN: 978-0-12-381539-2, © Copyright 2010 Elsevier Inc, Academic Press. Author's personal copy 7 AGC Kinases in mTOR Signaling ESTELA JACINTO Department of Physiology and Biophysics UMDNJ-Robert Wood Johnson Medical School, Piscataway New Jersey, USA I. Abstract The mammalian target of rapamycin (mTOR), a protein kinase with homology to lipid kinases, orchestrates cellular responses to growth and stress signals. Various extracellular and intracellular inputs to mTOR are known. mTOR processes these inputs as part of two mTOR protein com- plexes, mTORC1 or mTORC2. Surprisingly, despite the many cellular functions that are linked to mTOR, there are very few direct mTOR substrates identified to date.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Tricarboxylic Acid (TCA) Cycle Intermediates: Regulators of Immune Responses
    life Review Tricarboxylic Acid (TCA) Cycle Intermediates: Regulators of Immune Responses Inseok Choi , Hyewon Son and Jea-Hyun Baek * School of Life Science, Handong Global University, Pohang, Gyeongbuk 37554, Korea; [email protected] (I.C.); [email protected] (H.S.) * Correspondence: [email protected]; Tel.: +82-54-260-1347 Abstract: The tricarboxylic acid cycle (TCA) is a series of chemical reactions used in aerobic organisms to generate energy via the oxidation of acetylcoenzyme A (CoA) derived from carbohydrates, fatty acids and proteins. In the eukaryotic system, the TCA cycle occurs completely in mitochondria, while the intermediates of the TCA cycle are retained inside mitochondria due to their polarity and hydrophilicity. Under cell stress conditions, mitochondria can become disrupted and release their contents, which act as danger signals in the cytosol. Of note, the TCA cycle intermediates may also leak from dysfunctioning mitochondria and regulate cellular processes. Increasing evidence shows that the metabolites of the TCA cycle are substantially involved in the regulation of immune responses. In this review, we aimed to provide a comprehensive systematic overview of the molecular mechanisms of each TCA cycle intermediate that may play key roles in regulating cellular immunity in cell stress and discuss its implication for immune activation and suppression. Keywords: Krebs cycle; tricarboxylic acid cycle; cellular immunity; immunometabolism 1. Introduction The tricarboxylic acid cycle (TCA, also known as the Krebs cycle or the citric acid Citation: Choi, I.; Son, H.; Baek, J.-H. Tricarboxylic Acid (TCA) Cycle cycle) is a series of chemical reactions used in aerobic organisms (pro- and eukaryotes) to Intermediates: Regulators of Immune generate energy via the oxidation of acetyl-coenzyme A (CoA) derived from carbohydrates, Responses.
    [Show full text]
  • Phosphatidylinositol 3-Kinase Kinase-3 Signaling Pathway Via Akt
    The B Cell Antigen Receptor Activates the Akt (Protein Kinase B)/Glycogen Synthase Kinase-3 Signaling Pathway Via Phosphatidylinositol 3-Kinase This information is current as of September 28, 2021. Michael R. Gold, Michael P. Scheid, Lorna Santos, May Dang-Lawson, Richard A. Roth, Linda Matsuuchi, Vincent Duronio and Danielle L. Krebs J Immunol 1999; 163:1894-1905; ; http://www.jimmunol.org/content/163/4/1894 Downloaded from References This article cites 82 articles, 45 of which you can access for free at: http://www.jimmunol.org/content/163/4/1894.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The B Cell Antigen Receptor Activates the Akt (Protein Kinase B)/Glycogen Synthase Kinase-3 Signaling Pathway Via Phosphatidylinositol 3-Kinase1 Michael R. Gold,2* Michael P. Scheid,† Lorna Santos,‡ May Dang-Lawson,* Richard A.
    [Show full text]
  • Mtor Signaling in Pulmonary Vascular Disease: Pathogenic Role and Therapeutic Target
    International Journal of Molecular Sciences Review mTOR Signaling in Pulmonary Vascular Disease: Pathogenic Role and Therapeutic Target Aleksandra Babicheva 1, Ayako Makino 2 and Jason X.-J. Yuan 1,* 1 Section of Physiology, Division of Pulmonary, Critical Care and Sleep Medicine, Department of Medicine, University of California, San Diego, CA 92093, USA; [email protected] 2 Division of Endocrinology and Metabolism, Department of Medicine, University of California, San Diego, 9500 Gilman Drive, MC 0856, La Jolla, CA 92093-0856, USA; [email protected] * Correspondence: [email protected] Abstract: Pulmonary arterial hypertension (PAH) is a progressive and fatal disease without a cure. The exact pathogenic mechanisms of PAH are complex and poorly understood, yet a number of abnormally expressed genes and regulatory pathways contribute to sustained vasoconstriction and vascular remodeling of the distal pulmonary arteries. Mammalian target of rapamycin (mTOR) is one of the major signaling pathways implicated in regulating cell proliferation, migration, differentiation, and protein synthesis. Here we will describe the canonical mTOR pathway, structural and functional differences between mTOR complexes 1 and 2, as well as the crosstalk with other important signaling cascades in the development of PAH. The pathogenic role of mTOR in pulmonary vascular remodel- ing and sustained vasoconstriction due to its contribution to proliferation, migration, phenotypic transition, and gene regulation in pulmonary artery smooth muscle and endothelial cells will be discussed. Despite the progress in our elucidation of the etiology and pathogenesis of PAH over the two last decades, there is a lack of effective therapeutic agents to treat PAH patients representing Citation: Babicheva, A.; Makino, A.; a significant unmet clinical need.
    [Show full text]
  • PDK4 Promotes Vascular Calcification by Interfering with Autophagic
    Ma et al. Cell Death and Disease (2020) 11:991 https://doi.org/10.1038/s41419-020-03162-w Cell Death & Disease ARTICLE Open Access PDK4 promotes vascular calcification by interfering with autophagic activity and metabolic reprogramming Wen-Qi Ma 1,Xue-JiaoSun1,YiZhu1 and Nai-Feng Liu1 Abstract Pyruvate dehydrogenase kinase 4 (PDK4) is an important mitochondrial matrix enzyme in cellular energy regulation. Previous studies suggested that PDK4 is increased in the calcified vessels of patients with atherosclerosis and is closely associated with mitochondrial function, but the precise regulatory mechanisms remain largely unknown. This study aims to investigate the role of PDK4 in vascular calcification and the molecular mechanisms involved. Using a variety of complementary techniques, we found impaired autophagic activity in the process of vascular smooth muscle cells (VSMCs) calcification, whereas knocking down PDK4 had the opposite effect. PDK4 drives the metabolic reprogramming of VSMCs towards a Warburg effect, and the inhibition of PDK4 abrogates VSMCs calcification. Mechanistically, PDK4 disturbs the integrity of the mitochondria-associated endoplasmic reticulum membrane, concomitantly impairing mitochondrial respiratory capacity, which contributes to a decrease in lysosomal degradation by inhibiting the V-ATPase and lactate dehydrogenase B interaction. PDK4 also inhibits the nuclear translocation of the transcription factor EB, thus inhibiting lysosomal function. These changes result in the interruption of autophagic flux, which accelerates calcium deposition in VSMCs. In addition, glycolysis serves as a metabolic adaptation to improve VSMCs oxidative stress resistance, whereas inhibition of glycolysis by 2-deoxy-D-glucose induces the apoptosis of 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; VSMCs and increases the calcium deposition in VSMCs.
    [Show full text]
  • PDK4-Deficiency Results in Expedited Cellular Proliferation Through E2F1
    Molecular Pharmacology Fast Forward. Published on December 21, 2016 as DOI: 10.1124/mol.116.106757 This article has not been copyedited and formatted. The final version may differ from this version. MOL #106757 PDK4-deficiency results in expedited cellular proliferation through E2F1-mediated increase of cyclins Jonathan Choiniere, Jianguo Wu, and Li Wang Department of Physiology and Neurobiology, and The Institute for Systems Genomics, Downloaded from University of Connecticut, Storrs, CT 06269 (J.C, J.W, L.W) Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (L.W) Department of Internal Medicine, Section of Digestive Diseases, Yale University, New Haven, molpharm.aspetjournals.org CT 06520 (L.W) School of Pharmaceut ical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035, China (L.W) at ASPET Journals on September 28, 2021 1 Molecular Pharmacology Fast Forward. Published on December 21, 2016 as DOI: 10.1124/mol.116.106757 This article has not been copyedited and formatted. The final version may differ from this version. MOL #106757 Running title: PDK4 and arsenic crosstalk in HCC cell proliferation Corresponding Author: To whom correspondence should be addressed: Li Wang, Ph.D. Department of Physiology and Neurobiology, and The Institute for Systems Genomics, University of Connecticut Downloaded from 75 North Eagleville Rd., U3156, Storrs, CT 06269. molpharm.aspetjournals.org Tel: 860-486-0857 Fax: 860-486-3303 E-mail: [email protected] Manuscript information: at ASPET Journals on September 28, 2021 Number of text pages: 23 Number of tables: 0 Number of figures: 5 Number of references: 64 Number of words in abstract: 182 Number of words in introduction: 581 Number of words in discussion: 650 2 Molecular Pharmacology Fast Forward.
    [Show full text]