DOCSLIB.ORG

Mouse Pcsk6 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Pcsk6 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Pcsk6 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Pcsk6 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Pcsk6 gene (NCBI Reference Sequence: NM_011048 ; Ensembl: ENSMUSG00000030513 ) is located on Mouse chromosome 7. 22 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 22 (Transcript: ENSMUST00000055576). Exon 7 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Pcsk6 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-187G21 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous mutation of this gene results in partial lethality by E15.5. Embryos develop situs ambiguus with left pulmonary isomerism or craniofacial malformations including cyclopia, or both. Exon 7 starts from about 27.6% of the coding region. The knockout of Exon 7 will result in frameshift of the gene. The size of intron 6 for 5'-loxP site insertion: 21153 bp, and the size of intron 7 for 3'-loxP site insertion: 6005 bp. The size of effective cKO region: ~673 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 7 22 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Pcsk6 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7173bp) | A(26.43% 1896) | C(23.34% 1674) | T(26.4% 1894) | G(23.83% 1709) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr7 + 65949670 65952669 3000 browser details YourSeq 248 1406 1749 3000 92.8% chr16 + 32450395 32450776 382 browser details YourSeq 241 1424 1750 3000 92.7% chr10 + 105605501 105606152 652 browser details YourSeq 236 1415 1719 3000 93.4% chr1 - 180466933 180467697 765 browser details YourSeq 235 1423 1733 3000 93.7% chr5 - 113725020 113725487 468 browser details YourSeq 231 1420 1721 3000 91.7% chr13 - 35722601 35722976 376 browser details YourSeq 230 1435 1718 3000 92.0% chr2 - 91417560 91417905 346 browser details YourSeq 230 1420 1718 3000 93.0% chr16 - 11162986 11163315 330 browser details YourSeq 228 1453 1715 3000 94.6% chrX - 94040121 94040430 310 browser details YourSeq 228 1429 1719 3000 90.8% chr4 + 41847817 41848173 357 browser details YourSeq 227 1420 1718 3000 91.7% chr3 - 135668447 135668761 315 browser details YourSeq 227 1420 1715 3000 92.9% chr8 + 3326575 3326873 299 browser details YourSeq 227 1420 1725 3000 93.8% chr18 + 36623364 36623713 350 browser details YourSeq 226 1435 1718 3000 91.6% chr11 + 95933607 95933947 341 browser details YourSeq 224 1422 1720 3000 93.5% chr3 - 88589432 88590082 651 browser details YourSeq 224 1420 1718 3000 93.8% chr15 - 67511605 67511936 332 browser details YourSeq 223 1422 1718 3000 92.8% chr5 - 128978153 128978795 643 browser details YourSeq 223 1420 1719 3000 92.8% chr12 - 40924398 40924718 321 browser details YourSeq 223 1448 1719 3000 94.1% chr2 + 128725465 128725787 323 browser details YourSeq 222 1423 1724 3000 92.1% chr9 + 41625587 41625948 362 Note: The 3000 bp section upstream of Exon 7 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr7 + 65953343 65956342 3000 browser details YourSeq 94 1028 1163 3000 85.2% chr9 + 108420060 108589997 169938 browser details YourSeq 88 651 1084 3000 83.1% chr13 + 30160614 30161041 428 browser details YourSeq 87 922 1127 3000 72.7% chr9 + 107335140 107335323 184 browser details YourSeq 84 970 1135 3000 89.7% chr2 + 6255250 6255427 178 browser details YourSeq 83 1005 1131 3000 85.6% chr1 + 89910967 89911097 131 browser details YourSeq 82 1002 1127 3000 82.6% chr18 + 20577123 20577248 126 browser details YourSeq 81 1013 1135 3000 82.4% chr4 - 140553799 140553920 122 browser details YourSeq 81 1013 1135 3000 83.0% chr11 + 58096624 58096746 123 browser details YourSeq 80 1001 1127 3000 81.6% chr10 - 93617690 93617816 127 browser details YourSeq 78 1013 1134 3000 82.0% chr15 + 74648561 74648682 122 browser details YourSeq 77 1016 1131 3000 86.0% chr6 + 124948020 124948137 118 browser details YourSeq 76 1041 1252 3000 82.4% chr10 - 8894045 8894269 225 browser details YourSeq 75 1045 1318 3000 70.3% chr6 - 124876993 124877120 128 browser details YourSeq 73 1060 1157 3000 83.9% chr11 - 119932800 119932893 94 browser details YourSeq 73 912 1098 3000 89.2% chr11 - 101359257 101359451 195 browser details YourSeq 72 1028 1128 3000 86.2% chr15 - 100897126 101187667 290542 browser details YourSeq 72 971 1166 3000 82.4% chr15 - 83242966 83243159 194 browser details YourSeq 72 971 1138 3000 77.4% chrX + 65250547 65250696 150 browser details YourSeq 71 1055 1247 3000 90.7% chr16 + 33924771 33925030 260 Note: The 3000 bp section downstream of Exon 7 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Pcsk6 proprotein convertase subtilisin/kexin type 6 [ Mus musculus (house mouse) ] Gene ID: 18553, updated on 10-Sep-2019 Gene summary Official Symbol Pcsk6 provided by MGI Official Full Name proprotein convertase subtilisin/kexin type 6 provided by MGI Primary source MGI:MGI:102897 See related Ensembl:ENSMUSG00000030513 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as SPC4; Pace4; C86343; b2b2830Clo Expression Ubiquitous expression in liver adult (RPKM 17.9), cerebellum adult (RPKM 13.1) and 26 other tissuesS ee more Orthologs human all Genomic context Location: 7 C; 7 35.36 cM See Pcsk6 in Genome Data Viewer Exon count: 22 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 7 NC_000073.6 (65862136..66050386) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 7 NC_000073.5 (73007022..73195272) Chromosome 7 - NC_000073.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 6 transcripts Gene: Pcsk6 ENSMUSG00000030513 Description proprotein convertase subtilisin/kexin type 6 [Source:MGI Symbol;Acc:MGI:102897] Gene Synonyms PACE4, SPC4, b2b2830Clo Location Chromosome 7: 65,861,734-66,050,386 forward strand. GRCm38:CM001000.2 About this gene This gene has 6 transcripts (splice variants), 189 orthologues, 9 paralogues, is a member of 1 Ensembl protein family and is associated with 27 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Pcsk6-201 ENSMUST00000055576.11 4405 959aa ENSMUSP00000053742.5 Protein coding CCDS52267 F6XJP7 TSL:5 GENCODE basic APPRIS P3 Pcsk6-202 ENSMUST00000098391.10 4207 946aa ENSMUSP00000095992.4 Protein coding CCDS71978 E9Q4D0 TSL:1 GENCODE basic APPRIS ALT2 Pcsk6-204 ENSMUST00000176209.1 3734 798aa ENSMUSP00000135033.1 Protein coding - H3BJL4 CDS 5' incomplete TSL:5 Pcsk6-203 ENSMUST00000176199.7 619 164aa ENSMUSP00000135851.1 Protein coding - H3BLN2 CDS 3' incomplete TSL:3 Pcsk6-205 ENSMUST00000177272.1 681 No protein - Retained intron - - TSL:5 Pcsk6-206 ENSMUST00000177369.1 583 No protein - Retained intron - - TSL:5 Page 6 of 8 https://www.alphaknockout.com 208.65 kb Forward strand 65.90Mb 65.95Mb 66.00Mb 66.05Mb Genes (Comprehensive set... Pcsk6-203 >protein coding Pcsk6-206 >retained intron Pcsk6-205 >retained intron Pcsk6-201 >protein coding Pcsk6-202 >protein coding Pcsk6-204 >protein coding Snrpa1-206 >protein coding Gm45213-201 >protein coding Snrpa1-207 >lncRNA Snrpa1-202 >lncRNA Contigs < AC165968.3 < AC132595.3 AC148973.4 > Genes < Gm20684-201lncRNA (Comprehensive set... Regulatory Build 65.90Mb 65.95Mb 66.00Mb 66.05Mb Reverse strand 208.65 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript RNA gene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000055576 188.36 kb Forward strand Pcsk6-201 >protein coding ENSMUSP00000053... MobiDB lite Low complexity (Seg) Cleavage
Load more

Recommended publications
  • Identification of Expression Qtls Targeting Candidate Genes For
    ISSN: 2378-3648 Salleh et al. J Genet Genome Res 2018, 5:035 DOI: 10.23937/2378-3648/1410035 Volume 5 | Issue 1 Journal of Open Access Genetics and Genome Research RESEARCH ARTICLE Identification of Expression QTLs Targeting Candidate Genes for Residual Feed Intake in Dairy Cattle Using Systems Genomics Salleh MS1,2, Mazzoni G2, Nielsen MO1, Løvendahl P3 and Kadarmideen HN2,4* 1Department of Veterinary and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Denmark Check for 2Department of Bio and Health Informatics, Technical University of Denmark, Lyngby, Denmark updates 3Department of Molecular Biology and Genetics-Center for Quantitative Genetics and Genomics, Aarhus University, AU Foulum, Tjele, Denmark 4Department of Applied Mathematics and Computer Science, Technical University of Denmark, Lyngby, Denmark *Corresponding author: Kadarmideen HN, Department of Applied Mathematics and Computer Science, Technical University of Denmark, DK-2800, Kgs. Lyngby, Denmark, E-mail: [email protected] Abstract body weight gain and net merit). The eQTLs and biological pathways identified in this study improve our understanding Background: Residual feed intake (RFI) is the difference of the complex biological and genetic mechanisms that de- between actual and predicted feed intake and an important termine FE traits in dairy cattle. The identified eQTLs/genet- factor determining feed efficiency (FE). Recently, 170 can- ic variants can potentially be used in new genomic selection didate genes were associated with RFI, but no expression methods that include biological/functional information on quantitative trait loci (eQTL) mapping has hitherto been per- SNPs. formed on FE related genes in dairy cows. In this study, an integrative systems genetics approach was applied to map Keywords eQTLs in Holstein and Jersey cows fed two different diets to eQTL, RNA-seq, Genotype, Data integration, Systems improve identification of candidate genes for FE.
    [Show full text]
  • Supplementary Text Figures
    Supplementary Text Figures Figure S1: Comparison of cytokine-cytokine correlation in FINRISK07, FINRISK02, and YFS07. The heatmaps show the correlations between the normalised cytokines residuals in the discovery dataset, (A) FINRISK97, and the replication datasets, (B) FINRISK02 and (C) YFS07. Each square represents the Pearson’s correlation coefficient between the cytokines. The black box shows the correlation patterns among the 11 correlated cytokines (discovered using the FINRISK97) across the three datasets. The correlation matrix in FINRISK07 was subjected to hierarchical clustering using distance as 1 minus the absolute value of the correlations. The ordering of rows and columns in FINRISK02 and YFS07 was defined by the ordering in FINRISK07. The strength of the correlations is indicated by the colour on the scale, where red is a high positive correlation. Figure S2: Quantile-quantile (Q-Q) plots resulting from the multivariate GWAS in the three cohorts separately and meta-analysis. Q-Q plots of observed (y-axis) vs. expected P values (x-axis) for each SNP from the multivariate genome-wide association in (A) FINRISK97, (B) FINRISK02, (C) YFS07, and (D) Meta-analysis of the three cohorts. The diagonal red line (y=x) indicates null hypothesis of no association. The inflation factor (λ) was between 1.0 – 1.02 suggesting that inflation from population substructure or other confounders was appropriately adjusted for. Figure S3: Regional association plots for each of the 8 loci associated with the cytokine network from the meta-analysed multivariate GWA analysis. (A) VEGFA locus, rs7767396 is an intergenic SNP located 172.83kb downstream of vascular endothelial growth factor A (VEGFA) gene on chromosome 6p21.1.
    [Show full text]
  • Beyond the Genome—Towards an Epigenetic Understanding Of
    Progress in Neurobiology 159 (2017) 69–89 Contents lists available at ScienceDirect Progress in Neurobiology journal homepage: www.elsevier.com/locate/pneurobio Review article Beyond the genome—Towards an epigenetic understanding of handedness ontogenesis a, b a,c a Judith Schmitz *, Gerlinde A.S. Metz , Onur Güntürkün , Sebastian Ocklenburg a Institute of Cognitive Neuroscience, Department Biopsychology, Ruhr University Bochum, 44780 Bochum, Germany b Canadian Centre for Behavioural Neuroscience, Department of Neuroscience, 4401 University Drive, Lethbridge, Alberta, Canada c Stellenbosch Institute for Advanced Study (STIAS), Wallenberg Research Centre at Stellenbosch University, Stellenbosch 7600, South Africa A R T I C L E I N F O A B S T R A C T Article history: Received 28 February 2017 Hemispheric asymmetries represent one of the major organizational principles in vertebrate Received in revised form 18 September 2017 neurobiology, but their molecular determinants are not well understood. For handedness, the most Accepted 26 October 2017 widely investigated form of hemispheric asymmetries in humans, single gene explanations have been the Available online 31 October 2017 most popular ontogenetic model in the past. However, molecular genetic studies revealed only few specific genes that explain a small fraction of the phenotypic variance. In contrast, family studies Keywords: indicated heritability of up to 0.66. It has been suggested that the lack of recognizable genetic heritability Lateralization is partly accounted for by heritable epigenetic mechanisms. Based on recent neuroscientific findings Hemispheric asymmetry highlighting the importance of epigenetic mechanisms for brain function and disease, we review recent Functional preference findings describing non-genetic influences on handedness from conception to childhood.
    [Show full text]
  • PACE4 (PCSK6) (NM 138320) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC213553 PACE4 (PCSK6) (NM_138320) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: PACE4 (PCSK6) (NM_138320) Human Tagged ORF Clone Tag: Myc-DDK Symbol: PCSK6 Synonyms: PACE4; SPC4 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 PACE4 (PCSK6) (NM_138320) Human Tagged ORF Clone – RC213553 ORF Nucleotide >RC213553 representing NM_138320 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTCCGCGCGCGCCGCCTGCGCCCGGGCCCCGGCCGCCGCCCCGGGCCGCCGCCGCCACCGACACCG CCGCGGGCGCGGGGGGCGCGGGGGGCGCGGGGGGCGCCGGCGGGCCCGGGTTCCGGCCGCTCGCGCCGCG TCCCTGGCGCTGGCTGCTGCTGCTGGCGCTGCCTGCCGCCTGCTCCGCGCCCCCGCCGCGCCCCGTCTAC ACCAACCACTGGGCGGTGCAAGTGCTGGGCGGCCCGGCCGAGGCGGACCGCGTGGCGGCGGCGCACGGGT ACCTCAACTTGGGCCAGATTGGAAACCTGGAAGATTACTACCATTTTTATCACAGCAAAACCTTTAAAAG ATCAACCTTGAGTAGCAGAGGCCCTCACACCTTCCTCAGAATGGACCCCCAGGTGAAATGGCTCCAGCAA CAGGAAGTGAAACGAAGGGTGAAGAGACAGGTGCGAAGTGACCCGCAGGCCCTTTACTTCAACGACCCCA TTTGGTCCAACATGTGGTACCTGCATTGTGGCGACAAGAACAGTCGCTGCCGGTCGGAAATGAATGTCCA GGCAGCGTGGAAGAGGGGCTACACAGGAAAAAACGTGGTGGTCACCATCCTTGATGATGGCATAGAGAGA
    [Show full text]
  • Differentially Expressed Genes in Aneurysm Tissue Compared With
    On-line Table: Differentially expressed genes in aneurysm tissue compared with those in control tissue Fold False Discovery Direction of Gene Entrez Gene Name Function Change P Value Rate (q Value) Expression AADAC Arylacetamide deacetylase Positive regulation of triglyceride 4.46 1.33E-05 2.60E-04 Up-regulated catabolic process ABCA6 ATP-binding cassette, subfamily A (ABC1), Integral component of membrane 3.79 9.15E-14 8.88E-12 Up-regulated member 6 ABCC3 ATP-binding cassette, subfamily C (CFTR/MRP), ATPase activity, coupled to 6.63 1.21E-10 7.33E-09 Up-regulated member 3 transmembrane movement of substances ABI3 ABI family, member 3 Peptidyl-tyrosine phosphorylation 6.47 2.47E-05 4.56E-04 Up-regulated ACKR1 Atypical chemokine receptor 1 (Duffy blood G-protein–coupled receptor signaling 3.80 7.95E-10 4.18E-08 Up-regulated group) pathway ACKR2 Atypical chemokine receptor 2 G-protein–coupled receptor signaling 0.42 3.29E-04 4.41E-03 Down-regulated pathway ACSM1 Acyl-CoA synthetase medium-chain family Energy derivation by oxidation of 9.87 1.70E-08 6.52E-07 Up-regulated member 1 organic compounds ACTC1 Actin, ␣, cardiac muscle 1 Negative regulation of apoptotic 0.30 7.96E-06 1.65E-04 Down-regulated process ACTG2 Actin, ␥2, smooth muscle, enteric Blood microparticle 0.29 1.61E-16 2.36E-14 Down-regulated ADAM33 ADAM domain 33 Integral component of membrane 0.23 9.74E-09 3.95E-07 Down-regulated ADAM8 ADAM domain 8 Positive regulation of tumor necrosis 4.69 2.93E-04 4.01E-03 Up-regulated factor (ligand) superfamily member 11 production ADAMTS18
    [Show full text]
  • ATA35232-PCSK6 Rabbit Polyclonal Antibody
    ATAGENIX LABORATORIES Catalog Number:ATA35232 PCSK6 rabbit Polyclonal Antibody Product overview product name PCSK6 rabbit Polyclonal Antibody catalog No. ATA35232 Category Primary antibodies Host Rabbit Species specificity Human,Rat Tested applications WB Clonality Polyclonal Conjugation Unconjugated Immunogen Synthesized peptide derived from human PCSK6 Product performance Form Liquid Storage Use a manual defrost freezer and avoid repeated freeze thaw cycles. Store at 4 °C for frequent use. Store at -20 to -80 °C for twelve months from the date of receipt. Purity The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen. Dilution range WB 1:500-2000 Product background This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014], Web:www.atagenix.com E-mail: [email protected] Tel: 027-87433958.
    [Show full text]
  • Directional and Balancing Selection on Proprotein Convertase Subtilisin/Kexin Type 6 (PCSK6)
    Directional and balancing selection on proprotein convertase subtilisin/kexin type 6 (PCSK6) Sonja Kuderer Corresp., 1 , Martin Fieder 1 , Sylvia Kirchengast 1 1 Deparment of Anthropology, Universität Vienna, Vienna, Austria Corresponding Author: Sonja Kuderer Email address: [email protected] The selective pressures challenging the human population leave genetic signatures. This study was designed to detect positive and balancing selection on the proprotein convertase subtilisin/kexin type 6 (PCSK6) gene by four different approaches (FDIST, BayeScan, EHH, iHS). The outlier programs FDIST and BayeScan found 27 overlapping single nucleotide polymorphisms (SNPs) under selection, of which twelve are under strong positive directional selection and 15 under balancing selection. In the EHH analysis, all SNPs detected under positive selection show a slow decay of the derived extended haplotype. The integrated haplotype scores (iHS) for eight loci under positive selection were found to be larger than one. Based on these results, we provide a short overview of PCSK6-related mechanisms potentially associated with the detected positive or balancing selection patterns. Positive selection possibly reflects the key role of PCSK6 in tumorigenesis, in nociception, in rheumatoid arthritis and osteoarthritis, in the cardiovascular circulatory as well as in blood pressure regulation. Balancing selection acting on the PCSK6 locus might be explained by its involvement in vertebral left-right asymmetry and therefore in human handedness. Whereas until now
    [Show full text]
  • DNA Methylation Microarrays Identify Epigenetically Regulated Lipid
    Płatek et al. Mol Med (2020) 26:93 https://doi.org/10.1186/s10020-020-00220-z Molecular Medicine RESEARCH ARTICLE Open Access DNA methylation microarrays identify epigenetically regulated lipid related genes in obese patients with hypercholesterolemia Teresa Płatek1* , Anna Polus1, Joanna Góralska1, Urszula Raźny1, Anna Gruca1, Beata Kieć‑Wilk2,3, Piotr Zabielski4, Maria Kapusta1, Krystyna Słowińska‑Solnica1, Bogdan Solnica1, Małgorzata Malczewska‑Malec1 and Aldona Dembińska‑Kieć1 Abstract Background: Epigenetics can contribute to lipid disorders in obesity. The DNA methylation pattern can be the cause or consequence of high blood lipids. The aim of the study was to investigate the DNA methylation profle in periph‑ eral leukocytes associated with elevated LDL‑cholesterol level in overweight and obese individuals. Methods: To identify the diferentially methylated genes, genome‑wide DNA methylation microarray analysis was performed in leukocytes of obese individuals with high LDL‑cholesterol (LDL‑CH, 3.4 mmol/L) versus control obese individuals with LDL‑CH, < 3.4 mmol/L. Biochemical tests such as serum glucose, total≥ cholesterol, HDL cholesterol, tri‑ glycerides, insulin, leptin, adiponectin, FGF19, FGF21, GIP and total plasma fatty acids content have been determined. Oral glucose and lipid tolerance tests were also performed. Human DNA Methylation Microarray (from Agilent Tech‑ nologies) containing 27,627 probes for CpG islands was used for screening of DNA methylation status in 10 selected samples. Unpaired t‑test and Mann–Whitney U‑test were used for biochemical and anthropometric parameters statistics. For microarrays analysis, fold of change was calculated comparing hypercholesterolemic vs control group. The q‑value threshold was calculated using moderated Student’s t‑test followed by Benjamini–Hochberg multiple test correction FDR.
    [Show full text]
  • The Handedness-Associated PCSK6 Locus Spans an Intronic Promoter Regulating Novel Transcripts Robert Shore1, Laura Covill2, Kerry A
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Aston Publications Explorer Human Molecular Genetics, 2016, Vol. 25, No. 9 1771– 1779 doi: 10.1093/hmg/ddw047 Advance Access Publication Date: 21 February 2016 Original Article ORIGINAL ARTICLE The handedness-associated PCSK6 locus spans an intronic promoter regulating novel transcripts Robert Shore1, Laura Covill2, Kerry A. Pettigrew1, William M. Brandler2,†, Rebeca Diaz1, Yiwang Xu1, Javier A. Tello1, Joel B. Talcott3, Dianne F. Newbury2, John Stein4, Anthony P. Monaco2 and Silvia Paracchini1,* 1School of Medicine, University of St Andrews, St Andrews KY169TF, UK, 2Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford OX3 7BN, UK, 3School of Life and Health Sciences, Aston University, Birmingham, UK and 4Department of Physiology, Anatomy & Genetics, Parks Rd., Oxford OX1 3PT, UK *To whom correspondence should be addressed at: School of Medicine, University of St Andrews, St Andrews KY16 9TF, UK. Tel: +44 1334 463542; Fax: +44 1334 463482; Email: [email protected] Abstract We recently reported the association of the PCSK6 gene with handedness through a quantitative genome-wide association study − (GWAS; P < 0.5 × 10 8) for a relative hand skill measure in individuals with dyslexia. PCSK6 activates Nodal, a morphogen involved in regulating left–right body axis determination. Therefore, the GWAS data suggest that the biology underlying the patterning of structural asymmetries may also contribute to behavioural laterality, e.g. handedness. The association is further supported by an independent study reporting a variable number tandem repeat (VNTR) within the same PCSK6 locus to be associated with degree of handedness in a general population cohort.
    [Show full text]
  • Multivariate Genome-Wide Association Analysis of a Cytokine Network
    bioRxiv preprint doi: https://doi.org/10.1101/544445; this version posted February 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Multivariate genome-wide association analysis of a cytokine 2 network reveals variants with widespread immune, 3 haematological and cardiometabolic pleiotropy 4 5 Artika P. Nath1,2,3,*, Scott C. Ritchie1,2, Nastasiya F. Grinberg4, Howard Ho-Fung Tang1, Qin 6 Qin Huang1,5, Shu Mei Teo1,2, Ari V. Ahola-Olli6,7,8, Peter Würtz9,10 , Aki S. Havulinna8,11, 7 Kristiina Aalto12, Niina Pitkänen6, Terho Lehtimäki13, Mika Kähönen14, Leo-Pekka 8 Lyytikäinen13, Emma Raitoharju13, Ilkka Seppälä13, Antti-Pekka Sarin8,11, Samuli Ripatti8,15,16, 9 Aarno Palotie8,16,17,18,19, Markus Perola8,11, Jorma S Viikari20, Sirpa Jalkanen12, Mikael 10 Maksimow12, Marko Salmi20, Chris Wallace4,22, Olli T. Raitakari6,23, Veikko Salomaa11, Gad 11 Abraham1,2,5, Johannes Kettunen11,24,25,26, Michael Inouye1,2,3,5,27,* 12 13 1Cambridge Baker Systems Genomics Initiative, Baker Heart and Diabetes Institute, Melbourne, Victoria 3004, 14 Australia 15 2Cambridge Baker Systems Genomics Initiative, Department of Public Health and Primary Care, University of 16 Cambridge, Cambridge CB1 8RN, United Kingdom 17 3Department of Microbiology and Immunology, University of Melbourne, Parkville, Victoria 3010, Australia 18 4Department of Medicine, University of
    [Show full text]
  • The Genetic Relationship Between Handedness and Neurodevelopmental Disorders§
    Review The genetic relationship between handedness and neurodevelopmental disorders§ 1,2 3 William M. Brandler and Silvia Paracchini 1 MRC Functional Genomics Unit, Department of Physiology, Anatomy, and Genetics, University of Oxford, Oxford, OX1 3PT, UK 2 Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, OX3 7BN, UK 3 School of Medicine, University of St Andrews, St Andrews, KY16 9TF, UK Handedness and brain asymmetry have been linked to (Box 1). The only systematic review of the relationship neurodevelopmental disorders such as dyslexia and between handedness and developmental disorders was per- schizophrenia. The genetic nature of this correlation is formed in 1990 and found no evidence to suggest there are not understood. Recent discoveries have shown hand- any associations [6]. However, a meta-analysis of 3175 edness is determined in part by the biological pathways individuals with schizophrenia has shown that it is associ- that establish left/right (LR) body asymmetry during ated with an increased prevalence of left-handedness development. Cilia play a key role in this process, and (odds ratio = 1.81 [7]), but mixed results have also been candidate genes for dyslexia have also been recently reported [8]. shown to be involved in cilia formation. Defective cilia Being right-handed implies left-hemisphere dominance result not only in LR body asymmetry phenotypes but (see Glossary) for fine motor control, and handedness also brain midline phenotypes such as an absent corpus correlates with brain hemispheric asymmetries [9]. Fur- callosum. These findings suggest that the mechanisms thermore, there is a weak correlation between language for establishing LR asymmetry in the body are reused for lateralization and handedness; 96% of strong right-han- brain midline development, which in turn influences ders, as compared with 73% of strong left-handers, show traits such as handedness and reading ability.
    [Show full text]
  • A Point of Rarity in Genetic Risk for Bipolar Disorder and Schizophrenia
    WEB-ONLY CONTENT Rare Copy Number Variants A Point of Rarity in Genetic Risk for Bipolar Disorder and Schizophrenia Detelina Grozeva, MSc; George Kirov, PhD, MRCPsych; Dobril Ivanov, MSc; Ian R. Jones, PhD, MRCPsych; Lisa Jones, PhD; Elaine K. Green, PhD; David M. St Clair, MD, PhD; Allan H. Young, PhD, FRCPsych; Nicol Ferrier, PhD, FRCPsych; Anne E. Farmer, PhD, FRCPsych; Peter McGuffin, PhD, FRCPsych; Peter A. Holmans, PhD*; Michael J. Owen, PhD, FRCPsych*; Michael C. O’Donovan, PhD, FRCPsych*; Nick Craddock, PhD, FRCPsych*; for the Wellcome Trust Case Control Consortium Arch Gen Psychiatry. 2010;67(4):318-327 14 RESULTS schizophrenia article. In cases, this is caused by the ex- clusion of schizoaffective cases in the current analysis. The differences with regard to controls are caused by re- COMPARISON OF BURDEN OF COPY NUMBER analysis of a small subset of them. Some of the control VARIANTS ACCORDING TO SIZE BETWEEN data were processed with the use of different reference BIPOLAR CASES, CONTROLS, AND batches, which enabled us to include more controls in SCHIZOPHRENIA CASES the current analysis. We compared our bipolar disorder cases against our set of schizophrenia cases from the same population who had CNVs THAT OCCURRED MORE OFTEN IN been examined by the same methods (n=440).14 The copy BIPOLAR DISORDER CASES THAN CONTROLS number variants (CNVs) were classified into size cat- egories as in our previous report. eTable 1 shows the Although we did not observe an overall increase of CNV results. Compared with bipolar disorder, in the schizo- burden in bipolar cases compared with controls, some phrenia sample we observed a significant excess of large individual CNVs were more common in cases than con- deletions (PϽ.001) and total large CNVs (PϽ.001) and trols.
    [Show full text]