OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC305088

IFNA13 (IFNA1) (NM_024013) Human Untagged Clone Product data:

Product Type: Expression Plasmids Product Name: IFNA13 (IFNA1) (NM_024013) Human Untagged Clone Tag: Tag Free Symbol: IFNA1 Synonyms: IFL; IFN; IFN-ALPHA; IFN-alphaD; IFNA13; IFNA@; leIF D Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene sequence for NM_024013 edited CCATCTCAGCAAGCCCAGAAGTATCTGCAATATCTACGATGGCCTCGCCCTTTGCTTTAC TGATGGTCCTGGTGGTGCTCAGCTGCAAGTCAAGCTGCTCTCTGGGCTGTGATCTCCCTG AGACCCACAGCCTGGATAACAGGAGGACCTTGATGCTCCTGGCACAAATGAGCAGAATCT CTCCTTCCTCCTGTCTGATGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGATG GCAACCAGTTCCAGAAGGCTCCAGCCATCTCTGTCCTCCATGAGCTGATCCAGCAGATCT TCAACCTCTTTACCACAAAAGATTCATCTGCTGCTTGGGATGAGGACCTCCTAGACAAAT TCTGCACCGAACTCTACCAGCAGCTGAATGACTTGGAAGCCTGTGTGATGCAGGAGGAGA GGGTGGGAGAAACTCCCCTGATGAATGCGGACTCCATCTTGGCTGTGAAGAAATACTTCC GAAGAATCACTCTCTATCTGACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCA GAGCAGAAATCATGAGATCCCTCTCTTTATCAACAAACTTGCAAGAAAGATTAAGGAGGA AGGAATAACATCTGGTCCAACATGAAAACAATTCTTATTGACTCATACACCAGGTCACGC TTTCATG Restriction Sites: Please inquire ACCN: NM_024013 Insert Size: 700 bp OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_024013.1. RefSeq: NM_024013.1, NP_076918.1

This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 IFNA13 (IFNA1) (NM_024013) Human Untagged Clone – SC305088

RefSeq Size: 876 bp

RefSeq ORF: 570 bp Locus ID: 3439 UniProt ID: P01562, L0N195 Families: Druggable Genome Protein Pathways: Antigen processing and presentation, Autoimmune thyroid disease, - interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway Summary: This gene is a member of the alpha gene cluster on 9. The encoded cytokine is a member of the type I interferon family that is produced in response to viral infection as a key part of the innate immune response with potent antiviral, antiproliferative and immunomodulatory properties. This cytokine, like other type I , binds a plasma membrane receptor made of IFNAR1 and IFNAR2 that is ubiquitously expressed, and thus is able to act on virtually all body cells. This cytokine is upregulated in preeclamptic placentas and is thought to be a mediator of preeclampsia. [provided by RefSeq, Aug 2020]

This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2