A Genome-Wide Genetic Screen for Host Factors Required for Hepatitis C Virus Propagation
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
FHL3 Contributes to EMT and Chemotherapy Resistance Through Inhibiting Ubiquitination of Slug and Activating Tgfβ/Smad-Independent Pathways in Gastric Cancer
FHL3 Contributes to EMT and Chemotherapy Resistance Through Inhibiting Ubiquitination of Slug and Activating TGFβ/Smad-Independent Pathways in Gastric Cancer Guodong Cao First Aliated Hospital of Anhui Medical University Pengping Li Hangzhou Xiaoshan No 1 People's Hospital Qiang Sun Xuzhou Medical University Sihan Chen First Aliated Hospital of Anhui Medical University Xin Xu First Aliated Hospital of Anhui Medical University Xiaobo He First Aliated Hospital of Anhui Medical University Zhenyu Wang Hangzhou Xiaoshan No 1 People's Hospital Peng Chen First Aliated Hospital of Anhui Medical University Maoming Xiong ( [email protected] ) First Aliated Hospital of Anhui Medical University Bo Chen First Aliated Hospital of Anhui Medical University Research Keywords: EMT, Chemotherapy resistance, FHL3, Ubiquitination, Gastric cancer Posted Date: October 9th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-87249/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. ReLoaadd iFngu l[Ml LaitchJeanxs]/ejax/output/CommonHTML/jax.js Page 1/28 Loading [MathJax]/jax/output/CommonHTML/jax.js Page 2/28 Abstract Background: Gastric cancer presents high risk of metastasis and chemotherapy resistance. Hence, the mechanistic understanding of the tumor metastasis and chemotherapy resistance is quietly important. Methods: TCGA database and clinical samples are used for exploring the role of FHL3 in disease progression and prognosis. The roles of FHL3 in metastasis and chemotherapy resistance are explored in vitro and in vivo by siRNA or shRNA treatment. Finally, we explore the FHL3-mediated EMT and chemotherapy resistance. Results: mRNA and protein level of FHL3 is signicantly up-regulated in gastric cancer tissues when compares with it in adjacent tissue. -
Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome. -
Mechanical Forces Induce an Asthma Gene Signature in Healthy Airway Epithelial Cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T
www.nature.com/scientificreports OPEN Mechanical forces induce an asthma gene signature in healthy airway epithelial cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T. Kho4, Kelan Tantisira1, Marc Santolini 1,5, Feixiong Cheng6,7,8, Jennifer A. Mitchel3, Maureen McGill3, Michael J. O’Sullivan3, Margherita De Marzio1,3, Amitabh Sharma1, Scott H. Randell9, Jefrey M. Drazen3, Jefrey J. Fredberg3 & Scott T. Weiss1,3* Bronchospasm compresses the bronchial epithelium, and this compressive stress has been implicated in asthma pathogenesis. However, the molecular mechanisms by which this compressive stress alters pathways relevant to disease are not well understood. Using air-liquid interface cultures of primary human bronchial epithelial cells derived from non-asthmatic donors and asthmatic donors, we applied a compressive stress and then used a network approach to map resulting changes in the molecular interactome. In cells from non-asthmatic donors, compression by itself was sufcient to induce infammatory, late repair, and fbrotic pathways. Remarkably, this molecular profle of non-asthmatic cells after compression recapitulated the profle of asthmatic cells before compression. Together, these results show that even in the absence of any infammatory stimulus, mechanical compression alone is sufcient to induce an asthma-like molecular signature. Bronchial epithelial cells (BECs) form a physical barrier that protects pulmonary airways from inhaled irritants and invading pathogens1,2. Moreover, environmental stimuli such as allergens, pollutants and viruses can induce constriction of the airways3 and thereby expose the bronchial epithelium to compressive mechanical stress. In BECs, this compressive stress induces structural, biophysical, as well as molecular changes4,5, that interact with nearby mesenchyme6 to cause epithelial layer unjamming1, shedding of soluble factors, production of matrix proteins, and activation matrix modifying enzymes, which then act to coordinate infammatory and remodeling processes4,7–10. -
In Vivo Studies Using the Classical Mouse Diversity Panel
The Mouse Diversity Panel Predicts Clinical Drug Toxicity Risk Where Classical Models Fail Alison Harrill, Ph.D The Hamner-UNC Institute for Drug Safety Sciences 0 The Importance of Predicting Clinical Adverse Drug Reactions (ADR) Figure: Cath O’Driscoll Nature Publishing 2004 Risk ID PGx Testing 1 People Respond Differently to Drugs Pharmacogenetic Markers Identified by Genome-Wide Association Drug Adverse Drug Risk Allele Reaction (ADR) Abacavir Hypersensitivity HLA-B*5701 Flucloxacillin Hepatotoxicity Allopurinol Cutaneous ADR HLA-B*5801 Carbamazepine Stevens-Johnson HLA-B*1502 Syndrome Augmentin Hepatotoxicity DRB1*1501 Ximelagatran Hepatotoxicity DRB1*0701 Ticlopidine Hepatotoxicity HLA-A*3303 Average preclinical populations and human hepatocytes lack the diversity to detect incidence of adverse events that occur only in 1/10,000 people. Current Rodent Models of Risk Assessment The Challenge “At a time of extraordinary scientific progress, methods have hardly changed in several decades ([FDA] 2004)… Toxicologists face a major challenge in the twenty-first century. They need to embrace the new “omics” techniques and ensure that they are using the most appropriate animals if their discipline is to become a more effective tool in drug development.” -Dr. Michael Festing Quantitative geneticist Toxicol Pathol. 2010;38(5):681-90 Rodent Models as a Strategy for Hazard Characterization and Pharmacogenetics Genetically defined rodent models may provide ability to: 1. Improve preclinical prediction of drugs that carry a human safety risk 2. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Two Locus Inheritance of Non-Syndromic Midline Craniosynostosis Via Rare SMAD6 and 4 Common BMP2 Alleles 5 6 Andrew T
1 2 3 Two locus inheritance of non-syndromic midline craniosynostosis via rare SMAD6 and 4 common BMP2 alleles 5 6 Andrew T. Timberlake1-3, Jungmin Choi1,2, Samir Zaidi1,2, Qiongshi Lu4, Carol Nelson- 7 Williams1,2, Eric D. Brooks3, Kaya Bilguvar1,5, Irina Tikhonova5, Shrikant Mane1,5, Jenny F. 8 Yang3, Rajendra Sawh-Martinez3, Sarah Persing3, Elizabeth G. Zellner3, Erin Loring1,2,5, Carolyn 9 Chuang3, Amy Galm6, Peter W. Hashim3, Derek M. Steinbacher3, Michael L. DiLuna7, Charles 10 C. Duncan7, Kevin A. Pelphrey8, Hongyu Zhao4, John A. Persing3, Richard P. Lifton1,2,5,9 11 12 1Department of Genetics, Yale University School of Medicine, New Haven, CT, USA 13 2Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, CT, USA 14 3Section of Plastic and Reconstructive Surgery, Department of Surgery, Yale University School of Medicine, New Haven, CT, USA 15 4Department of Biostatistics, Yale University School of Medicine, New Haven, CT, USA 16 5Yale Center for Genome Analysis, New Haven, CT, USA 17 6Craniosynostosis and Positional Plagiocephaly Support, New York, NY, USA 18 7Department of Neurosurgery, Yale University School of Medicine, New Haven, CT, USA 19 8Child Study Center, Yale University School of Medicine, New Haven, CT, USA 20 9The Rockefeller University, New York, NY, USA 21 22 ABSTRACT 23 Premature fusion of the cranial sutures (craniosynostosis), affecting 1 in 2,000 24 newborns, is treated surgically in infancy to prevent adverse neurologic outcomes. To 25 identify mutations contributing to common non-syndromic midline (sagittal and metopic) 26 craniosynostosis, we performed exome sequencing of 132 parent-offspring trios and 59 27 additional probands. -
Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins
International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R. -
Stress-Responsive Regulation of Mitochondria Through the ER
TEM-969; No. of Pages 10 Review Stress-responsive regulation of mitochondria through the ER unfolded protein response T. Kelly Rainbolt, Jaclyn M. Saunders, and R. Luke Wiseman Department of Molecular and Experimental Medicine, Department of Chemical Physiology, The Scripps Research Institute, La Jolla, CA 92037, USA The endoplasmic reticulum (ER) and mitochondria form function is sensitive to pathologic insults that induce ER physical interactions involved in the regulation of bio- stress (defined by the increased accumulation of misfolded logic functions including mitochondrial bioenergetics proteins within the ER lumen). ER stress can be transmit- and apoptotic signaling. To coordinate these functions ted to mitochondria by alterations in the transfer of me- 2+ during stress, cells must coregulate ER and mitochon- tabolites such as Ca or by stress-responsive signaling dria through stress-responsive signaling pathways such pathways, directly influencing mitochondrial functions. as the ER unfolded protein response (UPR). Although the Depending on the extent of cellular stress, the stress UPR is traditionally viewed as a signaling pathway re- signaling from the ER to mitochondria can result in pro- sponsible for regulating ER proteostasis, it is becoming survival or proapoptotic adaptations in mitochondrial increasingly clear that the protein kinase RNA (PKR)-like function. endoplasmic reticulum kinase (PERK) signaling pathway During the early adaptive phase of ER stress, ER– 2+ within the UPR can also regulate mitochondria proteos- mitochondrial contacts increase, promoting Ca transfer 2+ tasis and function in response to pathologic insults that between these organelles [4]. This increase in Ca flux into induce ER stress. Here, we discuss the contributions of mitochondria stimulates mitochondrial metabolism 2+ PERK in coordinating ER–mitochondrial activities and through the activity of Ca -regulated dehydrogenases describe the mechanisms by which PERK adapts mito- involved in the tricarboxylic acid (TCA) cycle. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Inhibition of Pikfyve Using YM201636 Suppresses the Growth of Liver Cancer Via the Induction of Autophagy
ONCOLOGY REPORTS 41: 1971-1979, 2019 Inhibition of PIKfyve using YM201636 suppresses the growth of liver cancer via the induction of autophagy JIU-ZHOU HOU1, ZHUO-QING XI1, JIE NIU1, WEI LI1, XIAO WANG1, CHAO LIANG1, HUA SUN1, DONG FANG1 and SONG-QIANG XIE2 1Institute for Innovative Drug Design and Evaluation; 2Institute of Chemical Biology, School of Pharmacy, Henan University, Kaifeng, Henan 475004, P.R. China Received May 9, 2018; Accepted December 6, 2018 DOI: 10.3892/or.2018.6928 Abstract. Liver cancer is among the most common types Introduction of cancer worldwide. The aim of the present study was to investigate whether the phosphatidylinositol-3-phos- Liver cancer is one of the most common types of cancer world- phate 5-kinase (PIKfyve) inhibitor, YM201636, exerts wide, ranking as the third leading cause of cancer-associated anti-proliferative effects on liver cancer. The methods used in mortality (1). Despite the great advances in the use of modern the present study included MTT assay, flow cytometry, western surgical techniques in combination with chemotherapy, the blot analysis and an allograft mouse model of liver cancer. The overall 5-year survival rate for patients with liver cancer results revealed that YM201636 inhibited the proliferation of remains poor (2). Therefore, novel strategies for the anticancer HepG2 and Huh-7 cells in a dose-dependent manner. HepG2 therapy of liver cancer are urgently required. and Huh-7 cells exhibited strong monodansylcadaverine Phosphatidylinositol-3-phosphate 5-kinase (PIKfyve) is a staining following treatment with YM201636. Accordingly, lipid kinase that phosphorylates phosphatidylinositol-3-phos- YM201636 treatment increased the expression of the phate (PI3P) to generate phosphatidylinositol 3,5-bisphosphate autophagosome-associated marker protein microtubule-asso- [PtdIns(3,5)P2] or phosphatidylinositol 5-phosphate ciated 1A/1B light chain 3-II in HepG2 and Huh-7 cells. -
Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,