Fucus, Porphyra and Ulva Using a DNA Barcoding Approach, (Invited Seminar) Bamfield
Species identification and discovery in common marine macroalgae: Fucus,
Porphyra and Ulva using a DNA barcoding approach.
by
Hana Kucera
BSc. Simon Fraser University, 2004
A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
in the Graduate Academic Unit of Biology
Supervisor: Gary Saunders, PhD
Examining Board: Jason Addison, PhD, Department of Biology Dion Durnford, PhD, Department of Biology Larry Calhoun, PhD, Department of Chemistry
External Examiner: Chris Neefus, PhD, Department of Biological Sciences, University of New Hamshire
This dissertation is accepted by the Dean of Graduate Studies
THE UNIVERSITY OF NEW BRUNSWICK
July, 2010
©Hana Kucera, 2010 Library and Archives Bibliotheque et Canada Archives Canada
Published Heritage Direction du 1+1 Branch Patrimoine de I'edition 395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A 0N4 Canada Canada Your file Votre reference ISBN: 978-0-494-87658-9
Our file Notre reference ISBN: 978-0-494-87658-9
NOTICE: AVIS: The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distrbute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis. Canada DEDICATION
To Dave, whose support, patience and humour are my source of strength and inspiration.
ii ABSTRACT
The oceans represent a wealth of biological diversity where many species remain to be discovered and described. Among seaweeds, a paucity of morphological features by which to differentiate species means that many genera harbour overlooked or cryptic species. Fucus, Porphyra and Ulva are three common genera of marine intertidal algae and all include species that are particularly difficult to distinguish morphologically. DNA barcoding has been championed as a revolutionary tool for species identification and discovery and applying this tool to algae was a logical step due to the difficulty of morphological identification of many algal species. This thesis is part of a significant initiative aimed at identification and discovery of all species of seaweeds in Canadian waters, using a DNA barcoding approach. The original concept of DNA barcoding relied on comparing the 5' region of the mitochondrial cytochrome c oxidase 1 (COI-5P) gene among animal species. In this study, DNA barcoding with COI-5P was applied to the brown algal genus Fucus and worked as well as any other marker to assign morphologies to known species. The DNA barcoding results also uncovered substantial phenotypic diversity in Pacific F. distichus. Results were confirmed by comparison with sequences of the nuclear internal transcribed spacer region (ITS). For Porphyra, COI-5P DNA barcoding was compared with species identification using the chloroplast large rubisco subunit (rbcL) and the Universal Plastid Amplicon (UPA) in a floristic survey of
Canadian Porphyra species. Two new species were discovered and described {Porphyra corallicola and Porphyra peggicovensis), and P. cuneiformis was synonymized with P. amplissima. The COI-5P emerged as the best marker for species discrimination despite difficulties with primer universality. To aid in choosing a marker for DNA barcoding for iii green algae, the universality and species discriminatory power of the rubisco large subunit (rbcL) (considering the 5' and 3' fragments independently), the UP A, the D2/D3
region of the nuclear large ribosomal subunit (LSU-D2/D3) and the ITS were evaluated.
While the rbcL-2>Y highlighted several cryptic species, and worked well to distinguish
Ulva species, more research is needed to recommend a marker for DNA barcoding
generally in marine green macroalgae.
iv ACKNOWLEDGEMENTS
I would like to start by thanking my supervisor and mentor, Dr. Gary Saunders, for his tireless guidance throughout all aspects of the research and writing of this thesis. I am thankful for being a part of the productive and stimulating research environment that
Gary fosters in his laboratory. Gary's willingness to support all of my goals, even the non-research related ones, has made this degree a valuable and memorable experience.
Thank you also to my committee members, Dr. Aurora Nedelcu and Dr. Denise Clark for advice and feedback.
I am grateful for my wonderful labmates and colleagues for making field work a joy, for advice with research, for making my conference presentations better, for reminding me what is important and for sharing the journey as friends. Thank you,
Meghann Bruce, Bridgette Clarkston, Susan Clayden, Graham Cox, Sarah Hamsher, Katy
Hind, Dan McDevit, Kyatt Dixon, Ali Johnson, Line Le Gall, Caroline Longtin, Daniela
Milstein, Marina Morabito, Manuela Parente, Haseeb Randhawa, Kathryn Roy, Amanda
Savoie, Dennis Wong, and Norishige Yotsukura.
For technical assistance, many thanks to Andrew Blakney, Ross Campbell, Chris
Lane, and Tanya Moore. Charlene Mayes and Lisa Sharp have provided valuable teaching and career advice. Thanks to Mike Casey for helping keep my Mac happy for over 5 years. A big thank you to Lyle Smith, at Electronic Theses and Dissertations, for his friendly support and Word wizardry. For their support of my extracurricular activities,
I would like to thank Patti Douglass, Dr. Steve Heard, Sue McKee, Dr. Paul Munro, and
Dr. Allan Sharp. Thank you to Margaret Blacquier, Rose Comeau, Marg Morton, and
Marni Turnbull for their cheery hellos, and for their administrative assistance. v For their contributions to my well-being over the last few years, and I would very much like to thank April Kennedy, and Drs. Bonita Boone and Jo Ann Majerovich.
I am indebted to Dr. Louis Druehl for helping me find my passion for seaweeds by sharing his. I would like to thank my best friend and partner, Dave, for his unwavering support, understanding, patience and encouragement, which allowed me to sustain the effort needed to complete this thesis. And finally to my family, especially Mom and Dad, thank you. Thanks for inspiring me to love nature, and enabling me to become a scientist.
vi Table of Contents
DEDICATION ii ABSTRACT iii ACKNOWLEDGEMENTS v Table of Contents vii List of Figures x List of Tables xii Chapter 1 Introduction 1 Statement of Contributions to Research and Writing 8 References 9 Chapter 2 Assigning morphological variants of Fucus (Fucales, Phaeophyceae) in Canadian waters to recognized species using DNA barcoding 27 Abstract 28 Introduction 29 Materials and methods 32 Collections 32 Sequence acquisition and analysis 33 Anatomical observations 34 Results 34 F. serratus species group 35 F. vesiculosus and F. spiralis species group 35 F. distichus species group 36 Anatomical observations 38 Discussion 38 Acknowledgements 46 References 46 Chapter 3 A floristic survey of Canadian Porphyra and Bangia (Bangiales, Rhodophyta) species based on multiple molecular markers reveals cryptic diversity 61 Abstract 62 Introduction 62 Methods 69 Collections 69 DNA sequence acquisition 70 vii Sequence analyses for species identification 71 Phylogenetic analysis 72 Morphological work 73 Results 73 COI-5P results 74 rbcL results 75 UPA results 76 Comparing the COI-5P, rbcL and UPA as DNA barcode markers 77 Phylogenetic results 79 Discussion 79 Pacific floristic observations 79 Pacific Porphyra species not encountered in this study 82 Atlantic floristic observations 83 Atlantic Porphyra species not encountered in this study 85 Atlantic and Pacific Bangia 86 Caveats in using DNA sequences from Genbank 87 Choosing a molecular marker for species identification in the Bangiaceae 88 Taxonomic conclusions 90 Synonymy of Porphyra cuneiformis with Porphyra amplissima 90 Porphyra miniata and its sister species Porphyra variegata 92 General conclusions 97 Acknowledgements 97 References 98 Chapter 4 A pilot-study evaluation of rbcL, UPA, LSU and ITS as DNA barcode markers for the marine green macroalgae 130 Abstract 131 Introduction 131 Methods 137 Specimen collection and DNA extraction 137 Primer design and selection 138 PCR protocols and sequence acquisition 139 Comparison of markers 141 Species identification within the test set subsequent to DNA sequencing 141
viii Further evaluation of the rfecL-3P 142 Results and Discussion 142 Universality of the markers 142 Species-discrimination power of the markers 146 Taxonomic observations and putative cryptic species 148 Conclusions and future research 150 Acknowledgements 151 References 152 Chapter 5 General conclusions 177 Future research directions 182 References 183 Appendices 188 Appendix 1: Summary of collection information and GenBank and BOLD Accession numbers for Chapter 2 189 Appendix 2: Supplementary single strand ITS sequences for Chapter 2 197 Appendix 3: Specimens examined in Chapter 3 200 Appendix 4: Sources of published sequences used in Chapter 3 237 References 240 Appendix 5: Supplementary Figure: BOLD Taxon ID Tree for Chapter 3 245 Appendix 6: Collection information and accession numbers for samples used in the test set (Chapter 4) 251 Appendix 7: Collection information and accession numbers for rbcL-W data generated for the extended set of specimens (Chapter 4) 259 Curriculum Vitae
ix List of Figures
Figure 1.1: DNA barcoding workflow 22
Figure 1.2: Fucus species are a dominant component of the middle and upper intertidal zones 23
Figure 1.3: Phenotypic plasticity in Pacific Fucus 24
Figure 1.4: Morphology of the Bangiaceae 25
Figure 1.5: Main morphologies within Ulva 26
Figure 2.1: Neighbor-joining analysis of DNA barcode data, and a matrix of actual nucleotide distances between sequences 56
Figure 2.2: Neighbor-joining analysis of internal transcribed spacer data, and a matrix of actual distances between sequences for each genetic species group 58
Figure 2.3: Morphological variation in Fucus 60
Figure 3.1: Neighbor-joining phylogram for the C01-5P alignment 116
Figure 3.2: Neighbor-joining phylogram for the full rbcL alignment 118
Figure 3.3: Neighbor-joining phylogram for the UPA alignment 119
Figure 3.4: ML phylogeny of rbcL data 121
Figure 3.5: Porphyra corallicola sp. nov 123
Figure 3.6: Porphyrapeggicovensis sp. nov 125
Figure 4.1: Universality of each marker given as a percent of samples successfully sequenced 167
Figure 4.2: Unrooted neighbor-joining phylogram for r6cL-5P data 168
Figure 4.3: Unrooted neighbor-joining phylogram for rbcL-3P data 169
Figure 4.4: Unrooted neighbor-joining phylogram for UPA data 170 x Figure 4.5: Unrooted neighbor-joining phylogram for LSU-D2/D3 data 171
Figure 4.6: Unrooted neighbor-joining phylogram for the rbcL-3P data including sequences from the test set plus the extended set 173
Figure 4.7: Cellular arrangement of "Prasiola borealis" (a) and"Prasiola delicata" (b).
174
xi List of Tables
Table 3.1: A complete list of primers used in this study 126
Table 3.2: Summary of floristic results 128
Table 4.1: Summary of intra- and interspecific divergence for each marker for samples in the test set for genera for which more than one specimen was attempted and at least a single sequence was successfully generated 175
Table 4.2: Intra- and interspecific variation (% divergence) for the rbcL-3? for successful sequences from the test set plus the 162 additional samples in the extended set 176
xii 1
Chapter 1 Introduction
We are just beginning to understand fully the incredible taxonomic diversity of life on earth—while many terrestrial plants and animals have been and continue to be discovered, the oceans present a realm of immense species richness for which only a small proportion of species have been discovered and described (Knowlton 1993).
The intertidal macroalgae, generally referred to as seaweeds, present an interesting test case in species discovery. In a contemporary context, seaweeds have been studied since the time of Linnaeus and the description of new species has progressed steadily over the last two centuries (e.g., Brodie et al. 2008). Traditionally, discovery of new species of seaweeds required taxonomic expertise in the evaluation of morphological characteristics and anatomical and reproductive structures. However, owing to the typical simplicity of seaweed thalli, few characters are available for species description.
Furthermore, extensive phenotypic plasticity in gross morphological characteristics, as well as convergence on certain forms in seaweeds that share the same habitat, makes species identification difficult (e.g., Shaughnessy 2004). These difficulties, along with seasonality of reproductive structures, may have contributed to many species (known as cryptic species) remaining undiscovered.
In recent decades, the advancement of molecular techniques has provided a wealth of tools that aid in species discovery. Seaweed species have been discriminated based on DNA sequences (e.g., Saunders 2005), allozyme analysis (e.g., Lindstrom &
Cole 1993) and chemical profiles (e.g., Hemmingson & Nelson 2002), with DNA sequencing emerging as the preferred tool for species diversity questions. DNA sequences have also been used for phylogenetic analyses, allowing for taxonomic 2 investigation above the species level and providing an understanding of the relationships among species (e.g., Saunders & Hommersand 2004). However, phylogenetics and species discovery are two distinct (although related) areas of study, each requiring different approaches for selecting markers and data analysis. Phylogenetic questions require markers that evolve at an appropriate pace for the taxonomic level being investigated (Verbruggen & Theriot 2008). Models of DNA sequence evolution and robust statistical analyses are applied to infer hypotheses of evolutionary relatedness among taxa. On the other hand, a marker that is effective for species discovery is one that can be reliably and efficiently recovered from as many specimens as possible, provides resolution at the species level and can be standardized across a broad taxonomic range
(see Hollingsworth et al. 2009).
As the use of molecular markers emerged in phycological studies, phylogenetic analyses were the primary interest for macroalgal systematists. Taxonomic questions were investigated at the species level (e.g., Ross et al. 2003), up to the class and ordinal levels (e.g., Saunders et al. 2004, Saunders & Hommersand 2004). Molecular phylogenetic studies in algae have commonly relied on markers such as: the nuclear small ribosomal subunit (SSU) (e.g., Broom et al. 1999, Saunders et al. 2004, Rindi et al.
2007), the nuclear large ribosomal subunit DNA (LSU) (e.g., Harper & Saunders 2001,
Le Gall et al. 2008), internal transcribed spacer region of the ribosomal cistron (nuclear)
(ITS) (e.g., Saunders & Druehl 1993, Leclerc et al. 1998, Coyer et al. 2001, Bray et al.
2007, Brodie et al. 2007), the chloroplast rubisco large subunit (rbcL) (e.g., Freshwater et al. 1994, Hayden et al. 2003, Lindstrom & Fredericq 2003, Loughnane et al. 2008,
Phillips et al. 2008), or combinations of these and other markers. However, often a lack 3 of overlap between markers used within taxonomic groups, and between research laboratories, has made it difficult to compare data between studies.
More recently, the idea of using DNA sequences to identify and discover species prior to, or in the absence of, phylogenetic analysis has emerged as a new first step in taxonomic species description (e.g., Hebert et al. 2003a, Hebert et al. 2003b, Hebert &
Gregory 2005). The idea of using a standardized marker for species discovery and identification on a broad scale has been championed as "DNA barcoding" and has shown tremendous promise for animals such as mammals (e.g., Borisenko et al. 2007, Clare et al. 2007), birds (e.g., Kerr et al. 2009), fish (e.g., Ward & Holmes 2007, Valdez-Moreno et al. 2009), insects (e.g., Cywinska et al. 2006, Burns et al. 2007) and spiders (Barrett &
Hebert 2005), as well as marine macroalgae including the red (e.g., Saunders 2005,
Robba et al. 2006, Saunders 2008, Sherwood et al. 2008, Saunders 2009, Walker et al.
2009) and brown algae (Kucera & Saunders 2008, McDevit & Saunders 2009, 2010).
In a formal context, however, DNA barcoding is much more than simply using a standardized marker. Each step of the process from specimen collection to final identification to species (Fig. 1.1) involves a rigorous protocol ensuring high data quality.
At the time of collection, specimens are preserved as vouchers and detailed collection information, including latitudes and longitudes, is recorded. High standards for sequence data quality are ensured (see http://barcoding.si.edu/protocols.html). For example, trace files for forward and reverse reads for each sequence are given a quality ranking and stored in a single database repository, the Barcode of Life Data System (BOLD)
(Ratnasingham & Hebert 2007) (Fig. l.li). Sequences in BOLD are linked directly to vouchers, and are available for comparison with other sequences. Ultimately, alpha- 4 taxonomic evaluations of each specimen provide species names for the vouchers listed in
BOLD. Then, data analysis tools in BOLD allow users to match sequences from unidentified specimens with known species.
In its original conception, DNA barcoding was to rely solely on the 5' region of the mitochondrial cytochrome oxidase c 1 gene (COI-5P) as the standard marker, and this marker has been highly effective (as outlined above). However, it soon became apparent that no single marker can achieve the goal of identifying organisms from all kingdoms and other markers are now being investigated. For example, DNA barcoding in fungi relies on the ITS marker (Nilsson et al. 2008) and, in plants, the rbcL and maturase K
(matK) markers are being advocated (Hollingsworth et al. 2009).
This thesis is part of a substantial initiative to discover and identify all species of seaweeds in Canadian waters (Saunders 2008). The aim of this study was to test and apply a DNA barcoding approach to three common and taxonomically difficult intertidal macroalgal genera: the brown (Phaeophyceae) algae Fucus, the red (Rhodophyta) algae
Porphyra, and green (Chlorophyta) algae Ulva. Each of these genera has particular taxonomic difficulties in the Canadian flora and has presented unique challenges to the paradigm of DNA barcoding.
In Chapter 2, COI-5P is applied to species delimitation of Canadian Fucus
(Fucales, Phaeophyceae). Fucus species often dominate the upper and mid-intertidal zones and thus are of interest to intertidal ecologists (Fig. 1.2). Species-level identification is particularly difficult due to the lack of taxonomically informative characteristics, and to the presence of individuals expressing phenotypic characteristics intermediate between species (Perez-Ruzafa et al. 1993). For example, in the northeast 5
Pacific, F. spiralis and F. gardneri are distinguished partially based on distribution; the former is reportedly positioned highest in the intertidal, whereas the latter is found lower
(Gabrielson et al. 2006). However, morphological intermediates between these distinct species are commonly encountered in the area between the uppermost and lowest reaches of the Fucus zone (Fig. 1.3). A similar situation occurs in the Atlantic where a gradient of morphologies is observed between uppermost F. spiralis and mid-intertidal F. vesiculosus (Perez-Ruzafa et al. 1993, Engel et al. 2005).
Further complicating species resolution is the fact that species in this genus are closely related (e.g., Leclerc et al. 1998, Serrao et al. 1999, Coyer et al. 2002a, b, Coyer et al. 2003, Wallace et al. 2004, Bergstrom et al. 2005, Billard et al. 2005, Engel et al.
2005, Coyer et al. 2006, Mathieson et al. 2006). Fucus thus provides an ideal test case for
DNA barcoding with COI-5P and a key question of this study was whether or not this marker would work as well as others in distinguishing among species of this genus.
Owing to the presence of introgression and hybridization within this genus (Coyer et al.
2002b, Wallace et al. 2004, Billard et al. 2005, Engel et al. 2005), the ITS was also sequenced to allow for confirmation of COI-5P results and to proved a comparison with published work (Leclerc et al. 1998, Serrao et al. 1999).
In Chapter 3, DNA barcoding is applied to a broad floristic survey of Canadian
Bangiaceae (Bangiales, Rhodophyta). This monophyletic family consists of two genera,
Bangia and Porphyra, neither of which is monophyletic (Oliveira et al. 1995, Miiller et al. 1998, Broom et al. 1999, Broom et al. 2004). For both genera, the gametophytic phase is the most commonly encountered: Porphyra species consist of simple one- or two cell-layered blades, whereas Bangia species consist of uni- or multiseriate filaments (Fig. 6
1.4). The sporophytes of both genera are known as the "conchocelis stage", their microscopic filaments growing in calcareous substrates such as mollusk shells, barnacles or coralline algae (e.g., Drew 1949). As with Fucus, Porphyra species have been extensively studied, not so much because of their ecological role, but rather due to their economic importance as a food source (e.g., Merrill 1993, FAO 2003, Turner 2003).
However, when compared to Fucus, genera of the Bangiaceae are considered to have a deeper evolutionary history (Campbell 1980, Butterfield et al. 1990, Xiao et al. 1998,
Broom et al. 1999) and likely will require division into several segregate genera (see
Oliveira et al. 1995, Miiller et al. 1998, Broom et al. 1999, Broom et al. 2004). Given the economic importance of Porphyra, and the current interest in understanding the taxonomy of this genus (e.g., Brodie et al. 2008), the aim of this study was not only to provide a detailed survey of Canadian species, but also to evaluate the COI-5P in comparison with the rbcL and the universal plastid amplicon (UPA) (Sherwood &
Presting 2007) as a species delimitation tool. As in the Fucus study, the wealth of published sequence data (this time rbcL rather than ITS) allowed for confirmation of
COI-5P results and comparison with published studies, which facilitated the description of two new species, as well as provided new sequence data for species that had not previously been analyzed in a genetic context. Previously published data were combined with newly generated data and phylogenetic analyses were conducted to place newly described species in an evolutionary context.
The third and final paper in this thesis (Chapter 4) is a pilot study aimed at developing a marker for DNA barcoding of green marine macroalgae with the common intertidal genus Viva as the primary target. Marine green macroalgae are the last major 7 seaweed group for which a standardized DNA barcode marker remains to be established.
One of the major difficulties for DNA barcoding in the green seaweeds is the high prevalence of introns within green algal genomes (nuclear, mitochondrial, and plastid)
(e.g., Bhattacharya et al. 1996, Watanabe et al. 1998, Hanyuda et al. 2000, Haugen et al.
2005). The presence of introns within the cytochrome oxidase I gene (e.g., Watanabe et al. 1998) presumably hampered our initial attempts at isolating COI-5P sequences from green algae. Extensive primer testing for the COI-5P failed to generate successful sequence for this marker, leading us to abandon it in favour of testing the chloroplast rbcL (5' and 3' fragments), and UP A, as well as the nuclear LSU (variable D2/D3 region) and ITS markers, since each of these had shown promise in species identification among one or more taxa of plants, algae or fungi. Each of the above five markers was applied to 99 samples representing a broad taxonomic range and evaluated for universality and species discriminatory power.
The ultimate goal of this study was to recommend a marker for DNA barcoding and apply it to the genus Ulva, as a complement to the work on Fucus and Porphyra.
Ulva is one of the most common intertidal green macroalgae and consists of 16 reported species in Canada. As with Fucus and Porphyra, species identification in this genus is difficult due to the paucity of morphological and anatomical characters. Ulva species were formerly considered to fall into two genera, based on the gross morphology of their thalli. Species exhibiting a blade-like morphology were known as Ulva and species that were tube-like belonged to the genus Enteromorpha (Fig. 1.5). However, molecular systematic studies showed that this distinction lacks evolutionary significance and
Enteromorpha species were transfered to the genus Ulva (Hayden et al. 2003). Because 8
Ulva is a large contributor to pollutant-induced "green tides" (e.g., Blomster et al. 2002,
Leliaert et al. 2009), rapid species identification using a standardized DNA barcoding
technique is of practical importance.
The overarching theme of this thesis is the testing of DNA barcoding markers for
species identification, discrimination and discovery on three abundant and taxonomically
difficult genera common to the Canadian intertidal. Each taxonomic group tested has
provided a unique challenge in acquiring and interpreting DNA barcoding data.
Statement of Contributions to Research and Writing
I designed the research questions and methodology for this thesis, with guidance
and assistance from Dr. Gary Saunders.
I participated in the majority of the fieldwork components necessary to carry out
this research, and collectors who contributed to this project are acknowledged in each
chapter.
I carried out all but small components of the lab work needed for this thesis: I
produced all of the sequences and morphological assessments for Chapter 2. Of the 702
sequences in Chapter 3,1 produced approximately 650 with the remaining sequences
being generated by Andrew Blakney, a summer NSERC student, who I supervised during
the summer of 2006.1 also conducted all morphological investigations. In Chapter 4,
NSERC student Ross Campbell produced approximately 100 sequences under my
supervision, during the summer of 2008. Dan McDevit produced the 162 sequences in the
extended set, and I generated the remaining 170 sequences.
Under the guidance and assistance of Dr. Gary Saunders, I carried out all of the
data analysis, interpretation and manuscript preparation for this thesis. References
Barrett, R. D. H. & Hebert, P. D. N. 2005. Identifying spiders through DNA barcodes.
Can. J. Zool./Rev. Can. Zool. 83:481-91.
Bergstrom, L., Tatarenkov, A., Johannesson, K., Jonsson, R. B. & Kautsky, L. 2005.
Genetic and morphological identification of Fucus radicans sp nov (Fucales,
Phaeophyceae) in the brackish Baltic Sea. J. Phycol. 41:1025-38.
Bhattacharya, D., Friedl, T. & Damberger, S. 1996. Nuclear-encoded rDNA group I
introns: Origin and phylogenetic relationships of insertion site lineages in the
green algae. Mol. Biol. Evol. 13:978-89.
Billard, E., Daguin, C., Pearson, G., Serrao, E., Engel, C. & Valero, M. 2005. Genetic
isolation between three closely related taxa: Fucus vesiculosus, F. spiralis, and F.
ceranoides (Phaophyceae). J. Phycol. 41:900-05.
Blomster, J., Back, S., Fewer, D. P., Kiirikki, M., Lehivo, A., Maggs, C. A. & Stanhope,
M. J. 2002. Novel morphology in Enteromorpha (Ulvophyceae) forming green
tides. Am. J. Bot. 89:1756-63.
Borisenko, A. V., Lim, B. K., Ivanova, N. V., Hanner, R. H. & Hebert, P. D. N. 2007.
DNA barcoding in surveys of small mammal communities: a field study in
Suriname. Molecular Ecology Notes (OnlineEarly Articles):doi: 10.1111/j.471-
8286.2007.01998.x Bray, T. L., Neefus, C. D. & Mathieson, A. C. 2007. A morphological and molecular
investigation of the Porphyra purpurea (Bangiales, Rhodophyta) complex in the
Northwest Atlantic. Nova Hedwigia 84:277-98.
Brodie, J., Bartsch, I., Neefus, C., Orfanidis, S., Bray, T. & Mathieson, A. C. 2007. New
insights into the cryptic diversity of the North Atlantic-Mediterranean 'Porphyra
leucostictd complex: P. olivii sp nov and P. rosengurttii (Bangiales,
Rhodophyta). Eur. J. Phycol. 42:3-28.
Brodie, J., Mortensen, A., Ramirez, M. E., Russell, S. & Rinkel, B. 2008. Making the
links: towards a global taxonomy for the red algal genus Porphyra (Bangiales,
Rhodophyta). J. Appl. Phycol. 20:939-49.
Broom, J. E., Jones, W. A., Hill, D. F., Knight, G. A. & Nelson, W. A. 1999. Species
recognition in New Zealand Porphyra using 18S rDNA sequencing. J. Appl.
Phycol. 11:421-28.
Broom, J. E. S., Farr, T. J. & Nelson, W. A. 2004. Phylogeny of the Bangia flora of New
Zealand suggests a southern origin for Porphyra and Bangia (Bangiales,
Rhodophyta). Mol. Phylogenet. Evol. 31:1197-207.
Burns, J. M., Janzen, D. H., Hajibabaei, M., Hallwachs, W. & Hebert, P. D. N. 2007.
DNA barcodes of closely related (but morphologically and ecologically distinct)
species of skipper butterflies (Hesperiidae) can differ by only one to three
nucleotides. J. Lepid. Soc. 61:138-53. Butterfield, N. J., Knoll, A. H. & Swett, K. 1990. A Bangiophyte red alga from the
Proterozoic of Arctic Canada. Science 250:104-07.
Campbell, S. E. 1980. Palaeoconchocelis starmachii, a carbonate boring microfossil
from the Upper Silurian of Poland (425 million years old): implications for the
evolution of the Bangiaceae (Rhodophyta). Phycologia 19:25-36.
Clare, E. L., Lim, B. K., Engstrom, M. D., Eger, J. L. & Hebert, P. D. N. 2007. DNA
barcoding of Neotropical bats: species identification and discovery within
Guyana. Mol. Ecol. Notes 7:184-90.
Coyer, J. A., Hoarau, G., Oudot-Le Secq, M. P., Stam, W. T. & Olsen, J. L. 2006. A
mtDNA-based phylogeny of the brown algal genus Fucus (Heterokontophyta;
Phaeophyta). Mol. Phylogenet. Evol. 39:209-22.
Coyer, J. A., Peters, A. F., Hoarau, G., Stam, W. T. & Olsen, J. L. 2002a. Hybridization
of the marine seaweeds, Fucus serratus and Fucus evanescens
(Heterokontophyta: Phaeophyceae) in a 100-year-old zone of secondary contact.
Proc. R. Soc. Lond.B Biol. 269:1829-34.
Coyer, J. A., Peters, A. F., Hoarau, G., Stam, W. T. & Olsen, J. L. 2002b. Inheritance
patterns of ITS1, chloroplasts and mitochondria in artificial hybrids of the
seaweeds Fucus serratus and F. evanescens (Phaeophyceae). Eur. J. Phycol.
37:173-78. 12
Coyer, J. A., Peters, A. F., Stam, W. T. & Olsen, J. L. 2003. Post-ice age recolonization
and differentiation of Fucus serratus L. (Phaeophyceae; Fucaceae) populations in
Northern Europe. Mol. Ecol. 12:1817-29.
Coyer, J. A., Smith, G. J. & Andersen, R. A. 2001. Evolution of Macrocystis spp.
(Phaeophyceae) as determined by ITS1 and ITS2 sequences. J. Phycol. 37:574-
85.
Cywinska, A., Hunter, F. F. & Hebert, P. D. N. 2006. Identifying Canadian mosquito
species through DNA barcodes. Med. Vet. Entomol. 20:413-24.
Drew, K. M. 1949. Conchocelis-phase in the life history of Porphyra umbilicalis (L)
Kutz. Nature 164:748-49.
Engel, C. R., Daguin, C. & Serrao, E. A. 2005. Genetic entities and mating system in
hermaphroditic Fucus spiralis and its close dioecious relative F. vesiculosus
(Fucaceae, Phaeophyceae). Mol. Ecol. 14:2033-46.
FAO 2003. Review of the state of world aquaculture. FAO Fisheries Circular. Food and
Agriculture Organization of the United Nations, Rome.
Freshwater, D. W., Fredericq, S., Butler, B. S., Hommersand, M. H. & Chase, M. W.
1994. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL.
Proc. Natl. Acad. Sci. U. S. A. 91:7281-85. 13
Gabrielson, P. W., Widdowson, T. B. & Lindstrom, S. C. 2006. Keys to the Seaweeds and
Seagrasses of Southeast Alaska, British Columbia, Washington and Oregon.
University of British Columbia, Vancouver, 209 pp.
Hanyuda, T., Arai, S. & Ueda, K. 2000. Variability in the rbcL introns of Caulerpalean
algae (Chlorophyta, Ulvophyceae). J. Plant Res. 113:403-13.
Harper, J. T. & Saunders, G. W. 2001. The application of sequences of the ribosomal
cistron to the systematics and classification of the florideophyte red algae
(Florideophyceae, Rhodophyta). Cah. Biol. Mar. 42:25-38.
Haugen, P., Simon, D. M. & Bhattacharya, D. 2005. The natural history of group I
introns. Trends Genet. 21:111-19.
Hayden, H. S., Blomster, J., Maggs, C. A., Silva, P. C., Stanhope, M. J. & Waaland, J. R.
2003. Linnaeus was right all along: Ulva and Enteromorpha are not distinct
genera. Eur. J. Phycol. 38:277-94.
Hebert, P. D. N., Cywinska, A., Ball, S. L. & DeWaard, J. R. 2003a. Biological
identifications through DNA barcodes. Proc. R. Soc. Lond. B Biol. 270:313-21.
Hebert, P. D. N. & Gregory, T. R. 2005. The promise of DNA barcoding for taxonomy.
Syst. Biol. 54.
Hebert, P. D. N., Ratnasingham, S. & deWaard, J. R. 2003b. Barcoding animal life:
cytochrome c oxidase subunit 1 divergences among closely related species. Proc.
R. Soc. Lond. B Biol. 270:S96-S99. 14
Hemmingson, J. A. & Nelson, W. A. 2002. Cell wall polysaccharides are informative in
Porphyra species taxonomy. J. Appl. Phycol. 14:357-64.
Hollingsworth, P. M., Forrest, L. L., Spouge, J. L., Hajibabaei, M., Ratnasingham, S., van
der Bank, M., Chase, M. W., Cowan, R. S., Erickson, D. L., Fazekas, A. J.,
Graham, S. W., James, K. E., Kim, K. J., Kress, W. J., Schneider, H., van
AlphenStahl, J., Barrett, S. C. H., van den Berg, C., Bogarin, D., Burgess, K. S.,
Cameron, K. M., Carine, M., Chacon, J., Clark, A., Clarkson, J. J., Conrad, F.,
Devey, D. S., Ford, C. S., Hedderson, T. A. J., Hollingsworth, M. L., Husband, B.
C., Kelly, L. J., Kesanakurti, P. R., Kim, J. S., Kim, Y. D., Lahaye, R., Lee, H. L.,
Long, D. G., Madrinan, S., Maurin, O., Meusnier, I., Newmaster, S. G., Park, C.
W., Percy, D. M., Petersen, G., Richardson, J. E., Salazar, G. A., Savolainen, V.,
Seberg, 0., Wilkinson, M. J., Yi, D. K., Little, D. P. & Grp, C. P. W. 2009. A
DNA barcode for land plants. Proc. Natl. Acad. Sci. U. S. A. 106:12794-97.
Kerr, K. C. R., Lijtmaer, D. A., Barreira, A. S., Hebert, P. D. N. & Tubaro, P. L. 2009.
Probing evolutionary patterns in neotropical birds through DNA barcodes. PLoS
ONE 4.
Knowlton, N. 1993. Sibling species in the sea. Annu. Rev. Ecol. Syst. 24:189-216.
Kucera, H. & Saunders, G. W. 2008. Assigning morphological variants of Fucus
(Fucales, Phaeophyceae) in Canadian waters to recognized species using DNA
barcoding. Botany 86:1065-79. Le Gall, L., Dalen, J. L. & Saunders, G. W. 2008. Phylogenetic analyses of the red algal
order Rhodymeniales supports recognition of the Hymenocladiaceae fam. nov.,
Fryeellaceae fam. nov., and Neogastroclonium gen. nov. J. Phycol. 44:1556-71.
Leclerc, M. C., Barriel, V., Lecointre, G. & de Reviers, B. 1998. Low divergence in
rDNA ITS sequences among five species of Fucus (Phaeophyceae) suggests a
very recent radiation. J. Mol. Evol. 46:115-20.
Leliaert, F., Zhang, X. W., Ye, N. H., Malta, E., Engelen, A. H., Mineur, F., Verbruggen,
H. & De Clerck, O. 2009. Research note: Identity of the Qingdao algal bloom.
Phycol. Res. 57:147-51.
Lindstrom, S. C. & Cole, K. M. 1993. The systematics of Porphyra: character evolution
in closely related species. Hydrobiologia 261:151-57.
Lindstrom, S. C. & Fredericq, S. 2003. rbcL gene sequences reveal relationships among
north-east Pacific species of Porphyra (Bangiales, Rhodophyta) and a new
species, P. aestivalis. Phycol. Res. 51:211-24.
Loughnane, C. J., Mclvor, L. M., Rindi, F., Stengel, D. B. & Guiry, M. D. 2008.
Morphology, rbcL phylogeny and distribution of distromatic Ulva (Ulvophyceae,
Chlorophyta) in Ireland and southern Britain. Phycologia 47:416-29.
Mathieson, A. C., Dawes, C. J., Wallace, A. L. & Klein, A. S. 2006. Distribution,
morphology, and genetic affinities of dwarf embedded Fucus populations from
the northwest Atlantic Ocean. Bot. Mar. 49:283-303. McDevit, D. C. & Saunders, G. W. 2009. On the utility of DNA barcoding for species
differentiation among brown macroalgae (Phaeophyceae) including a novel
extraction protocol. Phycol. Res. 57:131-41.
McDevit, D. C. & Saunders, G. W. 2010. A DNA barcode examination of the
Laminariaceae (Phaeophyceae) in Canada reveals novel biogeographical and
evolutionary insights. Phycologia. 49:235-248
Merrill, J. E. 1993. Development of nori markets in the western world. J. Appl. Phycol.
5:149-54.
Miiller, K. M., Sheath, R. G., Vis, M. L., Crease, T. J. & Cole, K. M. 1998. Biogeography
and systematics of Bangia (Bangiales, Rhodophyta) based on the rubisco spacer,
rbcL gene and 18S rRNA gene sequences and morphometric analyses. 1. North
America. Phycologia 37:195-207.
Nilsson, R. H., Kristiansson, E., Ryberg, M., Hallenberg, N. & Larsson, K. H. 2008.
Intraspecific ITS variability in the Kingdom Fungi as expressed in the
international sequence databases and its implications for molecular species
identification. Evolutionary Bioinformatics 4.
Oliveira, M. C., Kumiawan, J., Bird, C. J., Rice, E. L., Murphy, C. A., Singh, R. K.,
Gutell, R. R. & Ragan, M. A. 1995. A preliminary investigation of the order
Bangiales (Bangiophycidae, Rhodophyta) based on sequences of nuclear small-
subunit ribosomal RNA genes. Phycol. Res. 43:71-79. 17
Perez-Ruzafa, I. M., Gallardo, T. & Gomez-Cancio, R. 1993. Numerical taxonomy of
some taxa of the genus Fucus in teh Iberian Peninsula. Hydrobiologia
260/261:81-90.
Phillips, N., Burrowes, R., Rousseau, F., De Reviers, B. & Saunders, G. W. 2008.
Resolving evolutionary relationships among the brown algae using chloroplast
and nuclear genes. J. Phycol. 44:394-405.
Ratnasingham, S. & Hebert, P. D. N. 2007. BOLD: The Barcode of Life Data System
(www.barcodinglife.org). Mol. Ecol. Notes 7:355-64.
Rindi, F., Mclvor, L., Sherwood, A. R., Friedl, T., Guiry, M. G. & Sheath, R. G. 2007.
Molecular phylogeny of the green algal order Prasiolales (Trebouxiophyceae,
Chlorophyra). J. Phycol. 43:811-22.
Robba, L., Russell, S. J., Barker, G. L. & Brodie, J. 2006. Assessing the use of the
mitochondrial cox 1 marker for use in DNA barcoding of red algae (Rhodophyta).
Am.J.Bot. 93:1101-08.
Ross, P. I., Donaldson, S. L. & Saunders, G. W. 2003. A molecular investigation of
Mazzaella (Gigartinales, Rhodophyta) morphologically intermediate between
Mazzaella linearis and M. splendens. Bot. Mar. 46:202-13.
Saunders, G. W. 2005. Applying DNA barcoding to red macroalgae: a preliminary
appraisal holds promise for future applications. Philos. Trans. R. Soc. Lond. B
Biol. Sci. 360:1879-88. Saunders, G. W. 2008. A DNA barcode examination of the red algal family
Dumontiaceae in Canadian waters reveals substantial cryptic species diversity. 1.
The foliose Dilsea-Neodilsea complex and Weeksia. Botany 86:773-89.
Saunders, G. W. 2009. Routine DNA barcoding of Canadian Gracilariales (Rhodophyta)
reveals the invasive species Gracilaria vermiculophylla in British Columbia.
Molecular Ecology Resources 9:140-50.
Saunders, G. W., Chiovitti, A. & Kraft, G. T. 2004. Small-subunit rDNA sequences from
representatives of selected families of the Gigartinales and Rhodymeniales
(Rhodophyta). 3. Delineating the Gigartinales sensu stricto. Can. J. Bot. 82:43-74.
Saunders, G. W. & Druehl, L. D. 1993. Nucleotide sequences of the internal transcribed
spacers and 5.8S ribosomal-RNA genes from Alaria marginata and Postelsia
palmaeformis (Phaeophyta, Laminariales). Marine Biology 115:347-52.
Saunders, G. W. & Hommersand, M. H. 2004. Assessing red algal supraordinal diversity
and taxonomy in the context of contemporary systematic data. Am. J. Bot.
91:1494-507.
Serrao, E. A., Alice, L. A. & Brawley, S. H. 1999. Evolution of the Fucaceae
(Phaeophyceae) inferred from nrDNA-ITS. J. Phycol. 35:382-94.
Shaughnessy, F. J. 2004. Contrasting patterns of allometry and realized plasticity in the
sister species Mazzaella splendens and Mazzaella linearis (Rhodopohyta). J.
Phycol. 40:846-56. Sherwood, A. R. & Presting, G. G. 2007. Universal primers amplify a 23S rDNA plastid
marker in eukaryotic algae and cyanobacteria. J. Phycol. 43:605-08.
Sherwood, A. R., Vis, M. L., Entwisle, T. J., Necchi, O. & Presting, G. G. 2008.
Contrasting intra versus interspecies DNA sequence variation for representatives
of the Batrachospermales (Rhodophyta): Insights from a DNA barcoding
approach. Phycol. Res. 56:269-79.
Turner, N. J. 2003. The ethnobotany of edible seaweed (Porphyra abbottae and related
species; Rhodophyta : Bangiales) and its use by First Nations on the Pacific Coast
of Canada. Canadian Journal of Botany-Revue Canadienne De Botanique 81:283-
93.
Valdez-Moreno, M., Ivanova, N. V., ElIas-GutiErrez, M., Contreras-Balderas, S. &
Hebert, P. D. N. 2009. Probing diversity in freshwater fishes from Mexico and
Guatemala with DNA barcodes. J. Fish Biol. 74:377-402.
Verbruggen, H. & Theriot, E. C. 2008. Building trees of algae: some advances in
phylogenetic and evolutionary analysis. Eur. J. Phycol. 43:229-52.
Walker, R. H., Brodie, J., Russell, S., Irvine, L. M. & Orfanidis, S. 2009. Biodiversity of
coralline algae in the northeastern Atlantic including Corallina caespitosa sp.
nov. (Corallinoideae, Rhodophyta). J. Phycol. 45:287-97.
Wallace, A. L., Klein, A. S. & Mathieson, A. C. 2004. Determining the affinities of salt
marsh fucoids using microsatellite markers: Evidence of hybridization and 20
introgression between two species of Fucus (Phaeophyta) in a Maine estuary. J.
Phycol. 40:1013-27.
Watanabe, K. I., Ehara, M., Inagaki, Y. & Ohama, T. 1998. Distinctive origins of group I
introns found in the COXI genes of three green algae. Gene 213:1-7.
Ward, R. D. & Holmes, B. H. 2007. An analysis of nucleotide and amino acid variability
in the barcode region of cytochrome c oxidase I (coxl) in fishes. Mol. Ecol. Notes
7:899-907.
Xiao, S. H., Zhang, Y. & Knoll, A. H. 1998. Three-dimensional preservation of algae and
animal embryos in a Neoproterozoic phosphorite. Nature 391:553-58. 21 Developing the DNA barcode database
e) PCR & Sequence d) DNA a) Collect specimen sub-sample
f) Compare with b) Collection information other specimens
i) Web-accessible database: BOLD g) Alpha taxonomy
c) Voucher
after Hebert (2007)
Figure 1.1: DNA barcoding workflow. Figure 1.2: Fucus species are a dominant component of the middle and upper intertidal zones.
Picture taken June 6,2005, Dixon Is., Bamfield B.C. 24
Upper tide zone: Rocky Intertidal Fucus spiralis
Mid Intertidal: Morphological intermediates
mid/low tide zone: Fucus distichus
* ^
Above Photos: M.D Guiry
Photo: H.Kucera
Figure 1.3: Phenotypic plasticity in Pacific Fucus.
On the rocky intertidal (represented by jagged black line), Fucus spiralis is found in the upper intertidal, whereas F. distichus is found lower. The zone between these distinct species is often inhabited by morphological intermediates. 25
b)
Figure 1.4: Morphology of the Bangiaceae.
Typical Porphyra blade form: (a) in situ, scale bar = 1 cm and (b) pressed as a voucher, scale bar = 2 cm. Typical Bangia filamentous form (c) in situ, scale bar = 10cm and (d)
pressed as a voucher, scale bar = 2.5cm 26
a)
c)
Figure 1.5: Main morphologies within Ulva.
Typical blade "Ulva" morphology: (a) in situ, scale bar = 1.5cm. (b) prior to preservation as voucher, scale bar = 3cm. Typical tube "Enteromorpha" morphology: (c) in situ, scale bar = 6cm. (d) prior to preservation as voucher, scale bar = 4cm. 27
Chapter 2 Assigning morphological variants of Fucus (Fucales,
Phaeophyceae) in Canadian waters to recognized species using DNA
barcoding
Citation for published manuscript: Kucera, H. and G.W. Saunders. 2008 Assigning
morphological variants of Fucus (Fucales, Phaeophyceae) in Canadian waters to
recognized species using DNA barcoding. Botany 86:1065-1079.
Used with permission of the publisher. 28
Abstract
The intertidal brown algal genus Fucus (Phaeophyceae) consists of individuals with a generally dichotomously branched habit. Morphological variability within species, combined with morphological similarity between species, renders field identification difficult. In light of recent taxonomic revisions, which reduced ten taxa traditionally recognized in Canada to four species, we tested the utility of the DNA barcode
(mitochondrial cytochrome oxidase 1, 5') for assigning individuals to these species. We sequenced the DNA barcode for 125 specimens representing all morphologies recognized. We confirmed our results by sequencing the internal transcribed spacer
region for 66 specimens. This is the first study to establish that the DNA barcode successfully assigns different morphologies of brown algae to known species as well as other single-gene molecular markers currently used. Furthermore, the results uncovered substantial phenotypic plasticity in Pacific Fucus distichus, from moss-like fragments embedded in estuarine mud, strap-like morphs on exposed rocky coasts, to 'spiralis'-like
morphs in the upper intertidal whereas phenotypic expression for this species was more
restricted in the Atlantic.
Key Words: Fucus, DNA barcoding, internal transcribed spacer, species identification,
brown algae, cytochrome c oxidase subunit I 29
Introduction
The brown algal genus Fucus is a prominent component of the intertidal seaweed flora along the rocky shorelines of the cold temperate waters of the northern hemisphere.
Fucus species inhabit a variety of exposure habitats from exposed rocky shores to quiet bays and estuarine areas. Thalli are flattened, more or less dichotomously branched, and terminate in tips that swell to become reproductive receptacles when fertile (Graham &
Wilcox, 2000).
Traditionally, ten taxa of Fucus were recognized in Canada. Reported from the
Atlantic were: F. serratus Linneaus, Fucus vesiculosus Linneaus; Fucus vesiculosus var. spiralis (Linneaus) C. Agardh; Fucus cottonii-like morphologies (as F. vesiculosus var. muscoides Cotton); F. distichus ssp. anceps (Harvey & Ward ex Carruthers) H.T.
Powell; F. distichus ssp. distichus H.T. Powell; F. distichus ssp. edentatus H.T. Powell; and F. distichus ssp. evanescens C. Agardh. Reported from the Pacific: F. gardneri
P.C. Silva; and F. cottonii-like morphologies of uncertain taxonomic designation.
Fucus spiralis Linneaus is reported from both Atlantic and Pacific coasts (Gabrielson et al. 2000, Sears 2002). However, many Fucus individuals in Canadian waters are difficult to assign to distinct taxa in the field. Individuals of the species Fucus serratus, with serrated margins, and F. vesiculosus, with paired vesicles on the thallus and a dioecious mating system, are relatively easily recognized; however, there are a number of difficulties in resolving the other Fucus 'species' and 'subspecies' morphologically.
Distinguishing features traditionally used include: habitat; shape of the thallus; receptacle shape; and reproductive characteristics such as monoecy versus dioecy (Sears 30
2002). Individuals commonly display morphologies that are intermediate in one or more of the distinguishing characters. Members of the various subspecies of Fucus distichus are particularly difficult to identify. While F. distichus ssp. distichus is distinctive in that it occupies upper tide pools and has a small, tough, terete thallus shape, Fucus distichus ssp. edentatus and F. distichus ssp. evanescens are difficult to tell apart; the former with thin blades, uniform in width (l-2cm), with thin, long receptacles and the latter with broad blades (2-4cm) and broad receptacles (Sears 2002). However, in the field we do not observe a distinct division between individuals with narrow and wide blades and specimens of intermediate width are frequently encountered.
Using a mitochondrial marker, Coyer et al. (2006a) suggested that all of the subspecies of F. distichus, as well as F. gardneri, should be collapsed into a single species, Fucus distichus. Coyer et al. (2006a) also recognized F. spiralis in the Pacific, and F. spiralis, F. vesiculosus and F. serratus in the Atlantic, as the only other species in Canada. Coyer et al. (2006a) continued to recognize F. spiralis and F. vesiculosus as separate species despite the fact that their data could not distinguish them. In the molecular studies completed to date, this closely related species pair is distinguishable only by microsatellite analyses, which also often failed to provide a 'correct' identification (Engel et al. 2003, Wallace et al. 2004, Billard et al. 2005a). Even with this radical reduction to only four taxa, problems still persist in the assignment of samples to species. For example, in the northeast Pacific, F. spiralis and F. distichus are distinguished partially based on distribution - the former reportedly positioned highest in the intertidal, whereas the latter is found lower. In between these upper and lower limits where individuals in the field appear morphologically distinct, there is a zone of Fucus 31 variously exhibiting morphologies of both species. This intermediate zone may be the result of phenotypic plasticity of one or both species, hybridization between the two species, or some combination of these events. The taxonomic identity of the F. cottonii- like morphologies is unclear, particularly in the northeast Pacific where their identity/source relative to the two known species in the flora is uncertain. In the
Atlantic, the F. cottonii-like morphologies have been described as F. vesiculosus var. muscoides Cotton (Mathieson & Dawes 2001, Wallace et al. 2004) and are found as tiny, dichotomously branched thalli embedded in the mud in estuarine areas. These
Atlantic morphologies have been attributed to hybrids of F. vesiculosus and F. spiralis
(Wallace et al. 2004).
An emerging molecular tool for species identification, the DNA barcode (5'-
COI), has been successfully used to distinguish among species, and identify new species
(Hebert et al. 2003a, Hebert et al. 2003b). DNA barcoding has the advantage of being an objective species identification tool in cases where identification is ambiguous and has been used in the red algae to delimit species that are morphologically similar (Saunders
2005, Robba et al. 2006). In the only study to date to assess DNA barcoding as a species identification tool in brown algae, Lane et al. (2007) were able to resolve distinct mitotypes, but these were not associated with recognized species owing to rampant introgression, hence the usefulness of DNA barcoding remained equivocal. Given that we now have a broad understanding of the diversity among Fucus species (Coyer et al.
2006a), we can test the utility of the DNA barcode for discriminating among and assigning individuals to the four accepted species in Canada, particularly those that are 32 difficult to identify in the field, providing an indication of the ability of this marker to discriminate more generally among species of brown algae.
In cases where species are known to undergo hybridization, or if introgression is suspected, it is beneficial to confirm mitochondrial DNA results (such as DNA barcoding) with a nuclear marker (Funk & Omland 2003). As hybridization has been extensively documented among Fucus species (Coyer et al. 2002b, Wallace et al. 2004,
Bergstrom et al. 2005, Billard et al. 2005a, Engel et al. 2005), and mitochondria are
inherited maternally in Fucus (Coyer et al. 2002b), we confirmed our DNA barcode
results with the internal transcribed spacer of the ribosomal cistron (ITS). The ITS has
been used extensively to assess algal species limits (Coyer et al. 2001, Ross et al. 2003),
identify cases of hybridization in algae (Liptack & Druehl 2000, Kooistra et al. 2001,
Druehl et al. 2005), and, in Fucus, to investigate species relationships (Leclerc et al.
1998, Serrao et al. 1999a). The last-mentioned were largely unsuccessful, in part due to
recent divergence of Fucus species, but possibly aggravated by the sequencing approach
used in the studies (see discussion). Here we use the ITS marker to confirm genetic
species groupings identified with the DNA barcode and to look directly for evidence of
hybridization between F. spiralis and F. distichus in the Pacific.
Materials and methods
Collections
We collected multiple individuals for each of the species and subspecies listed in
the taxonomic identification keys (Gabrielson et al. 2000, Sears 2002), as well as
specimens with morphologies that did not match the various descriptions. Individuals 33 were collected by harvesting the entire specimen, pressing it on herbarium paper as a voucher, and preserving a piece in silica gel for DNA work. Field identifications, collection information and sequence accessions of each individual are listed in
Appendix 1.
Sequence acquisition and analysis
The dried material was ground in liquid nitrogen and an organelle extraction followed by a phenol/chloroform DNA extraction was conducted as outlined in Lane et al. (2006). Gene regions were amplified by polymerase chain reaction (PCR) with the primers GazF2 (5'CC AACC A Y A AAG ATATW GGT AC3') and GazR2
(5 'GGATGACCAAARAACCAAAA3') for the DNA barcode (Lane et al. 2007). The fragment length was 654bp excluding the primer regions. The forward and reverse primers used in PCR of the ITS were PI and G4, respectively (Tai et al. 2001). The PCR profiles were as follows: for DNA barcode - an initial denaturation at 94°C for 4 min, 38 cycles of 94°C denaturation for 1 min, 50°C for annealing for 30 sec, 72°C elongation for 1 min and a final extension at 72°C for 7 min; and for ITS - an initial denaturation at
94°C for 3 min, 38 cycles of 94°C denaturation for 30 sec, 45°C for annealing for 45 sec, 72°C elongation for 2 min and a final extension at 72°C for 10 min. PCR products were then cooled to 4°C and maintained at that temperature. Amplified DNA fragments were purified by gel electrophoresis (Saunders 1993). Following purification, fragments were sequenced using the same primers as for PCR and for the ITS we additionally used
K1R1 (reverse to PI) and KP5 (forward to G4) (Lane et al. 2006). Sequencing was done using PE Applied Biosystems Big Dye (Foster City, CA, USA) cycle sequencing 34 kit and an ABI 3100 genetic analyzer. Sequences were edited using the computer software package Sequencher v.4.2 (Gene Codes Corporation, Ann Arbor, MI, USA). A
multiple sequence alignment was constructed by eye using MacClade v4.08 (Maddison
& Maddison 2005), and clustering was performed with the neighhbour-joining
algorithm in PAUP* v4.0bl0 (Swofford 2002) on uncorrected dissimilarities (p).
Anatomical observations
Following sequence analysis, we examined reproductive structures of nine collections of
F. spiralis (5 Pacific, 4 Atlantic) and nine collections of F. distichus (6 Pacific, 3
Atlantic), to identify useful characteristics for distinguishing these two species in the
Pacific. We chose to focus on antheridia because a cursory overview of other structures
failed to reveal differences between the species. We examined approximately four or
five antheridia from one conceptacle in each of the 9 collections for a total of 48 F.
spiralis antheridia and 44 F. distichus antheridia. We measured antheridial length and
width using an optical micrometer on a Leica DM 5000 B (Wetzlar, Germany)
compound microscope. We averaged the measurements of the antheridia for each
collection and reported the values +/- the standard deviation. We compared the mean
antheridial lengths and widths for the two species using an unpaired, two-tailed
Student's T-test.
Results
A total of 125 specimens were sequenced for the DNA barcode, which resolved
as three genetic species groups (for an explanation of species-level divergence see
Discussion): F. serratus, a F. vesiculosus/F. spiralis complex, and Fucus distichus (Fig. 35
2.1). The amount of within species variation (0-2 differences; 0-0.3%) was typical of what is seen among many other organisms, including red algae; however, the level of between-species variation (5-23 differences; 0.7-3%; Fig. 1) was lower than that typically observed between red algal species (usually >30 differences (5%); Saunders
2005). There were 66 sequences obtained for the ITS marker, which also resolved three genetic species groups, identical in composition to the groupings of DNA barcode marker (Fig. 2.2). The ITS data showed levels of within-species group variation slightly higher than the DNA barcode (Fig. 2.2). The original field identifications and the subsequent molecular identifications by DNA barcode for each collection are summarized in Appendix 1.
F. serratus species group
With both the DNA barcode and ITS markers, F. serratus was resolved as a monophyletic genetic species that consisted only of specimens that were correctly field- identified (Fig. 2.3a). There were 5-21 (0.7-3%) nucleotide differences between individuals of F. serratus and the two other species groups resolved with the DNA barcode, and 8-22 (0.7-2%) differences in the ITS.
F. vesiculosus and F. spiralis species group
In the DNA barcode analysis, Fucus vesiculosus and Fucus spiralis formed a single monophyletic group containing 39 collections, with an overall variation of 0-2 (0-
0.3%) differences (Fig. 2.1). The morphological and geographic variability of the F. vesiculosus!spiralis genetic species group included all 11 collections of typical F. vesiculosus (Fig. 2.3b) (Atlantic), all six collections of F. vesiculosus var. spiralis (Fig. 36
2.3c) (Atlantic), 11 Atlantic F. spiralis specimens (Fig. 2.3d), six specimens of F. spiralis from the Pacific, and all five collections of F. cottonii-hke morphologies (Fig.
2.3e) from the Atlantic. The Fucus vesiculosus collections (all Atlantic) were all resolved within a single subcluster within this species group, however, F. spiralis were not.
In the ITS analysis, the monophyletic F. vesiculosus/spiralis genetic species group contained 19 specimens with 0-2 (0-0.3%) differences among them (Fig. 2.2).
There were several individuals for which the majority of the ITSl (840bp) sequence could not be obtained (Appendix 1). These individuals exhibited within-individual heterogeneity at two positions in the sequence. Within-individual heterogeneity can result from recent hybridization and/or incomplete lineage sorting (Coen et al. 1982,
Doyle 1997, Okuyama et al. 2005). In this case, within-individual sequence heterogeneity was exhibited as varying length repeats at regions of multiple thymine residues, such that the sequence following the repeats is in two or more reading frames and difficult to read accurately. Unfortunately, these areas were found both near the 5' and 3' ends of the ITSl region and, therefore, affected both the forward and reverse sequences (PI primer and KlRl primer) used to acquire the ITSl data. The shorter (345 bp) ITS2 region showed no differences between F. vesiculosus and F. spiralis.
F. distichus species group
The DNA barcode assigned 78 individuals to the F. distichus genetic species group with genetic variation of 0-2 (0-0.3%) nucleotide differences (Fig. 2.1). The group included all F. distichus subspecies from the Atlantic, all collections of F. gardneri from 37 the Pacific and several specimens that were field-identified as F. spiralis (all but one of these were Pacific collections). Pacific collections of the F. distichus species group exhibited a wide range of morphologies: the typical F. gardneri morphology (long pointed receptacles; flat, strap-like thalli; caecostomata present; Fig. 2.3f); specimens of
a rigid, strictly dichotomously branched morphology (Fig. 2.3g,h; Fucus gardneri rigid
morph); mud-embedded F. cottomi-liks morphologies (Fig. 2.3i,j); several specimens
field-identified as F. spiralis found in the upper intertidal and intermixed with true F.
spiralis', all morphological intermediates between F. gardneri and F. spiralis; and
several morphs recorded as "F. spiralis undulate morph" found high in estuarine areas
attached to small stones or wood and having undulated fronds (Fig. 2.3k,l). The ITS
results (Fig. 2.2) also resolve F. distichus and F. gardneri as a single genetic species
group, with 0-5 (0-0.7%) nucleotide differences among members. Subclusters within the
F. distichus group did not correspond to any single morphology or geographic pattern,
and though one DNA barcode sub-cluster consisted of all Pacific samples, Pacific
collections were also found within the other sub-clusters in the group (Fig. 2.1).
Atlantic collections exhibited more limited morphological variation and consisted of: F.
distichus ssp. distichus (Fig. 2.3m), F. distichus ssp. evanescens (Fig. 2.3n), F. distichus ssp. edentatus (Fig. 2.3o), F. distichus ssp. anceps (Fig. 2.3p), and one specimen field-
identified as F. spiralis.
To evaluate further the possibility of hybridization between the Pacific
populations of F. spiralis and F. distichus as a putative explanation for individuals of intermediate morphology, we sequenced one strand of a short region of the ITS1 (final aligned length - 398 nucleotides; amplified with primers PI and G4, and sequenced 38 with K1R1; see Appendix 2), which contained nine fixed differences between F. spiralis and F. distichus for 62 additional specimens representing both morphologies (field identified F. spiralis n=24, F. distichus n=9) and morphological intermediates (n=29).
We visually examined the chromatograms with the expectation that if hybridization was occurring, we would observe double peaks at the variable sites, due to the bi-parental inheritance of the ITS marker (see also Lane et al. 2007). In all cases, the variable sites contained no ambiguities and clearly assigned each specimen to either F. distichus or F. spiralis, thus no evidence of hybridization was uncovered.
Anatomical observations
We found a statistically significant difference (p=0.0006) between the mean lengths of antheridia of F. spiralis (n=9) and F. distichus (n=9). There was no significant difference between the widths of antheridia (14±2.0 ^m, p-0.63). The mean antheridial length for F. spiralis was 39±3.8 (irn with less than five of the measured antheridia reaching lengths of 50-52 (im. The mean antheridial length for F, distichus was 48±5.1 fim with only a few (<5) with lengths of 32-38 |im.
Discussion
The only published study to assess the DNA barcode for species identification among brown algae failed to resolve the utility of this marker owing to introgression
(Lane et al. 2007). In the current study we establish that the DNA barcode can resolve brown algal species as well as all other single-locus markers currently used for this purpose (e.g., Coyer et al. 2006a) including the ITS marker, as confirmed here. We noted that COI divergence values within genetic species groups ranged from 0-0.3%, 39 which are typical values among animal lineages (Hebert et al. 2003a) and red algae
(Saunders 2005, 2008). Although interspecific divergence values (typically 3%) were slightly lower than those presented by Saunders (2005, 2008; lower limit ca. 3.5%), our values were generally an order of magnitude greater than intraspecific divergences (3% vs. 0.3%), which is consistent with the lower threshold generally used for the characterization of species in other barcoding studies (Hebert et al. 2004, Barrett &
Hebert 2005, Cywinska et al. 2006, Borisenko et al. 2007, Clare et al. 2007). Saunders
(2005, 2008) noted a few exceptional cases for which divergence between closely related species (based on additional molecular, morphological, anatomical and ecological data) was as low as 0.8-1.2%, which is equivalent to our results for Fucus serratus relative to Fucus distichus (0.7%). As with the red algal genera studied by
Saunders (2005, 2008), ample evidence supports species level distinction of these two taxa (data here; Leclerc et al. 1998, Serrao et al. 1999b, Coyer et al. 2002a, Coyer et al.
2006a). Such exceptional cases of low interspecific divergence values are also reported in other DNA barcoding studies (e.g., Burns et al. 2007) and serve to illustrate the effectiveness of DNA barcoding for distinguishing among even closely related species.
The relatively low between species group variation in both the DNA barcode and the
ITS among the four species currently recognized in Canada is consistent with previously published work suggesting that the genus Fucus has undergone a recent radiation
(Leclerc et al. 1998, Serrao et al. 1999a, Coyer et al. 2006a). Our study is the first to demonstrate that the DNA barcode is an effective tool to distinguish among species of brown algae. 40
It is necessary to reiterate that DNA barcoding is a tool for assigning biological specimens to species (Hebert et al. 2003a, Hebert et al. 2003b, Schander & Willassen
2005, Borisenko et al. 2007, Clare et al. 2007). Thus, simple clustering algorithms as implemented here are sufficient to provide a visual representation of these assignments
(e, Fig. 2.1). It is critical to emphasize, however, that these phenograms should not be
interpreted in a phylogenetic context owing to the simple models of sequence evolution
that were applied. Nonetheless, the short region of COI used for DNA barcoding does
have phylogenetic signal at the appropriate taxonomic level and thus can be embedded
in more robust phylogenetic analysis with additional data to resolve evolutionary
relationships among species (e.g., Lissovsky et al. 2007, Saunders 2008).
Despite a low level of variation, DNA barcoding distinguishes recognized
species of Fucus in Canada in all but one case (and in this case, other sequence-based
molecular markers also fail). We were able to use the DNA barcode to assign species
designations to all specimens that could not be identified using traditional
morphological characteristics or that had been identified incorrectly except for F.
spiralis versus F. vesiculosus.
Congruent with the findings of Coyer et al. (2006a), Fucus serratus forms a
distinct monophyletic grouping closely related to the F. distichus species group. Our
results, along with a wealth of published work, show that F. serratus is genetically
distinct from other species of Fucus in Canada. This species has been introduced to
Canada from Europe and has a relatively limited range in Atlantic Canada (Edelstein et
al. 1973). 41
Previously published work has indicated that F. spiralis and F. vesiculosus are a recently diverged species pair (Serrao et al. 1999a, Engel et al. 2003, Wallace et al.
2004, Billard et al. 2005a, Billard et al. 2005b, Engel et al. 2005, Coyer et al. 2006a).
Consistent with this, we were unable to distinguish these two species using either the
DNA barcode or the ITS marker. Genetic isolation between F. spiralis and F.
vesiculosus has only been established at the microsatellite level by Billard et al. (2005a).
Because both Billard et al. (2005a) and Coyer et al. (2006a) suggest maintaining these as
separate species, we follow their recommendation, while recognizing that the DNA
barcode cannot distinguish between these species. The DNA barcode marker was also
not variable enough to detect if there is a genetic basis for the F. vesiculosus var. spiralis
morphology. The Atlantic collections of F. cottonii-like morphs fell within the F.
vesiculosus/spiralis group, in agreement with the work of Wallace et al. (2004) and
Coyer et al. (2006b) in which these morphologies were reported to be hybrids between
F. spiralis and F. vesiculosus or polyploids of F. vesiculosus. Owing to morphological
and transplant observations and overlap in genetic signal at several mitochondrial loci
with both F. spiralis and F. vesiculosus, it has been hypothesized that F. cottonii-like
morphs may also be derived from pure F. spiralis and F. vesiculosus parental forms
having undergone habitat selection for embedded growth habit (Mathieson et al. 2006);
however, Mathieson et al. (2006) also state that their results would support a hybrid
origin for F. cottonii-likc forms. Wallace et al. (2004) hypothesize that the hybrid F.
cottonii-like morphologies in the Atlantic may be a vector for gene flow between F.
vesiculosus and F. spiralis; however, whether hybrids exist as attached individuals has
not yet been directly tested and unattached F. cottonii-like populations have not been 42 observed to reproduce sexually. Here, we observed the presence of within-individual heterogeneities of ITS sequence in representatives of all of the different morphologies within the F. vesiculosus and F. spiralis cluster, which is a possible signature of hybridization and introgression, but could simply represent within lineage heterogeneity, as is commonly encountered in the ITS. Previous studies employing the ITS marker for
Fucus (Leclerc et al. 1998, Serrao et al. 1999a) have similarly not been able to resolve relationships between F. vesiculosus and F. spiralis. While the DNA barcode will consistently assign both F. vesiculosus and F. spiralis collections within Atlantic
Canada to the F. vesiculosus/F. spiralis group, we would recommend using microsatellites (Billard et al. 2005a) in combination with morphological and anatomical features (F. vesiculosus having paired vesicles and separate sexes and F. spiralis lacking vesicles and having combined sexes) to distinguish between the species, although this also, at times, results in misidentifications (Billard et al. 2005b).
Using the ITS marker, Serrao et al. (1999a) reported within-species variability of
0-5.6%, overall in Fucus, whereas our data show lower levels (0-0.3%). One possible explanation for this discrepancy may be differences in the method used for sequencing between our study and both Serrao et al. (1999a) and Leclerc et al. (1998). In the previous studies, ITS sequence was obtained by cloning PCR product and sequencing from a single clone, whereas our study employed direct sequencing of PCR product.
During PCR, errors in nucleotide sequence may be introduced in many of the thousands of strands generated during amplification due to imperfect fidelity of the polymerase enzyme. By selecting an individual PCR product by cloning, these errors are amplified, 43 whereas in direct sequencing individual errors in the various strands are overwhelmed by copies of correct sequence (Strachan & Read 1999).
Our results are in concordance with the work of Coyer et al. (2006a) in showing
that all of the subspecies of Fucus distichus, as well as Fucus gardneri, should be
subsumed into this species, as we found little to no nucleotide divergence among them
in both the DNA barcode and ITS (see results, Figs. 2.1 and 2.2). Of particular interest
are our DNA barcoding results from the northeast Pacific. Several individuals that were
identified in the field as F. spiralis (Fig. 2.1), were identified by both the DNA barcode
and ITS data as belonging to the F. distichus genetic species group. These specimens
often had classic F. spiralis-like morphologies (absence of caecostomata, presence of
cryptostomata and sterile wings around the receptacles). The misidentified specimens
also included individuals with undulate thalli, which, though not a traditional taxonomic
character, is often associated with F. spiralis. Several of these latter collections were
made high in the intertidal in a quiet, estuarine bay, attached to wood or small stones (F.
spiralis undulate morphs; Fig. 2.3k,l). Other misidentified specimens were found in the
upper intertidal, attached to rocks and intermixed with true F. spiralis (Appendix 1). To
the contrary, in no case was a Pacific F. distichus misidentified as F. spiralis. Our
finding that the antheridia of F. distichus are significantly longer than those of F.
spiralis may be of use in distinguishing these species in the Pacific. In our observations,
there was some overlap in size, but measuring a number of antheridia from one plant
and taking the average is a good estimator of species identity when molecular
techniques are not available. Our preliminary observations suggest that there may be 44 other anatomical features that differentiate these two species and this is worthy of future investigation.
In the Pacific, where only two species of Fucus coexist and true F. spiralis appears to be rare in occurrence (our results; Luning 1990), F. distichus tends to take
morphologies and inhabit niches that in the Atlantic are characteristic of F. spiralis, F.
vesiculosus and their hybrids (as F. cottonii-like morphs). Recently, it has been
suggested that there is some aspect of the F. vesiculosus genome required for inhabiting salt marshes (Coyer et al. 2006b); however, our results indicate that this is not the case,
since Pacific F. distichus is also capable of mud-embedded estuarine existence.
Fucus spiralis is considered a recent introduction to the Pacific (Luning 1990,
Coyer et al. 2006a); perhaps, in the absence of competition (niche exclusion), F.
distichus has filled the niches that are occupied by members of the F.
vesiculosus/spiralis species group in the Atlantic. Displacement of phenotypically
plastic characters has been shown to occur in response to competition, and
phenotypically similar individuals in the same habitat experience the greatest level of
competition (Pfennig 1992). In the absence of competition, it is conceivable that species
capable of phenotypic plasticity will display all or most of the range of their phenotypes, should appropriate habitat be available. In the presence of competition, species may displace into habitats for which they are either specialized—in the case of non-plastic species, or into available habitat—in the case of plastic species. We hypothesize that competition between F. distichus and F. spiralis in the upper intertidal and estuarine areas in the Atlantic has been in place for long enough to restrict F. distichus to tide pool habitats in the upper intertidal (as F. distichus ssp. distichus morphs), and to mid and 45 lower intertidal areas. In the Pacific, where F. spiralis may be a recent introduction (or re-introduction), competitive interactions are still being established, and F. distichus fills
many of the niches from which it is excluded in the Atlantic. It is also possible that
environmental factors, perhaps subtle, are sufficiently different between the intertidal
zones of the Canadian Atlantic and Pacific coasts that F. distichus can out compete F.
spiralis over a wider variety of habitats in the Pacific.
In summary, our results show that on both western and eastern coasts F.
distichus exhibits a high level of phenotypic plasticity and can inhabit a range of
habitats. These include: upper most tide pools as small, strictly dichotomously branched
F. distichus ssp. distichus (Atlantic) morphs; mid intertidal wave exposed areas as strap
like F. gardneri (Pacific), F. distichus ssp. anceps and F. distichus ssp. edentatus
(Atlantic) morphs; as well as sheltered bays as wide F. distichus ssp. evanescens
(Atlantic) and F. spiralis (Pacific) undulate morphologies; and, mud-embedded upper
intertidal estuarine areas as the tiny F. cottonii-like morphs (Pacific); and finally Pacific
upper intertidal areas as morphologies indistinguishable from F. spiralis. On the other
hand, F. spiralis in the Pacific is relatively rare (though widely distributed) and
restricted to the upper intertidal, growing attached to the rocky substrate, and displays a
restricted level of phenotypic plasticity relative to Atlantic populations which, in
association with F. vesiculosus, occupy a wider niche and morphological range.
We establish the ability of the DNA barcode marker to assign individuals that
are difficult or impossible to identify in the field to one of three genetic species groups:
F. serratus, F. vesiculosus/spiralis and F. distichus. With this level of discrimination, 46 we were able to assign individuals from a number of morphologically unusual populations to distinct species and explore the distribution and level of phenotypic plasticity characteristic of each species. This finding is significant because as DNA
barcode technology and the associated database grow and progress, our data will allow for the standardized COI marker to be applied to Fucus in future ecological and biogeographical studies.
Acknowledgements
We thank colleagues listed in Appendix 1 for their assistance with collections, as well as
Louis Druehl for drawing our attention to the rigid Fucus morph from Nanaimo, B.C.
This research was supported through funding to the Canadian Barcode of Life Network from Genome Canada (through the Ontario Genomics Institute), and other sponsors
listed at www.BOLNET.ca. Funding also provided by the Canada Research Chair
Program, and the Natural Science and Engineering Research Council of Canada. A collecting trip to Nanaimo, B.C. was funded by a donation from H. Kucerova and J.
Kucera.
References
Barrett, R. D. H. & Hebert, P. D. N. 2005. Identifying spiders through DNA barcodes.
Can. J. Zool./Rev. Can. Zool. 83:481-91.
Bergstrom, L., Tatarenkov, A., Johannesson, K., Jonsson, R. B. & Kautsky, L. 2005.
Genetic and morphological identification of Fucus radicans sp nov (Fucales,
Phaeophyceae) in the brackish Baltic Sea. J. Phycol. 41:1025-38. Billard, E., Daguin, C., Pearson, G., Serrao, E., Engel, C. & Valero, M. 2005a. Genetic
isolation between three closely related taxa: Fucus vesiculosus, F. spiralis, and
F. ceranoides (Phaophyceae). J. Phycol. 41:900-05.
Billard, E., Serrao, E. A., Pearson, G. A., Engel, C. R., Destombe, C. & Valero, M.
2005b. Analysis of sexual phenotype and prezygotic fertility in natural
populations of Fucus spiralis, F. vesiculosus (Fucaceae, Phaeophyceae) and their
putative hybrids. Eur. J. Phycol. 40:397-407.
Borisenko, A. V., Lim, B. K., Ivanova, N. V., Hanner, R. H. & Hebert, P. D. N. 2007.
DNA barcoding in surveys of small mammal communities: a field study in
Suriname. Molecular Ecology Notes (OnlineEarly Articles):doi: 10.111 l/j.471-
8286.2007.01998.x
Burns, J. M., Janzen, D. H., Hajibabaei, M., Hallwachs, W. & Hebert, P. D. N. 2007.
DNA barcodes of closely related (but morphologically and ecologically distinct)
species of skipper butterflies (Hesperiidae) can differ by only one to three
nucleotides. J. Lepid. Soc. 61:138-53.
Clare, E. L., Lim, B. K., Engstrom, M. D., Eger, J. L. & Hebert, P. D. N. 2007. DNA
barcoding of Neotropical bats: species identification and discovery within
Guyana. Mo I. Ecol. Notes 7:184-90.
Coen, E., Strachan, T. & Dover, G. 1982. Dynamics of concerted evolution of ribosomal
DNA and histone gene families in the melanogaster species subgroup of
Drosophila. J. Mol. Biol. 158:17-35. 48
Coyer, J. A., Hoarau, G., Oudot-Le Secq, M. P., Stam, W. T. & Olsen, J. L. 2006a. A
mtDNA-based phylogeny of the brown algal genus Fucus (Heterokontophyta;
Phaeophyta). Mol. Phylogenet. Evol. 39:209-22.
Coyer, J. A., Hoarau, G., Pearson, G. A., Serrao, E. A., Stam, W. T. & Olsen, J. L.
2006b. Convergent adaptation to a marginal habitat by homoploid hybrids and
polyploid ecads in the seaweed genus Fucus. Biology Letters 2:405-08.
Coyer, J. A., Peters, A. F., Hoarau, G., Stam, W. T. & Olsen, J. L. 2002a. Hybridization
of the marine seaweeds, Fucus serratus and Fucus evanescens
(Heterokontophyta : Phaeophyceae) in a 100-year-old zone of secondary contact.
Proc. R. Soc. Lond.B Biol. 269:1829-34.
Coyer, J. A., Peters, A. F., Hoarau, G., Stam, W. T. & Olsen, J. L. 2002b. Inheritance
patterns of ITS 1, chloroplasts and mitochondria in artificial hybrids of the
seaweeds Fucus serratus and F. evanescens (Phaeophyceae). Eur. J. Phycol.
37:173-78.
Coyer, J. A., Smith, G. J. & Andersen, R. A. 2001. Evolution of Macrocystis spp.
(Phaeophyceae) as determined by ITS1 and ITS2 sequences. J. Phycol. 37:574-
85.
Cywinska, A., Hunter, F. F. & Hebert, P. D. N. 2006. Identifying Canadian mosquito
species through DNA barcodes. Med. Vet. Entomol. 20:413-24. 49
Doyle, J. J. 1997. Trees within trees: genes and species, molecules and morphology.
Syst. Biol. 46:537-53.
Druehl, L. D., Collins, J. D., Lane, C. E. & Saunders, G. W. 2005. An evaluation of
methods used to assess intergeneric hybridization in kelp using Pacific
Laminariales (Phaeophyceae). J. Phycol. 41:250-62.
Edelstein, T., M., G., C.J., B. & McLachlan, J. 1973. Investigations of the marine algae
of Nova Scotia. X. Distribution of Fucus serratus L. and some other species of
Fucus in the Maritime Provinces. Proc. N. S. Inst. Sci. 27:33-42.
Engel, C. R., Brawley, S. H., Edwards, K. J. & Serrao, E. 2003. Isolation and cross-
species amplification of microsatellite loci from the fucoid seaweeds Fucus
vesiculosus, F. serratus and Ascophyllum nodosum (Heterokontophyta,
Fucaceae). Mol. Ecol. Notes 3:180-82.
Engel, C. R., Daguin, C. & Serrao, E. A. 2005. Genetic entities and mating system in
hermaphroditic Fucus spiralis and its close dioecious relative F. vesiculosus
(Fucaceae, Phaeophyceae). Mol. Ecol. 14:2033-46.
Funk, D. J. & Omland, K. E. 2003. Species-level paraphyly and polyphyly: Frequency,
causes, and consequences, with insights from animal mitochondrial DNA. Annu.
Rev. Ecol. Evol. Syst. 34:397-423.
Gabrielson, P. W., Widdowson, T. B., Lindstrom, S., Hawkes, M. W. & Scagel, R. F.
2000. Keys to the benthic marine algae and seagrasses of British Columbia, 50
Southeast Alaska, Washington and Oregon. University of British Columbia,
Vancouver, 189 pp.
Graham, L. E. & Wilcox, L. W. 2000. Algae. Prentice-Hall, Inc., Upper Saddle River,
NJ, 640 pp.
Hebert, P. D. N., Cywinska, A., Ball, S. L. & DeWaard, J. R. 2003a. Biological
identifications through DNA barcodes. Proc. R. Soc. Lond. B Biol. 270:313-21.
Hebert, P. D. N., Ratnasingham, S. & deWaard, J. R. 2003b. Barcoding animal life:
cytochrome c oxidase subunit 1 divergences among closely related species. Proc.
R. Soc. Lond. B Biol. 270:S96-S99.
Hebert, P. D. N., Stoeckle, M. Y., Zemlak, T. S. & Francis, C. M. 2004. Identification of
birds through DNA barcodes. PLoS Biol. 2:1657-63.
Kooistra, W., de Boer, M. K., Vrieling, E. G., Connell, L. B. & Gieskes, W. W. C. 2001.
Variation along ITS markers across strains of Fibrocapsa japonica
(Raphidophyceae) suggests hybridisation events and recent range expansion. J.
Sea Res. 46:213-22.
Lane, C. E., Lindstrom, S. C. & Saunders, G. W. 2007. A molecular assessment of
northeast Pacific Alaria species (Laminariales, Phaeophyceae) with reference to
the utility of DNA barcoding. Mol. Phylogenet. Evol. 44:634-48. Lane, C. E., Mayes, C., Druehl, L. D. & Saunders, G. W. 2006. A multi-gene molecular
investigation of the kelp (Laminariales, Phaeophyceae) supports substantial
taxonomic re-organization. J. Phycol. 42:493-512.
Leclerc, M. C., Barriel, V., Lecointre, G. & de Reviers, B. 1998. Low divergence in
rDNA ITS sequences among five species of Fucus (Phaeophyceae) suggests a
very recent radiation. J. Mol. Evol. 46:115-20.
Liptack, M. K. & Druehl, L. D. 2000. Molecular evidence for an interfamilial
laminarialean cross. Eur. J. Phycol. 35:135-42.
Lissovsky, A. A., Ivanova, N. V. & Borisenko, A. V. 2007. Molecular phylogenetics
and taxonomy of the subgenus Pika (Ochotona, Lagomorpha). J. Mammal.
88:1195-204.
Luning, K. 1990. Seaweeds: Their Environment, Biogeography, and Ecophysiology.
John Wiley, New York, 537 pp.
Maddison, W. D. & Maddison, D. R. 2005. MacClade v4.08. Sinauer Associates,
Sunderland, Massachusetts.
Mathieson, A. C. & Dawes, C. J. 2001. A muscoides-like Fucus from a Maine salt
marsh: its origin, ecology, and taxonomic implications. Rhodora 103:172-201.
Mathieson, A. C., Dawes, C. J., Wallace, A. L. & Klein, A. S. 2006. Distribution,
morphology, and genetic affinities of dwarf embedded Fucus populations from
the northwest Atlantic Ocean. Bot. Mar. 49:283-303. Okuyama, Y., Fujii, N., Wakabayashi, M. & Kawakita, A. 2005. Nonuniform concerted
evolution and chloroplast capture: heterogeneity of observed introgression
patterns in three molecular data partition phylogenies of Asian Mitell
(Saxifragaceae). Mol. Biol. Evol. 22:285-96.
Pfennig, D. W. 1992. Polyphenism in spadefoot toad tadpoles as a locally adjusted
evolutionarily stable strategy. Evolution 46:1408-20.
Robba, L., Russell, S. J., Barker, G. L. & Brodie, J. 2006. Assessing the use of the
mitochondrial coxl marker for use in DNA barcoding of red algae
(Rhodophyta). Am. J. Bot. 93:1101-08.
Ross, P. I., Donaldson, S. L. & Saunders, G. W. 2003. A molecular investigation of
Mazzaella (Gigartinales, Rhodophyta) morphologically intermediate between
Mazzaella linearis and M. splendens. Bot. Mar. 46:202-13.
Saunders, G. W. 1993. Gel purification of red algal genomic DNA - an inexpensive and
rapid method for the isolation of polymerase chain reaction-friendly DNA. J.
Phycol. 29:251-54.
Saunders, G. W. 2005. Applying DNA barcoding to red macroalgae: a preliminary
appraisal holds promise for future applications. Philos. Trans. R. Soc. Lond. B
Biol. Sci. 360:1879-88. 53
Saunders, G. W. 2008. A DNA barcode examination of the red algal family
Dumontiaceae in Canadian waters reveals substantial cryptic species diversity. 1.
The foliose Dilsea-Neodilsea complex and Weeksia. Botany 86:773-89.
Schander, C. & Willassen, E. 2005. What can biological barcoding do for marine
biology? Mar. Biol. Res. 1:79-83.
Sears, J. R. 2002. NEAS Keys to the Benthic Marine Algae of the Northeastern Coast of
North America from Long Island Sound to the Strait of Belle Isle. University of
Massachusetts, Dartmouth, 161 pp.
Serrao, E. A., Alice, L. A. & Brawley, S. H. 1999a. Evolution of the Fucaceae
(Phaeophyceae) inferred from nrDNA-ITS. J. Phycol. 35:382-94.
Serrao, E. A., Brawley, S. H., Hedman, J., Kautsky, L. & Samuelson, G. 1999b.
Reproductive success of Fucus vesiculosus (Phaeophyceae) in the Baltic Sea. J.
Phycol. 35:254-69.
Strachan, T. & Read, A. P. 1999. Human Molecular Genetics 2. John Wiley & Sons,
Inc., Rexdale, ONT., pp.
Swofford, D. L. 2002. PAUP* v4.0bl0. Sinauer Associates, Sunderland, Massachusetts.
Tai, V., Lindstrom, S. C. & Saunders, G. W. 2001. Phylogeny of the Dumontiaceae
(Gigartinales, Rhodophyta) and associated families based on SSU rDNA and
internal transcribed spacer sequence data. J. Phycol. 37:184-96. 54
Wallace, A. L., Klein, A. S. & Mathieson, A. C. 2004. Determining the affinities of salt
marsh fucoids using microsatellite markers: Evidence of hybridization and
introgression between two species of Fucus (Phaeophyta) in a Maine estuary. J.
Phycol. 40:1013-27. 55 56
Atlantic coilectioos
3SS33? Fucus Fucus Fucus distichus serratus spiralis/ vesiculosiis Fucus distichus 0-2 Fucus serratus 5-7 0-1 Fucus 19-23 19-21 0-2 spiralis/vesiculosus Fucus distichus species group Pacific collections
»ma»ii-ow8oo73
Atlantic, Pacific, and Arctic collections
F*M-< F.MCr-HKSZO Fucus serratus species FMTT-HK024Fjnrr-HK621 F*T-UX5157F.««r~+f 169 FvMto-HK0241 Atlantic F.v«alo-HKO04F.'ii —ir t fQ2S FnwH,iFv— Figure 2.1: Neighbor-joining analysis of DNA barcode data, and a matrix of actual nucleotide distances between sequences. 57 58 F. distdist—HK078 F.dis£aef»-HK240 F.distdist-HK508 F.distoden-HK1S1 F.distevar>-HK194 F.distevan-HK261 F.distevan-HK649 Atlantic F.disttfist—HK116 F.distdist-HK255 collections F.disteden-HK023 F.<#steden-HK635 Fucus Fucus Fucus spirsHs/ F. F.vesic-HK092 L F.vesicVsptr-HK033 • F.cotAt-HKW8 F.cotAt-HK062 F.vesicVspir-HK050 - 0.001 substitutions/site Figure 2.2: Neighbor-joining analysis of internal transcribed spacer data, and a matrix of actual distances between sequences for each genetic species group 59 MaWS Figure 2.3: Morphological variation in Fucus. 61 Chapter 3 A floristic survey of Canadian Porphyra and Bangia (Bangiales, Rhodophyta) species based on multiple molecular markers reveals cryptic diversity 62 Abstract Bangiaceae (.Porphyra and Bangia) consist of 28 recognized species in Canada. The aim of this study was to employ a standardized molecular marker, the COI-5P DNA barcode (5' region of the mitochondrial cytochrome c oxidase 1 gene), in a broad florisitic survey of this taxon in Canadian marine waters. A total of 32 species was ultimately sequenced, 27 of which occurred in Canada. Molecular results led to the synonymization of Porphyra cuneiformis with Porphyra amplissima, as well as to the description of two new species: Porphyra corallicola and Porphyra peggicovensis. In conducting this survey, an assessment of the performance of COI-5P as a species identification tool relative to the chloroplast rbcL (large subunit of ribulose-1,5- bisphosphate carboxylase oxygenase) and UPA (universal plastid amplicon) was completed. The COI-5P emerged as the marker with the highest levels of genetic variation for species discrimination, and is recommended as a standard for identification despite difficulties with primer universality. The rbcL was further used to place the new species into a phylogenetic context. Key Words: Bangia, COI-5P, DNA barcoding, phylogeny, Porphyra, rbcL, UPA Introduction Porphyra and Bangia are two genera within the monophyletic red algal family Bangiaceae; their species are found in waters inhabiting marine intertidal and shallow subtidal areas throughout the world (Guiry & Guiry 2009). Bangiacean taxa, when sexual, are characterized by a biphasic life history with an alternation of heteromorphic generations. Porphyra gametophytes are simple blades consisting of one or two cell 63 layers growing epilithically, epizoically or epiphytically while Bangia gametophytes consist of uni- or multiseriate filaments (Graham & Wilcox 2000). Sporophytes of both genera are known as the "conchocelis stage", their microscopic filaments growing within calcareous substrates such as mollusk shells, coralline algae, barnacles and limestone (Drew 1949, Drew & Richards 1953, Brodie & Irvine 2003). While superficially different in gametophyte morphology, generic concepts within the Bangiaceae remain uncertain and neither genus is monophyletic (Oliveira et al. 1995, Miiller et al. 1998, Broom et al. 1999, Broom et al. 2004). The taxonomy of Porphyra has been of interest for over 200 years, in part because of its economic importance. Many world cultures use Porphyra for food, including: Japan, as nori in sushi; Wales, as laver; and under many names by North American First Nations (Turner 2003). Porphyra is one of the world's most important seaweed food crops, with annual US markets alone in the 1-2 billion dollar range (Merrill 1993, FAO 2003). With the potential for expansion into areas which historically have not farmed Porphyra (the US and Europe), it is critical that we understand the diversity of Porphyra occurring in these areas. This knowledge could then facilitate selection of locally indigenous species for farming rather than introducing species from other parts of the world. The spread of introduced and escaped farm Porphyra species has already been documented in the northeastern USA (Mathieson et al. 2008, Neefiis et al. 2008), and it is desirable to prevent further introductions (e.g., Occhipinti-Ambrogi & Sheppard 2007). Identifying and documenting species of Porphyra has recently become the focus of an international effort (Brodie et al. 2008). Despite 116 recognized species (Guiry & Guiry 2009), systematic and floristic work continues to reveal new species 64 (e.g., Stiller & Waaland 1993, Nelson et al. 2001, Neefus et al. 2002, Brodie et al. 2007, Lindstrom 2008), synonymize species (e.g., Broom et al. 2002, Bray et al. 2007), and refine our understanding of the ranges of currently accepted species (e.g., Brodie et al. 2007, Brodie et al. 2008, Lindstrom 2008). One of the major challenges for Porphyra taxonomy is the difficulty in identifying species based solely on morphological and anatomical characteristics. Blades may vary in colour from brown and green to red, purple and pink, and occasionally even yellow. While colour is sometimes used to distinguish species (e.g., Sears 2002, Gabrielson et al. 2006), overlap or similarity in colour exists between species (e.g., Neefus et al. 2002), and colour mutants within species have been reported (Wang et al. 2008 and references therein). Blade shape varies from broadly ovate to lanceolate, to deeply folded and has also been considered to correlate with species. For example, in the case of Porphyra linearis Greville, linear shape is considered to be a key diagnostic feature. However, blade shape can also vary dramatically within species (e.g., Neefus et al. 2008). Blades consist of one or two cell layers and, in addition to the previously mentioned, diagnostic characters at the anatomical scale rely on the development of reproductive structures and their relative location on the blade. Hus (1902) established "division formulae" to describe the pattern of division of male gametangia (packets of colourless cells which are the products of mitosis; see Nelson et al. 1999) and zygotosporangia (packets consisting of mitotic divisions of the diploid zygote; Nelson et al. 1999). Although division formulae were once considered to be characteristic of species (e.g., Brodie & Irvine 2003), they are known to vary within a species under 65 different culture conditions (Suto 1972). Also, Neefus et al. (2008) reported different division formulae for male gametangial packets and zygotosporagial packets in P. yezoensis Ueda when they compared descriptions of Japanese populations to observations of introduced plants in New England. Another reproductive characteristic used to discriminate species is the relative location of reproductive cells on the blade. While monoecy versus dioecy is not always correlated with species, when species are monoecious the organization of reproductive packets can be a species-specific character with some species exhibiting blades sectored into female and male halves (e.g., P. purpurea (Roth) C. Agardh, P. birdiae Neefus & Mathieson, and P. aestivalis S.C. Lindstrom & S. Fredericq) (Bray et al. 2007), others with oblique lines between zygotosporangial and male gametangial packets (e.g., P. mumfordii S.C. Lindstrom & K.M. Cole), or with marginal sori with packets separated into female and male patches (e.g., P. abbottiae V. Krishnamurthy) (Gabrielson et al. 2006), or female and male regions intermixed on the margin (e.g., P. amplissima (Kjellman) Setchell & Hus ex Hus) (Sears 2002). While the above-mentioned characteristics can be helpful in identifying species, a definitive identification cannot always be made. For example, according to Bray et al. (2007), the species P. birdiae, P. katadae A. Miura and P. purpurea have considerable overlap in traditionally studied morphological/anatomical characteristics; however, there were a few characteristics that differed between the taxa such as blade thickness and geographical distribution. Currently, experts recognize up to 15 species of Porphyra in the North Atlantic, seven of which are thought to occur in Canadian waters (Sears 2002, Brodie et al. 2007, 66 Brodie et al. 2008). Of the 15 North Atlantic species, three are introduced, but have not yet been reported in Canada. On the west coast of North America, there are over 30 recognized species (Guiry & Guiry 2009) with 20 documented in British Columbia (Gabrielson et al. 2006, Lindstrom 2008). On both coasts, recent work has revealed cryptic species in need of further taxonomic study (Robba et al. 2006, Lindstrom 2008, Mortensen et al. 2009). Specimens of Bangia are typically more difficult to identify based on morphological characteristics (Miiller et al. 1998). Characters that have been evaluated and previously used to delimit Bangia species include: filament diameter and length, pigmentation, and degree of hollowness. Unfortunately, these attributes have been shown to vary under differing environmental conditions (Sheath & Cole 1984). Cell diameter and the number of cells across the region of maximum filament width, along with several of the previously mentioned characteristics, were evaluated by Miiller et al. (1998) and failed to correlate with genetic species groups. The work of Miiller et al. (2003) demonstrated that there can be occasional correlation between genetic species groups of Bangia and reproductive mode and chromosome count, in accordance with Cole et al.'s (1983) observations based on chromosome counts and sexuality, that there are up to four different "types" of Bangia in British Columbia. However, Miiller et al. (2003) compared their karyological observations with their molecular data and were not able to use chromosome counts to delimit species. While it is likely that there are more species than currently recognized, only a single name—Bangia fuscopurpurea (Dillwyn) Lyngbye—is presently being applied to all marine Bangia in North America (Miiller et al. 1998, Miiller et al. 2003). 67 Extensive molecular work has addressed systematic questions and facilitated identification of species within Porphyra and Bangia. Studies have employed a variety of molecular markers including: COI-5P (5' end of the mitochondrial cytochrome c oxidase 1 gene) DNA barcoding (Robba et al. 2006); the chloroplast rubisco large subunit rbcL (e.g., Neefus et al. 2002, Farr et al. 2003, Klein et al. 2003, Lindstrom & Fredericq 2003, Muller et al. 2003, Hanyuda et al. 2004, West et al. 2005, Bray et al. 2006, Lindstrom 2008); the choroplast rubisco spacer (e.g., Brodie et al. 1996, Brodie et al. 1998, Muller et al. 1998, Varela-Alvarez et al. 2007, Milstein et al. 2008); the nuclear internal transcribed spacer region of the ribosomal cistron (ITS) (e.g., Broom et al. 2002, Milstein & de Oliveira 2005, Niwa et al. 2005, Bray et al. 2007, Brodie et al. 2007, Neefus et al. 2008, Niwa et al. 2008); the nuclear rDNA small subunit (SSU) and the associated group 1 introns (e.g., Stiller & Waaland 1993, Broom et al. 1999, Broom et al. 2002, Klein et al. 2003, Kunimoto et al. 2003, Muller et al. 2003, Broom et al. 2004, Jones et al. 2004, Milstein & de Oliveira 2005, Milstein et al. 2008, Teasdale et al. 2009). In addition to generating sequence data, fragment-based markers have also been used: random amplified polymorphic DNAs (RAPDs) (e.g., Dutcher & Kapraun 1994, Jia et al. 2000, Weng et al. 2005, Hu et al. 2007); amplified fragment length polymorphisms (AFLPs) (e.g., Yang et al. 2003, Niwa et al. 2004, Sun et al. 2005); restriction length fragment polymorphisms (RFLPs) (e.g., Teasdale et al. 2002, Bray et al. 2006); sequence-related amplified polymorphisms (SRAPs) (Qiao et al. 2007); inter-simple sequence repeats (ISSRs) (Lynch et al. 2006); and microsatellites (Zuo et al. 2007, Kong et al. 2009). Of the previous, three (COI-5P, rbcL and ITS) have been advocated as DNA barcode markers (Chase & Fay 2009). DNA barcoding (Hebert et al. 2003a, Hebert et al. 68 2003b) was developed to provide a standardized system by which species can be identified based on DNA sequences. This standardization is of practical importance by allowing work to be compared across different laboratories from around the globe. Furthermore, a high standard for DNA sequences (i.e., bidirectional reads of good quality, each sequence linked directly to a voucher) is implemented in DNA barcoding, leading to a solid framework on which to base further taxonomic research. Not only do taxonomists benefit from DNA barcoding, but researchers interested in rapid species identification for other purposes such as biodiversity surveys or identification of food crops will gain a tool that facilitates work previously difficult, time consuming, and, at times, impossible. Studies focused on organisms that are difficult to identify by conventional morphological methods have the most to gain from a DNA barcoding approach, as the need for taxonomic expertise for routine identifications is removed, and there is the possibility of revealing cryptic species (Saunders 2008, 2009, Le Gall & Saunders 2010). DNA barcoding with COI-5P has become widely accepted for red algal species identification and numerous studies have shown its effectiveness (Saunders 2005, Robba et al. 2006, Saunders 2008, 2009, Walker et al. 2009, Clarkston & Saunders 2010, Le Gall & Saunders 2010). The rbcL marker has been used to assess species diversity in red algae since the mid 1990s (Freshwater et al. 1994, Freshwater & Rueness 1994, Hommersand et al. 1994) and has also proven a useful tool for this purpose. An additional marker advocated for identifying photosynthetic organisms is the Universal Plastid Amplicon (UPA; a short, approximately 370bp region of the plastid ribosomal RNA large subunit gene) (Presting 2006, Sherwood & Presting 2007, Sherwood et al. 69 2008). The major advantage of this marker over many others is that a single primer pair can be used to amplify and successfully sequence the UPA from a wide range of species (Sherwood & Presting 2007). The first few studies to evaluate UPA in red algae have shown that it can discriminate species within a single genus (Sherwood et al. 2008, Clarkston & Saunders 2010); however, extensive testing and evaluation of this marker has yet to be undertaken in most red algal groups including the Bangiaceae. Porphyra presents an ideal case for applying standardized makers for species identification because, while extensive work has been done, no single marker has yet been sequenced across all of the species currently recognized worldwide. The aim of this study was to identify and enumerate the Porphyra and Bangia species in Canadian marine waters, thus contributing to the understanding of the taxonomy and floristics of the Bangiaceae in this region. We also evaluated the COI-5P as a DNA barcode marker in comparison with rbcL and UPA with the aim of providing an extensive overview of genetic diversity for discriminating and identifying Porphyra and Bangia species in Canada. Thirdly, we conducted phylogenetic analyses of rbcL data in order to place our newly discovered species in an evolutionary context. Methods Collections Collections of Porphyra and Bangia were made between 1992 and 2009 (with the majority of collections from August 2004 through July 2009) at locations listed in Appendix 3. Each collection was pressed on herbarium paper to serve as a voucher, with a small portion near the center of the blade removed for DNA analysis. For Bangia and 70 small Porphyra spp., several filaments or blades were isolated. Portions for molecular work were dried in silica gel and subsequently stored at -80 °C. Where feasible, specimens were given a provisional name based on the taxonomic keys of Sears (2002) or Gabrielson et al. (2006). DNA sequence acquisition Total genomic DNA was extracted following the protocol of Saunders (1993) with modifications (Saunders 2008). PCR and sequencing primers employed in this study are listed in Table 3.1 (see the records on BOLD http://www.barcodinglife.org (Ratnasingham & Hebert 2007) for the primer combination used for each specimen). For the rbcL, the internal sequencing primers FF4Por and RR4Por were developed specifically for the Bangiaceae. Ex-Taq DNA Polymerase (Takara, Shiga, Japan) and accompanying PCR kit was used according to the manufacturer's recommendations for all reactions. PCR profiles for COI-5P followed that outlined in Hebert et al. (2003a) except that an annealing temperature of 50 °C was employed in reactions that used primers with few degeneracies. For primers with multiple degeneracies (primers with "GWS" in the name, Table 3.1), the annealing temperature was 45 °C. The PCR profile for rbcL was carried out as follows: initial denaturation at 95 °C for 2 minutes; followed by 35 cycles of denaturation at 93 °C for 1 minute, annealing at 47 °C for 1 minute, and extension at 72 °C for 4 minutes; with a final extension at 72 °C for 7 minutes. The PCR profile for the UPA followed Sherwood & Presting (2007). Following amplification, the samples were lowered to 4 °C and maintained at that temperature until PCR clean-up. PCR products were cleaned using 71 the Exo-Sap-IT kit (USB, Cleveland OH, USA). Sequencing was done using the BigDye 3.0 kit (PE Applied Biosystems; Foster City, CA, USA) and with data generated on an Applied Biosystems 3130 XL automated sequencer (PE Applied Biosystems; Foster City, CA, USA). Sequences were edited using Sequencher version 4.2 (Gene Codes Corporation, Ann Arbor, MI, USA) and multiple sequence alignments were constructed in MacClade version 4.08 (Maddison & Maddison 2005). Sequence analyses for species identification The COI-5P alignment consisted of 411 isolates and 661 nucleotides. The rbcL alignment consisted of 83 isolates and 1363 nucleotides and was split into two subalignments to facilitate estimates of their respective potential as DNA barcode markers: the first (r£cL-5P) consisting of the initial 672 nucleotides and corresponding to the region of the rbcL employed in plant DNA barcoding studies (Hollingsworth et al. 2009) and the second (r6cL-3P) the final 670 nucleotides. The UPA alignment was 208 isolates by 371 nucleotides in length. Neighbor-joining (NJ) analyses were carried out using PAUP* version 4.0bl0 (Swofford 2002), as well as the Taxon ID function in BOLD. Intra- and interspecific distances were evaluated for the COI-5P alignment, the full rbcL alignment, as well as each subalignment, and the UPA alignment either with the Distance Summary function in BOLD or with PAUP*. In all cases, the Kimura-2 parameter model was applied. When PAUP* was used, corrected distances were exported to Microsoft Excel for Mac 2004 version 11.5.5 (Microsoft Corporation, Mississauga, Ontario, Canada), transformed to percentages and the maximum and minimum values were found using the MAX and MIN formula functions. For COI-5P, with the exception 72 of P. peggicovensis, incomplete sequences (<600bp in length or missing more than three nucleotides at the 5' end) were excluded from the distance analysis. To compare our provisional and unnamed species identifications from the previous analyses against published data, we downloaded at least one representative rbcL sequence for each species for which data were available on Genbank as of August 2009 (accessions listed in Appendix 4). We aligned these data with our rbcL sequences and conducted a NJ analysis. When specimens clustered with published sequences and were no more than 0.38% divergent (based on our previous analyses, see Results), names were assigned in cases where no provisional name was given, and confirmed or corrected in cases where provisional names were given. Phylogenetic analysis A dataset consisting of 82 taxa and 1363 nucleotides of the rbcL was used to evaluate the phylogenetic position of newly acquired genetic species groups. We used Genbank data (Appendix 4) for species from other parts of the world, or for which we did not have representatives, to provide as broad a taxonomic range as possible. A number of florideophycean taxa were used to form the outgroup (Miiller et al. 2001) (Appendix 4). The model of sequence evolution was selected using jModelTest 0.1.1 (Posada 2008) and phylogeny reconstruction was done using PHYML (Guindon & Gascuel 2003). Analysis was conducted under the general time reversible model (GTR) (Rodriguez et al. 1990) including parameters for invariable sites (I) and a gamma distributed rate variation (G). The proportion of invariable sites was estimated from the data. Four substitution rate categories were used and the gamma shape parameter was also estimated from the data. 73 Branch support was evaluated using the SH-like approximate Likelihood Ratio Test (aLRT) (Anisimova & Gascuel 2006), as well as 500 bootstrap replicates (for ingroup taxa only). Separate analyses were conducted with and without the outgroup taxa, with the resulting ingroup-only tree rooted according to the results of the ingroup+outgroup analysis. This approach reduces long-branch attraction artifacts possibly resulting from ingroup+outgroup analysis (Felsenstein 1978, Brinkmann et al. 2005). Morphological work Dried voucher material was rehydrated in 4% formalin in seawater for morphological and anatomical observations. For Porphyra corallicola, live cultures were also examined. Sections were made in a Leica CM1850 cryostat (Heidelberg, Germany) and observed using a Leica DM5000B microscope and photographs taken with a Leica DFC480 digital camera. Sections or whole-mounts were mounted on slides in 50% corn syrup in distilled water. For each measurement reported, 20 individual structures were measured, and an average was calculated, except in the case of blade and cuticle width where five measurements were made on each of two sections and the 10 measurements then averaged. Results A total of 32 species are reported in this study, 27 of which were found in Canada. A summary of the species studied, their habitat, seasonality, geographic range and number of markers sequenced is shown in Table 3.2. For a full list of specimens included in this study, see supplementary information in Appendix 3 and the BOLD database: http://www.barcodinglife.com. 74 C0I-5P results Of the 512 collections in this study, the COI-5P was successfully amplified and sequenced for 411 specimens. Neighbor-joining analyses were conducted only for specimens with sequence length greater than 600bp. The COI-5P sequences clustered into 28 genetic species groups (Fig. 3.1, Appendix 5). The genetic variation within these groups ranged from 0 to 0.77% with a mean of 0.096% while between groups the genetic variation ranged from 2.182% to 23.92% with a mean of 19.01%. The highest intraspecific divergences were observed in P. gardneri (G.M. Smith & Hollenberg) M.W. Hawkes. The six most genetically similar species pairs were: P. umbilicalis Kutzing and P. mumfordii differing by 2.18-2.82%; P. abbottiae and P. sp. 1POR differing by 2.18- 3.64%; P. columbina Montagne and P. mumfordii differing by 3.80-3.96%; P. leucosticta Thuret and P.fucicola V. Krishnamurthy differing by 3.62-4.14%; and P. columbina and P. umbilicalis differing by 3.97-4.14 %. Samples from the Pacific identified as Porphyra cuneiformis (Setchell & Hus) V. Krishnamurthy fell within the Atlantic P. amplissima genetic species group and had identical sequence in most cases (maximum divergences of 0.61%). All P. cuneiformis samples are referred to as P. amplissima throughout this manuscript (discussed below). The COI-5P could not be obtained for 101 samples including all samples of the species: P. kanakaensis T.F. Mumford, P. papenfussii V. Krishnamurthy, P. peggicovensis and P. aestivalis. However, 70 of these samples were sequenced with the rbcL and/or UPA (Table 3.2), while 31 collections failed for all markers. 75 rbcL results The rbcL was successfully sequenced for 83 of 111 samples attempted. The intraspecific divergences among our specimens ranged from 0% to 0.37% with a mean of 0.064%, while interspecific divergences ranged from 0.59% to 12.98% with a mean of 8.35%. The six most genetically similar species pairs were: P. abbottiae and P. sp. 1POR differing by 0.59-0.66%; P. umbilicalis and P. mumfordii differing by 0.81-0.96%; P. columbina and P. mumfordii differing by 0.81-0.89%; P. aestivalis and P. birdiae differing by 0.89-1.02%; P. columbina and P. umbilicalis differing by 1.41-1.48%; and P. kurogii S.C. Lindstrom and P. linearis differing by 1.71-1.82%. Our British Columbia samples of Porphyra amplissima ("P. cuneiformis ") were identical in sequence to Atlantic P. amplissima, as well as to a published P. cuneiformis sequence (AF452428), except in the case of a few substitutions unique to some sequences, signifying intraspecific variation. Intraspecific variation of the rbcL-5P among our specimens ranged from 0% to 0.45% with interspecific variation from 0.45% to 16.56%. The maximum intraspecific variation of 0.45% existed between two Porphyra amplissima isolates, while the minimum interspecific distance of 0.45% was between P. mumfordii and P. umbilicalis. Intraspecific variation of the r6cL-3P ranged from 0% to 0.49% with interspecific variation from 0.45% to 14.84%. Here, the maximum intraspecific distance was between two Bangia sp. 1 BAN isolates, and the minimum interspecific distance was between P. abbottiae and P. sp. 1POR. In summary, the rbcL-5? and the rbcL-3P had equally low minimum interspecific variation values and overlapping intra- and interspecific genetic variability. 76 In the neighbor-joining analysis of our rbcL data combined with Genbank data, specimens from this study clustered with and were no more than 0.379 % divergent from their nearest-neighbour published Porphyra species (Fig. 3.2) except in the case of P. columbina, P. corallicola, P. peggicovensis, P. sp. 6POR and P. cf. thuretii Setchell & E.Y. Dawson, which did not cluster with any published rbcL sequences. This allowed us to confirm species names based on reciprocal monophyly with published sequences in most cases, and alerted us to the newly discovered P. corallicola, P. peggicovensis and P. sp. 6POR and the newly sequenced P. columbina and P. cf. thuretii. UPA results The universal plastid amplicon was sequenced for a total of 208 samples of 246 attempted. Neighbor-joining analysis did not resolve genetic species groups with the same power as COI-5P or rbcL. Clusters were formed only for the following 18 genetic species: P. amplissima, P. fallax S.C. Lindstrom & K.M. Cole, P. fucicola, P. gardneri, P. kanakaensis, P. leucosticta, P. miniata (C. Agardh) C. Agardh, P. mumfordii, P. nereocystis C.L. Anderson, P. occidentalis Setchell & Hus, P. purpurea, P. papenfussii, P. perforata J. Agardh, P. smithii Hollenberg & I.A. Abbott, P. sp. 5POR, P. sp. collinsii, P. umbilicalis and Bangia sp. 1BAN (Fig. 3.3). Genetic species groups that were delimited with both the COI-5P and rbcL, but did not form clusters in the UPA, were: P. birdiae, P. kurogii, P. linearis, P. peggicovensis, and P. cf. thuretii. Due to this lack of clustering, overall intra- and interspecific variability overlapped completely, rendering the UPA ineffective for assigning samples to genetic species, except for the 18 species for which clusters were resolved. A confounding problem, which contributed to the low 77 genetic species resolution of the UPA, was the presence of numerous nucleotide sites with ambiguities in the sequence trace files. This problem was particularly common for: P. birdiae, P. smithii, P. sp. stamfordensis and P. sp. collinsii. In the case of P. birdiae, the nucleotide ambiguities were found at several sites that were common among individuals and consisted of the same ambiguity in each case. For example, at site 93 in our alignment, all P. birdiae individuals had a Y (C and T at the same site) and at site 94 all but one individual had an R (A, G). As with COI-5P and rbcL, sequences for the P. amplissima cluster, including "P. cuneiformis were identical (except for a single substitution and a few ambiguous sites in one Atlantic P. amplissima sequence). Comparing the COI-5P, rbcL and UPA as DNA barcode markers There was a 1.41% difference between the maximum intraspecific divergence and the minimum interspecific divergence ("DNA barcoding gap", see Discussion) in the COI-5P. Unfortunately, 19 primer combinations were required to generate the 411 COI- 5P sequences used here and, in many cases, several combinations needed to be tried before sequence was acquired. Primer development for all marine algae is an ongoing process in our laboratory, and most of the primers employed in this study were being tested as general red algal primers and not optimized for the Bangiaceae—explaining, in part, the low primer universality. The COI-5P for P. aestivalis, P. kanakaensis, P. papenfussii and P. peggicovensis could not be amplified with any of the primer combinations tested indicating that further primer design is imperative if COI-5P is to be used for routine barcoding of the Bangiaceae. On several occasions, specimens were identified as belonging to an established species group using the UPA (see below) or 78 rbcL because the C0I-5P did not amplify with any primer combination that had worked for the other members of the species. This observation may indicate variability at the established priming sites for COI-5P at the intraspecific level in some Bangiaceae. Primer development for the rbcL over the course of this study led to the primers F57, FF4Por, RR4Por and rbcLrevNew emerging as optimal for Porphyra and Bangia. Despite the fact that some samples were not successfully amplified, these primers can be used to recover sequence from all species studied. The external primers F57 and rbcLrevNew did not require any optimization for the Bangiaceae and work well for a broad spectrum of red algae (e.g., Le Gall & Saunders, 2010). The internal sequencing primers (FF4Por, RR4Por) were designed specifically for the Bangiaceae. Given that only a single set of primers is required to amplify the rbcL for the Porphyra and Bangia species studied here, whereas 19 primer combinations were required to recover COI-5P sequences, the universality of the rbcL is higher than that of the COI-5P. However, the barcoding gap for the full rbcL was only 0.22%, compared to 1.41% for COI-5P. The lack of genetic clustering with the UPA and the overlap between intra- and interspecific variation (for genetic groups outlined by both the COI-5P and the rbcL), limit the scope of the UPA for assigning collections to species. However, on 47 occasions, the UPA was used to assign specimens to one of the 18 species for which genetic clusters were consistent with the COI-5P and rbcL, when we were unable to obtain COI-5P sequence (the rbcL was used on four occasions, and the rbcL plus the UPA were sequenced for 18 samples for which the COI-5P failed). Universality was high for the UPA, with all sequences generated using only a single primer pair. 79 Phylogenetic results Results of the maximum likelihood analysis of one sample per genetic species group are shown in Figure 3.4. The ML analysis produced an unbalanced tree, with an unknown Porphyra species (unpublished AY795901 in Genbank) and a group containing P. papenfussii and P. tasa as sister to all the other taxa. In most cases, recent branches showed relatively high aLRT and bootstrap support when compared to deeper nodes. As in previous studies (e.g., Miiller et al. 2001, Lindstrom & Fredericq 2003, Brodie et al. 2008, Lindstrom 2008), Porphyra and Bangia did not form independent, monophyletic genera. Bangia fell into at least four separate lineages distributed throughout the tree (Fig. 3.4). Discussion Pacific floristic observations In the Pacific, we recorded 20 species (Table 3.2) and several interesting floristic results were noted. If our identification is correct, this study presents the first published sequence data for Porphyra thuretii. Porphyra thuretii is an "infrequently collected" (Hawkes 1981; pg. 98) epiphyte of other algae, particularly kelp stipes, but also occurs on red algae and seagrass (Hawkes 1981). The growing season of P. thuretii lasts from January until May, with the highest abundance found in March and April (Hawkes 1981). Our collections were from the end of May (Table 3.2, Appendix 3). According to published descriptions, blades of P. thuretii morphologically resemble those of Porphyra nereocystis, but differ in that they are less strap-shaped, the margins are ruffled, and the marginal spermatangial regions are found in small patches 80 and streaks rather than as broad marginal bands (Conway et al. 1975). Our collections differed from published descriptions of the species only in that blades were small (up to 4 cm long, as opposed to the 75 cm reported in the literature) and that they lacked ruffled margins. It is possible that such small blades have been overlooked by researchers previously, or that larger blades have eroded away by the end of the growing season. Alternatively, our small blades may represent a second cohort of recruits late in the growing season of this species. The small size of our collections may also explain the lack of ruffled margins, a characteristic that may require some minimum overall blade size to manifest. In maximum likelihood analysis of the rbch (Fig. 3.4), P. thuretii was evolutionarily unique and did not show a close sister relationship to any other Porphyra or Bangia species. Lindstrom (2008) reported a new cryptic species that closely resembled and was sister to Porphyra schizophylla G.J. Hollenberg, which was originally described from southern California (type locality: Monterey Peninsula, CA). Lindstrom's "Unknown #5" collections from northern California, BC and Alaska (no collections made in Oregon or Washington) clustered together and were 1.4-1.6% divergent from/', schizophylla in Lindstrom's rbch phylogeny (Lindstrom 2008). All of our collections that had a "P. schizophylla" morphology clustered with Unknown #5 rather than P. schizophylla in our neighbor-joining rbch analysis (Fig. 3.2) (for consistency with Lindstrom's work, we refer to these collections as P. sp. 5POR), confirming that northern collections similar in morphology to P. schizophylla likely represent a cryptic sister species. Genbank sample AF452443 listed as "P. schizophylla''' (Fig. 3.2) likely represents Unknown #5, as it was 81 sequenced by Lindstrom & Fredericq (2003) prior to recognition of Unknown #5 (Lindstrom 2008). Lindstrom's work (2008) also revealed a cryptic species sister to P. abbottiae that she named "Unknown #1". Our results (Figs. 3.1-2, 3.4; Porphyra sp. 1POR) confirmed this finding—the COI-5P results agree with the entire rbcL, which place Porphyra sp. 1 POR as a sister to P. abbottiae. Lindstrom (2008) observed that one difference between these two similar species is that collections of Unknown #1 were epiphytic (at least from the Victoria, British Columbia area—the habitat of the other collections was not described in her paper); however, the collections we made of P. sp. 1POR were all epilithic. The level of divergence between P. abbottiae and P. sp. 1POR (1.50-2.02% rbcL) is low enough to support the idea that this species pair represents a recent divergence. The recently described Porphyra aestivalis is reported to occur from Southeast Alaska to the Aleutian Islands (Lindstrom & Fredericq 2003, Lindstrom 2008), but we have uncovered a single isolate from Haida Gwaii extending the known range for this species. The southernmost point of southeast Alaska is only about 55 km north of the northern reaches of Haida Gwaii (although there are approximately 250km between the southernmost point of southeast Alaska and our collection site for this sample), so it is not surprising that this species occurs on Haida Gwaii and had been overlooked in the past. We also included a single isolate of Porphyra columbina collected in Chile (although Brodie et al. (2008) warn that the presence of P. columbina in Chile requires further study). This sample showed close genetic affinity to P. umbilicalis and P. 82 mumfordii (see Fig. 3.3). The rbcL for this species was not a match to any published sequences and represents the first published COI-5P and rbcL data for P. columbina (if our identification is correct). Pacific Porphyra species not encountered in this study There is a number of species reported, in the taxonomic key to the flora of southeast Alaska to Oregon (Gabrielson et al. 2006) and other published literature, to occur in the eastern Pacific that we did not find during our collecting trips. In most cases either seasonality of collecting or geographic range explains why we did not encounter these species. Our winter collections were limited to a few sites (Vancouver and Bamfield) over only a few days and therefore it is not surprising that we did not encounter some winter species including: P. torta V. Krishnamurthy, P. pseudolanceolata V. Krishnamurthy, and P. hiberna S.C. Lindstrom & K.M. Cole (which is also only reported from California). Pacific species that are not reported in British Columbia (are not necessarily seasonal) and were not found by us include: P. hollenbergi E.Y. Dawson (reported from Mexico), P. lanceolata (Setchell & Hus) G.M. Smith (ranges from California to Oregon), P. pseudolinearis Ueda (range includes Japan, Korea, Russia and Alaska), P. pulchra Hollenberg (originally reported in California, but also reported in Australia and New Zealand), P. segregata (Setchell & Hus) V. Krishnamurthy (Southern California only), and P. tasa (Yendo) Ueda (known from Japan and Alaska). Porphyra variegata (Kjellman) Kjellman has been reported from California to Alaska and Japan, but we did not encounter this species. We also did not encounter Pacific specimens of Porphyra purpurea—in these waters, this species is known only 83 from salt marshes (formerly as P. rediviva Stiller & Waaland (e.g., Stiller & Waaland 1996, Bray et al. 2007)) and we did not extensively sample this type of habitat during our survey. Atlantic floristic observations Our survey recovered all of the species that are reported in Atlantic Canada: Porphyra amplissima, P. birdiae, P. leucosticta, P. miniata, P. linearis, P. purpurea, and P. umbilicalis. A relatively newly discovered species, P. birdiae, has been reported from Maine, New Brunswick and mainland Nova Scotia (Neefus et al. 2002). In this study we expand its range to include the Cape Breton area of Nova Scotia, as well as Newfoundland (Appendix 3). We originally misidentified P. birdiae as P. purpurea until we sequenced the rbcL, an excellent example of how molecular tools can aid in the identification of species. Our survey uncovered two genetic species that did not cluster with named species but for which rbcL data matched two cryptic species in Genbank: "Porphyra sp. collinsir (DQ813598) and "Porphyra sp. stamfordensis" (DQ813642) from an unpublished study on cryptic Porphyra species by Bray, Neefus and Mathieson. Our COI-5P for P. sp. collinsii matches Robba et al.'s (2006) Porphyra leucosticta 3 (DQ442890; collected in the UK) with 99.24% similarity suggesting that this cryptic species is found both in the northwest and northeast Atlantic and linking these two form names in Genbank. All of our specimens of P. sp. collinsii were collected as subtidal epiphytes at a single site in Rhode Island, indicating that this species is likely not present 84 in Canada. Porphyra sp. stamfordensis is represented by a single collection of an epiphyte on Fucus, again collected in Rhode Island. We also sequenced a single isolate of a Porphyra from Texas {Porphyra sp. 6POR), originally identified as P. leucosticta, but this sample had unique COI-5P and rbcL sequences indicating the possibility of a new species (at least one for which the rbcL and COI-5P have not been previously published). None of our Canadian collections matched this sequence. Two additional cryptic species from the Atlantic—P. corallicola and P. peggicovensis—are described below. Porphyra peggicovensis was uncovered as a cryptic species resembling P. linearis. In his study of Nova Scotian Porphyra, Curtis (1997) reported that P. linearis likely harboured cryptic species. Though not discussed, Lindstrom & Fredericq (2003) included in their analyses two sequences for P. linearis that were divergent and clearly not from a single species. One sequence (AF168673) is from cultured material held at CCAP (Strain 1279/1) and was attributed to Miiller et al. (2001) though the sequence was not used in the paper. The other sequence (AF078745) represents a collection from Maine (Klein et al. 2003). Klein et al. (2003; pg. 115, Table 4) reported high intraspecific divergence among SSU sequences for samples of P. linearis and were likely using several species in their analysis. Mortensen et al. (2009) also reported cryptic diversity within P. linearis. We do not know which, if any, of the published rbcL sequences represents true P. linearis since none of the collections were thoroughly examined for morphological characteristics, nor did they come from the type locality. We included both sequences for the CCAP specimen and Klein et al.'s (2003) Maine isolate in our rbcL analyses and our collections of P. linearis group with the 85 former (Fig. 3.2). At least some of our P. linearis collections have several characteristics attributed to the species, most notably, the distinct short stipe (Greville 1830), but isolates were highly variable in morphology. Further, some specimens within this genetic group had blades sectored into female and male regions (as described in the lectotype description by Brodie & Irvine (2003)), whereas others lacked this attribute. Several of our samples with a P. linearis-like morphology did not group with either of the published P. linearis sequences, but rather had unique rbcL sequences and it is these that we recognize as P. peggicovensis (see Taxonomic conclusions). The P. peggicovensis rbcL sequences were 1.28-1.64% divergent from their closest sister species, the Pacific P. pseudolinearis and Lindstrom's (2008) Unknown #2. In the rbcL phylogeny (Fig. 3.4), P. peggicovensis associated strongly with these species suggesting that the linear blade morphology may be a unifying characteristic of this cluster. Conversely, among members of P. linearis as restricted here, we observed a variety of blade shapes from the typical linear to oval and rounded blades. Atlantic Porphyra species not encountered in this study While we did collect all species of Porphyra and Bangia reported in Atlantic Canada, there are several north Atlantic species found in New England and northern Europe that we did not encounter. These include the three introduced Asiatic species: P. katadae A. Miura, P. suborbiculata Kjellman and P. yezoensis. Of these, only one form of P. yezoensis has been reported to occur near Canadian waters—P. yezoensis f. yezoensis extending to mid-coast Maine. Oceanic temperatures may explain the lack of these species in Canada, as waters from mid-coast Maine to the Bay of Fundy and outer shores of Nova Scotia are on average 1-4 °C cooler than waters from Long Island Sound to mid-coast Maine (data from Oceanographies Databases, Fisheries and Oceans Canada: http://www.mar.dfo-mpo.gc.ca/science/ocean/database/data_query.html). Rising global temperatures may permit these introduced species to reach Canadian waters in the future. The southerly and counterclockwise direction of prevailing currents in the Gulf of Maine (Apollonio 1979) offers an alternative explanation for the lack of these species in Canadian waters. A standardized system for species identification as advocated here and elsewhere for algal barcoding (e.g., Saunders 2005, Robba et al. 2006, Saunders 2008, 2009, Le Gall & Saunders 2010) will allow researchers to monitor seaweed populations for the migration of these introduced species. Other Atlantic species not encountered in our survey include P. olivii Orfanidis, Neefus & Bray (found in the Mediterranean, as well as in Rhode Island, USA), and P. elongata Kylin (another European species also found in the USA). Porphyra dioica J. Brodie & L.M. Irvine (England), P. drachii J. Feldmann (a French species) and P. thulaea I.M. Munda & P.M. Pedersen (Greenland) have not yet been reported in the northwest Atlantic and were not encountered during this study. Atlantic and Pacific Bangia Though only B. fuscopurpurea is currently recognized for Atlantic and Pacific populations of Bangia, studies have revealed the presence of numerous cryptic species in both oceans (Mtiller et al. 1998, Broom et al. 2004). Our results uncovered a total of three Bangia species: B. sp. 1BAN found only in the Pacific, Bangia sp. 2BAN found in the Atlantic, and a single collection of Bangia fuscopurpurea from the Atlantic. We also 87 recovered a single UPA sequence of a Pacific Bangia (GWS008341; PORPH021-09) that did not cluster with either B. sp. 2BAN or B. fuscopurpurea; however, given the low variability of the UPA, and the poor quality of sequence data typical for Bangiaceae (see below), this result alone may not indicate a fourth species. Our phylogenetic results (Fig. 3.4) are consistent with those of Miiller et al. (1998, 2005) and Broom et al. (2004) in that Bangia and Porphyra are not monophyletic genera. We also agree that there may be a simple developmental switch responsible for blade versus filament forms (Miiller et al. 2005) and that both morphologies may have evolved independently on numerous occasions (Broom et al. 2004). Miiller et al. (1998) discussed the difficulty of describing new species for Bangia when morphological characteristics do not coincide with molecular analyses and morphological characteristics are, thus far, not taxonomically informative. Unfortunately, both Bangia and Porphyra have such simple morphologies that it is possible that, for some species, taxonomically informative morphological characters will either not be found or will be so difficult to evaluate that they will be of little use. Caveats in using DNA sequences from Genbank There are two significant dangers with using molecular data from Genbank for the purposes of species identification. The first is that accurate identifications of species are not guaranteed (e.g., Harris 2003, Vilgalys 2003). In our study, the majority of data selected was from papers focused on the taxonomy of Porphyra species. We screened the papers from which these data came and, while we cannot be certain of all of the identifications, in several cases the authors have indicated that type material was 88 examined (e.g., Lindstrom & Fredericq 2003). Given the scope of this study, and the agreement of our rbcL, COI-5P and UPA data, we feel these identifications serve well enough for the purposes of broad biogeographic surveys in that regardless of the name, at least a DNA match will confirm that a collection belongs to a particular genetic group. Secondly, in BOLD, trace files are given quality scores and are available for viewing, whereas Genbank sequences have a less rigorous quality assurance, with trace files not required for all records. Genbank sequences may contain large gaps, or many ambiguous sites that decrease the strength of multiple sequence analyses for the purposes of species identification and may inflate the perceived levels of species diversity (e.g., Le Gall & Saunders 2010). Choosing a molecular marker for species identification in the Bangiaceae Two important factors to evaluate when choosing a molecular marker for species identification (i.e. DNA barcoding) are universality and species-resolving power (see Hollingsworth et al. 2009). In terms of universality, an ideal marker is recoverable from as many taxa as possible from the group of interest, employing a single primer pair for amplification and sequencing. Furthermore, DNA barcoding regions should be short enough so that they may be sequenced bidirectionally with a single primer pair— allowing for rapid data generation with high confidence. In terms of species resolving power, a suitable marker should provide sufficient genetic variation that taxa may be distinguished at the species level, and no species are missed. A metric for this is the "barcoding gap" whereby the minimum interspecific variation is greater than the maximum intraspecific variation (Meyer & Paulay 2005, Meier et al. 2008). In this study, 89 both the COI-5P and the rbcL have a barcoding gap with more than an order of magnitude difference between mean intraspecific and mean interspecific divergence values (see results). Comparing the COI-5P to the rbcL highlights an example of a trade off between universality and resolving power that exists in Porphyra and Bangia. A DNA barcoding gap of 1.41% is present in the COI-5P over a region short enough (661bp) to be sequenced in both directions without the requirement of internal sequencing primers. However, there is variability at the priming regions within Porphyra. Difficulty with primers could be addressed by conducting a primer optimization study to identify primers that have the greatest universality. Conversely, the rbcL had more universal primers, but a smaller DNA barcoding gap (0.22%). Furthermore, the entire rbcL was needed to achieve this barcoding gap (i.e., both subalignments {rbcL-5? and rbcL-3P) lacked a barcoding gap). This lower level of variation poses a risk of missing closely related species if only the 5' or 3' regions are used, and reduces the practicality of the rbcL as a marker because four sequencing reactions are required to obtain a long enough read to distinguish species. Universality is also affected as the internal sequencing primers used here were designed to be specific to the Bangiaceae. Despite some species being consistently assigned to correct species groups with the UPA, this marker failed as a generally applicable DNA barcoding marker because variability was too low and there was no DNA barcoding gap. This issue was complicated by the presence of persistent sequence ambiguities at several sites within the UPA of certain Porphyra species. Multiple, non-identical copies of the ribosomal rRNA 90 cistron have been reported in the Porphyra plastid (Reith & Munholland 1993) and are the likely explanation for the prevalence of ambiguous sites in the UPA. While there is currently no "magic bullet" marker that provides appropriate levels of variation and has universal primers, of the three markers studied here, COI-5P is best suited to species identification. The COI-5P has been adopted as the standard for DNA barcoding and species identification in the red algae (Saunders 2005, Robba et al. 2006, Saunders 2008, 2009, Walker et al. 2009, Le Gall & Saunders 2010), brown algae (Kucera & Saunders 2008, McDevit & Saunders 2009), and animals (e.g., Hebert et al. 2003a, Hebert et al. 2003b, Frezal & Leblois 2008); whereas the region of the rbcL employed in land plant DNA barcoding studies (rbcL-5V) is too short to be of use for identifying bangiacean species. Taxonomic conclusions Synonymy o/Porphyra cuneiformis with Porphyra amplissima. Our results indicate that P. cuneiformis is not distinct from P. amplissima. For all three of the markers studied, P. cuneiformis fell within P. amplissima. The low level of COI-5P variation (maximum 0.465%) falls within limits for intraspecific status (0-0.77%) and well below the observed interspecific variation for even the most closely related species (P. abbottiae vs. P. sp. 1POR, 2.18%). Previous studies have also reported genetic similarity between these species (Lindstrom & Cole 1992, 1993, Lindstrom & Fredericq 2003) and indeed the rbcL sequences published by Lindstrom & Fredericq (2003) for P. cuneiformis and P. amplissima are identical. 91 Taxonomic confusion has surrounded these two taxa with several early accounts expressing difficulty in distinguishing them from each other, as well as from Porphyra miniata (a species currently only recognized in the Atlantic, see more below). Krishnamurthy (1972) originally elevated Porphyra cuneiformis from form status in Porphyra miniata on the bases of differences in reproductive formula and colour. Krishnamurthy recognized the similarities between P. cuneiformis and P. amplissima, but indicated that they are differentiated from one another by the presence of a cuneate basal portion and crenulate margin for P. cuneiformis (Krishnamurthy 1972). Morphological and anatomical observations were also made by Hollenberg (1972), Conway et al. (1975) and Abbott & Hollenberg (1976) all of whom referred to P. cuneiformis as P. miniata despite Krishnamurthy's (1972) conclusions. Hollengberg (1972) observed differences among specimens of P. amplissima, P. cuneiformis and P. miniata, but was unable to elucidate a pattern and thus concluded that all specimens should be considered P. miniata—a single morphologically variable species. This, no doubt, contributed to the confusion among these "species" until Lindstrom & Cole (1992) compared blade size, shape, colour, habitat, number of cell layers, sexuality, seasonality, division formula of zygotosporangia and spermatangia, blade thickness in vegetative and reproductive portions and the size of the protoplast. Although they found no significant differences between P. amplissima and P. cuneiformis, they did distinguish them from P. miniata by the arrangement of the zygotosporangia and spermatangia on the blade. Porphyra amplissima and P. cuneiformis had female and male reproductive packets intermixed along the margins of the blades, whereas P. miniata had blades sectored into male and female regions by a vertical line (Lindstrom & Cole 1992). These morphological 92 observations distinguishing P. amplissima from P. miniata were confirmed by Hehre & Mathieson (1993) who examined Atlantic collections of both species and also found that P. miniata had sectored blades while P. amplissima had male and female packets intermixed on the margin. Hehre & Mathieson (1993) reported that the plicate nature of P. amplissima is an additional characteristic by which to differentiate these species in the Atlantic. Lindstrom & Cole (1992) further employed isozyme analysis, the results of which corresponded with the morphological data in showing a close affinity between P. amplissima and P. cuneiformis to the exclusion of P. miniata. Given that all three genetic markers employed in this study show only intraspecific levels of variation for P. amplissima and P. cuneiformis, and there are no significant morphological differences between these two entities, we consider them synonymous. Porphyra amplissima has priority, being the older name. Porphyra miniata and its sister species Porphyra variegata Some of the taxonomic confusion mentioned above surrounding Pacific samples of "P. miniata" may have involved P. variegata as well. A published P. variegata rbcL sequence is only 0.192% divergent from a published P. miniata sequence and only 0.147% divergent from our P. miniata sequence. This level of variation falls within the scope of intraspecific divergence reported here, suggesting that these two are conspecific. When researchers (Hollenberg 1972, Krishnamurthy 1972, Conway et al. 1975) were investigating P. amplissima, P. cuneiformis and "P. miniatd\ they may have also been looking at P. variegata, which would have contributed to the confusion. None of our Porphyra specimens from the Pacific fell within the P. miniata species group based on 93 the COI-5P (Fig. 3.1, Appendix 5) or within species limits of P. miniata or P. variegata based on rbcL (Fig. 3.2), and therefore we do not have new data to support synonymizing these entities; however, this possibility should be investigated. Porphyra corallicola H. Kucera et G.W. Saunders sp. nov. Latin Filaments growing between cells of crustose coralline algae. In culture, vegetative cells rectangular 19-55/im long (average 37//m) and 3-8//m (average 6//m) wide, forming straight filaments branching most commonly at 90° angles. Putative archeosporangia rounded, occurring in chains or singly and sessile upon vegetative filaments, 10-20//m long (average 16//m) and 12-19//m wide (average 16/im), often germinating in situ. Conchosporangial branches consisting of cells 6-19//m long (average 11,5/im) and 16- lApim wide (average \9pim). Vegetative and archeosporangial plastids parietal; conchosporangial plastids stellate with a single, central pyrenoid. HOLOTYPE: G.W. Saunders, 20 December 1999 (UNB - GWSC014) (Fig. 3.5) TYPE LOCALITY: Maces Bay (45.1093° N, 66.4817 °W), New Brunswick, Canada, in crustose coralline, under Peyssonelia. HOLOTYPE COI-5P DNA BARCODE: ABMMC3531-08 (BOLD), XXXXX (Genbank). ETYMOLOGY: Named for the endophytic habit of the type collection. 94 COMMENTS: Porphyra corallicola was discovered growing in culture, during an attempt to isolate Peyssonnelia rosenvingei Schmitz that had been scraped from a large piece of cobble. When sections were made of the voucher, Porphyra corallicola was observed growing among cells of a dead crustose coralline (Fig. 3.5a), which were overgrown by Peyssonnelia rosenvingei. Due to the quality of the material following decalcification and the thickness of the section, it was difficult to obtain clean images; however, Figure 3.5a shows several filaments of the Porphyra corallicola (arrows), as well as the pit connections between the coralline cells (arrowheads). Filaments of P. corallicola were approximately 2-3 ^m in diameter; unfortunately the section was of insufficient quality to record cell length, or to recognize any reproductive structures. Regardless, our observations of cultured material establish that this isolate is clearly the conchocelis phase in the life history of this novel taxon. Conchocelis phases are known to undergo the following five types of reproduction: a) fragmentation of vegetative filaments; b) formation of archeospores (formerly known as monospores), which regenerate new conchocelis; c) formation of neutral spores, which also regenerate new conchocelis; d) formation of prothalli, which release protoplasts that develop as gametophyte blades; and e) formation of conchosporangia, which release conchospores that germinate as blades (Knight & Nelson 1999, Nelson et al. 1999). In our culture, three distinctive cell types were observed in culture: vegetative filaments, putative archeosporangia and putative conchosporangia. In P. corallicola, colonies of conchocelis filaments consisted of a central tangle of vegetative filaments mixed with chains of putative archeosporangia (Fig. 3.5b). Vegetative filaments were relatively straight, not gnarled or curled and consisted of 95 rectangular shaped cells (Fig. 3.5b,d). Vegetative filaments were branched, usually at approximately 90° angles, with filaments radiating out from the tangled colony (Fig. 3.5b). Branches were either formed by an existing vegetative cell making a protrusion (Fig. 3.5c) or by the germination of putative archeospores (Fig. 3.5d). Because we did not specifically follow the fate of spore products in our culture, we could not definitively identify the putative archeospore cells (Fig. 3.5e, arrowhead), which were nonetheless distinct from the vegetative cells of Porphyra corallicola. However, they resembled the "monospores" of Conway & Cole (1977, figs. 18,19), lacked stellate plastids and were not heavily pigmented as is characteristic of conchosporangia and neutral spores (Conway & Cole 1977, Knight & Nelson 1999) consistent with descriptions of archeospores. Our putative archeosporangia occurred singly (Fig. 3.5e) or in chains (Fig. 3.5f) on the vegetative filaments and either germinated following release (Fig. 3.5g) or in situ (Fig. 3.5d). Like vegetative cells, archeosporangia have parietal plastids (Fig. 3.5d). Putative conchosporangia-bearing colonies consisted of little or no vegetative filaments (Fig. 3.5h). Conchosporangial branches (Fig. 3.5i) were wider in diameter {3ptm on average) than vegetative branches with the cells having a roughly cuboidal shape and containing a stellate plastid with a single pyrenoid (Fig. 3.5i). We did not observe the formation of a gametophytic blade phase from the putative conchosporangia. Porphyrapeggicovensis H. Kucera et G.W. Saunders sp. nov. DESCRIPTION Latin 96 Blades linear in shape, 55-220 mm long and 3.5-10 mm wide (Fig. 3.6a). Dried blades burgundy to grey basally to centrally, becoming lighter distally. Vegetative cells irregularly polygonal 10-24 }im (average 16 / (Fig. 3.6c). Blades are monostromatic and 48-69 ptm (average 57 jim) thick. Basal and central regions of the blade are vegetative, while marginal regions consist of smaller cells arranged into irregular packets usually consisting of four phyOospores (Fig. 3.6d). In surface view, phyllospores 5-11 ptm (average 8 fim) wide by 6-14 pim (average 10 fim) long (Fig. 3.6e), and 10-18 //m (average 14 fim) high in transverse section (Fig. 3.6f). HOLOTYPE: G.W. Saunders and D. Saunders, Blade number 1 on the press is designated as the type. 31 December 2006 (UNB - GWS005677) (Fig. 3.6). TYPE LOCALITY: Peggys Cove (44.4905° N, 63.9166°W), Nova Scotia, Canada, forming a rich zone in the upper mid-intertidal. ETYMOLOGY: Named for the beautiful type locality—Peggys Cove, Nova Scotia, Canada. OTHER SPECIMENS EXAMINED: GWS00J282, GWS002660. See Appendix 3 for detailed collection information. COMMENTS: While only three collections of this species have been made to date, each collection consisted of multiple blades per voucher and all of them have a linear shape. Blade colour varies among specimens with some maintaining a burgundy and grey appearance that only lightens slightly towards the distal portions of the blade, while other specimens are a deep red in basal portions with distal regions pink with yellow patches, 97 which do not necessarily correspond to reproductive cells. Reproductive cells found near the margin are referred to as phyllospores because they are of unknown origin and fate (sensu Nelson et al. 1999). No other type of reproductive cell was observed. No reproductive cells were found on collection GWS001282. Dispersed among vegetative cells are cells bearing structures resembling trichogynes (Fig. 3.6c). However, further study of this species is needed to determine the identity of the phyllospores and evaluate whether sexual reproduction occurs in this species, especially given that male gametangia were not observed. General conclusions This study represents the most extensive molecular dataset published for Canadian marine Porphyra and Bangia species to date. As well, we provide a comparison of three markers for their effectiveness at assigning specimens to genetic species groups. These data provide a strong framework from which trends in biogeography of Porphyra and Bangia can be analyzed by alleviating the need for future morphological identifications that are often difficult and/or unreliable. Analyses presented here provide a phylogenetic context for species that are new or have not yet been included in previous phylogenetic assessments of the Bangiaceae. At nodes closer to the terminal branches, relationships among species were fairly well supported and are in general agreement with comparable published phylogenies (e.g., Lindstrom & Fredericq 2003, Lindstrom 2008). Acknowledgements We gratefully acknowledge the assistance of the collectors listed in Appendix 3 for their contributions in the field, and Andrew Blakney for technical assistance in the 98 laboratory. We are grateful to the Bamfield Marine Sciences Centre for hosting a large component of the field-work for this study. We thank Dr. Norm Sloan for encouraging us to study the seaweeds of Haida Gwaii, as well as Parks Canada and the Haida Nation, especially staff of the Gwaii Haanas National Park Reserve and Haida Heritage Site, for extensive support of our field studies in this unique region. Particular appreciation is extended to Clint Johnson and Dan Bartol—our guides while in Gwaii Haanas. This research was supported through funding to the Canadian Barcode of Life Network from Genome Canada (through the Ontario Genomics Institute), the Natural Sciences and Engineering Research Council of Canada and other sponsors listed at www.bolnet.ca. References Abbott, I. A. & Hollenberg, G. J. 1976. Marine Algae of California. Stanford University Press, Stanford, 844 pp. Anisimova, M. & Gascuel, O. 2006. Approximate likelihood-ratio test for branches: A fast, accurate, and powerful alternative. Syst. Biol. 55:539-52. Apollonio, S. 1979. The Gulf of Maine. Courier-Gazette, Rockland, Maine, 60 pp. Bray, T. L., Neefiis, C. D. & Mathieson, A. C. 2006. Morphological and molecular variability of Porphyra purpurea (Roth) C. Agardh (Rhodophyta, Bangiales) from the Northwest Atlantic. Nova Hedwigia 82:1-22. Bray, T. L., Neefus, C. D. & Mathieson, A. C. 2007. A morphological and molecular investigation of the Porphyra purpurea (Bangiales, Rhodophyta) complex in the Northwest Atlantic. Nova Hedwigia 84:277-98. Brinkmann, H., Van der Giezen, M., Zhou, Y., De Raucourt, G. T. & Philippe, H. 2005. An empirical assessment of long-branch attraction artefacts in deep eukaryotic phylogenomics. Syst. Biol. 54:743-57. Brodie, J., Bartsch, I., Neefus, C., Orfanidis, S., Bray, T. & Mathieson, A. C. 2007. New insights into the cryptic diversity of the North Atlantic-Mediterranean 'Porphyra leucostictd complex: P. olivii sp nov and P. rosengurttii (Bangiales, Rhodophyta). Eur. J. Phycol. 42:3-28. Brodie, J., Hayes, P. K., Barker, G. L. & Irvine, L. M. 1996. Molecular and morphological characters distinguishing two Porphyra species (Rhodophyta: Bangiophycidae). Eur. J. Phycol. 31:303-08. Brodie, J., Hayes, P. K., Barker, G. L., Irvine, L. M. & Bartsch, I. 1998. A reappraisal of Porphyra and Bangia (Bangiophycidae, Rhodophyta) in the northeast Atlantic based on the rbcL-rbcS intergenic spacer. J. Phycol. 34:1069-74. Brodie, J. & Irvine, L. 2003. Seaweeds of the British Isles, Volume 1. Rhodophyta, Part SB. Bangiophycidae. Natural History Museum, London, 167 pp. 100 Brodie, J., Mortensen, A., Ramirez, M. E., Russell, S. & Rinkel, B. 2008. Making the links: towards a global taxonomy for the red algal genus Porphyra (Bangiales, Rhodophyta). J. Appl. Phycol. 20:939-49. Broom, J. E., Jones, W. A., Hill, D. F., Knight, G. A. & Nelson, W. A. 1999. Species recognition in New Zealand Porphyra using 18S rDNA sequencing. J. Appl. Phycol. 11:421-28. Broom, J. E., Nelson, W. A., Yarish, C., Jones, W. A., Rosas, R. A. & Rosas, L. E. A. 2002. A reassessment of the taxonomic status of Porphyra suborbiculata, Porphyra carolinensis and Porphyra lilliputiana (Bangiales, Rhodophyta) based on molecular and morphological data. Eur. J. Phycol. 37:227-35. Broom, J. E. S., Farr, T. J. & Nelson, W. A. 2004. Phylogeny of the Bangia flora of New Zealand suggests a southern origin for Porphyra and Bangia (Bangiales, Rhodophyta). Mol. Phylogenet. Evol. 31:1197-207. Chase, M. W. & Fay, M. F. 2009. Barcoding of Plants and Fungi. Science 325:682-83. Clarkston, B. E. & Saunders, G. W. 2010. A comparison of two DNA barcode markers for species discrimination in the red algal family Kallymeniaceae (Gigartinales, Florideophyceae), with a description of Euthora timburtoni sp. nov. Botany. 88:119-31. 101 Cole, K. M., Hymes, B. J. & Sheath, R. G. 1983. Karyotypes and reproductive seasonality of the genus Bangia (Rhodophyta) in British Columbia, Canada. J. Phycol. 19:136-45. Conway, E. & Cole, K. 1977. Studies in the Bangiaceae: structure and reproduction of the conchocelis of Porphyra and Bangia in culture (Bangiales, Rhodophyceae). Phycologia 16:205-16. Conway, E., Mumford, T. F. & Scagel, R. F. 1975. The genus Porphyra in British Columbia and Washington. Syesis 8:185-244. Curtis, B. A. 1997. A morphological and phylogenetic investigation of Porphyra linearis Greville and Porphyra purpurea (Rth) C. Agardh forms from Nova Scotia. MSc, Acadia University, 176 pp. Drew, K. M. 1949. Conchocelis-phase in the life history of Porphyra umbilicalis (L) Kutz. Nature 164:748-49. Drew, K. M. & Richards, K. S. 1953. Studies in the Bangioideae. II. The Concochelis- phase of Porphyra sp. in Pollicipes cornucopia Leach at Roscoff. J. Linn. Soc. Lond. Bot. 55:84-87. Dutcher, J. A. & Kapraun, D. F. 1994. Random amplified polymorphic DNA (RAPD) identification of genetic variation in 3 species of Porphyra (Bangalies, Rhodophyta). J. Appl. Phycol. 6:267-73. 102 FAO 2003. Review of the state of world aquaculture. FAO Fisheries Circular. Food and Agriculture Organization of the United Nations, Rome. Farr, T. J., Nelson, W. A. & Broom, J. E. S. 2003. A challenge to the taxonomy of Porphyra in Australia: the New Zealand red alga Porphyra rakiura (Bangiales, Rhodophyta) occurs in southern Australia, and is distinct from P. lucasii. Aust. Syst. Bot. 16:569-75. Felsenstein, J. 1978. Cases in which parsimony or compatability methods will be positively misleading. Syst. Zool. 27:401-10. Freshwater, D. W., Fredericq, S., Butler, B. S., Hommersand, M. H. & Chase, M. W. 1994. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL. Proc. Natl. Acad. Sci. U. S. A. 91:7281-85. Freshwater, D. W. & Rueness, J. 1994. Phylogenetic relationships of some European Gelidium (Gelidiales, Rhodophyta) species, based on rbcL nucleotide sequence analysis. Phycologia 33:187-94. Frezal, L. & Leblois, R. 2008. Four years of DNA barcoding: Current advances and prospects. Infection, Genetics and Evolution 8:727-36. Gabrielson, P. W., Widdowson, T. B. & Lindstrom, S. C. 2006. Keys to the Seaweeds and Seagrasses of Southeast Alaska, British Columbia, Washington and Oregon. University of British Columbia, Vancouver, 209 pp. 103 Graham, L. E. & Wilcox, L. W. 2000. Algae. Prentice-Hall, Inc., Upper Saddle River, NJ, 640 pp. Greville, R. K. 1830. Algae britannicae, or descriptions of the marine and other inarticulated plants of the British islands, belonging to the order Algae; with plates and illustrative of the genera. McLachland and Stewart; Baldwin and Cradock, Edinburgh and London, 218 pp. Guindon, S. & Gascuel, O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol 52:696-704. Guiry, M. D. & Guiry, G. M. 2009. Algaebase. http://www.algaebase.org Accessed: September 13, 2009 Hanyuda, T., Suzawa, Y., Arai, S., Ueda, K. & Kumano, S. 2004. Phylogeny and taxonomy of freshwater Bangia (Bangiales, Rhodophyta) in Japan. J. Jpn. Bot. 79:262-68. Harris, J. D. 2003. Can you bank on GenBank? Trends Ecol. Evol. 18:317-19. Hawkes, M. W. 1981. Porphyra nereocystis and Porphyra thuretii (Rhodophyta) - gametophyte morphology, distribution, and occurrence. Syesis 14:97-108. Hebert, P. D. N., Cywinska, A., Ball, S. L. & DeWaard, J. R. 2003a. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B Biol. 270:313-21. 104 Hebert, P. D. N., Ratnasingham, S. & deWaard, J. R. 2003b. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Lond. B Biol. 270:S96-S99. Hehre, E. J. & Mathieson, A. C. 1993. Porphyra amplissima (Kjellman) Setchell et Hus - New records of an arctic seaweed in southern Maine, New Hampshire, and northern Massachusetts. Rhodora 95:184-87. Hollenberg, G. J. 1972. Phycological notes. VII. Concerning three Pacific coast species, especially Porphyra miniata (C.Ag.) C.Ag. (Rhodophyceae, Bangiales). Phycologia 11:43-46. Hollingsworth, P. M., Forrest, L. L., Spouge, J. L., Hajibabaei, M., Ratnasingham, S., van der Bank, M., Chase, M. W., Cowan, R. S., Erickson, D. L., Fazekas, A. J., Graham, S. W., James, K. E., Kim, K. J., Kress, W. J., Schneider, H., van AlphenStahl, J., Barrett, S. C. H., van den Berg, C., Bogarin, D., Burgess, K. S., Cameron, K. M., Carine, M., Chacon, J., Clark, A., Clarkson, J. J., Conrad, F., Devey, D. S., Ford, C. S., Hedderson, T. A. J., Hollingsworth, M. L., Husband, B. C., Kelly, L. J., Kesanakurti, P. R., Kim, J. S., Kim, Y. D., Lahaye, R., Lee, H. L., Long, D. G., Madrinan, S., Maurin, O., Meusnier, I., Newmaster, S. G., Park, C. W., Percy, D. M., Petersen, G., Richardson, J. E., Salazar, G. A., Savolainen, V., Seberg, O., Wilkinson, M. J., Yi, D. K., Little, D. P. & Grp, C. P. W. 2009. A DNA barcode for land plants. Proc. Natl. Acad. Sci. U. S. A. 106:12794-97. Hommersand, M. H., Fredericq, S. & Freshwater, D. W. 1994. Phylogenetic systematics and biogeography of the Gigartinaceae (Gigartinales, Rhodophyta) based on sequence analysis of rbcL. Bot. Mar. 37:193-203. Hu, Z. M., He, Y. J., Xia, P. & Duan, D. L. 2007. Molecular identification of Chinese cultivated Porphyra (Bangiaceae, Rhodophyta) based on the rDNA internal transcribed spacer-1 sequence and random amplified polymorphic DNA markers. Mar. Biol. Res. 3:20-28. Hus, H. T. A. 1902. An account of the species of Porphyra found on the Pacific coast of North America. Proceedings of the California Academy of Sciences (Series 3: Botany) 2:173-241. Jia, J. H„ Wang, P., Jin, D. M., Qu, X. P., Wang, Q., Li, C. Y„ Weng, M. L. & Wang, B. 2000. The application of RAPD markers in diversity detection and variety identification of Porphyra. Acta Bot. Sin. 42:403-07. Jones, W. A., Griffin, N. J., Jones, D. T., Nelson, W. A., Farr, T. J. & Broom, J. E. 2004. Phylogenetic diversity in South African Porphyra (Bangiales, Rhodophyta) determined by nuclear SSU sequence analyses. Eur. J. Phycol. 39:197-211. Klein, A. S., Mathieson, A. C., Neefus, C. D., Cain, D. F., Taylor, H. A., Teasdale, B. W„ West, A. L„ Hehre, E. J., Brodie, J., Yarish, C. & Wallace, A. L. 2003. Identification of north-western Atlantic Porphyra (Bangiaceae, Bangiales) based on sequence variation in nuclear SSU and plastid rbcL genes. Phycologia 42:109- 22. 106 Knight, G. A. & Nelson, W. A. 1999. An evaluation of characters obtained from life history studies for distinguishing New Zealand Porphyra species. J. Appl. Phycol. 11:411-19. Kong, F., Mao, Y., Yang, H., Qu, H., Yan, X. & Wang, L. 2009. Genetic analysis of Porphyra yezoensis using microsatellite markers. Plant Mol. Biol. Report. : 1-7. Krishnamurthy, V. 1972. A revision of the species of the algal genus Porphyra occurring on the Pacific coast of North America. Pac. Sci. 26:24-49. Kucera, H. & Saunders, G. W. 2008. Assigning morphological variants of Fucus (Fucales, Phaeophyceae) in Canadian waters to recognized species using DNA barcoding. Botany 86:1065-79. Kunimoto, M., Kito, H., Mizukami, Y., Murase, N. & Levine, I. 2003. Molecular features of a defined genetic marker for the determination of the Porphyra tenera lineage. J. Appl. Phycol. 15:337-43. Lane, C. E., Lindstrom, S. C. & Saunders, G. W. 2007. A molecular assessment of northeast Pacific Alaria species (Laminariales, Phaeophyceae) with reference to the utility of DNA barcoding. Mol. Phylogenet. Evol. 44:634-48. Le Gall, L. & Saunders, G. W. 2010. DNA barcoding is a powerful tool to uncover algal diversity: A case study of the Phyllophoraceae (Gigartinales, Rhodophyta) in the Canadian flora. J. Phycol. 46:374-89. 107 Lindstrom, S. C. 2008. Cryptic diversity, biogeography and genetic variation in Northeast Pacific species of Porphyra sensu lato (Bangiales, Rhodophyta). J. Appl. Phycol. 20:951-62. Lindstrom, S. C. & Cole, K. M. 1992. Relationships between some North Atlantic and North Pacific species of Porphyra (Bangiales, Rhodophyta) - evidence from isozymes, morphology, and chromosomes. Canadian Journal of Botany-Revue Canadienne De Botanique 70:1355-63. Lindstrom, S. C. & Cole, K. M. 1993. The systematics of Porphyra: character evolution in closely related species. Hydrobiologia 261:151-57. Lindstrom, S. C. & Fredericq, S. 2003. rbcL gene sequences reveal relationships among north-east Pacific species of Porphyra (Bangiales, Rhodophyta) and a new species, P. aestivalis. Phycol. Res. 51:211-24. Lynch, M. D., Muller, K. M. & Sheath, R. G. 2006. ISSR-estimated intraspecific genetic variation and phylogenetic position of a population of the red alga Bangia maxima. J. Phycol. 42:15. Maddison, W. D. & Maddison, D. R. 2005. MacClade v4.08. Sinauer Associates, Sunderland, Massachusetts. Mathieson, A. C., Pederson, J. R., Neefus, C. D., Dawes, C. J. & Bray, T. L. 2008. Multiple assessments of introduced seaweeds in the Northwest Atlantic. ICES J. Mar. Sci. 65:730-41. McDevit, D. C. & Saunders, G. W. 2009. On the utility of DNA barcoding for species differentiation among brown macroalgae (Phaeophyceae) including a novel extraction protocol. Phycol. Res. 57:131-41. Meier, R., Zhang, G. & Ali, F. 2008. The use of mean instead of smallest interspecific distances exaggerates the size of the "Barcoding Gap" and leads to misidentification. Syst. Biol. 57:809 - 13. Merrill, J. E. 1993. Development of nori markets in the western world. J. Appl. Phycol. 5:149-54. Messing, J. 1983. New M13 vectors for cloning. Methods Enzymol. 101:20-78. Meyer, C. P. & Paulay, G. 2005. DNA barcoding: Error rates based on comprehensive sampling. PLoSBiol. 3:2229-38. Milstein, D. & de Oliveira, M. C. 2005. Molecular phylogeny ofBangiales (Rhodophyta) based on small subunit rDNA sequencing: emphasis on Brazilian Porphyra species. Phycologia 44:212-21. Milstein, D., Oliveira, M. C., Martins, F. M. & Matioli, S. R. 2008. Group I introns and associated homing endonuclease genes reveals a clinal structure for Porphyra spiralis var. amplifolia (Bangiales, Rhodophyta) along the Eastern coast of South America. BMCEvol. Biol. 8:308. Mortensen, A. M., Neefiis, C. D. & Brodie, J. 2009. Cryptic diversity in Porphyra linearis (Bangiales, Rhodophyta) Phycologia 48:249. Muller, K. M., Cannone, J. J. & Sheath, R. G. 2005. A molecular phylogenetic analysis of the Bangiales (Rhodophyta) and description of a new genus and species, Pseudobangia kaycoleia. Phycologia 44:146-55. Muller, K. M., Cole, K. M. & Sheath, R. G. 2003. Systematics of Bangia (Bangiales, Rhodophyta) in North America. II. Biogeographical trends in karyology: chromosome numbers and linkage with gene sequence phylogenetic trees. Phycologia 42:209-19. Muller, K. M., Oliveira, M. C., Sheath, R. G. & Bhattacharya, D. 2001. Ribosomal DNA phylogeny of the Bangiophycidae (Rhodophyta) and the origin of secondary plastids. Am. J. Bot. 88:1390-400. MUller, K. M., Sheath, R. G., Vis, M. L., Crease, T. J. & Cole, K. M. 1998. Biogeography and systematics of Bangia (Bangiales, Rhodophyta) based on the rubisco spacer, rbcL gene and 18S rRNA gene sequences and morphometric analyses. 1. North America. Phycologia 37:195-207. Neefus, C„ Mathieson, A. C„ Klein, A. S„ Teasdale, B., Bray, T. & Yarish, C. 2002. Porphyra birdiae sp. nov. (Bangiales, Rhodophyta): A new species from the northwest Atlantic. Algae 17:203-16. Neefus, C. D., Mathieson, A. C., Bray, T. L. & Yarish, C. 2008. The distribution, morphology, and ecology of three introduced Asiatic species of Porphyra (Bangialies, Rhodophyta) in the northwestern Atlantic. J. Phycol. 44:1399-414. 110 Nelson, W. A., Brodie, J. & Guiry, M. D. 1999. Terminology used to describe reproduction and life history stages in the genus Porphyra (Bangiales, Rhodophyta). J. Appl. Phycol. 11:407-10. Nelson, W. A., Broom, J. E. & Farr, T. J. 2001. Four new species of Porphyra (Bangiales, Rhodophyta) from the New Zealand region described using traditional characters and 18S rDNA sequence data. Cryptogam. Algol. 22:263-84. Niwa, K., Kato, A., Kobiyama, A., Kawai, H. & Aruga, Y. 2008. Comparative study of wild and cultivated Porphyra yezoensis (Bangiales, Rhodophyta) based on molecular and morphological data. J. Appl Phycol. 20:261-70. Niwa, K., Kikuchi, N. & Aruga, Y. 2005. Morphological and molecular analysis of the endangered species Porphyra tenera (Bangiales, Rhodophyta). J. Phycol. 41:294- 304. Niwa, K., Kikuchi, N., Iwabuchi, M. & Aruga, Y. 2004. Morphological and AFLP variation of Porphyra yezoensis Ueda form, narawaensis Miura (Bangiales, Rhodophyta). Phycol. Res. 52:180-90. Occhipinti-Ambrogi, A. & Sheppard, C. 2007. Marine bioinvasions: A collection of reviews. Mar. Pollut. Bull. 55:299-301. Oliveira, M. C., Kurniawan, J., Bird, C. J., Rice, E. L., Murphy, C. A., Singh, R. K., Gutell, R. R. & Ragan, M. A. 1995. A preliminary investigation of the order Ill Bangiales (Bangiophycidae, Rhodophyta) based on sequences of nuclear small- subunit ribosomal RNA genes. Phycol. Res. 43:71-79. Posada, D. 2008. jModelTest: Phylogenetic model averaging. Mol. Biol. Evol. 25:1253- 56. Presting, G. G. 2006. Identification of conserved regions in the plastid genome: implications for DNA barcoding and biological function. Canadian Journal of Botany-Revue Canadienne De Botanique 84:1434-43. Qiao, L. X., Liu, H. Y., Guo, B. T., Weng, M. L., Dai, J. X., Duan, D. L. & Wang, B. 2007. Molecular identification of 16 Porphyra lines using sequence-related amplified polymorphism markers. Aquat. Bot. 87:203-08. Ratnasingham, S. & Hebert, P. D. N. 2007. BOLD: The Barcode of Life Data System (www.barcodinglife.org). Mol. Ecol. Notes 7:355-64. Reith, M. & Munholland, J. 1993, The ribosomal-RNA repeats are non-identical and directly oriented in the chloroplast genome of the red alga Porphyra purpurea. Curr. Genet. 24:443-50. Robba, L., Russell, S. J., Barker, G. L. & Brodie, J. 2006. Assessing the use of the mitochondrial coxl marker for use in DNA barcoding of red algae (Rhodophyta). Am. J. Bot. 93:1101-08. Rodriguez, F., Oliver, J. L., Marin, A. & Medina, J. R. 1990. The general stochastic model of nucletide substitution. J. Theor. Biol. 142:485-501. 112 Saunders, G. W. 1993. Gel purification of red algal genomic DNA - an inexpensive and rapid method for the isolation of polymerase chain reaction-friendly DNA. J. Phycol. 29:251-54. Saunders, G. W. 2005. Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Philos. Trans. R. Soc. Lond. B Biol. Sci. 360:1879-88. Saunders, G. W. 2008. A DNA barcode examination of the red algal family Dumontiaceae in Canadian waters reveals substantial cryptic species diversity. 1. The foliose Dilsea-Neodilsea complex and Weeksia. Botany 86:773-89. Saunders, G. W. 2009. Routine DNA barcoding of Canadian Gracilariales (Rhodophyta) reveals the invasive species Gracilaria vermiculophylla in British Columbia. Molecular Ecology Resources 9:140-50. Sears, J. R. 2002. NEAS Keys to the Benthic Marine Algae of the Northeastern Coast of North America from Long Island Sound to the Strait of Belle Isle. University of Massachusetts, Dartmouth, 161 pp. Sheath, R. G. & Cole, K. M. 1984. Systematics of Bangia (Rhodophyta) in North America 1. Biogeographic trends in morphology. Phycologia 23:383-96. Sherwood, A. R. & Presting, G. G. 2007. Universal primers amplify a 23S rDNA plastid marker in eukaryotic algae and cyanobacteria. J. Phycol 43:605-08. Sherwood, A. R., Vis, M. L., Entwisle, T. J., Necchi, O. & Presting, G. G. 2008. Contrasting intra versus interspecies DNA sequence variation for representatives of the Batrachospermales (Rhodophyta): Insights from a DNA barcoding approach. Phycol. Res. 56:269-79. Stiller, J. W. & Waaland, J. R. 1993. Molecular analysis reveals cryptic diversity in Porphyra (Rhodophyta). J. Phycol. 29:506-17. Stiller, J. W. & Waaland, J. R. 1996. Porphyra rediviva sp nov (Rhodophyta): A new species from northeast Pacific salt marshes. J. Phycol. 32:323-32. Sun, J. W„ Jin, D. M„ Zhou, C. J., Yang, Q. K„ Weng, M. L„ Duan, D. L„ Xu, P., Ma, J. H. & Wang, B. 2005. Identification of Porphyra lines (Rhodophyta) by AFLP DNA fingerprinting and molecular markers. Plant Mol. Biol. Report. 23:251-62. Suto, S. 1972. Variation in species characters of Porphyra under culture conditions. In: Abbott, I. A. & Kurogi, M. [Eds.] Contributions to the systematis of benthic algae of the North Pacific. Japanese Society of Phycology, Kobe, pp. 193-201. Swofford, D. L. 2002. PAUP* v4.0bl0. Sinauer Associates, Sunderland, Massachusetts. Teasdale, B., West, A., Taylor, H. & Klein, A. 2002. A simple restriction fragment length polymorphism (RFLP) assay to discriminate common Porphyra (Bangiophyceae, Rhodophyta) taxa from the Northwest Atlantic. J. Appl. Phycol. 14:293-98. Teasdale, B. W., West, A., Klein, A. S. & Mathieson, A. C. 2009. Distribution and evolution of variable group-I introns in the small ribosomal subunit of North Atlantic Porphyra (Bangiales, Rhodophyta). Eur. J. Phycol. 44:171-82. Turner, N. J. 2003. The ethnobotany of edible seaweed {Porphyra abbottae and related species; Rhodophyta : Bangiales) and its use by First Nations on the Pacific Coast of Canada. Canadian Journal of Botany-Revue Canadienne De Botanique 81:283- 93. Varela-Alvarez, E., Stengel, D. B. & Guiry, M. D. 2007. Seasonal growth and phenotypic variation in Porphyra linearis (Rhodophyta) populations on the west coast of Ireland. J. Phycol. 43:90-100. Vilgalys, R. 2003. Taxonomic misidentification in public DNA databases. New Phytol. 160:4-5. Vis, M. L. & Sheath, R. G. 1999. A molecular investigation of the systematic relationships of Sirodotia species (Batrachospermales, Rhodophyta) in North America. Phycologia 38:261-66. Walker, R. H., Brodie, J., Russell, S., Irvine, L. M. & Orfanidis, S. 2009. Biodiversity of coralline algae in the northeastern Atlantic including Corallina caespitosa sp. nov. (Corallinoideae, Rhodophyta). J. Phycol. 45:287-97. Wang, J. F., Xu, P., Zhu, J. Y„ Zhou, W„ Xu, J. R., Fei, X. G. & Zhang, X. C. 2008. The characterization of color mutations in Bangiaceae (Bangiales, Rhodophyta). J. Appl. Phycol. 20:499-504. Weng, M. L., Liu, B., Jin, D. M., Yang, Q. K., Zhao, G., Ma, J. H., Xu, P., Duan, D. L. & Wang, B. 2005. Identification of 27 Porphyra lines (Rhodophyta) by DNA fingerprinting and molecular markers. J. Appl. Phycol. 17:91-97. West, A. L., Mathieson, A. C., Klein, A. S., Neefus, C. D. & Bray, T. L. 2005. Molecular ecological studies of New England species of Porphyra (Rhodophyta, Bangiales). Nova Hedwigia 80:1-24. Yang, R., Liu, B. Q., Luo, Q. J., Wang, Y. J. & Bao, J. M. 2003. Genetic variation of Porphyrayezoensis by using AFLP1. Acta Oceanologica Sinica 22:453-57. Zuo, Z. H„ Wang, C. G., Cao, X. H., Su, Y„ Liao, L. J. & Chen, Y. X. 2007. Isolation and characterization of microsatellite loci from a commercial cultivar of Porphyra haitanensis. Mol. Ecol. Notes 7:522-24. 116 Bangia sp. 2BAN (n=14) i— Porphyra abbottiae (n=9) ' Porphyra sp. 1P0R (n=3) — Porphyra smithii (n=5) — Porphyra linearis (n=5) — Porphyra kurogii (n=2) — Porphyra fallax (n=12) — Porphyra nereocystis (n=7) Porphyra gardneri (n=15) Porphyra cf. thuretii (n=2) Porphyra perforata (n=61) Porphyra sp. 6P0R (n=1) Porphyra fucicola (n=11) Porphyra leucosticta (n=28) Porphyra sp. coilinsii (n=4) — Porphyra sp. stamfordensis (n=1) Porphyra sp. 5P0R (n=5) Porphyra amplissima (n=65; including P. Cuneiform's) — Porphyra miniata (n=39) Porphyra occidentalis (n=9) Porphyra birdiae (n=11) Bangia fuscopurpurea (n=1) Bangia sp. 1 BAN (n=2) — Porphyra coiumbina (n=1) Porphyra mumfordii (n=12) Porphyra umbilicalis (n=42) Porphyra purpurea (n=42) Porphyra corallicoia (n=1) 0.05 substitutions/site Figure 3.1: Neighbor-joining phylogram for the COl-SP alignment. Rooted based on the rbcL phylogenetic results (Fig. 3.4). Number of collections per species group indicated by "n=" 117 118 0*9013032 flWpfrwHlnMil A QWS0067J7QWS004880 Porphyn ihhn«H•Willi AF4145S3 Porphyn carotnarmia QW8013108 Porphyn rtifciifi •T'• nru QWS013127 Porphyn *if I—I 0043732SAP021Q94 Porphyn Porphyn lah^faoota amptaalma OVMOOC348 torphyrnatbomm 0*9013966 Porphyn Miylaaim EU223019 Porphyn Unfcnwn #1 GW90AS4X porphyn amp+arma owaooms Porphynm ipor Porphjn* QW8008448 Porphyn wp 1POB AF4S242S Porphyn cunaformiK AF4S2446 Porphyn torta QW30QM00 wyiai|iaiiM J EU223224 AvpApaamMf GW80106W Anp#»e» a»igie*ne 11 QW8008908QWS013117 Porphynamtht QW9013954 fforpM§*miiati»a AF4SHM Porphyn bnmmKa — AF18M71AF492443 Porphyncf. ptocmrmaaia a&bophyta r AF188ff73 AypfcpaAwartK ' 6W900B87BA»pf9ni*»ar* EU20180 Porphyn Urtmown5POR #5 GW90Q2515 Porphyn armaria GW8OOSMOQW8008679 ffwprtjctPorphyn ap. 5POR GW9OO0786 Porphyn Ihmrit GW900M83 AarpTora ap. 9POR LLQ097 Porphyn A GW8004427 AvpAyro ap. SPOR ^ AB388138*o»pAr»ap.P2 QW8010814 Porphyn ap. 5POR AF4S&9ZPorphynkuogl 6U22S188 Porphyn aMu^iym MiGW8008367OWSQ09733 Porphyn kttogSkirogt AY06M630 Porphyn iiiHaW _f AB2B797D Porphyn ap. DN002 SWS008108 mWfti AB287988 Porphyn ap. DNOOZ AF462447 Porphyn *mriagia J~ AF462441 QW8012571AF462436 Porphyn Porphyn oeddarmta nn^tiiaw> J1 EU223172 Ajqpftp* Unknown #2 | l OWPOQgBBO p»flpifiwn*ii EU223118 Porphyn oc&dm*a*a l—l (3W8001281 po/phyn paggteonmnaia QW8006372 Porphyn oouMwOii 3*8006877 floqrfpwipaqptowanafc 4QW8003427 Porphyn oeeUamaMa A011HHAB287982 Porphyn ap.8u8aap DN001 001 ^319400 Porphyn hMaa AF462427 flwpftywa oonwyaa AY18O0O8 /topAynt Mtibw AF462433 Porphyn lanoaoiata GWS007DB1OWS0037D1 Porphyn Porphyn bird^a t*dkm I*"AF4&428 Porphyn Mk <3H9t}\3Wb Porphyn aaato am QW90133S3 j-d1 ACAf462424 Porphym anWi •* » aQWS006175 Porphyn Mar —- EU223240 Porp^t Unknown #4 M1 AJC 45243B Porphpa paaudotanoaotata 1 AP188857 8aryl> fampipum IP EU223130 Porphyn Unknown #3 EU223151 Porphyn /mnkMvmmMi if AFD43378 0«V Figure 3.2: Neighbor-joining phylogram for the full rbcL alignment. 119 QWS000624 Porphyra ooddantaMa GWS002797 Porphyra partonta L1j GWS003427 Porphyra ocddmrtata &N90aa6\2Potr*ryraporkx*ta QWS003B7S Porphyra oodder**e QWQ003B»< Porphyra partoraia GWS003379 Porphyra ixvUmwm QW00039Q6 ftypftyra QW90Qg372 ftypfrra ocddermm QWS004490 Porphyra perioral GW90065M porphyra oaddertate GW9OCM093 Porphyra perforata QWS0065W Porphyra oecidaraata QtmoOSKT Porphyra perforata Gwsooeesa Porphyra nrktmlm* A QWS006303 Porphyra periorata GW9006N3 Porphyra ooddentata Qttsooeao* Porphyra parkjiam QW9QOCQQ3 Porphyra ocddertm QW8006464 Porphyra perforata GWSO1O106 ftiqpftyri oonaitnttii (3W9006492 Porphyra perforata QW9010206 A^iiyieocetiw** QWS006S7S Porphyra perforata QW9003830 Porphyra rrwmtt GW800g7X Porphyra perforata QWS003>31 8W9OO00O6 Porphyra perforata GWS006108 Porphyra mMaCa GW90081M Porphyra perforata OWSOOaOOO Porphyra mhim GW9006271 Porphyra partorata QWS008677 Porphyra mknatti GW800S273 Porphyra perforata awaooew Feiphym «**!• QW90Q8630 Ptapftyra perforata GWS007716 flwpftjw M QW800Q701 Porphyra perforata QW80Q7717 Porphyra minim* &N9009704 Porphyra perforata QWS000766 Porphyra miniatt Qimuuvm Porphyra perforata QWS009e04 porphyra mttiata QW8OO07O0 Porphyra perforam GWS0Q6649 ftvpftyraap. 5POR OWSO(»712 Porphyra perforata GW8006B79 ftwp^raap. 5POR QNtSOQ&W Porphyra porlaata GWSOOQ983ftyptyf*ap 5POR omtmru Porphyra perforata QWS010614 POrprtyraap. 5POR GW800Q715 Porphyra perforata QW80037D4 porphyra amptaatna GW9Q0B7W Porphyra pmlmata GWS003727 Porphyra ampiaakna QW900ff7H Porphyra perforata QW800422D Porphyra ampitalrm (3W8OO0736 Porphyra perforata 01*90057* Porphyra amplaeima QW8008736 Porphyra perforata <3WS006\BS Porphyra arr**aeana OWSOOP737 Porphyra perforata GWSQ06371 ftvptyra affytfaafrnt <3*9010396 Porphyra perforata GWS00M04 affjpiaatna QW8012668 Porphyra perforata QWS00600 Porphyra aiiyfaa*»a GW80133S6 Porphyra perforata GW9010912 Aarpft>ra ampMaatm Porphyra perforata QWS009706 f ' GW900003S ftrahvraap.GWS013644 QWS006341 Ben^aap. GWSQ08703 Porphyra amptaaima GW800S445 Porphyra ap. 1POR QW901&3S Porphyra ampieeima QWS006446 ap. 1POR GW801341* Porphyra amptaatna QWS006737 Porphyra atbomaa OWSQ133SS Porphyra a/Hma*na QtHSOOta** Porphyra wp. 1POR GWS01Z7Q2 Porphyra ar\jp*aaime GW800W72 AvpAyni GWS000729 Porphyra amptaairm GWS013032 Porphyra tp. 1POR GW9008728 Porphyra amptaaima GW9013106 iMiudlw QW8006727 Porphyra amptamma QWS0131Z7^rp^«aMMttw OWSOOVn# Porphyra ampMaeima GW8006733 Porphyra kurogt QW8009700 Porphyra amptaaima 45 GW9010073 Porphyra d. thuretK (3W3000M Porphyra arrptaatma GWS010076 Porphyra cf. MmvIV GW&XXM& Porphyra amptaalme _j dwreooaaoe Awphy»s»nwiiif GWS008677 Porphyra amptaaima l-l ^ GWS003416 n0rpf9f»«nWii QWS006183QWSOC Porphyra anipteeima r| 1 GWS019Q23POrpAyri«nMf r-i®^GM&0Q23/H Porphyra bMaa || GW9010775 Porphyra amkht QWS003701 Porphyra birdiae I GWS013026 «n«VW J*QW9007-GW90077W Porphyra bird^a rf1 GW8013085 Porphyra am*Ni GW9002662 Bangk ap. 2BAN GWS013117 Porphyra rf GWGWSC014 Porphyra ooraUooia j- GW80040Z8 Porphyra gartheri 1W80077WGWS0077W Porphyra bk&aa P GW800811B Porphyra gartlnen ®N90QBSt&QWS002S* Porphyra bMaa QWSQ04430 Porphyra gardneri QWSQtofoo Porphyra purpurea QWS004936 Porphyra gardneri 1 QHNSOOGZTO Porphyra purpurea GWS00670B Porphyra gardneri J -!GW9OO0OO1 Porphyra purpura* GW8OO0S83 Porphyra gardneri f GMGWS0075S2 Porphyra putpuraa GWS010167 Porphyra gaidneri f GWS007906GWS ftrpftyia purpurea GWS012S94 ftwphyf jarnharf l_I1 AttnQW8OO0O3O(3WS0Q8010QWS PorphyraPorphyra purpureapupurea GWS01303e ^orpAyrspwiM — OW8OO3O0S Porphyra Mtfea GWS013004 Porphyra gardneri GWS0G368S ^^yafrrofaw GW8004653GWS004431 Sang* ap.ap. 1BAN1BAN (QWS007081 Porphyra birdiae GW8004656 Bangia ap. 1BAN I IOW8005807 Porphyratort* Porphyra i IGWSOO66O0 ftyptyraforta —GWS00e0Q2 Gwsooeoes pwpftymap. ap. COM ccrthaf GW9005831 ftvptofaforta |GWS006a60 Porphyra lauoc GWSOOM22 Porphyratorta [—GWS007B46 Porphyra 4 GWS006S32 Porphyra torta I GWSOO6003 Porphyra leuooeHcta GW90026S5 Porphyra umtMca* \QmOOBO&t Porphyra ieuooatieta <3H90080U Porphyra umtmca* I QW8007687 Porphyra taueoeUcta GWSOOaBSg Porphyra uinbttaKa • OWSOOOSOS teuooetcta OmOOSm Porphyra urnWc** F 0WSQ0Qa07 Porphyra leume*3a (3HSOOSK6 Porphyra utnbHcaMa i GW8000860 Porphyra fudooia Figure 3.3: Neighbor-joining phylogram for the UPA alignment. 120 121 a r GWS006346 Porphyn afttetttoa QWS006385 Porphyn *>. 1POR AF462445 Porphyn torta QWS013117 Porphyn amtM AF452426 Porphyn brumalta attSODZSISPotpryrmtomf* AB366136 Porphyn n> P2 Branch support values: aLRT/txx>tstrap GW9006367 AvpApa kungi AF452441 Porphyn /muWmm code values code value EU223172 Porphyn Urknonvn #2 GW8006677 • 0.998/100 K 0.979/78 AB267906 Porphyn*. DN002 AB2S7M2 Porphyn* DN001 b 0.99/99.6 ii 0.84/76.4 Jy AB452427 Porphyn oormayma AF4S2433 Puphyra lanoaolata c 0.941/100 kk 0.998/82.6 GWS013353 Porphyn feter d 0.845/83.2 I 0.996/100 BJ223138 Porphyn Unknown #3 EU223151 Porphyn paaudotancmolata • 0.937/94.8 mm 0.999/99.2 QW3QQ6156 Porphyra naroocyatm QWSO1O017 Axphyr* f 0.916/ nn 1/100 GW8010073 topAymd. MuvMV A8116566 Porphyn haianawaH g 0.937/99.8 oo 0.865/99.6 R0WG03 Porphyn ap. 6P0R AB387S26 AvpApa dlMM h 0.946/93^ PP 0.994/1 GW80067Q6 Porphyn portonm AB267973 Porphyn*. 0E001 i 0.5/57.4 qq 0331/61 AV794401 Porphyn hotantmyt w| GWS000651 Porphyn tuckota i 0.681 rr 0.976/99.8 H— QW8006604 AypApatejcoatfeta ' AB366136 Pwptyr* UvMm k 0.98/99.4 *s 0.969/85.6 AB386146 Porphyn*. P10 AB366143 /30fp/*r»ip. P7 I 0.96/91.2 u 0.787/ AB243206 Porphyn tonara AB116574 Porphyn yeoana* m 0.931/94.4 uu 0.846/54.6 AF2267S4 Porphyn ap. BTW2000C DQ613606 Porphyn ap. ncwMryiat n 0.597/58.6 w 0.924/93.8 ffT AlAF452442 Porphyn roaangurOU JHLP-- |DQ613630 Porphyn«p. cM 0 0.727/86.4 WW 0.727/ • GWS006093AtMC Aypfyra ap coffnaf QWS000030 Porphyn ap. atamfortianam P 0.901/80 XX 0.976/99.6 M f— DQ63OO»PbrpftpaftatKfc0 AB267651 Porphyn lanulpadata q 0.807/ yy 0.536/ «— DQ613635D Porphyn ap. tpMata GWS012S94 porphyn gardrmf r 0.7831 zz 0.998/100 AB287946 Porphyn auborticutata 0.7961 \r- QWS013354 Pbrphyr* aftg*aa*na s aaa 0.604/67.6 AF168671 Porphyra Ctptocamtaatm t 0.769/ bbb 0.66/59 nj GWS006646 POrptyratp 5POR *- EU223138 Porphyn achaophyU [39 u 0.975/56 ccc 1/100 oof1QWS006W Porphyn minata JE AF4S2447 Porphyn vwiagata " {_ V 0.776/82.6 ddd 0.975/74.2 QWSOOtSto Porphyn ooddantala rrr—' GWS007061 Porphyn tmdtoa w 0.975/99.4 eee 1/99.8 i QWS013193 Porphyn a—*ra*» • EU223240 Porphyn Unknown #4 X 0.776/82.6 «rr 0.827/ - GWS006962 flarf* «P 2BAN ' EU223010 Sanpti »p. SCl-2006-1 y 0.989/98.6 ggg 0.863/84.2 » AFD61291 Porphyn Figure 3.4: ML phytogeny of rbcL data. 122 123 Figure 3.5: Porphyra corallicola sp. nov. 124 125 Figure 3.6: Porphyra peggicovensis sp. nov. Table 3.1: A complete list of primers used in this study. Primer Sequence 5' - 3' Direction PCR or Reference Name Sequencing COI-5P GazFl TC AAC AA ATC AT AAAGATATTGG Forward PCR Saunders (2005) GazF2 CC A ACC A Y AAAGAT ATWGGTAC Forward PCR Saunders (2005) GHalF TC A AC AAATC ATAAAG ATATYGG Forward PCR Saunders (2008) GWSF" TCCC AGTC ACG ACGTCGTTC A AC AA A Y CAY AAAGAT ATY GG Forward PCR Saunders (2009) GWSF1" TCCC AGTC ACGACGTCGT AC AAA YC AY AAIGAT ATIGG Forward PCR This study GWSF2a TCCC AGTC ACG ACGTCGT AC A A ATC AY A AIG AT ATIGG Forward PCR This study GWSF5 AC AAA Y CAY AAIGAT ATY GG Forward PCR Saunders (2009) GWSFi C A A A Y CAY A ARG AT ATY GGI AC Forward PCR This study GWSFn TCAACAAAYCAYAAAGATATY GG Forward PCR Le Gall & Saunders, 2010 GWSFt C A A A Y CAY A ARG AT ATY GGT AC Forward PCR This study COX1L1 ACAAATCATAAAGATATTGG Forward PCR This study GazRl ACTTCTGG ATGTCC AAAA A A Y CA Reverse PCR Saunders (2005) GazR2 GGATGACCAAARAACCAAAA Reverse PCR Lane et al. (2007) COX 1R1 GT AT ACATATGATGHGCTCAA Reverse PCR Saunders (2008) GWSRa GG AAAC AGCT ATG ACC ATGGGRTGTCCRAARAA Y C ARA A Reverse PCR This study GWSR1a GGAAACAGCTATGACCATGGGRTGICCIAAIAAYCAIAA Reverse PCR This study GWSR2" GGAAACAGCTATGACCATGGGRTGICCIAAIAAYCARAA Reverse PCR This study GWSR3" GG A AAC AGCT ATG ACC ATGGGRTGTCC AAAIA A Y C ARAA Reverse PCR Saunders (2009) GWSR5 TC AGGRTGNCCIAARAA YC A Reverse PCR Saunders (2009) GWSRn GGRTGTCCRA ARAA Y C ARAA Reverse PCR This study GWSRi GGRTGICCR A AR A A Y C ARA A Reverse PCR This study rbch F57 GT A ATTCC AT ATGCT A A A ATGGG Forward PCR Freshwater & Rueness (1994) FF4Por GG A AG AT ATGTAY G AR AG AGC Forward Sequencing This study RflfPey TCTC ARCCTTTY ATGMGNTG Forward Sequencing This study Rrlf TCTCAGCCTTTTATGCGTTG Forward Sequencing This study rbcLrev ACATTTGCTGTTGGAGTCTC Reverse PCR Vis and Sheath (1999) rbcLrevNew ACATTTGCTGTTGGAGTYTC Reverse PCR This study RR4Por GCTCTYTCRTACATATCTTCC Reverse Sequencing This study RR4 TTC AGCTCTTTC ATAC AT Reverse Sequencing This study Rrlr GGTT AAC ACCTTCCATTG AAT Reverse Sequencing This study UPA p23SrV_fl GGACAGAAAGACCCTATGAA Forward PCR Sherwood and Presting (2007) p23SnewR TCAGCCTGTTATCCCTAGA Reverse PCR Clarkston & Saunders 2010 a Indicates Ml 3-linked primers for which the primers M13F (5' TCCCAGTCACGACGTCGT 3') and M13R (5' GGAAACAGCTATGACCATG 3') were employed for sequencing. Table 3.2: Summary of floristic results. Number of sequences Geographic Height in Seasonality of Species Range" Habitat" intertidalb Collections0 COI-5P rbcL UPA Bangia fuscopurpurea (n=l) RI Epilithic M October 1 1 0 Bangia sp. J BAN (n=4) BC Epilithic S,U May-July 2 3 2 Bangia sp. 2BAN (n=14) ME, Que, Epilithic L, M, U Feb .-June 14 2 2 NB,NL,NS Porphyra abbottiae (n=9) BC Epilithic, Epizoic S, L, M, U May-July 9 8 6 Porphyra aestivalis (n=l) BC Eplilithic U June 0 1 0 Porphyra amplissima BC, NB, Epiphytic, Epilithic, S,L,M,U March-Sept. 65 7 25 (n=75) NL, Que Epizoic Porphyra birdiae (n=l 1) m,NL,NS Epilithic S, L, M, U May-Nov. 11 2 8 Porphyra columbina (n=l) Chile Unrecorded L Nov. 1 0 1 Porphyra corallicola (n=l) NB Endophytic L Dec. 1 1 1 Porphyra fallax (n=13) BC Epiphytic, Epilithic, S,L,M,U May-July 12 2 4 Epizoic (Dec.) Porphyra fucicola (n=23) BC Epiphytic, Epilithic, L,M, U May-Aug. 11 3 20 Epizoic Porphyra gardneri (n=17) BC Epiphytic S, L May-Sept. 15 4 10 Porphyra kanakaensis (n=4) BC Epilithic U May-June 0 4 4 Porphyra kurogii (n=2) BC Epilithic, Epizoic M June, Dec. 2 2 2 Porphyra leucosticta (n=28) NB,NL, Epiphytic, Epilithic S, L, M, U (Jan.) April- 28 2 7 NS, ME, RI Sept. Porphyra linearis (n=5) NS, Que Epilithic L,M (May, Sept., 5 5 4 Nov., Dec.) K> 00 Porphyra miniata (n=41) ME, NB, Epiphytic, Epilithic S,L,M (Feb.) May- 39 1 10 NL, NS, Aug. Que Porphyra mumfordii (n=12) BC Epilithic M, U Dec. 12 2 5 Porphyra nereocystis (n=7) BC Epiphytic S, M, D May-June 7 2 5 Porphyra occidentalis BC Epiphytic, Epilithic, S, L, D May-June 9 4 12 (n=16) Epizoic Porphyra papenfussii (n=4) BC Epilithic L,D July 0 3 3 Porphyra peggicovensis NS Epilithic M Dec .-Jan. 0 3 3 (n=3) (Mar.) Porphyra perforata (n=81) BC Epiphytic, Epilithic, S,L,M, U May-Aug. 61 4 36 Epizoic (Dec.) Porphyra purpurea (n=42) ME,NB, Epilithic, Epiphytic, L, M, U (Feb., April) 42 2 7 NL, NS, Epizoic June-Aug. Que Porphyra smithii (n=7) BC Epiphytic L, M, U June 5 2 7 Porphyra sp. 1POR (n=3) BC Epilithic M, U May 3 2 2 Porphyra sp. 5POR (n=5) BC Epilithic U May-June 5 5 4 Porphyra sp. 6POR (n=l) TX Epilithic L Feb. 1 1 0 Porphyra sp. collinsii (n=4) RI Epiphytic S April 4 1 2 Porphyra sp. stamfordensis RI Epiphytic U April 1 1 1 V"—u/n— 1 \ Porphyra cf. thuretii (n=3) BC Epiphytic S May 3 2 3 Porphyra umbilicalis (n=42) ME,NB, Epilithic L, M,U Mar .-Nov. 42 3 13 NS,NL,RI Total: 411 85 209 a Italics indicate a new species or new record for that locality. Abbreviations for locations are: BC, British Columbia, Canada; Que, Quebec, Canada; ME, Maine, USA; NB, New Brunswick, Canada; NL, Newfoundland and Labrador, Canada; NS, Nova Scotia, Canada; RI, Rhode Island, USA; TX, Texas, USA. b Bold indicates in which location and habitat the majority of the samples were collected. Codes for intertidal height: S, subtidal; L, lower intertidal; M, mid- intertidal; U, upper intertidal. c When collections did not span a continuous time, the months outside of the continuous range are shown in brackets. 130 Chapter 4 A pilot-study evaluation of r£cL, UP A, LSU and ITS as DNA barcode markers for the marine green macroalgae 131 Abstract Marine green macroalgae are the last group of seaweeds for which a DNA barcode marker remains to be developed. The aim of this study was to evaluate the universality and species discriminatory power of the rubisco large subunit (rbcL) (considering the 5' and 3' fragments independently), the universal amplicon (UPA), the D2/D3 region of the large ribosomal subunit (LSU) and the internal transcribed spacer of the ribosomal cistron (ITS) for green macroalgae. Each marker was assessed for 99 samples representing a variety of seaweed species. Of the markers tested, the 3' region of the rbcL had the highest universality and genetic variation at the species level, and thus showed the most promise as a DNA barcode. Unfortunately, the presence of introns within the rbcL for some taxa reduces the utility of this marker as a universal barcode system and more research is required before a DNA barcoding marker can be recommended for the green macroalgae. Despite the drawbacks, our rbcL analyses revealed putative cryptic species in the genera Acrosiphonia, Monostroma, and Ulva in Canadian waters. Key words: Chlorophyta, DNA barcoding, green algae, LSU, rbcL, ITS, UPA. Introduction DNA barcoding, identifying organisms based on comparisons of short, standardized DNA sequences as agreed upon by the Consortium for the Barcode of Life (CBOL; http://barcoding.si.edu/), has been championed as a revolutionary system for the identification and discovery of all of the world's eukaryotic organisms (Hebert et al. 2003a, Hebert et al. 2003b). The benefits of such an endeavour are multifold. First, 132 developing a database of sequences against which unknown biological materials can be compared greatly increases the speed at which routine identification can be carried out. Across all taxa, DNA barcoding removes the reliance on morphological characters traditionally used to discriminate species. This is of particular importance for taxonomic groups that have few characters on which to base identification, and require highly skilled, expert taxonomists for even routine morphological identifications. Second, during diversity surveys, specimens may be flagged as potentially new species, alerting the taxonomist that further study is required, and ultimately leading to the discovery of new records and/or description or new species. The case of marine macroalgae is an excellent example of the value and strength of DNA barcoding; seaweeds are notoriously difficult to identify due to simple morphologies, phenotypic plasticity and convergent evolution (see Saunders 2005). DNA barcoding has proven a phenomenal tool that has aided in species identification, discovery of cryptic species, or new records for red (Rhodophyta) and brown (Phaeophyceae) seaweeds (Saunders 2005, Robba et al. 2006, Kucera & Saunders 2008, Saunders 2008, McDevit & Saunders 2009, Saunders 2009, Walker et al. 2009, Le Gall & Saunders 2010). Whereas DNA barcoding has been advanced for the red and brown seaweeds, the marine green macroalgae (most belong to one of the Bryopsidophyceae, Trebouxiophyceae or Ulvophyceae) are the final group of marine macroalgae for which a DNA barcode marker remains to be developed. There are several requirements when choosing an appropriate marker for DNA barcoding. First, the genetic variability of the marker must be adequate for species level resolution. To this end, species discrimination is considered successful when specimens from a single species cluster together in 133 distance analysis (Hebert et al. 2003a) and the largest intraspecific divergence is less than the smallest interspecific divergence—this difference termed the "barcoding gap" (Meier et al. 2008). Second, and of equal importance, the marker should be universally recoverable across taxa, meaning there is high PCR and sequencing success, ideally with a near-universal set of PCR primers. Given current technologies, it is also of benefit for the DNA barcode marker to be short enough to be sequenced in a single read (<700bp) (see Hollingsworth et al. 2009b). Markers in which intra-individual heterogeneity is common, or which can exhibit microsatellites or single nucleotide runs (particularly of thymine or adenine) are not preferred because these cause problems with direct sequencing of PCR product (Gribble & Anderson 2007). The ideal marker consists of a highly variable region, which provides for species discrimination, flanked by highly conserved regions from which primers can be designed. During the development of DNA barcoding, several markers have been proposed for different phyla. In animals, red and brown algae, the 5' end of the mitochondrial cytochrome c oxidase 1 gene (COI-5P) provides resolution at the species level among most groups tested, and has come to be accepted as the barcode marker and is now being applied to biodiversity and taxonomic studies across the globe (e.g. Hebert et al. 2004, Hebert & Gregory 2005, Saunders 2005, Hajibabaei et al. 2006, Frezal & Leblois 2008, Ferri et al. 2009, Janzen et al. 2009, McDevit & Saunders 2009). For the green macroalgae, COI-5P was our first marker of interest; however, preliminary investigations failed to generate successful amplification, despite extensive primer testing (Kucera and Saunders, unpublished data). Our failure in designing primers for the successful amplification of green algal COI-5P may be in part attributable to the lack of available 134 mitochondrial sequences; only two published ulvophyceaen mitochondrial genomes were available at the time of study (Pombert et al. 2004, Pombert et al. 2006). However, the presence of introns within the cytochrome c oxidase 1 of ulvophycean taxa (Watanabe et al. 1998, Pombert et al. 2004, Pombert et al. 2006) may be the largest obstacle to developing the COI-5P as a DNA barcode marker for marine green macroalgae. These difficulties make COI-5P an unsuitable marker for DNA barcoding in Ulvophyceae, leading us to ultimately abandon it as a potential marker. Similarly, difficulties in applying the COI-5P have been encountered in land plants and fungi. In fungi, the presence of introns (Seifert et al. 2007) and lack of species level resolution (Geiser et al. 2007) meant that the COI-5P could not be applied universally. The nuclear internal transcribed spacer region of the ribosomal cistron (ITS) had been used for fungal identification for at least a decade before the advent of DNA barcoding in 2003, and is now recommended as the marker for barcoding fungi (Nilsson et al. 2008, Chase & Fay 2009, Seifert 2009). Finding a marker that is both universal and which provides sufficient species discrimination was much more difficult in land plants. After four years of extensive debate, the Plant Working Group members of CBOL have settled on two plastid markers, the rubisco large subunit (rbcL) and maturase K (matK) genes, as the DNA barcodes for plants (Hollingsworth et al. 2009b). Other markers that had been evaluated in plants include the following, both singly and in various combinations: ITS, trnH-psbA, rpoB, rpoCl, accD, atpF-atpH, psbK-psbl, ndhJ, ycfS and others (Kress et al. 2005, Kress & Erickson 2007, Sass et al. 2007, Edwards et al. 2008, Fazekas et al. 2008, Lahaye et al. 2008, Newmaster et al. 2008, Ford et al. 2009, Starr et al. 2009). Since 2005, the debate over which marker (and eventually which combination 135 of markers) would be used for land plant barcoding has produced a wealth of data on a variety of markers and some interesting conclusions. Firstly, a trade-off between universality and species discrimination has affected the search for the plant barcode as there has been no single marker studied to date that can achieve both of these criteria as well as COI-5P does for animals and, therefore, typically two or more markers have been recommended to be used in concert. Secondly, the optimal marker (or marker combination) tends to vary based on the taxonomic group studied (Hollingsworth et al. 2009b). We selected several markers to investigate as potential DNA barcode markers for the marine green macroalgae. The rbcL was an obvious choice for testing since its utility as a DNA barcode has been established among plant groups (Hollingsworth et al. 2009b) and because it has formed the basis of several taxonomic and phylogenetic studies in marine green macroalgae (e.g., Shimada et al. 2004, Lam & Zechman 2006, Curtis et al. 2008, Loughnane et al. 2008, Heesch et al. 2009). In the genus Ulva, the rbcL has been employed extensively to resolve taxonomic issues (e.g., Hayden & Waaland 2002, Hayden et al. 2003, Hayden & Waaland 2004), which provides a framework for testing of variability for rbcL sequences within and between species to evaluate its utility as a DNA barcode marker. Unfortunately, the presence of introns in the rbcL of some marine green macroalgae (Hanyuda et al. 2000) may negatively affect the universality of rbcL as a barcode marker since the ability to amplify and sequence large fragments with a single bidirectional read will be hampered. Given the fact that green algae are particularly prone to acquiring intron sequences (Bhattacharya et al. 1996, Haugen et al. 2005), and that the 136 extent to which introns are present among their rbcL genes is unknown, the wider applicability of this marker as a barcode needs to be evaluated empirically. The universal plastid amplicon (UPA) is a short (~370bp) region of the 23S plastid rDNA gene and has been proposed as an alternative DNA barcoding marker for photosynthetic eukaryotes (Sherwood & Presting 2007, Sherwood et al. 2008). However, the UPA has had mixed results in different taxonomic groups; for some red algal lineages, it has worked as well as COI-5P to distinguish species (Sherwood et al. 2008, Clarkston & Saunders 2010) while in other groups it was not sufficiently variable to identify species (Chapter 3, this thesis). The major advantage with the UPA is its universality. A single primer pair can reliably recover sequences from a broad taxonomic range including green, red and brown marine macroalgae, diatoms, and even cyanobacteria (Sherwood & Presting 2007). The D2/D3 region of the nuclear large ribosomal subunit (LSU-D2/D3) is known to be variable at the species level in some lineages and has been used to identify and screen for new species in taxonomic groups including animals, plants and algae (e.g., Saunders & Lehmkuhl 2005, Subbotin et al. 2005, Hajieghrari et al. 2007, Heraty et al. 2007). Primers modified from those developed for the red algae (Harper & Saunders 2001) are anchored in conserved regions and are expected to be broadly universal among green algal taxa having amplified target sequence from a broad range of taxa in our laboratory. As well as serving as the DNA barcode marker for fungi, the ITS has been used extensively for investigations of phylogeny, molecular ecology and evolution in a broad array of taxa including marine green macroalgae (e.g., Bakker et al. 1995, Woolcott et al. 137 2000, Coyer et al. 2001, Hayden et al. 2003, Hayden & Waaland 2004, Arnedo & Gillespie 2006, Kawai et al. 2007, Chen & Hare 2008, German et al. 2009). White et al.'s (1990) now classic paper has guided primer design for amplification of the ITS from many lineages including the green algae (e.g. Bakker et al. 1992). Despite the fact that there are potential problems (such as intraindividual heterogeneity or difficulties with multiple sequence alignments due to high levels of variation) with the ITS (Alvarez & Wendel 2003), it can also provide insightful results at the species level (Feliner & Rossello 2007). The aim of this study was to conduct a preliminary test of the universality and genetic variability of particular molecular markers for DNA barcoding of marine green macroalgae. We focused our testing on two plastid markers (divided into three putative barcodes) and two nuclear markers. From the plastid: 559 nucleotides of the 5' end of the rbcL (rbcL -5P), approximately 735 nucleotides of the 3' end of the rbcL (rbcL-3P), and the universal plastid amplicon (UPA) (Presting 2006, Sherwood & Presting 2007); and from the nucleus: the D2/D3 variable domains of the large ribosomal subunit (LSU- D2/D3) and the internal transcribed spacer (ITS) region of the ribosomal cistron. Methods Specimen collection and DNA extraction For the initial screening of potential barcode markers, 99 samples were chosen as a test group (referred to herein as "the test set") (Appendix 6). Samples were identified using taxonomic keys (Sears 2002, Gabrielson et al. 2006) except for several IJlva specimens, which were given provisional names until after sequencing (see below). The test set was chosen to include a broad taxonomic range within the marine green 138 macroalgae, but with an emphasis on the genus Ulva in order to evaluate intra- versus interspecific variation for this genus. In the genus Ulva, samples were chosen to include a wide geographic distribution and variety of morphologies for recognized species. Following collection, each sample was pressed on herbarium paper as a voucher, while a subsample was dried in silica gel for DNA extraction. The silica-dried portion was ground in liquid nitrogen using a mortar and pestle. Extraction of total genomic DNA was carried out using the protocol from Saunders (1993) with modifications (Saunders 2008). Primer design and selection Because DNA barcode markers should be short enough to be sequenced bidirectionally with a single primer pair, we divided the rbcL into 5' (r6cL-5P) and 3' (r6cL-3P) regions and treated them as separate markers. We made an alignment of available green algal sequences from Genbank and designed the following primers: GrbLF (5' GTTAAAGATTAYCGWYTAAC 3'), GrbcLnF (5' GCTGGWGTAAAAGATTAYCG 3') and GrbcLR (5' TCACGCCAACGCATRAASGG 3'). GrbcLF and GrbcLnF are partially overlapping forward primers at the 5' end of the rbcL, with GrbcLnF being the primer that produced better quality data. GrbcLR is a reverse primer anchored 560bp downstream of GrbcLF. Combinations of these three primers served to amplify and sequence the rbcL-5V. For the rbcL-3P, the forward primer GrbcLFi (5' TCTCARCCWTTYATGCGTTGG 3') was designed (and is a partial reverse complement of GrbcLR). The reverse primer used for the rbch-W was 1385R as published by Manhart (1994). The UPA primers were p23SrV_fl, p23SrV_rl (Sherwood & Presting 2007) and p23SnewR (modified from 139 p32SrV_rl (Clarkston & Saunders 2010)). The primers used for the LSU-D2/D3 region were: T16N (forward; 5' AMAAGTACCRYGAGGGAAAG 3') modified from Harper and Saunders (2001) and T24 (reverse) (Harper & Saunders 2001). For the ITS, the general primers PI (forward) and G4 (reverse) (Harper & Saunders 2001), modified from White et al. (1990), were used. Due to low success with PI and G4 (see results), we also tested published primers ITS1 (forward; Bakker et al. (1995) modified from White (1990)), 18S1763 (forward; Hayden et al. (2003) modified from Blomster et al. (1998)) and J06 (reverse; Lindstrom & Hanic (2005)) in four combinations: ITS1/J06, ITS1/G4, 18S1763/J06 and 18S1763/G4 on 16 samples including representatives of the genera Blidingia, Bryopsis, Chaetomorpha, Cladophora, Codium, Derbesia, Prasiola, Protomonostroma, Rhizoclonium, Ulva, Ulvaria, and Urospora. PCR protocols and sequence acquisition PCR amplification was carried out using the Ex Taq™ DNA Polymerase (Takara, Shiga, Japan) according to the manufacturer's recommendations with a final volume of 20 |aL per reaction. PCR profiles were as follows: rbcL-SV—an initial 2 min denaturation at 95 °C, 35 cycles of 93 °C for 1 min, 54 °C annealing for 45 s, 72 °C extension for 2 min followed by 72 °C final extension for 7 min; rbcL-W—profile as for r&cL-5P except with an annealing temperature of 50 °C; UPA—as published in Sherwood & Presting (2007); LSU-D2/D3—an initial 5 min denaturation at 94 °C, 38 cycles of 94 °C for 30 s, 50 °C annealing for 30 s, 72 °C extension for 1 min followed by 72 °C final extension for 7 min; ITS—an initial 3 min denaturation at 94 °C, 38 cycles of 94 °C for 30 s, 54 °C annealing for 40 s, 72 °C extension for 1.5 min followed by 72 °C final extension for 7 140 min. All PCR products were held at 4 °C following amplification. Amplification success was evaluated using gel electrophoresis in a 0.8% agarose gel. PCR products were cleaned using the Exo-Sap-IT kit (USB, Cleveland OH, USA) or via the gel electrophoresis technique described by Saunders (1993). Sequencing was done using the BigDye 3.0 kit (PE Applied Biosystems; Foster City, CA, USA), employing the same primers as for PCR. Sequence trace files were generated on an Applied Biosystems 3130 XL automated sequencer (PE Applied Biosystems; Foster City, CA, USA). Sequences were edited using Sequencher version 4.2 (Gene Codes Corporation, Ann Arbor, MI, USA) and multiple sequence alignments for the rbcL-SV, rbcL-W, UPA, and LSU-D2/D3 were constructed in MacClade version 4.08 (Maddison & Maddison 2005). The multiple sequence alignment for the ITS from the genus Cladophora was assembled using the Clustalw2 (Larkin et al. 2007) plugin for Geneious v4.8.3 (Drummond et al. 2009) with a gap opening cost of 13.4 and a gap extension cost of 7.26, with free end gaps option selected. For each marker and each sample, up to two PCR trials were attempted for each primer combination in an effort to achieve successful amplification. Successfully amplified samples proceeded to sequencing; however, if no band was detected, or if a sequence was found to be contaminated (messy or belonging to a non-green algal organism), then a second PCR attempt was made. If multiple bands were detected, and there was a strong band of the size expected for the marker of interest, the band was isolated using gel electrophoresis purification (Saunders 1993). In cases where there were many bands and/or a weak or non-existent band of the expected size, the PCR product was discarded. In the UPA, some cases of two bands were detected—one of the 141 expected size and one larger band. In these cases both bands were isolated and sequenced. Comparison of markers To evaluate universality, PCR and sequencing results were pooled into one of three descriptors of overall success as follows: i) successful sequence: amplification and sequencing of the target organism successful; ii) unreadable/contaminant sequence (U/C; see Appendix 6): amplification produced a single band, or a band that could be isolated; however, the resulting sequence was either messy due to contamination or read slippage, or belonged to a non-target organism; iii) sequencing not attempted (NA; Appendix 6): PCR failed, or produced multiple bands of more or less equal strength or streaks. To evaluate the discriminatory power of each marker, uncorrected-p distances were calculated for each marker using PAUP* version 4.0b 10 (Swofford 2002). Distances were exported to Microsoft Excel for Mac 2004 version 11.5.5 (Microsoft Corporation, Mississauga, Ontario, Canada), transformed to percentages and the maximum and minimum values were found using the MAX and MIN formula functions. Neighbor- joining (NJ) analyses were also performed on uncorrected distances using PAUP* for each marker to test for clustering of isolates into genetic species groups. Species identification within the test set subsequent to DNA sequencing For specimens of Ulva that were given a provisional name, available Genbank sequences were used to provide species names as follows. For every Ulva species listed in Genbank as of July 14, 2009, up to five representative sequences were downloaded. The sequences were aligned with our rbcL data, which were included either by 142 concatenating the 5' and 3' sequences for each sample, or including singly the fragment that was successfully sequenced. This dataset was subjected to neighbor-joining analysis using PAUP* and names were assigned to our specimens based on clustering with named specimens from Genbank. In cases where Genbank sequences of more than one name were found in the same group, the publications from which the sequences originated provided information as to which name is currently accepted for that group. In cases where our specimens did not cluster with any Genbank data, the specimens were given interim names (e.g., Ulva sp. 1GWS, etc.). Further evaluation of the rbcL-3P Following initial evaluation of the r£cL-5P, rbcL-3P, UPA, LSU-D2/D3 and ITS using the test set, the rbcL-3P was applied to 285 additional samples, and 208 were successfully sequenced. Of those sequences, 162 were selected to further evaluate the species discriminatory power of this marker ("the extended set"; Appendix 7). Results and Discussion Universality of the markers The BOLD and Genbank accessions for each marker successfully sequenced from each sample in the test set are listed in Appendix 6. The percent of samples sequenced for each marker is shown in Figure 4.1 with results for the total test set (n=99) presented as the first bar in each case (T). For the Cladophoraceae (n=18), the only data obtained were three ITS sequences, which prompted us to present the test set results also as two subsets: one with the Cladophoraceae excluded (n=81; E, Fig. 4.1); and another for the Cladophoraceae only (n=18; C, Fig. 4.1). 143 The rbcL markers had the highest overall universality of the regions tested. The rbch-SV had approximately the same universality as rbcL-3P with 72 and 70 of 99 samples being successfully sequenced, respectively. For samples of the genus Codium, r£cL-3P sequence could not be obtained, probably due to the presence of introns within this region of the rbcL (Hanyuda et al. 2000). We were, however, able to sequence the rbcL-5? for two Codium fragile samples—the introns in this species are likely confined to the 3' end of the rbcL. The presence of introns within other genera, such as Bryopsis, Caulerpa and members of the Chlorophyceae (Hanyuda et al. 2000), poses a significant shortfall for the universality of the rbcL as a DNA barcoding marker in green algae. Although the UPA had relatively high PCR success (dark plus light grey bars, Fig. 4.1), 20 sequences turned out to be contaminated or messy on sequencing (light grey bars, Fig. 4.1). It is possible that epiphytic or endophytic contaminants present in the samples were amplified preferentially or concurrently to the target organism for one of the following reasons: a) the UPA primers were a better match for the contaminants than the target organism; b) DNA extraction was not as effective for the target organism as for the contaminants; c) stochastic PCR effects leading to preferential amplification of the contaminant; or d) some combination of the previous. Markers with highly universal primers, such as the UPA, are particularly prone to these problems and effective isolation of target DNA becomes critically important. Previous to this study, the only marine green macroalgal genera for which the UPA had been tested were Codium, Prasiola, Rosenvingiella, and Viva (Sherwood & Presting 2007). It is, therefore, possible that the primers are not a good match for other genera, though this is unlikely given the universality of this marker system across several 144 kingdoms. More plausibly, it is possible that introns occur within the UPA for some species. Indeed, we observed five cases of putative introns within our test set for Ulva isolates that produced two PCR products of different sizes. When the larger product was isolated and sequenced the initial approximately 100-180 nucleotides matched Ulva UPA sequence in BLASTn searches and had GC contents of ~42-53%, whereas the subsequent 200-500 nucleotides consisted of AT-rich regions (GC content 20-33%) lacking BLASTn matches. The LSU-D2/D3 had approximately the same sequencing success as the UPA (Fig. 4.1), but in this case spanned a lower taxonomic breadth with no sequences obtained for any samples of the genera: Bryopsis, Codium, Derbesia, Kornmannia, and Prasiola (Appendix 6). The LSU-D2/D3 primers used here are fairly general and have been employed in a variety of diatom (S. Hamsher, personal communication), red and brown algal studies in our lab (e.g. Lane et al. 2006, Le Gall & Saunders 2007, Phillips et al. 2008, Clarkston & Saunders 2010). We, therefore, expected these primers would have a higher success for green algae than observed here. Again, given the high incidence of introns within green algae (Bhattacharya et al. 1996, Haugen et al. 2005), introns in the LSU are one possible explanation for our failure to recover sequence in some taxa. The presence and co-amplification of contaminating LSU sequences is another possible explanation for the difficulties observed here given that amplification success and levels of contaminated sequence were approximately on par with the UPA. Sequencing success was lowest for the ITS with only 16 sequences obtained. The majority of samples in the test set produced multiple or streaked PCR products and sequencing was not attempted. Similar to the LSU-D2/D3, the broad universality of the 145 primers employed (PI and G4) for red and brown algae (Harper & Saunders 2001, Ross et al. 2003, Kucera & Saunders 2008) led us to expect a high level of universality in the green algae as well. It is likely that these primers do amplify the ITS for green algae, but are also amplifying contaminating organisms, leading to multiple-band or streaked PCR product. In an effort to increase specificity for green algae, we tested several published green algal primers (see Methods) on 16 samples. Unfortunately, the prevalence of multiple bands in PCR product did not decrease, and samples for which single bands were recovered produced contaminant or messy sequence in most cases. Of the 16 samples tested with four primer combinations, we were only able to acquire clean sequence for: single isolates of Protomonostroma undulatum and Urospora sp. with the primer combinations ITS1/J06, ITS1/G4, 18S1763/J06 and 18S1763/G4, one isolate of Cladophora sp. with ITS1/G4 and an Ulvaria obscura isolate with 18S1763/J06. One general trend among all markers, except the ITS, was the failure to recover sequence from the Cladophoraceae. We first questioned the efficacy of our DNA extraction protocol for members of this taxon; however, we excluded this explanation for three reasons: a) published molecular studies in the Cladophoraceae use similar protocols to ours (e.g. Leliaert et al. 2007); b) we tried a modified DNA extraction protocol including phenol/chloroform (as published in Saunders (1993) but without the final gel electrophoresis cleaning step) for eight Cladophoraceae samples and still failed to get rbcL, UPA or LSU-D2/D3 sequence; and c) we were able to recover some ITS sequence. As in other cases of failure to recover sequence, primer mis-match or introns may explain why we were unable to obtain rbcL, UPA or LSU-D2/D3 sequence for the Cladophoraceae. For the chloroplast markers, attempts in other labs have similarly failed 146 to recover plastid DNA sequence from Cladophoraceae (H. Verbruggenpers. comm.) and there are no plastid sequences for any representative of this taxon in Genbank. For our nuclear markers, we compared published LSU sequences for Cladophora (Leliaert et al. 2007) with our primers and found that the T16N primer was mismatched with the Cladophora sequences at two sites, one of them being the terminal 3' nucleotide (G). Unfortunately, these published sequences did not overlap with the region where the T24 primer is anchored so we were unable to evaluate how well this primer would match with Cladophora. Primer mismatch seems the more likely explanation for lack of LSU-D2/D3 sequence success for the Cladophoraceae in the current study. Species-discrimination power of the markers For both the rbcL-5? and the r&cL-3P, samples assigned to the same species clustered together in neighbor-joining analysis (Figs. 4.2 and 4.3, respectively). Conversely, in the UPA and the LSU-D2/D3, not all species formed independent clusters (Figs. 4.4 and 4.5). For example, no Ulva species except for U. lobata formed independent clusters for UPA (Fig. 4.4) and no Acrosiphonia species formed independent clusters in the LSU-D2/D3 (Fig. 4.5). The ITS was so variable that it was not possible to align specimens from different genera; therefore, a neighbor-joining analysis was not conducted. A summary of the intra- and interspecific distances among samples in the test set is shown in Table 4.1. Higher taxon sampling and sequencing success in Acrosiphonia and Ulva allowed for comparison of intra- versus interspecific distances in these genera, especially in the rbcL markers (Table 4.1). In the rbcL-3P, a barcoding gap of 1.49% divergence and 0.68% divergence was observed for Acrosiphonia and Ulva, respectively. 147 The rbcL-5? showed no intraspecific variability with Acrosiphonia or Ulva indicating lower variability for this marker. The LSU-D2/D3 and UP A both showed overlapping intra- and interspecific divergences, thus lacking a barcoding gap. While the region of the LSU employed in this study (LSU-D2/D3) is known to be variable and has been applied extensively in generic and species level studies in other organisms (for example, insects: Singh et al. 2006, Heraty et al. 2007), our data suggest that in the marine green macroalgae this marker may not variable enough to distinguish all species. For the ITS, not enough sequences were generated to make comparisons of intra- versus interspecific distances; this lack of universality (largely a result of poor amplification) is sufficient to exclude this marker as a strong contender as a DNA barcode. Thus, of the markers tested here, the r6cL-3P has the best combination of universality and discriminatory power and was explored further as a DNA barcode candidate marker for marine green macroalgae. We investigated the intra- versus interspecific divergences in the r6cL-3P for an additional 162 samples (the extended set; Appendix 7). Neighbor-joining analysis of these sequences combined with test set sequences (Fig. 4.6) produced genetic species clusters congruent with genetic clusters of rbcL-3V in the test set (Fig. 4.3). The DNA barcoding gap in Acrosiphonia (1.36%) was on par with the gap observed in the initial test set (1.49%); however, in Ulva, the gap fell to 0.332% with increased sampling (Table 4.2). Since taxon sampling was the highest in Ulva, the likelihood of encountering closely related species pairs was also highest (e.g., Meier et al. 2008), consistent with the observation that the lowest interspecific divergences were observed in this genus. Higher sampling overall also means that samples with high intraspecific divergences, perhaps representing isolated populations, are more likely to be encountered than for groups in 148 which sampling was lower. Indeed, the highest intraspecific variation in Ulva was 0.404% (3bp) in Ulva intestinalis. An increase in taxon sampling among the other genera studied would allow a more detailed analysis of intra- versus interspecific divergence. The magnitude of the barcoding gap will not necessarily be the same among different genera, but wider ranges of both intra- and interspecific divergences are likely to be observed as more individuals and taxa are sampled. Taxonomic observations and putative cryptic species Based on our survey of intra- versus interspecific variation, this study has uncovered several putative cryptic species. Despite the thorough study of Ulva conducted in the northeast Pacific by Hay den & Waaland (2004), several genetic species groups of Ulva did not match published data and were more than 0.736% divergent in the rbcL-2>¥ from their nearest neighbour suggesting the occurrence of cryptic or overlooked species. These include: Ulva sp. 1GWS, a single collection from an estuarine habitat at end of a long, sheltered marine inlet; Ulva sp. 2GWS, each of three samples collected from different sites and different habitats in British Columbia; and Ulva sp. 5GWS, consisting of three winter collections from a single site in Bamfield, British Columbia. As most of the specimens studied by Hayden & Waaland (2004) were collected during the summer months, Ulva sp. 5GWS is perhaps a winter annual. Samples morphologically identified as Acrosiphonia arcta (Dillwyn) Gain fell into two distinct genetic species groups: "Acrosiphonia arcta" and "Acrosiphonia sp. 1GWS" (3.78% divergence in the rbcL-3P). The "A. sp. 1GWS" samples were all collected from the Pacific, whereas the "A. arcta " samples were from the Atlantic indicating that A arcta as currently considered may not inhabit both oceans. 149 Samples identified as Monostroma grevillei (Thuret) Wittrock also segregated into two clusters—M. grevillei sp. 1 and M. grevillei sp. 2, with 1.09% divergence in the rbch-W. Although the floristic guide to the northwest Atlantic flora (Sears 2002) lists a second species of Monostroma (M. oxyspermum (Kiitzing) Doty), this species is now considered to belong to the genus Gayralia. Gayralia oxysperma (Kiitzing) K.L. Vinogradova ex Scagel et al. rbcL sequence from Genbank did not match either of our Monostroma genetic species groups supporting the presence of cryptic species within Monostroma grevillei in the northwest Atlantic. Samples of Ulvaria obscura (Kiitzing) P. Gayral ex C. Bliding fell into two clusters (Fig. 4.6), which differed by only 0.404-0.409% divergence (Table 4.2). This is at the threshold of upper limits for intraspecific variation observed here and has a biogeographic component with one cluster consisting of our Atlantic collections and the other our Pacific collections. These two clusters likely represent two isolated populations of Ulvaria obscura although additional study to assess the status of these groups is warranted. Results of rbcL-3P clustering also led to some interesting observations within the genus Prasiola. In the Atlantic, only a single species, Prasiola meridionalis Setchell & N.L. Gardner, is recognized (Sears 2002). Samples of P. meridionalis grouped with, and were identical to Pacific samples identified as P. stipitata Suhr ex Jessen (based on our interpretation of Gabrielson et al. (2006)). Whether these two entities are conspecific requires further alpha taxonomic investigation. Another Prasiola cluster consisted of two samples with vastly different cellular arrangements. Sample GWS005101 consists of cells arranged in groups of 4-8, and what appeared to be a fungal infection (Fig. 4.7a)— 150 both of these characteristics typical of P. borealis M. Reed (Gabrielson et al. 2006). On the other hand, sample GWS005076, Prasiola delicata Setchell & N.L. Gardner, had cells arranged more regularly, not in groups of 4, and did not have an obvious fungal infection. Given that these two samples had identical rbcL sequences, we hypothesize that they may belong to the same species (P. delicata) and that the fungal infection is responsible for the morphology observed in GWS005101, "P. borealis". This hypothesis is based on only two samples and requires further investigation. An alternative explanation for these observations is that the r6cL-3P is not variable enough to distinguish between these two species of Prasiola, or perhaps, that plastid introgression has occurred between these two putative taxa. Conclusions and future research Of the five regions tested here, the rbcL-3P showed the most promise as a DNA barcoding marker due to its high variability and reasonable universality. However, as tested here, it was not a universal marker throughout the marine green macroalgae. The presence of introns in species of Bryposis, Caulerpa, Codium, and other green algae (Hanyuda et al. 2000) severely limits the utility and universality of the rbcL and is the likely explanation for our failure to amplify this region from Codium, some other samples, and perhaps all of the Cladophoraceae. Preliminary screening of 285 samples of various genera using our rZ>cL-3P primers (data not shown) has revealed introns (sequences contained obvious insertions) in three Acrosiphonia samples. These limitations mean that the rbcL-3P cannot stand alone as a DNA barcode marker for marine green macroalgae and further research is required before a recommendation of a marker (or combination of markers) for DNA barcoding can be made. As a first step, the 151 prevalence of introns within the rfecL-3P of marine green macrolagae needs to be investigated more thoroughly. One potential solution is to reevaluate the primer locations within the rbcL, perhaps extending the rbch-5V further downstream thereby gaining more variability (i.e. the current rbcL-5? fragment could be lengthened). Unfortunately, there are few conserved regions in this part of the gene for designing primers and, even if effective primers could be designed, a survey of the taxonomic range of introns would still need to be completed as introns are not limited to the 3' end of the rbcL (Hanyuda et al. 2000). We advise investigating other markers, with the prospect of either finding a more universal (and equally or more variable) marker. One marker with potential to serve as a DNA barcode is the elongation factor TU (tufA) (Fama et al. 2002). While initially used to infer deep evolutionary relationships among plastid bearing organisms (Ludwig et al. 1990, Delwiche et al. 1995, Baldauf et al. 1996), this marker has since been applied to phylogenetic and taxonomic investigations of green algae at the species level (Fama et al. 2002, O1 Kelly et al. 2004, de Clerck et al. 2008, Zuccarello et al. 2009). It may thus prove a promising alternative to the markers investigated here. Alternatively, as in land plants, a combination of markers may need to be used to achieve a balance of universality and species discrimination (see Newmaster et al. 2006, Hollingsworth et al. 2009a, Hollingsworth et al. 2009b). Acknowledgements We would like to thank Andrew Blakney, Bridgette Clarkston, Susan Clayden, Natasha Chisti, M. Corey, Jeremy De Waard, Kyatt Dixon, Bob Hooper, Chris Lane, Line Le Gall, Dan McDevit, Tanya Moore, Kathryn Roy, Jose Maria Utge Buil, and Rodney 152 Withall for contributions to sample collection. We are grateful to the Bamfield Marine Sciences Centre for hosting a large component of the field-work for this study. For technical assistance in the laboratory, we thank Ross Campbell. This research was supported through funding to the Canadian Barcode of Life Network from Genome Canada (through the Ontario Genomics Institute), the Natural Sciences and Engineering Research Council of Canada and other sponsors listed at www.bolnet.ca. Additional support was provided by the Canada Research Chair Program, the Canada Foundation for Innovation and the New Brunswick Innovation Foundation. References Alvarez, I. & Wendel, J. F. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Mol. Phylogenet. Evol. 29:417-34. Arnedo, M. A. & Gillespie, R. G. 2006. Species diversification patterns in the Polynesian jumping spider genus Havaika Proszynski, 2001 (Araneae, Salticidae). Mol. Phylogenet. Evol. 41:472-95. Bakker, F. T., Olsen, J. L. & Stam, W. T. 1995. Evolution of nuclear rDNA ITS sequences in the Cladophora albida/sericea clade (Chlorophyta). J. Mol. Evol. 40:640-51. Bakker, F. T., Olsen, J. L., Stam, W. T. & Vandenhoek, C. 1992. Nuclear ribosomal DNA internal transcribed spacer regions (ITS1 and ITS2) define discrete biogeographic groups in Cladophora albida (Chlorophyta). J. Phycol. 28:839-45. 153 Baldauf, S. L., Palmer, J. D. & Doolittle, W. F. 1996. The root of the universal tree and the origin of eukaryotes based on elongation factor phylogeny. Proc. Natl. Acad. Sci. U. S. A. 93:7749-54. Bhattacharya, D., Friedl, T. & Damberger, S. 1996. Nuclear-encoded rDNA group I introns: Origin and phylogenetic relationships of insertion site lineages in the green algae. Mol. Biol. Evol. 13:978-89. Blomster, J., Maggs, C. A. & Stanhope, M. J. 1998. Molecular and morphological analysis of Enteromorpha intestinalis and E. compressa (Chlorophyta) in the British Isles. J. Phycol. 34:319-40. Chase, M. W. & Fay, M. F. 2009. Barcoding of Plants and Fungi. Science 325:682-83. Chen, G. & Hare, M. P. 2008. Cryptic ecological diversification of a planktonic estuarine copepod, Acartia tonsa. Mol. Ecol. 17:1451-68. Clarkston, B. E. & Saunders, G. W. 2010. A comparison of two DNA barcode markers for species discrimination in the red algal family Kallymeniaceae (Gigartinales, Florideophyceae), with a description of Euthora timburtoni sp. nov. Botany. 88:119-31. Coyer, J. A., Smith, G. J. & Andersen, R. A. 2001. Evolution of Macrocystis spp. (Phaeophyceae) as determined by ITS1 and ITS2 sequences. J. Phycol. 37:574- 85. Curtis, N. E., Dawes, C. J. & Pierce, S. K. 2008. Phylogenetic analysis of the large subunit rubisco gene supports the exclusion of Avrainvillea and Cladocephalus from the Udoteaceae (Bryopsidales, Chlorophyta). J. Phycol. 44:761-67. de Clerck, O., Verbruggen, H., Huisman, J. M., Faye, E. J., Leliaert, F., Schils, T. & Coppejans, E. 2008. Systematics and biogeography of the genus Pseudocodium (Bryopsidales, Chlorophyta), including the description of P. natalense sp nov from South Africa. Phycologia 47:225-35. Delwiche, C. F., Kuhsel, M. & Palmer, J. D. 1995. Phylogenetic analysis of tufA seqeunces indicates a cyanobacterial origin of all plastids. Mol. Phylogenet. Evol. 4:110-28. Drummond, A., Ashton, B., Cheung, M., Heled, J., Kearse, M., Moir, R., Stones-Havas, S., Thierer, T. & Wilson, A. 2009. Geneious. v4.8. Avaliable from: http://www.geneious.com Edwards, D., Horn, A., Taylor, D., Savolain, V. & Hawkins, J. A. 2008. DNA barcoding of a large genus, Aspalathus L. (Fabaceae). Taxon 57:1317-27. Fama, P., Wysor, B., Kooistra, W. & Zuccarello, G. C. 2002. Molecular phylogeny of the genus Caulerpa (Caulerpales, Chlorophyta) inferred from chloroplast tufA gene. J. Phycol. 38:1040-50. Fazekas, A. J., Burgess, K. S., Kesanakurti, P. R., Graham, S. W., Newmaster, S. G., Husband, B. C., Percy, D. M., Hajibabaei, M. & Barrett, S. C. H. 2008. Multiple 155 multilocus DNA barcodes from the plastid genome discriminate plant species equally well. PLoS ONE 3. Feliner, G. N. & Rossello, J. A. 2007. Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Mol. Phylogenet. Evol. 44:911-19. Ferri, E., Barbuto, M., Bain, O., Galimberti, A., Uni, S., Guerrero, R., Ferte, H., Bandi, C., Martin, C. & Casiraghi, M. 2009. Integrated taxonomy: traditional approach and DNA barcoding for the identification of filarioid worms and related parasites (Nematoda). Frontiers in Zoology 6:1. Ford, C. S., Ayres, K. L., Toomey, N., Haider, N., Stahl, J. V., Kelly, L. J., Wikstrom, N., Hollingsworth, P. M., Duff, R. J., Hoot, S. B., Cowan, R. S., Chase, M. W. & Wilkinson, M. J. 2009. Selection of candidate coding DNA barcoding regions for use on land plants. Bot. J. Linn. Soc. 159:1-11. Frezal, L. & Leblois, R. 2008. Four years of DNA barcoding: Current advances and prospects. Infect. Genet. Evol. 8:727-36. Gabrielson, P. W., Widdowson, T. B. & Lindstrom, S. C. 2006. Keys to the Seaweeds and Seagrasses of Southeast Alaska, British Columbia, Washington and Oregon. University of British Columbia, Vancouver, 209 pp. Geiser, D. ML, Klich, M. A., Frisvad, J. C., Peterson, S. W., Varga, J. & Samson, R. A. 2007. The current status of species recognition and identification in Aspergillus. Stud. Mycol. 59:1-10. German, D. A., Friesen, N., Neuffer, B., Al-Shehbaz, I. A. & Hurka, H. 2009. Contribution to ITS phylogeny of the Brassicaceae, with special reference to some Asian taxa. Plant Syst. Evol. 283:33-56. Gribble, K. E. & Anderson, D. M. 2007. High intraindividual, intraspecific, and interspecific variability in large-subunit ribosomal DNA in the heterotrophic dinoflagellates Protoperidinium, Diplopsalis, and Preperidinium (Dinophyceae). Phycologia 46:315-24. Hajibabaei, M., Janzen, D. H., Burns, J. M., Hallwachs, W. & Hebert, P. D. N. 2006. DNA barcodes distinguish species of tropical Lepidoptera. Proc. Natl. Acad. Sci. U.S.A. 103:968-71. Hajieghrari, B., Torabi-Giglou, M. & Waeyenberge, L. 2007. Comparative d2/d3 LSU- rDNA sequence study of some Iranian Pratylenchus loosi populations. Afr. J. Biotechnol. 6:2458-46. Hanyuda, T., Arai, S. & Ueda, K. 2000. Variability in the rbcL introns of Caulerpalean algae (Chlorophyta, Ulvophyceae). J. Plant Res. 113:403-13. Harper, J. T. & Saunders, G. W. 2001. The application of sequences of the ribosomal cistron to the systematics and classification of the florideophyte red algae (Florideophyceae, Rhodophyta). Cah. Biol. Mar. 42:25-38. Haugen, P., Simon, D. M. & Bhattacharya, D. 2005. The natural history of group I introns. Trends Genet. 21:111-19. Hayden, H. S., Blomster, J., Maggs, C. A., Silva, P. C., Stanhope, M. J. & Waaland, J. R. 2003. Linnaeus was right all along: Ulva and Enteromorpha are not distinct genera. Eur. J. Phycol. 38:277-94. Hayden, H. S. & Waaland, J. R. 2002. Phylogenetic systematics of the Ulvaceae (Ulvales, Ulvophyceae) using chloroplast and nuclear DNA sequences. J. Phycol. 38:1200-12. Hayden, H. S. & Waaland, J. R. 2004. A molecular systematic study of Ulva (Ulvaceae, Ulvales) from the northeast Pacific. Phycologia 43:364-82. Hebert, P. D. N., Cywinska, A., Ball, S. L. & DeWaard, J. R. 2003a. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B Biol. 270:313-21. Hebert, P. D. N. & Gregory, T. R. 2005. The promise of DNA barcoding for taxonomy. Syst. Biol. 54. Hebert, P. D. N., Ratnasingham, S. & deWaard, J. R. 2003b. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Lond. B Biol. 270.S96-S99. Hebert, P. D. N., Stoeckle, M. Y., Zemlak, T. S. & Francis, C. M. 2004. Identification of birds through DNA barcodes. PLoS Biol. 2:1657-63. Heesch, S., Broom, J. E. S., Neill, K. F., Farr, T. J., Dalen, J. L. & Nelson, W. A. 2009. Ulva, Umbraulva and Gemina: genetic survey of New Zealand taxa reveals diversity and introduced species. Eur. J. Phycol. 44:143-54. Heraty, J. M., Woolley, J. B., Hopper, K. R., Hawks, D. L., Kim, J. W. & Buffington, M. 2007. Molecular phylogenetics and reproductive incompatibility in a complex of cryptic species of aphid parasitoids. Mol. Phylogenet. Evol. 45:480-93. Hollingsworth, M. L., Clark, A. A., Forrest, L. L., Richardson, J., Pennington, R. T., Long, D. G., Cowan, R., Chase, M. W., Gaudeul, M. & Hollingsworth, P. M. 2009a. Selecting barcoding loci for plants: evaluation of seven candidate loci with species-level sampling in three divergent groups of land plants. Molecular Ecology Resources 9:439-57. Hollingsworth, P. M., Forrest, L. L., Spouge, J. L., Hajibabaei, M., Ratnasingham, S., van der Bank, M., Chase, M. W., Cowan, R. S., Erickson, D. L., Fazekas, A. J., Graham, S. W., James, K. E., Kim, K. J., Kress, W. J., Schneider, H., van AlphenStahl, J., Barrett, S. C. H., van den Berg, C., Bogarin, D., Burgess, K. S., Cameron, K. M., Carine, M., Chacon, J., Clark, A., Clarkson, J. J., Conrad, F., Devey, D. S., Ford, C. S., Hedderson, T. A. J., Hollingsworth, M. L., Husband, B. C., Kelly, L. J., Kesanakurti, P. R., Kim, J. S., Kim, Y. D., Lahaye, R., Lee, H. L., Long, D. G., Madrinan, S., Maurin, O., Meusnier, I., Newmaster, S. G., Park, C. W., Percy, D. M., Petersen, G., Richardson, J. E., Salazar, G. A., Savolainen, V., Seberg, 0„ Wilkinson, M. J., Yi, D. K, Little, D. P. & Grp, C. P. W. 2009b. A DNA barcode for land plants. Proc. Natl Acad. Sci. U. S. A. 106:12794-97. Janzen, D. H., Hallwachs, W., Blandin, P., Burns, J. M., Cadiou, J.-M., Chacon, I., Dapkey, T., Deans, A. R., Epstein, M. E., Espinoza, B., Francelmont, J. G., Haber, W. A., Hajibabaei, M., Hall, J., P.W., Hebert, P. D. N., Gauld, I. D., 159 Harvey, D. J., Hausmann, A., Kitching, I. J., Lafontaine, D., Landry, J. F., Lemaire, C., Miller, J. Y., Miller, J. S., Miller, L., Miller, S. E., Montero, J., Munroe, E., Rab Green, S., Ratnasingham, S., Rawlins, J. E., Robbins, R. K., Rodriguez, J. J., Rougerie, R., Sharkey, M. J., Smith, M. A., Solis, M. A., Boiling, S. J., Thiacourt, P., Wahl, D. B„ Weller, S. J., Whitefield, J. B„ Willmott, K. R„ Wood, D. M., Woodley, N. E. & Wilson, J. J. 2009. Integration of DNA barcoding into an ongoing inventory of complex tropical biodiversity. Molecular Ecology Resources 9:1-26. Kawai, H., Shimada, S., Hanyuda, T. & Suzuki, T. 2007. Species diversity and seasonal changes of dominant Ulva species (Ulvalies, Ulvophyceae) in Mikawa Bay, Japan, deduced from ITS2 rDNA region sequences. Algae 22:221-28. Kress, W. J. & Erickson, D. L. 2007. A two-locus global DNA Barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2:e508. Kress, W. J., Wurdack, K. J., Zimmer, E. A., Weigt, L. A. & Janzen, D. H. 2005. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. U. S. A. 102:8369-74. Kucera, H. & Saunders, G. W. 2008. Assigning morphological variants of Fucus (Fucales, Phaeophyceae) in Canadian waters to recognized species using DNA barcoding. Botany 86:1065-79. Lahaye, R., Van der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin, O., Duthoit, S., Barraclough, T. G. & Savolainen, V. 2008. DNA barcoding the floras of biodiversity hotspots. Proc. Natl. Acad. Sci. U. S. A. 105:2923-28. Lam, D. W. & Zechman, F. W. 2006. Phylogenetic analyses of the Bryopsidales (Ulvophyceae, Chlorophyta) based on RUBISCO large subunit gene sequences. J. Phycol. 42:669-78. Lane, C. E., Mayes, C., Druehl, L. D. & Saunders, G. W. 2006. A multi-gene molecular investigation of the kelp (Laminariales, Phaeophyceae) supports substantial taxonomic re-organization. J. Phycol. 42:493-512. Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettingan, P. A., H., M., Valentin, F., Wallace, I. M., Wilm, A., R., L., Thompson, J. D., Gibson, T. J. & Higgins, D. G. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947-48. Le Gall, L. & Saunders, G. W. 2007. A nuclear phylogeny of the Florideophyceae (Rhodophyta) inferred from combined EF2, small subunit and large subunit ribosomal DNA: Establishing the new red algal subclass Corallinophycidae. Mol. Phylogenet. Evol. 43:1118-30. Le Gall, L. & Saunders, G. W. 2010. DNA barcoding is a powerful tool to uncover algal diversity: A case study of the Phyllophoraceae (Gigartinales, Rhodophyta) in the Canadian flora. J. Phycol. 46:374-89. Leliaert, F., De Clerck, O., Verbruggen, H., Boedeker, C. & Coppejans, E. 2007. Molecular phylogeny of the Siphonocladales (Chlorophyta : Cladophorophyceae). Mol. Phylogenet. Evol. 44:1237-56. Lindstrom, S. C. & Hanic, L. A. 2005. The phylogeny of North American Urospora (Ulotrichales, Chlorophyta) based on sequence analysis of nuclear ribosomal genes, introns and spacers. Phycologia 44:194-201. Loughnane, C. J., Mclvor, L. M., Rindi, F., Stengel, D. B. & Guiry, M. D. 2008. Morphology, rbcL phylogeny and distribution of distromatic Ulva (Ulvophyceae, Chlorophyta) in Ireland and southern Britain. Phycologia 47:416-29. Ludwig, W., Weizenegger, M., Betzl, D., Leidel, E., Lenz, T., Ludvigsen, A., Mollenhoff, D., Wenzig, P. & Schleifer, K. H. 1990. Complete nucleotide sequences of 7 eubacterial genes coding for the elongation factor Tu: functional, structural and phylogenetic evaluations. Arch. Microbiol. 153:241-47. Maddison, W. D. & Maddison, D. R. 2005. MacClade v4.08. Sinauer Associates, Sunderland, Massachusetts. Manhart, J. R. 1994. Phylogenetic Analysis of Green Plant rbcL Sequences. Mol. Phylogenet. Evol. 3:114-27. McDevit, D. C. & Saunders, G. W. 2009. On the utility of DNA barcoding for species differentiation among brown macroalgae (Phaeophyceae) including a novel extraction protocol. Phycol. Res. 57:131-41. Meier, R., Zhang, G. & Ali, F. 2008. The use of mean instead of smallest interspecific distances exaggerates the size of the "Barcoding Gap" and leads to misidentification. Syst. Biol. 57:809 - 13. Newmaster, S. G., Fazekas, A. J. & Ragupathy, S. 2006. DNA barcoding in land plants: evaluation of rbcL in a multigene tiered approach. Canadian Journal of Botany- Revue Canadienne De Botanique 84:335-41. Newmaster, S. G., Fazekas, A. J., Steeves, R. A. D. & Janovec, J. 2008. Testing candidate plant barcode regions in the Myristicaceae. Molecular Ecology Resources 8:480-90. Nilsson, R. H., Kristiansson, E., Ryberg, M., Hallenberg, N. & Larsson, K. H. 2008. Intraspecific ITS variability in the Kingdom Fungi as expressed in the international sequence databases and its implications for molecular species identification. Evolutionary Bioinformatics 4. O' Kelly, C. J., Wysor, B. & Bellows, W. K. 2004. Gene sequence diversity and the phylogenetic position of algae assigned to the genera Phaeophila and Ochlochaete (Ulvophyceae, Chlorophyta). J. Phycol. 40:789-99. Phillips, N., Burrowes, R., Rousseau, F., De Reviers, B. & Saunders, G. W. 2008. Resolving evolutionary relationships among the brown algae using chloroplast and nuclear genes. J. Phycol. 44:394-405. Pombert, J. F., Beauchamp, P., Otis, C., Lemieux, C. & Turmel, M. 2006. The complete mitochondrial DNA sequence of the green alga Oltmannsiellopsis viridis: 163 evolutionary trends of the mitochondrial genome in the Ulvophyceae. Curr. Genet. 50:137-47. Pombert, J. F., Otis, C., Lemieux, C. & Turmel, M. 2004. The complete mitochondrial DNA sequence of the green alga Pseudendoclonium akinetum (Ulvophyceae) highlights distinctive evolutionary trends in the chlorophyta and suggests a sister- group relationship between the Ulvophyceae and Chlorophyceae. Mol. Biol. Evol. 21:922-35. Presting, G. G. 2006. Identification of conserved regions in the plastid genome: implications for DNA barcoding and biological function. Canadian Journal of Botany-Revue Canadienne De Botanique 84:1434-43. Robba, L., Russell, S. J., Barker, G. L. & Brodie, J. 2006. Assessing the use of the mitochondrial coxl marker for use in DNA barcoding of red algae (Rhodophyta). Am. J. Bot. 93:1101-08. Ross, P. I., Donaldson, S. L. & Saunders, G. W. 2003. A molecular investigation of Mazzaella (Gigartinales, Rhodophyta) morphologically intermediate between Mazzaella linearis and M. splendens. Bot. Mar. 46:202-13. Sass, C., Little, D. P., Stevenson, D. W. & Specht, C. D. 2007. DNA barcoding in the Cycadales: testing the potential of proposed barcoding markers for species identification of cycads. PLoS ONE 2:el 154. 164 Saunders, G. W. 1993. Gel purification of red algal genomic DNA - an inexpensive and rapid method for the isolation of polymerase chain reaction-friendly DNA. J. Phycol. 29:251-54. Saunders, G. W. 2005. Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Philos. Trans. R. Soc. Lond. B Biol. Sci. 360:1879-88. Saunders, G. W. 2008. A DNA barcode examination of the red algal family Dumontiaceae in Canadian waters reveals substantial cryptic species diversity. 1. The foliose Dilsea-Neodilsea complex and Weeksia. Botany 86:773-89. Saunders, G. W. 2009. Routine DNA barcoding of Canadian Gracilariales (Rhodophyta) reveals the invasive species Gracilaria vermiculophylla in British Columbia. Molecular Ecology Resources 9:140-50. Saunders, G. W. & Lehmkuhl, V. K. 2005. Molecular divergence and morphological diversity among four cryptic species of Plocamium (Plocamiales, Florideophyceae) in northern Europe. Eur. J. Phycol 40:293-312. Sears, J. R. 2002. NEAS Keys to the Benthic Marine Algae of the Northeastern Coast of North America from Long Island Sound to the Strait of Belle Isle. University of Massachusetts, Dartmouth, 161 pp. Seifert, K. A. 2009. Progress towards DNA barcoding of fungi. Molecular Ecology Resources 9:83-89. 165 Seifert, K. A., Samson, R. A., Dewaard, J. R., Houbraken, J., Levesque, C. A., Moncalvo, J. M., Louis-Seize, G. & Hebert, P. D. N. 2007. Prospects for fungus identification using C01 DNA barcodes, with Penicillium as a test case. Proc. Natl. Acad. Sci. U. S. A. 104:3901-06. Sherwood, A. R. & Presting, G. G. 2007. Universal primers amplify a 23S rDNA plastid marker in eukaryotic algae and cyanobacteria. J. Phycol. 43:605-08. Sherwood, A. R., Vis, M. L., Entwisle, T. J., Necchi, O. & Presting, G. G. 2008. Contrasting intra versus interspecies DNA sequence variation for representatives of the Batrachospermales (Rhodophyta): Insights from a DNA barcoding approach. Phycol. Res. 56:269-79. Shimada, S., Hiraoka, M., Serisawa, Y. & Horiguchi, T. 2004. Phylogenetic studies in the genus Codium (Chlorophyta) from Japan. The Japanese Journal of Phycology 52:137-41. Singh, O. P., Chandra, D., Nanda, N., Sharma, S. K., Htun, P. T., Adak, T., Subbarao, S. K. & Dash, A. P. 2006. On the conspecificity of Anopheles fluviatilis species S with Anopheles minimus species C. Journal of Biosciences 31:671-77. Starr, J. R., Naczi, R. F. C. & Chouinard, B. N. 2009. Plant DNA barcodes and species resolution in sedges (Carex, Cyperaceae). Molecular Ecology Resources 9:151- 63. Subbotin, S. A., Vovlas, N., Crozzoli, R., Sturhan, D., Lamberti, F., Moens, M. & Baldwin, J. G. 2005. Phylogeny of Criconematina Siddiqi, 1980 (Nematoda: 166 Tylenchida) based on morphology and D2-D3 expansion segments of the 28S- rRNA gene sequences with application of a secondary structure model. Nematology 7:927-44. Swofford, D. L. 2002. PAUP* v4.0bl0. Sinauer Associates, Sunderland, Massachusetts. Walker, R. H., Brodie, J., Russell, S., Irvine, L. M. & Orfanidis, S. 2009. Biodiversity of coralline algae in the northeastern Atlantic including Corallina caespitosa sp. nov. (Corallinoideae, Rhodophyta). J. Phycol. 45:287-97. Watanabe, K. I., Ehara, M., Inagaki, Y. & Ohama, T. 1998. Distinctive origins of group I introns found in the COXI genes of three green algae. Gene 213:1-7. White, T. J., Bruns, T., Lee, S. & Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., Gelfan, D. H., Sninsky, J. J. & White, T. J. [Eds.] PCR Protocols: A guide to methods and applications. Academic Press, Inc., San Diego, California, pp. 315-22. Woolcott, G. W., lima, M. & King, R. J. 2000. Speciation within Blidingia minima (Chlorophyta) in Japan: evidence from morphology, ontogeny, and analyses of nuclear rDNA ITS sequence. J. Phycol. 36:227-36. Zuccarello, G. C., Price, N., Verbruggen, H. & Leliaert, F. 2009. Analysis of a plastid multigene data set and the phylogenetic position of the marind macroalga Caulerpa filiformis (Chlorophyta). J. Phycol. 45:1206-12. 167 100% Sequencing Not Attempted • Unreadable/Contaminant Sequence • Successful sequences 0% J-J rbcL-5P rbcL-3P UPA LSU ITS Figure 4.1: Universality of each marker given as a percent of samples successfully sequenced. Dark grey bars indicate percent of samples for which sequence was obtained, light grey indicate sequence that either belonged to a non-target organism or was unreadable due to contamination or read slippage, while white bars indicate failure of PCR or multiple/streaked bands with sequencing not attempted. First bar (T): entire test set (n=99), second bar (E): Cladophoraceae excluded (n=81), third bar (C): Cladophoraceae only (n=18). 168 j GWS002700 Actomphoni* coa0t» QW8004310 AaomiJhori* caaBa QW8003577 Aarntphorm «eca GW8OO0MSACKM*)ft0niasp.1QWS QWS003750 Acroaiphoni* aondari GWS005363 Acromphoni* ap. 6GWS QW9003734 Ptvtouvnoatmma unoUiatum GW8003753 PtaiomonoafrDma unduielum GWS0QSM7 Prctomonaat/arm unduldum j™GWS006374 Unoqpont f«GWS006048 codtolum phaaa I QW9006147m UntporapanicmofTnit * QWSOtBMB OkMngm /rmglrmta " GW9004830 Korrtmannia taptodarma GWS00277B UhmkJt&a GWS002820 Utm bbata GWS000007 C/fnibteCa GW8009013 Uhm/obata QW3OO3O06 Utai tactuca GWS003S17 tta *cftc» GWS00S100 Uta tactuca GWS0D5336 tlVa Jactucs QWS005837 Uhmlactuca GWS005650 Ufa la&uca GW80062S8 LVw Jaducsa QWSOO0886 Ura iaecuea QW8007962 Uhmlaotuca GWS006295 Uhmlactuca QWSOO50O3 l*«p«ft Figure 4.2: Unrooted neighbor-joining phyiogram for rAcL-5P data. Voucher ID numbers may be cross-referenced with Appendix 6. Atlantic collections of Ulvaria obscura are indicated with "A"; Pacific collections with "P" (see text). 169 I QWS0Q27fl0 AaviDhania c 1GWS004310 AcrcHphonia ccmtSa rQGWS003577 Acntiphonia arctm J4GQWSOO6066 AToa^KVW sp. 1QWS 1 {QWS008617 AavmiphoniM «p. 1QWS *•— «QW8003750 A»oe|iAoniB somlerf GWS0037W —ruprow ^GWS00S867 Prutomono&vma undutmtum GWS008048 codblum pha* _r- GWS006374 Umtpon womwtiokMI ' GWSOOS147 Umaporapmrn#kxrm GWS002779Ufcefe6ati GWS002B20 QW8009007 UhmtobtdB QWSOO0O13 UW fe6a£> f OWSOO50O3 Uhmpntm* ' OW8OO640O WvmpmtuB* QW8003686 Uhta tackic* QWS003817 Utvatactuca GWS005100 la&uc* QWS005338 tMmlmckJca GWS006S59 Jac&c* GWS006258 Utoa tot*** GWS007962 UKmladuca GWS0Cft29SUtaitacfcca GWS005637 (AaJacfUca GW8004618 IM« Maafthafe GW800645B tMvMnsfihali GWSOO79S0 GWS008549 UVa MMttull GW8006962 iA* kmathsMa GWS008030 Mtor tttaMfeafe GWS004067 Wfca cornpnMsa GWS005604 L0wi compmssa H GW8008267 Ufea comprwnm i QWS003290 (j*» «torxptyf« * GW8006574 Ufca ttanophyH* QW8004617 <*• ap. 2GWS J- GWS004642 Uta caMymca GW8005072 £Jfc» calfcmfca ¥ GWS008545 «a*uoa* QWS003715 Utva pfoHfara GWS00S446 UhmproHhra GW8007057 Utva protoara GWS005321 UvaproHhr* QW8005572 UhmproMaea GGWS006271 Uhmprocara I | GW8008377 UfvaMna ~ GWS006140 Uta #iza '— GW8006232 WwnjpUa GWS004319 Utaap. 1GW8 GWS003507 Itoariaobacuw " GWS003786 Ltaaria Odacurs GWS006999 obacuni GW8007079 Utaria rtacurv > A GWS007566 {Maria oAacum GWS008641 Utaariaoftacuni GWS006119 Ufrsria obacura . QHSOOSOTZUhmriaobacufa } GWS006315 Ltfvwia obacm I _ GW8006316 LMvmhB ob&ajrm j » GWS006404 Utaanfa abaara j GWS00S836£to*«^*Mflfc»-GWSOO36e9 0fc*)0fcm*pfrttC> J GWS009004 BfyoptM oofticulana l' /GWS009075 Bryopm cortcufr* I GWSOO2065 ftaatofe/nariaKcinaAf Gwsoo3eee Pramotaat&ma — 0.01 •ubMtutionsWte Figure 4.3: Unrooted neighbor-joining phylogram for r6cL-3P data. Voucher ID numbers may be cross-referenced with Appendix 6. Atlantic collections of Ulvaria obscura are indicated with "A"; Pacific collections with "P" (see text). 170 GWS002820 Ulva lobata GWS009007 Ulva lobata n GWS002779 Ulva lobata GWS009013 Ulva lobata GWS003686 Ulva lactuca GWS003817 Ulva lactuca GWS005100 Ulva lactuca f GWS005837 Ulva lactuca GWS005859 Ulva lactuca GWS006258 Ulva lactuca GWS006574 Ulva stenophylla GWS006666 Ulva lactuca GWS007962 Ulva lactuca GWS008295 Ulva lactuca GWS005338 Ulva lactuca b GWS005803 L//va pertusa 1 GWS006489 Ulva pertusa GWS003290 Ulva stenophylla GWS004319 C/rasp. 1GWS GWS004617 Uh/a sp. 2GWS GWS004842 L//va califomica GWS006271 Ulva procera GWS006377 Ulvalinza GWS006531 Ulva sp. 2GWS GWS008140 Ulvalinza GWS008545 Ulvaflexuosa 1 GWS005446 Ulva prolifera GWS003507 Ulvaria obscura GWS003786 Ulvaria obscura GWS006119 Ulvaria obscura GWS006315 Ulvaria obscura GWS006316 Ulvaria obscura GWS006404 Ulvaria obscura GWS006999 Ulvaria obscura GWS007079 Ulvaria obscura GWS007568 Ulvaria obscura GWS008841 Ulvaria obscura | GWS003689 Blidingia marginata 1 GWS007133 Blidingia minima i GWS003734 Protomonostroma undulatum r—f GWS005967 Protomonostroma undulatum GWS003753 Protomonostroma undulatum i GWS006374 Urospora wormskioldii ' GWS008147 Urospora penicilliformis - GWS003750 Acrosiphonia sonderi GWS006665 Acrosiphonia sp. 1GWS C- GWS004310 Acrosiphonia coalita — GWS005383 Acrosiphonia sp. 6GWS GWS004830 Kommannia leptoderma i GWS003527 Codium fragile i— 1 GWS002780 Codium fragile GWS008836 Derbesia marina I GWS009075 Bryopsis corticulans 1 GWS009004 Bryopsis corticulans GWS002865 Prasiola meridionalis — 0.01 substitutions/site Figure 4.4: Unrooted neighbor-joining phylogram for UPA data. Voucher ID numbers may be cross-referenced with Appendix 6. 171 -GWS006665 Acrosiphonia sp. 1GWS GWS002760 Acrosiphonia coalita GWS003577 Acrosiphonia arcta GWS003750 Acrosiphonia sonderi GWS004310 Acrosiphonia coalita GWSCX)3734 Protomonostroma undulatum GWS003753 Protomonostroma undulatum H GWS005967 Protomonostroma undulatum _r GWS006374 Urospora wormskioldii 1 GWS008147 Urospora penicilliformis — GWS003768 Spongomorpha aeruginosa GWS002779 Ulva lobata GWS009007 Ulva lobata H GWS009013 Ulva lobata GWS004087 Ulva compressa GWS005694 Ulva compressa GWS008267 Ulva compressa GWS004618 Ulva intestinalis GWS006458 Ulva intestinalis GWS006939 Ulva intestinalis GWS006962 Ulva intestinalis GWS007959 Ulva intestinalis GWS008549 Ulva intestinalis I GWS005803 Ulva pertusa ^ GWS006489 Ulva pertusa GWS004319 Ulva sp. 1GWS J GWS003290 Ulva stenophylla ^ GWS006531 Ulva sp. 2GWS _r GWS004842 Ulva califomica i GWS005072r Ulva califomica • GWS008140 Ulva liroa GWS003715 Ulva prolifera GWS005321 Ulva prolifera GWS005446 Ulva prolifera GWS005572 Ulva prolifera GWS007057 Ulva prolifera - GWS006271 Utvaprocera GWS008545 Ulva flexuosa GWS003507 Ulvaria obscura GWS003786 Ulvaria obscura GWS006119 Ulvaria obscura GWS006316 Ulvaria obscura GWS006315 Ulvaria obscura GWS006404 Ulvaria obscura GWS006999 Ulvaria obscura GWS007079 Ulvaria obscura GWS003686 Ulva lactuca GWS003817 Ulva lactuca GWS005859 Ulva lactuca GWS006258 Ulva lactuca GWS007962 Ulva lactuca L GWS005338 L//va /acfuca GWS005100 (7/va /acftyca GWS005837 Ulva lactuca GWS008295 Ulva lactuca J— GWS003689 Blidingia marginata 1 GWS007133 Blidingia mminima 0.01 substitutions/site Figure 4.5: Unrooted neighbor-joining phylogram for LSU-D2/D3 data. Voucher ID numbers may be cross-referenced with Appendix 6. 172 173 QW900M17 Awfrtem *>• 1qw8 > OWSOOOM* ll«« awauoeaw *.n»M»>mw«p. iows GW9006074 Uhm* QW3007WB Uhrnt, QWiO&4^/tooiK^£lQWS OWSOQMa* UW« OWMM719 «p. 1QW8 QW800461I WmoomSAenSEhan**. 13W8 QWa0060g7 UW*i OW900617S'fcKM&KY**!.0*S00607S 10WSiows }P AA A owBooanoutaMGWS006K7 Ukmh Aamatoharm ?AontphoHlaq>.6 18W81GWVS - * - - ' «p. 10W8 ip. iomts owgooj'w 1c3wsiows owi66a677 Acnayhont* mem _ i40Miaterii« OWSOOS751 9*80037904—" QM90037V7 A <3W90074»y« L~ QWSDOaaiB/tampion* V.2GWS QW90043B7 .jfliia^wiiCNorocftywijnSiaot GMSOOttlO 4 J 3W80087BI 4QWS ow»ow»y>te»B^Mwa^>. «aws qwa00B7M WBiHOWiMi OWWB7K MM 3WS0(»M7« QWS0Q0041 tAvJKfcca 0*8006042 (MMa • QW8OO0O13 UtaitoMa 1OW900M07 UMtJbMa OW9UU77B OfcvfcMO (3W8006072 UMi 0W80W4M GfMtpwtM &M8008K»6*ap«*M I QW90040S1 UhmctBomkx QWS006KB (*• partUM ii (SW90060M Uhm cvflbmbi 0W9OOMOO UMi p*MM GW9004221 UMO ~ 1 ft QW8OO4707® tf OW900604 ilM parftaa 1•— On QW9009B04 Uhmfmtuta il <**8004017 (A««p. J "11 Uhm*ot»ctM» 0*9004488 Um>.2QIW ' Uhmrtaobiour* - QW900eB74 UlMi mnofifip* OWS0037WUtaMlifl6Mura 0W800M07INA otmxn QW8003MI rl OW8006090 (*• proem 9W9007D6714M peltera Q¥VB006446 UMlpmehni OW800371S (AvpeflHi GggggaeeiQW8003B41 Uhmpro—nt*epm«iwi C3W800S716 Ukmpnrnon GW8003691 Utoipctfhni QW8006447 (A«pna«M QW9003764 UhmpmMn QW8006572 Utaprefln GW80OCB1 U»rnpmm*a ' QW800431B QW80040T (A« OW8OOB074 OW90Q907S *>qpaftcv«mm 3WS0047W Ihmitptulw 4»raafeap. 1QW8 | 1 <3*8006008 OarfcMta 2GW5 3W8004062GMOOIBtaSLta L— n,,*,-, '••• 1QWS 3W9008101 3W9009674 Uwi 0W9OO4631 Pimk*frm**jn*t w OW9006101 Pm&iboimm Figure 4.6: Unrooted neighbor-joining pbylogram for the rbcL-3P data including sequences from the test set plus the extended set 174 Figure 4.7: Cellular arrangement of "Prasiola borealis" (a) and "Prasiola delicata" (b). Scale bar = 200nm Table 4.1: Summary of intra- and interspecific divergence for each marker for samples in the test set for genera for which more than one specimen was attempted and at least a single sequence was successfully generated. Abbreviations as follows: total number of sequences compared, # seq.; number of genetic species clusters, #spp.; range of intraspecific divergence (%), intra; range of interspecific divergence (%), inter; ID, insufficient data. rbcL-5P Wx:L-3P UPA LSU-D2/D3 ITS # # intra inter # # intra inter # # intra inter # # intra inter # # intra inter seq. spp seq. spp seq. spp seq. spp. seq. spp. Acrosiphonia (n=8) 6 3 0 2.33- 6 3 0- 1.63- 4 4 ID 1.08- 5 3 0 0 6 5 0 0.663- 7.35 0.136 5.85 3.26 1.99 Blidingia (n=2) 1 1 ID ID 1 1 ID ID 2 2 ID 5.15 2 1 ID 2.18 0 0 ID ID Bryopsis (n=2) 2 1 0 ID 2 1 0 ID 2 1 0 ID 0 0 ID ID 0 0 ID ID Cladophora (n=9) 0 0 ID ID 0 0 ID ID 0 0 ID ID 0 0 ID ID 3 3 ID 9.57- 18.6" Codium (n=4) 2 1 0 ID 0 0 ID ID 2 1 0.269 ID 0 0 ID ID 0 0 ID ID Prasiola (n=2) 2 2 ID 0.194 2 2 ID 0 1 1 ID ID 0 0 ID ID 0 0 ID ID Protomonostroma 3 1 0 ID 3 1 0.27 ID 3 1 0 ID 3 1 0 ID 1 1 ID ID (n=3) Ulva (n=43) 41 14 0 0.179- 41 14 0- 0.952- 27 11 0- 0- 36 13 0- 0.352- 2 2 ID 7.07b 3.42 0.272 4.762 1.08 1.09 0.704 3.174 Ulvaria (n=l 1) 11 1 0- ID 11 1 0- ID 10 2 0 ID 8 1 0 ID 2 2 0.759 ID 0.179 0.47 Urospora (n=2) 2 2 ID 0.179 2 2 ID 2.13 2 2 ID 0 2 2 ID 0.165 0 0 ID ID a These sequences were highly divergent, and alignment was difficult. Regions that could not be aligned were excluded. Of the total 1006 nucleotides in this alignment, only 404 nucleotides were compared. b82 unalignable characters were removed from the alignment prior to distance calculation. 176 Table 4.2: Intra- and interspecific variation (% divergence) for the rbcL-3P for successful sequences from the test set plus the 162 additional samples in the extended set. Total number of sequences represented by "n=". ID = insufficient data. Intraspecific Interspecific Variation Variation #of Barcoding Species Min Max Min Max gap Acrosiphonicf (n=45) 7 0 0.271 1.61 7.73 1.34 Blidingia (n=3) 2 0 0 8.61 8.61 8.61 Bryopsis (n=3) 2 0 0 5.43 5.43 5.43 Derbesia (n=3) 2 0 0 3.13 3.13 3.13 Monostroma" (n=l 1) 2 0 0.269 1.08 1.09 0.811 Prasiola" (n=7) 2 0 0 1.35 1.41 1.35 Protomonostroma (n=7) 1 0 0.271 ID ID ID Spongomorpha (n=3) 1 0 0.271 ID ID ID Ulva (n=122) 16 0 0.404 0.736 5.46 0.332 Ulvaria (n=24) 1 0.404 0.409 ID ID ID Urospora (n=3) 3 ID ID 1.10 2.31 ID a Putative cryptic species (see text) were treated as separate species in this analysis. 177 Chapter 5 General conclusions In this thesis I set out to test and apply a DNA barcoding method to three common intertidal genera found in Canada: Fucus, Porphyra and Ulva. The Fucus study was the first brown algal study published to show that DNA barcoding with COI-5P works to distinguish species as well as other markers studied to date. I also uncovered substantial phenotypic plasticity in F. distichus, and matched the previously unidentified mud- embedded dwarf morphologies found in the Pacific to F. distichus. The DNA barcode- based floristic survey of the family Bangiaceae highlighted several cryptic species, two of which were formally described. On the other hand, the results also showed that the Pacific Porphyra cuneiformis is synonymous with the Atlantic P. amplissima and these were formerly synonymized. While a DNA barcode marker universal among all green seaweeds could not be recommended, the work in this thesis highlighted several putative cryptic species in the genera Acrosiphonia, Monostroma, and Ulva. As well, genetic clustering in the rbcL-3P of Ulvaria isolates corresponded to a biogeographic pattern whereby samples from the Pacific and Atlantic formed separate clusters. DNA barcoding was initially advocated as a tool for species identification and discovery and has served well for both of these purposes in this thesis. However, I believe that results from DNA barcoding studies such as those presented here will form the basis of, and direct research in, related questions of species biogeography and evolutionary history. Indeed, DNA barcoding studies have already been used to highlight interesting evolutionary patterns, such as historical hybridization and introgression events (McDevit & Saunders 2010). 178 The science of DNA barcoding has evolved somewhat over the course of this thesis. For example, during my early work on Fucus, a generally accepted rule for successful species discrimination was an order of magnitude difference between the mean intraspecific and mean interspecific DNA divergence values (Hebert et al. 2004). Following the publication of Meier et al. (2008), this measure, though not dismissed, was not considered adequate for assessment of discriminatory power of DNA barcode markers. Instead, the presence of a "barcoding gap", namely that the highest intraspecific divergence must be smaller than the lowest interspecific divergence, was considered necessary for successful species assignments. Even within this new context, my conclusions for the Fucus chapter stand and COI-5P DNA barcoding remains as effective as any other sequence-based marker that has been studied in distinguishing among these closely related species. Considering all three studies together, this thesis demonstrates the efficacy of DNA barcoding at distinguishing among even closely related species. Given that the definition of species is a paradigm conceived to allow effective communication and cataloging of the diversity of life, some practical means of applying species concepts is imperative. The biological species concept (Dobzhansky 1937, Mayr 1942), while intuitively attractive as a mechanistic explanation for species distinctness, may not always be possible (or practical) to test. One working assumption applied throughout this thesis is that the genetic species concept implied in DNA barcoding is a sufficient proxy for the biological species concept. Since reproductive isolation leads to genetic differentiation, it is not unreasonable to apply genetic divergences as a measure of reproductive isolation. In fact, this has been tested directly on a number of occasions in 179 both seaweeds (Zuccarello & West 2003, Zuccarello et al. 2005) and diatoms (Evans et al. 2007) confirming that genetic variation correlates with reproductive isolation. In an exceptional case in the Fucus study, the two most closely related species, F. spiralis and F. vesiculosus, could not be distinguished using the COI-5P. These two species differ in their mating systems (F. spiralis being monoecious and F. vesiculosus being dioecious) and are also distinguished by the presence of paired vesicles on F. vesiculosus. Unfortunately, neither of these characteristics is consistent, likely due to the presence of hybridization between these two species (Wallace et al. 2004, Billard et al. 2005, Engel et al. 2005). What, then, justifies recognition of separate species in this case? Coyer et al. (2006) viewed species designation in Fucus as a sliding scale from "good species", where both DNA sequence and ecological data suggest reproductive isolation, such as the case of F. serratus, and "bad species", which are morphologically and/or ecologically distinct but with molecular data indicating substantial gene flow. Fucus spiralis and F. vesiculosus fall somewhere in the middle of this sliding scale, with evidence for genetic structure only observed with microsatellite data (Engel et al. 2003, Wallace et al. 2004, Billard et al. 2005, Engel et al. 2005). These results together suggest that F. spiralis and F. vesiculosus are either incipient species, in the process of diverging, or are two species in the process of converging back to a single species via hybridization and introgression. Given the extensive evidence for hybridization, combined with molecular evidence suggesting very little divergence, perhaps synonymization of these species should be considered. On the other hand, since microsatellite data can differentiate between them, and no F. vesiculosus individuals have been reported in the Pacific, where F. spiralis does occur, it may be useful to retain their species designations. 180 In Porphyra, interpretation of DNA barcoding results with respect to closely related species pairs was somewhat less complex. The two species observed to have the closest level of genetic divergence were P. abbottiae and P. sp. 1POR and both the rbcL and the COI-5P could distinguish these. A case of two taxa on the boundary between populations and species was also observed in the green algae. Two populations of Ulvaria obscura were differentiated by genetic divergence at the upper limit of intraspecific variability for the r6cL-3P, as defined by observations of intra- and interspecific differences among the other green algae studied here. Geographic distributions of each cluster support recognition of distinct genetic entities: one cluster consisted of all Pacific specimens, and the other of all Atlantic specimens. Further study, applying other markers along with morphological investigations, should shed light on the distinctness of these Ulvaria taxa. These examples serve to illustrate that genetic divergence of DNA barcode markers usually aids in species discrimination by providing discrete delimitation among individuals, even in the case of closely related species. The only exception documented here was the case of F. spiralis and F. vesiculosus; however, the species distinction of these entities should be questioned, given that the only way to differentiate them is to use microsatellites, which are generally considered to apply to population, rather than species level questions (Jarne & Lagoda 1996). The DNA barcode as applied here and in other studies (Robba et al. 2006, Saunders 2008, 2009, Walker et al. 2009, Le Gall & Saunders 2010) can serve well to identify cryptic species. Cryptic species were formerly known as sister species (Knowlton 1993), though now the term sister species refers to those that are each other's closest 181 extant relative. Often, cryptic species are indeed sister to known species (as in Porphyra abbottiae sister to P. sp. 1POR, and P. schizophylla sister to P. sp. 5POR); however, they need not be (e.g., Porphyra peggicovensis). The observations made in this thesis indicate that DNA barcoding, whether applied with the COI-5P marker or an alternative marker, should (and does) aid in the identification of cryptic species even when they are close sisters to known species. It should be noted, however, that species differentiation and species description require different approaches. While DNA barcodes serve well to alert the taxonomist to potential new species, a DNA barcode alone cannot serve to describe a new species, in my opinion. Traditional alpha-taxonomic strategies including morphological and anatomical observations, combined with molecular evidence from more than one marker should be combined to yield a rigorous and holistic description of a new species. Despite ample evidence in the literature (e.g., Hebert et al. 2003, Saunders 2005, Kaila & Stahls 2006, Burns et al. 2007, as well as in this thesis), there is some concern that the DNA barcoding technique will fail to differentiate closely related species (e.g., Meyer & Paulay 2005, Hickerson et al. 2006). Fortunately, instances where species are so genetically similar that DNA barcoding may fail to identify them are exceedingly rare when compared to the wealth of species for which DNA barcoding works. Furthermore, the adaptation of new standards for species-level thresholds (Meier et al. 2008) strengthens the confidence in DNA barcoding as a species identification and discovery tool. DNA barcoding will likely become an indispensible tool for routine species identification. 182 Future research directions One difficulty that was not encountered during the Fucus study, but was a significant hurdle in both the Porphyra and green algal studies, was primer universality. Only a single primer pair was required to amplify and sequence all specimens in the Fucus study, whereas for Porphyra up to 19 different primer combinations were required to attain COI-5P sequences. There is no doubt that primer development is key to the success of DNA barcoding. In Porphyra, development of primers for the COI-5P is a logical next step for application of this marker on a broad scale. One potential solution when a single primer pair cannot be applied to a broad group of organisms is to develop a "primer cocktail". This involves a mixture of primers applied in a single PCR, with different primers aimed at different target organisms. The primer cocktail approach has been applied successfully to DNA barcoding of fish (Ivanova et al. 2007). However, before primer cocktails can be applied, primers capable of amplifying each target organism must be developed. Because it was not possible to recommend a marker for DNA barcoding of the green algae, DNA barcoding was not applied to Ulva on the same scale as in Fucus and Porphyra. While the rbcL-W, as applied in Chapter 4, would serve well for DNA barcoding of Ulva, its lack of universality among other green algae means that more markers should be investigated rather than applying the rbcL-3P to the limited cases (such as Ulva) for which it is effective. An obvious step following the development of a DNA barcode marker for green algae would be application to species rich, and taxonomically difficult clades such as Acrosiphonia and Ulva. Even the preliminary data presented in this thesis drew attention 183 to potential cryptic species within Acrosiphonia, Monostroma and Ulva. Therefore, the potential for broad-scale species discovery in many green algal genera is significant. While the initial promise of DNA barcoding via the COI-5P as a rapid, easy and inexpensive tool for species identification and discovery has been complicated by difficulties in universality of primers, as well as the lack of applicability of the COI-5P to groups such as the green seaweeds, DNA barcoding remains superior to other techniques due to the emphasis on standardization and data quality. One of the great boons of DNA barcoding has been renewed interest and support for taxonomy in Canada (Packer et al. 2009). The work presented here provides ample evidence for the utility of DNA barcoding for species identification and discovery in the Bangiaceae, in Fucus, as well as some lineages of green algae. Furthermore, this thesis lays the groundwork for future development of DNA barcoding in marine green macroalgae thus contributing to the understanding of species diversity among some of the most common seaweeds on our Pacific and Atlantic shores. References Billard, E., Daguin, C., Pearson, G., Serrao, E., Engel, C. & Valero, M. 2005. Genetic isolation between three closely related taxa: Fucus vesiculosus, F. spiralis, and F. ceranoides (Phaophyceae). /. Phycol. 41:900-05. Burns, J. M„ Janzen, D. H., Hajibabaei, M., Hallwachs, W. & Hebert, P. D. N. 2007. DNA barcodes of closely related (but morphologically and ecologically distinct) species of skipper butterflies (Hesperiidae) can differ by only one to three nucleotides. J. Lepid. Soc. 61:138-53. 184 Coyer, J. A., Hoarau, G., Oudot-Le Secq, M. P., Stam, W. T. & Olsen, J. L. 2006. A mtDNA-based phylogeny of the brown algal genus Fucus (Heterokontophyta; Phaeophyta). Mol. Phylogenet. Evol. 39:209-22. Dobzhansky, T. 1937. Genetics and the Origin of Species. Columbia University Press, New York, 364 pp. Engel, C. R., Brawley, S. H., Edwards, K. J. & Serrao, E. 2003. Isolation and cross- species amplification of microsatellite loci from the fucoid seaweeds Fucus vesiculosus, F. serratus and Ascophyllum nodosum (Heterokontophyta, Fucaceae). Mol. Ecol. Notes 3:180-82. Engel, C. R., Daguin, C. & Serrao, E. A. 2005. Genetic entities and mating system in hermaphroditic Fucus spiralis and its close dioecious relative F. vesiculosus (Fucaceae, Phaeophyceae). Mol. Ecol. 14:2033-46. Evans, K. M., Wortley, A. H. & Mann, D. G. 2007. An assessment of potential diatom "barcode" genes (coxl, rbcL, 18S and ITS rDNA) and their effectiveness in determining relationships in Sellaphora (Bacillariophyta). Protist 158:349-64. Hebert, P. D. N., Ratnasingham, S. & deWaard, J. R. 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Lond. B Biol. 270:S96-S99. Hebert, P. D. N., Stoeckle, M. Y., Zemlak, T. S. & Francis, C. M. 2004. Identification of birds through DNA barcodes. PLoS Biol. 2:1657-63. Hickerson, M., Meyer, C. & Moritz, C. 2006. DNA barcoding will often fail to discover new animal species over broad parameter space. Syst. Biol. 55:729-39. Ivanova, N. V., Zemlak, T. S., Hanner, R. H. & Hebert, P. D. N. 2007. Universal primer cocktails for fish DNA barcoding. Mol. Ecol. Notes 7:544-48. Jarne, P. & Lagoda, P. J. L. 1996. Microsatellites, from molecules to populations and back. Trends Ecol. Evol. 11:424-29. Kaila, L. & Stahls, G. 2006. DNA barcodes: Evaluating the potential of COI to diffentiate closely related species of Elachista (Lepidoptera : Gelechioidea : Elachistidae) from Australia. Zootaxa:1-26. Knowlton, N. 1993. Sibling species in the sea. Annu. Rev. Ecol. Syst. 24:189-216. Le Gall, L. & Saunders, G. W. 2010. DNA barcoding is a powerful tool to uncover algal diversity: A case study of the Phyllophoraceae (Gigartinales, Rhodophyta) in the Canadian flora. /. Phycol. 46:374-89. Mayr, E. 1942. Systematics and the origin of species from the viewpoint of a zoologist. Columbia University Press, New York, 334 pp. McDevit, D. C. & Saunders, G. W. 2010. A DNA barcode examination of the Laminariaceae (Phaeophyceae) in Canada reveals novel biogeographical and evolutionary insights. Phycologia. 49:253-248. 186 Meier, R., Zhang, G. & Ali, F. 2008. The use of mean instead of smallest interspecific distances exaggerates the size of the "Barcoding Gap" and leads to misidentification. Syst. Biol. 57:809 - 13. Meyer, C. P. & Paulay, G. 2005. DNA barcoding: Error rates based on comprehensive sampling. PLoS Biol. 3:2229-38. Packer, L., Grixti, J. C., Roughley, R. E. & Hanner, R. 2009. The status of taxonomy in Canada and the impact of DNA barcoding. Can. J. ZoolJRev. Can. Zool. 87:1097- 110. Robba, L., Russell, S. J., Barker, G. L. & Brodie, J. 2006. Assessing the use of the mitochondrial coxl marker for use in DNA barcoding of red algae (Rhodophyta). Am.J.Bot. 93:1101-08. Saunders, G. W. 2005. Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Philos. Trans. R. Soc. Lond. B Biol.Sci. 360:1879-88. Saunders, G. W. 2008. A DNA barcode examination of the red algal family Dumontiaceae in Canadian waters reveals substantial cryptic species diversity. 1. The foliose Dilsea-Neodilsea complex and Weeksia. Botany 86:773-89. Saunders, G. W. 2009. Routine DNA barcoding of Canadian Gracilariales (Rhodophyta) reveals the invasive species Gracilaria vermiculophylla in British Columbia. Molecular Ecology Resources 9:140-50. Walker, R. H., Brodie, J., Russell, S., Irvine, L. M. & Orfanidis, S. 2009. Biodiversity of coralline algae in the northeastern Atlantic including Corallina caespitosa sp. nov. (Corallinoideae, Rhodophyta). J. Phycol. 45:287-97. Wallace, A. L., Klein, A. S. & Mathieson, A. C. 2004. Determining the affinities of salt marsh fucoids using microsatellite markers: Evidence of hybridization and introgression between two species of Fucus (Phaeophyta) in a Maine estuary. J. Phycol. 40:1013-27. Zuccarello, G. C., Schidlo, N., Mclvor, L. & Guiry, M. D. 2005. A molecular re examination of speciation in the intertidal red alga Mastocarpus stellatus (Gigartinales, Rhodophyta) in Europe. Eur. J. Phycol. 40:337-44. Zuccarello, G. C. & West, J. A. 2003. Multiple cryptic species: Molecular diversity and reproductive isolation in the Bostrychia radicans/B. moritziana complex (Rhodomelaceae, Rhodophyta) with focus on North American isolates. J. Phycol. 39:948-59. 188 Appendices Appendix 1: Summary of collection information and GenBank and BOLD Accession numbers for Chapter 2. Field ID and Name BOLD Accession GenBank GenBank Location; Collector" Habitat" Voucher following this DNA ITS Number study" Barcode Accessionb Accession Fucus cottonii-Wke morph - Atlantic collections HK058 F. vesic/F. spir MACR0870-07 EU646751 EU525652 Brave Boat Harbor, ME; upper, in mud HK, GWS HK059 F. vesic/F. spir MACR0871-07 EU646750 ND-H Brave Boat Harbor, ME; upper, in mud HK, GWS HK062 F. vesic/F. spir MACR0872-07 EU646749 EU525653 Brave Boat Harbor, ME; upper, in mud HK, GWS HK316 F. vesic/F. spir MACR0891-07 EU646748 EU525654 McGrath Cove, NS; HK, upper, in mud GWS HK604 F. vesic/F. spir MACR0924-07 EU646752 ND-H Near Letete, NB; HK upper, in mud Fucus cottonii-like morph - Pacific collections GWS002284 Fdist MACR0040-06 EU646708 EU525620 Bamfield, BC; GWS in mud GWS003180 F.dist MACR0049-06 EU646682 ND Bamfield, BC; GWS, in mud KWp w GWS003181 F.dist MACR0050-06 EU646681 ND Bamfield, BC; GWS, in mud KWPW GWS003182 Fdist MACR0051-06 EU646680 ND Bamfield, BC; GWS, in mud KWPAX/ GWS003183 Fdist MACR0052-06 EU646679 ND Bamfield, BC; GWS, in mud RW GWS003I84 Fdist MACR0053-06 EU646678 ND Bamfield, BC; GWS, in mud RW GWS004801 Fdist MACR0833-07 EU646676 ND Prince Rupert, BC; BC, upper DM, GWS HK565 Fdist MACR0914-07 EU646700 EU525624 Bamfield, BC; HK upper, in mud HK566 Fdist MACR0915-07 EU646699 EU525625 Bamfield, BC; HK upper, in mud 00VO HK568 F.dist MACR0916-07 EU646698 EU525626 Bamfield, BC; HK upper, in mud Fucus distichus ssp. anceps GWS007733 F.dist MACR0851-07 EU646664 ND Point Lance, NL; HK, mid DM GWS007734 F.dist MACR0852-07 EU646663 ND Point Lance, NL; HK, mid DM GWS007737 F.dist MACR0853-07 EU646662 ND Point Lance, NL; HK, mid DM GWS007752 F.dist MACR0856-07 EU646660 ND Point Lance, NL; HK, mid DM Fucus distichus ssp. distichus GWS007197 F.dist MACR0846-07 EU646667 ND Bonne Bay, NL; HK, upper, tide pool LLG GWS007749 F.dist MACR0854-07 EU646661 ND Point Lance, NL; HK, mid DM HK078 F.dist MACR0873-07 EU646657 EU525593 Cutts Is., Beach, ME; upper, tide pool HK, GWS HK116 F.dist MACR0877-07 EU646656 EU525594 Prim Point, Brier Is., upper, tide pool NS; HK HK255 F.dist MACR0885-07 EU646650 EU525595 Brier Is., Lighthouse, upper, tide pool NS; HK HK293 F.dist MACR0889-07 EU646648 EU525596 Peggy's Cove, NS; HK upper, tide pool HK598 F.dist MACR0923-07 EU646692 EU525597 Meadow Cove, NB: HK upper, tide pool Fucus distichus ssp. edentatus CSM007A F.dist MACR0037-06 EU646709 EU525598 Cape St. Mary's, NS; lower GWS GWS006994 F. dist MACR0840-07 EU646670 ND Cape Ray, NL; LLG, JU subtidal (3-4m) GWS007013 F.dist MACR0841-07 EU646669 ND Norris Pt. Bonne Bay, subtidal (lm) NL; LLG, JU GWS00734I F.dist MACR0847-07 EU646666 ND St. Davids, NL; LLG, subtidal GWS007589 F.dist MACR0848-07 EU646665 ND Miquelon, France; HK, upper, tide pool LLG, DM HK023 F.dist MACR0863-07 EU646658 EU525599 Pt. Lepreau, NB; HK, low GWS HK151 F.dist MACR0878-07 EU646655 EU525600 Prim Point, Brier Is., mid NS; HK HK240 F.dist MACR0884-07 EU646651 EU525601 Brier Is., Lighthouse, mid-low NS; HK HK301 F.dist MACR0890-07 EU646647 EU525602 Peggy's Cove, NS; HK mid HK635 F.dist M ACR0931 -07 EU646690 EU525603 Ingonish, NS; HK mid-upper Fucus distichus ssp. evanescens HK194 F.dist MACR0881-07 EU646654 EU525605 Digby, NS; HK mid HK201 F.dist MACR0882-07 EU646653 EU525606 Pond Cove, Brier Is., mid, tide pool NS; HK HK235 F.dist MACR0883-07 EU646652 EU525607 Brier Is., Lighthouse, mid-low NS; HK HK261 F.dist MACR0887-07 EU646649 EU525608 Peggy's Cove, NS; HK mid, tide pool HK575 F.dist MACR0921-07 EU646693 EU525609 Grand Manan Is., NB; low HK HK609 F.dist MACR0925-07 EU646691 EU525610 Letete Lighthouse, NB; low HK HK649 F.dist MACR0934-07 EU646689 EU525611 Ingonish, NS; HK mid-upper HK656 F.dist MACR0935-07 EU646688 EU525604 Ingonish, NS; HK mid-upper Fucus gardneri HK007 F.dist MACR0860-07 EU646659 ND Seppings Is., Bamfield, lowest of Fucus BC; HK HK363 F.dist MACR0895-07 EU646644 EU525612 Nanaimo, BC; HK mid HK411 F.dist MACR0898-07 EU646641 EU525615 Nanaimo, BC; HK drift HK429 F.dist MACR0902-07 EU646638 EU525618 Burnaby, BC; HK upper HK466 F.dist MACR0904-07 EU646637 ND Dixon Is., Bamfield, lower BC; HK HK574 F.dist MACR0920-07 EU646694 EU525619 Wizard Is., Bamfield, mid BC; HK Fucus gardneri - rigid morph HK370 F.dist MACR0896-07 EU646643 EU525613 Nanaimo, BC; HK mid HK393 F.dist MACR0897-07 EU646642 EU525614 Nanaimo, BC; HK upper HK412 F.dist MACR0899-07 EU646640 EU525616 Nanaimo, BC; HK drift HK413 F.dist MACR0900-07 EU646639 EU525617 Nanaimo, BC; HK drift Fucus serratus DM05-014 F. serr MACR0091-06 EU646717 ND Pomquet Harbour, NS; mid DM GWS002293 F. serr MACR0054-06 EU646716 EU525637 Isle Madame, NS; GWS subtidal GWS007819 F.serr MACR0857-07 EU646710 ND White Point, Cape subtidal Breton, NS; LLG, DM HK620 F. serr MACR0927-07 EU646715 EU525638 Covehead Harbour, PEI; upper HK HK621 F. serr MACR0928-07 EU646714 ND Covehead Harbour, PEI; upper HK HK624 F. serr MACR0929-07 EU646713 ND Sydney, ferry terminal, upper NS; BM HK634 F. serr MACR0930-07 EU646712 EU525639 Ingonish, NS; HK mid-upper LLG157 F.serr MACR0936-07 EU646711 EU525640 Cape George, NS; LLG lower Fucus spiralis - Atlantic collections CSM009A F. vesic/F. spir MACR0055-06 EU646738 EU525641 Cape St. Mary's, NS; upper GWS GWS006963 F. vesic/F. spir MACR0839-07 EU646732 ND Whycocomagh, NS; upper HK, LLG GWS007590 F. vesic/F. spir MACR0849-07 EU646728 ND Miquelon, France; HK, upper, tide pool LLG, DM GWS007630 F. vesic/F. spir MACR0850-07 EU646727 ND Miquelon, France; HK, upper LLG, DM GWS007751 F. vesic/F. spir MACR0855-07 EU646726 ND Point Lance, NL; DM, upper HK HK017 F. vesic/F. spir MACR0861-07 EU646723 EU525644 Bay near Lepreau, NB; upper HK HK096 F. vesic/F. spir MACR0876-07 EU646721 EU525645 St. Andrew's, NB; HK upper HK257 F. vesic/F. spir MACR0886-07 EU646720 EU525646 Peggy's Cove, NS; HK upper HK617 F. vesic/F. spir MACR0926-07 EU646736 ND Letete Lighthouse, NB; upper HK HK640 F. vesic/F. spir MACR0932-07 EU646735 ND-H Ingonish, NS; HK mid-upper GWS007042 F. dist MACR0843-07 EU646668 ND St. Paul salt marsh, NL; in brook, on cobl LLGHK Fucus spiralis - Arctic collection GWS005225 F. dist MACR0344-06 EU646733 ND Churchill, MB; DM, subtidal (3m) BC, GWS Fucus spiralis - Pacific collections GWS004800 F. vesic/F. spir MACR0832-07 EU646734 ND Prince Rupert, BC; DM, upper BC, GWS HK003 F. vesic/F. spir MACR0858-07 EU646725 EU525642 Seppings Is., Bamfield, upper BC; HK HK004 F. vesic/F. spir MACR0859-07 EU646724 EU525643 Seppings Is., Bamfield, upper BC; HK HK545 F. vesic/F. spir MACR0913-07 EU646737 EU525651 Seppings Is., Bamfield, upper BC; HK HK427 F. vesic/F. spir MACR0901-07 EU646719 EU525649 Burnaby, BC; HK upper HK435 F. vesic/F. spir MACR0903-07 EU646718 EU525650 Burnaby, BC; HK upper GWS004799 F. dist MACR0831-07 EU646677 ND Prince Rupert, BC; DM, upper BC, GWS GWS004832 F. dist MACR0835-07 EU646674 ND Prince Rupert, BC; DM, mid-upper BC, GWS GWS004834 F. dist MACR0837-07 EU646672 ND Prince Rupert, BC; DM, upper on cobble BC,GWS GWS004835 F. dist MACR0838-07 EU646671 ND Prince Rupert, BC; DM, upper BC, GWS HK333 F. dist MACR0893-07 EU646646 EU525647 Vancouver, BC; HK upper HK344 F. dist MACR0894-07 EU646645 EU525648 Vancouver, BC; HK upper HK536 F. dist MACR0909-07 EU646704 ND Seppings Is., Bamfield, mid BC; HK HK538 F. dist MACR0910-07 EU646703 ND Seppings Is., Bamfield, upper BC; HK HK540 F. dist M ACR0911 -07 EU646702 ND Seppings Is., Bamfield, upper BC; HK HK541 F. dist MACR0912-07 EU646701 ND Seppings Is., Bamfield, upper BC; HK Fucus spiralis undulate morph GWS003165 F. dist MACR0041-06 EU646707 ND Bamfield, BC; GWS, sheltered bay RW GWS003166 F. dist MACR0042-06 EU646706 EU525627 Bamfield, BC; GWS, upper, sheltered bay RW GWS003167 F.dist MACR0043-06 EU646705 EU525628 Bamfield, BC; GWS, upper, sheltered bay RW GWS003168 F.dist MACR0044-06 EU646687 ND Bamfield, BC; GWS, upper, sheltered bay RW GWS003169 F.dist MACR0045-06 EU646686 EU525629 Bamfield, BC; GWS, upper, sheltered bay RW GWS003175 F.dist MACR0046-06 EU646685 EU525630 Bamfield, BC; GWS, mid, sheltered bay RW GWS003176 F.dist ND ND EU525631 Bamfield, BC; GWS, mid, sheltered bay RW GWS003177 F.dist MACR0047-06 EU646684 EU525632 Bamfield, BC; GWS, mid, sheltered bay RW GWS003178 F.dist ND ND EU525633 Bamfield, BC; GWS, mid, sheltered bay RW GWS003179 F.dist MACR0048-06 EU646683 ND Bamfield, BC; GWS, mid, sheltered bay RW HK571 F.dist MACR0917-07 EU646697 EU525634 Bamfield, BC; HK upper, sheltered bay HK572 F. dist MACR0918-07 EU646696 EU525635 Bamfield, BC; HK upper, sheltered bay HK573 F. dist MACR0919-07 EU646695 EU525636 Bamfield, BC; HK upper, sheltered bay Fucus vesiculosus GWS007031 F. vesic/F. spir MACR0842-07 EU646731 ND Norris Pt. Bonne Bay, subtidal (lm) NL; LLG, JU GWS007106 F .vesic/F. spir MACR0844-07 EU646730 ND Bonne Bay, NL; LLG, subtidal (lm) JU GWS007169 F. vesic/F. spir MACR0845-07 EU646729 ND Bonne Bay, NL; HK, mid LLG, JU HK018 F. vesic/F. spir MACR0862-07 EU646746 ND-H Bay near Lepreau, NB; upper, sheltered bay HK,GWS HK024 F. vesic/F. spir MACR0864-07 EU646745 ND Pt. Lepreau, NB; HK, mid GWS HK025 F. vesic/F. spir MACR0865-07 EU646744 EU525655 Pt. Lepreau, NB; HK, mid GWS HK084 F. vesic/F. spir MACR0874-07 EU646743 EU525656 Cutts Is., Beach, ME; mid/upper, exposed HK, GWS HK092 F. vesic/F. spir MACR0875-07 EU646742 EU525657 St. Andrew's, NB; HK, mid GWS HK 175 F. vesic/F. spir MACR0879-07 EU646741 ND-H Saint John, NB; GWS upper HK179 F. vesic/F. spir MACR0880-07 EU646740 EU525658 Saint John, NB; GWS upper HK268 F. vesic/F. spir MACR0888-07 EU646739 EU525659 Peggy's Cove, NS; HK upper HK644 F. vesic/F. spir MACR0933-07 EU646747 ND-H Ingonish, NS; HK mid-upper Fucus vesiculosus var. spiralis HK033 F. vesic/F. spir MACR0866-07 EU646756 EU525660 Calais, ME; HK, GWS upper, sheltered bay HK034 F. vesic/F. spir MACR0867-07 EU646755 ND Pembroke, ME; HK, upper, sheltered bay GWS HK050 F. vesic/F. spir MACR0868-07 EU646754 EU525661 Pembroke, ME; HK, upper, sheltered bay GWS HK318 F. vesic/F. spir MACR0892-07 EU646753 ND-H McGrath Cove, NS; HK, upper, drift GWS HK593 F. vesic/F. spir MACR0922-07 EU646757 ND Grand Manan Island, upper, sheltered bay NB; HK lidentified Fucus GWS004819 F. dist MACR0834-07 EU646675 ND Prince Rupert, BC; DM, upper BC.GWS GWS004833 F. dist MACR0836-07 EU646673 ND Prince Rupert, BC; DM, upper BC, GWS HK054 F. vesic/F. spir MACR0869-07 EU646722 ND-H Pembroke, ME; HK, upper, sheltered bay GWS HK523 F.dist MACR0905-07 EU646636 ND Seppings Is., Bamfield, lower BC; HK HK526 F.dist MACR0906-07 EU646635 ND Seppings Is., Bamfield, lower BC; HK HK528 F.dist MACR0907-07 EU646634 ND Seppings Is., Bamfield, mid BC; HK HK530 F. dist MACR0908-07 EU646633 ND Seppings Is., Bamfield, mid BC; HK a Name following this study refers to the genetic species group to which each specimen was assigned according to DNA barcode and ITS results, abbreviations are: F.dist, F. distichus; F. serr, F. serratus; F. spir/F. vesic, F. vesiculosus/spiralis species group. b ND refers to No Data (ITS or Barcode not sequenced). ND - H refers to samples that could not be sequenced due to within- individual heterogeneity (see text). c Collectors initials: HK, Hana Kucera; GWS, Gary Saunders; LLG, Line Le Gall; JU, Jose Maria Utge Buil; DM, Dan McDevit; BC Bridgette Clarkston; BM, Brian McDonald; RW, Rodney Withall. d Habitat refers to height in intertidal; all specimens were collected on rock unless otherwise noted. o ON Appendix 2: Supplementary single strand ITS sequences for Chapter 2. Voucher BOLD Number Field IDa Genetic IDb Location; Collector Habitat0 Accession HK461 F. distichus F. distichus Dixon Is., Bamfield, BC HK lower FUCUI001-08 HK462 F. distichus F. distichus Dixon Is., Bamfield, BC HK lower FUCUI002-08 HK463 F. distichus F. distichus Dixon Is., Bamfield, BC HK lower FUCUI003-08 HK464 F. distichus F. distichus Dixon Is., Bamfield, BC HK lower FUCUI004-08 HK465 intermediate F. distichus Dixon Is., Bamfield, BC HK lower FUCUI005-08 HK470 F. distichus F. distichus Dixon Is., Bamfield, BC HK mid FUCUI006-08 HK471 F. spiralis F. distichus Dixon Is., Bamfield, BC HK mid FUCUI007-08 HK472 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK mid FUCUI008-08 HK473 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK upper FUCUI009-08 HK474 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK upper FUCUIO10-08 HK476 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK upper FUCUI011-08 HK477 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK upper FUCUIO 12-08 HK478 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK upper FUCUIO 13-08 HK479 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK upper FUCUIO 14-08 HK480 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK upper FUCUIO15-08 HK481 F. spiralis F. spiralis Dixon Is., Bamfield, BC HK upper FUCUIO 16-08 HK494 intermediate F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUIO17-08 HK495 intermediate F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUIO 18-08 HK496 F. distichus F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUIO19-08 HK497 F. distichus F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUI020-08 HK498 F. distichus F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUI021-08 HK499 F. distichus F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUI022-08 HK500 intermediate F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUI023-08 HK501 intermediate F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUI024-08 HK509 intermediate F. distichus Brady's Beach, Bamfield, BC; HK lower FUCUI025-08 HK510 intermediate F. distichus Brady's Beach, Bamfield, BC; HK mid FUCUI026-08 HK511 intermediate F. distichus Brady's Beach, Bamfield, BC; HK mid FUCUI027-08 HK512 intermediate F. distichus Brady's Beach, Bamfield, BC; HK mid FUCUI028-08 HK513 F. spiralis F. spiralis Brady's Beach, Bamfield, BC; HK upper FUCUI029-08 HK514 F. spiralis F. spiralis Brady's Beach, Bamfield, BC; HK upper FUCUI030-08 HK515 F. spiralis F. spiralis Brady's Beach, Bamfield, BC; HK upper FUCUI031-08 HK516 F. spiralis F. spiralis Brady's Beach, Bamfield, BC; HK upper FUCUI032-08 HK518 intermediate F. distichus Brady's Beach, Bamfield, BC; HK upper FUCUI033-08 HK519 intermediate F. distichus Brady's Beach, Bamfield, BC; HK upper FUCUI034-08 HK520 intermediate F. distichus Brady's Beach, Bamfield, BC; HK upper FUCUI035-08 HK523 intermediate F. distichus Seppings Is., Bamfield, BC; HK lower FUCUI061-08 HK526 intermediate F. distichus Seppings Is., Bamfield, BC; HK lower FUCUI054-08 HK528 intermediate F. distichus Seppings Is., Bamfield, BC; HK mid FUCUI055-08 HK530 intermediate F. distichus Seppings Is., Bamfield, BC; HK mid FUCUI056-08 HK536 intermediate F. distichus Seppings Is., Bamfield, BC; HK upper FUCUI057-08 HK538 intermediate F. distichus Seppings Is., Bamfield, BC; HK upper FUCUI058-08 HK540 F. spiralis F. distichus Seppings Is., Bamfield, BC; HK upper FUCUI059-08 HK541 F. spiralis F. distichus Seppings Is., Bamfield, BC; HK upper FUCUI060-08 HK542 F. spiralis F. distichus Seppings Is., Bamfield, BC; HK upper FUCUI036-08 HK544 F. spiralis F. distichus Seppings Is., Bamfield, BC; HK upper FUCUI037-08 HK545 F. spiralis F. spiralis Seppings Is., Bamfield, BC; HK upper FUCUI062-08 HK546 intermediate F. distichus Mud Cove, Bamfield, BC; HK lower FUCUI038-08 HK547 intermediate F. distichus Mud Cove, Bamfield, BC; HK lower FUCUI039-08 HK548 intermediate F. distichus Mud Cove, Bamfield, BC; HK lower FUCUI040-08 HK549 intermediate F. distichus Mud Cove, Bamfield, BC; HK lower FUCUI041-08 HK550 intermediate F. distichus Mud Cove, Bamfield, BC; HK lower FUCUI042-08 HK552 intermediate F. distichus Mud Cove, Bamfield, BC; HK mid FUCUI043-08 HK553 intermediate F. distichus Mud Cove, Bamfield, BC; HK mid FUCUI044-08 HK554 intermediate F. distichus Mud Cove, Bamfield, BC; HK mid FUCUI045-08 HK555 intermediate F. distichus Mud Cove, Bamfield, BC; HK mid FUCUI046-08 HK556 intermediate F. distichus Mud Cove, Bamfield, BC; HK mid FUCUI047-08 HK557 intermediate F. distichus Mud Cove, Bamfield, BC; HK mid FUCUI048-08 HK558 F. spiralis F. distichus Mud Cove, Bamfield, BC; HK upper FUCUI049-08 HK559 F. spiralis F. distichus Mud Cove, Bamfield, BC; HK upper FUCUI050-08 HK560 F. spiralis F. spiralis Mud Cove, Bamfield, BC; HK upper FUCUI051-08 HK561 F. spiralis F. spiralis Mud Cove, Bamfield, BC; HK upper FUCUI052-08 HK562 F. spiralis F. spiralis Mud Cove, Bamfield, BC; HK upper FUCUI053-08 a Identification based on morphological characteristics. In cases of ambiguity of identification "intermediate" was given. b Genetic identification based on single strand ITSl sequences. c Habitat refers to height in the intertidal. All specimens were attached to rock. v© Appendix 3: Specimens examined in Chapter 3. Specimens examined in Chapter 3a and presented with their taxonomic designations following our genetic determinations. Species and COI-5P rbcL UPA Sample ID Habitat Collection Location Collectors'1 BOLD IDC Genbank Genbank Genbank Bangia fuscopurpurea (Dillwyn) Lyngbye GWS001869 mid to lower intertidal on Brenton Pt., Newport, RI GWS& ABMMC1273-07 XXXXXX XXXXXX ND rock RW Bangia sp. 1BAN GWS004431 upper intertidal on rock Botanical Beach, Port GWS, BC ABMMC3802-09 XXXXXX XXXXXX XXXXXX Renfrew, Vancouver I., BC & DM GWS004653 upper intertidal on rock inside Kelsey Bay, Vancouver BC & DM PQRPH006-09 ND ND XXXXXX breakwater Island, BC GWS004658 upper intertidal on rock open Kelsey Bay, Vancouver BC & DM PORPH007-09 ND XXXXXX XXXXXX side breakwater Island, BC GWS006406 subtidal (1 ft snorkel) on rock Whiffen Spit, Vancouver DM,BC, ABMMC3484-08 XXXXXX XXXXXX ND Island, BC KR&SH Bangia sp. 2BAN GWS002652 lower rocks of intertidal Letete, Bay of Fundy, NB GWS ABMMC2888-08 XXXXXX ND XXXXXX GWS002659 upper midintertidal on Peggys Cove, NS GWS ABMMC2889-08 XXXXXX ND ND exposed coast, on rock forming a rich zone GWS002674 upper intertidal on rock, Cape Elizabeth, near GWS ABMMC2890-08 XXXXXX ND ND exposed Portland, ME GWS002682 low intertidal on rock Samoset Resort, ME GWS ABMMC3479-08 XXXXXX ND ND GWS005916 low intertidal on rock forming SE of Beaver Harbour, Bay GWS ABMMC2897-08 XXXXXX XXXXXX ND extensive turfs of Fundy, NB GWS005932 on rock, low intertidal Letete, Bay of Fundy, NB GWS ABMMC3804-09 XXXXXX ND ND N> O o GWS006061 mid intertidal on rock Narragansett, RI GWS,BC, ABMMC 1680-07 XXXXXX ND ND DM, SC & SH GWS006128 mid upper intertidal on rock Escoumins (old ferry GWS, DM ABMMC2900-08 XXXXXX ND ND terminal), QC & HK GWS006129 mid upper intertidal on rock Escoumins (old ferry GWS, DM ABMMC2901-08 XXXXXX ND ND terminal), QC & HK GWS006130 mid upper intertidal on rock Escoumins (old ferry GWS, DM ABMMC3483-08 XXXXXX ND ND terminal), QC & HK GWS007743 high intertidal on rock Point Lance, NL LLG, HK, ABMMC440-06 XXXXXX ND ND DM & JU GWS009382 low intertidal on rock Escoumins (Rue des GWS, BC ABMMC2929-08 XXXXXX XXXXXX ND Pilotes), QC & DM GWS009810 mid intertidal on rock Peggys Cove, NS HK & SH ABMMC3514-08 XXXXXX ND ND exposed front GWS009851 upper intertidal on rock Port Bickerton Lighthouse, HK & SH ABMMC3521-08 XXXXXX ND ND NS Porphyra abbottiae V. Krishnamurthy GWS004880 subtidal (40 ft) on invert Tree Knob Islands, Prince GWS, BC ABMMC3481 -08 XXXXXX XXXXXX ND Rupert, BC & DM GWS006737 upper mid intertidal on rock Friendly Cove, Tahsis, BC DM, BC, ABMMC2367-08 XXXXXX XXXXXX XXXXXX KR&HK GWS008329 upper intertidal on rock Ridley Island (south of coal GWS,BC, ABMMC2916-08 XXXXXX XXXXXX ND terrminal), Prince Rupert, DM & KR BC GWS008348 mid intertidal pool on rock Ridley Island (south of coal GWS, BC, ABMMC2917-08 XXXXXX XXXXXX XXXXXX terrminal), Prince Rupert, DM & KR BC GWS009972 high intertidal on rock, semi- Tahsis, Island #40 on GWS & BC ABMMC3523-08 XXXXXX XXXXXX XXXXXX exposed Esperenza Inlet Chart, BC N> O GWSO13021 upper intertidal on rock Scudder Point, Burnaby GWS& ABMMC4179-09 XXXXXX ND ND Island, Gwaii Haanas, BC DM GWSO 13032 low intertidal on mussel Scudder Point, Burnaby GWS& PORPH047-09 XXXXXX XXXXXX XXXXXX Island, Gwaii Haanas, BC DM GWSO 13108 upper intertidal on mussel Ramsey Island (point GWS& PORPH051 -09 XXXXXX XXXXXX XXXXXX adjacent Kloo Rock), Gwaii DM Haanas, BC GWSO 13127 mid intertidal on rock Ramsey Island (point GWS& PORPH053-09 XXXXXX XXXXXX XXXXXX adjacent Kloo Rock), Gwaii DM Haanas, BC Porphyra aestivalis S.C. Lindstrom & S. Fredericq GWSO13193 upper intertidal on cobble Ramsey Island (beach on GWS& PORPH054-09 ND XXXXXX ND NW coast), Gwaii Haanas, DM BC Porphyra amplissima (Kjellman) Setchell & Hus ex Hus GWS002653 lower rocks of intertidal Letete, Bay of Fundy, NB GWS ABMMC 1212-07 XXXXXX ND ND GWS002654 lower rocks of intertidal Letete, Bay of Fundy, NB GWS ABMMC 1213-07 XXXXXX ND ND GWS003005 drift on worm tube Bradys Beach, Bamfield, GWS ABMMC1217-07 XXXXXX ND ND BC GWS003691 on Chondrus, low intertidal Letete, Bay of Fundy, NB HK ABMMC 1228-07 XXXXXX ND ND pools GWS003693 on Fucus, low intertidal Letete, Bay of Fundy, NB HK ABMMC1229-07 XXXXXX XXXXXX ND GWS003696 on rock, low intertidal Letete, Bay of Fundy, NB HK ABMMC 1231 -07 XXXXXX ND ND GWS003697 on rock, low intertidal Letete, Bay of Fundy, NB HK ABMMC 1232-07 XXXXXX ND ND GWS003702 on Dumontia, sheltered Letete Pool, Bay of Fundy, HK ABMMC 1234-07 XXXXXX ND ND midintertidal pool, NB GWS003704 on Dumontia, sheltered Letete Pool, Bay of Fundy, HK ABMMC 1235-07 XXXXXX ND XXXXXX midintertidal pool. NB GWS003727 subtidal (5 m), on rocks & Pettes Cove, Grand Manan, GWS, BC ABMMC 1236-07 XXXXXX ND XXXXXX algae NB & DM to Oto GWS003824 low intertidal pool on kelp Lepreau, Bay of Fundy, NB HK ABMMC 1244-07 XXXXXX ND ND stipe GWS004180 on Desmarestia, subtidal (15 Otter Point, Vancouver GWS, BC ABMMC2303-08 XXXXXX ND ND ft) Island, BC & DM GWS004220 drift Whiffen Spit, Vancouver GWS,BC PORPH005-09 ND ND XXXXXX Island, BC & DM GWS005063 low intertidal on barnacle Ridley Island (south of coal GWS, BC ABMMC2306-08 XXXXXX ND ND terrminal), Prince Rupert, & DM BC GWS005083 drift Ridley Island (north of grain GWS, BC ABMMC2307-08 XXXXXX ND XXXXXX terrminal), Prince Rupert, & DM BC GWS005186 subtital at 20 ft on rock Meadow Cove, NB GWS & BC ABMMC 1687-07 XXXXXX ND ND GWS005769 low intertidal on cobble Simpson Island, Bay of Atlantic PORPH023-09 ND ND XXXXXX Fundy, NB Reference Centre: NAGISA crew 2007 GWS005929 on rock, low intertidal Letete, Bay of Fundy, NB GWS ABMMC2326-08 XXXXXX ND ND GWS005930 on rock, low intertidal Letete, Bay of Fundy, NB GWS ABMMC2327-08 XXXXXX ND ND GWS006109 low intertidal on Fucus in Escoumins (cross point in GWS, DM ABMMC2339-08 XXXXXX ND ND saltwater flow channels town), QC & HK GWS006111 low intertidal on mussel in Escoumins (cross point in GWS, DM ABMMC2341-08 XXXXXX ND ND saltwater flow channels town), QC & HK GWS006161 low intertidal on Fucus Escoumins (Rue des GWS & ABMMC2344-08 XXXXXX ND ND Pilotes), QC DM GWS006180 low intertidal on mussel Escoumins (Rue aux GWS, DM ABMMC2345-08 XXXXXX ND ND Bouchets),QC & HK GWS006183 low intertidal pool on Maces Bay, Lepreau, Bay of SC & KD ABMMC2346-08 XXXXXX ND XXXXXX Dumontia Fundy, NB to ou> GWS006184 low intertidal pool on limpet Maces Bay, Lepreau, Bay of SC & KD AB MMC2664-08 XXXXXX ND ND Fundy, NB GWS006185 low intertidal pool on Maces Bay, Lepreau, Bay of SC & KD ABMMC2665-08 XXXXXX ND XXXXXX Dumontia Fundy, NB GWS006186 low intertidal pool on Maces Bay, Lepreau, Bay of SC & KD ABMMC2347-08 XXXXXX ND ND Dumontia Fundy, NB GWS006281 subtidal (25 ft), gregarious on Meadow Cove, Bay of GWS AB MMC2666-08 XXXXXX ND ND cobble over limited depth Fundy, NB range GWS006282 subtidal (25 ft), gregarious on Meadow Cove, Bay of GWS AB MMC2667-08 XXXXXX ND ND cobble over limited depth Fundy, NB range GWS006369 subtidal, on rock (10 ft) Otter Point, Vancouver DM, BC, ABMMC2351-08 XXXXXX ND ND Island, BC KR & SH GWS006371 subtidal, on rock (10 ft) Otter Point, Vancouver DM, BC, ABMMC2352-08 XXXXXX ND XXXXXX Island, BC KR & SH GWS006398 subtidal (5 ft snorkel) on rock Whiffen Spit, Vancouver DM, BC, ABMMC2354-08 XXXXXX ND ND Island, BC KR & SH GWS006400 subtidal (5 ft snorkel) on Whiffen Spit, Vancouver DM,BC, ABMMC2355-08 XXXXXX XXXXXX ND brown alga Island, BC KR & SH GWS006491 mid lower intertidal on rock Stephenson Pt., Nanaimo, DM,BC, ABMMC2359-08 XXXXXX ND ND BC KR & SH GWS006577 subtidal (25 ft) on work tubes Tahsis Nuchatliz Island, BC,DM, ABMMC2361-08 XXXXXX ND XXXXXX (#37 on Esperenza Inlet KR & SH Chart), BC GWS006908 on bryozoan in area of rapid Lepreau, NB LLG, SC & ABMMC2370-08 XXXXXX ND ND tidal flow JU GWS006984 subtidal on rock (3-5 m) Cape Ray, NL LLG & JU ABMMC2372-08 XXXXXX ND ND GWS006985 subtidal on rock (3-5 m) Cape Ray, NL LLG&JU ABMMC2373-08 XXXXXX ND XXXXXX GWS008177 drift Scott's Bay, Bamfield,BC HK ABMMC2404-08 XXXXXX ND ND to o 45- GWS008252 mid intertidal on rock Bradys Beach, Bamfield, DM, BC, PORPHO19-09 ND XXXXXX XXXXXX BC KR&HK GWS008305 upper mid intertidal pool on Butze Rapids, Prince GWS, BC, ABMMC2698-08 XXXXXX ND ND rock Rupert, BC DM&KR GWS008347 mid intertidal pool on rock Ridley Island (south of coal GWS, BC, ABMMC2406-08 XXXXXX ND ND terrminal), Prince Rupert, DM&KR BC GWS008604 low intertidal on Gracilaria Comox Marina Breakwater, GWS, BC, PORPH022-09 ND ND XXXXXX BC DM&KR GWS008668 mid intertidal on rock Point Holmes, Comox, BC GWS, BC, ABMMC2699-08 XXXXXX ND ND DM&KR GWS008669 mid intertidal on rock Point Holmes, Comox, BC GWS, BC, ABMMC2408-08 XXXXXX ND ND DM&KR GWS009003 on rock, subtidal (20 ft) Scott's Bay, Bamfield, BC GWS & BC ABMMC2700-08 XXXXXX ND ND GWS009072 drift Bradys Beach, Bamfield, GWS & BC ABMMC2701-08 XXXXXX ND ND BC GWS009297 on rock, low intertidal pool, Lepreau, Bay of Fundy, NB HK ABMMC3488-08 XXXXXX ND ND exposed GWS009338 low intertidal on rock or low Escoumins (Rue aux GWS, BC ABMMC2927-08 XXXXXX ND ND algae Bouchets), QC & DM GWS009339 low intertidal on rock or low Escoumins (Rue aux GWS, BC ABMMC2928-08 XXXXXX ND ND algae Bouchets), QC & DM GWS009631 drift Tahsis, Island #40 on GWS & BC ABMMC2932-08 XXXXXX ND ND Esperenza Inlet Chart, BC GWS009648 drift on Sarcodiotheca Tahsis, Island #40 on GWS & BC ABMMC3490-08 XXXXXX ND XXXXXX Esperenza Inlet Chart, BC GWS009700 mid intertidal on rock Stephenson Pt., Nanaimo, HK & HKI ABMMC3492-08 XXXXXX ND XXXXXX BC GWS009702 mid intertidal on clam shell Stephenson Pt., Nanaimo, HK & HKI ABMMC3493-08 XXXXXX ND ND BC K> O GWS009703 mid intertidal on rock Stephenson Pt., Nanaimo, HK & HKI ABMMC2933-08 XXXXXX ND XXXXXX BC GWS009705 upper intertidal on red alga Stephenson Pt., Nanaimo, HK & HKI ABMMC2935-08 XXXXXX ND XXXXXX BC GWS009709 mid intertidal on rock northern end of Qualicum HK & HKI ABMMC3494-08 XXXXXX ND XXXXXX Beach, BC GWS009726 on rock, in lagoon creek at Manson's Landing Lagoon, HK & HKI ABMMC3813-09 XXXXXX ND ND low tide, but submerged in Cortes Island, BC seawater at high tide GWS009727 on rock, in lagoon creek at Manson's Landing Lagoon, HK & HKI ABMMC2943-08 XXXXXX ND XXXXXX low tide, but submerged in Cortes Island, BC seawater at high tide GWS009728 on rock, in lagoon creek at Manson's Landing Lagoon, HK & HKI ABMMC2944-08 XXXXXX ND XXXXXX low tide, but submerged in Cortes Island, BC seawater at high tide GWS009729 on rock, in lagoon creek at Manson's Landing Lagoon, HK & HKI ABMMC2945-08 XXXXXX ND XXXXXX low tide, but submerged in Cortes Island, BC seawater at high tide GWSO 10062 upper-low intertidal on cobble Tahsis, BC GWS ABMMC3822-09 XXXXXX ND ND GWS010367 subtidal (20 ft) on worm tube PalliserRock,Comox,BC BC, DM & ABMMC3823-09 XXXXXX ND ND KH GWS010374 subtidal (20 ft) on rock PalliserRock,Comox,BC BC, DM & ABMMC3824-09 XXXXXX ND ND KH GWS010589 subtidal (20 ft) on worm tube Bamfield, Wizard I., BC KH & DM ABMMC2950-08 XXXXXX XXXXXX ND GWS010912 mid intertidal on cobble Stephenson Pt., Nanaimo, GWS & PQRPH036-09 ND ND XXXXXX BC DM GWS012702 drift on seagrass Between Wiah Point & GWS & ABMMC4011-09 ND ND XXXXXX Cape Edensaw, NW of DM Masset, Haida Gwaii, BC NJ O as GWSO13354 rapids between upper and Murchison Island Lagoon, GWS & PQRPH056-09 ND XXXXXX ND lower pools, on coralline Gwaii Haanas, BC DM GWSO13355 open coast, low on red algae Murchison Island Lagoon, GWS & PORPH057-09 ND XXXXXX XXXXXX Gwaii Haanas, BC DM GWSO 13418 low intertidal in channel on Burnaby (Dolomite) GWS & PORPH059-09 ND ND XXXXXX red alga Narrows, Gwaii Haanas, BC DM GWSO 13435 low intertidal in channel on Burnaby (Dolomite) GWS & PQRPH061-09 ND XXXXXX XXXXXX rock Narrows, Gwaii Haanas, BC DM LLG001 mid intertidal on Ascophyllum Letete, Bay of Fundy, NB LLG ABMMC 1709-07 XXXXXX ND ND LLG136 exposed site, low intertidal Letete, Bay of Fundy, NB GWS ABMMC2410-08 XXXXXX ND ND zone on rock. LLG193 subtidal (3 m) on rock Deer Island, NB LLG ABMMC2411-08 XXXXXX ND ND LLG196 subtidal (3 m) on rock Deer Island, NB LLG & JU ABMMC3532-08 XXXXXX ND ND Porphyra birdiae Neefus & Mathieson GWS002304 mid intertidal on rock Little Anse, Isle Madame, GWS ABMMC 1209-07 XXXXXX ND XXXXXX Cape Breton, NS GWS002502 mid intertidal on rock Lighthouse on Grand GWS ABMMC1210-07 XXXXXX ND XXXXXX Passage, Brier Island, NS GWS003085 mid intertidal, on rock Harrington Cove, Grand GWS ABMMC 1219-07 XXXXXX ND XXXXXX Manan, NB GWS003695 on rock, low intertidal Letete, Bay of Fundy, NB HK ABMMC 1230-07 XXXXXX ND XXXXXX GWS003701 on rock, mid intertidal Letete, Bay of Fundy, NB HK ABMMC 1233-07 XXXXXX XXXXXX XXXXXX GWS007081 subtidal (1 m) Bonne Bay Station, NL LLG & JU ABMMC2375-08 XXXXXX XXXXXX XXXXXX GWS007788 upper intertidal on rock White Pt., NS HK ABMMC2388-08 XXXXXX ND XXXXXX GWS007789 upper intertidal on rock White Pt., NS HK ABMMC2389-08 XXXXXX ND XXXXXX O -J GWS009891 mid intertidal on rock shaded Beaver Harbour, NB GWS ABMMC3820-09 XXXXXX ND ND under low deep ledge GWS011900 on rock, low intertidal Swallow Tail Lighthouse, JB ABMMC3827-09 XXXXXX ND ND Grand Manan, NB LLG007 intertidal on rock Little Anse, Isle Madame, LLG ABMMC1258-07 XXXXXX ND ND Cape Breton, NS Porphyra columbina Montagne GWS000129 low intertidal Chacao, Chiloe, Chile BR ABMMC2886-08 XXXXXX XXXXXX ND Porphyra coralticola nom. prov. GWSC014 in crustose coralline under Maces Bay, Lepreau, Bay of GWS ABMMC3531-08 XXXXXXXXXXXX XXXXXX Peyssonnelia (GWS000759) Fundy, NB Porphyra fallax S.C. Lindstrom & K.M. Cole GWS004818 upper intertidal on Fucus Ridley Island (south of coal GWS, BC ABMMC2654-08 XXXXXX ND XXXXXX terrminal), Prince Rupert, & DM BC GWS005175 upper intertidal on mussels Butze Rapids, Prince GWS, BC ABMMC1686-07 XXXXXXXXXXXX ND Rupert, BC & DM GWS006379 upper intertidal on rock Otter Point, Vancouver HK ABMMC2353-08 XXXXXX ND ND Island, BC GWS006380 upper intertidal on rock Otter Point, Vancouver HK ABMMC2668-08 XXXXXX ND XXXXXX Island, BC GWS006401 subtidal (5 ft snorkel) on Whiffen Spit, Vancouver DM, BC, ABMMC2356-08 XXXXXX ND XXXXXX Fucus Island, BC KR & SH GWS006877 low intertidal, exposed, on PachenaBay,Bamfield,BC BC,DM, ABMMC2368-08 XXXXXX ND XXXXXX mussel KR & HK GWS006881 mid intertidal on rock Pachena Bay, Bamfield, BC BC,DM, ABMMC2905-08 XXXXXX ND ND KR & HK GWS006885 mid intertidal on Fucus Pachena Bay, Bamfield, BC BC,DM, ABMMC2906-08 XXXXXX ND ND KR & HK K) O 00 GWS008137 upper intertidal on rock Pachena Bay, Bamfield, BC BC,DM, ABMMC2697-08 XXXXXX ND ND KR&HK GWS009589 high intertidal on rock Snickett Park, Sechelt, BC GWS,BC, ABMMC3489-08 XXXXXX ND ND DM&KH GWS009734 upper mid on barnacle Whytecliff Park, Vancouver,HK&PK ABMMC3498-08 XXXXXX ND ND BC GWS009979 mid intertidal on Tahsis, Island #40 on GWS & BC ABMMC3524-08 XXXXXX ND ND Mastocarpus, semi-exposed Esperenza Inlet Chart, BC GWSO13353 open coast, low intertidal on Murchison Island Lagoon, GWS & PORPH055-09 ND XXXXXX ND mussel Gwaii Haanas, BC DM Porphyra fucicola V. Krishmanurthy GWS004671 upper intertidal on Fucus Kelsey Bay, Vancouver BC & DM ABMMC3803-09 XXXXXX ND ND inside breakwater Island, BC GWS006650 mid intertidal on Mastocarpus Tahsis, Island #40 on BC,DM, ABMMC2363-08 XXXXXX ND XXXXXX Esperenza Inlet Chart, BC KR & SH GWS006651 low intertidal on kelp stipe Tahsis, Island #40 on BC, DM, ABMMC2364-08 XXXXXX XXXXXX XXXXXX Esperenza Inlet Chart, BC KR & SH GWS006684 mid intertidal pool on Tahsis, Island #40 on BC,DM, ABMMC3806-09 XXXXXX ND ND Halosaccion Esperenza Inlet Chart, BC KR & SH GWS006736 upper mid intertidal on Fucus Friendly Cove, Tahsis, BC DM,BC, ABMMC2366-08 XXXXXX XXXXXX XXXXXX KR&HK GWS008183 mid intertidal on Fucus Scott's Bay, Bamfield, BC HK ABMMC3807-09 XXXXXX ND XXXXXX GWS008365 mid intertidal on Fucus Ridley Island (south of coal GWS,BC, ABMMC3808-09 XXXXXX ND XXXXXX terrminal), Prince Rupert, DM & KR BC to ©vo GWS009617 upper intertidal on Fucus Tahsis, Island #40 on GWS & BC PQRPH025-09 ND ND XXXXXX Esperenza Inlet Chart, BC GWS009627 mid intertidal on Fucus Tahsis, Island #40 on GWS & BC ABMMC2930-08 ND ND XXXXXX Esperenza Inlet Chart, BC GWS009658 mid intertidal pool on rock Tahsis, Island #40 on GWS & BC PORPH026-09 ND ND XXXXXX Esperenza Inlet Chart, BC GWS009661 low intertidal on Mastocarpus Tahsis, Island #40 on GWS & BC ABMMC3809-09 XXXXXX ND XXXXXX Esperenza Inlet Chart, BC GWS009670 low intertidal on Halosaccion Tahsis, Island #40 on GWS & BC PQRPH027-09 ND ND XXXXXX Esperenza Inlet Chart, BC GWS009671 mid intertidal on rock Tahsis, Island #40 on GWS & BC ABMMC3810-09 XXXXXX ND Esperenza Inlet Chart, BC GWS009711 upper intertidal on rock northern end of Qualicum HK&HKI PORPH039-09 ND ND XXXXXX Beach, BC GWS009719 upper intertidal on barnacle Smelt Bay, Cortes Island, HK&HKI ABMMC3812-09 XXXXXX ND XXXXXX BC GWS009721 upper intertidal on barnacle Smelt Bay, Cortes Island, HK&HKI PORPH041-09 ND ND XXXXXX BC GWS009722 upper intertidal on barnacle Smelt Bay, Cortes Island, HK & HKI ABMMC2941-08 ND ND XXXXXX BC GWS009725 upper intertidal on alga Smelt Bay, Cortes Island, HK&HKI ABMMC3497-08 XXXXXX ND XXXXXX BC GWSO10334 lower mid intertidal on rock Point Holmes, Comox, BC GWS, DM PORPH031-09 ND ND XXXXXX &KH GWSO10335 lower mid intertidal on Fucus Point Holmes, Comox, BC GWS, DM PORPH032-09 ND ND XXXXXX &KH GWSO 10732 mid-upper intertidal on Dixon I., Bamfield, BC GWS & BC PORPH033-09 ND ND XXXXXX Fucus, sheltered side of island N> © GWSO10895 low intertidal on Bradys Beach, Bamfield, KH & DM PORPH035-09 ND ND XXXXXX Gymnogongrus linearis in BC sandy area GWSO 13419 mid intertidal on Fucus Burnaby (Dolomite) GWS & PORPH060-09 ND XXXXXX XXXXXX Narrows, Gwaii Haanas, BC DM Porphyra gardneri (GM. Smith & Hollenberg) M.W. Hawkes GWS003137 subtidal (ca. 10 ft) on Execution Rock, Bamfield, RW ABMMC1221-07 XXXXXX ND ND Laminaria setchellii BC GWS004028 on Laminaria setchellii, low Bradys Beach, Bamfield, GWS,BC ABMMC2894-08 XXXXXX ND XXXXXX intertidal BC & DM GWS004430 on Laminaria setchellii, low Botanical Beach, Port GWS,BC ABMMC1683-07 XXXXXX ND XXXXXX intertidal Renfrew, Vancouver I., BC, & DM BC GWS004926 subtital 32 ft on Laminaria Stenhouse Reef, Prince GWS & BC ABMMC1685-07 XXXXXX XX) setchelli Rupert, BC GWS006759 low intertidal, exposed side, Friendly Cove, Tahsis,BC DM, BC, ABMMC3486-08 XXXXXX ND ND on Saccharina sessile KR&HK GWS006768 low intertidal, exposed side, Friendly Cove, Tahsis, BC DM, BC, ABMMC2904-08 XXXXXX ND XXXXXX on Saccharina sessile KR&HK GWS008119 low intertidal, exposed, on Pachena Bay, Bamfield, BC BC, DM, ABMMC2696-08 XXXXXX XXXXXX XXXXXX Laminaria setchelli KR&HK GWS008983 subtidal (ca. 30 ft) on Execution Rock, Bamfield, GWS & BC PQRPH024-09 ND ND XXXXXX Laminaria setchellii BC GWS010167 subtidal (20 ft) on Eisenia Tahsis, Flower Islet, GWS & BC ABMMC2947-08 XXXXXX ND XXXXXX Esperanza Channel, BC GWSO 10168 subtidal (20 ft) on Eisenia Tahsis, Flower Islet, GWS & BC ABMMC2948-08 XXXXXX ND ND Esperanza Channel, BC GWSO 10473 subtidal (20 ft) on Laminaria Execution Rock, Bamfield, BC & ST ABMMC3528-08 XXXXXX ND ND setchellii BC GWS010474 subtidal (20 ft) on Laminaria Execution Rock, Bamfield, BC & ST ABMMC3825-09 XXXXXX ND ND setchellii BC GWS010515 subtidal (17 ft) on Laminaria Bamfield, Edward King BC ABMMC3529-08 XXXXXX ND ND setchellii Island, BC GWSO12560 subtidal (40 ft) on Laminaria Tcenakun Point, Chaatl GWS & ABMMC3927-09 XXXXXX ND ND setchellii Island, Haida Gwaii, BC DM GWSO 12594 subtidal 20ft on Desmarestia Chaatl Island across from GWS & ABMMC3941-09 XXXXXX XXXXXX XXXXXX Newton Point, Haida Gwaii, DM BC GWSO 13038 low intertidal on Laminaria Scudder Point, Burnaby GWS & PQRPH048-09 ND ND XXXXXX setchellii Island, Gwaii Haanas, BC DM GWSO 13094 low intertidal on Laminaria Ramsey Island (point GWS & PORPH049-09 XXXXXX XXXXXX XXXXXX setchellii adjacent Kloo Rock), Gwaii DM Haanas, BC Porphyra kanakaensis T.F. Mumford GWS003428 upper intertidal on rock Pachena Beach, Bamfield, GWS,BC PORPH004-09 ND XXXXXX XXXXXX BC & DM GWS006387 high intertidal on rock Whiffen Spit, Vancouver HK PORPHO15-09 ND XXXXXX XXXXXX Island, BC GWS006880 upper intertidal on rock Pachena Bay, Bamfield, BC BC,DM, PORPHO17-09 ND XXXXXX XXXXXX KR&HK GWS010817 on rock, mid-upper intertidal, Seppings I., Bamfield, BC GWS & PORPH034-09 ND XXXXXX XXXXXX exposed BC Porphyra kurogii S.C. Lindstrom GWS008367 mid intertidal on rock Ridley Island (south of coal GWS,BC, ABMMC3487-08 XXXXXX XXXXXX XXXXXX terrminal), Prince Rupert, DM & KR BC GWS009733 upper mid on barnacle Whytecliff Park, Vancouver, HK & PK ABMMC3814-09 XXXXXX XXXXXX XXXXXX BC Porphyra leucosticta Thuret GWS003086 mid intertidal, on Vertebrata Harrington Cove, Grand GWS ABMMC1220-07 XXXXXX ND ND Manan, NB GWS003638 mid pools, on Vertebrata End of public road, GWS, ABMMC 1226-07 XXXXXX ND ND Starboard, ME LLG,DM, SC&CL GWS003668 mid pools, on Vertebrata End of public road, GWS, ABMMC 1227-07 XXXXXX ND ND Starboard, ME LLG,DM, SC&CL GWS003749 on Ascophyllum, low mid Harrington Cove, Grand GWS ABMMC 1238-07 XXXXXX ND ND intertidal Manan, NB GWS003769 on Ascophyllum, mid Harrington Cove, Grand HK ABMMC 1241-07 XXXXXX ND ND intertidal Manan, NB GWS003843 mid intertidal on Vertebrata Lepreau, Bay of Fundy, NB HK ABMMC 1249-07 XXXXXX ND ND GWS005880 on rock, mid intertidal Letete, Bay of Fundy, NB HK ABMMC2323-08 XXXXXX ND XXXXXX GWS005883 on rock, low intertidal Letete, Bay of Fundy, NB GWS ABMMC2324-08 XXXXXX ND XXXXXX GWS005994 upper mid intertidal on Fucus Pier #5, Narragansett, RI SC ABMMC2331 -08 XXXXXX ND ND GWS005995 drift Pier #5, Narragansett, RI SC ABMMC2332-08 XXXXXX ND ND GWS006037 mid upper intertidal in estuary Governor Sprague Bridge GWS, BC, ABMMC2660-08 XXXXXX ND ND on Fucus 17, Narragansett, RI DM, SC & SH GWS006054 upper intertidal on rock Hazard Ave., Narragansett, GWS, BC, ABMMC2335-08 XXXXXX ND XXXXXX RI DM, SC & SH GWS006056 mid intertidal on Mastocarpus Hazard Ave., Narragansett, GWS, BC, ABMMC2336-08 XXXXXX ND ND RI DM, SC & SH GWS006091 subtidal (12 ft) on Fort Wetherill, RI GWS, BC ABMMC2661-08 XXXXXX ND ND Mastocarpus & DM GWS006192 mid intertidal on Vertebrata Meadow Cove, NB DM ABMMC2348-08 XXXXXX XXXXXX ND GWS006904 low mid intertidal on Lepreau, Bay of Fundy, NB LLG, SC ABMMC1251-07 XXXXXX XXXXXX ND Vertebrata &JU GWS007674 high intertidal on rock St. Brides, NL LLG, HK, ABMMC2680-08 XXXXXX ND ND DM & JU GWS007687 low intertidal pool on rock St. Brides, NL LLG,HK, ABMMC2681-08 XXXXXX ND XXXXXX DM & JU GWS007846 low intertidal on rock Cap St. Mir, Digby, NS LLG & JU ABMMC 1253-07 XXXXXX ND XXXXXX GWS007857 mid intertidal pool on rock Cap St. Mir, Digby, NS LLG & JU ABMMC 1255-07 XXXXXX ND ND GWS009302 mid intertidal on Vertebrata, Cape Elizabeth, near GWS, BC ABMMC2923-08 XXXXXX ND ND exposed Portland, ME & DM GWS009741 mid intertidal on Ascophyllum Point Prim Lighthouse, NS HK & SH ABMMC3499-08 XXXXXX ND ND GWS009745 mid intertidal tide pool on Point Prim Lighthouse, NS HK & SH ABMMC3500-08 XXXXXX ND ND Chondrus GWS009763 low intertidal on Mastocarpus Brier Island Northern Light, HK & SH ABMMC3505-08 XXXXXX ND ND NS GWS009802 on rock more sheltered than Peggys Cove, NS HK & SH ABMMC3507-08 XXXXXX ND XXXXXX lighthouse front GWS009807 mid intertidal on Chondrus Peggys Cove, NS HK & SH ABMMC3512-08 XXXXXX ND XXXXXX around the bend (sheltered more than exposed) GWS009895 mid intertidal on Fucus SE of Beaver Harbour, Bay HK ABMMC3522-08 XXXXXX ND ND of Fundy, NB GWS009896 mid intertidal on crustose alga SE of Beaver Harbour, Bay HK ABMMC3821-09 XXXXXX ND ND of Fundy, NB Porphyra linearis Greville GWS002515 low intertidal on rock (smooth Lighthouse at Peggys Cove, GWS ABMMC3478-08 XXXXXX XXXXXX XXXXXX and whitish) NS GWS005678 upper midintertidal on Peggys Cove, NS GWS & ABMMC3482-08 XXXXXX XXXXXX XXXXXX exposed coast, on rock DS GWS009765 low intertidal on rock Brier Island Northern Light, HK & SH ABMMC3817-09 XXXXXX ND XXXXXX NS GWS009808 lower mid intertidal on rock Peggys Cove, NS HK & SH ABMMC3819-09 XXXXXX ND XXXXXX exposed front LLG0037 intertidal on rock Les Escoumins, Off LLG ABMMC1257-07 XXXXXX XXXXXX ND Discovery Centre, QC Porphyra miniata (C. Agardh) C. Agardh GWS002155 mid-upper intertidal, on rock Harrington Cove, Grand GWS ABMMC441-06 XXXXXX ND ND Manan, NB GWS003084 low intertidal, on Harrington Cove, Grand GWS ABMMC1218-07 XXXXXX ND ND Cystoclonium Manan, NB GWS003748 on Mastocarpus, lowest Harrington Cove, Grand GWS ABMMC 1237-07 XXXXXX ND ND intertidal Manan, NB GWS003825 low intertidal pool on algae Lepreau, Bay of Fundy, NB HK ABMMC 1245-07 XXXXXX ND ND GWS003828 lower intertidal on rock Lepreau, Bay of Fundy, NB HK ABMMC 1246-07 XXXXXX ND ND GWS003830 lower intertidal on rock Lepreau, Bay of Fundy, NB HK ABMMC 1247-07 XXXXXX ND XXXXXX GWS003831 lower intertidal on rock Lepreau, Bay of Fundy, NB HK ABMMC 1248-07 XXXXXX ND XXXXXX GWS005191 subtital 20 ft on rock Meadow Cove, NB GWS & ABMMC 1688-07 XXXXXX ND ND BC GWS006108 low intertidal on Fucus in Escoumins (cross point in GWS, DM ABMMC2338-08 XXXXXX XXXXXX XXXXXX saltwater flow channels town),QC & HK GWS006110 low intertidal on Fucus in Escoumins (cross point in GWS, DM ABMMC2340-08 XXXXXX ND ND saltwater flow channels town), QC & HK GWS006112 low intertidal on Fucus in Escoumins (cross point in GWS, DM ABMMC2342-08 XXXXXX ND ND saltwater flow channels town),QC & HK GWS006113 low intertidal on kelp in Escoumins (cross point in GWS, DM ABMMC2343-08 XXXXXX ND ND saltwater flow channels town),QC & HK GWS006114 low intertidal on kelp in Escoumins (cross point in GWS, DM AB MMC2662-08 XXXXXX ND ND saltwater flow channels town), QC & HK GWS006115 low intertidal on kelp in Escoumins (cross point in GWS, DM ABMMC2663-08 XXXXXX ND ND saltwater flow channels town), QC & HK GWS006900 low intertidal pool Lepreau, Bay of Fundy, NB LLG, SC & ABMMC1250-07 XXXXXX ND XXXXXX JU GWS006977 on Corallina at 3-5 m Cape Ray, NL LLG & JU ABMMC2371-08 XXXXXX ND XXXXXX GWS006996 on rock at 3-5 m Cape Ray, NL LLG & JU ABMMC2374-08 XXXXXX ND XXXXXX GWS007675 drift St. Brides, NL LLG,HK, ABMMC2381-08 XXXXXX ND ND DM & JU GWS007684 drift St. Brides, NL LLG, HK, ABMMC2382-08 XXXXXX ND ND DM & JU GWS007716 mid intertidal pool on rock Point Lance, NL LLG, HK, PORPHOl 1-09 ND ND XXXXXX DM & JU GWS007717 mid intertidal pool on rock Point Lance, NL LLG, HK, PORPHO12-09 ND ND XXXXXX DM & JU GWS007744 mid intertidal pool on rock Point Lance, NL LLG, HK, ABMMC2387-08 XXXXXX ND ND DM & JU GWS007838 low intertidal pool on rock Cap St. Mir, Digby, NS LLG & JU ABMMC 1252-07 XXXXXX ND ND GWS007850 low intertidal on Chondrus Cap St. Mir, Digby, NS LLG & JU ABMMC2390-08 XXXXXX ND ND GWS007851 low intertidal on Chondrus Cap St. Mir, Digby, NS LLG & JU ABMMC1254-07 XXXXXX ND ND GWS009758 low intertidal tide pool on Brier Island Northern Light, HK & SH ABMMC3501-08 XXXXXX ND ND branched red NS GWS009759 low intertidal on branched red Brier Island Northern Light, HK & SH ABMMC3502-08 XXXXXX ND ND NS GWS009760 low intertidal tide pool on Brier Island Northern Light, HK & SH ABMMC3503-08 XXXXXX ND ND articulated coralline NS GWS009762 low intertidal on Chondrus Brier Island Northern Light, HK & SH ABMMC3504-08 XXXXXX ND ND NS GWS009764 low intertidal on rock Brier Island Northern Light, HK & SH ABMMC3816-09 XXXXXX ND ND NS K) Os GWS009766 low intertidal on Chondrus Brier Island Northern Light, HK & SH ABMMC3818-09 XXXXXX ND XXXXXX NS GWS009804 low intertidal tide pool Peggys Cove, NS HK & SH ABMMC3509-08 XXXXXX ND XXXXXX exposed front on red alga GWS009845 low intertidal on other algae Port Bickerton Lighthouse, HK & SH ABMMC3515-08 XXXXXX ND ND NS GWS009846 low intertidal on on other Port Bickerton Lighthouse, HK & SH ABMMC3516-08 XXXXXX ND ND algae NS GWS009847 low intertidal on articulated Port Bickerton Lighthouse, HK & SH ABMMC3517-08 XXXXXX ND ND coralline NS GWS009848 low intertidal on articulated Port Bickerton Lighthouse, HK & SH ABMMC3518-08 XXXXXX ND ND coralline NS GWS009849 lower mid intertidal tide pool Port Bickerton Lighthouse, HK & SH ABMMC3519-08 XXXXXX ND ND on other algae NS GWS009850 mid intertidal tide pool on Port Bickerton Lighthouse, HK & SH ABMMC3520-08 XXXXXX ND ND rock NS GWS011866 drift Paddy's Head, Halifax, NS GWS & ABMMC3736-09 XXXXXX ND ND DM GWSO11870 subtidal (18 ft) on other algae Paddy's Head, Halifax, NS GWS & ABMMC3740-09 XXXXXX ND ND DM GWSO11871 subtidal (18 ft) on other algae Paddy's Head, Halifax, NS GWS & ABMMC3741 -09 XXXXXX ND ND DM Porphyra mumfordii S.C. Lindstrom & K.M. Cole GWS005806 upper intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC1691-07 XXXXXX ND ND GWS005807 upper intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2655-08 XXXXXX ND XXXXXX GWS005808 upper intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC1692-07 XXXXXX ND XXXXXX GWS005822 upper mid intertidal, on rock Scott's Bay, Bamfield, BC HK & DR ABMMC 1697-07 XXXXXX ND XXXXXX K> GWS005823 upper mid intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC1698-07 XXXXXX ND ND GWS005824 upper mid intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC2314-08 XXXXXX ND ND GWS005825 upper mid intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC2315-08 XXXXXX ND ND GWS005826 upper mid intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC1699-07 XXXXXX ND ND GWS005830 upper intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC1703-07 XXXXXX ND ND GWS005831 upper intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC2316-08 XXXXXX XXXXXX XXXXXX GWS005832 upper intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC2896-08 XXXXXX ND XXXXXX GWS005850 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC2320-08 XXXXXX XXXXXX ND BC Porphyra nereocystis C.L. Anderson GWS006595 subtidal (3 ft) on Nereocystis Tahsis Nuchatliz Island, BC, DM, ABMMC2673-08 XXXXXX ND XXXXXX stipe (#37 on Esperenza Inlet KR & SH Chart), BC GWS006653 drift on Nereocystis Tahsis, Island #40 on BC, DM, ABMMC2365-08 XXXXXX XXXXXX XXXXXX Esperenza Inlet Chart, BC KR & SH GWS006878 mid intertidal, exposed, on Pachena Bay, Bamfield, BC BC, DM, ABMMC2676-08 XXXXXX ND XXXXXX Nereocystis KR&HK GWS008153 open water on Nereocystis Cape Beale, Bamfield, BC LD ABMMC2401-08 XXXXXX ND XXXXXX stipes GWS008154 open water on Nereocystis Cape Beale, Bamfield, BC LD ABMMC2402-08 XXXXXX ND ND stipes GWS008155 open water on Nereocystis Cape Beale, Bamfield, BC LD ABMMC2403-08 XXXXXX XXXXXX ND stipes GWSO12672 surface on Nereocystis stipe Mazarredo Islands, NW of GWS & ABMMC3992-09 XXXXXX ND XXXXXX Masset, Haida Gwaii, BC DM Porphyra occidentalis Setchell & Hus GWS000624 low intertidal on rock, Seppings I., Bamfield, BC GWS PORPH001-09 ND ND XXXXXX exposed side GWS003353 low intertidal pools on rock Pachena Beach, Bamfield, GWS,BC ABMMC3480-08 XXXXXX ND ND BC & DM GWS003379 drift Pachena Beach, Bamfield, GWS, BC PORPH003-09 ND ND XXXXXX BC & DM GWS003427 drift Pachena Beach, Bamfield, GWS,BC ABMMC2891-08 XXXXXX XXXXXX XXXXXX BC & DM GWS003978 drift Seppings I., Bamfield, BC GWS, BC ABMMC2892-08 XXXXXX ND XXXXXX & DM GWS006372 subtidal, on rock (10 ft) Otter Point, Vancouver DM, BC, ABMMC2902-08 XXXXXX XXXXXX XXXXXX Island, BC KR & SH GWS006584 subtidal (15 ft) Tahsis Nuchatliz Island, BC, DM, ABMMC3805-09 XXXXXX ND XXXXXX (#37 on Esperenza Inlet KR & SH Chart), BC GWS006593 subtidal (25 ft) on kelp stipe Tahsis Nuchatliz Island, BC,DM, ABMMC2903-08 XXXXXX XXXXXX XXXXXX (GWS006594) (#37 on Esperenza Inlet KR & SH Chart), BC GWS006652 drift Tahsis, Island #40 on BC,DM, ABMMC3485-08 XXXXXX ND XXXXXX Esperenza Inlet Chart, BC KR & SH GWS006883 drift Pachena Bay, Bamfield, BC BC, DM, PORPHO18-09 ND ND XXXXXX KR&HK GWS009993 low intertidal on rock, Tahsis, Island #40 on GWS & PORPH028-09 ND ND XXXXXX exposed Esperenza Inlet Chart, BC BC GWS010169 subtidal (20 ft) on rock Tahsis, Flower Islet, GWS & PORPH029-09 ND ND XXXXXX Esperanza Channel, BC BC GWS010209 subtidal (8 ft) on mussel shell Tahsis, Rosa Harbour, GWS & PORPH030-09 ND ND XXXXXX Esperanza Channel, BC BC GWSO10887 low intertidal on rock at Bradys Beach, Bamfield, GWS & ABMMC3826-09 XXXXXX ND ND entrance to cave BC BC GWSO 12571 subtidal (20 ft) on rock Chaatl Island across from GWS & ABMMC3928-09 ND XXXXXX ND Newton Point, Haida Gwaii, DM BC GWSO 12789 Drift Burnaby Island near Saw GWS & ABMMC4075-09 XXXXXX ND ND Reef, Gwaii Haanas, BC DM Porphyra papenfussii V. Krishnamurthy GWS005062 low intertidal on rock Ridley Island (south of coal GWS,BC PORPH008-09 ND XXXXXX XXXXXX terrminal), Prince Rupert, & DM BC GWS005065 low intertidal on rock Ridley Island (south of coal GWS,BC PORPH009-09 ND XXXXXX XXXXXX terrminal), Prince Rupert, & DM BC GWS005082 drift Ridley Island (north of grain GWS, BC PORPH010-09 ND XXXXXX XXXXXX terrminal), Prince Rupert, & DM BC Porphyra peggicovensis notn. prov. GWS001282 upper midintertidal on Peggys Cove, NS GWS PORPH002-09 ND XXXXXX XXXXXX exposed coast, on rock forming a rich zone GWS002660 upper midintertidal on Peggys Cove, NS GWS ABMMC1216-07 ND XXXXXX XXXXXX exposed coast, on rock forming a rich zone GWS005677 upper midintertidal on Peggys Cove, NS GWS & ABMMC1690-07 ND XXXXXX XXXXXX exposed coast, on rock DS forming a rich zone K) O Porphyra perforata J. Agardh GWS002797 on rock, mid intertidal Dixon I., Bamfield, BC GWS& ABMMC2639-08 XXXXXX ND XXXXXX SC GWS002812 on algae, upper intertidal Dixon I., Bamfield, BC GWS& ABMMC2640-08 XXXXXX ND XXXXXX SC GWS003108 semi-exposed on rock, mid- Pachena Beach, Bamfield, GWS ABMMC2641-08 XXXXXX ND ND upper intertidal BC GWS003124 attached to rock, mid-upper Pachena Beach, Bamfield, GWS ABMMC2642-08 XXXXXX ND ND intertidal - common BC GWS003244 mid intertidal on rock Bradys Beach, Bamfield, GWS ABMMC2643-08 XXXXXX ND ND BC GWS003426 mid upper intertidal on rock Pachena Beach, Bamfield, GWS, BC ABMMC1224-07 XXXXXX ND ND BC & DM GWS003923 on rock, upper intertidal Dixon I., Bamfield, BC GWS, BC ABMMC2647-08 XXXXXX ND ND & DM GWS003981 on rock, low intertidal surge Seppings I., Bamfield, BC GWS, BC ABMMC2893-08 XXXXXX ND ND channels & DM GWS003994 on rock, mid intertidal Dixon I., Bamfield, BC CS ABMMC2648-08 XXXXXX ND XXXXXX GWS003995 on rock, mid intertidal Dixon I., Bamfield, BC CS ABMMC2649-08 XXXXXX ND XXXXXX GWS004033 on rock, lower mid intertidal, Bradys Beach, Bamfield, GWS, BC ABMMC2650-08 XXXXXX ND ND sandy area BC & DM GWS004071 on mussels, mid upper Bamfield, Wizard I., BC GWS, BC ABMMC2651-08 XXXXXX ND ND intertidal & DM GWS004140 on rock, subtidal (25 ft) Scott's Bay, Bamfield, BC GWS, BC ABMMC2652-08 XXXXXX ND ND & DM GWS004450 upper intertidal on rock wall Botanical Beach, Port GWS, BC ABMMC2653-08 XXXXXX ND XXXXXX Renfrew, Vancouver I., BC, & DM BC GWS004693 on rock, mid intertidal Palmerston Recreation BC & DM ABMMC1684-07 XXXXXX ND XXXXXX Reserve near Raft Cove, Vancouver Island, BC N> K> GWS005809 upper intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC1693-07 XXXXXX ND ND GWS005810 upper intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC1694-07 XXXXXX ND ND GWS005811 upper intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2656-08 XXXXXX ND ND GWS005812 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2308-08 XXXXXX ND ND GWS005813 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2309-08 XXXXXX ND ND GWS005814 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2310-08 XXXXXX XXXXXX ND GWS005815 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2311-08 XXXXXX ND ND GWS005816 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2312-08 XXXXXX ND ND GWS005817 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2313-08 XXXXXX ND ND GWS005818 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC1695-07 XXXXXX ND ND GWS005819 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2895-08 XXXXXX ND ND GWS005820 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC1696-07 XXXXXX ND ND GWS005821 upper mid intertidal, on rock Aguilar Point, Bamfield, BC HK & DR ABMMC2657-08 XXXXXX ND ND GWS005827 upper mid intertidal, on rock Scott's Bay, Bamfield, BC HK & DR ABMMC1700-07 XXXXXX ND XXXXXX GWS005828 upper mid intertidal, on rock Scott's Bay, Bamfield, BC HK & DR ABMMC1701-07 XXXXXX ND ND GWS005829 upper mid intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC1702-07 XXXXXX ND ND GWS005833 upper intertidal, on rock Scott's Bay, Bamfield, BC HK&DR ABMMC1704-07 XXXXXX ND ND GWS005843 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC2658-08 XXXXXX ND ND BC GWS005844 upper mid intertidal, on rock Brady s Beach, Bamfield, HK&DR ABMMC 1705-07 XXXXXX ND ND BC GWS005845 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC2317-08 XXXXXX ND ND BC GWS005846 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC2659-08 XXXXXX ND ND BC GWS005847 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC2318-08 XXXXXX ND ND BC GWS005848 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC 1706-07 XXXXXX ND ND BC GWS005849 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC2319-08 XXXXXX ND ND BC GWS005851 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC2321-08 XXXXXX ND ND BC GWS005852 upper mid intertidal, on rock Bradys Beach, Bamfield, HK&DR ABMMC2322-08 XXXXXX ND ND BC GWS006303 upper intertidal on rock Tswassen Ferry Terminal, HK PORPHO13-09 ND ND XXXXXX BC GWS006304 upper intertidal on rock Tswassen Ferry Terminal, HK PORPHO14-09 ND ND XXXXXX BC GWS006464 upper mid intertidal on rock Stephenson Pt., Nanaimo, HK, DM, PORPHO 16-09 ND ND XXXXXX BC BC, KR & SH GWS006465 upper mid intertidal on rock Stephenson Pt., Nanaimo, HK,DM, ABMMC2358-08 XXXXXX ND ND BC BC, KR & SH K) K> U> GWS006492 mid lower intertidal on rock Stephenson Pt., Nanaimo, DM, BC, ABMMC2671 -08 XXXXXX ND XXXXXX BC KR&SH GWS006503 upper mid intertidal on rock Willow Pt., Campbell River,, HK, DM, ABMMC2360-08 xxxxxx ND ND BC BC, KR & SH GWS006578 subtidal (25 ft) on rock Tahsis Nuchatliz Island, BC, DM, ABMMC2672-08 xxxxxx ND XXXXXX (#37 on Esperenza Inlet KR&SH Chart), BC GWS006735 upper intertidal on rock Friendly Cove, Tahsis, BC DM,BC, ABMMC2674-08 xxxxxx ND XXXXXX KR & HK GWS006805 upper intertidal pool on rock Friendly Cove, Tahsis, BC DM,BC, ABMMC2675-08 xxxxxx ND XXXXXX KR & HK GWS006884 mid intertidal on rock Pachena Bay, Bamfield, BC BC,DM, ABMMC2677-08 xxxxxx ND ND KR & HK GWS008184 mid intertidal on rock Scott's Bay, Bamfield, BC HK ABMMC2915-08 xxxxxx ND XXXXXX GWS008271 mid intertidal on rock Pachena Beach, Bamfield, DM, BC, ABMMC2405-08 xxxxxx XXXXXX xxxxxx BC KR & HK GWS008272 mid upper intertidal on wood Pachena Beach, Bamfield, DM, BC, PORPH020-09 ND ND xxxxxx BC KR & HK GWS008431 subtidal (6 ft) on cobble Pier at Davis Bay, Sunshine GWS& ABMMC2407-08 xxxxxx ND ND Coast, BC DM GWS008605 upper intertidal on rock Comox Marina Breakwater, GWS, BC, ABMMC2918-08 xxxxxx ND ND BC DM & KR GWS009071 upper intertidal pools on rock Bradys Beach, Bamfield, GWS & ABMMC2920-08 xxxxxx ND ND BC BC GWS009149 on rock, mid intertidal Pachena Beach, Bamfield, GWS & ABMMC2921-08 xxxxxx ND ND (locally abundant) BC BC GWS009630 high intertidal on rock Tahsis, Island #40 on GWS & ABMMC2931-08 ND ND xxxxxx Esperenza Inlet Chart, BC BC K)NJ GWS009701 upper intertidal on rock Stephenson Pt., Nanaimo, HK & HKIPORPH037-09 ND ND XXXXXX BC GWS009704 upper intertidal on rock Stephenson Pt., Nanaimo, HK & HKI ABMMC2934-08 ND ND XXXXXX BC GWS009706 mid intertidal on rock Stephenson Pt., Nanaimo, HK & HKI PORPH038-09 ND ND XXXXXX BC GWS009708 mid intertidal on rock Qualicum Beach, BC HK & HKI ABMMC2936-08 ND XXXXXX XXXXXX GWS009710 mid intertidal on rock northern end of Qualicum HK & HKI ABMMC3811 -09 XXXXXX ND ND Beach, BC GWS009712 upper intertidal on rock northern end of Qualicum HK & HKI ABMMC2937-08 XXXXXX ND XXXXXX Beach, BC GWS009713 upper mid intertidal on rock northern end of Qualicum HK & HKI PORPH040-09 ND ND XXXXXX Beach, BC GWS009714 upper intertidal on mussel northern end of Qualicum HK & HKI ABMMC2938-08 ND ND XXXXXX Beach, BC GWS009715 upper mid intertidal on alga End of Valdez Rd, Quadra HK & HKI ABMMC2939-08 ND ND XXXXXX Island, BC GWS009716 upper intertidal on old Fucus End of Valdez Rd, Quadra HK & HKI ABMMC3495-08 XXXXXX ND ND or other algal stipe Island, BC GWS009717 upper intertidal on End of Valdez Rd, Quadra HK & HKI ABMMC2940-08 ND ND XXXXXX Mastocarpus Island, BC GWS009718 upper intertidal on rock or on End of Valdez Rd, Quadra HK & HKI ABMMC3496-08 XXXXXX ND XXXXXX algae Island, BC GWS009724 upper intertidal on drift Smelt Bay, Cortes Island, HK & HKI ABMMC2942-08 ND ND ND seagrass BC GWS009732 upper mid on rock Whytecliff Park, Vancouver, HK & PK ABMMC2946-08 XXXXXX ND ND BC GWS009735 upper on mussel Whytecliff Park, Vancouver, HK & PK PORPH042-09 ND ND XXXXXX BC GWS009736 upper mid on mussel Whytecliff Park, Vancouver, HK&PK PORPH043-09 ND ND XXXXXX BC K> GWS009737 upper mid on Fucus Why tecliff Park, Vancouver, HK & PK PORPH044-09 ND ND XXXXXX BC GWSO10336 lower mid intertidal on rock Point Holmes, Comox, BC GWS, DM ABMMC2949-08 XXXXXX ND XXXXXX &KH GWSO10730 mid intertidal on rock, Dixon I., Bamfield, BC GWS & ABMMC2951-08 XXXXXX ND ND sheltered side of island BC GWSO12658 subtidal at 40 ft on rock Mazarredo Islands, NW of GWS & ABMMC3990-09 ND ND XXXXXX Masset, Haida Gwaii, BC DM GWSO 13356 open coast, upper intertidal on Murchison Island Lagoon, GWS & PORPH058-09 ND ND XXXXXX rock Gwaii Haanas,BC DM GWSO 13644 mid intertidal on rock Warden Station Huxley GWS & PORPH062-09 ND XXXXXX XXXXXX Island, Gwaii Haanas, BC DM Porphyra purpurea (Roth) C. Agardh GWS000351 unrecorded Maces Bay, Lepreau, Bay of GWS ABMMC2887-08 XXXXXX ND ND Fundy, NB GWS002357 mid intertidal on pebble Cape Blomidon Beach, Bay GWS ABMMC2298-08 XXXXXX ND ND of Fundy, NS GWS002487 on rock, mid low interrtidal Prim Point at opening to GWS ABMMC2299-08 XXXXXX ND ND Digby Harbour, NS GWS002503 mid intertidal on dock side Westport Ferry Dock, Brier GWS ABMMC2300-08 XXXXXX ND ND (wood) Island, NS GWS003090 low intertidal, on algae Harrington Cove, Grand GWS ABMMC2302-08 XXXXXX ND ND Manan, NB GWS003525 upper intertidal, on rock Cape St. Mary's, NS GWS ABMMC2645-08 XXXXXX ND ND GWS003630 upper intertidal, on rock End of public road, GWS, ABMMC2646-08 XXXXXX ND XXXXXX Starboard, ME LLG, DM, SC&CL GWS006269 high intertidal on rock Richebucto Cape KR ABMMC2349-08 XXXXXX XXXXXX ND Breakwater, NB K> K> as GWS006270 high intertidal on rock Richebucto Cape KR ABMMC2350-08 XXXXXX xxxxxx xxxxxx Breakwater, NB GWS007503 subtidal (1 m) on rock English Harbour East LLG, DM ABMMC2907-08 XXXXXX ND ND Government Dock, NL & JU GWS007576 intertidal on rock English Harbour East on HK ABMMC2678-08 XXXXXX ND ND intertidal, NL GWS007580 intertidal on rock English Harbour East on HK ABMMC2376-08 XXXXXX ND ND intertidal, NL GWS007581 intertidal on rock English Harbour East on HK ABMMC2377-08 XXXXXX ND ND intertidal, NL GWS007582 intertidal on rock English Harbour East on HK ABMMC2679-08 XXXXXX ND XXXXXX intertidal, NL GWS007906 low intertidal pool on Cape St. Mary's, NS LLG & JU ABMMC2684-08 XXXXXX ND XXXXXX Ahnfeltia GWS007912 intertidal Cape St. Mary's, NS LLG & JU ABMMC2908-08 XXXXXX ND ND GWS007932 intertidal epiphyte on Fucus L'Anse Bleue Breakwater, LLG,HK ABMMC2909-08 XXXXXX ND ND Northumberland Strait, NB & JU GWS007934 intertidal on rock L'Anse Bleue Breakwater, LLG, HK ABMMC2685-08 XXXXXX ND ND Northumberland Strait, NB & JU GWS007935 intertidal on rock L'Anse Bleue Breakwater, LLG, HK ABMMC2686-08 XXXXXX ND ND Northumberland Strait, NB & JU GWS007964 intertidal on rock Cap des Caissie, North of LLG, HK ABMMC2687-08 XXXXXX ND ND Shediac, NB & JU GWS007997 intertidal on sandstone St. Thomas, LLG, HK ABMMC2688-08 XXXXXX ND ND Northumberland Strait, NB & JU N> —1 GWS008001 intertidal on sandstone St. Thomas, LLG, HK ABMMC2689-08 XXXXXX ND xxxxxx Northumberland Strait, NB & JU GWS008010 intertidal on rock Pointe Sapin, LLG, HK ABMMC2910-08 xxxxxx ND xxxxxx Northumberland Strait, NB & JU GWS008014 intertidal on rock Pointe Sapin, LLG, HK ABMMC2391-08 xxxxxx ND ND Northumberland Strait, NB & JU GWS008024 intertidal on rock Escuminac wharf, LLG, HK ABMMC2911-08 xxxxxx ND ND Northumberland Strait, NB & JU GWS008025 intertidal on rock Escuminac wharf, LLG, HK ABMMC2912-08 xxxxxx ND ND Northumberland Strait, NB & JU GWS008029 intertidal on rock Escuminac wharf, LLG, HK ABMMC2690-08 xxxxxx ND ND Northumberland Strait, NB & JU GWS008030 mid intertidal on rock Riviere du Loup, QC HK ABMMC2691-08 xxxxxx ND xxxxxx GWS008031 mid intertidal on rock Riviere du Loup, QC HK ABMMC2692-08 xxxxxx ND ND GWS008033 mid intertidal on rock Riviere du Loup, QC HK ABMMC2392-08 xxxxxx ND ND GWS008034 mid intertidal on rock Riviere du Loup, QC HK ABMMC2693-08 xxxxxx ND ND GWS008035 mid intertidal on rock Riviere du Loup, QC HK ABMMC2694-08 xxxxxx ND ND GWS008038 mid intertidal on rock Riviere du Loup, QC HK ABMMC2393-08 xxxxxx ND ND GWS008040 mid intertidal on rock Riviere du Loup, QC HK ABMMC2394-08 xxxxxx ND ND GWS008041 mid intertidal on rock Riviere du Loup, QC HK ABMMC2913-08 xxxxxx ND ND GWS008042 mid intertidal pool on rock Riviere du Loup, QC HK ABMMC2395-08 xxxxxx ND ND GWS008044 mid intertidal on rock Riviere du Loup, QC HK ABMMC2396-08 xxxxxx ND ND GWS008045 mid intertidal on rock Riviere du Loup, QC HK ABMMC2397-08 xxxxxx ND ND GWS008046 mid intertidal on rock Riviere du Loup, QC HK ABMMC2914-08 xxxxxx ND ND to K> 00 GWS008079 mid intertidal on mussel St.Irenee,QC GWS, DM ABMMC2695-08 XXXXXX ND ND & HK GWS008879 on rock, upper mid intertidal Lepreau, Bay of Fundy, NB GWS & ABMMC2919-08 XXXXXX ND ND KD GWS009223 on rock, mid low intertidal in Lepreau, Bay of Fundy, NB GWS ABMMC2922-08 XXXXXX ND ND seepage area Porphyra smithii Hollenberg & I.A. Abbott GWS003309 semi-exposed, mid intertidal Pachena Beach, Bamfield, GWS, BC ABMMC1222-07 XXXXXX XXXXXX XXXXXX on Mastocarpus BC & DM GWS003418 upper intertidal on Pachena Beach, Bamfield, GWS,BC ABMMC1223-07 XXXXXX ND XXXXXX Mastocarpus BC & DM GWSO10775 on Mastocarpus, mid Seppings I., Bamfield, BC GWS & ABMMC3530-08 XXXXXX ND XXXXXX intertidal, semi-exposed BC GWSO 13023 low intertidal on Alaria stipe Scudder Point, Burnaby GWS & PORPH045-09 XXXXXX ND XXXXXX Island, Gwaii Haanas, BC DM GWSO 13026 low intertidal on Scudder Point, Burnaby GWS & PORPH046-09 ND ND XXXXXX Neorhodomela Island, Gwaii Haanas, BC DM GWSO 13095 low intertidal on Mazzaella Ramsey Island (point GWS & PORPH050-09 XXXXXX ND XXXXXX sp. adjacent Kloo Rock), Gwaii DM Haanas, BC GWS013117 low intertidal on Fucus Ramsey Island (point GWS & PORPH052-09 ND XXXXXX XXXXXX adjacent Kloo Rock), Gwaii DM Haanas, BC Porphyra sp. 1POR GWS006385 high intertidal on rock Whiffen Spit, Vancouver HK ABMMC2669-08 XXXXXX XXXXXX ND Island, BC GWS006445 upper mid intertidal on rock Spring Bay, BC HK ABMMC2670-08 XXXXXX ND XXXXXX GWS006446 upper mid intertidal on rock Spring Bay, BC DM,BC, ABMMC2357-08 XXXXXX XXXXXX XXXXXX KR&SH Porphyra sp. 5POR to K> VO GWS004427 upper intertidal on rock Botanical Beach, Port GWS, BC & ABMMC2304-08 XXXXXX XXXXXX ND Renfrew, Vancouver I., DM BC, BC GWS006649 upper intertidal on rock Tahsis, Island #40 on BC, DM, KR & ABMMC2362-08 XXXXXX XXXXXX XXXXXX Esperenza Inlet Chart, SH BC GWS006879 upper intertidal, exposed, on PachenaBay, BC, DM, KR & ABMMC2369-08 XXXXXX XXXXXX XXXXXX rock Bamfield, BC HK GWS009663 high intertidal on rock Tahsis, Island #40 on GWS & BC ABMMC3491-08 xxxxxx xxxxxx xxxxxx Esperenza Inlet Chart, BC GWSO10814 on rock, high intertidal, Seppings I., Bamfield, GWS & BC ABMMC2952-08 XXXXXX XXXXXX XXXXXX exposed BC Porphyra sp. 6POR RDW503 on rock, low intertidal South Jetty, Port RW ABMMC1570-07 XXXXXX XXXXXX ND Aransas, Texas Porphyra sp. collinsii GWS006085 subtidal (20 ft) on red Fort Wetherill, RI GWS, BC & ABMMC2898-08 XXXXXX ND XXXXXX DM GWS006092 subtidal (12 ft) on Chondrus Fort Wetherill, RI GWS, BC & ABMMC2899-08 XXXXXX ND XXXXXX DM GWS006093 subtidal (12 ft) on Chondrus Fort Wetherill, RI GWS, BC & ABMMC2337-08 XXXXXX XXXXXX ND DM GWSO11805 subtidal (15 ft) common Fort Wetherill, RI GWS, BC & ABMMC3714-09 XXXXXX ND ND epiphyte on red algae DM Porphyra sp. stamfordensis GWS006039 mid upper intertidal in estuary Governor Sprague GWS, BC, DM, ABMMC2333-08 XXXXXX XXXXXX xxxxxx on Fucus Bridge 17, SC&SH Narragansett, RI u> o Porphyra cf. thuretii Setchell & E.Y. Dawson GWSO10073 subtidal (30 ft) on Tahsis, Island south of GWS & BC ABMMC3525-08 XXXXXX XXXXXX XXXXXX articulated coralline Clotchman I., Spanish Pilot Group, Tahsis, BC GWSO 10076 subtidal (15 ft) on Tahsis, Island south of GWS & BC ABMMC3526-08 XXXXXX XXXXXX XXXXXX Laminaria setchellii stipe Clotchman I., Spanish Pilot Group, Tahsis, BC GWSO 10079 subtidal (15 ft) on Tahsis, Island south of GWS & BC ABMMC3527-08 XXXXXX ND XXXXXX Pterygophora blade Clotchman I., Spanish Pilot Group, Tahsis, BC Porphyra umbilicalis Kiitzing GWS000994 upper intertidal, on rock. Harrington Cove, Grand GWS ABMMC2297-08 XXXXXX ND ND Manan, NB GWS002154 mid-upper intertidal, on Harrington Cove, Grand GWS ABMMC1208-07 XXXXXX ND ND rock Manan, NB GWS002504 mid intertidal on wood Tiverton Ferry Dock, GWS ABMMC1211-07 XXXXXX ND ND Long Island, NS GWS002516 high mid intertidal on rock Lighthouse at Peggys GWS ABMMC2301-08 XXXXXX ND ND wall Cove, NS GWS002655 highest rocks of intertidal Letete, Bay of Fundy, NB GWS ABMMC1214-07 XXXXXX ND XXXXXX GWS002656 highest rocks of intertidal Letete, Bay of Fundy, NB GWS ABMMC 1215-07 XXXXXX ND XXXXXX GWS003602 high intetidal, on rock Cape Neddick, southern LLG ABMMC 1225-07 XXXXXX ND ND ME GWS003766 on rock, mid intertidal pool Harrington Cove, Grand HK ABMMC 1239-07 XXXXXX ND ND Manan, NB GWS003767 on rock, mid intertidal Harrington Cove, Grand HK ABMMC 1240-07 XXXXXX ND ND Manan, NB GWS003771 on rock, upper intertidal Harrington Cove, Grand HK ABMMC 1242-07 XXXXXX ND ND Manan, NB GWS003793 on rock, mid intertidal Meadow Cove, Bay of HK ABMMC 1243-07 XXXXXX ND XXXXXX Fundy, NB GWS005600 upper intertidal on rock Cape Neddick, southern GWS,BC& ABMMC1689-07 XXXXXX ND XXXXXX ME DM GWS005914 mid intertidal on rock; SE of Beaver Harbour, GWS ABMMC2325-08 XXXXXX ND XXXXXX occasional but locally Bay of Fundy, NB abundant GWS005955 on rock, upper intertidal. Long Eddy Point, Grand DM & BC ABMMC2328-08 XXXXXX ND XXXXXX Manan, Bay of Fundy, NB GWS005956 on rock, mid intertidal. Long Eddy Point, Grand DM & BC ABMMC2329-08 XXXXXX ND ND Manan, Bay of Fundy, NB GWS005957 on rock, mid intertidal. Long Eddy Point, Grand DM & BC ABMMC2330-08 XXXXXX ND ND Manan, Bay of Fundy, NB GWS006052 mid intertidal on rock Hazard Ave., GWS, BC, DM, ABMMC2334-08 XXXXXX ND ND Narragansett, RI SC&SH GWS006905 upper intertidal on rocks Lepreau, Bay of Fundy, LLG,SC&JU ABMMC1707-07 XXXXXX ND ND NB GWS006909 on rock low intertidal Deer Island, NB LLG,SC&JU ABMMC1708-07 XXXXXX ND ND GWS007671 high intertidal on rock St. Brides, NL LLG, HK, DM ABMMC2378-08 XXXXXX ND ND & JU GWS007672 high intertidal on rock St. Brides, NL LLG,HK,DM ABMMC2379-08 XXXXXX ND ND & JU GWS007673 high intertidal on rock St. Brides, NL LLG,HK,DM ABMMC2380-08 XXXXXX XXXXXX ND & JU GWS007738 mid intertidal on rock; Point Lance, NL LLG, HK, DM ABMMC2682-08 XXXXXX ND ND exposed & JU GWS007739 mid intertidal on rock; Point Lance, NL LLG,HK, DM ABMMC2383-08 XXXXXX ND ND exposed & JU U>NJ K> GWS007740 upper mid intertidal on Point Lance, NL LLG, HK, DM ABMMC2384-08 XXXXXX ND ND rock; exposed & JU GWS007741 upper intertidal on rock Point Lance, NL LLG, HK, DM ABMMC2385-08 XXXXXX ND ND & JU GWS007742 upper intertidal on rock Point Lance, NL LLG, HK, DM ABMMC2386-08 XXXXXX ND ND & JU GWS007834 mid intertidal pool on rock Cap St. Mir, Digby, NS LLG & JU ABMMC2683-08 XXXXXX ND ND GWS007866 high intertidal on rock Cap St. Mir, Digby, NS LLG & JU ABMMC1256-07 XXXXXX ND XXXXXX GWS008068 not recorded Gull Rock, White Head JCB ABMMC2398-08 XXXXXX ND ND Island, Grand Manan, NB GWS008069 not recorded Gull Rock, White Head JCB ABMMC2399-08 XXXXXX ND ND Island, Grand Manan, NB GWS008070 not recorded Gull Rock, White Head JCB ABMMC2400-08 XXXXXX ND XXXXXX Island, Grand Manan, NB GWS009303 mid intertidal on rock, Cape Elizabeth, near GWS, BC & ABMMC2924-08 XXXXXX ND ND exposed Portland, ME DM GWS009304 mid intertidal on rock, Cape Elizabeth, near GWS, BC & ABMMC2925-08 XXXXXX XXXXXX ND exposed Portland, ME DM GWS009305 mid intertidal on rock, Cape Elizabeth, near GWS, BC & ABMMC2926-08 XXXXXX ND ND exposed Portland, ME DM GWS009743 upper intertidal on rock Point Prim Lighthouse, HK&SH ABMMC3815-09 XXXXXX ND XXXXXX NS GWS009776 upper intertidal on rock Brier Island Western HK&SH ABMMC3506-08 XXXXXX ND XXXXXX Light (exposed rocky site), NS GWS009803 mid intertidal on rock Peggys Cove, NS HK&SH ABMMC3508-08 XXXXXX ND XXXXXX exposed GWS009805 mid intertidal on rock Peggys Cove, NS HK&SH ABMMC3510-08 XXXXXX ND ND exposed front GWS009806 mid intertidal on rock Peggys Cove, NS HK&SH ABMMC3511-08 XXXXXX ND XXXXXX exposed front to OJ u> GWS009809 mid intertidal on rock Peggys Cove, NS HK & SH ABMMC3513-08 XXXXXX ND XXXXXX exposed front LLG035 intertidal on rock Peggy s Cove, NS LLG ABMMC2409-08 XXXXXX ND ND Bangia sp. GWS003286 on rock, mid intertidal, Seppings I., Bamfield, BC GWS ND ND ND ND semi exposed GWS003988 n rock, high intertidal Seppings I., Bamfield, BC GWS, BC & ND ND ND ND DM GWS008341 upper intertidal on rock Ridley Island (south of GWS,BC,DM PORPH021-09 ND ND XXXXXX coal terrminal), Prince & KR Rupert, BC Porphyra sp. GO 104 drift Port MacDonnell, South GTK ND ND ND ND Australia GWS002720 mid-upper on rock Pachena Beach, Bamfield, GWS ND ND ND ND BC GWS003684 on rock & reds, low Letete, Bay of Fundy, NB GWS ND ND ND ND intertidal GWS004081 on Zostera, subtidal on Bamfield, Wizard I., BC GWS, BC & ND ND ND ND sheltered side DM GWS004428 upper intertidal on rock Botanical Beach, Port GWS, BC & ND ND ND ND wall Renfrew, Vancouver I., DM BC, BC GWS004429 mid upper intertidal on Botanical Beach, Port GWS, BC & ND ND ND ND rock Renfrew, Vancouver I., DM BC, BC GWS005061 mid intertidal on Fucus Ridley Island (south of GWS, BC & ND ND ND ND coal terrminal), Prince DM Rupert, BC U)to 4^ GWS006042 drift Governor Sprague Bridge GWS, BC, DM, ND ND ND ND 17, Narragansett, RI SC&SH GWS006551 subtidal (15 ft) on kelp Tahsis, Princesa Channel, BC, DM, KR & ND ND ND ND BC SH GWS006552 subtidal (15 ft) on kelp Tahsis, Princesa Channel, BC, DM, KR & ND ND ND ND holdfast BC SH GWS006576 subtidal (25 ft) on shell Tahsis Nuchatliz Island, BC,DM,KR & ND ND ND ND (#37 on Esperenza Inlet SH Chart), BC GWS006882 drift Pachena Bay, Bamfield, BC, DM, KR & ND ND ND ND BC HK GWS007745 lower mid intertidal pool Point Lance, NL LLG, HK, DM ND ND ND ND on rock &JU GWS008251 mid intertidal on rock Bradys Beach, Bamfield, DM, BC, KR & ND ND ND ND BC HK GWS008328 mid intertidal on rock Ridley Island (south of GWS, BC, DM ND ND ND ND coal terrminal), Prince & KR Rupert, BC GWS008533 high intertidal on rock Backeddy Resort, BC GWS, BC, DM ND ND ND ND & KR GWS008534 low intertidal on eelgrass Backeddy Resort, BC GWS, BC, DM ND ND ND ND & KR GWS008603 low intertidal on Comox Marina GWS, BC, DM ND ND ND ND Sargassum Breakwater, BC & KR GWS008703 Subtidal (ca. 25 ft) on kelp Seapool Rock, Bamfield, GWS, BC, DM ND ND ND ND blades BC & KR GWS009667 low intertidal on Mazzaella Tahsis, Island #40 on GWS & BC ND ND ND ND Esperenza Inlet Chart, BC K) U> GWS009707 mid intertidal on rock, in Qualicum Beach, BC HK & HKI ND ND ND ND freshwater runoff GWS009720 upper intertidal on drift Smelt Bay, Cortes Island, HK & HKI ND ND ND ND seagrass BC GWS009723 upper intertidal on drift Smelt Bay, Cortes Island, HK & HKI ND ND ND ND seagrass BC GWS009761 low intertidal on articulated Brier Island Northern HK & SH ND ND ND ND coralline Light, NS GWSO10866 mid intertidal on Bradys Beach, Bamfield, GWS & BC ND ND ND ND Mastocarpus in sandy area BC GWSO12726 upper intertidal on rock Burnaby Island near Saw GWS & DM ND ND ND ND Reef, Gwaii Haanas, BC GWSO 12746 low intertidal on rock Burnaby Island near Saw GWS & DM ND ND ND ND Reef, Gwaii Haanas, BC GWSO 12783 upper intertidal on Fucus Burnaby Island near Saw GWS & DM ND ND ND ND Reef, Gwaii Haanas, BC GWSO13022 low intertidal on Scudder Point, Burnaby GWS & DM ND ND ND ND Mastocarpus jardinii Island, Gwaii Haanas, BC a Further collection information including date of collection, latitude and longitude coordinates can be obtained by accessing the BOLD database at http://www.barcodinglife.com. Abbreviations for Provinces/States as follows: BC, British Columbia, Canada; ME, Maine, USA; NB New Brunswick, Canada; NL, Newfoundland and Labrador, Canada; NS, Nova Scotia, Canada; QC, Quebec, Canada; RI, Rhode Island, USA. b Abbreviations for collectors are: JCB, John & Carrie Banks; JB, Jeff Barsalou; BC, Bridgette Clarkston; SC, Susan Clayden; KD, Kyatt Dixon; LD, Louis Druehl; SH, Sarah Hamsher; KH, Katy Hind; GTK, Gerald Kraft; HK, Hana Kucera; HKI, Hana Kucerova; PK, Paul Kucera; CL, Chris Lane; LLG, Line Le Gall; DM, Dan McDevit; DR, David Riddell; KR, Kathryn Roy; BR, Brain Rudolph; DS, Davin Saunders; GWS, Gary W. Saunders; CS, Corynne Spry; ST, Scott Toews; JU, Jose Utge; RW, Rodney Withall. c ND stands for not determined. (XXXXXX = Genbank accession numbers pending) N) OS 237 Appendix 4: Sources of published sequences used in Chapter 3. Accession Number Species Reference AB114641 Bangia atropurpurea Hanyuda et al. (2004) AY 119770 Bangia atropurpurea Yoon et al. (2002) AF169328 Bangia atropurpurea Miiller et al. (2003) AF168657 Bangia fuscopurpurea Muller et al. (2001) AY119771 Bangia fuscopurpurea Yoon et al. (2002) DQ308423 Bangia maxima Yoon et al. (2006) EU289022 Bangia vermicularis Lynch et al. (2006) AF043366 Bangia sp. Muller et al.(1998) AF043367 Bangia sp. Muller etal. (1998) AF043377 Bangia sp. Muller et al. (1998) AF043368 Bangia sp. Muller et al. (1998) AF043369 Bangia sp. Muller et al. (1998) AF043371 Bangia sp. Muller et al. (1998) AF043372 Bangia sp. Muller et al.(1998) AF043373 Bangia sp. Muller et al. (1998) AF043374 Bangia sp. Muller etal. (1998) AF043376 Bangia sp. Muller et al. (1998) AF043377 Bangia sp. Muller et al. (1998) AF043378 Bangia sp. Muller et al. (1998) AF452422 Bangia sp. Lindstrom & Fredericq (2003) FJ769173 Bangia sp. gdst Unpublished EU223009 Bangia sp. SCL-2008-1 Lindstrom (2008) EU223010 Bangia sp. SCL-2008-1 Lindstrom (2008) FJ769174 Bangia sp. sddy Unpublished FJ769175 Bangia sp. sxyq Unpublished AF452423 Porphyra abbottiae Lindstrom & Fredericq (2003) AF452424 Porphyra aestivalis Lindstrom & Fredericq (2003) AF021034 Porphyra amplissima Klein et al. (2003) AF319460 Porphyra birdiae Klein et al. (2003) AY180909 Porphyra birdiae Neefus et al. (2002) AF452426 Porphyra brumalis Lindstrom & Fredericq (2003) AF414593 Porphyra carolinensis Teasdale et al. (2002) AF452427 Porphyra conwaye Lindstrom & Fredericq (2003) AF452428 Porphyra cuneiformis Lindstrom & Fredericq (2003) AB287928 Porphyra dentata Unpublished AF081291 Porphyra dioica Klein et al. (2003) AY028524 Porphyra dioica Klein et al. (2003) AF452429 Porphyra fallax Lindstrom & Fredericq (2003) AF452430 Porphyra fucicola Lindstrom & Fredericq (2003) 238 EU223095 Porphyra gardneri Lindstrom (2008) AB118585 Porphyra haitanensis Unpublished AY794401 Porphyra hollenbergii Unpublished GQ427225 Porphyra ishigecola Unpublished AF452431 Porphyra kanakaensis Lindstrom & Fredericq (2003) DQ630039 Porphyra katadae Neefus et al. (2008) AB366145 Porphyra kinositae Niwa et al. (2009) AB366139 Porphyra kinositae Niwa et al. (2009) AF452432 Porphyra kurogii Lindstrom & Fredericq (2003) AF452433 Porphyra lanceolata Lindstrom & Fredericq (2003) AF271078 Porphyra leucosticta West et al. (2005) AF168673 Porphyra linearis Miiller et al. (2001) (but not in paper) AF078745 Porphyra linearis Klein et al. (2003) AY 139687 Porphyra lucasii Farr et al. (2003) AY028530 Porphyra miniata Klein et al. (2003) AF452434 Porphyra mumfordii Lindstrom & Fredericq (2003) AF452435 Porphyra nereocystis Lindstrom & Fredericq (2003) AF452436 Porphyra occidentalis Lindstrom & Fredericq (2003) EU223119 Porphyra occidentalis Lindstrom (2008) AF452437 Porphyra papenfussii Lindstrom & Fredericq (2003) AF452438 Porphyra perforata Lindstrom & Fredericq (2003) AF452439 Porphyra Lindstrom & Fredericq (2003) pseudolanceolata EU223151 Porphyra Lindstrom (2008) pseudolanceolata AF452441 Porphyra pseudolinearis Lindstrom & Fredericq (2003) NC000925 Porphyra purpurea Reith and Munholland (1995) DQ418738 Porphyra purpurea Bray et al. (2006) AF514280 Porphyra rediviva Lindstrom & Fredericq (2003) AF452442 Porphyra rosengurttii Lindstrom & Fredericq (2003) AF452443 Porphyra schizophylla Lindstrom & Fredericq (2003) EU223224 Porphyra smithii Lindstrom (2008) AB287948 Porphyra suborbiculata Unpublished EU223228 Porphyra tasa Lindstrom (2008) AB243206 Porphyra tenera Niwa et al. (2009) AB287951 Porphyra tenuipedalis Unpublished AF452445 Porphyra torta Lindstrom & Fredericq (2003) AF452446 Porphyra umbilicalis Lindstrom & Fredericq (2003) AF452447 Porphyra variegata Lindstrom & Fredericq (2003) NC007932 Porphyra yezoensis Unpublished AB 118574 Porphyra yezoensis Unpublished AB287970 Porphyra sp. Unpublished 239 AB287968 Porphyra sp. Unpublished AB366138 Porphyra sp. P2 Niwa et al. (2009) AB366143 Porphyra sp. P7 Niwa et al. (2009) AB366146 Porphyra sp. P10 Niwa et al. (2009) AF228754 Porphyra sp. BWT2000C Unpublished AY795901 Porphyra sp. CDN-2004 Unpublished AB287973 Porphyra sp. DE001 Unpublished AB287962 Porphyra sp. DN001 Unpublished AB118586 Porphyra sp. SuSa 001 Unpublished DQ813598 Porphyra sp. collinsi Unpublished DQ813608 Porphyra sp. Unpublished novaeangliae DQ813630 Porphyra sp. olivii Unpublished DQ813635 Porphyra sp. spatulata Unpublished DQ813642 Porphyra sp. Unpublished stamfordensis EU223019 Porphyra Unknown #1 Lindstrom (2008) EU223172 Porphyra Unknown #2 Lindstrom (2008) EU223139 Porphyra Unknown #3 Lindstrom (2008) EU223240 Porphyra Unknown #4 Lindstrom (2008) EU223190 Porphyra Unknown #5 Lindstrom (2008) Outgroup Taxa U28421 Palmaria palmata Freshwater et al. (1994) U04173 Halosaccion glandiforme Freshwater et al. (1994) AY688026 Dichotomaria Wang et al. (2005) diesingiana DQ787558 Corallina pilulifera Unpublished U04168 Ahnfeltia plicata Freshwater et al. (1994) GQ338151 Gymnogongrus Le Gall & Saunders 2010 crenulatus AB030627 Gelidium pacijicum Shimada et al. (2000) AB061394 Prionitis schmitziana Wang et al. (2001) EU977496 Botryocladia exquisita Schneider & Lane (2008) AF212194 Sarcodia sp. Unpublished DQ022808 Plumaria plumosa Hommersand et al. (2006) AF208809 Hildenbrandia Sherwood & Sheath (2000) crouaniorum 240 References Bray, T. L., Neefus, C. D. & Mathieson, A. C. 2006. Morphological and molecular variability of Porphyra purpurea (Roth) C. Agardh (Rhodophyta, Bangiales) from the Northwest Atlantic. Nova Hedwigia 82:1-22. Farr, T. J., Nelson, W. A. & Broom, J. E. S. 2003. A challenge to the taxonomy of Porphyra in Australia: the New Zealand red alga Porphyra rakiura (Bangiales, Rhodophyta) occurs in southern Australia, and is distinct from P. lucasii. Aust. Syst. Bot. 16:569-75. Freshwater, D. W., Fredericq, S., Butler, B. S., Hommersand, M. H. & Chase, M. W. 1994. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL. Proc. Natl. Acad. Sci. U. S. A. 91:7281-85. Freshwater, D. W. & Rueness, J. 1994. Phylogenetic relationships of some European Gelidium (Gelidiales, Rhodophyta) species, based on rbcL nucleotide sequence analysis. Phycologia 33:187-94. Hanyuda, T., Suzawa, Y., Arai, S., Ueda, K. & Kumano, S. 2004. Phylogeny and taxonomy of freshwater Bangia (Bangiales, Rhodophyta) in Japan. J. Jpn. Bot. 79:262-68. Hommersand, M. H., Freshwater, D. W., Lopez-Bautista, J. M. & Fredericq, S. 2006. Proposal of the Euptiloteae Hommersand et Fredericq, trib. nov and transfer of some Southern Hemisphere Ptiloteae to the Callithamnieae (Ceramiaceae, Rhodophyta). J. Phycol. 42:203-25. Klein, A. S., Mathieson, A. C., Neefus, C. D., Cain, D. F., Taylor, H. A., Teasdale, B. W., West, A. L., Hehre, E. J., Brodie, J., Yarish, C. & Wallace, A. L. 2003. Identification of north-western Atlantic Porphyra (Bangiaceae, Bangiales) based on sequence variation in nuclear SSU and plastid rbcL genes. Phycologia 42:109- 22. Le Gall, L. & Saunders, G. W. 2010. DNA barcoding is a powerful tool to uncover algal diversity: A case study of the Phyllophoraceae (Gigartinales, Rhodophyta) in the Canadian flora. J. Phycol. 46:374-89. Lindstrom, S. C. 2008. Cryptic diversity, biogeography and genetic variation in Northeast Pacific species of Porphyra sensu lato (Bangiales, Rhodophyta). J. Appl. Phycol. 20:951-62. Lindstrom, S. C. & Fredericq, S. 2003. rbcL gene sequences reveal relationships among north-east Pacific species of Porphyra (Bangiales, Rhodophyta) and a new species, P. aestivalis. Phycol. Res. 51:211-24. Lynch, M. D., Miiller, K. M. & Sheath, R. G. 2006. ISSR-estimated intraspecific genetic variation and phylogenetic position of a population of the red alga Bangia maxima. J. Phycol. 42:15. Miiller, K. M., Cole, K. M. & Sheath, R. G. 2003. Systematics of Bangia (Bangiales, Rhodophyta) in North America. II. Biogeographical trends in karyology: chromosome numbers and linkage with gene sequence phylogenetic trees. Phycologia 42:209-19. Muller, K. M., Oliveira, M. C., Sheath, R. G. & Bhattacharya, D. 2001. Ribosomal DNA phylogeny of the Bangiophycidae (Rhodophyta) and the origin of secondary plastids. Am. J. Bot. 88:1390-400. Muller, K. M., Sheath, R. G., Vis, M. L., Crease, T. J. & Cole, K. M. 1998. Biogeography and systematics of Bangia (Bangiales, Rhodophyta) based on the rubisco spacer, rbcL gene and 18S rRNA gene sequences and morphometric analyses. 1. North America. Phycologia 37:195-207. Neefus, C., Mathieson, A. C., Klein, A. S., Teasdale, B., Bray, T. & Yarish, C. 2002. Porphyra birdiae sp. nov. (Bangiales, Rhodophyta): A new species from the northwest Atlantic. Algae 17:203-16. Neefus, C. D., Mathieson, A. C., Bray, T. L. & Yarish, C. 2008. The distribution, morphology, and ecology of three introduced Asiatic species of Porphyra (Bangialies, Rhodophyta) in the northwestern Atlantic. J. Phycol. 44:1399-414. Niwa, K., Iida, S., Kato, A., Kawai, H., Kikuchi, N., Kobiyama, A. & Aruga, Y. 2009. Genetic diversity and introgression in two cultivated species {Porphyra yezoensis and Porphyra tenera) and closely related wild species of Porphyra (Bangiales, Rhodophyta). J. Phycol. 45:493-502. Reith, M. & Munholland, J. 1995. Complete nucleotide sequence of the Porphyra purpurea chloroplast genome. Plant Mol. Biol. Report. 13:333-35. Schneider, C. W. & Lane, C. E. 2008. Notes on the marine algae of the Bermudas. 9. The genus Botryocladia (Rhodophyta, Rhodymeniaceae), including B. bermudana, B. exquisita and B.flookii spp. nov. Phycologia 47:614-29. Sherwood, A. R. & Sheath, R. G. 2000. Biogeography and systematics of Hildenbrandia (Rhodophyta, Hildenbrandiales) in Europe: inferences from morphometries and rbcL and 18S rRNA gene sequence analyses. Eur. J. Phycol. 35:143-52. Shimada, S., Horiguchi, T. & Masuda, M. 2000. Two new species of Gelidium (Rhodophyta, Gelidiales), Gelidium tenuifolium and Gelidium koshikianum, from Japan. Phycol. Res. 48:37-46. Teasdale, B., West, A., Taylor, H. & Klein, A. 2002. A simple restriction fragment length polymorphism (RJFLP) assay to discriminate common Porphyra (Bangiophyceae, Rhodophyta) taxa from the Northwest Atlantic. J. Appl. Phycol. 14:293-98. Wang, H. W., Kawaguchi, S., Horiguchi, T. & Masuda, M. 2001. A morphological and molecular assessment of the genus Prionitis J. Agardh (Halymeniaceae, Rhodophyta). Phycol. Res. 49:251-61. Wang, W. L., Liu, S. L. & Lin, S. M. 2005. Systematics of the calcified genera of the Galaxauraceae (Nemaliales, Rhodophyta) with an emphasis on Taiwan species. J. Phycol. 41:685-703. West, A. L., Mathieson, A. C., Klein, A. S., Neefiis, C. D. & Bray, T. L. 2005. Molecular ecological studies of New England species of Porphyra (Rhodophyta, Bangiales). Nova Hedwigia 80:1 -24. 244 Yoon, H. S., Hackett, J. D. & Bhattacharya, D. 2002. A single origin of the peridinin- and fucoxanthin-containing plastids in dinoflagellates through tertiary endosymbiosis. Proc. Natl. Acad. Sci. U. S. A. 99:11724-29. Yoon, H. S., Muller, K. M., Sheath, R. G., Ott, F. D. & Bhattacharya, D. 2006. Defining the major lineages of red algae (Rhodophyta). J. Phycol. 42:482-92. 245 Appendix 5: Supplementary Figure: BOLD Taxon ID Tree for Chapter 3. BOLD TaxonlD Tree Project MERGED: {PORPH,BANGI} Subprojects Porphyra of Canada[PORPH) Bangiales of Canada IBANGI) Date 25-February~2010 Data Type Nucleotide Distance Model Kimura 2 Parameter Codon Positions 1st, 2nd, 3rd Labels SamplelD, ProcessID, Colorization Sequence Count : 409 Species count : 28 Genus count : 2 Family count : 1 Unidentified : 0 Cover Pag* 1/1 246 MERGED: J PORPH3ANGI} niu Feb 25 15:53:47 2010 Page 1 of 5 2 1 -Porphyra corallicola IABM4C3531-061GN5C014 Porphyra purpurealAB»«C2300-OeiGNS002503 Porphyra purpurea IABMC2302-0616NS003090 Porphyra purpurea IABMMC2350-08IGWS006270 Porphyra purpurea IADIHC2687-0B1GWS007964 Porphyra purpurea IJUBMHC2689-081GHS008001 •Porphyra purpurealABM*C2684~08IGWS007906 Porphyra purpurealA»»C2€79-08|GWS00?582 Porphyra purpurea!A»®C2377-08|GllS007581 Porphyra purpureaiABMMC2376-06| porphyra umbilicalia|ABI«4C2378-0B IGWS007671 Porphyra umbilicaliafABMC2334-08IGWS006052 Porphyra umbilicaliaIABM4C2329-08IGWS005956 porphyra \snbilicalia|ABMMC2325~08|G»IS005914 Porphyra umbilicalia|ABI*IC1240-07 JGWS003767 Porphyra umbilicalia I ABI#4C1239-07jGlfS003766 Porphyra umbilicaliaIJUMMC1225-07JGWS003602 Porphyra umbilicaliaIABJMC2301-08IGWS002516 Porphyra umbilicaliaIABlt4C2297-08 iGWS000994 porphyra umbilicaliaIABM4C1208-07IGWS002154 f orphyra umbilicalia|Afi»MC1211-07(GWS002504 orphyra umbilicaliaIABMMC1243-07IGWS003793 orphyra umbilicaliaIABM4C2330-08IGMS005957 (•Porphyra umbilicalia|AS»MC1224-07{GWS0C2655 -Porphyra umbilicalia IABM4CS635-09 16MS013859 Porphyra umbilicaliaIABIMC2409-08ILLG035 rBangia ap. 2BAN|ABM4C440-06!GWS007743 IBangia ap. 2BAMIABM4C1680-07I6WS006061 Bangia ap. 2BANIABM4C3804-09!6WS005932 Bangia ap. 2BANIABN4C2897-08S6NS005916 Bangia ap. 2BANIABM4C2890-08JGWS002674 Bangia ap. 2BAM|ABM4C2B89-08iGMS002659 Bangia ap. 2BAM1ABM4C2888-0BI6WS002652 Bangia ap. 2BAN|ABMMC3479-08iGNS002682 (Bangia ap. 2BAN|AB»MC290X-08(GWS0D6129 Bangia sp. 2BANfABM4C2900-08;G*S006128 Bangia ap. 2BAN|ABMHC3483-08jGW5006130 Bangia sp. 2BANIABM4C2929-08IGWS009382 'Bangia ap. 2BAN|AB»MC3514-08|6irS009810 *Bangia ap. 2BAMIABM4C3S21-08IGWS0Q9851 porphyra ampliaaimaIABMMC3532-08ILLG196 Porphyra ampliaaimaiABW4C2935-08IGWS0097Q5 Porphyra ampliaaiaaiABMMC241X-08|LLG193 Porphyra ampliaaima|*BHMC2410-08ILLG136 porphyra ampli8aimalABHMCl709-07jl,LG001 Porphyra ampliaaimaIABMMC5579-09IGWSO13864 Porphyra ampliaaimaIABKMC55fi7-09|GWS013863 Porphyra ampliaaima(PORPH057-09JGKS023355 Porphyra ampliaaima|ABMMC2950-08IGWS010589 Porphyra ampliaaimajABMMC3822-09IGWS010062 Porphyra ampliaaima|ABIWC3490-08 IGMS009648 Porphyra ampliaaima!ABMMC2928-08IGWS009339 Porphyra ampliaaimaIABMMC2927-08{SHS009338 Porphyra ampliaaimaIABKMC3488-08{GWS009297 Porphyra ampliaaimaIABMMC2701-08IGWS009Q72 Porphyra ampliaaimaIABMMC27Q0-06{GKS009003 Porphyra ampliaaima|ABMMC24Q6-08IGWS008347 Porphyra ampliaaimaIABMHC2698-08{6WS008305 Porphyra ampliaaimaIABMMC2404-08IGWS008177 Porphyra ampliaaima |AB»IC2373-08 IGWS006985 Porphyra ampliaaimaIABHHC2372-08IGWS006984 Porphyra ampliaaima|ABMMC2370-08IGWS006908 Porphyra ampliaaimaIABHMC2361-08IGWS006577 Porphyra ampliaaimaIABMMC2355-08IGWS006400 Porphyra ampliaaimaIABMMC2354-08IGWS006398 Porphyra ampliaaimaIABMMC2352-08IGWS006371 Porphyra ampliaaima|ABMMC2351-08IGWS006369 Porphyra ampliaaimaIABMMC2667-08IGWS006282 Porphyra ampliaaimaIABMMC2666-08|GWS00628I Porphyra ampliaaima IABMMC2347-081GWS006186 Porphyra ampliaaima(ABMHC2665-081GWS006185 Porphyra ampliaaimaJABMMC2664-DB/GWS006184 Porphyra ampliaaimaIABKMC2345-08IGWS006180 Porphyra ampliaaima|ABMMC2341-DBIGWS006111 Porphyra ampliaaima jABMMC2339-08IGWS006109 Porphyra ampliaaima| ABHBC2327-08IGWS005930 Porphyra ampliaaimaIABKMC2326-08IGWS005929 Porphyra ampliaaimaIABMMC2306-08I6WS005063 Porphyra ampliaaimaIABMMC2303-08I6WS004180 Porphyra ampliaaimaIABHMC1244-07IGWS003824 Porphyra ampliaaima|ABMMC1235~07IGWS003704 porphyra ampliaaima IABMHC1232-07 16MS003697 Porphyra ampliaaima|ABMMC1229-07(GWS003693 Porphyra ampIiaaima|ABMMC1213-07JGWS002654 •Porphyra ampliaaimaIABMMC2344-08IGWS006161 Porphyra ampliaaima IABKMC2346-08IGWS006183 Porphyra ampliaaima|ABMMC1236-07IGWS003727 Porphyra ampliaaimaIABHMC1234-071GWS003702 Porphyra ampliaaimaIABHMC1231-071GWSOQ3696 Porphyra ampliaaima|ABMMC1217-071GWS003005 Porphyra ampliaaimaIM3MMC1212-071GWS002653 •Porphyra ampliaaimaIABHMC4011-09I6WS012702 Porphyra ampliaaimaIABMMC1687-07I6WS005186 Porphyra ampliaaimaIABMMC1228-07IGWS003691 248 MERGED:_{PORPH3ANGI} Thu Feb 25 15:53:47 2010 Page 3 of 5 Porphyra amplissima|ABMMC1687-07IGWS005186 Porphyra amplissima|A»»r:i228-07lGIfS003$91 Porphyra aaplissimal MMMC3813-09IGWS009726 Porphyra amplissima|ABI®C3492-0B|GlfS009700 Porphyra ampliasimaiAB»IC2932-08|G*S0Q9631 Porphyra amplisaijna|ABHMC2408-08|GlfS008669 Porphyra amplissima jABM4C2699-081GWS008668 Porphyra amplissimalABMMC2359-08IGWS0Q6491 Porphyra amplissima|ABIMC2307-08lG*S005083 Porphyra amplissimaIABMMC2933-08IGWS009703 Porphyra ampliasima IABMMC3823-09IGWS01Q367 Porphyra amplissimaIABHMC3493-08IGWS009702 Porphyra amplissima IABMMC3824~09iGifS010374 Porphyra amplissima IPORPHC56-09 IGWS013354 Porphyra amplissima|PORPH059-09IGWS013418 Porphyra amplissimaIPORPH061-09 IGWS013435 LPorphyra aaiplissimalABMMC3494-08IGHS009709 Porphyra occidentalisIABM4C3480-08IGWS003353 Porphyra occidentalisIABMHC2891-06IGMS003427 Porphyra occidentalis|ABtMC2892-0B!GWS003978 Porphyra occidentalisIADWIC2902-08IGWSO06372 Porphyra occidentalisIABM4C2903-081GWS00659 3 Porphyra occidentalis SABHHC3485-0816W3006652 Porphyra occidentalisIABM4C3826-09IGWS010887 Porphyra miniataIAB»iC3502-08IGWS009759 Porphyra niniataIABM4C2338-08iGMS006108 orphyra miniata jABIWC3520-081GHS009850 orphyra miniata IABM4C3736-091GWS011866 forphyra miniata|ABHMC3515-08|GWS009845 Porphyra miniatalABHMC3519-08|GWS009849 Porphyra miniataiABM4C3740-09IGWS011870 Porphyra miniata IABHHC3741-09IGWS011B71 Porphyra miniataJABW1C3517-08JGWS009B47 [Porphyra miniata IABM4C2390-08IGWS007850 Porphyra miniata}ABMMC1254-07|GWS007851 Porphyra miniataIABMMC3501-08IGHS009758 Porphyra miniata|AB»WC3503-08IGWS009760 Porphyra miniata|AB»MC3504-08(GWS009762 Porphyra miniataIABMMC3818-09IGWS009766 Porphyra miniataIABM4C3509-08IGWS009804 Porphyra miniataIABMMC3516-08IGWS009B46 Porphyra miniata IABI-MC3518-08IGWS009B48 Porphyra miniataIABM4C1252-07 IGMS007838 Porphyra miniataIABM4C2387-08IGWS007744 Porphyra miniataIAB>WC2382-08IGWS007684 Porphyra miniataIABM4C2381-08(GWS007675 Porphyra miniataIABMMC2374-08IGWS006996 Porphyra miniataIABM4C1250-07IGWS006900 Porphyra miniataIABIMC2663-08IGHS006115 Porphyra miniataIABM4C2662-08IGWS006114 Porphyra miniataIAB»MC2343-081GWS006113 Porphyra miniataIABHMC2342-08IGWS006112 Porphyra miniatalABMMC2340-08lGWS006110 Porphyra miniata1ABM4C1688-071GWS005191 Porphyra miniata]ABM4C1248-07|GHS003831 Porphyra miniata|ABM4C1247-07|GWS003830 Porphyra miniataIABM4C1245-07IGWS003825 Porphyra miniataIABMMC1237-07IGWS003748 Porphyra miniataIABM4C1218-07|GWS003084 Porphyra miniataIABMHC441-06IGMS0021S5 Porphyra miniata IABIMC1246-07 |GffS003828 r Porphyra miniata IABM4C2371-08IGNS006977 LPorphyra miniataIABMMC3816-09IGWS009764 Porphyra miniataIABM4C5613-09IGWS013853 Porphyra birdiaeIABM4C2388-08IGWS007788 Porphyra birdiaeIABMMC1219-07(GWS003085 Porphyra birdiaeIABMKC3827-091GWS011900 Porphyra birdiaeIABMHC3820-09IGWS009891 Porphyra birdiae I JkSMfC2389-08!GWS0077B9 Porphyra birdiae iABM4C237S-081GWS007081 Porphyra birdiae1ABM4C1233-07|GWS003701 Porphyra birdiae IABWC1230-07IGWS003695 Porphyra birdiaeIABMWC1210-071GWS002502 Porphyra birdiaeIABM4C1209-071GWS002304 Porphyra birdiae|AB»MC5634-09|GWS013e28 Porphyra birdiae |ABtttC5590-09|Gtrs013849 Porphyra birdiae |ABM(CS557-09IGIfS013905 Porphyra birdiaeIASMMC1258-07ILLG007 Porphyra sp. 5PORIABMMC2369-08IGWS006879 Porphyra sp. 5PORIABMMC3491-08IGWS009663 Porphyra sp. 5POR|ABMMC2304-08|GWS004427 Porphyra sp. 5PORIABMMC2362-08IGMS006649 Porphyra sp. 5PORIABMMC2952-08IGWS010814 -Bangia fuscopurpureaIABMMC1273-07 IGWS001869 249 MERGED:_{PORPH3ANGI} Thu Feb 25 15:53:47 2010 Page 4 of 5 'Porphyra ap. SPO*|ABt*«C2952-08|GtrS0108l4 -Bangia fuacopurpureaIABMMC1273-07 IGWS001869 rBangia ap. 1BAHIABWC3802-09 IGWS004431 1—Bangia ap. 1BANIABIMC3464-08 IGMS006406 •'"•'"•"—Porphyra ap. ataafordenaia IAM4C2333-08 IGWS006039 IPorphyra ap. collinaii|Aa#JC2898-08|GWS0060e5 porphyra ap. collinsii IABMMC2899-08IGWS006092 Porphyra ap. collinaii IABCMC2337-0816HS006093 'Porphyra ap. collinaii IABWC3714-09 IGWS011805 "Porphyra fucicola IABM4C2363-081GMS006650 -Porphyra fuclcolaIABIMC2364-08IGWSD06651 Porphyra fucicolaIABMMC2366-08IGMS006736 Porphyra fucicola IABHMC3807-09 IGWS008183 ————— porphyra fucicola IABM4C3809-09 IGMS009661 Porphyra fucicolal ABMMC3810-09 IGWS009671 jPorphyra fucicolaIABIMC3812-09IGHSQ09719 •Porphyra fucicolaIABMMC3497-08IGWS009725 -Porphyra leucoaticta|\BHHC1220-07IGWS003086 1 Porphyra leucoaticta|AB»»4C1241-07|GlfS003769 Porphyra leucostictaIABM4C3522-08IGMS009895 Porphyra leucoatictaIABMMC3512-08IGMS009807 Porphyra leucoatictaIABM4C3505-08IGWS009763 Porphyra 2eucostictaJABMMC35D7-08|GWS009802 Porphyra leucoatictaIABM4C3499-08IGWS009741 Porphyra leucoatictaIABJMC3500-08IGWS009745 Porphyra leucoatictaIABM4C1255-07IGWS007857 Porphyra leucostictaIABM4C2923-08IGMS009302 Porphyra leucoatictaIABM4C2681-08IGWS007687 Porphyra leucoaticta I ABMMC1253-071GWS007846 Porphyra leucoatictaIABHMC3821-09IGWS009896 Porphyra leucoaticta i ABM4C2660-081GMS007674 Porphyra leucoatictaIAWMC1251-07IGWS006904 Porphyra leucoatictaIABM4C2348-08I6WS006192 Porphyra leucoaticta j ADIXC2661-08 j GWS006091 Porphyra leucoatictaIABM4C2336-08IGWS006056 Porphyra leucoatictaIABMMC2335-08IGWS006054 Porphyra leucoatictaIABM4C2660-08IGWS006037 Porphyra leucoaticta!ABM4C2332-08IGMS00S995 Porphyra leucoatictaIABt*4C2331-08IGWS00S994 Porphyra leucoatictaIABIMC2324-08IGWS005883 Porphyra leucoatictaIABMMC2323-08IGMS00588Q Porphyra leucoatictaIABHMC1249-07|GWS003843 Porphyra leucoatictaIABM4C1238-07IGWS003749 Porphyra leucoatictaIABM4C1227-07IGWS003668 Porphyra leucoatictaIABM4C1226-07|GWS0C3638 Porphyra leucoaticta(ABM4C5599-09IGWSO13741 Porphyra leucoatictaIABM4C5610-09IGWS013743 .Porphyra ap. 1PORIABMHC2670-08IGWS006445 LPorphyra ap. 1PORI ABMMC2669-08 IGWS006385 *Porphyra ap. 1PORIABMMC2357-08IGMS006446 Porphyra abbottiaeIABH4C3523-08IGWS009972 Porphyra abbottiaelABIMC2367-08IGWS006737 Porphyra abbottiae|ABMHC4179-09IGWS013021 Porphyra abbottiaeIPORPH047-09IGWS013032 Porphyra abbottiaeIPORPH051-091GWS013108 ^Porphyra abbottiaeIPORPHOS3-09IGWS013127 (Porphyra amithii tABM4C1223-07IGWS003418 liPorphyra 8®ithiiIABHMC1222-071GMS003309 ffPorphyra amithii |ABMMC3530-08 IGWS010775 liPorphyra amithiilPORPH045-09|GWSOl3023 ^Porphyra amithii|PORPH050-09|GWSOl3095 Porphyra nereocyatiaJABM4C2403-08IGWSOOS155 Porphyra nereocyatia IABMMC2402-081GW5008154 Porphyra nereocyatiaJABMMC2401-08|GWS008153 Porphyra nereocyatia JABWC2676-08IGWS006878 Porphyra nereocyatia IADIV1C236S-06 IGWS006653 Porphyra nereocyatia(ABM4C2673-06IGWS006595 •Porphyra nereocyatiaIABMMC3992-09IGWS012672 ^porphyra fallaxlABM4C3489-08IGWS009589 Porphyra falla*IAB»IC3524-08lGWS009979 Porphyra fallax!ABI«4C3498-08|GWS009734 Porphyra fallax|ABI*iC2906-08|GlfS006885 Porphyra fallax!ABMMC2697-08|GWS008137 Porphyra fallax!Afi»MC2905>08|GffS006881 Porphyra fallaxiABM£2368-08|GWS006877 Porphyra fallaxiABWC2356-08(GMS006401 Porphyra fallax!ABI>MC2668-OeiGifS006360 Porphyra fallax|ABMMC1686-07|GWS005175 •Porphyra fallax!ABMMC2654-08IGWS00481B 'Porphyra fallaxiABM«C2353-08IGWS006379 'Porphyra fallax|PORPH0S5-09|GWS013353 j—Porphyra kurogii I AB&WC3487-081GWS008 367 *-Porphyra kurogiiIABJMC3814-09IGWS009733 |—Porphyra lineariaJABMHC3482-08IGNS005678 250 MERGED:,{PORPH3ANGI} Thu Feb 25 15:53:47 2010 Page 5 of 5 - Porphyra kurogiiIA8MMC3814-09IGWS009733 pPorphyra linearis IABMMC3482-08IGWS005678 •jjPorphyra linearis IABMMC3478-081GWS002515 If Porphyra linearis IABMHC3817-09JGWS009765 LPorphyra linearis IABMMC1257-071LLG0037 orphyra thuretii|ABMHC3S25-08|6NS010073 iPorphyra thuretii)ABMNC3526-08|GWS010076 'orphyra thuretii IABMC3527-08IGWS010079 Porphyra gardneri iABMHC1221-07|GWS003137 Porphyra gardnerif ABM4C2948-08IGWS010168 Porphyra gardneri |AB#4C1683-07 IGWSQ04430 Porphyra gardneriIABM4C3825-09IGWS010474 Porphyra gardneri |ABtMC2947-08 (GWS010167 Porphyra gardneriIABMMC1685-07IGWSQ04926 Porphyra gardneri I AB»MC3528-0B IGWS010473 Porphyra gardneri IABMC2696-08 S GWS008119 orphyra gardneriIABM4C2894-08I6WS004028 orphyra gardneri j ABM4C2904-08!GHS00676B frorphyra gardneriIABM4C3529-08IGWS010515 Porphyra gardneriIABMMC3927-09IGWS012560 Porphyra gardneriIABMMC3941-09IGWS012594 Porphyra gardneriIPORPH049-091GWS013094 Porphyra perforataIABIMC2659-08IGWS005846 Porphyra perforata|AB»MC2318'08IGWS005847 Porphyra perforata(ABMMCH00-07IGWS005627 Porphyra perforata|ABMHC1702-07 IGWS005829 Porphyra perforata |ABmC2310~08 IGWS005814 Porphyra perforata IABM4C2313-08IGWS005817 Porphyra perforata|ADI#IC2648-08IGWS003994 Porphyra perforata IABI«C2308-08IGWS005812 Porphyra perforata IABtMC2321-08IGWS0058S1 jPorphyra perforata IABMHC1224-07(GWS003426 'porphyra perforata IABIMC2677-08 16MS006884 Porphyra perforata IABM4C2643-08 IGKS003244 Porphyra perforata[ABHIC1706-07ISWS005848 Porphyra perforata IABI-MC2319-08 IGWS005849 Porphyra perforata )A»#IC2915-08IGWS0D8184 Porphyra perforata!ABMHC1704-07ICWS005833 Porphyra perforataIABMMC3811-09IGWS009710 Porphyra perforata IABMiC2407-08IGWS008431 Porphyra perforataIABM4C2937-08IGWS009712 Porphyra perforata).IABM4C2918-08I 3IGKS008605 Porphyra perforata!.IABMMC2322-08I 3 IGWS005852 Porphyra perforata!|AB(«C2920-08l 91GHS009071 Porphyra perforata!.IJLBM4C2405-08 JIGWS008271 I Porphyra perforata IIABM4C2675-08 ) IGWS006805I Porphyra perforata|.IABM4C2672-08 5|GWS006S78 I Porphyra perforata).)ABMMC2360-08I 3IGWS006503 Porphyra perforata)IABM4C2671-08 3 IGWS006492I Porphyra perforata)IABM4C2358-08 i IGWS006465 I Porphyra perforata).iABMfC2317-08 I IGWS005845 I Porphyra perforata).!ABMMC170S-07I 7IGWS005844 Porphyra perforata).IABM4C2658-08 } IGHS005843I Porphyra perforata),IABMMC1701-07| 7 IGWS005828 porphyra perforata)IABMMC2657-08I i IGWS005821 Porphyra perforata).IABI-WC1696-07 11GWS005820 I Porphyra perforata).iABtMC289S-08 iIGWS005819 I Porphyra perforata).IABM4C1695-07 MGNS005818 I Porphyra perforata)IABM4C2312-08 iIGKS005816 I Porphyra perforata).IABM1C2311-08 )IGWS005815 I Porphyra perforata)IABM4C2309-08 )ISKS005813 I Porphyra perforata)IABIMC2656-06 5IGWS005811 I Porphyra perforata)IABM4C1694-07 11GWS005810 I Porphyra perforata!IABM4C1693-07 7|GWS005809 I Porphyra perforata).IABMMC2652-08I iIGWS004140 Porphyra perforata)IABMMC2651-08I iIGWS004071 Porphyra perforata).[ABM4C2650-08 i|GHS004033 I Porphyra perforata)IABM4C2649-08 ) IGWS003995I Porphyra perforata).)AB>MC2893-08 i IIGHS003981 Porphyra perforata I,IABMMC2647-08i iIGWS003923 Porphyra perforata)IABM4C2641-08 JIGWS003108 I Porphyra perforata).IABMMC2640-08I iIGWS002812 Porphyra perforata).IABM4C2639-08 i IIGWS002797 Porphyra perforata).IABMMC2642-08I iIGWS003124 Porphyra perforata IABMNC2653-081GWS004450 Porphyra perforataIADIHC1684-07IGMS004693 Porphyra perforata IABM4C2674-08|GWS006735 LPorphyra perforata IABM4C2921-08 16MS009149 iPorphyra perforata)ABMMC3496-08IGWS009718 *Porphyra perforata IABM4C2946-08 1GWSQ09732 Porphyra perforata|ABM«C2949-08IGWS010336 Porphyra perforata)AB*#4C2951-08(GWS010730 Porphyra sp. 6PORIABMMC1570-07[RDW503 Appendix 6: Collection information and accession numbers for samples used in the test set (Chapter 4). Genbank Accession numbers8 Voucher Species Number Collection Site4* BOLD IDC rbcL-5P rbcL-3P UPA LSU ITS Byropsidophyceae, Bryposidales, Bryposidaceae Bryopsis corticulans GWS009004 Scotts Bay, ULVA571-09 XXXXXXX XXXXXXX XXXXXXX U/C NA Setchell Bamfield, BC Bryopsis corticulans GWS009075 Wizard I., ULVA574-09 XXXXXXX XXXXXXX XXXXXXX U/C U/C Setchell Bamfield, BC Byropsidophyceae, Bryposidales, Codiaceae Codium fragile GWS002780 Dixon, I., Bamfield, ULVA478-09 XXXXXXX U/C XXXXXXX U/C NA (Suringar) Hariot BC Codium fragile GWS003527 Peggys Cove, NS ULVA488-09 XXXXXXX U/C XXXXXXX U/C NA (Suringar) Hariot Codium setchellii GWS002933 Bradys Beach, ULVA482-09 NA NA NA NA NA Gardner Bamfield, BC Codium setchellii GWS008955 Seapool Rock, ULVA570-09 NA NA NA NA U/C Gardner Bamfield, BC Trebouxiophyceae, Prasioiales, Derbesiaceae Derbesia marina GWS008836 Beaver Harbour, ULVA567-09 U/C XXXXXXX XXXXXXX NA U/C (Lyngbye) Solier NB Trebouxiophyceae, Prasioiales, Prasioiaceae Prasiola meridionalis GWS002865 Wizard I., ULVA481-09 XXXXXXX XXXXXXX XXXXXXX U/C NA Setchell et Gardner Bamfield, BC Prasiola stipitata Suhr GWS003898 Lepreau, NB ULVA502-09 XXXXXXX XXXXXXX U/C U/C NA ex Jessen K> Ltt Ulvophyceae, Cladophorales, Cladophoraceae Chaetomorpha GWS007053 St. Paul, Bonne ULVA550-09 NA U/C U/C NA U/C brachygona Harvey Bay, NL Chaetomorpha GWS008847 Beaver Harbour, ULVA569-09 NA U/C U/C U/C NA brachygona Harvey NB Chaetomorpha GWS003521 Cape St. Marys, NS ULVA487-09 NA NA NA NA NA melagonium (F. Weber et D. Mohr) Kutzing Chaetomorpha GWS005272 Churchill Northern ULVA514-09 NA NA NA NA U/C melagonium (F. Weber Studies Centre, MB et D. Mohr) Kutzing Chaetomorpha GWS006949 Peggys Cove, NS ULVA546-09 NA NA NA NA NA melagonium (F. Weber et D. Mohr) Kutzing Chaetomorpha GWS003617 Cape Neddick, ME ULVA490-09 NA NA NA NA U/C piquotiana Montagne ex. Kutzing Chaetomorpha sp. GWS006227 Kouchibouguac ULVA528-09 NA NA NA NA NA National Park, NB Cladophora albida GWS006228 Kouchibouguac ULVA529-09 U/C U/C U/C NA U/C (Nees) Kutzing National Park, NB Cladophora GWS002814 Dixon, I., Bamfield, ULVA479-09 NA NA NA NA NA columbiana Collins in BC Setchell et Gardner Cladophora ruchingeri GWS005860 Lepreau, NB ULVA525-09 NA U/C U/C U/C U/C (C. Agardh) Kutzing Cladophora rupestris GWS003791 Meadow Cove, NB ULVA500-09 NA NA NA NA U/C (Linnaeus) Kutzing Cladophora sericea GWS003029 Ross Islets, ULVA484-09 NA NA U/C NA U/C (Hudson) Kutzing Bamfield, BC Cladophora sp. GWS004311 Pachena Beach, ULVA505-09 NA NA U/C NA NA Bamfield, BC K> Cladophora sp. GWS006670 Island #40, Tahsis, ULVA544-09 NA NA NA NA NA BC Cladophora sp. GWS006968 Whycocomagh, ULVA548-09 NA NA NA NA NA Bras d'Or Lakes, NS Cladophora vagabunda GWS007136 Deer Arm, Bonne ULVA554-09 U/C U/C U/C U/C NA (Linnaeus) C. Hoek Bay, NL Lola lubrica (Setchell GWS002984 Cape Beale, ULVA483-09 NA NA NA NA U/C et Gardner in Gardner) Bamfield, BC Hamel et Hamel Rhizoclonium riparium GWS003717 near Letete, NB ULVA494-09 NA NA NA NA NA (Roth) Harvey Ulvophyceae, Ulotrichales, Gomontiaceae Protomonostroma GWS003734 Pettes Cove, Grand ULVA495-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX U/C undulatum (Wittrock) Manan I., NB K.L. Vinogradova Protomonostroma GWS003753 Harrington Cove, ULVA497-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA undulatum (Wittrock) Grand Manan I., K.L. Vinogradova NB Protomonostroma GWS005967 Long Eddy Point, ULVA526-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX XXXXXXX undulatum (Wittrock) Grand Manan I., K.L. Vinogradova NB Ulvophyceae, Ulotrichales, Ulotrichales Acrosiphonia arcta GWS003577 Lepreau,NB ULVA489-09 XXXXXXX XXXXXXX U/C XXXXXXX XXXXXXX (Dillwyn) J. Agardh Acrosiphonia coalita GWS002760 Dixon I., Bamfield, ULVA476-09 XXXXXXX XXXXXXX U/C XXXXXXX XXXXXXX (Ruprecht) Scagel et al. BC Acrosiphonia coalita GWS004310 Pachena Beach, ULVA504-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX XXXXXXX (Ruprecht) Scagel et al. Bamfield, BC Acrosiphonia sonderi GWS003750 Harrington Cove, ULVA496-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX XXXXXXX (Kutzing) Kornmann Grand Manan I., NB u> Acrosiphonia sp. GWS007351 St. Davids, NL ULVA555-09 NA NA NA NA U/C Acrosiphonia sp. GWS006665 Island #40, Tahsis, ULVA542-09 xxxxxxx xxxxxxx xxxxxxx xxxxxxx xxxxxxx 1GWS BC Acrosiphonia sp. GWS008617 Comox Marina ULVA566-09 u/c xxxxxxx U/C U/C U/C 1GWS Breakwater, BC Acrosiphonia sp. GWS005383 NW of Eskimo I., ULVA518-09 xxxxxxx U/C xxxxxxx NA xxxxxxx 6GWS Churchill, MB codiolum phase GWS008049 Riviere du Loup, ULVA559-09 xxxxxxx xxxxxxx U/C U/C U/C QC Spongomorpha GWS003768 Harrington Cove, ULVA498-09 u/c xxxxxxx NA xxxxxxx xxxxxxx aeruginosa (Linnaeus) Grand Manan I., C.Hoek NB Urospora GWS008147 Pachena Bay, ULVA561-09 xxxxxxx xxxxxxx xxxxxxx xxxxxxx NA penicilliformis (Roth) Bamfield, BC Areschoug Urospora wormskioldii GWS006374 Otter Point, ULVA535-09 xxxxxxx xxxxxxx xxxxxxx xxxxxxx U/C (Mertens ex Vancouver I., BC Hornemann) Rosenvinge Ulvophyceae, Ulvales, Kornmanniaceae Blidingia marginata (J. GWS003689 Letete, NB ULVA492-09 xxxxxxx xxxxxxx XXXXXXX XXXXXXX NA Agardh) P.J.L. Dang Blidingia minima GWS007133 Deer Arm, Bonne ULVA553-09 NA U/C XXXXXXX XXXXXXX NA (Nageli ex Kutzing) Bay, NL Kylin Kornmannia GWS004830 Ridley Island, ULVA509-09 XXXXXXX U/C XXXXXXX NA XXXXXXX leptoderma (Kjellman) Prince Rupert, BC Bliding Ulvophyceae, Ulvales, Ulvaceae Ulra californica Wille GWS004842 near Butze Rapids, ULVA510-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX XXXXXXX Prince Rupert, BC K> Ulva californica Wille GWS005072 Ridley Island, ULVA511-09 XXXXXXX XXXXXXX U/C XXXXXXX U/C Prince Rupert, BC Ulva compressa GWS004087 Wizard I., ULVA503-09 XXXXXXX XXXXXXX U/C XXXXXXX NA Linnaeus Bamfield, BC Ulva compressa GWS005694 Lepreau.NB ULVA521-09 XXXXXXX XXXXXXX U/C XXXXXXX NA Linnaeus Ulva compressa GWS008267 Bradys Beach, ULVA562-09 XXXXXXX XXXXXXX Intron XXXXXXX NA Linnaeus Bamfield, BC Ulva flexuosa Wulfen GWS008545 Backeddy Resort, ULVA564-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX U/C BC Ulva lactuca Linnaeus GWS003686 Letete, NB ULVA491-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA Ulva lactuca Linnaeus GWS003817 Beaver Harbour, ULVA501-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA NB Ulva lactuca Linnaeus GWS005100 Ridley Island (north ULVA513-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX U/C of grain terrminal), Prince Rupert, BC Ulva lactuca Linnaeus GWS005338 Button Bay, ULVA517-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA Churchill, MB Ulva lactuca Linnaeus GWS005837 Scotts Bay, ULVA523-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA Bamfield, BC Ulva lactuca Linnaeus GWS005859 Lepreau, NB ULVA524-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX U/C Ulva lactuca Linnaeus GWS006258 Richebucto Cape ULVA531-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA Breakwater, NB Ulva lactuca Linnaeus GWS006666 Island #40,Tahsis, ULVA543-09 XXXXXXX U/C XXXXXXX NA U/C BC Ulva lactuca Linnaeus GWS007962 Cap des Caissie, ULVA558-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA North of Shediac, NB Ulva lactuca Linnaeus GWS008295 Pachena Beach, ULVA563-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA Bamfield, BC Ulva linza Linnaeus GWS006377 Otter Point, ULVA536-09 XXXXXXX XXXXXXX XXXXXXX U/C NA Vancouver I., BC NJ Ulva linza Linnaeus GWS008140 Pachena Bay, ULVA560-09 xxxxxxx xxxxxxx xxxxxxx xxxxxxx u/c Bamfield, BC Ulva lobata (Kiitzing) GWS002779 Dixon, I., Bamfield, ULVA477-09 xxxxxxx xxxxxxx xxxxxxx xxxxxxx u/c Harvey BC Ulva lobata (Kiitzing) GWS002820 Dixon, I., Bamfield, ULVA480-09 xxxxxxx XXXXXXX XXXXXXX NA U/C Harvey BC Ulva lobata (Kiitzing) GWS009007 Reef N. of Island ULVA572-09 xxxxxxx XXXXXXX XXXXXXX XXXXXXX NA Harvey 76, Broken Group, BC Ulva lobata (Kiitzing) GWS009013 Gilbert Island, ULVA573-09 xxxxxxx XXXXXXX XXXXXXX XXXXXXX NA Harvey Broken Group, BC Ulva pertusa Kjellman GWS005803 Aguilar Point, ULVA522-09 xxxxxxx XXXXXXX XXXXXXX XXXXXXX NA Bamfield, BC Ulva pertusa Kjellman GWS006489 Stephenson Pt., ULVA539-09 xxxxxxx XXXXXXX XXXXXXX XXXXXXX u/c Nanaimo, BC Ulva procera (K. GWS006271 Richebucto Cape ULVA532-09 xxxxxxx XXXXXXX XXXXXXX XXXXXXX NA Ahlner) Hayden, Breakwater, NB Blomster, Maggs, P.C. Silva, M J. Stanhope, J.R. Waaland Ulva prolifera O.F. G W S003715 near Letete, NB ULVA493-09 xxxxxxx XXXXXXX Intron XXXXXXX NA Miiller Ulva prolifera O.F. GWS005321 Gordon Point, ULVA516-09 xxxxxxx XXXXXXX u/c XXXXXXX NA Miiller Churchill Northern Studies Centre, MB Ulva prolifera O.F. GWS005446 East shore ULVA519-09 xxxxxxx XXXXXXX XXXXXXX XXXXXXX NA Miiller Churchill River, Churchill, MB Ulva prolifera O.F. GWS005572 Gravel Pit E of ULVA520-09 xxxxxxx XXXXXXX u/c XXXXXXX u/c Miiller Churchill, MB Ulva prolifera O.F. GWS007057 St. Paul, Bonne ULVA551-09 xxxxxxx xxxxxxx u/c XXXXXXX NA Miiller Bay, NL L/l Os Ulva rigida C. Agardh GWS006232 Kouchibouguac ULVA530-09 XXXXXXX XXXXXXX U/C NA NA National Park, NB Ulva sp. GWS005273 Churchill Northern ULVA515-09 NA NA NA NA U/C Studies Centre, MB Ulva sp. 1GWS GWS004319 Bamfield Inlet, ULVA506-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA Bamfield, BC Ulva intestinalis GWS004618 Kye Bay, ULVA508-09 XXXXXXX XXXXXXX U/C XXXXXXX U/C Linnaeus Vancouver I., BC Ulva intestinalis GWS006458 Stephenson Pt., ULVA538-09 XXXXXXX XXXXXXX U/C XXXXXXX NA Linnaeus Nanaimo, BC Ulva intestinalis GWS006939 Beach Meadows, ULVA545-09 XXXXXXX XXXXXXX Intron XXXXXXX NA Linnaeus NS Ulva intestinalis GWS006962 Whycocomagh, ULVA547-09 XXXXXXX XXXXXXX U/C XXXXXXX NA Linnaeus Bras d'Or Lakes, NS Ulva intestinalis GWS007959 L'Anse Bleue ULVA557-09 XXXXXXX XXXXXXX Intron XXXXXXX XXXXXXX Linnaeus Breakwater, Northumberland Strait, NB Ulva intestinalis GWS008549 Courtenay Estuary, ULVA565-09 XXXXXXX XXXXXXX U/C XXXXXXX NA Linnaeus BC Ulva sp. 2GWS GWS004617 Kye Bay, ULVA507-09 XXXXXXX XXXXXXX XXXXXXX U/C NA Vancouver I., BC Ulva sp. 2GWS GWS006531 Tahsis Narrows, ULVA540-09 XXXXXXX NA XXXXXXX XXXXXXX U/C BC Ulva stenophylla GWS003290 Seppings I., ULVA485-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA Setchell et Gardner Bamfield, BC Ulva stenophylla GWS006574 Nuchatliz Island, ULVA541-09 NA XXXXXXX XXXXXXX U/C NA Setchell et Gardner Tahsis, BC Ulvaria obscura GWS003507 Lepreau, NB ULVA486-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA (Ktttzing) Gayral Ulvaria obscura GWS003786 Meadow Cove, NB ULVA499-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX XXXXXXX (Kiitzing) Gayral NJUi -J Ulvaria obscura GWS006119 Escoumins, QC ULVA527-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA (Kiitzing) Gayral Ulvaria obscura GWS006999 Cape Ray, NL ULVA549-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA (Kiitzing) Gayral Ulvaria obscura GWS007079 Bonne Bay Station, ULVA552-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA (Kiitzing) Gayral NL Ulvaria obscura GWS007568 English Harbour, ULVA556-09 XXXXXXX XXXXXXX XXXXXXX NA NA (Kiitzing) Gayral NL Ulvaria obscura GWS008841 Beaver Harbour, ULVA568-09 XXXXXXX XXXXXXX XXXXXXX u/c u/c (Kiitzing) Gayral NB Ulvaria obscura GWS005073 Ridley Island, ULVA512-09 XXXXXXX XXXXXXX NA NA XXXXXXX (Kiitzing) Gayral Prince Rupert, BC Ulvaria obscura GWS006315 Sidney, BC ULVA533-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA (Kiitzing) Gayral Ulvaria obscura GWS006316 Sidney, BC ULVA534-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX NA (Kiitzing) Gayral Ulvaria obscura GWS006404 Whiffen Spit, ULVA537-09 XXXXXXX XXXXXXX XXXXXXX XXXXXXX u/c (Kiitzing) Gayral Vancouver I., BC 8 For each marker, successful sequences are listed by their Genbank accession; unreadable/contaminant sequences listed as "U/C" and samples for which sequencing was not attempted due to failed or poor PCR results listed as "NA" (see Methods for more details on the these categories). In the UPA, samples with introns are listed as "Intron". XXXXXXX=Genbank accession number pending. b Abbreviations for Provinces as follows: BC, British Columbia, Canada; MB, Manitoba, Canada; NB, New Brunswick, Canada; NL, Newfoundland and Labrador, Canada; NS, Nova Scotia, Canada; QC, Quebec, Canada. c Further information for each sample, including a list of collectors for each sample, date of collection and latitudes/longitudes, is available at the Barcode of Life Data Systems (BOLD) website: http://www.barcodinglife.com. K) 00 259 Appendix 7: Collection information and accession numbers for r6cL-3P data generated for the extended set of specimens (Chapter 4). Voucher Genbank Species Number Collection Site" BOLD ID" accession0 Byropsidophyceae, Bryposidales, Bryposidaceae Bryopsis hypnoides J.V. GWS005754 Fort Wetherill, RI ULVA256-09 XXXXXXX Lamouroux Byropsidophyceae, Bryposidales, Derbesiaceae Derbesia marina GWS005999 Pier #5, Narragansett, RI ULVA229-09 XXXXXXX (Lyngbye) Solier Derbesia sp. 1GWS GWS004888 Tree Knob Islands, Prince ULVA190-09 XXXXXXX Rupert, BC Trebouxiophyceae, Prasiolales, Prasiolaceae Prasiola borealis GWS005101 Ridley Island (north of ULVA 122-09 XXXXXXX grain terminal), Prince Rupert, BC Prasiola meridionalis GWS004462 Botanical Beach, Port ULVA 177-09 XXXXXXX Setchell et Gardner Renfrew, Vancouver I., BC Prasiola meridionalis GWS004831 Ridley Island, Prince ULVA 167-09 XXXXXXX Setchell et Gardner Rupert, BC Prasiola delicata GWS005076 Ridley Island, Prince ULVA 169-09 XXXXXXX Rupert, BC Prasiola stipitata Suhr ex GWS003545 Swallow Tail Lighthouse, ULVA090-09 XXXXXXX Jess. Grand Manan I., NB Prasiola stipitata Suhr ex GWS005964 Long Eddy Point, Grand ULVA285-09 XXXXXXX Jess. Manan I., NB Ulvophyceae, Ulotrichales, Gomontiaceae Monostroma grevillei GWS003588 Cape Neddick, ME ULVA091-09 XXXXXXX (Thuret) Wittrock sp. 1 Monostroma grevillei GWS003637 Starboard Cove, ME ULVA046-09 XXXXXXX (Thuret) Wittrock sp. 1 Monostroma grevillei GWS003763 Harrington Cove, Grand ULVA086-09 XXXXXXX (Thuret) Wittrock sp. 1 Manan I., NB Monostroma grevillei GWS005934 Letete, NB ULVA214-09 XXXXXXX (Thuret) Wittrock sp. 1 Monostroma grevillei GWS005974 Lepreau,NB ULVA228-09 XXXXXXX (Thuret) Wittrock sp. 1 Monostroma grevillei GWS003626 Starboard Cove, ME ULVA022-09 XXXXXXX (Thuret) Wittrock sp. 2 Monostroma grevillei GWS003787 Meadow Cove, NB ULVA051-09 XXXXXXX (Thuret) Wittrock sp. 2 Monostroma grevillei GWS003847 Lepreau,NB ULVA 172-09 XXXXXXX (Thuret) Wittrock sp. 2 260 Monostroma grevillei GWS005906 Beaver Harbour, NB ULVA261-09 XXXXXXX (Thuret) Wittrock sp. 2 Monostroma grevillei GWS005975 Lepreau, NB ULVA240-09 XXXXXXX (Thuret) Wittrock sp. 2 Monostroma grevillei GWS005976 Lepreau, NB ULVA252-09 XXXXXXX (Thuret) Wittrock sp. 2 Protomonostroma GWS002668 Cape Elizabeth, near ULVAO13-09 XXXXXXX undulatum (Wittrock) K.L. Portland, ME Vinogradova Protomonostroma GWS003587 Cape Neddick, ME ULVA080-09 XXXXXXX undulatum (Wittrock) K.L. Vinogradova Protomonostroma GWS003666 Starboard Cove, ME ULVA093-09 XXXXXXX undulatum (Wittrock) K.L. Vinogradova Protomonostroma GWS003761 Harrington Cove, Grand ULVA062-09 XXXXXXX undulatum (Wittrock) K.L. Manan I., NB Vinogradova Ulvophyceae, Ulotrichales, Ulotrichales Acrosiphonia arcta GWS002667 Cape Elizabeth, near ULVA001-09 XXXXXXX (Dillwyn) J. Agardh Portland, ME, ME Acrosiphonia arcta GWS003690 Letete, NB UL V A071 -09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS003692 Letete, NB ULVA083-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS003751 Harrington Cove, Grand ULVA084-09 XXXXXXX (Dillwyn) J. Agardh Manan I., NB Acrosiphonia arcta GWS003755 Harrington Cove, Grand ULVA014-09 XXXXXXX (Dillwyn) J. Agardh Manan I., NB Acrosiphonia arcta GWS003796 Meadow Cove, NB ULVA096-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS003818 Beaver Harbour, NB ULVA132-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS003827 Lepreau, NB ULVA112-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS003839 Lepreau, NB ULVA 148-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS005760 Simpson Island, Bay of ULVA268-09 XXXXXXX (Dillwyn) J. Agardh Fundy, NB Acrosiphonia arcta GWS005863 Lepreau, NB ULVA200-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS005879 Letete, NB ULVA249-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS005915 Beaver Harbour, NB ULVA284-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS005939 Blacks Harbour, NB ULVA226-09 XXXXXXX (Dillwyn) J. Agardh Acrosiphonia arcta GWS005963 Long Eddy Point, Grand ULVA274-09 XXXXXXX (Dillwyn) J. Agardh Manan I., NB 261 Acrosiphonia GWS004397 Botanical Beach, Port ULVA164-09 XXXXXXX ChlorochytriumStage Renfrew, Vancouver I., BC Acrosiphonia coalita GWS002956 Seppings I., Bamfield, BC ULVA041-09 XXXXXXX (Ruprecht) Scagel et al. Acrosiphonia coalita GWS004598 Pachena Beach, Bamfield, ULVA 188-09 XXXXXXX (Ruprecht) Scagel et al. BC Acrosiphonia coalita GWS005067 Ridley Island, Prince ULVA 109-09 XXXXXXX (Ruprecht) Scagel et al. Rupert, BC Acrosiphonia coalita GWS005069 Ridley Island, Prince ULVA 133-09 XXXXXXX (Ruprecht) Scagel et al. Rupert, BC Acrosiphonia sonderi GWS002672 Cape Elizabeth, near ULVA025-09 XXXXXXX (Kiitzing) Kornmann Portland, ME Acrosiphonia sonderi GWS003756 Harrington Cove, Grand ULVA026-09 XXXXXXX (Kiitzing) Kornmann Manan I., NB Acrosiphonia sonderi GWS003797 Meadow Cove, NB ULVA 108-09 XXXXXXX (Kiitzing) Kornmann Acrosiphonia sonderi GWS007426 Eastport, NL ULVA064-09 XXXXXXX (Kiitzing) Kornmann Acrosiphonia sp. 1GWS GWS002799 Dixon, I., Bamfield, BC ULVA073-09 XXXXXXX Acrosiphonia sp. 1GWS GWS003448 Pachena Beach, Bamfield, ULVA089-09 XXXXXXX BC Acrosiphonia sp. 1GWS GWS003449 Pachena Beach, Bamfield, ULVA007-09 XXXXXXX BC Acrosiphonia sp. 1GWS GWS003451 Pachena Beach, Bamfield, ULVA031-09 XXXXXXX BC Acrosiphonia sp. 1GWS GWS003983 Seppings I., Bamfield, BC ULVA 162-09 XXXXXXX Acrosiphonia sp. 1GWS GWS004092 Ross Islets, Bamfield, BC ULVA151-09 XXXXXXX Acrosiphonia sp. 1GWS GWS004453 Botanical Beach, Port ULVA 187-09 XXXXXXX Renfrew, Vancouver I., BC Acrosiphonia sp. 1GWS GWS004672 Kelsey Bay, Vancouver I., ULVA 130-09 XXXXXXX BC Acrosiphonia sp. 1GWS GWS004719 Palmerston Recreation ULVA 166-09 XXXXXXX Reserve, Vancouver I., BC Acrosiphonia sp. 1GWS GWS004720 Palmerston Recreation ULVA 178-09 XXXXXXX Reserve, Vancouver I., BC Acrosiphonia sp. 1GWS GWS005075 Ridley Island, Prince ULVA 157-09 XXXXXXX Rupert, BC Acrosiphonia sp. 1GWS GWS005178 Butze Rapids, Prince ULVA 158-09 XXXXXXX Rupert, BC Acrosiphonia sp. 2GWS GWS003819 Beaver Harbour, NB ULVA 144-09 XXXXXXX Acrosiphonia sp. 4GWS GWS005697 Lepreau, NB ULVA278-09 XXXXXXX Acrosiphonia sp. 4GWS GWS005761 Simpson Island, Bay of ULVA279-09 XXXXXXX Fundy, NB Spongomorpha aeruginosa GWS003854 Lepreau, NB ULVA 113-09 XXXXXXX (Linnaeus) C. Hoek Spongomorpha aeruginosa GWS005235 Churchill, MB ULVA 182-09 XXXXXXX (Linnaeus) C. Hoek 262 Urospora speciosa GWS002687 Samoset Resort, Rockport, ULVA061-09 XXXXXXX (Carmichael) Leblond ex G. ME Hamel Ulvophyceae, Ulvales, Kornmanniaceae Blidingia marginata (J. GWS004837 Butze Rapids, Prince ULVA 179-09 XXXXXXX Agardh) PJ.L. Dang Rupert, BC Blidingia minima (Nageli ex GWS003770 Harrington Cove, Grand ULVA027-09 XXXXXXX Kiitzing) Kylin Manan I., NB Ulvophyceae, Ulvales, Ulvaceae Ulva californica Wille GWS004051 Bradys Beach, Bamfield, ULVA 185-09 XXXXXXX BC Ulva californica Wille GWS004221 Whiffen Spit, Vancouver ULVA 104-09 XXXXXXX I., BC Ulva californica Wille GWS004797 Seal Cove, Prince Rupert, ULVA107-09 XXXXXXX BC Ulva californica Wille GWS005068 Ridley Island, Prince ULVA121-09 XXXXXXX Rupert, BC Ulva compressa Linnaeus GWS003101 Pachena Beach, Bamfield, ULVA077-09 XXXXXXX BC Ulva compressa Linnaeus GWS003155 Pachena Beach, Bamfield, ULVA088-09 XXXXXXX BC Ulva compressa Linnaeus GWS003574 Lepreau, NB ULVA032-09 XXXXXXX Ulva compressa Linnaeus GWS003928 Dixon, I., Bamfield, BC ULVA 126-09 XXXXXXX Ulva compressa Linnaeus GWS003929 Dixon, I., Bamfield, BC ULVA138-09 XXXXXXX Ulva compressa Linnaeus GWS004052 Bradys Beach, Bamfield, ULVA 103-09 XXXXXXX BC Ulva compressa Linnaeus GWS004084 Wizard I., Bamfield, BC ULVA 127-09 XXXXXXX Ulva compressa Linnaeus GWS004085 Wizard I., Bamfield, BC ULVA 139-09 XXXXXXX Ulva compressa Linnaeus GWS004796 Seal Cove, Prince Rupert, ULVA 189-09 XXXXXXX BC Ulva compressa Linnaeus GWS005862 Lepreau, NB ULVA282-09 XXXXXXX Ulva gigantea (Kiitzing) GWS005692 Lepreau, NB ULVA231-09 XXXXXXX Bliding Ulva gigantea (Kiitzing) GWS005693 Lepreau, NB ULVA243-09 XXXXXXX Bliding Ulva gigantea (Kiitzing) GWS005861 Lepreau, NB ULVA271-09 XXXXXXX Bliding Ulva gigantea (Kiitzing) GWS005870 Letete, NB ULVA236-09 XXXXXXX Bliding Ulva lactuca Linnaeus GWS005557 Wreck of the Ithaca, east ULVA227-09 XXXXXXX of Churchill, MB Ulva lactuca Linnaeus GWS005613 Cape Neddick, ME ULVA263-09 XXXXXXX Ulva lactuca Linnaeus GWS005695 Lepreau, NB ULVA255-09 XXXXXXX Ulva lactuca Linnaeus GWS005696 Lepreau, NB ULVA267-09 XXXXXXX Ulva lactuca Linnaeus GWS005698 Lepreau, NB ULVA 196-09 XXXXXXX Ulva lactuca Linnaeus GWS005750 Fort Wetherill,RI ULVA244-09 XXXXXXX 263 Ulva lactuca Linnaeus GWS005785 Seal Point, PEI ULVA209-09 xxxxxxx Ulva lactuca Linnaeus GWS005791 Sea Cow Pond, PEI ULVA221-09 xxxxxxx Ulva lactuca Linnaeus GWS005792 Sea Cow Pond, PEI ULVA233-09 xxxxxxx Ulva lactuca Linnaeus GWS005801 Aguilar Point, Bamfield, ULVA269-09 xxxxxxx BC Ulva lactuca Linnaeus GWS005841 Scotts Bay, Bamfield, BC ULVA281-09 xxxxxxx Ulva lactuca Linnaeus GWS005842 Scotts Bay, Bamfield, BC ULVA 199-09 xxxxxxx Ulva lactuca Linnaeus GWS005853 Bradys Beach, Bamfield, ULVA211-09 xxxxxxx BC Ulva lactuca Linnaeus GWS005871 Letete, NB ULVA248-09 xxxxxxx Ulva lactuca Linnaeus GWS005872 Letete, NB ULVA260-09 xxxxxxx Ulva lactuca Linnaeus GWS005875 Letete, NB ULVA201-09 xxxxxxx Ulva lactuca Linnaeus GWS005876 Letete, NB ULVA213-09 xxxxxxx Ulva lactuca Linnaeus GWS005877 Letete, NB ULVA225-09 xxxxxxx Ulva lactuca Linnaeus GWS005907 Beaver Harbour, NB ULVA273-09 xxxxxxx Ulva lactuca Linnaeus GWS005933 Letete, NB ULVA202-09 xxxxxxx Ulva lactuca Linnaeus GWS005997 Pier #5, Narragansett, RI ULVA205-09 xxxxxxx Ulva lactuca Linnaeus GWS005998 Pier #5, Narragansett, RI ULVA217-09 xxxxxxx Ulva lactuca Linnaeus GWS006041 Governor Sprague Bridge ULVA242-09 xxxxxxx 17, Narragansett Ulva lobata (Kiitzing) GWS005839 Scotts Bay, Bamfield, BC ULVA258-09 XXXXXXX Harvey Ulva pertusa Kjellman GWS005800 Aguilar Point, Bamfield, ULVA257-09 XXXXXXX BC Ulva pertusa Kjellman GWS005802 Aguilar Point, Bamfield, ULVA280-09 XXXXXXX BC Ulva pertusa Kjellman GWS005804 Aguilar Point, Bamfield, ULVA 198-09 XXXXXXX BC Ulva pertusa Kjellman GWS005834 Scotts Bay, Bamfield, BC ULVA210-09 xxxxxxx Ulva pertusa Kjellman GWS005836 Scotts Bay, Bamfield, BC ULV A234-09 xxxxxxx Ulva procera (K. Ahlner) GWS005864 Lepreau, NB ULVA212-09 xxxxxxx Hayden, Blomster, Maggs, P.C. Silva, M J. Stanhope, J.R. Waaland Ulva procera (K. Ahlner) GWS006030 Governor Sprague Bridge ULVA 194-09 XXXXXXX Hayden, Blomster, Maggs, 17, Narragansett, RI P.C. Silva, MJ. Stanhope, J.R. Waaland Ulva prolifera O.F. Miiller GWS003591 Cape Neddick, ME ULVA033-09 xxxxxxx Ulva prolifera O.F. Miiller GWS003716 near Letete, NB ULVA072-09 xxxxxxx Ulva prolifera O.F. Miiller GWS003764 Harrington Cove, Grand ULVA003-09 xxxxxxx Manan I., NB Ulva prolifera O.F. Miiller GWS003841 Lepreau, NB ULVA 160-09 xxxxxxx Ulva prolifera O.F. Miiller GWS003858 Lepreau, NB ULVA 149-09 xxxxxxx 264 Viva prolifera O.F. Miiller GWS005322 Gordon Point, Churchill ULVA123-09 XXXXXXX Northern Studies Centre, MB Viva prolifera O.F. Miiller GWS005447 East shore Churchill River, ULVA215-09 XXXXXXX Churchill, MB Viva intestinalis Linnaeus GWS003584 Cape Neddick, ME ULVA044-09 XXXXXXX Viva intestinalis Linnaeus GWS002673 Cape Elizabeth, near ULVA037-09 XXXXXXX Portland, ME Viva intestinalis Linnaeus GWS002815 Dixon, I., Bamfield, BC ULVA085-09 XXXXXXX Viva intestinalis Linnaeus GWS002857 Wizard I., Bamfield, BC ULVAO17-09 XXXXXXX Viva intestinalis Linnaeus GWS003095 New River Beach, NB ULVA065-09 XXXXXXX Viva intestinalis Linnaeus GWS003585 Cape Neddick, ME ULVA056-09 XXXXXXX Viva intestinalis Linnaeus GWS003592 Cape Neddick, ME ULVA045-09 XXXXXXX Viva intestinalis Linnaeus GWS003622 Starboard Cove, ME ULVA069-09 XXXXXXX Viva intestinalis Linnaeus GWS003623 Starboard Cove, ME ULVA081-09 XXXXXXX Viva intestinalis Linnaeus GWS003699 Letete, NB ULVA024-09 XXXXXXX Viva intestinalis Linnaeus GWS003798 Meadow Cove, NB ULVA 120-09 XXXXXXX Viva intestinalis Linnaeus GWS003820 Beaver Harbour, NB ULVA 156-09 XXXXXXX Viva intestinalis Linnaeus GWS003857 Lepreau, NB ULVA 137-09 XXXXXXX Viva intestinalis Linnaeus GWS004455 Botanical Beach, Port ULVA 117-09 XXXXXXX Renfrew, Vancouver I., BC Viva intestinalis Linnaeus GWS004829 Ridley Island, Prince ULVA 155-09 XXXXXXX Rupert, BC Viva intestinalis Linnaeus GWS005074 Ridley Island, Prince ULVA 145-09 XXXXXXX Rupert, BC Viva intestinalis Linnaeus GWS005857 Bradys Beach, Bamfield, ULVA247-09 XXXXXXX BC Viva intestinalis Linnaeus GWS005858 Bradys Beach, Bamfield, ULVA259-09 XXXXXXX BC Viva intestinalis Linnaeus GWS006027 Governor Sprague Bridge ULVA253-09 XXXXXXX 17, Narragansett, RI Viva sp. 2GWS GWS004459 Botanical Beach, Port ULVA 153-09 XXXXXXX Renfrew, Vancouver I., BC Viva sp. 5GWS GWS005835 Scotts Bay, Bamfield, BC ULVA222-09 XXXXXXX Viva sp. 5GWS GWS005838 Scotts Bay, Bamfield, BC ULVA246-09 XXXXXXX Viva sp. 5GWS GWS005840 Scotts Bay, Bamfield, BC ULVA270-09 XXXXXXX Viva stenophylla Setchell et GWS003927 Dixon, I., Bamfield, BC ULVA 114-09 XXXXXXX Gardner Viva stenophylla Setchell et GWS004599 Pachena Beach, Bamfield, ULVA106-09 XXXXXXX Gardner BC Vivaria obscura (Kutzing) GWS003572 Lepreau, NB ULVA008-09 XXXXXXX Gayral Vivaria obscura (Kutzing) GWS003573 Lepreau, NB ULVA020-09 XXXXXXX Gayral 265 Ulvaria obscura (Kiitzing) GWS003627 Starboard Cove, ME ULVA034-09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS003667 Starboard Cove, ME ULV AO 11 -09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS003673 Starboard Cove, ME ULVA023-09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS003821 Beaver Harbour, NB ULVA168-09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS003826 Lepreau, NB ULV A100-09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS003834 Lepreau, NB ULVA 124-09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS003855 Lepreau, NB ULVA 125-09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS005873 Letete, NB ULVA272-09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS005874 Letete, NB ULVA283-09 XXXXXXX Gayral Ulvaria obscura (Kiitzing) GWS004457 Botanical Beach, Port ULVA 141-09 XXXXXXX Gayral Renfrew, Vancouver I., BC Ulvaria obscura (Kiitzing) GWS004603 Kye Bay, Vancouver I. ULVA 118-09 XXXXXXX Gayral BC a Abbreviations for Provinces/States as follows: BC, British Columbia, Canada; MB, Manitoba, Canada; ME, Maine, USA; NB, New Brunswick, Canada; NL, Newfoundland and Labrador, Canada; NS, PEI, Prince Edward Island, Canada; QC, Quebec, Canada; RI, Rhode Island, USA. b Further information for each sample, including a list of collectors for each sample, date of collection and latitudes/longitudes, is available at the Barcode of Life Data Systems (BOLD) website: http://www.barcodinglife.com. c XXXXXXX=Genbank accession number pending. Curriculum Vitae Candidate's full name: Hana Kucera Universities attended (with dates and degrees obtained): Bachelor of Science, Biology, Simon Fraser University 2004 Publications: Kucera, H. & G.W. Saunders (2008) Assigning morphological variants o/Fucus (Fucales, Phaeophyceae) in Canadian waters to recognized species using DNA barcoding. Botany 86:1065-1079. Conference Presentations: Kucera, H. (2010) Species identification and discovery in common marine macroalgae: Fucus, Porphyra and Ulva using a DNA barcoding approach, (invited seminar) Bamfield Marine Sciences Centre Summer Seminar Series, Bamfield, BC, June 23, 2010. Kucera, H. & G.W. Saunders (2010) A pilot study evaluation of rbcL, UP A, LSU, and ITS as DNA barcode markers for the marine green macroalgae. (talk) Northeast Algal Symposium, Roger Williams University, Bristol, RI. April 16-18, 2010. Kucera, H. & G.W. Saunders (2008) DNA barcoding as a tool for speices identification in the red algal genus Porphyra in Canada, (talk) Northeast Algal Symposium, University of New Hampshire, Durham, NH. April 18-20, 2008. Kucera, H. & G.W. Saunders (2007) DNA barcoding: an efficient tool to distinguish taxonomically difficult algal species o/Porphyra (Rhodophyta), Ulva (Chlorophyta), and Fucus (Phaeophyceae). (poster) Centre for Environmental and Molecular Algal Research. Fredericton, NB. September 14-15, 2007. Kucera, H. & G.W. Saunders (2007) DNA Barcoding: a tool to distinguish species in three taxonomically difficult genera of marine macroalgae. (poster) Canadian Society for Ecology and Evolution. Toronto, ON. May 17-20, 2007. Kucera, H. & G.W. Saunders (2007) DNA Barcoding: a tool to distinguish species in three taxonomically difficult genera of marine macroalgae. (poster) Canadian Barcode of Life Network's Science Symposium, Guelph, ON. May 9-12, 2007. Kucera, H. & G.W. Saunders (2007) DNA barcoding: an efficient tool to distinguish taxonomically difficult algal species o/Porphyra (Rhodophyta), Ulva (Chlorophyta), and Fucus (Phaeophyceae). (poster) Northeast Algal Symposium, Narragansett, RI. April 20- 22, 2007. Kucera, H. & G.W. Saunders (2006) Species limits andphenotypic plasticity, (talk) Evolution 2006: Joint meeting of the Society for the Study of Evolution, the Society of Systematic Biologists, and the American Society of Naturalists. State University of New York, Stony Brook, NY. June 23-27, 2006. Kucera, H. & G.W. Saunders (2006) Molecular analysis of species limits of the brown algal genus Fucus in the Northeast Pacific, (talk) Northeast Algal Symposium, Marist College, Poughkeepsie, NY. April 21-23, 2006. Kucera, H. & G.W. Saunders (2006) Molecular analysis of species diversity in the brown algal genus Fucus in Canada, (talk) Centre for Environmental and Molecular Algal Research. Mount Allison University, Sackville, NS. March 30-31, 2006. Kucera, H. & G.W. Saunders (2005) Resolving species limits for the brown algal genus Fucus in the Northeast Pacific, (poster) Northeast Algal Symposium, Rockport, ME. April 27-30, 2005. Kucera, H. & A.0. Mooers (2004) Supertrees v.s. Supermatrices: comparing two methods of building phylogenetic trees with large, heterogeneous molecular datasets; a test case with Sophophora (Drosophila). (poster) Evolution-Washington, Idaho, British Columbia, Oregon (Evo-WIBO). Port Townsend, WA. April 16-28, 2004 Kucera, H. & A.0. Mooers (2003) A tree for Drosophila, total evidence versus consensus trees: a proposal, (talk) Pacific Ecology Conference. Bamfield, BC. February 14-16, 2003.