Molecular Phylogeny of Dissanthelium (Poaceae: Pooideae) and Its Taxonomic Implications
Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. O 10.1600/036364412X616701 DOI © Botany Systematic itlae i.1) e r ieul n n spossibly is one and obs.). are bisexual, floret pers. are Refulio-Rodriguez Most upper few (N. a and perennials. dioecious are 1B), bisexual species are Fig. Three floret pistillate; remainder 2003). (lower al. the gynomonoecious et while have Soreng (Nicora few The annuals synonymy 1998; a or 20. time; Soreng subspecies to over 1973; varieties, changed number to has reduced total species been new the some three of bringing status described Peru, (1985) from Tovar species revised Later, (1965) described. Tovar newly and Swallen and B). (Swallen Dissanthelium 1A, glumes awn- (Fig. equal three) 1965) by (rarely Tovar exceeded two mostly by florets distinguished less is species, dwarf 98 no n erto19;Slkc19)a elevations of at exception the 1999) Renvoize with m Sulekic 1965; 5,000 1997; and 3,600 Tovar Negritto between and and Bolivia, Peru, Anton (Swallen of 1998; Chile Andes the and to restricted Argentina, is America South in in h pce sa nuladi h nymme of member only p. the (1923, is Hitchcock climate. and type annual an is Dissanthelium species The tion. of within placement species The this Mexico. Island, ( Guadalupe 2010 from in collection (rediscovered A. S. Island, 2008). U. Knapp Catalina and Santa (McCune on californicum A. 2005 S. in U. rediscovered California, was on it elevations until low the other at in is The grows species islands, which only distribution. species, the amphi-Neotropical in American is also North an It and Bolivia. with Mexico and genus Peru central of of Andes volcanoes the the of on region elevations Patagonian America, the North mathewsii in in occur elevations species Two low Argentina. at occurs which oyih 02b h mrcnSceyo ln Taxonomists Plant of Society American the by 2012 Copyright Dissanthelium Dissanthelium Dissanthelium opiigthe comprising plastid treating and within propose ITS nested ribosomal We nuclear is the and from monophyletic sequences with not DNA is relationship and species) its 20 the investigate of to (seventeen and genus, the .apiaiaa .calycina P. amplivaginata, P. .swallenii, P. Abstract— Keywords— 2 eerhDvso,Cnda uemo aue ..Bx34,SainD taa nai 1 P,Canada. 6P4, K1P Ontario Ottawa, D, Station 3443, Box P.O. Nature, of Museum Canadian Division, Research hc a ijn itiuin rw thigh at grows distribution, disjunt a has which , sas nw rmSnCeet sad California, Island, Clemente San from known also is .californicum. D. 21) 71:p.122–133 pp. 37(1): (2012), 1 acoSnaAaBtncGre n lrmn rdaeUiest,10 ot olg Avenue, College North 1500 University, Graduate Claremont and Garden Botanic Ana Santa Rancho htgosna e ee n naMediterranean- a in and level sea near grows that n eonzd1 pce,tno hc were which of ten species, 17 recognized and 3 and eivsiae h hlgn fteNwWrdgrass World New the of phylogeny the investigated We mtsna nttto,Dprmn fBtn R-6,Ntoa uemo aua History, Natural of Museum National MRC-166, Botany of Department Institution, Smithsonian rn,asal anyAda rs eu of genus grass Andean mainly small, a Trin., slmtdt h e ol.Isdistribution Its World. New the to limited is Bayesian, and oeua hlgn of Phylogeny Molecular Dissanthelium .thomasii P. Dissanthelium oaoho,P pclt,P rut,P oiin,P ogsa .dmnt,P ierfla .prioi,P serpaiana, P. parvifolia, P. linearifolia, P. deminuta, P. congesta, P. boliviana, P. arcuata, P. apiculata, P. Tovarochloa, ac .Refulio-Rodriguez, F. Nancy Dissanthelium Dissanthelium ..Bx302 ahntn itito ouba20371,U .A. S. U. 20013-7012, Columbia of District Washington, 37012, Box P.O. twspeue ob extinct be to presumed was It r fetdherein. effected are ) ld and clade var. oe1039 Howe 2)woe“hsseisdoes species “this wrote 224) a encle noques- into called been has and ahwi,P iata .mcsness .rahuii, P. macusaniensis, P. gigantea, P. mathewsii, T,mxmmlikelihood, maximum ITS, , D 4 Tovarochloa uhrfrcrepnec ([email protected]) correspondence for Author Poa . alM Peterson, M. Paul peruvianum ,RSA))andanold oee,tnseisfr togyspotdcae(the clade supported strongly a form species ten However, . omnctn dtr at Wojciechowski Marty Editor: Communicating lrmn,Clfri 11-17 .S A. S. U. 91711-3157, California Claremont, .patagonicum D. aooi Implications Taxonomic Dissanthelium Dissanthelium Poa stxnmcsnnm of synonyms taxonomic as n h ooyi sect. monotypic the and , oeua hlgntcaaye nldn hruhsmln of sampling thorough a including analyses phylogenetic Molecular . Dissanthelium 1,4 .Tai Columbus, Travis J. Poa 3 , 122 n oetJ Soreng J. Robert and Dissanthelium , Tovarochloa nlsswr efre sn N eune rmthe from of sequences phylogeny DNA using the performed investigate were we analyses 2009), 2008, of Dissanthelium 2007, species al. Soreng three et 2009; most at 2008, included 2007, al. spe- et 2010). informal al. and (Gillespie et subsections groups many and cies sections 22 mately e pce of species few (POM), subgen. in nested lrsuisb ilsi ta.(07 08 09 and 2009) 2008, (2007, al. et of Poinae. position in the confirmed Gillespie (2007) al. et by Quintanar placed studies (with and Poeae Poinae), ular tribe and Aveninae the Dissanthelium including into data, subtribes Poeae (2003), 22 molecular and al. and Aveneae et Soreng combined morphological florets. awnless available its considering of because placed Poeae (1992) Dallwitz in Macfarlane and contrast, Watson In glumes. and long (1987) its of virtue by Aveneae of knowledge our that to much genus.” [Andean not contributed distinct Dissanthelium does two a who it constitute other Tovar, but to time], different Further, the sufficiently the to be at to recognized related seem ones closely only be the species, to appear not hn50seis ti iie nofv subgenera: five into divided is Poa It species. 500 than 2009). 2008, oieebsdo pkltmrhlg a enuncer- been included has (1986) Renvoize morphology and spikelet Clayton tain. on based Pooideae 2002). comm. ncnrs opeiu hlgntcsuisin studies phylogenetic previous to contrast In oeua hlgntcsuisin studies phylogenetic Molecular h rblpaeetof placement tribal The ihsupersections with .californicum D. Tovarochloa Poa Paee oiee n its and Pooideae) (Poaceae: , trnT-trnL-trnF oepoeismnpyy oeaierltosiswithin relationships examine to monophyly, its explore to Pseudopoa Poa eeettonwscin in sections new two erect We . Poa Poa SalnadTvr16;Tvr18) believed 1985), Tovar 1965; Tovar and (Swallen Glepee l 07 08 09,seiial in specifically 2009), 2008, 2007, al. et (Gillespie n supersection and ysmln 7o t pce.Phylogenetic species. its of 17 sampling by ntesbrb one usqetymolec- Subsequently Poinae. subtribe the in h eesr e obntos( combinations new necessary The . 1 trnT Dissanthelium and ynJ Gillespie, J. Lynn stelretgnso rse ihmore with grasses of genus largest the is , - . 3 trnL Stenopoa a emslcdi h eu (pers. genus the in misplaced be may .trollii P. - trnF Homalopoa Dissanthelium ein ugs that suggest regions Dissanthelium n e ae ( names new and ) ,and n on httegnsis genus the that found and Homalopoa Sylvestres Poa 2 Dissanthelium HMAD and (HAMBADD) ld)i h T tree. ITS the in clade) sect. : Poa ihnsubfamily within aesmlda sampled have Glepee al. et (Gillespie Dissanthelium Dissanthelium o aequalis, Poa Dissanthelium Dissanthelium Poa n approxi- and Dissanthelium Dissanthelium Poa sections (Gillespie Ochlopoa hthave that , Poa in , Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ,D ln.PooDcuts fJ .Columbus. T. J. of courtesy D Photo Plant. D. C, 02 EUI-ORGE TA. HLGN FDSATEIM123 DISSANTHELIUM OF PHYLOGENY AL.: ET REFULIO-RODRIGUEZ 2012] Fig. 1. isnhlu breve Dissanthelium AC and (A-C) oaoho peruviana Tovarochloa DE.A .Siee.B lrt,lwrfoe ieuladuprfoe pistillate. floret upper and bisexual floret lower Florets, B. Spikelet. E. A, (D-E). Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 08 09.I atclrw nlddAda pce of species Andean included we particular In 2009). 2008, eepeiul eoie nGnakb ilsi ta.(07 2008, (2007, al. et Gillespie Andean by The GenBank in 2009). deposited previously of sequences were DNA new included analyses section that Homalopoa oce nomto n eBn ceso ubr ftesamples 1. the Appendix in of provided sec- 2009). numbers are (2008, study and accession al. this subtribes in et GenBank used Gillespie the and by For classification information the Bromeae. follow Voucher tribe we to Poeae of related of subtribes member tions and one Poinae of and genera other Poinae, include that consisted samples outgroups 17 The 1). of (Appendix boundaries species test to than analyses more of possible species whenever per sam- samples; sample 124 107 one of of total consisted a ingroup included The analyses ples. The (1986). Renvoize with and Clayton relationship by possible a because study subgen. the How- 2009). on only 2008, focused (2007, known al. was et are it Gillespie by ever, they recognized The as since subgenera not types. five specimens could species their herbarium these field from from of the in material removed them leaf for be addition, searches In because unsuccessful. analyses the were in included not were eonzdb wle n oa 16)adTvr(95.Trespecies, Three (1985). Tovar and (1965) D Tovar and Swallen by recognized oa T ein(T1sae .Seo T2sae)adtechloro- the and spacer) ITS2 + exon 5.8S + plast spacer (ITS1 region ITS somal oiiain(oubse l 98 fte2 the of 1998) al. et (Columbus modification 2010). al. et Soreng T4(TCCTCCGCTTATTGATATGC) ITS4 (GCATCGATGAAGAACGCAGC) ITS3 (GCTGCGTTCTTCATCGATGC) ITS2 37 [Volume BOTANY SYSTEMATIC chloroplast and ITS ribosomal nuclear 124 ooylr9 Srtgn,L ol,Clfri) 9cce eernwith run were cycles 94 39 at step California), denaturing Jolla, a La (Stratagene, 96 Robocycler 98 sa ta.19;Bytn ta.20;Treil ta.2004; al. et Torrecilla 2004; al. et Brysting 1999; and al. used Zimmer widely and et Catala Hamby been (e.g. have Hsiao grasses they of 1988; because studies study phylogenetic in this informative in use for selected T5(GGAAGTAAAAGTCGTAACAAGG) ITS5 ihacnetaino 0ng/ 10 2 of DNA, concentration of Amplifications primers a ng 1). ITS5 40 (Table with and using employed ITS4 out were the carried (1990) al. were region, et ITS White the by amplify designed To (1987). Doyle and (ATTTGAACTGGTGACACGAG) F trnL 3 ildwtrfrattlvlm f50 of volume total a for water tilled trnL5 (CGTCCGAGCCATATCAAATTG) INT4R trnTL (GTTAGCTTGATATGCTTAAC) INT3F trnTL (GGGGAGAGAAAAACTTTTGGAT) INT1F trnTL (ATCCAAAAGTTTTTCTCTCCCC) INT1R trnTL (TCTACCGATTTCGCCATATC) B (CATTACAAATGCGATGCTCT) A rLITF(GAGAGAGTCCCATTCTACATGTC) INT3F trnL neseii eainhp,icuigwt pca neetthe of interest position special with including relationships, interspecific of monophyly the investigate We ae norrslsw rps h rnfrof transfer the propose and we results our on Based (GGGGATAGAGGGACTTGAAC) D . m N slto,Apiiain n Sequencing— and Amplification, Isolation, DNA ao Sampling— Taxon oa N a sltdfo eftsu re nslc e sn a using gel silica in dried tissue leaf from isolated was DNA Total Table aequale fdTs 0.25 dNTPs, of L Dissanthelium Tovarochloa 3 ´ 0 trnT ta.20) including 2007), al. et n 0 R(GATATGGCGAAATCGGTAGA) BR Homalopoa exon, .Piesue nteapiiainadsqecn fteISand ITS the of sequencing and amplification the in used Primers 1. - ic rvosmlclrpyoeei tde aeshown have studies phylogenetic molecular previous since , (Bolivia), trnL rmrnm sqec (5 (sequence name Primer D trnL - . trnF californicum htaemrhlgclysmlrto similar morphologically are that - into snse nsupersection in nested is trnF D aeil n Methods and Materials ein( region esmld1 fte2 pce of species 20 the of 17 sampled We oaoho peruviana Tovarochloa . m longiligulatum Lof o i,a neln tpa 48 at step annealing an min, 1 for C Poa Poa pcr eefe eerdt as to referred hereafter spacer; Dissanthelium . trnT Taq apigicue ersnaie fall of representatives included sampling m ihrsett h nenspecies. Andean the to respect with ,5 L, ,5 - Poa trnL 0 -3 0 m )ApiiainSqecn Author/Source Sequencing Amplification )) m fDS,ad28.75 and DMSO, of L Blva,and (Bolivia), Glepee l 07 08 2009; 2008, 2007, al. et (Gillespie Lof(NH m spacer, Poa eeicue ntephylogenetic the in included were .Apiiain eerni a in run were Amplifications L. m Dissanthelium fec mlfcto primer amplification each of L pcfclyo supersection on specifically , Poa Dissanthelium a noprtdit this into incorporated was Homalopoa
+ trnT trnL swl ssqecsthat sequences as well as 4 ) TBmto fDoyle of method CTAB 2 SO - 5 trnL D 4 0 . h ula ribo- nuclear The Dissanthelium 10 exon, pygmaeum - Dissanthelium Glepee al. et (Gillespie n examine and trnF + suggested was trnTLF Poa Dissanthelium o min, 1 for C C buffer, PCR trnL m regions. fsuper- of fdis- of L were ) (Peru), intron, The . p p p p p p p p ffi ffi ffi ffi ffi ffi ffi ffi netninse t72 at step extension an hiswr u o ,8,0 IS,ad24650( 2,426,500 and (ITS), 6,689,500 for (MCMC) one Carlo run and Monte employed; were chain was Markov chains tree heated starting incrementally three random and a sepa- cold locus, three phylogeny. each of for consisted infer runs Analysis rated 2003). vers. to Huelsenbeck MrBayes and with conducted (Ronquist calculated 3.1.2 were were (PP) probabilities analyses posterior Bayesian 1973) Felsenstein (ML; PTC-100 a the in for run reactions Amplification were employed. were F and Br au fteaeaesadr eito fsltfeunisdropped frequencies split the because of until G deviation run + standard were TVM Analyses of average MrBayes. instead the in model of implemented G value not + is GTR latter the For the employ generations. to 500 every opted done we was sampling Tree respectively. G + TVM and ITS, for obtained was nucleo- G The + 1974). 2008) for SYM Akaike (Posada model (AIC; jModelTest substitution criterion tide program information Akaike the the with using substitution determined Nucleotide (2007). were Soreng models and Davis by Pooideae subfamily an using read Biosystems). (Applied were sequencer sequences automated 3100 DNA Prism Inc.). ABI Research, (MJ Cycler Thermal yl a u ihadntrn tpa 94 at step denaturing a with run was cycle trnL ascuet)wt niiildntrn tpo i t94 at min 4 of step denaturing initial an with Massachusetts) ntopee.T mlf the amplify To pieces. two in 25 of volume mlfe sn n rmr Tbe1.I te ae,piesB, primers the cases, of other were Amplification In samples used. 1). the were (Table trnL primers INT1F of D trnTL most and and difficulties; A using amplification amplified of because used t52 at 8cce ihadntrn tpa 94 at step denaturing a with cycles 38 miuu ie.Ainddt arcswr eoie nTreeBASE in deposited were matrices S11724). data number (study Aligned sites. In ambiguous 1996). similarity (Rambaut the 2.0a11 vers. on Se-Al the based using manually and 2004) done Michigan). (Simmons was Arbor, criterion sequences Ann of Corporation, alignment Codes The (Gene 4.5 Sequencher using ihafnletnina 72 at extension final a with MOwsntadd h eunigratoswr u naPTC-100 a in run were and reactions sequencing California) The added. not City, was DMSO Foster Biosystems, (Applied 12 3.1 vers. terminator y3 ylswt eauigse t94 at step denaturing a with cycles 35 by tpa 54 at step f16ng/ (1995). 1.6 Soltis of and 1 Johnson DNA, of of the protocol for precipitation reactions PEG Sequencing the using fied t52 at ina 72 at sion of i.Apiiainof Amplification min. 7 fec mlfcto rmrwt ocnrto f1 ng/ 10 of concentration a (NH with primer amplification each of trnTLF hlgntcAnalyses— Phylogenetic aeinMM Yn n anl 97 n aiu likelihood maximum and 1997) Rannala and (Yang MCMC Bayesian ldgaswr otdwith rooted were Cladograms m Taq trnTLF trnTLF - - fdsildwtr h T eunigratoswr iia except similar were reactions sequencing ITS The water. distilled of L 4 trnF trnF ) o i,a xeso tpa 72 at step extension an min, 1 for C o 5scada xeso tpa 72 at step extension an and sec 45 for C 2 1.25 , SO regions. 4 pcrrgoswr u naRbcce 6(taaee,one (Stratagene), 96 Robocycler a in run were regions spacer . pcrwsmr tagtowr n nypiestrnL5 primers only and straightforward more was spacer m o 5sc n netnina 72 at extension an and sec, 45 for C o 0mn mlfcto ecin o the for reactions Amplification min. 10 for C aamti 9bs ar eermvdbfr nlssfrom analyses before removed were pairs base 69 matrix data 10 m ,4 L, m fDS,1 DMSO, of L p p p p p p p p p p p p p p m fDS n 13.625 and DMSO of L ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi + .Apiiaino the of Amplification L. m C ufr 1.5 buffer, PCR fbgdebfe 5 buffer dye big of L TM trnTLF o i,adafnletnina 72 at extension final a and min, 2 for C N igesrne eune eecontiged were sequences single-stranded DNA hra ylr(JRsac,Ic,Waltham, Inc., Research, (MJ cycler thermal m o i.TePRpout eepuri- were products PCR The min. 7 for C fpie Tbe1 ihaconcentration a with 1) (Table primer of L trnTLF a efre sn 5n fDA 1 DNA, of ng 25 using performed was trnT ht ta.(1990) al. et White (1990) al. et White ht ta.(1990) al. et White oubse l (2007) al. et Columbus hsppr(eindb .T Columbus) T. J. by (designed Columbus) paper T. This J. by (designed Columbus) paper T. This J. by (designed Columbus) paper T. This J. by (designed paper This (1991) al. et Taberlet (1991) al. et Taberlet ht ta.(1990) al. et White aelte l (1991) al. et Taberlet oubse l (2007) al. et Columbus aelte l (1991) al. et Taberlet m fMgCl of L Bromus - trnL einwr efre sn ng 6 using performed were region m trnTLF o 5sc nanaigstep annealing an sec, 45 for C fdsildwtr o total a for water, distilled of L
+ were primers different spacer, o i,a neln step annealing an min, 1 for C o i,adafnlexten- final a and min, 3 for C ae nteaayi fthe of analysis the on based ,1 2 1.5 , o 5sc nannealing an sec, 45 for C m o 0sc n finished and sec, 90 for C einwsaccomplished was region o i olwdby followed min 2 for C fAIPimbgdye big Prism ABI of L m fdTs 0.125 dNTPs, of L trnTLF trnL trnT trnL nrnadthe and intron generations, ) m - ,followed C, ,2.5 L, trnL nrnand intron trnTLF spacer m for C Lof m m TM L L 0 Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. lt nalsqecs ny1 eune eeincomplete were sequences 10 3 only the sequences; at all in plete bevdin observed in f62b.Sqecso T eeotie o l accessions, all for obtained were ITS for of except Sequences bp. 622 of upr 10 P9 S.Hwvr nteISte hyare they tree ITS the in However, BS). PP/92 (1.00 support omacaewt o upr,ti ld a o recovered not was clade this the support, low in with clade a form eso . Hsne l 2007). al. et Dendroscope (Huson using 2.4 edited version and 2 visualized were trees PORTAL performed. RAxML 2006) were and (Stamatakis replicates Bayesian author 1985) CIPRES Felsenstein the (BS; bootstrap by the rapid recommended 1,000 as and at locus each 7.0.4 for 2008) used in version was al. Maxi- model RAxML burn G et 2004). + using GTR as (http://www.phylo.org/portal2/login!input.action). Stamatakis Drummond The performed discarded 2006; and was the (Stamatakis (Rambaut were analysis using 1.4 likelihood verified samples was mum version of Stationarity Tracer 25% 2001). program Ronquist first and The (Huelsenbeck 0.01. below ( egho ,6 patrrmvn 9b rmambiguous from bp 69 removing of after Sequences bp sites. 2,460 1997; of Negritto length and (Anton genus in the obs.). rare pers. Refulio-Rodriguez in N. be uncommon may be Polymorphisms to 2010). al. Dissanthelium et Soreng 2010; Soreng al. 1990; et (Gillespie introgression and hybridization of samples in mon itrt h Andean the to sister peruviana Tovarochloa huhteISte a esrslto hnthe than of resolution species less ten containing Dissanthelium has clade well-supported tree a phylogeny ITS and the ITS though the between resolution of trnTLF amount in differences lar subgen. of of members bers the includes polytomy a subgen. tree the ITS than the resolved in less while is datasets. tree combining ITS avoid The (2008, to al. (2010) et al. Gillespie et led Soreng and conflicts 2010) These trees. gene plastid ( Poa partitions the the and between ITS between al. partitioned et data PAUP (Farris in test performed difference 1994) length incongruence an because regions. overcome poly-N by to caused cloned problems stutter were samples Five incomplete. were except h T hlgn,adsx(l nenecp for except Andean (all six and phylogeny, ITS the the containing Dissanthelium in clade contrast supported poorly In 2). (Fig. 02 EUI-ORGE TA. HLGN FDSATEIM125 DISSANTHELIUM OF PHYLOGENY AL.: ET REFULIO-RODRIGUEZ 2012] hl nteISphylogeny Moreover, ITS polytomies. the unresolved in in while are species several tree Dissanthelium of species eesn16594 Peterson h T aamti f12smlshda lge length aligned an had samples 122 of matrix data ITS The The h aeinteswr iia otoeotie rmML. from obtained those to similar were trees Bayesian The separately marker each for performed were Analyses Dissanthelium n onehv losoncnlcsbtenISand ITS between conflicts shown also have Poinae and isnhlu laxifoliumDissanthelium trnTLF trnTLF re eeas on yGlepee l 20) Even (2008). al. et Gillespie by found also were trees 0 Poa n.Plmrhsswr lotcmltl absent completely almost were Polymorphisms end. o interior Poa Poa n subgen. and .trollii D. r eovda oohltcwiei the in while monophyletic as resolved are pce htfr togyspotdcaein clade supported strongly a form that species sfudwti h subgen. the within found is loi h T re oto h pce of species the of most tree, ITS the in Also . re nbt T and ITS both In tree. aamti a 2 ape n naligned an and samples 122 had matrix data eas fibedn;otrsigappears outcrossing inbreeding; of because .I e ae ohed ftesequences the of ends both cases few a In ). Poa ape.Ol w oyopi ie were sites polymorphic two Only samples. trnTLF Poa n subgen. and ,and oee,plmrhsswr com- were polymorphisms However, . snse in nested is paeyrmprocumbens Aphanelytrum hc oetal niae ae of cases indicates potentially which , Stenopoa p Results D P * eeotie o l accessions, all for obtained were .1.Pyoeei tde in studies Phylogenetic 0.01). = . . .b0(wfod20)wt the with 2002) (Swofford 4.0b10 occidentalis aaoiu n o atropidiformis Poa and patagonicum ,andonesampleof trnTLF .Inthe Stenopoa Poa trnTLF .Inthe D trnTLF hlgn hr sa is there phylogeny . trnTLF .The5 trnTLF peruvianum Poa omcae.Simi- clades. form re Fg.2 3) 2, (Figs. trees trnTLF re(is ,3), 2, (Figs. tree / 0 on conflict found Stenopoa n a com- was end retemem- the tree P ihstrong with D . . mathewsii h ten the , expansum rei is it tree trnTLF trnTLF clade Taq Poa ) osberltosi between relationship possible o depauperate a for Negritto Dissanthelium with and lemmas Anton reported in (1992) nerves 3–5 However, Dallwitz and 1993). Watson and (1997) (Tovar nerves three aiybtenfre utie oa n vna.Our Aveneae. and Poeae of subtribes glumes former long between the larity fea- that caryopsis believed and Dissanthelium he surfaces consequently, blade leaf tures; adaxial similar have of group sister a indicated (1998) Soreng (gynomonoecy). Poa to similar of is those resemble it that describing cated when (1848), Nuttall dence. ifrnitdfrom in differentiated three usual the of of of that lemmas to similar looks it that tde h em opooyof morphology lemma the studied al. et relationship Gillespie a of of hypotheses between prior those support and 2009) 2008, here (2007, found of species results few molecular a included that 2009) 2008, itn ihpyoeisof phylogenies with sistent of glumes long the that undeniably corroborate results molecular hlg,adla ld ntm of micromor- anatomy leaf blade and leaf lemma and the phology, of addi- studies foregoing, In the erroneous. to was tion 1986) Renvoize and (Clayton glumes of placement ape ob etdwithin nested be to sampled httegnsi iia othe to similar is genus the that o itr.Terpstosaeursle ntelreclade large the in unresolved of species are containing positions Their sisters. not ot(ilsi ta.20,20,20) lhuhi u plastid our in supersection Although 2009). tree 2008, 2007, previous al. et In (Gillespie port tree. in evidenced ITS was supersection groups the this the of informal monophyly in the various studies monophyletic supersection and as study (2007)), unresolved this In al. “Punapoa”). et (e.g. Gillespie species, 340 by ca. includes Anthochloa 2009) ( 2008, sections 2007, seven al. et (Gillespie supersection the in cally within nested 2010). al. et Soreng 2010; 2008, (Gillespie al. attraction et long-branch or polyploidy, hybridization, al. et the and with Gillespie consistent not by is several 2) found (Fig. of those placement with The consistent (2009). are 3) (Fig. a ruso supersection infor- and of sections the groups of all not mal that addi- indicate results In unresolved. our are tion, sections the among relationships BS) h eut fti td hwalseisof species all show study this of results The nour In eainhp among Relationships Dissanthelium trnTLF pce eas hysaesmlrte nsxa system sexual in similarities share they because species P . trivialis Dissanthelium trnTLF , .patagonicum D. n T+T re n eevdlwt odsup- good to low received and trees ITS+ETS and Dasypoa Dissanthelium hwta hscaatri oolsossimi- homoplasious a is character this that show pce ihsotgue ih emistaken be might glumes short with species .Teecnlcsfudin found conflicts These ). Dissanthelium Poa re(i.3,alseisof species all 3), (Fig. tree Homalopoa Poa r neapeo ovrec.Tu,the Thus, convergence. of example an are Poa Danthonia Homalopoa ,and Poa subgen. ra fsoto t eas ohgenera both because it, of offshoot an or Poa no n erto(97 ugse a suggested (1997) Negritto and Anton . Dissanthelium and yisln lmsadlmawith lemma and glumes long its by Discussion Dioicopoa Poa Homalopoa subgen. lyo n evie(96 noted (1986) Renvoize and Clayton . aefv evs(sin (as nerves five have , Poa Poa Dnhnoda) ioa(1973) Nicora (Danthonioideae). o atropidiformis Poa Acutifoliae nAeeebsdo t long its on based Aveneae in Poa a odspot(.8PP/79 (0.98 support good has Dissanthelium ugnr nthe in subgenera Poa Poa Poa Homalopoa n lohsgue that glumes has also and , ae nmrhlgclevi- morphological on based trnTLF Poa eerdt sHAMBADD as to referred ; 10 P10B) specifi- BS), PP/100 (1.00 RfloRdiuz2007). (Refulio-Rodriguez Poa D Fg.2 ) idn con- finding a 3), 2, (Figs. . nGlepee l (2007, al. et Gillespie in Dissanthelium Supersection . . Dissanthelium patagonicum and pce nteIStree ITS the in species , re(e.g. tree Dissanthelium D Madropoa Poa . Stenopoa r monophyletic. are Dissanthelium californicum, n ihAndean high and Dissanthelium ol edeto due be could h on that found She . Homalopoa Dissanthelium demonstrate Poa P trnTLF n noticed and yial is typically , . . Homalopoa abbreviata Brizoides )instead a be may The . indi- was tree are , Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2 YTMTCBTN Vlm 37 [Volume BOTANY SYSTEMATIC 126 eo ahbac r aeinpseirpoaiiisadM otta aus epciey brvain o etosada nomlgopo t of group informal an and sections for Abbreviations respectively. values, bootstrap ML and probabilities posterior supersection Bayesian are branch each below ru Pnpa ) n h ugnsSeoo Seoo ugnsSeoo) N”idctsseisof species indicates “NZ” Stenopoa). subgenus = (Stenopoa Stenopoa subgenus the and P), = “Punapoa” group eintdsection. designated Fig. .NcerrN T aoiyrl osnu hlga f1,3 re eeae rmteBysa nlss uei ausaoeand above values Numeric analysis. Bayesian the from generated trees 10,036 of phylogram consensus majority-rule ITS rDNA Nuclear 2. Homalopoa H= (H Homalopoa ,AC= Acutifoliae ,M= Madropoa ,B= Brizoides ,AN= Anthochloa ,DA= Dasypoa Poa rmNwZaadwtota without Zealand New from n I= DI and , Dioicopoa informal , he Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ahbac r aeinpseirpoaiiisadM otta aus epciey brvain o etosada nomlgopo the of group informal an and sections for Abbreviations of respectively. species values, indicates “NZ” bootstrap P). ML = “Punapoa” and group probabilities posterior Bayesian supersection are branch each 02 EUI-ORGE TA. HLGN FDSATEIM127 DISSANTHELIUM OF PHYLOGENY AL.: ET REFULIO-RODRIGUEZ 2012] Fig. .Plastid 3. Homalopoa trnTLF H= (H aoiyrl osnu hlga f361tesgnrtdfo h aeinaayi.Nmrcvle bv n below and above values Numeric analysis. Bayesian the from generated trees 3,641 of phylogram consensus majority-rule Homalopoa ,AC= Acutifoliae Poa rmNwZaadwtotadsgae section. designated a without Zealand New from ,M= Madropoa ,B= Brizoides ,AN= Anthochloa ,DA= Dasypoa n I= DI and , Dioicopoa informal , Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2 YTMTCBTN Vlm 37 [Volume BOTANY SYSTEMATIC 128 D and nlssb ilsi ta.(07 eoee oescin of sections some recovered (2007) supersection al. et Gillespie by Analyses n ieo h nhr,(wle n oa 95 Tovar infor- 1965; the phylogenetically Tovar of are and characters the in (Swallen these lemmas, mative anthers, of of Some the ornamentation 1993). of lemmas, size and and glumes of shape Dissanthelium elevations. high at Mexico central of volcanoes the for on except Andes, the in only and includes that polytomy subgen. the within where patagonicum D. the as to includ- refer (10), species we the ( of type most the phylogeny ing ITS our in While .breve D. o N eunevrainadascae o support low associated The and improved. the variation in not found values sequence has clade DNA this low within resolution 2009), supersection Homalopoa of representatives American South more include ftosblds noesubclade one in subclades; two of the logeny, ( Meudt Mya; 2006). ago Eastwood or years and Pliocene Hughes of 2006; late Simpson millions Andes, and 2–4 the (ca. of plants Pleistocene uplift Andean early final elevation the high after of diverged lineages some phylogenies Dated that origin. suggest elevation recent high of that be hypothesized eleva- may been plants high has herbaceous at It Andes. distributed the primarily in are tions study our in included of species Most Homalopoa hlgn t oiini h subgen. ITS the the In in BS). position PP/50 its (0.81 phylogeny support low has relationship this is florets this the in to relative However, glumes blades. the ( shiny of variable to length opposed the subclade as dull, have ogrta h lrt;and florets; the than longer rmters ftegnsb t es,oln-vi panicle. oblong-ovoid dense, its by genus the of rest the from unresolved. to sister is species this 3), (Fig. lmsa oga h lrt)adteeoeti hrce is character includes calycinum this that D. therefore polytomy the and In florets) informative. phylogenetically the not as long as glumes and with polytomy unresolved laxifolium an D. in are ( but clade, Mexico from and of specimens differentiate tree, to used (1998) Soreng be similarity, treated morphological can this and lemmas of shape and Because mor- the them. glumes are only the species and of another These size one florets. to the similar than phologically longer are glumes .apiaiau,D aioncm .giganteum D. californicum, D. amplivaginatum, D. . opooia hrcesue ntetxnm of taxonomy the in used characters Morphological Dissanthelium isnhlu amplivaginatum— Dissanthelium h ee pce aln usd fthe of outside falling species seven The rauhii .densum D. oaoho peruviana Tovarochloa .semitectum D. Dissanthelium .mathewsii D. , r itrt ld containing clade a to sister are .densum D. .breve D. hni rvossuis(ilsi ta.20,2008, 2007, al. et (Gillespie studies previous in than a edet ai n eetdiversification. recent and rapid to due be may Dissanthelium ,and isnhlu amplivaginatum Dissanthelium , Homalopoa Dissanthelium .laxifolium D. .calycinum D. l pce nthe in species All . , nld h seto h lds ieand size blades, the of aspect the include Dissanthelium .peruvianum D. sntmnpyei nayo u analyses. our of any in monophyletic not is , .semitectum D. n ntescn subclade second the in and ; Dissanthelium .densum D. Dissanthelium ,and .mathewsii D. sasbpce of subspecies a as eui 151 Refulio ld omdby formed clade .calycinum D. u ihwa upr.Atog we Although support. weak with but .brevifolium D. , r icse below. discussed are ld 10 P7 S scomposed is BS) PP/77 (1.00 clade Poa ,fr elspotdcaethat clade well-supported a form ), .mathewsii D. ld.Frisac,i h subclade the in instance, For clade. .brevifolium D. .mathewsii D. ,and / and ,and Stenopoa samples. o dissanthelioides Poa ontfr nexclusive an form not do ) Dissanthelium ld n in and clade ld Fg ) ee species seven 2), (Fig. clade rmPr ( Peru from .macusaniense D. Poa , D .laxifolium D. .trollii D. . supersection — .calycinum D. D expansum ,and l pce perto appear species all , .breve D. Poa ld.I u T phy- ITS our In clade. . nthe In ,whichisalsofound a edistinguished be can ,and expansum Dissanthelium / Stenopoa )arefoundelse- .semitectum, D. Poa ld r found are clade eesn16595 Peterson , , D .longifolium D. D .brevifolium D. , .calycinum D. aeglumes have .mathewsii D. supersection . trnTLF . ssse oa to sister is However, . rauhii nteITS the In . , expansum Homalopoa D ld is clade . rauhii clade have tree all / ) , , , , , rsneo ar ntelmain lemma the on hairs of presence itste.Bcueo hsmrhlgclsmlrt,Nicora similarity, transferred morphological this (1973) of Because them. tiates o upr 6 S nteM nlss hsrelationship This analysis. patagonicum the ML in D. the recovered tree, in not BS) ITS was (60 with the support and analysis, Bayesian In low with the in lemmas. PP) spikelets (0.97 support hairy moderate has and and patagonicum florets D. elevations, bisexual low 2–3 at grows species species any to nor clade, seven this the of of any outside to of fall sister that not is species it and its clade of explore and members study other this the in a it to include than affinity to more on 2008), us Knapp 2005 for allowed and in which (McCune seen California rediscovered been Island, was Catalina not it Santa Fortunately had years. it hundred since 2001) (CNPS to atropidiformis P. oehrte r ato oyoyta nldssx(all six includes that polytomy a for of except part Andean are annual, they together another Andean with the to Andes the macusaniense D. in sympatrically occurs ntePtgna eino ot mrc n hyare they and America South of region sympatric. sometimes Patagonian the in re(i.2) (Fig. tree htece h ails n nqela ld anatomy blade leaf 2007). blades Refulio-Rodriguez unique leaf thick; a cells linear three and epidermis florets, panicles, (abaxial the the than exceed shorter that slightly are that for described longifolium as unresolved is oteseisi the in blade species leaf the the and to of lemma, 2007), epidermis the (Refulio-Rodriguez abaxial of anatomy spikelet, micromorphology the blade, of leaf features on Based of cies ye h oiino hsseisi neovdwti the within unresolved is species this of subgen. position the lyses the In unresolved. scvrdwt ok RfloRdiuz2007). (Refulio-Rodriguez hooks epidermis with blade covered leaf is abaxial its because species the remaining in the growing Morphologically, cm) 30–40 Andes. (ca. tallest high the is species This tively. section oegn akr oipoeterslto ihnsuper- within resolution American studies the improve Future North section to relative. markers more gene closest include more its to identify need not do results hlg e iccc 12)adTvr(es om 2002) genus. comm. that (pers. speculate Tovar mor- and to and (1923) distribution Hitchcock Its led lemmas. phology hairy and florets remaining bisexual the from distinct of also Mediterranean- species are species a two in These grows level. with that along and, genus climate, the type of member only isnhlu peruvianum— Dissanthelium isnhlu patagonicum— Dissanthelium isnhlu longifolium— Dissanthelium isnhlu giganteum— Dissanthelium isnhlu californicum—Dissanthelium Dissanthelium Poa t lcmn ntesubgen. the in placement Its . Dissanthelium isnhlu californicum Dissanthelium Homalopoa Homalopoa Poa Dissanthelium ifr rmohr ntegnsb aigglumes having by genus the in others from differs / Stenopoa .californicum D. . n oeg(98 transferred (1998) Soreng and nthe In . o anae Poa ssmlrto similar is om ld with clade a forms o atropidiformis Poa . .californicum D. Fg ) u t oiini neovd Our unresolved. is position its but 2), (Fig. .patagonicum D. trnTLF P (the ld n supersection and clade . Dissanthelium mathewsii yhvn pklt ihu othree to up with spikelets having by trnTLF u ihlwspot(i.3 and 3) (Fig. support low with but Dissanthelium trnTLF re(i.3 ti etdi super- in nested is it 3) (Fig. tree sntpr fthe of part not is o atropidiformis Poa D — .giganteum D. . pce of species ) tree, — patagonicum .giganteum D. a rsmdt eextinct be to presumed was nteISand ITS the In — — — ,like a emslcdi the in misplaced be may nlss Morphologically, analysis. hsana pce often species annual This Dissanthelium into hsana pce sthe is species annual This naltesisposition its trees all In Like .peruvianum D. .patagonicum D. ld.Cneunl,as Consequently, clade. .peruvianum D. o atropidiformis Poa Poa D ld nteIStree). ITS the in clade Poa .californicum D. . / patagonicum Homalopoa Stenopoa Poa Poa cusna sea near occurs , sdsic from distinct is savreyof variety a as P . . Dissanthelium Dissanthelium Dissanthelium n nythe only and n e spe- ten and norITS our In . atropidiformis pce and species trnTLF ssimilar is differen- ld is clade ssister is respec- grows this , with ana- Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 1. o upr 4 S nM.I h T reispsto is position its tree ITS the In and ML. subgen. PP) in the in (0.96 BS) unresolved analysis (49 Bayesian support in low support moderate with procumbens Aphanelytrum oee,i h T tree ITS the in However, procumbens Aphanelytrum show 3) 2, (Figs. analyses peruviana ML and T. Bayesian rela- the of to diagram next 1E). from placed their results was (Fig. in it but spikelet Aveneae affinity, of uncertain tionships per of floret genus monotypic a one the as of treated has Andes (1986) Renvoize the It and Clayton in Bolivia. pools and ephemeral shallow Peru in grows species ogates lota oga h em,adareduced a and lemma, the as long Another, as gynoecium. almost anthers, long .Plantsperennial1. annual ...... Plants 1. by formed clade resolved poorly a of specimen One genus. the in species into species this include to sect. choose we below, presented o itr n hi oiin ntesubgen. the in positions their and sisters not the in in species supported this is results of our In inclusion (2008). al. the et Gillespie by demonstrated also was em pdri suiu nta ti moh(Refulio- smooth is it the that the genus, in In the 2007). unique of Rodriguez is typical are epidermis spikelets lemma the Although cious. that indicating gynoecium, developed upr 5 S nteISmxmmprioyanalysis parsimony the maximum in between BS) ITS relationship (87 the support good in and BS) rela- (58 sister support the (2008) between al. et tionship Gillespie In unresolved. are clade 02 EUI-ORGE TA. HLGN FDSATEIM129 DISSANTHELIUM OF PHYLOGENY AL.: ET REFULIO-RODRIGUEZ 2012] earsl faln-rnhatato Piip ta.2005; al. et (Philippe from differs attraction Morphologically, long-branch 2009). Thornton a and Kolaczkowski of result a be Tovarochloa peruviana— isnhlu trollii— Dissanthelium o macusaniensis Poa .Aailla ld ufc hn . . shiny surface blade leaf Abaxial 3. .Lmagaru,ae nie. entire . apex . glabrous, Lemma dentate apex pubescent, 2. Lemma 2. .Aailla ld ufc dull surface blade leaf Abaxial 3. stp:GE,W). pascuis GOET, In isotype: PERU. 1854, Jun. TYPE: Macusani, 1965.— prope 249. 12(5): 1914. Phytologia 348. 32: Centralbl. macusaniense Bot. Beih. Krause, nov. comb. Rodriguez, Dissanthelium .Gue .–. mln;lwrlma2428m og pxaue. acute apex long, subacute mm or 2.4–2.8 obtuse lemma apex lower long, long; mm mm 1.8–2.3 3.5–4.2 lemma Glumes lower long; mm 2.4–3 8. Glumes 8. .Gue sln stefoes.. . florets the as long as Glumes 4. .Gue ogrta h lrt . florets the than longer Glumes 4. .Cls69c og ailsmr hn3c long cm 3 than more long panicles cm long; 1.5 cm than 6–9 less Culms panicles long; cm 2–4 7. Culms 7. .Gue arw uauiae arcuate subacuminate, narrow, Glumes 5. .Gue boglnelt rlnelt,ntacae... . . arcuate not lanceolate, or oblong-lanceolate Glumes 5. e oteSeisof Species the to Key paeyrmprocumbens Aphanelytrum ob etdwithin nested be to .Pncedne spike-like dense, Panicle spike-like not flowered, loosely 6. Panicles 6...... 2 ...... E .L rue .C otr&L .Sm., B. L. & Foster C. R. Krause) L. H. (E. . Tovarochloa trnTLF eui 231, Refulio T . E .L rue .F Refulio- F. N. Krause) L. H. (E. ihsrn upr 10 P9 BS). PP/92 (1.00 support strong with , trnTLF peruviana T o rivas-martinezii, Poa Poa rmnsrmmacusaniense Graminastrum — . — reweei ssse oAndean to sister is it where tree peruviana hsrr,daf(i.1) annual 1D), (Fig. dwarf rare, This hsi h nyrhizomatous only the is This / Stenopoa and W re(i.3) (Fig. tree Poa ...... 2...... 4 ...... Poa a tmndsadawell- a and staminodes has trnTLF . P and ehe 1836 Lechler OA t oiinwithin position Its ...... 8 ...... 1...... nadto h abaxial the addition In ...... 7 ...... 5 ...... supersection Aphanelytrum oaohlaperuviana Tovarochhloa ...... 4...... and .trolli D. sect. A clade. eesn18303 Peterson . nlss h sister The analysis. Dissanthelium A procumbens . D .trolli D. procumbens and ISSANTHELIUM ...... 5...... a edioe- be may hltp:P!; (holotype: Dissanthelium Poa Tovarochloa Tovarochloa Homalopoa o reflexa Poa / ...... 3...... a low has Stenopoa .H L. H. E. spart is might has , ...... 7...... 6...... The Poa Poa are aatdfo wle n Tovar and Swallen from (adapted / ...... 6 ...... lrt,3nre.Lmaoaeo bog ct,subacute, acute, scabr oblong, usually toothed, or or ovate obtuse, Lemma 3-nerved. the florets, than longer or two, equaling subacuminate, ovate- Glumes arcuate, lanceolate, lanceolate, disar- oblong-lanceolate, florets. so, Rachilla between approximately or florets. and equal two glumes with above usually ticulating (spike-like) Spikelets narrow open. upper panicle, to a and Inflorescence bisexual pistillate). floret floret (lower gynomonoecious quently Poa typic the support 2009) of 2008, inclusion 2007, al. et (Gillespie studies previous 2007). (Refulio-Rodriguez study this of in species included all from distinct and unique mathewsii one, first The var. semitectum Dissanthelium laxifolium in sections we new addition two In below. create changes nomenclatural necessary the ot mrc Agnia hl,Blva n Peru). and and Bolivia, Chile, (Mexico) (Argentina, America America South North Distribution 3(5)-nerved. cent, o rauhii Poa for varieties two ( and species eight 2. the efbaeeiemsadla ld ntm of anatomy blade leaf and epidermis blade leaf o arcuata Poa nulo eena,msl wr,cepts.Pat fre- Plants caespitose. dwarf, mostly perennial, or Annual ic h oeua hlgne fti td n hs of those and study this of phylogenies molecular the Since ...... 9...... o serpaiana Poa Dissanthelium mathewsii olcae :17 76[77.TP:PR.Ad PERU. [1787].—TYPE: 1786 Apr., Titicacam, 107. non lacum 1906. 1: 378. 37: Collectanea Syst. Jahrb. Bot. 1841. peruvianum Phalaridium h pcfceihthnr r sa oa Serpa, Tovar Oscar Dr. honors epithet specific The 8.13.TP:PERU. 1830.—TYPE: 281. 1836. ob tstat. et comb. sect. Poa , sect. ssnnmzdwith synonymized is , rzprmcalycinum Brizopyrum isnhlu peruvianum Dissanthelium Dissanthelium o congesta Poa , o serpaiana Poa ...... 8...... Dissanthelium o calycina Poa h eodnwscincntttstemono- the constitutes section new second The . Poa Tovarochloa aooi Treatment Taxonomic ld and clade sect. Dissanthelium .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. , Dissanthelium and , . var. ssnnmzdwith synonymized is o macusaniensis Poa and Ti. .F Refulio-Rodriguez, F. N. (Trin.) F es&Myn rmna 29. Gramineae Meyen, & Nees Poa . T D calycina 1965; J u,rrl lboso pubes- or glabrous rarely ous, o calycina Poa . Tovarochloa .Pel ei.Hek 1(4–5): Haenk. Reliq. Presl, J. . o swallenii Poa . anes n. s. Haenke F peruvianum rn,Lnaa1() 305. 10(3): Linnaea Trin., (supersection . ee .n. s. Meyen Tovar Ne ee)Pilg., Meyen) & (Nees Poa ossso pce of species of consists , and , Poa o calycina Poa o calycina Poa o peruviana Poa sect. and 1993) var. in o calycina Poa , hltp:PR).‘ (holotype: ). erecognize We . o macusaniensis Poa o parvifolia Poa Poa Dissanthelium Dissanthelium Tovarochloa Dissanthelium calycina ioye B). (isotype: o calycina Poa Homalopoa var. emake we , o parvifolia Poa o serpaiana Poa o swallenii Poa var. o congesta Poa o arcuata Poa o rauhii Poa mathewsii calycina Jacq., and , var. .3 is ). , Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. isnhlu aioimSaln&Tvr htlga1:370. 11: Phytologia Tovar, & Swallen laxifolium Dissanthelium o amplivaginata Poa the of part form not do but Dissanthelium isnhlu semitectum Dissanthelium 9. 6. 7. 3 YTMTCBTN Vlm 37 [Volume BOTANY SYSTEMATIC 130 4. 5. 3. .P 8. o parvifolia Poa o swallenii Poa o congesta Poa o rauhii Poa o arcuata Poa olwn r h oecaua hne o h pce of species the for changes nomenclatural the are Following o calycina Poa ACALYCINA OA nov. it a. e.B o.3:7 95—YE EU Ancash: PERU. 1985.—TYPE: 7. 33: Bot. B, Ser. Nat., Hist. 1922, 1155 Featherstone Jun W. 12 Junin, PERU. 1965.—TYPE: 1965.— 249. Apr. 12(5): 22 Phytologia ft, Sm., 14,000–14,300 1882, Casapalca, B. Above L. PERU. & TYPE: Foster C. R. Mexic.Pl.2:112.1886. 2 0 1885. 60. 22: nov. comb. pte eest h rut iso h glumes. the of tips arcuate the to refers epithet ui:Yui nloe“oy lp,1,0 t 5May leaves. small 25 the to ft, refers epithet 13,600 specific slope, “doby” loose 1922, on Yauli, Junin: brevifolia Poa brevifolium 95—YE EU nah oons,2 a 1956, May 29 Bolognesi, E Ancash: PERU. 1965.—TYPE: r ao .Salnwodsrbdteseisfrthe for species the described who time. first Swallen R. Jason Dr. 1305 Gilbert 1My1956, May Huancavelica11 Hu entre Huancavelica: Dist., PERU. Conaica Prov., 1928.—TYPE: 1. f. densa Poa densum uyaaocTnii ec at,440450m, 4,400–4,500 1953, Manta, Mar. 31 a cerca Huaytanayocc-Tansiri, Prov., Huancavelica Huancavelica: PERU. 1927.—TYPE: brevis Poa breve panicle. spike-like crowded, the to refers epithet 7.16.TP:PR.Slaty ,0 ,2 a 1957, May 29 m, W 3,200 Salcantay, PERU. 1965.—TYPE: 376. nov. .Ws.Aa.Si 31) 2.12.TP:PERU. 1923.—TYPE: 224. 13(11): Sci. T Acad. Wash. J. 1830. 281. calycinum Brizopyrum ihu i eoint rse hssuywudnot would study this possible. grasses been to have devotion his without EU ianoc atclaps,aot360m, 3,600 about pass, Panticolla Pinasniocc, PERU. expansa Poa expansum . . . ert 2627 Cerrate anes n. s. Haenke Rauh isnhlu rauhii Dissanthelium isnhlu amplivaginatum Dissanthelium als n. s. Ball wle oa,Pyooi 1 7.16.non 1965. 371. 11: Phytologia Tovar, & Swallen Macbride wle oa,Pyooi 1 7.16.non 1965. 374. 11: Phytologia Tovar, & Swallen Saln&Tvr .F eui-orge,comb. Refulio-Rodriguez, F. N. Tovar) & (Swallen & .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. wle oa,Pyooi 1 7.16.non 1965. 374. 11: Phytologia Tovar, & Swallen htwr nlddi u oeua analysis molecular our in included were that risy z.Gan o.Sd ....2:619, 27: S.S.S.R. Sada Bot. Glavn. Izv. Troitsky, .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. wle oa,Pyooi 1 7.16.non 1965. 375. 11: Phytologia Tovar, & Swallen .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. var. G icc,Cnr ..Nt.Hr.2() 328. 24(8): Herb. Natl. U.S. Contr. Hitchc., .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. ecapi mathewsii Deschampsia isnhlu calycinum Dissanthelium isnhlu sclerochloides Dissanthelium hltp:U!.Teseii pte honors epithet specific The US!). (holotype: . .F ml,Ss.Nt 8.1791.—TYPE: 181. Nat. Syst. Gmel., F. J. J rs)Knh nm l :36 1833. 326. 1: Pl. Enum. Kunth, Presl) (J. O C,Sn al 3.10.TP:PERU. 1806.—TYPE: 131. Gall. Syn. DC., hltp:K stp:GH). isotype: K; (holotype: ishP Hirsch O hltp:US!). (holotype: hltp:PR). (holotype: mathewsii . & . Tvr .F eui-orge,comb. Refulio-Rodriguez, F. N. (Tovar) oa 2547 Tovar oa 1161 Tovar etesoe933 Featherstone hltp:US!). (holotype: wle oa,Pyooi 1 370. 11: Phytologia Tovar, & Swallen - 1418 Poa .Pel ei.Hek 1(4–5): Haenk. Reliq. Presl, J. wle oa,Pyooi 11: Phytologia Tovar, & Swallen isnhlu mathewsii Dissanthelium Bl)N .Refulio-Rodriguez, F. N. (Ball) sect. hltp:US!). (holotype: hltp:U!.Tespecific The US!). (holotype: yaaocyMna ,0 m, 4,500 Manta, y aytanayocc hltp:U!.Tespecific The US!). (holotype: Dissanthelium Ball,J.Linn.Soc.,Bot. hltp:U!.The US!). (holotype: oa,Pbi.Mus. Public. Tovar, J rs)Hitchc., Presl) (J. tu.e .Fourn, E. ex Steud. J . F Dissanthelium Dissanthelium . Dissanthelium Dissanthelium MacBride : Cook (Ball) & & o atropidiformis Poa o gigantea Poa o linearifolia Poa o deminuta Poa boliviana Poa aequalis Poa into species these transfer also we similarities examined. were remaining of the three with species spikelet all the of of similarities specimens Morphological type the However, D thomasii Poa o trollii Poa . he species, Three pygmaeum A,M,US!). MO, MAF, Unio la 1983, Mar. y 19 Pachacoto entre cumbre Bolognesi, hltp:B;ioye I US!). SI, isotype: BA; (holotype: longifolium de Ancash: PERU. 1985.—TYPE: 9831 7–8. Unio La 33: a Huaraz Bot. B, Ser. giganteum Dissanthelium 1922, Dec. 24 ARGENTINA. Gallegos, 1925.—TYPE: Rio 7. Cruz: f. 80, Santa 8: Aires) (Buenos 1973. 97. 18: dePunaconpajonal,4,070m,23Mar.1983, pygmaeum species. endemic the the of to 1926, distribution refers epithet Jan. specific 20 The US!). (holotype: ft, 18,000–20,000 Paz, BOLIVIA.La 1899.—TYPE: 3. 9: U.S.D.A. Agrostol. Div. Circ. non 1912. 25. 11: non longiligulatum BOLIVIA. 1292A 1965.—TYPE: 368. 11: Phytologia nov. comb. blades. leaf narrow very the to refers epithet cific 9884 PERU. 1851.—TYPE: 425. 2: Abyss. Fl. Hua Tent. Rich., A. ex t c.Nt ,() 1 86 non 1836. 61. 4,2(1): Nat. Sci. Pt. Saint-Pe Sci. Imp. non 1985. 33:9–10. Bot. alm1:78 93—YE OII.L Union, La BOLIVIA. 1933.—TYPE: 1966 778. Troll 11: Dahlem trollii Dissanthelium first who Nuttall Thomas species. honors the described epithet specific Santa California: The A. S. Island, U. Catalina 1854.—TYPE: non 261. 1: 1881. Glumac. 56. 4: Pl. Icon. 1848. californica oic it,Hatnyc-Tnii ce Tansiri, Huaytanayocc- Dist., Coniaca Prov., Huancavelica Huancavelica: PERU. 1880.—TYPE: pygmaea Poa ´ uo o eMy rv,vled ulac,ce Huallanca, de valle Prov., Mayo de Dos nuco: o boliviensis Poa hltp:UM;ioye A,M,US!). MO, MAF, isotype: USM!; (holotype: hltp:UM;ioye A,M,U!.Tespe- The US!). MO, MAF, isotype: USM!; (holotype: isnhlu californicum Dissanthelium hltp:US!). (holotype: Dissanthelium Pl. .F eui-orge,cm.nov. comb. Refulio-Rodriguez, F. N. (Pilg.) eenticue normlclranalysis. molecular our in included not were , .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. Tvr .F eui-orge,cm.nov. comb. Refulio-Rodriguez, F. N. (Tovar) ut,Po.Aa.Nt c.Piaepi :25. 4: Philadelphia Sci. Nat. Acad. Proc. Nutt., Saln&Tvr .F Refulio-Rodriguez, F. N. Tovar) & (Swallen wle oa,Pyooi 1 6.16.non 1965. 367. 11: Phytologia Tovar, & Swallen hltp:B). (holotype: .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. oa,Pbi.Ms it a.Lm,Sr B, Ser. Lima, Nat. Hist. Mus. Public. Tovar, isnhlu aequale Dissanthelium var. O uhnn ni.Gas .Za. .50A. t. Zeal., N. Grass. Indig. Buchanan, isnhlu aequale Dissanthelium isnhlu patagonicum Dissanthelium wle oa,Pyooi 1 6.1965. 369. 11: Phytologia Tovar, & Swallen . abls n. s. Gambel oa tal et Tovar ´ ´ o longiligula Poa patagonica ,450m 2Mr 1983, Mar. 22 m, 4,590 n, esor,Se tersbourg, ak eet pc o.RgiVeg. Regni Nov. Spec. Repert. Hack. ig,Ntzl o.Gr.Berlin- Gart. Bot. Notizbl. Pilg., eefudadbsdo these on based and found were o longifolia Poa oa,Pbi.Ms it Nat., Hist. Mus. Public. Tovar, . o californica Poa 9777 hltp:G! stp:US!). isotype: GH!; (holotype: Prd)Ncr,Darwiniana Nicora, (Parodi) ´ .6 c.Mt. Seconde Math., Sci. 6, r. hltp:UM;isotype: USM!; (holotype: cin ..Williams, T.A. & Scribn. Nt. et. Hooker’s Benth., (Nutt.) , D o longifolia Poa . wle Tovar, & Swallen longiligulatum rn,Me Trin., A ´ tu. y.Pl. Syn. Steud., . pdd Puna, de sped aoi Physis Parodi, Poa L O ureos n. s. Guerrero O Dissanthelium . Dissanthelium Dissanthelium . ´ . abr180 Dauber G : ,44 m, 4740 n, oa tal et Tovar oa tal et Tovar ´ Stenochloa . .Acad. m. Mandon Hochst. ´ and , sped . . Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. lyo,W .adS .Rnoz.18.Gnr rmnm rse of Grasses Graminum: Genera 1986. Renvoize. A. S. and D. W. Clayton, more or One 2004. Aiken. G. S. and Leitch, J. I. Fay, F. posicio M. la K., A. Sobre Brysting, 1997. Negritto. A. M. and M. A. Anton, Tovar ars .S,M Ka for M. procedure S., isolation J. DNA Farris, rapid A 1987. Doyle. L. J. and J. J. Doyle, analysis phylogenetic preliminary A 2007. Soreng. J. R. and I. J. Davis, Cladistic 1998. Siqueiros. E. M. and Pant, R. Kinney, S. M. T., J. Siqueiros- Columbus, E. M. Kinney, S. M. Cerros-Tlatilpa, R. T., J. Columbus, Catala endan- and rare of Inventory 2001. (CNPS). Society Plant Native California identification. model statistical the at look new A 1974. H. Akaike, NY, MO, GH, F, CM, USM. CAS, the and BAA, US, BA, UC, in curators SI, loans: the provided PH, for to grateful herbaria assistance also following are the the We Marcos Bolivia. of for and San Peru Bolivia in of plants Herbarium of of collection the Herbarium of National staff the islandsand Guadalupe to and thanks Clemente, San Special Catalina, respectively. Santa explore to us Ecologı tating de A. S. Grupo U. and Conservancy, Atherton Island Navy, Catalina Institution’s Santa Smithsonian to the Thanks National Foundation. and Seidell the Biodiversity History, of Fund Natural Grant), Grants of Small (Educational Museum and Program Society Rancho Inventories the and Plant Founda- Surveys from Mellon Native W. grants California Andrew by Program, tion, supported Botany Garden was Botanic work Ana Santa lab and Field grasses. 02 EUI-ORGE TA. HLGN FDSATEIM131 DISSANTHELIUM OF PHYLOGENY AL.: ET REFULIO-RODRIGUEZ 2012] esnti,J 93 aiu ieiodadmnmmsesmethods minimum-steps and likelihood Maximum 1973. J. Felsenstein, o apiculata Poa Poa Acknowledgments. h world. the evidence. Pooideae) phylogenetic (Poaceae: on Loliinae based subtribe to approach systematic A 2007. genus project. grass Flora arctic Panarctic the in species Kurtziana ge del Automatic on Transactions Engineers Electronics and Control Electrical of tute oit fAmerica tissue. of leaf Society an fresh of including quantities genomes, small nuclear and GBSSI. struc- plastid in to the loss attention intron with of (Poaceae), features Pooideae tural subfamily grass the of (nrDNA) region Aliso spacer transcribed of internal sequences of analysis parsimony and spacer Refulio-Rodriguez. transcribed internal F. preliminary ribosomal N. a nuclear chloroplast and (Gramineae): on Griffith, based Chloridoideae P. study of M. Phylogenetics Bell, 2007. L. H. delgado, Society. Plant Editor. Native Convening California Tabor, P. Sacramento: D. Committee, Advisory Rare California. Scientific Sacramento, Plant edition) (sixth California of plants gered o siaigeouinr re rmdt ndsrt characters. discrete on data from Zoology Systematic trees evolutionary estimating for incongruence. of cance .D afr.&Bt rtoi 44:4841 .1 1982 1. f. 478–481, 34(4): Brittonia But, [ & nov.— Macfarl. D. stat. T. et comb. Rodriguez, of plants of size small the species. to the refers epithet specific The ,0 ,1 a 1956, May 11 m, 4,500 .18.non 1982. 1. peruviana pcfceihtrfr otearp pclnroigof narrowing apical lemma. and abrupt glumes the the to refers epithet specific 1954, May 11 Rauh m, 4,600 Ausangate, PERU. [1787].—TYPE: ´ sect. { = ,P,P orcla .A oe-orge,J Mu J. Lopez-Rodriguez, A. J. Torrecilla, P. P., n, h otiue mesrbyt u nweg fPeruvian of knowledge our to immeasurably contributed who , o apiculata Poa 7 99–132. 17: ´ nero Tovarochloa & 9 716–723. 19: 5 157–163. 25: ishP1208 Hirsch e ultnAdtoa Series Additional Bulletin Kew trnL .D afr.&Bt rtoi 44:4841 f. 478–481, 34(4): Brittonia But, & Macfarl. D. T. Dissanthelium .F eui-orge,nm nov. nom. Refulio-Rodriguez, F. N. ¨ llersjo Bouteloua o peruviana Poa - F 9 11–15. 19: sequences. 2 240–249. 22: ¨ .F Refulio-Rodriguez] F. N. .G lg,adC ut 94 etn signifi- Testing 1994. Bult. C. and Kluge, G. A. , hsppri rte nhnro r Oscar Dr. of honor in written is paper This Aliso ieaueCited Literature T .Mcal u)N .Refulio- F. N. But) & Macfarl. D. (T. Cladistics Taxon ´ ayConservacio n eaie Gaiee Chloridoideae). (Gramineae: relatives and hltp:U! stp:HI) The HEID). isotype: US!; (holotype: Paee upeecae Argentina. en presencia su y (Poaceae) 3 335–348. 23: Aliso 3 365–382. 53: O aq,Cletna1 0.1786 107. 1: Collectanea Jacq., . 0 315–319. 10: Aliso Dupontia oa 2545 Tovar 3 565–579. 23: htceia ultn Botanical Bulletin. Phytochemical 3 380–405. 23: ´ 3 1–389. 13: eIls(EI o facili- for (GECI) Islas de n oaoho peruviana Tovarochloa otiuint the to contribution a – ? ¨ lr n .A Stace. A. C. and ller, hltp:US!). (holotype: ´ sistema n Tovarochloa Insti- ´ tica ilsi,L . .Acabut n .J oeg 07 hlgn of Phylogeny 2007. Soreng. J. R. and Archambault, A. G., L. Gillespie, esnti,J 95 ofdnelmt npyoeis napproach an phylogenies: on limits Confidence 1985. J. Felsenstein, oqit .adJ .Hesnek 03 RAE :Bysa phylo- Bayesian 3: MRBAYES 2003. Huelsenbeck. P. J. and F. Ronquist, 1998. A. S. Renvoize, uhs .adR atod 06 sadrdaino continental a on radiation Island 2006. Eastwood. R. and of C. inference Hughes, Bayesian MrBayes: 2001. A Ronquist. 1999. F. and Asay. P. J. H. Huelsenbeck, K. and Chatterton, J. N. Jacobs, L. W. S. C., Hsiao, ed,H .adB .Smsn 06 h igorpyo the of biogeography The 2006. Simpson. B. status B. and rediscovery and The M. 2008. H. Knapp. Meudt, S. D. and L. J. in McCune, 265–276 Pp. Pooideae. subfamily Poaceae 1987. D. T. Macfarlane, bias attraction Long-branch 2009. Thornton. W. J. and B. Kolaczkowski, Saxifragaceae in and inference Franz, Phylogenetic 1995. M. Soltis. E. D. Dezulian, and A. T. L. Johnson, Rausch, C. Richter, C. D. H., D. Huson, 1923. for S. sequences A. RNA Hitchcock, Ribosomal 1988. Zimmer. A. E. and K. R. Hamby, Phylogeny 2010. Bull. D. R. and Paradis, M. Soreng, J. R. J., L. Gillespie, eui-orge,N .2007. F. N. Refulio-Rodriguez, Catala P. and Castroviejo, S. averaging. A., Quintanar, model phylogenetic jModelTest: 2008. D. Posada, 2005. Delsuc. F. and Rodriguez, N. Brinkmann, H. Zhou, Gambel, Y. William H., Philippe, by collected plants of Descriptions 1848. T. Nuttall, abu,A n .J rmod 04 Tracer. 2004. Drummond. J. A. and A. Rambaut, 2.0.a11. version editor, alignment Sequence Se-Al: 1996–2002. A. Rambaut, agrosto Novedades 1973. G. E. Nicora, ilsi,L . .J oeg n .W .Jcb.20.Pyoeei rela- Phylogenetic 2009. Jacobs. L. W. S. and Soreng, J. R. J., L. Gillespie, Refulio- F. N. and Jacobs, L. W. S. Bull, D. R. Soreng, J. R. J., L. Gillespie, Poa sn h bootstrap. the using eei neec ne ie models. mixed under inference genetic University. Graduate Claremont California: Claremont, dissertation. cl:Ecpinlrtso ln iesfcto fe pito the of uplift after diversification plant of Andes. rates Exceptional scale: trees. phylogenetic the on (ITS). based DNA (Poaceae) ribosomal family Botany nuclear grass of the sequences of phylogeny molecular Sciences of Academy Washington the of nal oit.LnenSceyo London of Tasmania. dispersal Society and and Linnean Society. Zealand origin American New South to evidence: phylogenetic ular genus subalpine austral, California. of Smithsonian C.: D. Washington, Press. Barkworth. Institution E. M. and Campbell, evolution S. C. and systematics Grass phylogenetics. 10.1371/journal.pone.0007891. Bayesian doi: in inconsistency and Garden Botanical Missouri the and stricto sensu phylo- large for viewer interactive trees. An genetic Dendroscope: 2007. Rupp. R. 10334–10339. (Poaceae). family grass Evolution and the tematics within phylogeny Press. inferring University Aarhus Aarhus: Davis. I. J. and Barfod, S. A. (Poaceae) subtribes l related o and g Poinae ebasedonnrITS,ETS,and n subtribe y in ,a reticulation nand de v o l u t i oBotany ni nt h eM o n o c o t y l e d o n s documentation plastid from inferred sequences. ITS Poaceae) nuclear (Pooideae, Aveneae Evolution and Biology phylogenetics. Biology in lutionary attraction long-branch and California. Heterotachy upper and Philadelphia Mountains of Sciences Rocky Natural of the Academy in D. M. 80–106. optrpormaddcmnain vial thttp://tree.bio. at ed.ac.uk/software/. available documentation, and program Computer aa relationships. basal o w e genera, new two for Australian of tionships plastid Poinae and ITS subtribe nuclear in on sequences. based relationships Poeae) Phylogenetic (Poaceae, 2008. Rodriguez. isnhlu californicum Dissanthelium Paee ae on based (Poaceae) 1 667–668. 11: 2 413–436. 22: rceig fteNtoa cdm fSine USA Sciences of Academy National the of Proceedings Botany Madron vial thttp://tree.bio.ed.ac.uk/software/tracer/. at available , M Bioinformatics BMC Gramı Gilia :50–57. 5: Dissanthelium ˜ 6 938–967. 86: o Bioinformatics Aliso ´ Evolution 5 60–68. 55: 5 1253–1256. 25: Plmnaee using(Polemoniaceae) esd Bolivia de neas 6:29–37. 160: mrcnJunlo Botany of Journal American Saxipoa Poa trnT 3 420–434. 23: Ourisia trnTLF ytmtc of Systematics 2 149–175. 82: - Paee one,mlclrevidence molecular Poinae), (Poaceae: trnF Paee nSnaCtln Island, Catalina Santa on (Poaceae) d .R oesrm .W Hilu, W. K. Soderstrom, R. T. ed. , 9 783–791. 39: nAeia eu fgrasses. of genus American an and ´ :460. 8: 7 754–755. 17: oia patago logicas aa p 8–1 in 589–617 Pp. data. Patgnca)bsdo molec- on based (Plantaginaceae) 7 479–513. 87: e:TeRylBtncGardens. Botanic Royal The Kew: . eunedt:mjrcae and clades major data: sequence ilgclJunlo h Linnean the of Journal Biological ´ Sylvipoa .20.Pyoeyo h tribe the of Phylogeny 2007. n. Bioinformatics d.O eeg .Petersen, G. Seberg, O. eds. , 3 223–225. 13: Dissanthelium :149–189. 1: matK . optrpormand program Computer ´ utainSystematic Australian utainSystematic Australian LSONE PLoS nicas. sequences. 4 1554–1569. 94: 9 1572–1574. 19: Darwiniana trnT iest,phy- Diversity, Trin trnT-F Proceedings. ln Sys- Plant M Evo- BMC - Molecular trnL :e7891, 4: nasof Annals h D. Ph. . - Jour- trnF 103: and 18: Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. wfod .L 02 PAUP 2002. L. D. Swofford, orcla . .A Lo A. J. P., Torrecilla, primers Universal 1991. Bouvet. J. and Pautou, G. Gielly, L. P., Taberlet, oa,O 95 coepce uvsd rmna e Peru del gramineae de nuevas especies Ocho 1985. O. Tovar, genus grass The 1965. Tovar. O. and R. J. Swallen, ht,T . .Bus .Le n .Tyo.19.Apiiainand Amplification 1990. Taylor. J. world. and the Lee, of S. genera Bruns, grass T. The J., 1992. T. Dallwitz. White, J. M. and L. Watson, Gramı Las 1993. O. Tovar, oeg .J 98 nifaeei lsiiainfor classification infrageneric An 1998. J. R. Soreng, uei,A .19.Nea ia aal lr Argentina: Flora la para citas Nuevas 1999. A. algo- A. bootstrap rapid Sulekic, A 2008. Rougemont. J. and Hoover, P. A., Stamatakis, phylo- likelihood-based Maximum RAxML-VI-HPC: 2006. A. Stamatakis, Zuloaga, O. F. Judziewicz, J. E. Davidse, G. Peterson, M. P. J., R. Soreng, reticula- and Phylogeny 2010. Gillespie. J. L. and Bull, D. R. J., R. Soreng, 3 YTMTCBTN Vlm 37 [Volume BOTANY SYSTEMATIC biogeography search. and tree phylogenetics and Chloroplast-DNA 1990. alignment J. of R. Independence Soreng, 2004. P. M. Simmons, 132 Ne ee)Srn .J ilsi—eu U942 EU792464. EU792422, Gillespie—Peru; J. L. & Soreng Subgenus Meyen) & (Nees Subgenus acinaciphylla Poa Subgenus DQ353982. EU792380, Islands; Falkland EU792455; EU792382, sub-Antarctic; Island, Ochlopoa, JF904756 using inference phylogenetic Bayesian 1997. Rannala. B. and Z. Yang, o cockayneana Poa tion Gillespie the by classification For the study. follow 2009). this (2008, we in al. Poeae et sequenced of samples sections Voucher for and obtained. subtribes only not was given this sequence in is the obtained that information indicates were (—) sequences dash that A indicate study. bold and in ITS numbers numbers: accession accession GenBank (herbarium); ber DQ353986; Q248 Subgenus GQ324458. GQ324448; DQ354014; GQ324537, EU792409, GQ324416; Australia; GQ324506, Vickery—Australia; Subgenus DQ354036/DQ354037. EU792389, Balb.—Slovakia; Appendix Subgenus ( 361–376. 11: naayi fISand ITS of analysis on of relationships DNA. chloroplast of regions Biology non-coding Molecular Plant three of amplification for ulccoe e ue eHsoi aua Jve rd” ei B. Serie Prado”. “Javier Natural Historia de Botanica Museo del Publicaciones Garden ical 303–308. 2: alnfr,U . AIPublishing. CABI K.: U. Wallingford, n te oe nscin,seis n useisof subspecies and and species, sections, on notes other and 1383–1400. 77: villosissimus servers. web RAxML the models. for rithm mixed and taxa of thousands informatics with analyses genetic World New of Herbarium Pooideae. Catalogue National Subfamily 2003. States United Morrone. IV. O. (Poaceae): and grasses Filgueiras, S. T. Press. University Aarhus Aarhus: Davis. I. J. in Monocotyledons 619–643 the Pp. diploids. to tion in tion nartcltn ru:suyin study group: reticulating a in Evolution and Phylogenetics Molecular ietsqecn ffna iooa N ee o phylogenies. for in genes RNA 315–322 ribosomal Pp. fungal of sequencing direct N eune:aMro hi ot al method. Carlo Monte Evolution San Chain and White. Markov Biology J. a T. sequences: and DNA Sninsky, J. J. Gelfand, Inc. H. Press, D. Academic Diego: Innis, A. M. eds. Micrantherae * n te ehd)vrin401.Sneln:SnurAssociates. Sinauer Sunderland: 4.0b10. version methods) other and ; Dissanthelium Poa Section o supina Poa Poa, o bulbosa Poa Poa Ochlopoa, ,Supersection 3 1–16. 33: .Txn onr;vuhrcletradcleto num- collection and collector voucher country; Taxon; 1. 2 2688–2690. 22: ereNwZaad Q247 GQ324409; GQ324497, Zealand; Petrie—New Supersection 1 124–158. 91: ae nplastid on based .Desv.—Chile; E. : Parodiochloa y o annua Poa ´ isnhlu macusaniense Dissanthelium C rtcl:agiet ehd n applications and methods to guide a protocols: PCR crd—.S . U937 Q594 Subgenus DQ353984. EU792387, A.; S. Schrad.—U. Vulpia pez-Rodrı Section (Poaceae). d.O eeg .Ptre,A .Bro,and Barfod, S. A. Petersen, G. Seberg, O. eds. , .U .A;G349,GQ324404; GQ324492, A.; S. L.—U. Poa o sieberiana Poa ´ 4 717–724. 14: es(oca)dlPeru del (Poaceae) neas Homalopoa Supersection , trnL 7 1105–1109. 17: n eae eea(oa,Paee based Poaceae) (Poeae, genera related and : Homalopoa, * Arenariae L.—Peru; hlgntcaayi sn parsimony using analysis Phylogenetic : o cookii Poa ´ - uz n .Catala P. and guez, F trnTLF Novon oeg7169 Soreng sequences. o porphyroclados Poa ,Section iest,pyoey n vlto in evolution and phylogeny, Diversity, 8 1–730. 48: : ytmtcBiology Systematic :187–202. 8: o alpina Poa Poa n rT eune ihatten- with sequences nrITS and eesn18256 Peterson peg—utai;GQ324550, Spreng.—Australia; Section Ho.f)Ho.f.—Kerguelen Hook. f.) (Hook. 1 874–879. 31: Homalopoa o flabellata Poa . Brizoides naso h isuiBotan- Missouri the of Annals mrcnJunlo Botany of Journal American o labillardierei Poa (US); ´ Anthochloa Dissanthelium . .Cnd;EU792390, L.—Canada; (Gramineae). Poa ´ Ruizia otiuin rmthe from Contributions Poa .20.Phylogenetic 2004. n. JF904812 ,Subsect. Section , Section , nNrhAmerica, North in trnTLF Nees—Australia; (RSA); Lm)Raspail— (Lam.) 7 758–771. 57: 3 1–480. 13: o,Puccinellia Poa, : Ochlopoa, o fawcettiae Poa o molinerii Poa DQ354023. , o lepidula Poa Australopoa . GenBank . Acutifoliae Phytologia Molecular JF904811 Brizoides Steud.— Hickenia Bromus Sec- Bio- ´ . , : , , : , JF904840 isnhlu peruvianum Dissanthelium Tovar—Peru; (RSA); semitectum JF904764 amplivaginatumDissanthelium procumbens Aphanelytrum Subgenus DQ354055; DQ354021; JF904785 JF904784 17059 Subsect. eesn18119 Peterson brevifolium Dissanthelium Homalopoa scaberula JF904845 JF904818 U940 Subgenus EU792460. Brizoides Subgenus DQ354013. EU792411, Section Subgenus DQ354048/DQ354049. EU792408, JF904768 A.; S. Benth—U. (Nutt.) 18172 (RSA); Refulio Section Subgenus GQ324451. GQ324544, Republic; occidentalis Poa (RSA); (US); (RSA); 44741 EU854590; EU792404, Russia; Q500 Argentina; DQ354020; (RSA); Homalopoa, Subgenus EU792469. EU792428, peruviana Tovar—Peru; Tovar—Peru; EU792467; & EU792425, Swallen EU792466; EU792426, Peru; Peru; Poa DQ354024; DQ354025; DQ354028; EU792405, A.; EU792407, S. U. A.; S. Vasey—U. fendleriana cinU .A;G344,GQ324450; GQ324543, A.; S. Scribn—U. ae—.S A.; S. Vasey—U. JF904837 Sm.—Peru; 16595 B. L. mathewsii & Dissanthelium Foster C. R. JF904834 Krause) L. H. (E. (RSA); (RSA); Peru; Reeder—Chile; Peru; Peru; eesn18140 Peterson Peru; Pilg.—Peru; Peru; Peru; H151 Subgenus AH015561. stiriaca Poa Tovar—Peru; eesn17972 Peterson Supersection , eesn18037 Peterson JF904846, eesn17950 Peterson eesn16567 Peterson eesn17973 Peterson (RSA); eesn17898 Peterson eesn18117 Peterson - (RSA); JF904847 (RSA); eesn17914 Peterson (RSA); orge 165 Rodriguez F087 JF904761 JF904817, JF904830 JF904831 JF904826 JF904813 Madropoa JF904821 Brizoides ,Subsect. , , , Austrofestuca ok .Cie U942 U941 Subgenus EU792461. EU792412, f.—Chile; Hook. ; ; ; , , ; JF904779 isnhlu trollii Dissanthelium JF904782 ,Section JF904787 Poa .D afr.&BtPr;E722,E727;Bolivia; EU792470; EU792429, But—Peru; & Macfarl. D. T. cue2 McCune Refulio isnhlu breve Dissanthelium Sed)VsyU .A;E720,DQ354027; EU792403, A.; S. Vasey—U. (Steud.) JF904762 JF904776 o wheeleri Poa wle Tovar—Peru; & Swallen o stuckertii Poa .s n .l.: s. and s. s. rtc Hayek—Austria; & Fritsch eesn18106 Peterson o holciformis Poa JF904838 ,Supersection JF904816 (RSA); eesn16569 Peterson eesn17954 Peterson JF904836 eesn16634 Peterson ae—.S A.; S. Vasey—U. JF904828 eesn15676 Peterson , , DQ354015; , ,Subsect. , JF904788; , , (RSA); : - (RSA); — hr 11305 Ahart orge 231 Rodriguez JF904774 Neuropoa JF904770 o cusickii Poa JF904757 Homalopoa ; JF904765 U947 EU792465; EU792427, ; ; ; ; ; Dioicopoa isnhlu patagonicum Dissanthelium (RSA); (RSA); (RSA); (RSA); o howellii Poa JF904858 isnhlu giganteum Dissanthelium : eesn17138 Peterson (RSA); (RSA); , o horridula Poa (RSA); Refulio Poa Poa (SBBG); o pubinervis Poa , JF904780 , (RSA); ae—.S . U946 Q506 Subgenus DQ354026. EU792406, A.; S. Vasey—U. , JF904760 eesn16663 Peterson Bl)R .Fse .B Sm.—Peru; B. L. & Foster C. R. (Ball) cue1 McCune Ne ee)Pilg.—Peru; Meyen) & (Nees JF904823 JF904778 Supersection , JF904855 wle oa—eu Q223 EU792468; GQ324263, Tovar—Peru; & Swallen Supersection , JF904772 ; o kurtzii Poa Hc. aoiCie U944 DQ354022. EU792414, Parodi—Chile; (Hack.) ; : ; ; JF904853 Brizoides ; Hc. ak—eu U949 EU792459; EU792419, Hack.—Peru; (Hack.) o gilgiana Poa JF904852 JF904832 o huancavelicae Poa JF904833 (RSA); o fax Poa - Homalopoa ru “Punapoa”: Group , isnhlu laxifolium Dissanthelium : o asperiflora Poa isnhlu calycinum Dissanthelium o atropidiformis Poa orge 118 Rodriguez Tovar—Peru; JF904851 (US); JF904856 eesn18048 Peterson , JF904850 Pilg.—Peru; ae—.S . Q251 DQ354029; GQ324501, A.; S. Vasey—U. (RSA); (RSA); (RSA); o arachnifera Poa o chapmaniana Poa JF904798 .PelCie Q252 DQ354054/ GQ324512, Presl—Chile; J. (RSA); JF904825 o porsildii Poa wle Tovar—Peru; & Swallen ; oeg403 Soreng JF904857 ; eesn17103 Peterson ae cin—.S A.; S. Scribn.—U. & Vasey (RSA); , ;Mexico; , o fibrifera Poa JF904854 Poa ; Poa WilyBtnclGarden); Botanical (Wrigley JF904815 : , (RSA); ils&CutAsrla EU792410, Court—Australia; & Willis , ,—; JF904767 , .E r—hl;E721,DQ354018; EU792413, Fr.—Chile; E. R. JF904795 Vcey .W .Jacobs—Australia; L. W. S. (Vickery) isnhlu expansum Dissanthelium Pilg.—Peru; JF904794 o drummondiana Poa JF904793 JF904775 JF904814 JF904829 , JF904860 ,Supersection , ,Supersection , Section , JF904841 .Subgenus (RSA); JF904792 eesn18168 Peterson Pilg.—Peru; JF904796 , JF904791 Poa mraPS10 Smarda , Homalopoa isnhlu longifolium Dissanthelium JF904844 JF904769 eesn18303 Peterson JF904819 U) —, (US); isnhlu rauhii Dissanthelium eesn17961 Peterson JF904797 DQ354017; , o nervosa Poa jee.U .A;GQ324538, A.; S. Gjaerev.—U. ,Section o remota Poa , Poa Hack.—Peru; Poa Refulio ; (RSA); Tovar—Peru; Tovar—Peru; ; ; (RSA); JF904759 or—.S . GQ324486, A.; S. Torr.—U. ; Parodi—Argentina; JF904827 ; , Pilg.—Peru; , , o humillima Poa o dissanthelioides Poa isnhlu californicum Dissanthelium (RSA); isnhlu macusaniense Dissanthelium , Supersection , cin—.S A.; S. Scribn.—U. ak—hl;GQ324489, Hack.—Chile; JF904758 Homalopoa, ,Supersection o gymnantha Poa ; JF904773 ; JF904799 ; JF904783 o dentigluma Poa o aequigluma Poa , Poa o perligulata Poa eesn17888 Peterson o anae Poa ; Section , , - JF904789 ; JF904786 orge 151 Rodriguez eesn16548 Peterson JF904763 isnhlu densum Dissanthelium eesn18255 Peterson Refulio eesn18029Peterson Ircuticae JF904835 ,Section JF904822 wle Tovar— & Swallen o rivas Poa J rs)Hitchc.— Presl) (J. Homalopoa Homalopoa JF904839 ; (BRNU); , o reflexa Poa o chaixii Poa JF904771 (RSA); Ho. Vasey— (Hook.) Poa Forselles—Czech ; Nees—Australia; (RSA); ; (RSA); ; o candamoana Poa ; eesn16564 Peterson - eesn18193 Peterson eesn16594 Peterson o subspicata Poa eesn18210 Peterson eesn17953 Peterson eesn17960 Peterson netesedis: incertae orge 238 Rodriguez o macrantha Poa Supersection , Tovar—Peru; Dissanthelium ; ; Pilger—Peru; ; Dasypoa : o pearsonii Poa o bolanderi Poa oeg5964 Soreng , Leptophyllae , wle & Swallen o ircutica Poa Tovarochloa Homalopoa Homalopoa wle & Swallen , - JF904820 JF904842 JF904843 JF904766 JF904824 JF904848, martinezii JF904781 JF904777 Section , Section , ; ae & Vasey Tovar— Tovar— Pilger— Pilger— Tovar— Tovar— Peterson Peterson Peterson Radford (RSA); (RSA); (RSA); (RSA); Vill.— (RSA); : Poa Poa ; , , , ; , , , ; : ; Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Thu, 01 Mar 2012 21:17:45 Copyright (c) American Society for Plant Taxonomists. All rights reserved. DQ353996; JF904790 Subgenus DQ354009. GQ324487, Canada; Subgenus .S . U937 DQ354032/DQ354033. EU792377, A.; S. U. sylvestris Poa Sylvestres 133 compressa DISSANTHELIUM OF PHYLOGENY AL.: ET REFULIO-RODRIGUEZ Macropoa: Section Subgenus DQ354007. EU792402, Roshev—Russia; 2012] pseudoabbreviata U939 DQ353995; EU792399, Section Stenopoa Pseudopoa Subgenus GQ324435. GQ324525, Zealand; Petrie—New Poa U937 DQ354004; EU792397, Subgenus DQ354002; DQ353991. —, A.; S. Rydb.—U. Subgenus ammophila GQ324462. Poa GQ324555, A.; S. L.—U. JF904859 ,Subsection Oreinos Section , .Subgenus Q598 Subgenus DQ353998. , : : .U .A;E729,D340.Subgenus DQ354003. EU792395, A.; S. L.—U. o autumnalis Poa Poa o diaphora Poa o lettermanii Poa .Ga—.S . U935 DQ353980; EU792375, A.; S. Gray—U. A. Supersection , : .E osl—aaa U932 DQ353992; EU792392, Porsild—Canada; E. A. ohv—.S . U938 Q597 Subgenus DQ353997. EU792398, A.; S. Roshev.—U. Poa o laxa Poa Abbreviatae : o pratensis Poa o sibirica Poa Poa Stenopoa, o palustris Poa o leptocoma Poa anesubsp. Haenke rn—uky U940 Q598 Subgenus DQ353988. EU792400, Trin.—Turkey; Xcae,’e eln E2’: Zealand ’New clade), (X , ul xElotU .A;E727,DQ353979; EU792379, A.; S. Elliott—U. ex Muhl. ae—.S . Q251 GQ324431; GQ324521, A.; S. Vasey—U. :Poa Poa Section ,Section o secunda Poa ohvRsi;G344,GQ324455. GQ324547, Roshev—Russia; L.—Peru; Stenopoa, .U .A;E729,DQ354000; EU792396, A.; S. L.—U. abbreviata rn—.S A.; S. Trin.—U. Stenopoa fernaldiana Malacanthae eesn18107 Peterson Section Poa .PelU .A;EU792393, A.; S. Presl—U. J. .B.Cnd;GQ324481, Br.—Canada; R. Supersection , : Stenopoa, o glauca Poa Nnf)Hl—.S A.; S. Hyl.—U. (Nannf.) Poa Pandemos : oeg6040 Soreng Supersection , o arctica Poa o wolfii Poa Pseudopoa Sylvestres, Section (RSA); Vahl—Canada; o mathewsii Poa : Poa o trivialis Poa o interior Poa JF904849 Scribn.— Secundae Section , Stenopoa Section , .Br.— R. - Section 1 (US); Poa Poa Poa , , , : Argentina; .S A.; S. U. Aveninae: Peru; JF904752 antarctica Deschampsia utieLoliiinae: Subtribe 155 Rodriguez Agrostidinae: Subtribe Mexico; (RSA); (RSA); Phleinae: Subtribe Puccinelliinae: Poeae, Tribe pratense DQ353963. Phleum EU792340, Bieb.—Spain; M. oeg&L .GlepeCie U934 DQ353971. EU792354, Gillespie—Chile; J. L. & Soreng .B lxe—utai;E724,EU792435; EU792348, Alexeev—Australia; B. E. EU792433; EU792350, U936 DQ353967;EU792346, DQ353976; EU792368, Prob.—China; Stapf) DQ354058; DQ353969; EU792347, EU792351, Andersson—Canada; Griseb.—Canada; Br.) (R. Outgroups— eesn18220 Peterson JF904808 JF904805 rb oa,Sbrb Alopecurinae: Subtribe Poeae, Tribe . Refulio Refulio rhnteu elatius Arrhenatherum eesn17319 Peterson (RSA); ucnli frigida Puccinellia , - rb Bromeae: Tribe , L. orge 145 Rodriguez JF904753 - JF904750 orge 140 Rodriguez — iliclafloribunda Dielsiochloa .S . U931 Q594 rb oa,Subtribe Poeae, Tribe DQ353964. EU792341, A.; S. U. .Desv. E. JF904802 etclaeriopoda Festucella (RSA); okrclahookeriana Hookerochloa rb oa,Sbrb Poinae: Subtribe Poeae, Tribe . rb oa,Sbrb Miliinae: Subtribe Poeae, Tribe . gotstolucensis Agrostis (RSA); — JF904810 , (RSA); Argentina; Pi. .M Johnst.—Chile; M. I. (Phil.) JF904747 (RSA); rmsanomalus Bromus L)P eu.e .Pel&C Presl C. & Presl J. ex Beauv. P. (L.) JF904803 , JF904806 Vcey .B Alexeev—Australia; B. E. (Vickery) JF904804 Pl. Pilg.—Peru; (Pilg.) JF904755 rb oa,Sbrb Airinae: Subtribe Poeae, Tribe . uotafisheri Dupontia eesn17079 Peterson , lpcrshitchcockiiAlopecurus rtpatibetica Arctopoa JF904748 Kunth (F.Muell.exHook.f.) , , rb oa,Subtribe Poeae, Tribe . ioapaandina Nicoraepoa JF904751 JF904749 rtpiafulva Arctophila ur xE Fourn. E. ex Rupr. — ; rtgotslatifolia Arctagrostis Mexico; vn fatua Avena (RSA); .Br.—Canada; R. rb Poeae, Tribe . rb Poeae, Tribe . iimvernale Milium eesn17963 Peterson eesn15488 Peterson Mnoex (Munro JF904807 Parodi Refulio (Trin.) (Trin.) L.— — — — - ,