New Insights Into the Regulation of NADPH Oxidase Dependent Reactive Oxygen Species Signaling During the Plant Immune Response

UNIVERSIDAD POLITÉCNICA DE MADRID ESCUELA TÉCNICA SUPERIOR DE INGENIEROS AGRÓNOMOS

New insights into the regulation of NADPH oxidase dependent reactive oxygen species signaling during the plant immune response

PhD Thesis JORGE MORALES BELLO Bachelor in Biology, MSc in Agricultural and Forestry Biotechnology 2015

UNIVERSIDAD POLITÉCNICA DE MADRID ESCUELA TÉCNICA SUPERIOR DE INGENIEROS AGRÓNOMOS Departamento de Biotecnología y Biología Vegetal Centro de Biotecnología y Genómica de Plantas (UPM-INIA)

New insights into the regulation of NADPH oxidase dependent reactive oxygen species signaling during the plant immune response

PhD Thesis

JORGE MORALES BELLO Bachelor in Biology, MSc in Agricultural and Forestry Biotechnology 2015

UNIVERSIDAD POLITÉCNICA DE MADRID ESCUELA TÉCNICA SUPERIOR DE INGENIEROS AGRÓNOMOS Departamento de Biotecnología y Biología Vegetal Centro de Biotecnología y Genómica de Plantas (UPM-INIA)

PhD Thesis: New insights into the regulation of NADPH oxidase dependent reactive oxygen species signaling during the plant immune response

Author: Jorge Morales Bello Bachelor in Biology, MSc in Agricultural and Forestry Biotechnology

Supervisor: Miguel Ángel Torres Lacruz Bachelor in Sciences (section Biology) PhD in Biology

Madrid, 2015

iii

ACKNOWLEDGEMENTS

This Philosophy Doctorate (PhD) Thesis has been carried out at Dr. Antonio Molina Fernandez´s laboratory, associated to the Biotechnology department of the Escuela Técnica Superior de Ingenieros Agrónomos (Universidad Politénica de Madrid) located at the Centro de Biotecnología y Genómica de Plantas (UPM-INIA). The work performed has been supervised by Dr. Miguel Angel Torres Lacruz. The following people have contributed to the results obtained:

Dr. Miguel Ángel Torres Lacruz has directed this research work and my scientific predoctoral training. He was also directly involved in the generation of the promoter-Rboh::GUS, promoter-swap genetic constructs employed in chapter 1, and the 35S::YFP::RbohD genetic construct employed in chapter 2. Moreover, he generated the combinatorial mutant lines: agb1 gpa1, agb1 rbohD rbohF and agb1 gpa1 rbohD rbohF by genetic crosses and collaborated in the experimental work to obtain the results presented in figures: 1, 4 and 5 (chapter 2).

Dr. Antonio Molina Fernández has contributed to the attainment of this PhD Thesis with useful comments and discussion of the results obtained, allowing me to use all the resources in his laboratory and co- funding the second half of my PhD.

Dr. Cyril Zipfel advised me during the EMBO proposal writing and in the experimental design of the biochemical work carried out to test the potential association between RBOHs, BIK1 and AGB1. He also allowed me to use the resources in his laboratory to carry out the experiments shown in figures 3B, 4 and 9A (chapter 1) and figures 8 and 10, (chapter 2).

Begoña Prieto, former laboratory technician, contributed to the generation of promoter-Rboh:GUS, promoter-swap transgenic lines and the 35S::YFP::RbohD genetic construct.

Gemma López, laboratory technician at Dr. Antonio Molina´s group, was in charge of the generation and storage of the Plectosphaerella cucumerina monosporic cultures employed.

Dr. Clara Shánchez Rodríguez, former postdoctoral researcher at Dr. Staffan Persson’s group at the Max Planck Institute, contributed to the pathotests of the combinatorial mutants between heterotrimeric G proteins and NADPH oxidases in response to Plectosphaerella cucumerina.

Dr. Shuta Asai, postdoctoral researcher at Dr. Jonathan Jones group at TSL, generated and shared the 35S::FLAG::RbohF construct employed in the co-immunoprecipitation assays on figure 10 chapter 2.

Dr. Brisa Ramos and Dr. Beatríz Nuñez, former postdoctoral researchers at Dr. Antonio Molina´s group, and Dr. Alberto Macho, Dr. Yasuhiro Kadota and Dr. Rosa Lozano, former postdoctoral researchers at Dr. Cyril Zipfel´s group, have made useful comments and suggestions critical to the advancement of this research work.

Dr. Yasuhiro Kadota generated the 35S::FLAG::RbohD and 35S::Bik1::HA genetic constructs used in the co-immunoprecipitation assays on figure 10 chapter 2 and, together with Dr. Alberto Macho, have technically advised me during the performance of these experiments.

Dr. Christoph Bücherl, postdoctoral researcher at Dr. Cyril Zipfel´s group, technically assisted me at the confocal microscope to detect the transient expression of YFP-AGB1.

The Universidad Politécnica de Madrid (UPM) has funded my PhD with a co-fund UPM predoctoral fellowship associated to the European Reintegration Grant 0/562971 granted to Dr. Miguel Angel Torres Lacruz.

The European Molecular Biology Organization (EMBO) and the UPM have funded my stays at The Sainsbury Laboratory in Norwich (UK).

AGRADECIMIENTOS PERSONALES

Si algo he aprendido durante este periodo es que para llevar un proyecto a cabo, tan importantes son las ideas, los medios y la financiación como las personas que te rodean. Por ello no puedo dejar pasar la oportunidad de dar las gracias a la gente que ha estado a mi lado durante este proceso:

To Cyril and “his crew” for making me feel at home during my stays at TSL, specially to: Daniel Couto Diewertje Van der Does, Yasuhiro Kadota, Martin Stegman, Lena Strandsfeld and Christoph Bücherl.

Mención a parte merecen Rosa y Alberto. Vaya dos IPs que se está perdiendo España... Sin duda uno de los mejores aspectos de esta Tesis ha sido poder compartir camino y ciencia con vosotros. Simplemente muchas gracias. Nos vemos en Shanghai!

A Fernando por sus ánimos durante la aplicación para EMBO, su apoyo en momentos de flaqueza y por compartir conmigo útiles y sinceros consejos sobre la vida y la ciencia.

A mis compañeros del 227, especialmente a Manu, Jim y Nils: habéis hecho del lugar de trabajo un sitio mucho más agradable. También a Livia e Israel que desinteresadamente han tenido siempre su puerta abierta para resolver mis incordiosas dudas.

A Isa, Virginia y Alfonso, compañeros de Master y de precariedad, gracias por vuestra complicidad. Sin esos tés, cafés y cervezas la Tesis se habría hecho realmente cuesta arriba.

A mis compañeros del 232-234 y muy especialmente a Mada, Bego, Bea, Brisa y Gemma. En pocas palabras: calma, humor, amabilidad, locura y conexión cómplice, id preparando la pamela! Por supuesto un guiño a la gente de la primera planta, Mar, Miguel Angel, Laura, Inma, Jan e Iván con quien he compartido menús y tuppers a discreción. Definitivamente las penas con palmeras de chocolate son menos (y las alegrías más!).

A Pilar, Ramiro y Suso, gracias por vuestra amistad y por ser una fuente de motivación y energía positiva desde los inicios de la carrera. Mención especial para Miguel, que ha compartido conmigo prácticamente cada paso del camino desde hace 11 años, ya son historias… facturas, sangre, sudor y lágrimas, pero también muchas risas, viajes y alegrías. Mike, mil gracias por estar ahí siempre aportándome cosas positivas. Gracias también a “mi artista preferido”, Andrés Pachón, por sus consejos express sobre edición de imagen y por ayudarme a fotografiar la Arabidopsis que aparece en la portada de esta Tesis. Espero que sigamos celebrando grandes éxitos y fracasos.

A mis padres, quienes me han apoyado siempre. Sois las mejores personas que uno puede tener cerca, tanto si el viento sopla a favor como si vienen mal dadas. Y por supuesto a mein Bruder, compartir contigo escaladas, riscos recónditos, noches de pizza y cine, tontunas y elucubraciones cósmicas tiene un valor incalculable para mí y ha sido crucial para desconectar del lab.

Y por supuesto a Julia, por alumbrarme en la oscuridad y hacerme mantener el equilibrio en la cuerda floja tantas veces. Eres una fuente de alegría y la vida compartida contigo es mucho mejor.

vii

viii

INDEX

ACKNOWLEDGEMENTS ...... v INDEX ...... viii ABSTRACT...... xiii RESUMEN ...... xiv ABREVIATIONS…………………………………………………………………………………………………..xvii

1. GENERAL INTRODUCTION ...... 1 1.1 GENERATION AND FUNCTIONS OF REACTIVE OXYGEN SPECIES IN PLANTS ...... 4 1.1.1 Generation of the main Reactive Oxygen Species ...... 4 1.1.2 Metabolic and enzymatic sources of ROS in plants...... 5 1.1.3 ROS: key signaling molecules to integrate and adapt to the environment...... 6

1.2 THE PLANT DEFENSE RESPONSE AGAINST PATHOGENS: CONSTITUTIVE AND INDUCIBLE MECHANISMS ...... 7 1.2.1 Pattern recognition receptors triggered immunity ...... 9 1.2.2 Effector triggered immunity ...... 11 1.2.3 Cell death ...... 13 1.2.4 ROS production ...... 14

1.3 RBOH-NADPH OXIDASES: ENZIMATIC SYSTEMS FOR INDUCIBLE ROS PRODUCTION IN PLANT DEVELOPMENT, ABIOTIC STRESS RESPOSE AND IMMUNITY ...... 17 1.3.1 Plant NADPH oxidases: evolution and structure ...... 17 1.3.2 Regulation of RBOH-NADPH oxidases ...... 19 1.3.3 Functions of the RBOH-NADPH oxidases in plant development ...... 20 1.3.4 Functions of the RBOH-NADPH oxidases in abiotic stress responses ...... 22 1.3.5 Functions of the RBOH-NADPH oxidases in biotic interactions ...... 23 1.3.6 Arabidopsis thaliana RBOHD and RBOHF regulation and crosstalk with other signaling pathways during the plant immune response ...... 24

1.4 HETEROTRIMERIC G PROTEINS ...... 26 1.4.1 Plant heterotrimeric G proteins: key cell signaling transduction nodes ...... 26 1.4.2 Heterotrimeric G proteins functions in plant immunity ...... 28

1.5 MODEL PATHOSYSTEMS EMPLOYED ...... 29 1.5.1 A. thaliana-Pseudomonas syringae pathovar tomato DC3000 ...... 29 1.5.2 A. thaliana-Plecthosphaerella cucumerina ...... 30

2. OBJECTIVES ...... 32 3. MATERIALS AND METHODS ...... 34 3.1 Plant materials and growth conditions ...... 35 3.2 Pathogens employed, storage and growth conditions ...... 35 3.3 Molecular cloning ...... 35 3.4 Generation of Arabidopsis transgenic plants ...... 38 3.5 Genomic DNA extraction ...... 38

3.6 Polymerase chain reaction (PCR) ...... 39 3.7 Histology ...... 40 3.8 Bacterial and fungal inoculation assays ...... 40 3.9 Luciferase activity measurements ...... 41 3.10 PcBMM and Pc2127 fungal genomic biomass quantification ...... 41 3.11 Chemical treatments ...... 41 3.12 RNA extraction...... 42 3.13 Gene expression analysis by quantitative real time PCR (qRT-PCR) ...... 42 3.14 Informatic resources and Bioinformatic tools employed ...... 43 3.15 Transient expression and co-expression in Nicotiana benthamiana...... 44 3.16 Protein extraction, immunoprecipitation and co-immunoprecipitation ...... 45 3.17 SDS-PAGE and immunoblotting ...... 45 3.18 ROS burst assay ...... 46 3.19 Electrolyte leakage measurements ...... 46 3.20 Stomatal aperture measurements ...... 46 3.21 Statistical analyses ...... 46 3.22 Confocal microscopy assays ...... 47 4. RESULTS AND DISCUSSION ...... 48 4.1 CONTRIBUTION OF RbohD and RbohF SPATIAL-TEMPORAL EXPRESSION PATTERN TO THE REGULATION OF SPECIFIC ROS-SIGNALING IN ARABIDOPSIS IMMUNITY ...... 49 4.1.1 RbohD and RbohF promoters drive reporter gene expression to different tissues during Arabidopsis development ...... 51 4.1.2 RbohD and RbohF promoters display a differential activation in response to Pto DC3000 ...... 54 4.1.3 RbohD and RbohF promoters determine a differential expression pattern during Arabidopsis immune response to the necrotrophic fungus P. cucumerina ...... 57 4.1.4 Loss of RbohD and RbohF function alters non-host resistance to the non-adapted Pc2127 fungal isolate ...... 59 4.1.5 PAMPs and ABA differentially modulate Rboh promoter activity ...... 60 4.1.6 RbohD and RbohF promoters differentially modulate the spatial pattern of ROS production during Arabidopsis response to P. cucumerina ...... 62 4.1.7 Prediction of common and distinct potential cis-regulatory DNA elements in RbohD and RbohF promoters ...... 66 4.1.8 DISCUSSION ...... 69

4.2 ASCERTAINING THE ROLE OF HETEROTRIMERIC G PROTEINS IN THE REGULATION OF RBOH-MEDIATED IMMUNE SIGNALLING ...... 75 4.2.1 The β-subunit of heterotrimeric G-proteins (AGB1) is a component of Arabidopsis immune response to Pto DC3000 that plays a role in basal resistance and ETI ...... 78 4.2.2 The agb1 mutant is impaired in ROS production during PTI and ETI ...... 79 4.2.3 Agb1 loss of function attenuates some phenotypes of the rbohD rbohF mutant ...... 80

4.2.4 The RBOH-NADPH oxidases act independently of AGB1 during Arabidopsis immune response to the necrotrophic fungus Plectosphaerella cucumerina isolate BMM...... 82 4.2.5 The agb1 mutant is impaired in stomatal closure and RbohD transcript accumulation in response to flg22 ...... 83 4.2.6 RbohD transcript accumulation in response to flg22 is impaired in agb1 ...... 84 4.2.7 Analysis of AGB1 potential association with RBOHD, RBOHF and with the RBOHD regulatory kinase BIK1 during PTI ...... 85 4.2.8 DISCUSSION ...... 88

5. GENERAL DISCUSSION ...... 95 6. CONCLUSIONS ...... 103 7. REFERENCES ...... 106

xii

ABSTRACT

The plant NADPH oxidases, termed respiratory burst oxidase homologues (RBOHs), produce reactive oxygen species (ROS) which mediate a wide range of functions. Fine tuning this ROS production provides the signaling specificity to the plant cell to produce the appropriate response to environmental threats. RbohD and RbohF, two of the ten Rboh genes present in Arabidopsis, are pleiotropic and mediate diverse physiological processes in response to pathogens. One aspect that may prove critical to determine the multiplicity of functions of RbohD and RbohF is the spatio-temporal control of their gene expression. Thus, we generated Arabidopsis transgenic lines with RbohD- and RbohF-promoter fusions to the β-glucuronidase and the luciferase reporter genes. These transgenics were employed to reveal RbohD and RbohF promoter activity during Arabidopsis immune response to the pathogenic bacterium Pseudomonas syringae pv tomato DC3000, the necrotrophic fungus Plectosphaerella cucumerina and in response to immunity- related cues. Our experiments revealed a differential expression pattern of RbohD and RbohF throughout plant development and during Arabidopsis immune response. Moreover, we observed a correlation between the level of RbohD and RbohF promoter activity, the accumulation of ROS and the amount of cell death in response to pathogens. RbohD and RbohF gene expression was also differentially modulated by pathogen associated molecular patterns and abscisic acid. Interestingly, a promoter-swap strategy revealed the requirement for the promoter region of RbohD to drive the production of ROS in response to P. cucumerina. Additionally, since the RbohD promoter was activated during Arabidopsis interaction with a non-adapted P. cucumerina isolate 2127, we performed susceptibility tests to this fungal isolate that uncovered a new role of these oxidases on non-host resistance. The interplay between RBOH-dependent signaling with other components of the plant immune response might also explain the different immunity-related functions mediated by these oxidases. Among the plethora of signals coordinated with RBOH activity, pharmacological and genetic evidence indicates that heterotrimeric G proteins are involved in some of the signaling pathways mediated by RBOH–derived ROS in response to environmental cues. Therefore, we analysed the interplay between these RBOH-NADPH oxidases and AGB1, the Arabidopsis β-subunit of heterotrimeric G proteins during Arabidopsis immune response. We carried out epistasis studies that allowed us to test the implication of AGB1 in different RBOH-mediated defense signaling pathways. Our results illustrate the complex relationship between RBOH and heterotrimeric G proteins signaling, that varies depending on the type of plant-pathogen interaction. Furthermore, we tested the potential association between AGB1 with RBOHD and RBOHF during early immunity. Interestingly, our co-immunoprecipitation experiments point towards an association of AGB1 and the RBOHD regulatory kinase BIK1, thus providing a putative mechanism in the control of the NADPH oxidase function by AGB1. Taken all together, these studies provide further insights into the role that transcriptional control or the interaction with heterotrimeric G-proteins have on RBOH-NADPH oxidase-dependent ROS production and signaling in immunity. Our work exemplifies how, through a differential regulation, two members of a multigenic family achieve specialized physiological functions using a common enzymatic mechanism.

xiii

RESUMEN

Las NADPH oxidasas de plantas, denominadas “respiratory burst oxidase homologues” (RBOHs), producen especies reactivas del oxígeno (ROS) que median un amplio rango de funciones. En la célula vegetal, el ajuste preciso de la producción de ROS aporta la especificidad de señal para generar una respuesta apropiada ante las amenazas ambientales. RbohD y RbohF, dos de los diez genes Rboh de Arabidopsis, son pleiotrópicos y median diversos procesos fisiológicos en respuesta a patógenos. El control espacio-temporal de la expresión de los genes RbohD y RbohF podría ser un aspecto crítico para determinar la multiplicidad de funciones de estas oxidasas. Por ello, generamos líneas transgénicas de Arabidopsis con fusiones de los promoters de RbohD y RbohF a los genes delatores de la B-glucuronidasa y la luciferasa. Estas líneas fueron empleadas para revelar el patrón de expresión diferencial de RbohD y RbohF durante la respuesta inmune de Arabidopsis a la bacteria patógena Pseudomonas syringae pv. tomato DC3000, el hongo necrótrofo Plectosphaerella cucumerina y en respuesta a señales relacionadas con la respuesta inmune. Nuestros experimentos revelan un patrón de expresión diferencial de los promotores de RbohD y RbohF durante el desarrollo de la planta y en la respuesta inmune de Arabidopsis. Además hemos puesto de manifiesto que existe una correlación entre el nivel de actividad de los promotores de RbohD y RbohF con la acumulación de ROS y el nivel de muerte celular en respuesta a patógenos. La expression de RbohD y RbohF también es modulada de manera diferencial en respuesta a patrones moleculares asociados a patógenos (PAMPs) y por ácido abscísico (ABA). Cabe destacar que, mediante una estrategia de intercambio de promotores, hemos revelado que la región promotora de RbohD, es necesaria para dirigir la producción de ROS en respuesta a P. cucumerina. Adicionalmente, la activación del promotor de RbohD en respuesta al aislado de P. cucumerina no adaptado a Arabidopsis 2127, nos llevó a realizar ensayos de susceptibilidad con el doble mutante rbohD rbohF que han revelado un papel desconocido de estas oxidasas en resistencia no-huesped. La interacción entre la señalización dependiente de las RBOHs y otros componentes de la respuesta inmune de plantas podría explicar también las distintas funciones que median estas oxidasas en relación con la respuesta inmune. Entre la gran cantidad de señales coordinadas con la actividad de las RBOHs, existen evidencias genéticas y farmacológicas que indican que las proteínas G heterotriméricas están implicadas en algunas de las rutas de señalización mediadas por ROS derivadas de los RBOHs en respuesta a señales ambientales. Por ello hemos estudiado la relación entre estas RBOH-NADPH oxidasas y AGB1, la subunidad β de las proteínas G heterotriméricas en la respuesta inmune de Arabidopsis. Análisis de epistasis indican que las proteínas G heterotriméricas están implicadas en distintas rutas de señalización en defensa mediadas por las RBOHs. Nuestros resultados ilustran la relación compleja entre la señalización mediada por las RBOHs y las proteínas G heterotriméricas, que varía en función de la interacción planta-patógeno analizada. Además, hemos explorado la posible asociación entre AGB1 con RBOHD y RBOHF en eventos tempranos de la respuesta immune. Cabe señalar que experimentos de coímmunoprecipitación apuntan a una posible asociación entre AGB1 y la kinasa citoplasmática reguladora de RBOHD, BIK1. Esto

xiv

indica un posible mecanismo de control de la función de esta NADPH oxidase por AGB1. En conjunto, estos datos aportan nuevas perspectivas sobre cómo, a través del control transcripcional o mediante la interacción con las proteínas G heterotriméricas, las NADPH oxidases de plantas median la producción de ROS y la señalización por ROS en la respuesta inmune. Nuestro trabajo ejemplifica cómo la regulación diferencial de dos miembros de una familia multigénica, les permite realizar distintas funciones fisiológicas especializadas usando un mismo mecanismo enzimático.

xvi

ABBREVIATIONS

ABA: Abscisic Acid

AGB1: Arabidopsis β subunit of heterotrimeric G proteins

AGG1: Arabidopsis γ subunit of heterotrimeric G proteins 1

AGG2: Arabidopsis γ subunit of heterotrimeric G proteins 1

AGG3: Arabidopsis γ subunit of heterotrimeric G proteins 1

ANOVA: Analysis Of Variance

APX: Ascorbate peroxidase

ATRBOH: Arabidopsis thaliana Respiratory Burst Oxidase Homologue

Avr: Avirulence

BAK1: Brassinosteroid Insensitive-Associated Kinase 1

BIK1: Botrytis induced kinase 1

Ca2+ : Calcium cation

CC-NB-LRR: Coiled Coil Nucleotide Binding Leucine Reach Repeat Receptor

CDC5: Cell Division Cycle 5-like protein

CERK1: Chitin Elicitor Receptor-like Kinase

CFU: Colony Forming Units

Cl-: Chloride ion

CIPK: Calcineurin B-like sensor Interacting Protein Kinases

CPK: Calcium Dependent Protein Kinase

CREs: Cis-regulatory DNA elements cyp79B2cyp79B3: tryptophan N-hydroxylase 2 and 3 mutant

DAB: Diaminobenzidine

DAMP: Danger Associated Molecular Pattern

DHAR: Dihidroascorbate reductase

DNA: Deoxyribonucleic Acid

DPI: Diphenyleneiodonium

EFR: Elongation Factor-Tu Receptor elf18: Elongation factor-Tu epitope 18

ER: Endoplasmic Reticulum

xvii

ET: Ethylene

ETI: Effector Triggered Immunity

Flg22: Flagelline epitope 22

FLS2: Flagelline Sensitive-2

G protein: Guanine nucleotide binding protein

GDP: Guanine Dinucleotide Phosphate

GEF: Guanine nucleotide Exchange Factor gp91phox : Mamalian phagocyte NADPH oxidase

GPA1: Arabidopsis α subunit of heterotrimeric G proteins

GPCR: G Protein Coupled Receptor

GSH: Glutathione (reduced form)

GSSG: Glutathione (oxidized form)

GT-1: Trihelix transcription factor GT-1

GTP: Guanine Trinucleotide Phosphate

GUS: β-glucuronidase

Gβγ: β and γ subunit heterodimer of heterotrimeric G proteins

H+: Proton

H2O2: Hydrogen peroxide

HA: Hemaglutinin

Hpi: Hours post inoculation

HR: Hypersensitive Response hrcC: hypersensitive response conserved

JA: Jasmonic Acid

K+: Potassium cation

LSD1: Lesion Stimulating Disease Resistance-1

LUC: Luciferase

Lys-M: Lysine Motif

MAPK: Mitogen Activated Protein Kinase

MeJA: Methyl Jasmonate

NADPH: Nicotine Adenine Dinucleotide Phosphate (reduced form)

NO: Nitric Oxide xviii

NOX: NADPH oxidase

NPR1: Nonexpresser of PR genes 1

O2 : Molecular oxygen

1 O2: Singlet oxygen

.- O2 : Superoxide anion

OH. : Hydroxil radical

OXI1: Oxidative Signal-Inducible 1 protein kinase

PAMPs: Pathogen Associated Molecular Patterns

Pc: Plectosphaerella cucumerina

Pc2127: Plectosphaerrella cucumerina isolate 2127

PcBMM: Plectosphaerella cucumerina isolate Briggitte Mauch Mani

PCD: Programed Cell Death

PCR: Polymerase Chain Reaction pD: Promoter RbohD

Pen2: Penetration 2 gene pF: Promoter RbohF

PR: Pathogenesis Related genes pRboh: Promoter Rboh

PRR: Pathogen Recognition Receptor

PTI: Pathogen Recogniton Receptor Triggered Immunity

Pto: Pseudomonas syringae pathovar tomato qPCR: real-time Polymerase Chain Reaction qRT-PCR: real-time Reverse Transcription Polymerase Chain Reaction

Rac: Rac GTPase-activating protein 1

RBOH: Respiratory Burst Oxidase Homologue

RBOHD: Respiratory Burst Oxidase Homologue D

RBOHF: Respiratory Burst Oxidase Homologue F

ROS: Reactive Oxygen Species

RGS1: Regulator of G protein Signaling-1

RK: Receptor Kinase

RLCK: Receptor Like Cytoplasmic Kinase xix

RLK: Receptor Like Kinase

RLP: Receptor Like Protein

RLUs: Relative Light Units

RNA: Ribonucleic Acid

Rop: Rho-type GTPase

ROS: Reactive Oxygen Species

RPM1: Resistance to Pseudomonas syringae pv. maculicola 1

RPS2: Resistance to Pseudomonas syringae pv. maculicola 2

SA: Salicylic Acid

SAA: Systemic Acquired Acclimation

SAR: Systemic Acquired Resistance

SERK: Somatic Embryogenesis Receptor Kinases

SNO: S-nitrosothiol

SOD: Supreoxide dismutase

TB: Tripan Blue

TF: Transcription Factor

TIR-NB-LRR: Toll-like intracellular receptor nucleotide binding leucine reach repeat receptor

UTR: Untranslated Region

WRKY: WRKY protein domain transcription factor

YFP: Yellow Fluorescent Protein.

GENERAL INTRODUCTION

1. GENERAL INTRODUCTION

GENERAL INTRODUCTION

1. GENERAL INTRODUCTION

Reactive Oxygen Species (ROS) is a term defining oxygen-centered molecules with one or more .- . unpaired electrons in one orbital, i.e. superoxide ion (O2 ) or hydroxyl radical (OH ), and non- 3 radical derivatives of molecular oxygen ( O2, hereafter O2), with oxidizing properties such as 1 singlet oxygen ( O2) and hydrogen peroxide (H2O2) that are easily converted into radicals (Halliwell, 2001, 2006).

Turning highly reactive and toxic ROS into efficient cell signaling transducers was a major evolutionary success. The tight regulation of ROS production and turnover involves many different cellular mechanisms comprising the ROS signaling network. In plants, this network integrates: the cellular compartmentalization of ROS generation in different organelles, the coordinated activity of enzymes and compounds that detoxify or scavenge ROS, the activity of ROS producing enzymes and multiple redox-sensitive proteins involved in different signaling pathways (Mittler, 2002; Mittler et al., 2004). The ROS signaling network allows the generation of intracellular or apoplastic ROS in different tissues and cell types in specific amounts. This fine- tuned level of ROS mediate several processes, from development to biotic and abiotic stress responses that are key for plant survival and adaptation to a changing environment (Mittler et al., 2011).

One of the challenges that plants have to face is their interaction with potentially invading pathogens. Despite available preventive agronomic practices, an estimated 15% of global crop production is lost to preharvest plant disease (Dangl et al., 2013). Understanding the molecular signaling events that are activated after pathogen recognition can provide new approaches for crop protection (Dodds and Rathjen, 2010). In this regard, the rapid ROS production is a conserved signaling event during immunity across kingdoms, and nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases) have emerged as the signaling engines that mediate inducible ROS production in different contexts including the plant response to pathogens (Suzuki et al., 2011). NADPH oxidases have evolved to perform a broad range of tasks across eukaryotic kingdoms and ROS produced by these enzymes, act as signaling molecules involved in: cell communication, differentiation, protein modifications, and host defense (Bedard et al., 2007). Interestingly, the plant and animal oxidases show functional commonalities that can be exploited in an effort to better understand the role and regulation of these key players of the immune system (Canton and Grinstein 2014). This issue has attracted the attention of scientist from different fields of knowledge including immunology, cell signaling and phytophathology.

NADPH oxidases are the most extensively studied enzymes responsible for regulated ROS production in plants. Despite the involvement of NADPH oxidases in plant immune response is known for several years, we are just starting to understand how NADPH oxidase- dependent ROS production is regulated.

GENERAL INTRODUCTION

1.1 GENERATION AND FUNCTIONS OF REACTIVE OXYGEN SPECIES IN PLANTS

1.1.1 Generation of the main Reactive Oxygen Species

The generation of ROS is a process associated with oxygen-dependent life that takes place by energy transfer or univalent reduction of ground state oxygen (Figure 1; Halliwell and Guteridge,

1984; Apel and Hirt, 2004). O2 is a potent oxidizing agent having two unpaired electrons with the same (parallel) spin quantum number. However, to oxidize a non-radical, it would need to capture 2 electrons with the same spin, criteria that non radical molecules do not meet, since they have opposite spins. Therefore, O2 rarely reacts with non-radicals to accept electrons but it rapidly reacts with other radicals by single electron transfers (Cadenas, 1989; Gilbert, 1981; Halliwell and Gutteridge, 1984; Halliwell, 2006).

Figure 1. Generation of different ROS by energy transfer or sequential univalent reduction of ground .- state oxygen. O2 and H2O2 are the most extensively studied ROS in plant cell signaling (adapted from Apel and Hirt, 2004).

3 .- Molecular oxygen ( O2) can be reduced by electron transfer reaction generating O2 that .- has a short half-life. O2 can spontaneously dismutate to H2O2, especially at low pH, given that dismutation requires protons to occur, or by the action of superoxide dismutases (SOD). In the 2+ presence of ferrous iron (Fe ), partial reduction of H2O2 can occur by the Fenton reaction leading to the generation of highly reactive OH.. To avoid the formation of this noxious radical for cell 2+ survival, living organisms limit the availability of free Fe and H2O2 (Halliwell and Guteridge, 1984; Halliwel, 2006). To recover their electronic equilibrium ROS oxidize lipids, nucleic acids and proteins, resulting in structural and functional modifications of these biomolecules (Toledano et .- . al., 2003). The reactivity and short life span of O2 and OH make them more prone to react with cellular components at their site of generation. Controlling ROS turnover is therefore essential for cell survival, and aerobic organisms have evolved the ability to compartmentalize intracellular

ROS production and several ROS scavenging systems to cope with the excess of these O2 derivatives, these include: electron acceptors such as thioredoxines, peroxiredoxines, catalases, SODs, the ascorbate-gluthation cycle and other non-enzymatic compounds (Mittler et al., 2004).

Among ROS, H2O2 meets the criteria to serve as a secondary messenger in cell signaling: is the most stable ROS with a lifespan of 1 ms and its small size and neutral charge, allows it to traverse cellular membranes either passively (Hancock, 2005), or more efficiently

GENERAL INTRODUCTION through membrane channels (Bienert et al., 2006). However, to avoid cellular damage and to maintain cellular homeostasis and balanced cell signaling, H2O2 generation and scavenging must be tightly regulated being readily removed once its signaling is perceived (Neill et al., 2002; Petrov and Van Breusegen, 2012).

1.1.2 Metabolic and enzymatic sources of ROS in plants

.- Intracellular O2 generation can occur in aerobic organisms during normal metabolism by leakage of electrons directly on to O2 from the intermediate electron carriers of the mitochondrial, chloroplastic or peroxisomal electron transport chains and at the endoplasmic reticulum (ER, Bhatajarchee, 2005; Hallilwel, 2001; Neill et al., 2002). Eukaryotes have evolved systems to limit the accumulation of these toxic compounds in all these compartments (Mittler et al., 2011).

Figure 2. H2O2 turnover in the plant cell. H2O2 is generated in intracellular compartments (chloroplasts, mitochondria, peroxisomes and ER) and at the apoplast mainly by NADPH oxidases and cell wall peroxidases. H2O2 intracellular rates are controlled via catalase and the ubiquitous ascorbate-glutathione cycle, involving ascorbate peroxidase (APX), dehydroascorbate reductase (DHAR) and glutathione reductase (GR). H2O2 also reacts with glutathione converting it from its reduced state (GSH) to its oxidised state (GSSG; Neill et al., 2002).

GENERAL INTRODUCTION

The highest amounts of ROS inside the plant cell are produced in the chloroplasts (Neill 1 et al., 2002; Petrov and Van Breusegem, 2012). O2 can be generated as a result of chlorophyll triplet state formation due to insufficient energy dissipation during photosynthesis (Halliwell, .- 2006). Additionally, O2 and H2O2, can be produce by the Mehler reaction in which electrons flow from the photosystem I to O2 (Neill et al., 2002). To avoid the potential cellular damage caused by these oxidizing agents, several ROS scavenging systems exists to turn them into water molecules: the glutathione-ascorbate cycle, peroxiredoxins and thioredoxins. Mitochondrial ROS are generated at the electron transport chain mainly during electron transfer from the four 2+ reduced Fe -heme groups of the cytochrome oxidase multiprotein complex to O2 (Halliwell, 2006; Neill et al., 2002). Excessive ROS accumulation in this organelle can be alleviated by an additional mechanism for electron transport carried out by the alternative oxidase. In peroxisomes and glyoxisomes, H2O2 is generated during photorespiration and fatty-acid oxidation by xanthine oxidase in the organelle matrix and by the glycolate oxidase reaction at the peroxisomal membrane. The ascorbate-glutathione cycle combined with the activity of peroxiredoxines and catalases prevent high levels of H2O2 in these organelles (del Río et al., 2006; Noctor et al., 2002). Finally, ROS are produced in the ER for proper oxidative protein folding (Ozgur et al.,

2014). In addition to the scavenging systems of each cellular compartment, H2O2 and other metabolic ROS that leak out in the cytoplasm, are easily handled by the activity of ROS- scavenging systems similar to those in the chloroplast and non-enzymatic compounds like tocopherols, ascorbic acid and flavonoids (Asada, 2006; Miller et al., 2010; Noctor and Foyer, 1998).

In addition, enzymatic mechanisms exist to generate specific amounts of H2O2 as a second messenger for intra and cell-to-cell communication and defense at the free diffusional apoplastic space (Mittler et al., 2011). Although enzymes such as amine oxidases and oxalate oxidases have also been documented, the main recognized sources for apoplastic ROS are NADPH oxidases and class III cell wall peroxidases. Both types of enzymes are encoded by multigene families in plants and mediate the rapid generation of apoplastic H2O2 in response to .- different stimuli. While NADPH oxidases are flavoproteins that rapidly generate O2 upregulating

H2O2 levels, class III cell wall peroxidases are heme proteins that can act either as H2O2 scavengers via the peroxidase cycle, or generate H2O2 through the oxidase cycle, depending on the physiological pH conditions. According to the specific features of these two enzyme families, ROS production by cell wall peroxidases and plant NADPH oxidases are not functionally equivalent (O´brien et al., 2012; Wrzacek et al., 2014).

1.1.3 ROS: key signaling molecules to integrate and adapt to the environment

The generation of ROS was initially understood as an inevitable process derived from oxygen dependent life associated with the imbalance of cellular homeostasis as a consequence of metabolic processes and different stresses. Initial research effort focused on the activity of these molecules as deleterious agents, functioning against either invading pathogens, or the cellular components themselves. A deeper understanding of the second messenger features of H2O2 and

GENERAL INTRODUCTION the establishment of solid links between ROS production and physiological effects in many biological systems changed this perception. ROS are now considered molecules with a prominent role in cell signaling in response to developmental or environmental cues (Apel and Hirt, 2004; Halliwell, 2006; Hancock, 2005, Mittler et al., 2011).

The effect of ROS on the cell and on the whole plant is dependent on their concentration, the site of generation and accumulation, the plant development stage and its pre-exposure to a certain stress condition (Gechev and Hille, 2005). While transitory ROS increase generally initiates an adaptative cellular response to the changing environment, persistent elevated concentration of intracellular ROS triggers the damage of cellular components and mediates cell death (Bhattacharjee, 2005, 2012). This programmed cell death is a crucial process for some development programs and biotic interactions (Bethke and Jones, 2001; Coll et al., 2011; Gechev et al., 2005; Torres et al., 2010).

Different cues produce an increase in ROS levels mainly in the apoplast but also intracellularly, changing the cellular redox state. Thus, ROS increase impacts directly or indirectly many cellular processes: calcium (Ca2+) homeostasis, ion fluxes, protein kinases and phosphatases activity, gene expression mediated by microRNAS (miRNAs) and Transcription Factors (TFs; Petrov and Van Breusegen, 2012) and lipid signaling (Wang, 2005). Additionally, ROS drive the cross-linking of cell wall proteins (Ros-Barceló and Gómez-Ros, 2009) and mediate systemic signaling in the whole plant (Gilroy et al., 2014). These molecular events are behind a plethora of physiological processes essential for plant development, abiotic stress response and biotic interactions.

1.2 THE PLANT DEFENSE RESPONSE AGAINST PATHOGENS: CONSTITUTIVE AND INDUCIBLE MECHANISMS

Plants are constantly exposed to a wide range of potential pathogens including viruses, bacteria, fungi, oomycetes, pest insects and parasitic weeds. These pathogens are generally classified according to lifestyle, as summarized in Box 1. However, disease is an exceptional outcome due to highly robust plant resistance mechanisms (Nurnberger and Scheel, 2001). These include layers of mechanical and chemical constitutive defenses (Glazebrook, 2005; Panstruga and Dodds, 2009) as well as a highly refined cell autonomous inducible immune system (Jones and Dangl, 2006; Dangl et al., 2013). Some of the most often employed concepts in the description of plant-pathogen interactions are defined in Box 2.

The outermost mechanical barrier is the cuticle, a hidrofobic layer comprised by a matrix of long chain fatty acids called cutine and soluble amides, overlying the whole plant surface avoiding water loss and the penetration of potentially noxious substances and microorganisms (Taiz and Zeiger, 2010). Additionally, the plant cells are surrounded by a relatively thick cell wall formed by a complex matrix of polysacharides, proteins and different polymers secreted by the plant and arranged in an organized network (Reina-Pinto and Yephremov, 2009; Underwood, 2012). These are not only physical and passive but also dynamic defense barriers. In fact, the

GENERAL INTRODUCTION

plant cell wall is a reservoir of antimicrobial compounds that are released in response to pathogen threats (Miedes et al., 2014). These include peptides such as tionines, defensins and lipid transfer proteins that can destabilize pathogen membranes (García-Olmedo et al., 2001) and tryptophan derived secondary metabolites such as camalexin and indole glucosinolates with antimicrobial activity (Bednarek et al., 2009; Sánchez-Vallet et al., 2010).

Box 1. General classification of pathogens according to lifestyle (Agrios, 2008)

Biotrophs: An organism that can live and multiply only on another living organism. These pathogens propagate in living plant tissue and generally do not cause necrosis as a result of infection.

Necrotrophs: pathogens that kill host cells in initial stages of the infection and live off the dead tissue as a means for nutrient acquisition.

Hemibiotrophs: Organisms that expend part of their lifespan as parasites on another organism and another part as saprophytes. These pathogens incorporate aspects of both biotrophic and necrotrophic infection strategies. Their cycle involves an initial biotrophic infection phase during which the pathogen spreads in host tissue, followed by a necrotrophic phase during which host cell death is induced . Often invaded host tissues remain alive until later stages of infection, several days or even months after inoculation.

In addition to constitutive defense mechanisms, plants can directly recognize potentially invading pathogens. In the absence of the specialized immune cells or organs present in animals, plants have evolved a two-layered cell-autonomous immune system whose frontline is comprised of plasma membrane and intracellular receptors that perceive the pathogen and trigger both, local and systemic responses, that prevent pathogen spread and colonization (Dodds and Rathjen 2010; Dangl et al., 2013; Jones and Dangl, 2006; Zipfel, 2014).

Box 2. General concepts employed in the description of plant-pathogen interactions

(Agrios, 2008)

Disease: Any malfunctioning of host cells and tissues that result from continuous irritation by a pathogenic agent or environmental factor and leads to the development of symptoms.

Disease resistance: The ability of an organism to exclude or overcome, completely or in some degree, the effect of a pathogen or other damaging factor.

Susceptibility: inability of a plant to resist the effect of a pathogen or other damaging factor.

Pathogenicity: potential capacity of certain species of microbes or viruses to cause a disease.

Virulence: degree of pathogenicity within a group or species of parasites as indicated by case fatality rates and/or the ability of the pathogen to invade the tissues of the host.

Avirulence: The inability of a pathogen to infect a certain plant variety that carries genetic resistance.

GENERAL INTRODUCTION

1.2.1 Pattern recognition receptors triggered immunity

The first active layer of the plant innate immune system is the recognition of Microbe/Pathogen- Associated Molecular Patterns (MAMPs or PAMPs) which are conserved molecules among different types of microbes. Recognition occurs through the direct interaction between MAMPs and plasma membrane Pattern Recognition Receptors (PRRs). This initial recognition activates a battery of downstream signaling pathways that leads to PRR-Triggered Immunity (PTI) that fend off most potential pathogens (Dodds and Rathjen, 2010; Zipfel, 2014).

Due to the conservation of MAMPs among pathogen classes, PRRs can detect most potentially invading pathogens. Thus, a given pathogen typically colonizes a limited number of plant species. Those species falling outside of this host range mount non-host disease resistance to fend off the attempted colonization by the, in this case, non-adapted pathogen. The underlying mechanism of non-host immunity and host basal immunity involves the same MAMPs/PAMPs detection systems (Dodds and Rathjen, 2010; Schulze-Lefert and Panstruga, 2011; Zipfel, 2014).

The best characterized MAMPs are: flg22, active epitope of flagellin which is the proteic subunit forming the flagellum of gram negative bacteria; elf18, the elicitor peptide from bacterial elongation factor EF-Tu (Gomez-Gomez and Boller, 2002; Zipfel et al., 2006); and chitin, a β- glucan oligomere of the fungal cell wall (Miya et al., 2007; Wan et al., 2008). Additionally, Peptidoglycans (PGNs), major constituents of bacterial cell walls, can also be perceived by plant PRRs. In these four cases, the PRRs that recognize these MAMPs have been identified in the model plant Arabidopsis thaliana. Recent data indicate that virus and insects can also be sensed by PRRs and that many MAMP-PRR pairs are still to be identified (Zipfel, 2014).

In addition, disruption of the plant cell wall integrity by pest insects, mildews, fungal and some bacterial pathogens results in the release of plant self-origin signaling molecules termed Danger Associated Molecular Patterns (DAMPs; Cantu et al., 2008; Vorwerk et al., 2004). DAMPs can also be recognized by PRRs to activate downstream signaling defense responses and mediate defense gene activation and cell wall reinforcement (Galleti et al., 2008; Malinovsky et al., 2014; Miedes et al., 2014).

In contrast to mammals, that use both intracellular and surface-localized PRRs to perceive MAMPs and DAMPs, all currently known plant PRRs are surface localized. Plant PRRs are either Receptor Kinases (RKs), which have a ligand-binding ectodomain, a single-pass transmembrane domain and an intracellular kinase domain, or Receptor-Like Proteins RLPs, which share the same overall structure but lack the intracellular kinase domain. Leucine-rich repeats (LRRs) are common ectodomains that bind proteins and peptides. Two well-studied LRR- containing PRR examples are Flagellin-Sensitive-2 (FLS2) that recognizes flg22 and Elongation Factor Tu Receptor (EFR) that senses elf18. Additionally, other ectodomains i.e lysine motifs (Lys-M), lectin motifs or epidermal growth factor-like domains are involved in the recognition of chitin, bacterial peptidoglycans, extracellular ATP, or plant cell-wall-derived oligogalacturonides.

GENERAL INTRODUCTION

The Arabidopsis PRR involved in chitin perception is Chitin Elicitor Receptor-like Kinase CERK1 and presents a Lys-M ectodomain (Macho and Zipfel, 2014).

PRRs form complexes with other proteins that mediate the transduction of the signal perceived. Eventhough some of these receptors contain intracellular domains with signaling potential, the PRRs characterized to date require dimerization with Somatic Embryogenesis Receptor Kinases (SERKs) to transduce the signal such as Brassinosteroid Insensitive- Associated Kinase 1 (BAK1). Hetero-dimerization seems essential to regulate the function of both, LRR-RKs and LRR-RLPs, suggesting that SERKs can act as co-receptors for other ligands (Zipfel, 2014). Phosphorylation plays a key role in the activation of PRR complexes. Receptor-like cytoplasmic kinases (RLCKs) are direct substrates of PRR linking their activation with downstream intra-cellular signaling. In this regard, Botrytis-Induced Kinase 1 (BIK1) has been shown to play a key role mediating these signal transduction events (Figure 3). Increasing data indicates that protein phosphatases return PRR-mediated cell signaling to a steady state (Macho and Zipfel, 2014).

PRR complexes initiate many signaling cascades and readjust the cellular dynamics, redirecting resources towards immunity. Early cellular PTI events include changes in Ion fluxes and the rapid and transient generation of ROS occurring a few minutes after MAMP treatment. Alteration of cytoplasmic Ca2+ concentration is perceived by Calcium-dependent Protein Kinases (CPKs) and Calcineurin B-like proteins which are involved in the regulation of defense gene expression, impinging salicylic acid (SA) production and regulating ROS generation (Nicaise et al., 2009).

Early changes lead to the subsequent activation of signaling cascades that mediate the establishment of PTI. ROS, together with lipid peroxides and nitric oxide (NO), are also generated in response to pathogen elicitors, alter redox homeostasis and induce defense gene expression (Torres et al., 2010; Vellosillo et al., 2010; Vidhyasekaran, 2013). Mitogen-activated protein kinase (MAPK) cascade activation leads to the activation of WRKY-type transcription factors, key regulators of plant defenses (Nicasie et al., 2009). The activation of hormone signaling pathways also contributes to the establishment of PTI. In response to bacterial pathogens, PTI signaling impinges ethylene (ET) and SA levels mediating an amplification cascade (Bari and Jones, 2009; Spoel and Dong, 2012). Additionally, flg22 induced production of SA is required for local and systemic acquired resistance (SAR, Durrant and Dong, 2004). Importantly, the expression of microRNA encoding genes and the derived gene silencing of specific targets, which is essential during antiviral immunity, also plays an important role in antibacterial PTI (Navarro et al., 2006).

Activation of PTI leads to the establishment of the plant defenses which include the production of antimicrobial compounds, such as Pathogenesis-Related (PR) proteins and phytoalexins (Spoel and Dong, 2012) and callose deposition (Bestwick et al., 1995; Luna et al., 2011). Additionally, an important PTI response for antibacterial immunity is stomatal closure, which is largely dependent on Abscisic Acid (ABA), SA, ion fluxes, ROS production and hetrotrimeric G proteins (Nicaise et al., 2009; Sawinski et al., 2013; Song et al., 2014).

GENERAL INTRODUCTION

Figure 3. Formation of active Pattern Recognition Receptor complexes. (a) PAMPs (pink, yellow and purple shapes) are recognized in the apoplast by PRRs. (b) Immediately after ligand binding, PRR forms an active complex with BAK1. (c) This results in transphosphorylation (indicated by P) and activation of kinase domains of the PRR and BAK1. Signaling via this active complex can be mediated directly by the RLCK BIK1, which is directly involved in the regulation of ROS production, or by MAPKs or CPKs. This is a generalized model based on flagellin perception by FLS2 (modified from Doods and Rathjen, 2010).

1.2.2 Effector triggered immunity

Despite PTI can fend off and limit microbial colonization of the host, some adapted pathogens have evolved virulence genes, encoding effector proteins, which enable them to suppress PRR- dependent responses, facilitate nutrient acquisition, contribute to pathogen dispersal and hence cause disease. In turn, some of these effectors can be recognized by intracellular plant receptors encoded by Resistance genes (R genes), activating Effector Triggered Immunity (ETI), the second tier of the plant immunity system. This is a rapid response that amplifies PTI signaling events and limits host colonization by the pathogen (Dangl et al., 2013; Jones and Dangl, 2006).

Both layers of the immune response share many signaling elements such as ion fluxes, ROS and NO production, MAPK activation and induction of the SA, Jasmonic Acid (JA) and ET signaling pathways and downstream responses. However, ETI is usually more robust and often involves an Hypersensitive Response (HR) mediating local and systemic acquired resistance. Specifically, ROS production and MAPK activation are transient in PTI and prolonged in ETI (Dodds and Rathjen, 2010; Tsuda and Katagiri, 2010). Nevertheless, several cases have been documented in which PTI also triggers the HR and SAR. Thus, it seems that both ETI and PTI can be either robust or weak, depending on the specific interaction, the trigger, the receptor and possibly the environmental conditions (Thomma et al., 2011).

In contrast to PAMPs, effectors are typically dispensable for the pathogen. Each pathogen isolate can express a set of effectors, and these can be highly diverse across the population of any pathogen species, being their genes often associated with genomic regions with high plasticity (Jones and Dangl, 2006). Effector repertoires have been described from

GENERAL INTRODUCTION

evolutionary diverse pathogens with different lifestyles ranging from bacterial pathogens, oomycetes and fungi, to aphids and nematodes (Dangl et al., 2013).

ETI receptors, the R proteins, are usually highly diverse both within and between species, contrary to the PRR, whose functions are widely conserved (Dodds and Rathjen, 2010). Most R genes encode members of an extremely polymorphic superfamily of intracellular nucleotidebinding leucine-rich repeat (NLR) receptors. Specific NLR proteins are activated by specific pathogen effectors. Recognition can be either direct or indirect, acting in this case the R-proteins as guardians of host proteins targeted by the effectors (Figure 4). The molecular architecture of NLR proteins is poorly understood, but many of them present diverse N-terminal signaling domains that might confer an advantage in host defense. Regarding their site of action, some NLRs may require for functioning nucleo-cytoplasmic shuttling, whereas others appear to be activated at the plasma membrane (Dangl et al., 2013).

Figure 4. Diagram depicting the plant cell-autonomous immune system. Pathogens of all lifestyle classes express PAMPs and MAMPs during plant colonization. The plant cell perceives them via surface-localized PRRs and initiate PRR-mediated Immunity (PTI; 1). In turn, some pathogens present a repertoire of virulence effectors that are delivered to block PAMP/MAMP perception and derived immune signaling (2), thus suppressing PTI and facilitating virulence (3). Intracellular Nucleotide-binding Leucine-rich Repeat NLR receptors can sense effectors mainly through : direct interaction, as receptor and ligand (4a); alternatively, an effector can modify a molecular decoy which mimics its host cellular target, or a a bona fide host molecular target, such as the intracellular domain of a PRR, modification that is detected by a specific NLR (4b and 4c). NLR activation coordinates Effector-Triggered Immunity (ETI), a high-amplitude restart of the previously suppressed PTI, limiting pathogen proliferation (5; Dangl et al., 2013).

GENERAL INTRODUCTION

When the effector is recognized by the R protein, the interaction is considered incompatible. By contrast, in the absence of this recognition the plant-pathogen interaction is compatible. In the first case, the effector recognized by the R-protein is an avirulent factor, in contraposition to the virulent factors which are the effectors not recognized that promote the disease. Interestingly, in host-pathogen interactions the frequencies of virulence genes and R genes influence one another in a co-evolutionary arms race. ETI effectiveness selects for pathogen variants that can avoid recognition while this effector plasticity might influence R-gene evolution. The strength of the natural selection on effectors and R genes will vary depending on their mode of action. For instance ETI receptors that directly interact and recognize pathogen effectors are more prone to evolve faster than those acting as guardians of host proteins targeted by effectors (Jones and Dangl, 2006).

1.2.3 Cell death

The onset of cell death is an integral part of many plant-pathogen interactions (Greenberg, 1997; van Doorn et al., 2011). Many plant pathogens induce cell death to gain access to nutrients and facilitate the process of infection (Olivier and Solomon, 2010). Moreover, regulated cell death often occurs as part of the repertoire of responses that the plant establishes to stop the pathogen. During ETI, recognition of the effector by the R protein is often accompanied by a HR, whose ultimate manifestation is a tightly organized programmed cell death (PCD) at the site of interaction (Mur et al., 2008). However, HR induction has also been reported in some cases of PTI (Thomma et al., 2011). Therefore, quantitative rather than qualitative differences in the common cell signaling events during both tiers of plant immunity might account for the HR execution. Morphologically, the HR presents features of both vacuolar and necrotic plant cell death (van Doorn et al., 2011). During this PCD, chloroplasts play a key as ROS and phytohormone signaling sources. Additionally, fusion of the vacuole to the plasma membrane, mediated by caspase-like cystein proteases, leads to the release of antibacterial factors and cell death promoting signals (Coll et al., 2011).

The molecular pathway leading to the HR after pathogen recognition is not fully understood. In the basal cellular state, the onset of PCD is negatively controlled by the Lesion Stimulating Disease Resistance (LSD1) protein. This interacts with positive cell death regulators possibly sequestering them, and thus maintaining low levels of ROS that in turn avoid SA accumulation. Upon pathogen recognition, perception of effectors by NB-LRR receptors and the changes in the cellular redox status trigger the expression of resistance genes and impinge ROS and SA accumulation that synergize during the HR execution. Additionally, metacaspases 1 and 2 regulate cell death downstream of NB-LRR activation but not NB-LRR mediated resistance. In parallel to the onset of cell death, as the level of SA rises locally, mobile signals such as methylsalycilate or azelaic acid are generated inducing SAR (Coll et al., 2011; Dickman and Fluhr, 2014; Spoel and Dong, 2012). SAR is achieved by the accumulation of SA in systemic tissues which mediate epigenetic changes on immunity related genes and the secretion of antimicrobial PR proteins. Consequently, the whole plant is protected from secondary infection of

GENERAL INTRODUCTION a broad spectrum of pathogens for a variable time lapse. Moreover, SAR can potentially be passed on to the progeny through epigenetic regulation (Fu and Dong, 2013).

The HR is effective against many (hemi)biotrophs that include some viral, bacterial, fungal and oomycete pathogens, as well as nematodes that feed on live plant cells (Spoel and Dong, 2012). The relevance of host cell death is evidenced by the strategies evolved by pathogens to manipulate it. Some (hemi)biotrophs use effectors to suppress the HR maintaining host cells alive to complete a successful infection cycle (Coll et al., 2011). Although necrosis is traditionally viewed as a more disordered type of cell death that results in swelling and cell lysis and where the host plant has no influence, recent studies suggest that several necrotic-type cell deaths are also programmed (Dickman and Fluhr, 2014). Hence, also necrotrophs manipulate the host cell death machinery through the activity of pathogenicity factors such as: toxins, lytic enzymes, oxalic acid and effector proteins, that trigger necrosis contributing to pathogen propagation (Grovrin and Levine, 2000; Lai and Mengiste, 2013; Lorang et al., 2007).

Despite PCD is at the center of immune responses across kingdoms, several natural plant–pathogen interactions resulting in resistance without cell death have been reported (Coll et al., 2011). Moreover, SAR has been uncoupled from the HR cell death in a plant-virus interaction (Liu et al., 2010). Therefore it is still unclear whether cell death is the cause or the consequence of resistance during incompatible interactions. The HR may occur due to the rise in toxic intermediates during plant pathogen interactions that lead to both host and pathogen cell death. Thus, possibly the process leading to cell death and not cell death itself is what contributes to disease or resistance in a given plant-pathogen interaction (Coll et al., 2011; Dickman and Fluhr, 2014).

1.2.4 ROS production

A hallmark of pathogen recognition across kingdoms is the rapid and transient production of ROS termed oxidative burst (Lamb and Dixon, 1997; Nathan and Cunningham-Bussel, 2013). In plants, this oxidative burst occurs during the successful recognition of pathogenic bacteria and fungi but also in response to nematodes, insects and symbionts (Torres et al., 2010). ROS generated from intracellular sources may modulate the response to pathogens, particularly in relation to the HR progression, and therefore may contribute to limit the spread of the pathogens and acts as source of signals for establishment systemic defenses (Alvarez et al., 1998; Coll et al., 2011; Miller et al., 2009; Mur et al., 2008). However, during the oxidative burst, the majority of ROS occurs in the apoplast, where is generated by the action of NADPH oxidases and type III cell wall peroxidases (O´Brien et al., 2012). Due to their reactivity, ROS could have a direct effect on pathogens inhibiting their growth or directly killing them (Chen and Schopfer, 1999; Peng and Kuc, 1992). However, the direct antimicrobial role of ROS has been a matter of debate since many pathogens can still grow in high (mM) concentrations of H2O2, or even obtain a benefit from the generation of ROS by the host (O´Brien et al., 2012; Torres et al., 2010). Thus, the current thought is that, instead of having a direct pathogen-killing effect, ROS are produced during the

GENERAL INTRODUCTION plant-pathogen interaction to mediate a variety of processes depending on the nature of the organism recognized.

ROS produced in response to pathogens seem to contribute limiting the penetration of pathogens by mediating the establishment of physical barriers at the cell wall called papillae which is formed at the site of interaction by: cross linking of cell wall glycoproteins (Bradley et al., 1992) and precursors of lignin and suberin polymers (Huckelhoven et al., 2007; Ros-Barceló and Gómez-Ros, 2009). This ROS also play a role acting as positive signals during callose deposition (Galletti et al; 2008; Luna et al., 2010; Zhang et al., 2007). Additionally, ROS signaling induces the generation of phytoalexins and secondary metabolites that arrest pathogen growth (Thomma et al., 2002).

However, ROS are mostly considered early signals that activate different pathways leading to the establishment of the defenses. Similarly to abiotic stress response, transmission of pathogen recognition and defense response signals at the cellular level via ROS can be achieved by control of MAPK phosphorylation cascades and regulation of gene expression through oxidative modulation of TFs activity (Torres et al., 2010). This is exemplified by the redox control of NPR1, a master regulator of SA transcriptional response and defense gene activation (Spadaro et al., 2010) and the activation of the defense response regulatory kinases MPK3/6 by the ROS-activated OXI1 kinase (Menke et al., 2004; Rentel et al., 2004). ROS can carry out redox-based post-translational modifications through the hydroxylation of cysteine residues to form cysteine sulphenic acid or disulphide bonds that, in turn, can be reduced back to cysteine by various cellular reductants (Spadaro et al., 2010). Thus, ROS can stabilize MPK kinases in plants (Doczi et al. 2007; Pitzschke et al. 2009). In addition, recent reports suggest that oxidation of methionine may couple oxidative signals to changes in phosphorylation activity in Arabidopsis

(Hardin et al., 2009). A recent genome-wide study of H2O2-regulated miRNAs in rice indicates that transcriptional reprogramming in response to ROS also occurs by the modulation of microRNA expression (Li et al., 2011). Interestingly, ROS dependent regulation of gene expression seems to be ROS type specific (Miller et al., 2009; Petrov and Van Breusegem, 2012; Wang et al., 2013b).

Modulation of ion fluxes and Ca2+ signaling are also ROS-mediated signaling events that occur in both abiotic and biotic stress responses. During infection, ROS mediate apoplast alkalinization that possibly contributes to activation of downstream defense responses (Kotchoin and Gachomo, 2006). Moreover, after treatment with pathogen elicitors, ROS production is required to prime Ca2+ influx (Levine et al., 1996) and to induce CPKs (Li et al., 2008) that are essential for the plant defense response (Romeis et al., 2001). In fact, ROS signaling can act up or downstream of Ca2+ signaling (Torres et al., 2010). Importantly, changes in Ca2+ fluxes and ROS production in guard cells are key elements for stomatal closure in response to pathogens as a pre-invasive defense barrier to avoid the penetration of potentially harmful microbes (Sawinski et al., 2013). ROS can also lead to the generation of lipid derivatives by non-enzymatic oxygenation, which can produce membrane damage or function as signaling molecules i.e. cyclic oxylipins (Vellosillo et al., 2010). Interestingly, ROS function during plant immunity has also been

GENERAL INTRODUCTION related to vesicle trafficking, for PRR endocytosis and recycling during defense activation or for delivery of ROS to specific cellular locations (Torres et al., 2010).

In addition to their action at cellular level, ROS are mediators during establishment of systemic responses and have been proposed to act as a rapid, long-distance cell-to-cell propagating signal that, in synergy with SA, mediate the establishment of SAR (Coll et al., 2011; Torres et al., 2010). In this regard, after mechanical wounding associated with pest insects feeding, a propagating signal dependent on H2O2 mediates the establishment of wound responses at plant distal tissues (Miller et al., 2009). Additionally, ROS and ET signaling have been related to SAR against cauliflower mosaic virus in Arabidopsis (Love et al., 2005).

ROS are generally perceived as positive regulators of cell death and resistance. However, in some plant-pathogen interactions, ROS accumulation and the HR are uncoupled. Mutants impaired in ROS production are generally more susceptible to a wide range of pathogens and show a reduction of HR. Nevertheless, some studies report that pathogens with a necrotrophic phase could benefit from ROS produced by the host to promote cell death, gain easy access to nutrients and thus contributing to disease progression (Torres et al., 2010). Consequently, different specific ROS pools at the host plant could play a positive or negative role on cell death and disease progression depending on the pathosystem analysed. Particularly, ROS produced by NADPH oxidases seem to play dual roles in the regulation of cell death. Depending on the levels of ET and SA and the cellular damage caused by the pathogen, ROS could contribute to maintain cellular integrity or to trigger cell death when the cellular damage is excessive (Pogany et al., 2009; Torres et al., 2005).

Apart from the response to pathogens, ROS are also produced in early stages of symbiosis with bacteria and mychorrizae and could play an important role in the establishment of these mutualistic interactions (Fester and Hause, 2005, Santos et al., 2001). For example, adequate balance between active ROS production and the activity of ROS-scavenging systems is essential for proper Rhizobium-legume symbiosis to develop (Jamet et al. 2003; Marino et al.,

2011). In addition, H2O2 could be involved in biomechanics of infection threat growth possibly via cross linking and insolubilization of the extracellular matrix of legume tissues. Moreover, ROS has been linked to Ca2+ signaling and cytoskeleton rearrangement as well as with the senescence of the nodule and arbuscular branches (Torres et al., 2010).

Interestingly, ROS can also influence some plant-plant interactions. In this regard, certain invasive plant species secrete allelochemicals to manipulate ROS production at the root meristem of neighboring plants, eliciting cell death signaling cascades and destroying the susceptible plant root system (Bais et al., 2003).

GENERAL INTRODUCTION

1.3 RBOH-NADPH OXIDASES: ENZIMATIC SYSTEMS FOR INDUCIBLE ROS PRODUCTION IN PLANT DEVELOPMENT, ABIOTIC STRESS RESPONSE AND IMMUNITY

1.3.1 Plant NADPH oxidases: evolution and structure

Plasma membrane NADPH oxidases, also termed NOX, are proteins that emerged along eukarya evolution as a mechanism for active generation of ROS in response to different stimuli. These .- enzymes catalyze the one-electron reduction of O2 to O2 using NADPH as electron donor (Torres and Dangl, 2005; Sumimoto, 2008; Suzuki et al., 2011). Biological functions of NOX enzymes include, among others, post-translational modification of proteins, regulation of hormone synthesis signal transduction, control of cell growth and differentiation, and host defense (Bedard et al., 2007; Sumimoto, 2008).

While NOX enzymes are not found in prokaryotes and most unicellular eukaryotes, they are present in fungi, plants and animals (Figure 5A). Since NOX enzymes are present in all eukaryotic supergroups except Rhizaria (a group of protists) it is likely that a common ancestor of NOX genes emerged at an early stage in the evolution of eukaryotes (Sumimoto, 2008). The relevance of the NADPH oxidases is evidenced by the lack of known multicellular life without these enzymes (Bedard et al., 2007).

All subfamilies of NADPH oxidases are characterized by a domain structure consisting of 6 transmembrane domains, the third and the fifth containing two asymmetrical hemes, and a long cytoplasmic C-terminal region containing the FAD (Flavin Adenosine Diphosphate) and NADPH binding sites. Each heme group harbors two hystidines coordinated with a ferrous ion and both are required for transfer of electrons from NADPH across the membrane to O2 which is, in overall, an energetically favorable process (Figure 5B; Bedard et al., 2007; Cross and Segal, 2004; Sagi and Fluhr, 2006).

During the course of evolution, NADPH oxidases have acquired controlling mechanisms through the insertion of regulatory domains (or motifs) into their own sequences or by gaining associated proteins as regulatory subunits, divergence that generated different NOX types. The animal NOX can be divided into three subfamilies: the NOX1–4 subgroup, which form a heterodimer with p22phox; the NOX5 subfamily with Ca2+-binding EF hand domains; and the Dual oxidase (DUOX) subfamily with a N-terminal peroxidase like ectodomain separated from the two EF-hands by an additional transmembrane segment (Figure 4B; Sumimoto, 2008). Plant NADPH oxidases were first identified as homologues of gp91phox, the mammalian phagocyte NADPH oxidase, also termed NOX2 or Respiratory Burst Oxidase. Therefore, plant NOXs were named RBOHs for Respiratory Burst Oxidase Homologues (Torres and Dangl, 2005). Plant NADPH oxidases are encoded by a multigenic family and the number of Rboh genes varies between species. Arabidopsis thaliana genome presents 10 Rboh genes (AtRbohA-J; Figure 5A); Oriza sativa genome harbors 9 Rboh genes; Medicago truncatula and Vitis vinifera present 7 (Cheng et al., 2013; Marino et al., 2011).

GENERAL INTRODUCTION

Figure 5. NADPH oxidases are conserved ROS producing enzymes in eukaryotes phylogeny. (A) Phylogenetic tree showing the relationship between NADPH oxidases from 3 species belonging to 3 different eukaryotic kingdoms: Metazoa, Fungi (supergroup Opisthokonta) and Plantae. NADPH oxidases shown in the tree are: Homo sapiens NOX and DUOX enzymatic family, Magnaporthe oryzae NOX and Arabidopsis thaliana RBOH. Only the carboxy-terminal with homology to gp91phox/NOX2 (excluding the EF hands), were used in the alignment. The phylogenetic analyses were made with ClustalX using neighbor-joining as clustering method. The length of the horizontal lines connecting the sequences is proportional to the estimated amino acid substitutions/site between these sequences. Bootstrap values from 1,000 iterations are shown. (B) Diagram of plant RBOH and representative classes of animal NADPH oxidases: NOX1-4, NOX5 and DUOX. Cylinders represent transmembrane domains (Adapted from Suzuki et al., 2011).

The NADPH oxidase encoding genes strongly expanded within the vascular plants. This family expansion might have been associated with the need for a more complex signaling network to coordinate multicellular growth, morphological complexity and biotic/abiotic stress responses (Mittler et al., 2011). Interestingly, phylogenetic analysis of legume Rboh genes indicates that duplication, might have played a key role during the emergence of different homologues allowing RBOH functional divergence (Marino et al., 2011).

GENERAL INTRODUCTION

RBOHs share common structural features and regulatory domains (Torres et al., 2005; Sagi and Fluhr, 2006). They present an N-terminal region which is absent in the phagocytic gp91phox, but present in other animal NOXs such as NOX5 and DUOX. This N-terminal extension of about 300 aa contains regulatory regions, among them, calcium-binding EF-hands and phosphorylation motifs important for the activation and regulation of the plant oxidases (Figure 5B; Kaya et al., 2014; Suzuki et al., 2011). This regulatory N-term domain allows RBOH proteins to link Ca2+ signaling with ROS signaling in different cellular and physiological processes.

1.3.2 Regulation of RBOH-NADPH oxidases

In contrast to gp91phox that needs the presence of the membrane bound p22phox and the assembly of several cytosolic components (p40phox, p47phox, p67phox) to function (Cross and Segal 2004), .- 2+ plant RBOHs can directly produce O2 upon stimulation with Ca (Sagi and Fluhr, 2001). This is similar to the NOX5 subfamily activation which occurs through an intra-molecular interaction derived from a conformational change induced by Ca2+ binding to the N-terminal region (Bánfi et al., 2004). The similarities in the regulation of plant and animal NADPH could arose from a signaling cassete inherited from a common ancestor. Alternatively this could be a case of convergent evolution of a signaling pathway (Canton and Grinstein, 2014).

The rapid activation of plant NADPH oxidases in response to broad biotic and/or abiotic stimuli is achieved by RBOH N-terminal specific postranslational modifications. In this regard, phosphorylation is essential but not sufficient for full activation of RBOHs (Nuhse et al., 2007). Recent data shows that the rapid initial phosphorylation at the RBOH N-terminal ocurrs independently of Ca2+ and seems to prime the enzyme for the following Ca2+-dependent activation (Kimura et al., 2012; Li et al., 2014; Kadota et al., 2014). In turn, Ca2+ binding to the EF-hand motifs induces conformational changes, which are important for activation of RBOHs (Ogasawara et al., 2008; Oda et al., 2010). Moreover, Ca2+ activates protein kinases, such as CPKs or calcineurin B-like sensor interacting protein kinases (CIPKs), which can phosphorylate RBOHs (Boudsocq and Sheen, 2013; Drerup et al., 2013; Dubiella et al., 2013; Gao et al., 2013; Kimura et al., 2013). The direct or indirect Ca2+ dependent modifications of RBOHs N-termini are thought to be important for the binding of the small Rho-like GTPases, Rac (also termed Rop), which imposes an RBOH N-term conformational change and are required for full activation of plant NADPH oxidases (Kaya et al., 2014; Wong et al., 2007). Thus, Ca2+ and phosphorylation synergize in the regulation of these enzimes.

A negative feedback regulation of RBOH activity by Ca2+ has been proposed. After initial activation of the NADPH oxidase by Ca2+ and phosphorylation, ROS produced may induce cytosolic Ca2+ elevation, which in turn inhibits Rac binding, thus terminating the oxidative burst (Wong et al., 2007). Moreover, a direct negative regulation of RBOH activity occurs at the C-term by S-nitrosylation of an evolutionary conserved cysteine residue that interferes with FAD binding .- and therefore blocks electron transfer from NADPH to O2 (Yun et al., 2011).

GENERAL INTRODUCTION

In mammals, different NADPH oxidases exhibit tissue and even cell type-specific expression and mediate different processes from cell proliferation to microbial pathogens killing in phagocytes or thyroid hormone biosynthesis (Canton and Grinstein, 2014; Cross and Segal, 2004). Similarly, different plant Rbohs also present certain tissue-specific distribution of transcripts reflecting their functional specialization (Suzuki et al., 2011; Sagi and Fluhr, 2006) and their expression patterns exhibit diverse stress-response expression signatures (Cheng et al., 2013; Suzuki et al., 2011; Wang et al., 2013c). Thus, transcriptional control might be an important level of regulation of different members of the Rboh multigene family.

An additional factor that might be important for the regulation of RBOHs activity in a certain context is their subcellular localization. Cell fractioning and microscopy studies have shown that RBOHs localize at the plasma membrane in different cell types (Keller et al., 1998; Kobayashi et al., 2007; Lee et al., 2013a; Noirot et al., 2014; Simon-Plas et al., 2002; Takeda et al., 2008). This is in agreement with the generation of apoplasitic ROS necessary for: growth (tightly associated to cell wall loosening and stiffening), immune responses at the front line of plant-microbe interactions and perception of abiotic stress related cues in the apoplast (Marino et al., 2012). Moreover the reported presence of RBOH proteins in particular lipid microdomains could enhance their functional specificity (Liu et al., 2009). Additionally, there is evidence of vesicle trafficking of RBOH-dependent ROS which could allow shuttling ROS between different cell compartments (Leshem et al., 2007).

Thus, the activity of different RBOHs in specific tissues seems to be coordinated and these enzymes provide a link between Ca2+ signaling, phosphorylation events and ROS signaling to orchestrate many cellular and physiological processes which are essential for the plant.

1.3.3 Functions of the RBOH-NADPH oxidases in plant development

Our understanding of the biological relevance of RBOH-dependent ROS production has greatly advanced with the identification of Arabidopsis thaliana rboh mutants. Different RBOHs play specific signaling functions ranging from development to biotic and abiotic stress responses (Figure 6; Torres and Dangl, 2005). While some of these processes are mediated by a specific homologue, there is also genetic evidence of functional overlapping between RBOHs (Kaya et al., 2014: Marino et al 2012; Suzuki et al., 2011). Moreover, the presence of Rboh multigene families in monocots and other dicots has allowed the identification of several orthologues with additional functions in different plant species (Cheng et al., 2013; Marino et al., 2011; Mittler et al., 2011; Simon-Plas et al., 2002; Yoshioka et al., 2003; Wang et al., 2013c).

The spatial control of ROS production is an important factor in the regulation of plant development (Gapper and Dolan, 2006). A clear link has been established between: environmental cues, ROS production, changes in cellular redox state and shoot and root meristem development. Many available data suggest that the control of growth involves a network of interactions between ROS, antioxidants and different phytohormones such as auxins, giberelins and strigolactones (Bhattajarchee, 2012; Considine and Foyer, 2014; Swanson and

GENERAL INTRODUCTION

Gilroy, 2010). The plethora of development processes mediated by ROS include: cell division and morphogenesis patterning (Considine and Foyer, 2014; Dinneny and Benfi, 2008); cell expansion and orientation of both cellular (Swanson and Gilroy, 2010; Wu et al., 2010) and organ growth (Clore et al., 2008; Joo et al., 2001, 2005b); transition from dormant to metabolic active tissues during seed germination and bud burst (Considine and Foyer, 2014); and development associated PCD of the aleurone (Bethke and Jones, 2001).

Figure 6. Processes mediated by the plant RBOH-NADPH oxidases. ROS produced by RBOH proteins mediate multiple processes in plants including: seed after-ripening; lignification; abiotic stress response; biotic interactions; root hair formation; mechanosensing and wound responses; HR and tapetum PCD; stomatal closure in response to PAMPs and ABA; systemic signaling in response to diverse stresses and pollen tube growth. The specific RBOH(s) involved in the modulation of each physiological process in Arabidopsis thaliana are indicated. *In the legumes Medicago and Phaseolus, MTRBOHA and PVRBOHB, respectively are involved in symbiotic nodule formation and functioning

RBOH-dependent ROS are essential for cell expansion in root hairs and pollen tubes. ATRBOHC mediates root hair growth in a tightly regulated process where a growth pulse causes the cell turgor to increase followed by Ca2+ influx, ROS production and a change in apoplastic pH (Foreman et al., 2003). ATRBOHC-dependent ROS modulates the loosening of the cell wall at the growth apex and the rigidification of the cell wall behind the tip growth apex, maintaining the polarized tubular cell expansion (Monshaushen et al., 2007). ATRBOHC activity also mediates the perception of internal and external mechanical stimuli in the root cells modulating organ

GENERAL INTRODUCTION growth direction (Monshausen et al., 2009). Likewise, ATRBOH and ATRBOHJ mediate tip growth during pollen tube development (Kaya et al., 2014; Potocky et al., 2007). In addition, ROS produced by ATRBOHE are essential to control PCD in the tapetum for the formation of mature pollen grains (Xie et al., 2014). Finally, ATRBOHB-dependent ROS contribute to protein oxidation in seeds and promote endosperm weakening. Specifically, ATRBOHB participates in seed after- ripening, a process in mature seeds that releases dormancy and promotes germination (Müller et al., 2009).

1.3.4 Functions of the RBOH-NADPH oxidases in abiotic stress responses

Plants have to cope with non-optimum environmental conditions affecting their normal performance. The stress caused by any other factor than direct interaction with another organism is known as abiotic stress and includes: drought, salinity (in the form of NaCl), extreme temperatures, excess light, presence of heavy metals, xenobiotics, ultra-violet radiation, ozone, hypoxia and nutrient deficiency (Apel and Hirt, 2004; Møller et al., 2007). The mechanisms of damage, signaling and metabolic responses differ from each other. However, plants respond to all these stresses with increasing ROS in different cellular compartments that have dual roles. On one hand, ROS contribute to the adjustment of the cellular machinery to altered conditions (Jaspers et al., 2010, Petrov and Van Breusegen, 2010). On the other hand, under sustained high stress conditions, excessive ROS accumulation causes uncontrolled cellular damage affecting the plant performance (Møller et al., 2007).

RBOH-dependent ROS synergize with metabolic ROS to regulate the plant acclimation response to different abiotic stresses (Jaspers et al., 2010). These enzymes modulate stomata movement, which regulates water and gas exchange in response to environmental cues (Song et al., 2013), and mediate long distance signaling contributing to plant systemic acquired acclimation after exposure to a certain stress (Jaspers et al., 2010; Miller et al., 2011; Suzuki et al., 2013). AtRbohD is the most highly expressed Rboh in Arabidopsis and is also involved in the regulation of long-distal signaling in response to different stresses. ROS produced by ATRBOHD mediate a rapid, long-distance, cell-to-cell propagating signal in response to diverse local stresses including excess light, heat and high salinity (Miller et al. 2009). This signaling prepares distal tissues to suffer less oxidative damage contributing to plant systemic acquired acclimation (Jaspers et al., 2010; Miller et al., 2010; Suzuki et al., 2013).

ABA perception in guard cells during drought or salinity stress increases H2O2 levels derived from ATRBOHD and ATRBOHF activity (Kwak et al., 2003; Leshem et al., 2007; Zhang et 2+ 2+ al., 2009b). H2O2 activates permeable Ca channels raising cytoplasmic Ca concentrations which, in turn, depolarize the plasma membrane. This depolarization blocks H+ efflux and K+ intake and activates K+ and Cl- efflux, contributing to lower the turgor pressure in guard cells, thus causing stomata to close (Pei et al., 2000; Wang et al., 2013a).

ROS derived from both, ATRBOHD and ATRBOHF, have been also reported to contribute to salinity acclimation (Ma et al., 2010; Xie et al., 2011). In response to elevated soil

GENERAL INTRODUCTION salinity, while RBOHD possibly contributes to this process mediating long distance signaling (Miller et al., 2009), ATRBOHF increases ROS levels at the root vasculature thereby limiting sodium concentrations in xylem sap and, in turn, protecting shoot cells from transpiration- dependent delivery of sodium excess (Jiang et al., 2012a). Interestingly ATRBOHD and ATRBOHF also mediate lignification, a major cell wall modification occuring in many different cell types and in response to various environmental stresses. ATRBOHF mediates lignin deposition in the root endodermis for the formation of the Casparian strip, a band of cell wall material that blocks the passive flow of water and solutes into the root stele (Lee et al., 2013a). In turn, a negative feedback loop between JA and ATRBOHD dependent ROS mediates lignin biosynthesis after cell wall damage (Denness et al., 2011).

1.3.5 Functions of the RBOH-NADPH oxidases in biotic interactions

RBOH-dependent ROS have been extensively associated with the establishment of plant defenses in response to pathogens. In Arabidopsis, AtRbohD and AtRbohF (hereafter RbohD and RbohF), are the two pleiotropic homologues mediating immune responses to a wide range of pathogens tested (Marino et al., 2012; Torres and Dangl, 2005; Suzuki et al., 2011). Specifically, RBOHD is responsible for the majority of the apoplastic ROS burst in response to PAMPs (Nüshe et al., 2007; Zhang et al., 2007) and during ETI (Torres et al., 2002). RBOHD-dependent ROS play a critical role in PAMP induced stomatal closure as part of the pre-invasive immunity (Macho et al., 2012; Mersmann et al., 2010) and in callose deposition in response to flg22 (Luna et al., 2011). Moreover RBOHD-derived ROS play dual roles in cell death regulation in response to necrotrophs and avirulent bacterial strains, contributing to maintain cellular integrity, avoiding the spread of cell death or contributing to autophagy when the cellular damage is excessive (Pogany et al., 2009; Torres et al., 2005). It was reported that local HR during incompatible interactions, triggers micro-ROS bursts possibly mediated by this NADPH oxidase at distal tissues that are required for the establishment of systemic defenses (Alvarez et al., 1998). Moreover, RBOHD is required as well for activation of distal defense responses after PAMP treatment (Dubiella et al., 2013). Therefore, RBOHD might be involved in redox signaling during SAR. In agreement with this RBOHD-dependent long distance signaling also occurs in response to pest insects feeding (Miller et al., 2009). On the other hand, RBOHF is a crucial modulator of defense-related metabolism upon phytopathogenic bacterial infection (Chaouch et al., 2012).

Certain functional redundancy exists between RBOHD and RBOHF. Both oxidases cooperate during the HR execution (Torres et al., 2002; Zhang et al., 2009a) and in ABA mediated stomatal closure (Kwak et al., 2003), processes in which RBOHF plays a more prominent role. Moreover, often a susceptible phenotype is enhanced or only detected in the rbohD rbohF double mutant (Berrocal-Lobo et al., 2010; Perchepied et al., 2010). Thus, these two pleiotropic oxidases play specific signaling roles that often synergize during the plant immune response.

GENERAL INTRODUCTION

Intriguingly, these two rboh mutants are not always compromised in disease resistance. The rbohD mutant is largely unaffected in anti-bacterial immunity (Kadota et al., 2014; Macho et al., 2012; Marino et al., 2012) and the rbohF mutant presents a very mild susceptibility phenotype (Chaouch et al., 2012). Additionally, the double mutant rbohD rbohF displays enhanced resistance compared to wild-type plants in response to an avirulent isolate of the oomycete Hyaloperonospora arabidopsidis or to parasitic nematodes (Torres et al., 2002; Siddique et al., 2014). The possibility that RBOH-dependent ROS act as a signals favoring the proliferation of certain types of pathogens cannot be ruled out. However, this phenotypes might also be explained by the over-accumulation of SA, ET and antimicrobial compounds detected in rbohD and rbohF mutants upon infection (Chaouch et al., 2012; Pogany et al., 2009), which may compensate for impaired RBOHD and RBOHF downstream responses.

Studies in Nicotiana benthamiana indicate that the Arabidopsis RbohD and RbohF functional orthologues, NbRbohB and NbRbohA respectively, are required for ROS accumulation and non-host resistance to the potato pathogen Phytophthora infestans (Yoshioka et al., 2003) and that both enzymes are involved in PAMP-induced stomatal closure (Zhang et al., 2009a).

In addition to their roles in response to pathogens, studies in legumes revealed that plant RBOH-NADPH oxidases also mediate other biotic interactions such as the establishment of functional symbiotic nodules in Medicago truncatula, which is regulated by MtRbohA (Marino et al., 2011). Additionally down-regulation of PvRbohB in Phaseolus vulgaris was shown to suppress ROS production and abolish Rhizobium infection-threat progression but also to enhance arbuscular mycorrhizal fungal colonization (Arthikala et al., 2014).

1.3.6 Arabidopsis thaliana RBOHD and RBOHF regulation and crosstalk with other signaling pathways during the plant immune response

A plethora of signals interact with RBOHD and RBOHF and regulate their gene expression and/or enzymatic activation during the plant immune response. This immunity related cues include: activation of the SA, ET, JA and ABA hormone signaling pathways, Ca2+ signaling, phosphorylation by different protein kinases and NO regulation. In turn RBOHD and RBOHF activity often impinge the activity of these modulators in plant defense signaling (Marino et al., 2012; Suzuki et al., 2011).

An extensive crosstalk exist between RBOH-dependent ROS signaling and the cascade mediated by different hormones. ET and SA pathways induce RbohD in response to pathogens (Meng et al., 2013) or during cell death (Bouchez et al., 2007; Devadas et al., 2002). In turn, ROS also influences signaling mediated by these phytohormones during the plant immune response. For instance, at the site of infection, RBOHD-dependent ROS synergize with SA during the HR execution, or with SA and ET during cell death caused by necrotrophic pathogens. However, beyond the infection site, ROS antagonize with SA and ET negatively regulating the spread of the cell death (Pogany et al., 2009; Torres et al., 2005). Redox sensors like the OXI1 kinase or the TF NPR1 might be at the center of this crosstalk.

GENERAL INTRODUCTION

By contrast, the activation of the JA and ABA signaling pathways seems to antagonize with RbohD transcriptional activity. For instance, RbohD gene expression is negatively regulated by JA in response to wounding (Takahashi et al., 2011), and a negative feedback loop between JA and RBOHD-dependent ROS mediates lignin biosynthesis after cell wall damage (Denness et al., 2011). Moreover, ABA treatment represses RbohD expression in seedlings (Sagi and Flurh, 2006) and ABA-deficient mutants display enhanced constitutive expression of RbohD compared to wild-type plants (Sanchez-Vallet et al., 2012). In addition to influence Rboh gene expression, the activation of the JA and ABA signaling pathways have been shown to impact RBOHD and RBOHF enzymatic activity. MeJA and ABA induce the alkalinization of guard cell cytoplasm that might contribute to RBOHD- and RBOHF-dependent ROS production (Suhita et al., 2004). ABA perception activates Open Stomata 1 (OST1) kinase, which stimulates RBOHF-dependent H2O2 production that mediates stomata closure (Sirichandra et al., 2009; Song et al., 2013). In addition, during ABA-mediated ROS production, phosphatidic acid, the lipid product of phospholipase D, stimulates RBOHD and RBOHF activity by direct binding to their N-term region (Zhang et al., 2009b). Hence, these RBOHs might represent a cross-talk point between ABA and defense signaling.

Ca2+ signaling and phosphorylation are essential mechanisms that regulate RBOH activity and are interconnected. RBOHD is phosphorylated at specific residues in the N-terminal upon PAMP treatment (Nüshe et al., 2007; Zhang et al., 2007). RBOHD is activated in a Ca2+ dependent or independent manner by the CPK5 and the RLCK BIK1 respectively (Dubiella et al., 2013; Li et al., 2014; Kadota et al., 2014). While Serine 347 (S347) can be phosphorylated by BIK1 and CPKs, S39, S339 and S343 are BIK1-specific phosphorylation sites. RBOHD associates with PRR complexes at the plasma membrane and after PAMP elicitation, where it is rapidly and directly phosphorylated by BIK1. This rapid phosphorylation seems to prime RBOHD for the subsequent Ca2+ based regulation of the NADPH oxidase activity (Kadota et al., 2014). Additional studies also provide links between early Ca2+ signaling and RBOH dependent ROS production through RBOHD and RBOHF phosphorylation. Increase of cytoplasmic Ca2+ is detected by the Calcineurin B-like sensors CBL1/9 which mediate phosphorylation of the RBOHF N-terminus by CIPK26 and activates ROS production (Drerup et al., 2013; Kimura et al., 2013). Moreover, although the link between NB-LRR activation and downstream responses is not totally understood, it has been recently shown that RBOHD and RBOHF N-termini can be phosphorylated by CPK1/2/4 and 11. Additionally, cpk mutants are impaired in ROS production and resistance in response to avirulent pathogens (Gao et al., 2013), suggesting that phosphorylation of the RBOH N-termini cytosolic extension by CPKs is important for RBOH- dependent ROS production during ETI.

RBOH-dependent ROS functions have also been related to NO (Torres and Dangl, 2005). A fine balance between coordinated levels of ROS and NO mediate the execution of the HR and both intervene in ABA induced stomatal closure (Delledonne et al., 2001; Desikan et al., 2004; Tada et al. 2004; Zeier et al. 2004). Also redox regulation of NPR1, which is essential for SA downstream gene activation and responses, provides a link between both types of reactive

GENERAL INTRODUCTION molecules (Spadaro et al., 2010; Torres, 2010). Interestingly, RBOHD-mediated ROS production during the HR is controlled by NO-dependent S-nitrosylation of RBOHD at Cys 890, providing a mechanism for the crosstalk between both signaling molecules during cell death control (Yun et al., 2011).

1.4 HETEROTRIMERIC G PROTEINS

1.4.1 Plant heterotrimeric G proteins: key cell signaling transduction nodes

Heterotrimeric guanyl nucleotide-binding proteins, commonly referred as heterotrimeric G proteins, were first identified in mammals as signal transducers mediating the synthesis of secondary messengers that amplify downstream signaling in response to extracellular cues (Hancock, 2005). Heterotrimeric G proteins exist as a complex of three polypeptides, Gα, Gβ, Gγ. In the widely accepted mammalian G-protein signaling cycle paradigm (Figure 7A; Oldham and Hamm, 2008), the three subunits form, in the absence of an activating ligand, an inactive heterotrimer with a GDP-bound Gα monomer and a Gβγ dimer attached to the inner part of the plasma membrane. Binding of ligands to the G protein-coupled receptors (GPCRs) consisting of 7 transmembrane domains results in the exchange of GDP for GTP at the Gα subunit and the subsequent dissociation of the GTP-bound Gα subunit and the Gβγ dimer, both of which activate downstream effectors (Temple and Jones, 2007). Hydrolysis of the GTP by the intrinsic GTPase activity of the Gα subunit in a process stimulated by Regulators of G protein Signaling proteins (RGS) leads to re-association of the Gα subunit to the Gβγ dimer and binding to the GPCR, resuming the cycle (Ross and Wilkie, 2000).

The genetic complexity of heterotrimeric G proteins is high in animals. For instance, 5 Gα subunits, 12 Gβ and more than 850 putative GPCRs have been identified in humans (McCudden et al., 2005). On the contrary, the genetic complexity in plants is quite low, with Arabidopsis only having one Gα (GPA1; Ma et al., 1990), one Gβ (AGB1; Weiss et al., 1994) and three Gγ subunits: AGG1, AGG2 (Mason and Botella, 2000) and AGG3 (Thung et al., 2012). In addition, AGG1 and AGG2 share high sequence similarity and have overlapping functions (Mason and Botella, 2000; Trusov et al., 2007; Trusov et al., 2008). Rice genome also has one Gα and one Gβ, but it contains four Gγ subunits (Chakravorty et al., 2011). Although RGS proteins, enhancers of Gα GTPase activity, contain in plants 7 transmembrane domains, the canonical GPCRs present in animals have not been identified to date (Urano and Jones 2014). In addition, the activation mechanism of plant heterotrimeric G protein appears to be different from those from mammals (Figure 7B; Urano and Jones, 2014). In vitro studies showed that GDP-GTP exchange in Arabidopsis GPA1 occurs spontaneously in the absence of GPCRs (Willard and Siderovski; Jones et al., 2011). Moreover, GPA1 displays very low GTPase activity and requires the priming by RGS. Therefore, most GPA1 proteins in Arabidopsis, by default, might be in a GTP-bound state (Temple and Jones, 2007). These key biochemical differences make plant G signaling different from that of animals, where the presence of a signal stimulates the production of the activated G protein. In contrast, plant heterotrimeric G proteins regulation might occur via

GENERAL INTRODUCTION inhibiting deactivation, either controlling the GTP-bound pool, or inhibiting the GTP hydrolysis promoted by RGS proteins.

Figure 7. Heterotrimeric G protein mechanism of action models in mammals and Arabidopsis. (A) The animal model. In the steady state, heterotrimeric G proteins form an inactive heterotrimer with GDP bound to the Gα subunit. Binding of a ligand to the GPCR promotes the Gα subunit to exchange GDP for GTP. GTP-bound Gα then dissociates from the Gβγ dimer, and both released subunits interact with downstream signaling effectors. Gα spontaneously hydrolyses GTP, activity which is accelerated by RGS proteins, returning to the GDP-bound state and reforming the inactive heterotrimer. (B) The Arabidopsis model. The Gα subunit, GPA1, spontaneously exchanges GDP for GTP without GPCRs, but does not readily hydrolyse GTP to return to the inactive state without the GTPase-accelarating 7 transmembrane protein RGS. Numbers (min-1) indicate the intrinsic rates of GDP/GTP exchange and GTP hydrolysis (adapted from Urano and Jones, 2014).

Despite the small repertoire of the G signaling complex, plant heterotrimeric G proteins process multiple signaling inputs. The availability of mutants defective in different subunits makes Arabidopsis an interesting model to understand the mechanism of action and roles of

GENERAL INTRODUCTION heterotrimeric G protein in key cell signaling pathways. Among these responses, plant heterotrimeric G proteins regulate a wide range of development processes such as ABA sensitivity during germination (Pandey et al., 2006; Ullah et al., 2001), stomata density (Zhang et al., 2008) and the shape of the rosette, flowers and siliques (Lease et al., 2001; Ullah et al., 2003). Moreover, they mediate auxin signaling in roots and the perception and integration of glucose levels with cell division (Chen et al., 2003; Grigston et al., 2008; Wang et al., 2006). Additionally, this protein complex is a central signaling switch during abiotic and biotic stress response. For instance in response to ozone (O3), they control ROS production and cell death spread (Joo et al., 2005; Galvez-Valdivieso et al., 2009). Moreover, they have been related to ABA responses such as stomatal closure (Wang et al., 2001; Fan et al., 2008) and the high light response (Booker et al., 2012). Furthermore, in a yeast two-hybrid screen, heterotrimeric G proteins interact with a large number of proteins involved in many different biological processes, including the regulation of cell wall modifications (Klopffleisch et al., 2012). In the last decade, their function has also been extensively related to the plant immune response to bacterial and fungal pathogens (Llorente et al., 2005; Suharsono et al., 2002; Trusov et al., 2006).

The link between heterotrimeric G proteins and immunity was first documented in medical research studies. In humans, these proteins are the target of pathogen toxins such as the cholera toxin (choleragen) secreted by Vibrio cholera, that destroys Gα subunit´s intrinsic GTPase activity. Another toxin from Bordetella pertussis, the causal agent of the whooping cough, also modifies the Gα subunit preventing its activation. These alterations lead to deregulation of adenylyl cyclase which, in turn, impairs ion and water fluxes in cells and cause disease symptoms (Hancock, 2005). In plants, we are starting to grasp the relevance of heterotrimeric G proteins in immunity.

1.4.2 Heterotrimeric G proteins functions in plant immunity

Genetic analyses of mutants impaired in individual subunits of heterotrimeric G proteins revealed that these proteins are required for the full immune response to different pathogens. Interestingly, the Gα and the Gβγ dimers seem to mediate different plant defense responses. The first genetic indication showing evidence of G protein signaling being involved in plant immunity came from rice. Studies on the dwarf1 (d1) mutant, lacking the only copy of Gα gene in rice, showed that heterotrimeric G proteins are required for ETI (Suharsono et al., 2002). d1 plants treated with an avirulent race of the rice blast fungus displayed delayed induction of PR gene expression and significant reduction of ROS production and the HR. Additionally, expression of a constitutively active form of the small GTPase OsRac1 restored ROS production and resistance to the avirulent rice blast (Suharsono et al., 2002), suggesting that the Gα subunit might acts upstream of OsRac1 and possibly of RBOH-dependent ROS production.

However, in Arabidopsis, the heterodimer Gβγ seems to have a more preeminent role in immunity. The Gβ subunit AGB1 and the Gγ AGG1/AGG2 subunits are required for full resistance against Plectosphaerella cucumerina, Alternaria brassicicola, Fusarium oxyspurum and Botrytis

GENERAL INTRODUCTION cinerea, since agb1 and agg1 agg2 double mutant plants exhibit enhanced susceptibility to these necrotrophs. On the other hand, the mutant in the Gα subunit, gpa1, shows slightly enhanced resistance against these pathogens (Llorente et al., 2005; Delgado-Cerezo et al., 2012; Trusov et al., 2006; Trusov et al., 2007; Trusov et al., 2009). Comparative transcriptomic analyses reveal that the Gβγ dimer acts independently of the classical ET, JA and SA signaling pathways (Delgado-Cerezo et al., 2012; Trusov et al., 2009). The misregulation of genes related to cell wall functions suggests that defects in the plant cell wall may contribute to the enhanced colonization of the fungus in agb1 and agg1 agg2 (Delgado-Cerezo et al., 2012). In fact, the amount of xylose in the cell wall of these mutants is reduced compared to wild-type plants (Delgado-Cerezo et al., 2012; Klopffleisch et al., 2012).

G protein signaling has been shown to play an important role in non-host resistance, when host-specific pathogens interact with other plant species. For instance, Magnaporthe oryzae causes rice blast disease, but is non-pathogenic to Arabidopsis and therefore is termed a non-adapted pathogen of Arabidopsis. Arabidopsis mutants in the Penetration 2 (Pen2) gene display a higher penetration ratio than wild-type plants when challenged with M. oryzae (Maeda et al., 2009). Interestingly, pen2 gpa1 double mutant shows lower penetration rate of the fungus than pen2 mutant, whereas pen2 agb1 displays enhanced penetration. This suggests a role of AGB1 in non host resistance against M. oryzae (Maeda et al., 2009).

G protein signaling has also been linked with the immune responses to various bacterial elicitors. In Arabidopsis, GPA1 was found to act in this process (Zhang et al., 2008). Upon treatment with flg22, guard cells inward K+ channels, responsible for K+ uptake and necessary for stomata opening, are inhibited. In fls2 and gpa1 single mutant plants, flg22 was unable to inhibit inward K+ channels of guard cells and stomata opening, suggesting that GPA1 functions downstream of FLS2 to regulate flg22-induced stomata closure. Consistent with its role in PAMP- triggered stomata closure, gpa1 mutant is unable to close stomata in response to the coronatine- deficient Pseudomonas syringae pv. tomato DC3118, which grows to a much higher titter than on wild-type plants when spray-inoculated (Zeng and He, 2010). Thus, GPA1 seems to be required for stomata defense against some pathogens. Additionally, both Gα and Gβ subunits were shown to be required for stomata closure and cell death after exposure to different elicitors in N. benthamiana (Zhang et al., 2012b).

1.5 MODEL PATHOSYSTEMS EMPLOYED

1.5.1 A. thaliana-Pseudomonas syringae pathovar tomato DC3000

Various strains of the gram-negative bacterial pathogen Pseudomonas syringae have been extensively used as models for understanding plant-bacterial interactions. Pseudomonas syringae pv. tomato (Pto) strain DC3000, infects not only its natural host (tomato) but also Arabidopsis in the laboratory. Pto DC3000 genome is formed by 1 cromosome and two plasmids, and carries a large repertoire of potential virulence factors. These include proteinaceous

GENERAL INTRODUCTION effectors, which are introduced into the host cell through the type III secretion system to subvert the plant immune system. They also produce a phytotoxin called coronatine, which structurally mimics the plant hormone JA to induce host stomatal aperture (Xin and He, 2013).

P. syringae may be best described as a hemibiotrophic pathogen. It colonizes mainly aerial portions of plants, such as leaves and fruits. Infection is often contained within a few millimeters of the initial entry site and does not spread to other parts of the plant. In a successful disease cycle, P. syringae strains generally live two lifestyles that are spatially and temporally interconnected: an initial epiphytic phase upon arrival on the surface of a healthy plant, and an endophytic phase in the apoplastic space after entering the plant through natural openings (i.e. stomata and hydatodes) and accidental wounds. Under favorable environmental conditions (e.g., heavy rain, high humidity and moderate temperature), P. syringae can multiply in a susceptible host plant. The acutest phase of P. syringae growth in planta occurs in the absence of apparent host cell death. However, at the late stage of pathogenesis (often after bacteria have almost reached the peak population in the infected tissues), host cells die and infected tissues show extensive chlorosis and necrosis (Figure 8A). This pathogenesis mode is distinct from that of strictly biotrophic pathogens, which obtain nutrients from living host cells without causing host cell death, and from that of strictly necrotrophic pathogens, which kill host cells during early stages of infection as the main strategy of obtaining nutrients (Xin and He, 2013).

The study of the Arabidopsis-Pto DC3000 pathosystem has provided several conceptual advances in understanding how a bacterial pathogen promotes disease susceptibility. Moreover it has also facilitated the discovery of key components of the plant immune system (Xin and He, 2013). In the frame of this PhD Thesis we employed 3 different strains of Pto DC3000 to activate different tiers of Arabidopsis immune response: Pto DC3000 hrcC, a mutant strain in the type III secretion system unable to secrete effectors into the host plant cell to subvert PTI (Colmer et al., 2000; Pto DC3000, virulent strain that successfully infects Arabidopsis by producing effectors that block PTI thus causing disease; Pto DC3000(avrRpm1), isogenic strain, that carries the avrRpm1 gene from P. syringae pv. Maculicola, an avirulence factor recognized by the Arabidopsis R protein RPM1, activating ETI (Grant et al., 1995; Mackey et al., 2003; Dangl and Jones 2001).

1.5.2 A. thaliana-Plecthosphaerella cucumerina

Plectosphaerella cucumerina (Lindf.) W. Gams, anamorph Plectosphorium tabacinum (Van Beyna; Palm et al., 1995), is a filamentous ascomycete which is common in the rizosphere and in decaying tissues of a diverse range of plants. P. cucumerina has been widely reported as the causal agent of sudden death and blight in crops of cucurbits and legumes (Dillar et al., 2005; Jimenez and Zitter, 2005; Ramos et al., 2013; Vitale et al., 2007). P. cucumerina is also a natural pathogen of several weeds, including A. thaliana and Hydrilla verticillata (Berrocal-Lobo et al., 2002; Ton and Mauch-Mani, 2004). The symptoms observed on infected plants include white to cream colored lesions on stems and leaves (Strickland et al., 2007: Figure 8B). As disease progresses, the infected stems become very brittle, often leading to breakage (Berrocal-Lobo et al., 2002).

GENERAL INTRODUCTION

Figure 8. Macroscopic symptoms derived from compatible interactions between P. syringae pv tomato DC3000 or P. cucumerina isolate BMM and different host plants. (A) Disease-associated necrotic spots in tomato fruits (left; image from Clemson University) and chlorosis in Arabidopsis (right; image from and pseudomonas-syringae.org) infected with Pto DC3000. (B) White to cream colored necrotic lesions in Arabidopsis (left) and pumpkin (Cucurbita maxima; right) infected with PcBMM.

The interaction between Arabidopsis and P. cucumerina is a well-established pathosystem for the study of plant basal and non-host resistance to necrotrophic fungi (Ramos et al., 2013). This is due to the availability of P. cucumerina adapted isolates, such as PcBMM, which is virulent on all Arabidopsis ecotypes tested, as well as non-adapted isolates, like Pc2127 which infects Viola spp in nature but is unable to colonize Arabidopsis plants (Llorente et al., 2005; Sánchez-Vallet et al., 2010; Ton and Mauch-Mani, 2004). Arabidopsis immune response to PcBMM isolate is genetically complex and multigenic (Denby et al., 2004; Llorente et al., 2005). The components involved in the Arabidopsis defense response to this fungus include: ET, JA, SA, ABA and auxin signaling pathways (Berrocal-Lobo et al., 2002; Ferrari et al., 2003; Hernández-Blanco et al., 2007; Llorente et al., 2005; Sanchez Vallet et al., 2012; Thomma et al., 1998); tryptophan derived secondary metabolites (Bednarek et al., 2009; Sanchez Vallet et al., 2010); the LRR-RLK ERECTA (Sanchez-Rodriguez et al., 2009); the cell wall (Ellis and Turner, 2002; Hernández-Blanco et al., 2007); and heterotrimeric G-proteins (Llorente et al., 2005; Delgado-Cerezo et al., 2012). In this work, we employed the P. cucumerina adapted and non- adapted isolates PcBMM and Pc2127 respectively to activate Arabidopsis immune responses.

OBJECTIVES

2. OBJECTIVES

OBJECTIVES

2. OBJECTIVES

This PhD Thesis intended to reveal novel molecular elements that regulate RbohD and RbohF dependent ROS-signalling during the Arabidopsis immune response.

In order to accomplish this goal we pursued the following specific objectives:

I. To analyze the gene spatial-temporal expression pattern of RbohD and RbohF in the Arabidopsis immune response to bacterial and fungal pathogens. (Chapter 1)

II. To test the role of Rboh promoters in the regulation of specific ROS-production during the plant immune response. (Chapter 1).

III. To study the contribution of heterotrimeric G proteins to the regulation of RBOH dependent ROS-signalling during plant immunity. (Chapter 2).

MATERIALS AND METHODS

3. MATERIALS AND METHODS

MATERIALS AND METHODS

3. MATERIALS AND METHODS

3.1 Plant materials and growth conditions

Plant species and lines employed in this study were Nicotinana benthamiana, Arabidopsis thaliana ecotype Columbia (Col-0) and the following mutants derived from Col-0 were: rbohD, rbohF, rbohD rbohF (Torres et al., 2002), cyp79B2/B3 (Sanchez-Vallet et al., 2010), agb1 (agb1- 2) (Ullah et al., 2003), gpa1 (gpa1-4) (Jones et al. 2003), agg1 and agg2 (agg1-1 and agg2-1, respectively; Trusov et al., 2008), rbohD rbohF agb1, rbohD rbohF gpa1, agb1 gpa1, rbohF agb1 (Torres et al., 2013). Arabidopsis Col-0, mutant lines and transgenics derived from col-0 and rbohD mutant lines were grown on a soil-vermiculite 3:1 mixture under a 10 hours day/14 hours night schedule, with a daytime temperature of 24°C and a night temperature of 22°C, under relative humidity of 65 % and light intensity of 120 mE m2 sec1. In vitro Arabidopsis seedlings growth conditions were: 16 hours day/8 hours night schedule, on Murashige Skoog (MS) salt medium (Duchefa) 1% sucrose agar plates. Nicotiana benthamiana plants were soil-grown under a 16 h photoperiod at 22°C.

3.2 Pathogens employed, storage and growth conditions

Bacterial strains used in this study were Pseudomonas syringae pv. tomato (Pto) DC3000, PtoDC3000(avrRpm1) and PtoDC3000 hrcC. Pseudomonas growth was carried out on King´s Base Medium (KB) agar plates supplemented with kanamycin (Kn) and rifampicin (Rif) for 48h at 28ºC and passed on to a new plate for 24h at 28ºC prior to inoculation. Pseudomonas stocks were kept in 20% glycerol KB (Kn, Rif) liquid medium at -80 ºC. The necrotrophic fungi P. cucumerina BMM isolate was originally provided by Dr B. Mauch-Mani (University of Fribourg, Switzerland; Tierens et al., 2001; Ton and Mouch-Mani, 2004). The P. cucumerina isolate Pc2127 comes from the DSMZ collection (http://www.dsmz.de). To obtain spore suspensions, fungal spores were inoculated Potato Dextrose Agar medium (Difco, USA) and grown for8 days at 28º C. Subsequently, fungal spores were collected in sterile water, quantified and kept on 20% glycerol at -80ºC as described (Berrocal-Lobo and Molina, 2004; Llorente et al., 2005)

3.3 Molecular cloning

3.3.1 promoterRboh:GUS and promoterRboh:luciferase genetic constructs

Genetic fusions were generated between the RbohD and RbohF promoters and the β- glucuronidase (GUS) reporter gene; the 5´ untranslated region (UTR) of the At5g47910 RbohD gene (1877bp; pD) and the At1g64060 RbohF gene (2002bp; pF) covering the intergenic distance between the ATG translation initiation codon and their preceding genes in the Arabidopsis genome, were amplified by Polymerase Chain Reaction (PCR) with Phusion Taq DNA polymerase (Thermo Scientific), adding EcoRI and BamHI restriction sites to the 5´and 3´of the amplicons. PCR products were sequenced and mobilized into pKGWF54 binary vector, a derivative from the SLJ44026 vector that carries tetracycline resistance for bacteria and Km resistance for plants (Jones et al., 1992), to generate the pKGWF54-pD::GUS::NOS and

MATERIALS AND METHODS

pKGWF54-pF::GUS::NOS cassettes. Fusions between the RbohD and RbohF promoters and the firefly luciferase reporter genewere obtained by PCR amplifying the same 5´ region of each Rboh promoter without the predicted translation start codon, that was subsequently cloned into the Gateway (GTW) pENTRD-Topo vector (Invitrogen) that confers kn resistance to bacteria. The fragments were then mobilized with LR CLONASE II (Invitrogen) into the LUCTRAP-3 (GTW) binary vector carrying Kn resistance to plants (Calderón-Villalobos et al., 2006). The primers used in these procedures are listed in table 1.

3.3.2 Rboh own-promoter and promoter-swap genetic constructs

To generate RbohD and RbohF promoter-swap constructs , the promoter region of RbohD (pD) and and RbohF (pF) use in the promoter-GUS fusions were amplified by PCR adding an MfeI restriction site at the 5´ of the promoters and the HA-tag flanked by EcoRI and SnaBI, XbaI restriction sites at the 3´ region.Subsequently, the amplicons were cloned into the pENTRD-Topo vector. On the side, the attR1/R2 reading frame B of the GTW cassette was isolated using EcoRV and cloned into the SnaBI site of these pENTRD clones, thus generating the pD::HA::attR1/attR2 and pF::HA::attR1/R2 entry clones. Subsequently, these cassettes were mobilized using MfeI and XbaI into a derivative of the pGREEN binary vector containing (EcoRI)35S::GUS::(XbaI)NOS on its polylinker after digesting with EcoRI and XbaI. Finally, RbohD and RbohF cDNAs were amplified, cloned into p-ENTRD-Topo and sequenced. Then each cDNA was mobilized by a clonase reaction into the pGREEN derivatives pGREEN-pRbohD::HA::attR1/R2::NOS and pGREEN-pRbohF::HA::attR1/R2::NOS. Primers used in these procedures are listed in table 1.

3.3.3 YFP-Agb1 genetic construct

For transient overexpression of AGB1 and co-immunoprecipation analysis, a 35S-YFP-Agb1 genetic construct was generated. First, total RNA was extracted from wild-type Col-0 Arabidopsis plants and cDNA was synthesized. Subsequently, total cDNA was employed as a template for AGB1 cDNA amplification by PCR using Phusion Taq DNA polymerase (Thermo Scientific) with the AGB15´and and AGB13´bis primers. PCR products were purified, cloned into pENTRD-Topo vector (Invitrogen) and sequenced. Finally, Agb1 cDNA was mobilized into the pEarlyGate104 vector obtained from ABRC stocks (CD3-686). The primers used are listed on table 1.

3.3.4 YFP-RbohD, FLAG-Rboh, and Bik1-HA constructs

The 35S-YFP-RbohD construct was generated by Dr. Miguel Angel Torres cloning RbohD cDNA into the pGWB42 binary vector (Nakagawa et al., 2007). 35S-3xFLAG-RbohD and 35S-3xFLAG- RbohF were generated at The Sainsbury laboratory (Norwich) by Dr. Shuta Asai and Dr. Yasuhiro Kadota by cloning each cDNA into the pGD binary.35S-FLAG-RbohD was employed in Kadota et al., 2014. 35S-Bik1-3xHA construct was generated by Dr. Yasuhiro Kadota by cloning Bik1 cDNA into the pGWB14 binary vector.

MATERIALS AND METHODS

Primer Sequence (5’3’) Target region

D146-f CACCCAATTGCCTTACTTTCTCATCGGGTTCTA

Amplify the At15g47910 5´ÚTR region for pD-GUS fusions TCTGGATCCTACGTAAGCTTTCCGCTGGCGTAGTCGGGTACG D147bsh-ha-r --TCATAAGGGTATCCTTTCATCGAATTCGAGAAACGAAAAAGATCT

F321-f CACCCAATTGTTACTACTACAACTGTTTGCACA Amplify the At1g64060 5´UTR region for pF-GUS fusions TCTGGATCCTACGTAAGCTTTCCGCTGGCGTAGTCGGGTACG F322bsh-ha-r --TCATAAGGGTATCCTTTCATAGATCCAAAGTCGGAATTCAAAGA

EcoDGUS-f CTCGAATTCGATGTTACGTCCTGTAGAAACC Amplify the GUS gene for pD- EcoFGUS-f TTTGAATTCCGACTTTGGATCTGATGTTACGTCCTGTAGAAACC GUS or pF-GUS fusions

Bam GUS-r CCCGGATCCTCATTGTTTGCCTCCCTGCTGC

pDGTW-f CACCCCCTTACTTTCTCATCGGGTTCTA Amplify the At5g47910 5´UTR for pDATGLess-r pD:luciferase fusions CGAATTCGAGAAACCAAAAAG

pFGTW-f CACCCTTACTACTACAACTGTTTGCACA Amplify the At5g47910 5´UTR for pF:luciferase fusions AGATCCAAAGTCGGAATTCAA pFATGLess-r

DEHAshx-r GAATTCGATGAAAGGATACCCTTATGACGTACCCGACTACGCCA --GCGGAAAGCTTACGTATCTAGA With D-146 amplifies pD:HA

FEHAshx-r GAATTCCGACTTGGATCTATGAAAGGATACCCTTATGACGTACC --CGACTACGCCAGCGGAAAGCTTACGTATCTAGA With F-321 amplifies pF:HA

D345-f CACCATGAAAATGAGACGAGGCAATTC AmplifyRbohD

D91-r CTTGTTTTATTTTTCTACAACGT

F346-f CACCATGAAACCGTTCTCAAAGAACGA Amplify RbohF

F145-r TATATTTACACGTATGCCTCGGTG

AGB15´ CACCATGTCTGTCTCCGAGCTCAA Amplify Agb1 (At4g34460) AGB13´bis CTTCAAATCACTCTCCTGTG

Table 1. Primers used in cloning procedures. Forward or reverse primers used are indicated as (-f) and (- r) respectively. From top to bottom, primers used in promoter Rboh-GUS (grey), promoter Rboh-Luciferase (white), promoter-swap (grey ) and Agb1 (white) cloning. Restriction sites added to the primers for cloning purpose are underlined; the cap for GTW cloning is highlighted in bold.

MATERIALS AND METHODS

3.3.5 Plasmid isolation and Agrobacterium tumefaciens transformation

Escherichia coli strain DH5α chemical competent cells were employed for cloning. Plasmid purification prior transformation was carried out using Nucleo spin kit (Promega, Madison, WI, USA) according to manufacturer recommendations. The amount of DNA was checked by a NanoDrop spectrophotometer (NanoDropTechnologies Wilmington, USA) at 260 nm. Genetic constructs were sequenced at Macrogen (http://dna.macrogen.com/) or GATC biotech (http://www.gatc-biotech.com/) and curated using the DNASTAR or CLC-Workbench sequence analysis software. Transformation of Agrobacterium tumefaciens GV3101 (rifampicin, gentamicin resistant) strain was carried out by standard electrophoration method using a BIO-RAD micropulser electrophorator. The presence of the genetic construct in Agrobacterium was tested by antibiotic selection and PCR.

3.4 Generation of Arabidopsis transgenic plants

The promoter-GUS constructs were brought into the Agrobacterium tumefaciens strain GV3101 and the promoter-Luciferase and promoter-swap constructs into the GV3101 strain with the pSoup helper plasmid (Hellens et al., 2000).Arabidopsis plants were transformed by the standard floral dip method (Clough and Bent, 1998). The pRboh-GUS and pRboh-LUC constructs were used to transform wild-type Col-0 plants, while promoter swap constructs where employed to transform rbohD and rbohF mutant lines. Transgenic plants were selected on MS agar plates with 50 µg L-1 Kn. Homozygous plants were obtained from lines with single insertion events. For each construct, 4 to 10 independent transgenic lines were analysed. The presence of the transgene was controled by PCR and the expression tested by different bioassays: GUS staining and quantification for pRboh-GUS lines; bioluminescence detection for pRboh-LUC; and immunodetection by western-blot together with ROS production complementation assays for promoter-swap constructs. Final experiments were performed with representative lines. Primers used to check the rboh mutant genetic background and the presence of the genetic constructs generated in this study are listed in table 2.

3.5 Genomic DNA extraction

Arabidopsis DNA extraction for genotyping was performed by homogenization of plant tissue in 300 µl of extraction buffer: Tris(hydroxymethyl)aminomethane-hydrocloride [pH 8] 100 mM, Ethylenediaminetretracetic acid di-sodium salt 20 mM, NaCl 1,4 M, Cetyl trimethylammonium bromide 2% and polyvinyl pyrrolidone 1%). Homogenates were incubated at 55º C for 5 minutes before adding 1 volume of Chloroform-Isoamyl Alcohol (24:1). Tubes were then spun down at 13000 rpm for 10 minutes. Supernatant was collected and precipitated with 2 volumes of ethanol for 20 to 60 minutes at -20º C. Samples were spun down for 20 minutes at 13000 rpm. Pellets were washed with 70% ethanol, air dried and re-suspended in 50 µl of Tris-EDTA with RNAse (0,2 µg µl-1). Nucleic acid samples were cuantified using a NanoDrop ND-1000 spectofotometer (NanoDrop Technologies Wilmington, USA).

MATERIALS AND METHODS

3.6 Polymerase chain reaction (PCR)

Primer Sequence 5´3´ Target region and amplicon size

JD1-f TTGCAAGCGGGATAGTCGTC Region flanking the first transposon insertion in RbohD gDNA (444 bp) JD2-r TTAACCGGAAAAAGGAAAGAAAAT

With JD1 targets the transposon insertion in dspm1-f CTTATTTCAGTAAGAGTGTGGGGTTTTGG rbohD after the 5th exon (280 bp)

JF1-f TTTGGTGAACTCGGCTTTAG Region flanking the first transposon insertion in RbohF gDNA (427 bp) JF2-r ACTCTCGTCGTTGATTTGTGA

With JF1 targets the transposon insertion in dspm11-r GGTGCAGCAAAACCCACACTTTTACTTC rbohF after the 1stth exon (290 bp)

pDdown-f CAACTAATACAGTAACCTTACGGGTGT -95 bp of RbohD promoter

pFdown-f TTCCACCAACCTATACATATACTTATA -97 bp from RbohF ATG

Gus_up-r CCTGGCACAGCAATTGCCCGGCT 146 bp from β-glucuronidase ATG

83 bp from Luciferase ATG Luc_up-r TTATGCAGTTGCTCTCCAGCGGT

DqRT3´-r GAACTTGAGACCTTTGAGTGCG PF:HA-D With pFdown (620 bp)

DRT5´-f GCCTCAACAACACCACCTCCT RbohD cDNA flanking 1st intron (455bp)

DRT3`-r TTTGTGATTGCATCGCCGGAG

FRT13th5´-f ATTGTTAAAATGGAAGAGCATGC RbohF cDNA before 13th intron (364bp)

FRT13th3´-r TCCAATTAGGTCTTGCAAAGTGTG

FRT1st3´-r CTCATCGTGATTGATTTTCTCTAC PD:HA-F With pDdown (943 bp)

YFP-f CACCATGGTGAGCAAGGGCGAGG eYFP-Agb1 (1085 bp)

AGB1-r CACACGCAACCGACTGACCATT

Table 2. Primers used to genotype the rboh mutant lines and the transgenic lines and Agrobacterium transformants generated in this study. Forward or reverse primers used are indicated as (-f) and (-r) respectively. From top to bottom, primers used to detect the transposon insertion in rbohD and rbohF mutatns (grey), the presence of the pD- or pF-GUS/LUC constructs (white), the promoter swap constructs (grey), and the YFP-Agb1 construct (white).

MATERIALS AND METHODS

DNA fragments were amplified by PCR using a homemade thermostable polymerase for genotyping or the Phusion Taq DNA polymerase (Thermo Scientific) for cloning procedures. PCRs were performed in a BIO-RAD thermal cycler in a final volume of 20 µl. The thermal parameters for PCR amplification during genotyping were: [94ºC (2´)] for denaturing nucleic acids, 37 cycles of [94°C (20´´), 57°C (30´´), 72°C (30´´ to 1´30´´)] and [72ºC (10´)] final termination. For visualization of DNA amplicons, PCR products mixed with Bromophenol-blue were stained with ethidium bromide and samples runned on a BIO-RAD sub-cell GT Cell horizontal electrophoresis apparatus on 1% agarose gels. Samples were visualized in a Gel Doc XR System (BIO-RAD) under the UV light.

3.7 Histology

To visualize H2O2 in situ, 3,3’-Diaminobenzidine (DAB, SIGMA) staining was performed by vacuum infiltrating leaves with 1 mg ml-1 DAB solution as described (Torres et al., 2002). Subsequently, the leaves were placed in a plastic box under high humidity until brown precipitate was observed (5-6 hours), and then fixed with a solution of 3:1:1 ethanol:lactic acid:glycerol.

Dead cells were visualized with a solution of lactophenol-trypan blue (TB) containing 10 gr of phenol, 10 ml of glycerol, 10 ml of lactic acid, 10 ml of distilled water, and 20 mgr of TB (SIGMA) as described (Slusarenko et al. 1991). Stock solution was diluted with ethanol 96% (1:2). Leaves were soaked and boiled for 2 minutes in this solution and cleared with saturated chloral hydrate solution.

Histochemical GUS staining was performed by vacuum infiltrating a GUS solution containing 50 µgr ml-1 X-glucuronide (Duchefa), 0.5 mM ferrocyanide, 0.5 mM ferricyanide, 10 mM EDTA, 50 mM phosphate buffer pH 7 and 0.1% Triton X-100, according to Jefferson et al. (1987). Tissues were kept at 37ºC during 16 hours and then cleared in 70% EtOH. Adult plant tissues were photographed with a Sony DSC-H20 digital camera. Seedlings were examined and photographed with an Olympus binocular stereo magnifying glass SZX9, and details of different tissues with a Zeiss Axiophot microscope.

3.8 Bacterial and fungal inoculation assays

7 -1 Four-week old plants were inoculated with 2,5 x 10 cfu x ml bacteria (OD600 = 0.05) using a 1 5 -1 ml syringe as described (Debener and Dangl, 2001) for histology assays, and 10 cfu x ml bacteria for bacterial quantification assays. Alternatively, for quantification assays and to allow the 7 -1 visualization of symthomps, Pto strains were sprayed at 5 x 10 cfu x ml concentration (0.1 optical density) following standard procedures (Zipfel et al., 2004).

For P. cucumerinai noculation assays, spore suspensions (4 x 106 spores ml-1 in sterile water) of the virulent isolate PcBMM or the non-adapted isolate Pc2127 were sprayed on Arabidopsis plants using 5 ml of the solution per 2 medium size pots (8x8 cm) or 5 little pots (5x5 cm: aprox .125 cm2 of soil). Inoculated plants were subsequently kept under high relative humidity as described (Sánchez-Rodríguez et al., 2009; Sánchez-Vallet et al., 2010). For histochemical

MATERIALS AND METHODS

stains and luciferase activity bioluminescence assays 4 weeks-old plants were inoculated, while evaluation of growth was carried out on 3 weeks-old plants.

3.9 Luciferase activity measurements

For in vivo quantification of Rboh-promoter driven luciferase activity during ETI, 2 leaves of 3 pD- LUC and pF-LUC 4 weeks-old transgenics were infiltrated with Pto DC3000(avrRpm1). Subsequently, plants were sprayed with a 0.5 mM solution of D-Luciferin (potassium salt; MELFORD). Luminescence produced either at the infiltrated area and by the whole plant rosette was measured every 15 minutes for a period of 10 hours with a Photek CCD camera (East Sussex, UK). Two different templates were used to detect luciferase activity either at the infiltrated leaves or in the whole plant rosette with the CCD camera. Local promoter activity values correspond to photon counts emitted by Pto DC3000(avrRpm1) relative to MgCl2 infiltrated leaves. To obtain systemic values, we first subtracted the photon counts emitted by infiltrated leaves with Pto DC3000(avrRpm1) from total photon counts emitted by the whole plant rosette from Pto DC3000(avrRpm1) infiltrated plants. These rosette-minus-leaves value was relativized to the systemic value from MgCl2 infiltrated plants.

Luciferase activity in response to P. cucumerina was quantified using a NightOWL LB 983 in vivo Imaging System (Berthold). Six fully expanded leaf areas of 135 mm2 from 4 pD-LUC and pF-LUC transgenics were measured per plant at 1, 2 and 3 days post inoculation. Measurements were taken every 30 minutes, 6 times each day. To monitor Rboh-promoter driven luciferase activity in response to flg22, 1 week old seedlings were cultivated on MS agar plates for 6 days, transferred to water in a 96 wells plate and keep overnight. Next day, water was exchanged for a solution containing 50 μM D-Luciferin and luminescence produced by pD-LUC and pF-LUC seedlings (n=8) was measured as relative light units with a TECAN plate reader over a period of 180 minutes.

3.10 PcBMM and Pc2127 fungal genomic biomass quantification

Quantification of fungal DNA relative to total plant genomic DNA was performed by quantitative PCR (qPCR) using as template genomic DNA extracted from infected and mock inoculated 3 weeks old plants (4 to 10 plants per genotype and condition) at 3 or 7 days post inoculation with PcBMM or Pc2127 respectively. The expression of the specific β-tubulin gene from the fungus was normalized to that of the Ubiquitin21 (At5G25760) housekeeping gene from Arabidopsis as described (Sanchez-Rodríguez et al., 2009; Sánchez-Vallet et al., 2010). Primers employed to amplify the P. cucumerina β-tubulin gene and Arabidopsis Ubiquitin21 are listed in table 3.

3.11 Chemical treatments

For abscisic acid (ABA) treatment pD-GUS and pF-GUS transgenic plants were grown 5 days on MS agar plates, transferred to liquid MS medium and kept 24 hours under agitation (150 rpm), before adding ABA diluted in MS to the following concentrations:0, 1,0 µM, 10 µM or 100 µM. The seedlings were harvested after 6 or 24 hours to perform GUS histochemical stains (6 to 10

MATERIALS AND METHODS

seedlings per treatment) or MUG fluorimetric assays. The same procedure was followed for PAMP treatment with 100 nM flg22, 100 nM elf18 or 10mg ml-1 chitin, harvesting pD-GUS and pF- GUS transgenics for GUS staining 30 minutes, 1 hour or 3 hours after treatment. For bioluminescence imaging pD-LUC and pF-LUC seedlings were treated with 500 nM flg22 before measurement. The flg22 and elf18 peptides were purchased from Peptron, chitin oligosaccharide from Yaizu Suisankagaku Industry and ABA from Duchefa.

3.12 RNA extraction

For total RNA extraction, 1 weekold seedlings were frozen in liquid N2 after treatments with flg22. Frozen samples were ground with a pre-chilled pestle to a fine powder and homogenized with 500 µl extraction buffer (0.2 M TRIS-HCl, 0.4 M LiCl, 25 mM EDTA and 1% SDS). Homogenates were mixed in a vortex and treated twice with phenol-chloroform (addition of 1 volume of phenol- chlorophorm and centrifugation for 5 minutes at 13000 rpm) followed by 1 chloroform treatment (addition of 1 volume followed by centrifugation for 2 minutes at 13000 rpm). The supernatant was mixed with 1/3 of its volume of LiCl 8M and kept on ice for 2 hours. Subsequently, samples were centrifuged for 30 minutes at 13000 rpm (4ºC), the supernatant was discarded and the pellet disoved in 300 µl of H2O. After addition of 30 µl AcNa 3 M and 600 µl ethanol 98%, RNA precipitation was carried overnight at -20ºC. The next day samples were centrifuged for 20´ at 13000 rpm (4ºC). Then, the supernatant was discarded and pellets were washed with 80% ethanol, air dried and resuspended in 30 µl steril water. RNA quality was checked in a 1.5% agarose gel and nucleic acid quantification of each sample was assessed using a NanoDrop ND- 1000 spectophotometer.

3.13 Gene expression analysis by quantitative real time PCR (qRT-PCR)

For Rboh gene expression analysis, RNA extractions were performed as described (Llorente et al., 2005). Total RNA extraction was performed from 20 in vitro cultivated 1 week-old Col-0 or agb1-2 seedlings treated for 90 minutes or untreated with flg22 500nM. 3 biological replicates were included in each experiment. For Rboh gene expression analysis by qRT-PCR, 10 ng of total RNA per sample were utilized with Brilliant III Ultra-Fast SYBR® 269 Green QRT-PCR Master Mix according to the manufacturer’s recommendations (Agilent Technologies, CA, USA) in a final volume of 16 µL. Assays were performed in triplicate on a LightCycler 480 II real-time PCR system (Roche, IN, USA). In order to quantify RbohD transcript accumulation in the various samples, the primers DqRT-f and DqRT-r (Penfield et al., 2006) were employed. For RbohF, the primers FqRT-f and FqRT-r were designed with Primer Express (version 2.0; Applied Biosystems). Reactions including no template and no reverse transcriptase were included in each trial. Thermal parameters for RT-PCR amplification were [65°C (3´) + 50°C (10´)] for reverse transcription [95°C (5´)] for denaturing nucleic acids and 45 cycles of [95°C (20´´), 60°C (30´´)]. At the end of each run, dissociation curves were generated to ascertain that only one single product was produced in each case. To normalize the Rboh transcript level in each sample and calculate de dCt value, the expression of the Ubiquitin10 gene was employed as endogenous control amplified, using the primers qUBQ10-f and qUBQ10-r (He et al., 2006). Data were presented as

MATERIALS AND METHODS

differences in fold change abundance of RbohD and RbohF transcripts before and after flg22 treatment compared to untreated control calibrator samples (Col-0 mock).

Primer Sequence 5´3´ Target region and amplicon size

Pc_b-tubulin-f GAAGAGCTGACCGAAGGGACC P. cucumerina β-tubulin Pc_b-tubulin-r CAAGTATGTTCCCCCGAGCCGT

Ubiquitin21-f GCTCTTATCAAAGGACCCTTCGG At5g25760 (101 bp) Ubiquitin21-r CGAACTTGAGGAGGTTGCAAAG

DqRT-f CGAATGGCATCCTTTCTCAATC At5g47910 (76 bp) DqRT-r GTCACCGAGAGTGCGGATATG

FqRT-f CTTGGCATTGGTGCAACTCC At1g64060 (159 bp) FqRT-r TCTTTCGTCTTGGCGTGTCA

qUBQ10-f AGATCCAGGACAAGGAGGTATTC At4g05320 (129 bp) qUBQ10-f CGCAAGGACCAAGTGAAGAGTAG

Table 3. Primers used for qPCR and qRT-PCR analysis.

3.14 Informatic resources and bioinformatic tools employed

ImageJ software U. S. National Institutes of Health, Bethesda, Maryland, USA, was used to perform stomatal aperture measurements. (http://imagej.nih.gov/ij/),

STATGRAPHICS Plus Version 5.1 standard edition software (2006) StatPoint, Inc., was employed for statistical analysis. (http://www.statgraphics.com/statgraphics_plus.htm)

The Arabidopsis Information Resource (TAIR) database, specifically the Seqviewr tool, was used to retrieve the genomic DNA sequences of RbohD, RbohF, Bik1 and Agb1. (http://tairvm09.tacc.utexas.edu/servlets/sv).

The website from Clemson University USA and the pseudomonas-plant interaction web site (PPI), were respectively employed to retrieve a picture of tomato infected fruits and Arabidopsis infected rossete. (http://www.forestryimages.org/search/index.cfm), ( http://www.pseudomonas- syringae.org/pst_ab_DC3000.html).

The CLUSTALW multiple sequence alignment on line software (EMBL-EBI), was used to perform different DNA or protein multiple sequence alignment of Rboh homologs and orthologues. http://www.ebi.ac.uk/Tools/msa/clustalw2/)

MATERIALS AND METHODS

The LaserGene (DNASTAR) software modules SeqBuilder, SeqMan Pro and MegAlign were respectively employed for: visualization and sequence editing, sequence assembly and sequence alignment.

The BLAST on-line database for sequence alignement was employed to test the specificity of the primers designed in this study. (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

The LASX software from Leica Microsystems CMS was used to analyse confocal microscopy images.

The DAS transmembrane prediction server, was employed to predict the length of the N-terminal region of RBOHD and RBOHF. (http://www.sbc.su.se/~miklos/DAS/). Additionally, the EXPASy TMpred Server (http://www.ch.embnet.org/software/TMPRED_form.html) was used to confirm this prediction.

Phylogenetic shadowing and cladogram

The 2 kb 5´UTR regions of RbohD and RbohF ortologues from five different species within the Brassicaceae family were retrieved from the Phytozome database (Goodstein et al., 2012; http://www.phytozome.net) and submitted to the mVISTA on-line tool for global pair-wise and multiple alignment of the promoters with the Multi-LAGAN program (Frazer et al., 2004; http://genome.lbl.gov/vista). Conserved DNA regulatory elements were identified using the rVISTA genomic on-line tool that makes predictions by the Match program based on TRANSFAC Professional 9.2 (Loots et al., 2002), and confirmed using MATinspector (Cartharius et al., 2005; Quandt et al., 1995, www.genomatix.de/online_help/help_matinspector). The CLC MAIN WORKBENCH program (Qiagen) was used to generate a multiple sequence alignment in order to visualize conserved immunity-related putative CIS-elements present in Rboh promoter sequences and to produce a phylogenetic tree using Neighbor joining as clustering method that was visualized using the FIGTREE software (tree.bio.ed.ac.uk/software/figtree/).

3.15 Transient expression and co-expression in N. benthamiana

Agrobacterium tumefaciens GV3101 strains carrying the genetic constructs under study were grown overnight in Luria-Bertani (LB) medium supplemented with Kn and Rif. Cultures were centrifuged and re-suspended in buffer containing 10 mM MgCl2, 10 mM MES pH 5.6 and to OD600=0.3, incubated for 3 h at room temperature (RT) and infiltrated into 3.5 or 4 weeks old N. benthamiana plants depending on the assay. Expression of tagged proteins was analysed 48 hours post infiltration.

For co-expression, Agrobacterium cells were grown, centrifuged and re-suspended as previously described but to an OD600=0.6. Afterwards resuspended Agrobacterium cells carrying the 2 genetic constructs under analysis were mixed and incubated for 3 h at RT prior to infiltration in 3,5 or 4 week-old N. benthamiana plants.

MATERIALS AND METHODS

3.16 Protein extraction, immunoprecipitation and co-immunoprecipitation

Protein extraction from Arabidopsis plant rosettes employed in the complementation analysis and from N. benthamiana leaves used for the trans-complementation assays was performed as described (Schwessinger et al., 2011), with minor modifications. Arabidopsis 4 weeks-old rosettes or N. benthamiana leaves were ground to fine powder in liquid nitrogen. Subsequently, 1 g of powder was weighted and incubated in 2 ml of protein extraction buffer for 1-2 hours. Arabidopsis extraction buffer was prepared using: 50 mM Tris-HCl pH 7.5; 150 mM NaCl; 10% glycerol; 5 mM

DTT; 2 mM EDTA; 1 mM NaF; 1 mM Na2MoO4. 2H2O; 1 mM PMSF (Sigma); 5 mM Na3VO4; 1% (v/v) P9599 protease inhibitor cocktail (Sigma); 2% (v/v) IGEPAL CA-630 (Sigma)]. For Nicotiana samples the extraction buffer was prepared using: 50 mM Tris-HCl pH 7.5; 150 mM NaCl; 10% glycerol; 10 mM DTT; 10 mM EDTA; 1 mM NaF; 1 mM Na2MoO4.2H2O; 1% (w/v) PVPP; 1% (v/v) P9599 protease inhibitor; 1% (v/v) IGEPAL CA-630. Samples were cleared by centrifugation at 16000 rpm for 15 min at 4°C and adjusted to 2 mg ml-1 total protein concentration.

Immunoprecipitation of total proteins from N. benthamiana samples was performed on 1.5 ml total protein by adding 30 µl anti-FLAG agarose beads (Sigma-Aldrich), and incubating at 4°C for 3–4 hours. Beads were washed 4 times with elution buffer [50 mM Tris-HCl pH 7.5; 150 mM

NaCl; 10% glycerol; 10 mM DTT; 10 mM EDTA; 1 mM NaF; 1 mM Na2MoO4.2H2O; 1% (v/v) IGEPAL CA-630]. Subsequently samples were incubated with FLAG peptide (Sigma Aldrich), to outcompete FLAG-tagged proteins binding to the beads, and spun down. The supernatant of immunoprecipitated samples was eluted with 50 µl 2x Laemli SDS buffer (LDS) and heated at 60°C for 10 min.

Alternatively, immunoprecipitation of total protein extracts was performed by fast magnetic immunoprecipitation with magnetic MicroBeads, conjugated to the anti-GFP monoclonal antibodies (µMACS™, Miltenyi). MicroBeads were incubated with the protein lysate and bound to the specific target protein. Protein samples were incubated for 2 hours with magnetic beads and then loaded onto a µMACS Column placed in the magnetic field of a µMACS Separator. The magnetically labeled epitope-tagged and associated proteins were retained in the column during the washing steps and eluted after addition of 30 µl 2x LDS.

3.17 SDS-PAGE and immunoblotting

SDS-gels were prepared with 10% cross-linking bis-acrilamide. Gels were run at 80/150 V and proteins electro-blotted onto PVDF membrane (Biorad) or Nitrocelulose membranes (Amersham) at 235 mA for 1 hour. Membranes were rinsed in TBS and blocked in 5% (w/v) non-fat milk powder in TBST 0.1% (w/v) for 1 hour.

For immunodetection of HA or FLAG tagged RBOH proteins, membranes were incubated for 2 hours at RT with antibodies diluted in blocking solution (5% non fat milk in TBS with 0.1% [v/v] Tween) at the different dilutions. 1:2000 anti-HA High Affinity (3F10 monoclonal antibody; Roche; primary antibody) followed by incubation with 1:5000 anti-rat IgG-horseradish peroxidase (HRP; secondary antibody) was used to detect HA tagged RBOH proteins. 1:2000 anti-FLAG

MATERIALS AND METHODS

HRP-conjugated (M2 monoclonal antibody, Sigma-Aldrich) was used to detect the FLAG-tagged RBOH proteins. In turn, 1:5000 anti-GFP HRP-conjugated (B-2 monoclonal antibody; Santa Cruz) was employed to detect YFP-tagged AGB1.

3.18 ROS burst assay

12 leaf discs from four 5 week-old Arabidopsis plants were sampled using a cork borer with a 4 mm diameter and floated overnight on sterile water. The following day the water was replaced with a solution of 17 mg ml-1 (w/v) luminol (Sigma) and 10 mg ml-1 horseradish peroxidase (Sigma) containing 200 nM flg22 for N. benthamiana or 100 nM flg22 for Arabidopsis discs. Luminescence was captured over 60 minutes using a Photek CCD camera or over 30 minutes using a TECAN Genius Pro multi-label counter plate reader (Beckman Coulter).

3.19 Electrolyte leakage measurements

Conductivity measurements were performed as described (Torres et al. 2002). Four week-old plants were injected with 2.5 × 107 cfu ml–1 of the avirulent P. syringae strain DC3000 (avrRpm1) in 10 ml MgCl2. Ten minutes after injection, 7.5 mm-diameter leaf discs were collected from the injected area and were washed extensively with water for 50 min. Then, four discs were placed in a tube with 6 ml of water. Four replicates were taken per genotype. Conductivity measurements were taken from the tubes over time with an Orion (Boston) conductivity meter, model 130. The units of this measurement are microsiemens per centimeter (µS cm–1).

3.20 Stomatal aperture measurements

2 leaf punches from five different 5 week-old plants were exposed to white light for 2 h while submerged in a solution containing 50 mM KCl, 10 mM CaCl2, 0.01% Tween 20 and 10 mM MES-KOH, pH 6.15, to induce stomatal aperture. Subsequently, 5 µM ABA or mock solution was added to the buffer, and the samples were incubated under the same conditions for 1 h as described in (Macho et al., 2012). Abaxial leaf surfaces were photographed with a microscope Zeiss Axiophot microscope using the 20x objective lens and 10x eyepiece. Stomatal aperture was measured using the width by length ratio of each stoma with the ImageJ software.

3.21 Statistical analyses

Differences in stomatal aperture, ROS production, fungal DNA levels and bacterial log number were analysed by one-way analysis of variance (ANOVA) using Arabidopsis genotype as factor, whereas differences in fold change abundance of Rboh transcripts or luciferase activity values where analysed using treatment as a factor. To determine whether values of analysed variables were significantly different among groups within each factor, the Bonferroni or the Less Significant Difference (LSD) post hoc test were employed depending on the assay analized. Since our data showed heterogeneity of variances, differences between genotypes were also analysed by tests that do not assume homocedastic data (Kruskal-Wallis test). Since both analyses rendered similar results, only one-way ANOVA is indicated as statistical analysis in the figures.

MATERIALS AND METHODS

3.22 Confocal microscopy assays

48 hours post infiltration with Agrobacterium, leaf discs from 3.5 weeks old N. benthamiana infiltrated leaves transiently expressing YFP-RBOHD or YFP-AGB1 were harvested and placed onto a glass slide with water prior to microscopic analysis. Confocal laser microscopy was performed using a Leica SP5 laser point scanning microscope. YFP was excited using the 488nm argon laser, and fluorescence emissions were captured between 500nm and 550nm for YFP.

RESULTS AND DISCUSSION

4. RESULTS AND DISCUSSION

RESULTS AND DISCUSSION

4.1 CONTRIBUTION OF RbohD and RbohF SPATIO-TEMPORAL EXPRESSION PATTERN TO THE REGULATION OF SPECIFIC ROS SIGNALING IN ARABIDOPSIS IMMUNITY

RESULTS AND DISCUSSION

4.1 INTRODUCTION

The Arabidopsis RbohD and RbohF genes and their functional orthologues in other plant species mediate pathogen-induced ROS production. Although several studies have shown that RBOHD and RBOHF perform specific signaling roles in plant immunity, genetic studies with double mutants indicate that these pleiotropic oxidases also synergize during the plant immune response (Marino et al., 2012; Suzuki et al., 2011; Torres et al., 2002). Important efforts have focused in understanding the regulation of RBOHD and RBOHF at the protein level. However, the elements that modulate the specificity of function of these oxidases are not fully understood.

The control of spatial and temporal generation of RBOH-dependent ROS has been proposed to be relevant to achieve the multiplicity of functions of these oxidases (Suzuki et al., 2011). In this regard, the analysis of gene spatio-temporal expression pattern, can contribute to understand the molecular mechanisms of gene activation, helping to identify novel roles of known genes and to decipher the regulation of biological processes controlled by multigenic families such as the Rboh family (Niehrs et al., 1999; Song et al., 2014; Valerio et al., 2004).

Previous Affymetrix microarray expression analysis in Arabidopsis indicated that different Rbohs, display distinctive tissue-specific transcript accumulation reflecting the Rboh- gene functional specialization. In these studies RbohD and RbohF expression was detected throughout the plant (Sagi and Fluhr, 2006). Contrary to the other Rbohs, RbohD is strongly induced by different stresses (Suzuki et al., 2011) exemplifying the relevance of its transcriptional regulation for the physiological response of the plant to different cues. Additionally, the activation of the SA, ET, JA and ABA signaling pathways, which are involved in the plant immune response, have been shown to influence RbohD gene expression (Bouchez et al., 2007; Devadas et al., 2002; Meng et al., 2013; Takahasi et al., 2011; Sagi and Fluhr 2004). Furthermore, pharmacological induction of the ET signaling pathway induced RbohD and to a lesser extent RbohF expression (Jakubowizh et al., 2010). This data strengthen the relevance of Rboh transcriptional regulation during the plant immune response.

Despite the current available data in public gene expression databases, the specific timing and level of RbohD and RbohF transcriptional activation in response to pathogens with different life-styles may contribute to determine the outcome of the plant immune response, and this information remains mostly unknown. We hypothesized that the differential RbohD and RbohF spatio-temporal gene expression pattern, regulated by their promoters, can modulate the specificity of action of these NADPH oxidases in different events of the plant immune response.

In this work, we explored the expression pattern of RbohD and RbohF during different events of the Arabidopsis immune response. In order to achieve this goal, we generated transgenic lines with RbohD and RbohF promoters fused to either the β-glucuronidase (GUS) or the luciferase reporter genes. These transgenic lines were used to reveal the spatio-temporal expression pattern and promoter activation level of these genes, in different tiers of the plant immune response and after infection with two pathogens with a distinctive mode of action: the

RESULTS AND DISCUSSION

hemibiotrophic bacteria Pseudomonas syringae pv. tomato (Pto) DC3000 and the necrothrophic fungus Plectosphaerella cucumerina (Pc). In addition, we tested the promoter activation of RbohD and RbohF in response to PAMPs and the defense-related phytohormone ABA. Furthermore, following a promoter-swap strategy, we explored the relevance of the promoter region of these genes to determine specific ROS production during the Arabidopsis immune response. Our results exemplify the complex regulation of multigenic families to achieve many specialized physiological functions using a common enzymatic mechanism.

RESULTS

4.1.1 RbohD and RbohF promoters drive reporter gene expression to different tissues during Arabidopsis development

We sought to determine whether RbohD and RbohF present a differential tissue-specific expression pattern that could modulate ROS-signaling at a certain moment, in a specific region, or in response to developmental and immunity related cues. Thus, we generated transgenic Arabidopsis (Col-0) plants (Table 1), harboring genetic constructs consisting of fusions between the RbohD (pD) and RbohF (pF) promoters with the β-glucuronidase (GUS) or the firefly Luciferase (LUC) reporter genes.

A promoter RbohD GUS NOS

PRbohD::GUS (pD-GUS) 1877 bp 1809 bp

promoter RbohF PRbohF::GUS (pF-GUS) 2002 bp 1 kb B LUC

PRbohD::LUC (pD-LUC) 1652 bp

PRbohF::LUC (pF-LUC)

Figure 1. Schematic representation of the genetic constructs with Rboh promoter fused to reporter genes generated in this study. (A) Diagrams depicting promoter RbohD and RbohF fusions to the β- glucuronidase (GUS) gene (pRbohD::GUS and pRbohF::GUS) for simplicity transgenic lines with this constructs were named pD-GUS and pF-GUS respectively. (B) Promoter RbohD and RbohF fusions to the luciferase reporter gene (pRbohD::LUC and pRbohF::LUC). The size of the Rboh promoter DNA fragments and that of the reporter genes is indicated in base pairs (bp) below the diagrams. For cloning and genetic constructs generation procedures see the materials and methods section.

RESULTS AND DISCUSSION

For the RbohD promoter, we used the 1877 bp region covering the intergenic region between the ATG translation initiation codon of RbohD (At5g47910) and its preceding gene At5g47900 in the Arabidopsis genome. For the RbohF promoter, we selected the 2002 bp region upstream of the ATG also including the initiation codon (Figure 1). Several homozygous lines harboring each construct were identified (Table 1; see methodology section for details on the selection procedure to obtain these lines). Lines displaying representative pattern of stain (Figure 2) were chosen to continue with the forthcoming experiments.

Rboh promoter-GUS Rboh promoter-LUC

Construct and Construct and Transgenic line line name Transgenic line line name

1472b A7.1 pD-GUS-1 6365 A1.2 pD-LUC-2

1472b A9.2 pD-GUS-2 6365 A1.4 pD-LUC-4

1472b C2.3 pD-GUS-11 6365 A1.5 pD-LUC-5

1472b B3.3 pD-GUS-12 6365 A3.3 pD-LUC-8

1472b B4.3 pD-GUS-13 6365 A3.4 pD-LUC-9

1482b B4.1 pF-GUS-3 6365 C2.1 pD-LUC-10

1482b A1.1 pF-GUS-4 6377 B4.1 pF-LUC-1

1482b A5.2 pF-GUS-5 6377 E1.1 pF-LUC-2

1482b A6.2 pF-GUS-6 6377 E1.2 pF-LUC-4

1482b A9.2 pF-GUS-7 6377 E2.1 pF-LUC-3

1482b B1.1 pF-GUS-8 6377 E2.2 pF-LUC-5

1482b B2.1 pF-GUS-9 6377 E3.1 pF-LUC-6

Table 1. Homozigous Arabidopsis transgenic lines with Rboh-promoter GUS or Rboh promoter LUC genetic constructs generated in this work. Shadowed lines displaying representative staining were employed to perform the assays in this study.

We performed a detailed GUS histochemical staining with pD-GUS and pF-GUS lines throughout different stages of Arabidopsis development (Figure 2). pD-GUS plants displayed a high level of expression in roots and aerial parts of seedlings, whereas pF-GUS showed a lower expression level in this stage, often restricted to the plant vessels.

RESULTS AND DISCUSSION

pD-GUS pF-GUS Figure 2. RbohD and RbohF present a differential spatial expression pattern during Arabidopsis development. GUS histochemical staining of pRbohD::GUS transgenic plants (pD- GUS; left) and pRbohF::GUS plants (pF-GUS; A B right). (A, B) 6 day-old seedlings; (C, D) secondary root emerging zone. (E, F) 4 week- old leaves; (G, H) mesophyll and vasculature from 4 week-old leaves; (I, J) abaxial leaf epidermis; arrowheads highlight several stomata; (K, L) inflorescences and siliques of 6 C D week-old plants; (M, N) detail of the basal region of the siliques. Bar size equals 100 μm in C, D, G and H, 2 mm in A, B, M, N and 25 μm in I and J. Six plants per line were analyzed. Representative samples are shown.

E F

G H

I J

K L

M N

RESULTS AND DISCUSSION

Interestingly, in roots, β-glucuronidase activity driven by pD-GUS appears widespread through most tissues including root hairs, while pF-GUS expression is mostly restricted to areas where secondary roots develop (Figure 2 C-D). In leaves from four week-old plants, the RbohF promoter also drives GUS expression to vascular tissues and hydatodes, while the RbohD promoter directs GUS expression to disperse areas of the leaf lamina, the petiole (Figure 2 E-H) and to many stomatal guard cells. In the inflorescence, RbohF promoter activity is localized at the basal part of the pedicel of siliques, whereas RbohD promoter drives a lower GUS expression in these areas (Figure 2 K-N). These analyses revealed that the promoter of RbohD drive specifically the expression of the GUS reporter gene to different tissues than the promoter of RbohF during Arabidopsis development.

4.1.2 RbohD and RbohF promoters display a differential activation in response to Pto DC3000

We next studied if pD and pF determined a differential transcriptional regulation of this RBOH-NADPH oxidases during the plant interaction with phytopathogenic bacteria, and if this expression correlated with the modulation of ROS production and cell death at different stages of the immune response. The spatial and temporal pattern of GUS expression was examined in pD-GUS and pF-GUS lines after infiltration with different strains of the hemibiotrophic bacterial pathogen Pto DC3000. In parallel, we monitored H2O2 accumulation and cell death in the infiltrated leaves by diaminobenzidine (DAB) and Trypan Blue (TB) stains, respectively (Figure 3A). After infiltration with the avirulent Pto DC3000(avrRpm1; Grant et al., 1995), which activates ETI, a strong RbohD promoter activity was detected spatially matching the areas where a massive accumulation of peroxides occurs and cell death takes place. Meanwhile, RbohF was slightly induced at the leaf vasculature. However, infiltration with the virulent strain Pto DC3000 that leads to a compatible interaction with absence of ROS production and cell death at the initial stage of infection, a mild activation of both Rboh promoters was observed. A similar weak activation was detected after a challenge with the Pto DC3000 hrcC (hypersensitive response and pathogenicity conserved) mutant strain (Colmer et al., 2000), which lacks a functional type III secretion system for the secretion of virulence factors into the plant cell and activates PTI responses. Activation of PTI responses after Pto DC3000 hrcC inoculation produced just a mild accumulation of H2O2 and no cell death was detected by TB stain. Thus, strong activation of the RbohD promoter parallels high level of ROS production and cell death during ETI.

To monitor in vivo the promoter activity of both Rboh and to determine their time-course and spatial expression during ETI, the promoter-luciferase transgenic lines were challenged with Pto DC3000(avrRpm1). Interestingly, we detected a biphasic wave of luminescence after infiltration (Figure 3B). However, MgCl2 infiltrated pD-LUC and pF-LUC plants also exhibited the first peak of promoter activity. Therefore this initial activation was probably derived from the infiltration process, where small tissue damage might have occur. However, Pto DC3000(avrRpm1) infiltrated plants, displayed a second wave of RbohD promoter activity that

RESULTS AND DISCUSSION

takes place between 4 and 7 hpi, reaching the highest expression level between 5 and 6 hpi. This wave of luminescence was absent in mock inoculated plants. Furthermore, a similar biphasic trend was observed in pF-LUC transgenic lines, although RbohF promoter activity was around 8-fold lower than that of RbohD (Figure 3B).

A B DC3000 DC3000

2 (avrRpm1) hrcC MgCl DC3000 pD-LUC activity 3 18 16 DC3000(avrRpm1) MgCl 14 2

12 plant x plant 10 10 8 pD-GUS 6 4 2

hpi

Photon Photon per counts 4 4

Minutes after infiltration

pF-GUS

3 pF-LUC activity 6 DC3000(avrRpm1) 5 MgCl2 plant x10 plant 4

DAB 3

hpi 0

9 9 Photon Photon per counts

TB Minutes after infiltration

Figure 3. RbohD and RbohF expression pattern in different layers of Arabidopsis immune response to Pto DC3000. (A) Histochemical stains of leaves from 4 week-old plants after infiltration with 2.5 × 107 CFU.ml–1 of different Pto strains: DC3000(avrRpm1), DC3000 hrcC, virulent DC3000 or 10 mM

MgCl2. GUS stain on pD-GUS and pF-GUS plants 4 hpi, DAB stain on Col-0 plants 4 hpi; and TB stain on Col-0 plants 9 hpi are shown. (B) In vivo quantification of luciferase activity detected in 4 week-old pD-LUC

and pF-LUC transgenic lines after infiltration with DC3000(avrRpm1) or MgCl2. Bars represent the mean (± SE) of total photon counts emitted by the rosettes of 3 plants with 2 infiltrated leaves per treatment. Note that Y axis in the RbohF promoter activity graphic is 3 times smaller than that in RbohD. These different Y axis values were employed to ease the visualization of the induction in RbohF promoter activity in response to Pto DC3000(avrRpm1).

To test if inoculation with the avirulent bacteria caused a systemic induction of Rboh genes in parallel to the local induction observed by GUS staining, the luminescence generated

RESULTS AND DISCUSSION

in the two inoculated leaves (local) was separated from the luminescence detected in the rest of the rosette outside the infiltrated area (Figure 4).

A Infiltrated leaf (local) B Rest of the plant rosette (systemic) pD-LUC pD-LUC 8 8

*** DC3000(avrRpm1) 3 3 7 7 DC3000(avrRpm1) MgCl2 MgCl 6 2

x 10 6 5 5 4 4 counts 3 3 2 2

1 1

photon 10 counts photon x photon 0 0 30 60 120 180 240 300 360 420 480 540 600 30 60 120 180 240 300 360 420 480 540 600 Minutes after infiltration Minutes after infiltration

pF-LUC pF-LUC 4 4

DC3000(avrRpm1) DC3000(avrRpm1)

3 3 MgCl2 MgCl2

3 3 x 10

2 2 counts 1 1

*** photon 0 10 counts photon x 0 30 60 120 180 240 300 360 420 480 540 600 30 60 120 180 240 300 360 420 480 540 600 Minutes after infiltration Minutes after infiltration

C Fold change in promoter activity pD-LUC pF-LUC 5 hpi Pto DC3000(avrRpm1) Local 4.33 + 1,63 2.57 + 0,34

Systemic 1.17 + 0,12 1.03 + 0,025

Figure 4. Local and systemic RbohD and RbohF promoter activity in response to avirulent

bacteria Pto DC3000(avrRpm1). (A) Local In vivo quantification of luciferase activity detected in leaves 7 . –1 from 4 week-old pD-LUC and pF-LUC transgenic lines after injection of 2.5 × 10 CFU ml Pto DC3000

(avrRpm1) or 10 mM MgCl2. Bars represent the mean (± SE) of total photon counts emitted by 6 infiltrated leaves from 3 different plants per treatment. (B) Systemic luciferase activity detected outside the infiltrated area in the plants analyzed in (A). Note that the Y axis in the RbohF promoter activity

graphic is 3 times smaller than the one for RbohD. (C) Fold change values in RbohD and RbohF promoter driven luciferase activity 5 hpi with DC3000(avrRpm1) relative to MgCl at infiltrated leaves 2 (Local) or at the rest of the plant rosette (Systemic). Data represent the means of 3 independent experiments + SE.

In local leaves, the comparison of the promoter activities between the leaf area infiltrated with Pto DC3000(avrRpm1) and the MgCl2 infiltrated control leaves 5 hpi, revealed a change of about 4.3 and 2.6-fold in RbohD and RbohF promoter activity respectively (Figure

RESULTS AND DISCUSSION

4A-C). However, in systemic non-infiltrated tissues no statistically significant Rboh induction derived from avirulent bacteria inoculation was detected (Figure 4B-C). Thus, a local induction of RbohD and RbohF transcription occurs between 4 to 7 hours after infiltration with Pto DC3000(avrRpm1), with RbohD promoter activity being around 8 times stronger than that of RbohF.

4.1.3 RbohD and RbohF promoters determine a differential expression pattern during Arabidopsis immune response to the necrotrophic fungus P. cucumerina

We sought to ascertain the Rboh spatial-temporal expression pattern and level of promoter activity in response to necrothophic pathogens. We sprayed pD-GUS and pF-GUS plants with spore suspensions from the Pc virulent isolate BMM (PcBMM). Histochemical GUS staining revealed that RbohD promoter activity is strongly up-regulated in leaves during the infection

process, following a pattern that spatially matches the areas of the leaf lamina where H2O2 accumulated (monitored by DAB stain) and cell death takes place (TB stain; Figure 5). In addition, an increase in pF activation was observed mostly associated to leaf veins.

PcBMM Pc2127

Mock 24h 48h 72h Mock 24h 48h 72h

pD-GUS

pF-GUS

DAB

Figure 5. Spatio-temporal expression pattern driven by pRbohD and pRbohF during Arabidopsis interaction with P. cucumerina isolates PcBMM and Pc2127. Histochemical staining (1, 2 and 3 dpi) of 4 week-old plants sprayed with 4 x 106 spores ml-1 of the virulent isolate PcBMM (left) and the non- adapted isolate Pc2127 (right). From top to bottom: GUS stain on pD-GUS and pF-GUS plants, DAB stain on Col-0 plants and TB stain on Col-0 plants.

RESULTS AND DISCUSSION

To further underpin if the up-regulation in Rboh expression was derived only from the necrosis process, we monitored GUS activity in plants sprayed with Pc2127 spores. Pc2127 is a Pc isolate that colonizes Viola spp in nature but is unable to successfully colonize Arabidopsis. Interestingly, GUS activity was induced in pD-GUS plants while ROS accumulation was lower than in response to PcBMM and no macroscopic cell death was observed (Figure 5-right). These results suggest that induction of RbohD expression could also be triggered by molecular determinants present in this non-adapted microbe recognized by the plant. However, no RbohF promoter-driven luciferase activity was observed in response to this isolate, suggesting that RbohF transcriptional activation seems to be more associated with the necrosis process.

A 1 dpi 2 dpi 3 dpi pF-LUC pD-LUC pF-LUC pD-LUC pF-LUC pD-LUC

Mock

Pc2127

PcBMM

B c*

4 30 pD-LUC Mock

x 10 25 pD-LUC Pc2127 20 pD-LUC PcBMM * 15 d * b pF-LUC Mock 10 c* pF-LUC Pc2127 5 * c* * b* bc ab a a a a ab* a a ab a a pF-LUC PcBMM Photons per second 0 1dpi 2dpi 3dpi

Figure 6. Level of RbohD and RbohF promoter activity during Arabidopsis interaction with P. cucumerina isolates PcBMM and Pc2127. (A) In vivo bioluminescence generated by 4 week-old pD-LUC and pF-LUC transgenic plants sprayed with PcBMM and Pc2127 (4 x 106 spores ml-1) or mock-treated. (B) Quantification of Rboh-promoter driven luciferase activity. Bars represent means (+ SE) of photons per second emitted by 135 mm2 areas from plant leaves shown in (A) and from plant leaves measured on a second repetition of the assay (n=12). Statistical analysis for each time point was performed by analysis of variance (ANOVA) 5%, corrected with LSD post hoc test. Letters indicate groups with homogenous means, asterisks indicate statistically significant differences compared to mock.

We also explored in vivo the pattern and level of LUC expression driven by RbohD and RbohF promoters, during Arabidopsis interaction with the PcBMM isolate (Figure 6A-B). After

RESULTS AND DISCUSSION

fungal inoculation, expression driven by RbohD promoter was already upregulated at 24 hours and increased to higher levels during the progression of the infection. Interestingly, RbohD promoter activity extended from the areas of fungal growth through the petiols reaching the whole plant rosette. By contrast, LUC activity driven by RbohF was just limited to local, infected areas of leaves and mainly detected at later time points. Furthermore, we tested the promoter activity in response to inoculation with the non-adapted isolate Pc2127. We found that LUC activity in pD-LUC plants was lower than that observed after inoculation with PcBMM, and that just a very weak, localized LUC activity was detected in pF-LUC plants. Hence, the level of Rboh promoter activity, mainly that of RbohD, parallels the amount of ROS and cell death that occurs in these two plant-fungal interactions.

4.1.4 Loss of RbohD and RbohF function alters non-host resistance to the non-adapted Pc2127 fungal isolate

The upregulaton of the RbohD promoter in response to Pc2127 suggested a physiological role for ROS produced by this oxidase in the establishment of the non-host defenses. Thus, we inoculated rbohD and rbohF single and double mutants with Pc2127 (Figure 7).

A rbohD cyp79b2 Col-0 rbohD rbohF rbohF cyp79b3

Mock

Pc2127

B 9

8 b 0 - 7 6 5

fold abundance abundance fold - 4 n

3 a relative to Col to relative 2 a a

PcBtub 1 0 ColCol-0-0 rbohD rbohF rbohD rbohF Figure 7. The double mutant rbohD rbohF shows weakened non-host resistance to P. cucumerina

non-adapted isolate Pc2127. (A) Symptoms of 3 weeks-old wild-type Col-0 plants compared to those of the listed mutant genotypes, at 7 dpi with Pc2127. (B) Quantification of Pc2127 biomass by q-PCR at 7 dpi. Primers specific for β-tubulin from the fungus and ubiquitin from Arabidopsis were used. Bars represent averages (+ SE) of fungal DNA levels relative to Col-0 plants from one of two independent repetitions of the assay. Statistical analysis was performed by ANOVA 5%, corrected with LSD post hoc test.

RESULTS AND DISCUSSION

As a negative control we employed wild-type Col-0 plants that are fully resistant. As susceptibility control, we used the double cyp79b2 cyp79b3 mutant altered in the biosynthesis of indole-glucosinolates. This mutant can be infected by Pc2127 and other Pc isolates non- adapted to Arabidopsis (Sánchez-Vallet et al., 2010). The rbohD rbohF plants displayed at 7 dpi more macroscopic disease symptoms and supported enhanced fungal growth, quantified by q- PCR, than wild-type Col-0 plants. However, the single mutants did not show a susceptibility phenotype. Due to the high fungal growth supported by the cyp79b2 cyp79b3 plants, the quantification of fungal biomass in these mutants is not shown. This is to ease the visualization of the differences in fungal growth supported by rbohD rbohF plants compared with Col-0 and the single mutants. These results demonstrated that RbohD and RbohF are necessary for full non-host resistance to the non-adapted isolate Pc2127.

4.1.5 PAMPs and ABA differentially modulate Rboh promoter activity

Since RbohD and RbohF promoters are activated during the Arabidopsis immune response to avirulent Pto and Pc, we wanted to address if individual bacterial or fungal PAMPs play a role in Rboh transcriptional up-regulation upon pathogen challenge. We tested the impact of 3 different PAMPs: flg22, elf18 and chitin (Figure 8A), at concentrations previously used in other studies (Lozano-Durán et al., 2013; Schwessinger et al., 2011). The analysis of promoter- GUS fusions revealed that RbohD was notably up-regulated by these three PAMPs, whereas RbohF promoter activity remained unaltered compared with mock treated plants.

Quantification using luciferase lines revealed that RbohD promoter activity started around 15 minutes after treatment with flg22, reaching a maximum activity at 1-1.5 hours (Figure 8B). These results were confirmed by qRT-PCR expression analysis of endogenous RbohD and RbohF in seedlings (Figure 8C). Based on the time course activation of RbohD promoter activity, samples were taken 1.5 hours after flg22 treatment. These data fits with the known role of RbohD in early immune signaling (Zhang et al., 2007). Moreover, our resuts indicate that in addition to its activation at the protein level, the transcriptional activation of RbohD might be relevant for the full immune response to a pathogen threat.

Additionally, we wanted to test if increased levels of ABA impact Rboh gene expression. ABA is generated in the plant tissues upon infection with PcBMM, and plays a capital role in the modulation of the plant immune response to necrotrophic fungi (Denancé et al., 2013; Sánchez- Vallet et al., 2012). Therefore we subjected pD-GUS and pF-GUS 1 week-old seedlings to 1, 10 or 100 μM ABA treatment (Figure 9). While no significant changes in GUS expression driven by the RbohD promoter were observed after 6 hours exposure to ABA, a 24 hours exposure to the phytohormone caused a significant decrease in RbohD promoter activity. On the contrary, RbohF was significantly up-regulated in the main root after ABA treatment. The differential regulation of RbohD and RbohF promoter activity detected by GUS stains, points out towards a possible role for the ABA signaling pathway in the control of the transcription and the function of these oxidases.

RESULTS AND DISCUSSION

A pD-GUS pF-GUS 30 mpt 60 mpt 180 mpt 30 mpt 60 mpt 180 mpt

Chitin 1 mg/ml

flg22 100 nM

elf18 100 nM

Mock

B C 325 RbohD RbohF 6 6 275 pD-LUC mock * Mock 5 5 225 pD-LUC flg22 flg22 4 4 175 pF-LUC mock 125 3 3

RLUs pF-LUC flg22

75 2 2 fold fold expression

25 -

n 1 1 -25

0 0 0

105

120

135 150 165 Col-0 Col-0 Minutes after PAMP treatment

Figure 8. RbohD but not RbohF promoter activity is induced by fungal and bacterial PAMPs. (A) GUS histochemical staining of pD-GUS and pF-GUS in one week-old seedlings at 30, 60 or 180 minutes post treatment (mpt) with the PAMPs chitin, flg22 and elf18 at the concentration shown on the left of the panel. (B) Time course assay showing luciferase activity driven by RbohD or RbohF promoters in 1 week- old seedlings during 165 mpt with 500 nM flg22. Each time point represents the mean luminescence generated by 8 seedlings shown in Relative Light Units (RLUs). (C) Endogenous RbohD and RbohF expression 90 mpt after 500 nM flg22 treatment in 1 week-old Col-0 seedlings normalized using Ubiquitin10 gene as endogenous control. Bars represent n-fold relative expression of the indicated genes after flg22 treatment relative to the calibrator sample (Col-0 mock), with the value in Col-0 mock plants set to one. Data represent the means of three biological replicates (mean ± SE). Asterisk indicates statistically significant differences (Welch Student two sample t-test) p-value < 0.05.

RESULTS AND DISCUSSION

6 hours treatment 24 hours treatment

pD-GUS pF-GUS pD-GUS pF-GUS

Mock

1 μM

ABA 10 μM

100 μM

Figure 8. RbohD and RbohF display a differential promoter activity in response to the defense-

related phytohormone ABA. GUS histochemical staining of 6 day-old pD-GUS and pF-GUS seedlings treated and untreated for 6 or 24 hours with ABA. From top to bottom the following treatments were applied; water (mock), 1 μM, 10 μM and 100 μM ABA. 6 seedlings where stained per time point and condition. Representative samples are shown. Bar scale= 2 mm for all treatments.

4.1.6 RbohD and RbohF promoters differentially modulate the spatial pattern of ROS production during Arabidopsis response to P. cucumerina

To assess the role that the RbohD and RbohF promoters have in the determination of the functional specificity of these oxidases, we evaluated the capability of Rboh promoter-swap constructs to complement the rbohD mutant phenotype in response to necrotrophic PcBMM. We first generated the following Rboh own-promoter and promoter-swap, HA-tagged constructs: pRbohD::HA::RbohD (pD-HA-D), pRbohD::HA::RbohF (pD-HA-F), pRbohF::HA::RbohD (pF-HA- D) and pRbohF::HA::RbohF (pF-HA-F; Figure 10). These constructs were transformed into rbohD Arabidopsis mutant lines and homozygous lines were obtained (Table 2). The expression of the HA-tagged RBOH proteins was checked by immunodetection using an anti-HA antibody. Intriguingly, in all the analyses and regardless of the promoter, the accumulation of HA-RBOHF in our expression assays was remarkably lower than that of RBOHD tagged proteins (Figures 11A-C and 12B).

RESULTS AND DISCUSSION

RbohD cDNA promoter RbohD PRbohD::HA::RbohD (pD-HA-D) 1877 bp 2726 bp 1 kb

PRbohF::HA::RbohD (pF-HA-D) 2002 bp 1xHA

RbohF cDNA

PRbohD::HA::RbohF (pD-HA-F) 2835 bp

promoter RbohF PRbohF::HA::RbohF (pF-HA-F)

Figure 10. Diagram of the promoter-swap genetic constructs generated in this study. Schematic representation of RbohD and RbohF own and promoter-swap constructs generated in this study. From top to bottom: own promoter, 1xHA tagged RbohD (pRbohD::HA::RbohD); RbohF promoter, 1xHA tagged RbohD (pRbohF::HA::RbohD); RbohD promoter, 1xHA tagged RbohF (pRbohD::HA::RbohF); own promoter, 1xHA tagged RbohF (pRbohF::HA::RbohF). The size of the Rboh promoter fragments and the cDNAs is indicated in base pairs (bp) below the diagrams. For cloning and genetic constructs generation procedures see the materials and methods section.

pRbohD::HA::RbohD pRbohD::HA::RbohF pRbohF::HA::RbohD pRbohF::HA::RbohF

pD-HA-D #1 pD-HA-F#1 pF-HA-D#1 pF-HA-F#1

pD-HA-D #2 pD-HA-F#2 pF-HA-D#2 pF-HA-F#2

pD-HA-D #3 * pD-HA-F#3 pF-HA-D#3 pF-HA-F#3

pD-HA-D #4 pD-HA-F#4 * pF-HA-D#4 pF-HA-F#4 *

pD-HA-D #5 pD-HA-F#5 pF-HA-D#5 pF-HA-F#5

pD-HA-D #6 pD-HA-F#6 pF-HA-D#6 pF-HA-F#6

pD-HA-F#7 pF-HA-D#7

Table 2. Homozygous Arabidopsis transgenic lines with Rboh-own promoter and promoter-swap genetic constructs in rbohD genetic background generated in this work. (A) Summary of own- promoter and promoter-swap transgenic lines. Selection of transgenic lines was performed based on the

complementation of H2O2 accumulation 24 and 48 hpi with PcBMM detected by DAB staining. Lines in shadowed squares complemented the lack of ROS production in rbohD mutant background. * indicates loss of resistance to kanamycin in the selection process.

RESULTS AND DISCUSSION

A B

F#2

F#3

F#4

D#3

F#3

D#2

F#2

D#2

D#3

D#4

Empty

Col

pF pD

anti 100 HA kDa

24 hpi PcBMM 24 hpi PcBMM CBB

F#1

D#1

D#2

D#3

F#1

D#2

Col

pD pD + - + - + - + - + - + - + -

100 kDa

Pto DC3000(avrRpm1)

Figure 11. Detection of HA-tagged RBOH proteins by western-blot in several promoter-swap transgenic lines. (A, B) Immunodetection of the recombinant HA-tagged RBOH proteins with anti-HA antibody in different 4 week-old own-promoter and promoter-swap lines, 24 hpi with PcBMM. (C) Immunodetection of HA-RBOH proteins with anti-HA antibody in 5 week-old plants, 5 hpi with Pto DC3000(avrRpm1). In this experiment immunoprecipitation of total proteins was carried out using anti-HA agarose beads before western blotting, Molecular mass is written in kilodaltons (kDa).

To test the complementation of the rbohD phenotype, 4 week-old transgenic plants in rbohD mutant background were sprayed with a suspension of PcBMM spores. Subsequently, leaves from these plants were stained with DAB 24 hpi to detect RbohD-dependent H2O2 accumulation. Only constructs harboring the RbohD structural part of the gene under the control of RbohD promoter were able to restore H2O2 production in response to the necrotrophic fungus

(Figure 12A). Transgenic lines harboring RbohF promoter driving RbohD did not restore H2O2 accumulation in rbohD mutant background, suggesting that the differential pattern and level of expression driven by the RbohD promoter is important for the accurate production of ROS in response to pathogens. On the other hand, RbohF under the control of RbohD promoter was unable to complement ROS production in rbohD mutant background. Thus, differential regulation and/or differences in stability between RBOHD and RBOHF at the protein level might also play a key role in the specification of ROS production by different isoforms of the plant NADPH oxidase in the context of the defense response.

RESULTS AND DISCUSSION

pD-HA-D pD-HA-F pF-HA-D pF-HA-F Col-0 #1 #2 #1 #4 #1 #3 #1 #3

rbohD

pD-HA-D pD-HA-F pF-HA-D pF-HA-F Col-0 #2 #4 #3 #3

rbohD

D#2

F#1 F#4

F#3

D#3

- -

HA HA

- -

Col

pD pD pF

100 kDa anti-HA

24 hpi PcBMM

CBB

Figure 12. Functional complementation of the rbohD mutant in ROS production after PcBMM inoculation. (A) Complementation of H2O2 accumulation 24 hpi with PcBMM by Rboh promoter-swap constructs in rbohD mutant background. H2O2 accumulation was detected by DAB staining in leaves from

4 week-old wild-type Col-0, rbohD and HA-tagged promoter-swap transgenic plants: pRbohD-HA-

RBOHD (pD-HA-D), pRbohD-HA-RBOHF (pD-HA-F) and pRbohF-HA-RBOHD (pF-HA-D). Below, microscopic details of H2O2 accumulation at the leaf lesions derived from PcBMM infection are shown; scale bar 500 µM. (C) Immunodetection by western blot of HA-RBOH proteins using anti-HA antibody. Total protein extraction was performed from 4 weeks-old own-promoter and promoter-swap transgenic plants 24 hpi with PcBMM. Molecular mass is written in kDa. CBB: Comassie Brilliant Blue.

RESULTS AND DISCUSSION

4.1.7 Prediction of common and distinct potential cis-regulatory DNA elements in RbohD and RbohF promoters

To further explore the specific transcriptional regulation of RbohD and RbohF during pathogen response, we searched in silico in the promoter sequences of both genes for putative cis- regulatory DNA elements (CREs) with a known biological function in response to pathogens. We followed a “phylogenetic shadowing” approach, based on the rapid evolutionary divergence of non-coding promoter sequences of orthologous genes, except for those sequences that are important to regulate a conserved function among them. This procedure consists in a comparison of the promoter sequences of orthologous genes from related species to find conserved non-coding elements, which might be important for gene expression control (Cliften et al., 2001; Boffelli et al., 2003; Hong et al., 2003; Iglesias et al., 2013). Phylogenetic shadowing was performed using the 2 kb 5´UTR sequences of RbohD orthologues of the Brassicaceae species Arabidopsis lyrata, Brassica rapa, Capsella rubella and Thellungiella halopila. Sequences obtained from the Phytozome database were submitted to the mVISTA program tool (Frazer et al., 2004) for global pair-wise and multiple alignments. This comparison was also performed with the corresponding five RbohF orthologous genes.

Conserved blocks among RbohD and RbohF promoter regions respectively are shown in grey. Two highly conserved regions among the promoter cluster of RbohD orthologous genes were identified (Figure 13A; left). The first one spans from -280 to -450 bp and the second one from -700 to -820 bp upstream of the ATG. This second block is not conserved in B. rapa, although it is highly conserved among the other four Brassicacea species and was thus, considered for the post-hoc search of immunity-related CREs. The RbohF promoter comparison revealed two highly conserved blocks spanning from -40 to -190 bp and -900 to -1100 bp, respectively (Figure 13A; right). Subsequently, we searched for the presence of conserved potential immunity-related transcription factor binding sites in either RbohD and/or RbohF orthologous gene groups. Using Arabidopsis RbohD or RbohF promoter sequences as references, we submitted the pair-wise comparison alignments to the rVISTA program (Loots et al., 2002), finding putative transcription factor binding sites in each group of sequences. Only potential CREs present in the five Brassicaceae species were considered. A sequence alignment of the specific promoter sequences where the conserved predicted CREs were found is shown in Figure 13B.

Additionally, a cladogram representing the phylogenetic relationships of the Rboh promoter orthologues compared in this analysis is also shown to highlight the higher sequence similarity within the orthologous genes of each Rboh paralog (Figure 13C).

RESULTS AND DISCUSSION

A A. thaliana Conserved regions in RbohD promoters compared to Conserved regions in RbohF promoters A. lyrata

B. rapa

C. rubella

T.halophila -2000 -1500 -1000 -500 ATG -2000 -1500 -1000 -500 ATG

B W-box (+) W-box (-) GT-1 (+) W-box (+) - 417 pAtRbohD - 705 - 277 pAlRbohD - 553 - 305 pBrRbohD - 545 - 257 pCrRbohD - 636 - 252 pThRbohD - 637 Consensus 100%

CDC5(+) GT-1(+) GT-1(-) GT-1(-) pAtRbohF - 170 - 67 pAlRbohF - 177 - 79 pBrRbohF - 170 - 63 pCrRbohF - 177 - 82 pThRbohF - 210 - 63 Consensus 100%

C pAtRbohE

pBrRbohD

pThRbohD pCrRbohD

pAtRbohD

pAlRbohD

pThRbohF

pBrRbohF

pCrRbohF

pAtRbohF pAlRbohF

Figure 13. Prediction of common and distinct potential cis-regulatory DNA elements (CREs) involved in RbohD and RbohF transcriptional control upon pathogen challenge. (A) Conserved non coding regions in the 5´UTR regions of RbohD (left) and RbohF orthologous genes (right) are represented. Grey areas indicate regions of at least 100 bp with a minimum conservation identity of 70%. (B) Multiple alignments depicting the promoter sequences where immunity related CREs were identified. W-box, GT-1 and CDC5 putative binding sites are highlighted. (C) Cladogram representing the phylogenetic relationships of the promoter from the RbohD and RbohF orthologous genes compared in this analysis. NJ was applied as clustering method, Bootstrap values are shown in each node and Arabidopsis RbohE promoter sequence was used as outgroup.

RESULTS AND DISCUSSION

This in silico approach allowed us to predict the location in Arabidopsis Rboh promoters of conserved potential cis-elements that could be recognized by 3 different immune response related transcription factors (TFs): CDC5 Myb related TF (involved in HR control), GT-1 trihelix TFs (with a role in NaCl and pathogen response) and WRKY TFs (key players in transcriptional reprogramming during plant immunity). Interestingly, we identified 3 potential WRKY TFs binding sites conserved among RbohD promoters. These sites were absent in the RbohF promoter cluster, where a conserved putative CDC5 TF binding site was predicted. Additionally, several potential cis-elements for GT-1 trihelix TFs binding were predicted in both RbohD and RbohF promoter clusters (Table 3).

Putative TF Putative Location on and core Rboh cis-elements A. thaliana Transcription Factor role CIS-element Gene conserved among promoters in plant immunity Rboh orthologues from ATG (bp)

CDC5

Myb-related TTCACAGCGCG (+) -187 -181 Contributes to cell death control RbohF CTCAGCG in leaves (Lin et al., 2007).

TATTCAA (-) -1076 -1069 GAAAAA (+) -177 -173 RbohF CTATACATATAC (-) -88 -75 TGTATATACTT (-) -54 -42 GT-1 like TF binding to GT-1 CIS-elements play a role in Trihelix GT-1 SCaM-4 gene induction by G(T/A)AA(T/A) pathogens and NaCl GTAAA (+) -434 -430 (Park et al.,2004). RbohD TATTTC (-) -343 -337 AATTTC (-) -288 -294

Global transcriptional TTTGACCA (+) -712 -707 reprogramming in response WRKY TTTTGACCAGAC (+) -424 -419 RbohD to pathogens (Pandey & (T)TGACY AAGTCAAAAAT (-) -452 -447 Sommsich, 2009).

Table 3. Sequence and location of the conserved putative CREs found in this study in RbohD and RbohF promoters. The location of the in silico immunity related CREs found in RbohD and RbohF promoters is summarized. TFs predicted to potentially bind these CREs and with known function in pathogen response are also indicated. CREs were identified using the rVISTA genomic on-line tool and confirmed using MatInspector.

Altogether, these in silico data suggests that Arabidopsis RbohD and RbohF promoters present common and distinct putative cis-regulatory DNA elements that might be involved in transcriptional reprogramming upon pathogen challenge. Moreover, these results point towards a potential role of WRKY TFs in the control of RbohD, and GT-1 TFs in RbohD and RbohF transcriptional regulation during plant immunity.

RESULTS AND DISCUSSION

4.1.8 DISCUSSION

RbohD and RbohF promoters drive distinct spatio-temporal patterns and levels of expression throughout Arabidopsis development and in the plant immune response to Pto DC3000

RbohD and RbohF are well known NADPH oxidases that concur in the regulation of multiple responses in Arabidopsis, including the defense response, although their precise transcriptional regulation during immunity remains mostly overlooked. Many tools are available to assess the expression of a certain gene such as northern blot or qRT-PCR, however the information obtained by means of these general applications is often limited and little precise to fully understand the biological role of your gene of interest. Therefore, we set up a strategy using reporter genes to investigate in detail the spatio-temporal expression pattern of RbohD and RbohF, to reveal their precise activation by different cues, in different tissues and during specific events of Arabidopsis immune response and, in addition, to investigate new roles of these genes in immunity.

Histochemical staining of pD-GUS and pF-GUS transgenic lines revealed that RbohD and RbohF promoters determine a differential expression pattern throughout different stages of Arabidopsis development (Figure 2). In agreement with previous mRNA accumulation studies and microarray data (Suzuki et al., 2011; Torres et al., 1998), RbohD promoter activity is markedly higher than that of RbohF in seedling tissues and during the responses analysed in this study. However, abnormal development phenotypes related to these expression patterns are not observed in the single rbohD or rbohF mutants and only the double mutant rbohD rbohF exhibits reduced rosette growth and some necrotic lesions (Torres et al., 2002). The absence of developmental phenotypes in the individual mutants could be due to functional redundancy, given that Arabidopsis encodes 10 Rboh genes (Torres and Dangl, 2005), some of which mediate different developmental processes (Suzuki et al., 2011). We observed that RbohD promoter drives reporter gene expression to root tissues and guard cells and RbohF promoter to leaf hydathodes (Figure 2), all of them areas of pathogen penetration into plants (Dodman, 1979; Hallman, 2001). This is congruent with the known role of these genes as components of the plant immune response (Marino et al., 2012; Torres, 2010).

The analysis of RbohD and RbohF promoter activity during ETI shows that both genes are differentially up-regulated in response to avirulent Pto DC3000(avrRPM1), with RbohD activation being 8-fold stronger than that of RbohF (Figure 3A-B). This is in agreement with most of the apoplastic ROS generated during ETI being RBOHD-dependent and with the additive role of both oxidases in the control of the HR (Torres et al., 2002). Interestingly, the activation of RbohD and RbohF promoters spatially matched the areas where ROS accumulate and HR occurs. This up-regulation is temporally reminiscent of the second wave of ROS production during ETI (Lamb and Dixon, 1996), suggesting that RbohD and RbohF

RESULTS AND DISCUSSION

transcriptional activation might be required to achieve the high level of ROS detected after recognition of incompatible pathogens.

Infiltration with the virulent Pto DC3000 did not trigger a clear induction of the reporter genes activity driven by the RbohD and the RbohF promoters (Figure 3A), consistent with the absence of ROS production in this interaction. This is possibly due to the action of effectors that manipulate the plant immune system and to the activity of bacterial ROS scavenging systems (Torres et al., 2010; Xin and He, 2013). Intringuingly, injection with Pto DC3000hrcC mutant strain did not upregulate these promoters, although a mild accumulation of H2O2 was detected by DAB staining (Figure 3A). On the other hand, seedlings treated with the bacterial PAMPs flg22 and elf18 showed a marked up-regulation of RbohD (Figure 8A-C). Differences in the developmental stage of the plants and in the amount of available PAMPs to be sensed by PRRs might explain these results. Alternatively, additional signals may be present in the microbe that damper the promoter upregulation after PAMP recognition.

The quantitative assays with the luciferase reporter gene revealed that RbohD promoter induction is around 8-fold stronger than that of RbohF promoter (Figure 3 and 4). Since RbohD is responsible for the majority of the apoplastic ROS production in response to avirulent bacteria (Marino et al., 2012; Torres et al., 2002), we hypothesize that the differential promoter activity of RbohD and RbohF contributes to determine the differential ROS production mediated by these NADPH oxidases.

Since RBOHD-dependent ROS were shown to mediate long distance signaling in response to different stresses (Miller et al., 2009), we tested the possibility of an induction of RbohD and RbohF promoters in distal tissues outside the area infiltrated with avirulent bacteria. Our in vivo expression analysis of pD-LUC and pF-LUC activity in response to Pto DC3000(avrRPM1) revealed that RbohD and RbohF promoter activity increased at the local infiltrated leaves 4.3 and 2.5 fold, respectively. However the activity of these promoters outside the infiltrated area was not significantly induced as compared with MgCl2 treated control plants (Figure 4). The mild up-regulation of RbohD outside the interaction site might be derived from the infiltration process. Thus, the proposed role of RbohD in systemic signaling (Dubiella et al., 2013), does not likely depend on transcriptional upregulation of this gene.

Correlation between Rboh spatio-temporal expression pattern in response to P. cucumerina with ROS production, cell death and non-host resistance

The analysis of RbohD and RbohF spatio-temporal expression pattern in response to PcBMM infection revealed a strong up-regulation of RbohD promoter at the leaf lamina and the petiols, whereas RbohF is mainly up-regulated at the midrib and the leaf veins (Figure 5A-B). This Rboh up-regulation, which increases with the progression of the infection, is in agreement with their implication in the immune response to necrotrophic fungi (Sánchez-Vallet et al., 2012; Torres et al., 2013) and with the additive role of these oxidases for a full immune response to different pathogens (Marino et al., 2012; Torres and Dangl, 2005). The concomitance between the levels

RESULTS AND DISCUSSION

of RbohD promoter activation, H2O2 accumulation, pathogen colonization and its associated necrosis (Figure 5A) is coincident with the preeminent role that this NADPH oxidase has on ROS production during pathogen recognition (Torres et al., 2002; Zhang et al., 2007) and in the regulation of cell death during pathogen response (Pogany et al., 2009; Torres et al., 2005). In agreement with this, chitin and other PAMPs triggered the upregulation of the RbohD promoter but not that of RbohF (Figure 8), further suggesting that a transcriptional upregulation of RbohD could be required for the accumulation of ROS detected after recognition of the pathogen. The pattern of stain defined by the RbohD promoter reveals that its expression is induced at early time points after inoculation with PcBMM, which is in accordance with the RbohD role during early events of the plant immune response (Kadota et al., 2014; Zhang et al., 2007). On the other hand, the RbohF promoter activity is very low during early stages of the infection and occurs mainly when cell death in response to the pathogen is in progress, in agreement with the role of RbohF in cell death modulation (Torres et al., 2002).

The transcriptional activation of Rboh gene expression in response to PcBMM might be influenced by several specific signals during the infection process: hormone signaling pathways, cell death related signals or fungal PAMPs and effectors. ET and ABA signaling pathways are activated upon infection with PcBMM (Sánchez-Rodríguez et al., 2009; Sánchez-Vallet et al., 2010; Sánchez-Vallet et al., 2012) and the ET pathway induces RBOHD enzymatic activity (Bouchez et al., 2007) and impacts RbohD and less markedly RbohF expression (Jakubowicz et al., 2010). In contrast, ABA-deficient mutants, that have a constitutive activation of ET and SA pathways, show enhanced constitutive expression of RbohD in comparison to that in wild-type plants (Sánchez-Vallet et al., 2012). We observed that long exposure to ABA induces RbohF promoter, whereas RbohD promoter is reduced in seedlings roots (Figure 9). These data is in agreement with previous expression analysis (Kwak et al., 2003; Sagi and Fluhr, 2006) and suggest that ABA differentially modulates RbohD and RbohF gene expression, pointing towards a positive role of this phytohormone in the transcriptional regulation of RbohF.

RbohD was proposed to control cell death during Alternaria brassicicola infection by triggering death in damaged cells but simultaneously inhibiting it in neighboring cells, through a negative feedback regulation of SA and ET (Pogany et al., 2009). The strong increase in RbohD promoter activity observed at the leaf areas surrounding necrotic lesions induced by PcBMM (Figure 5A-B), is in agreement with the existence of cell death related cues that might combine to modulate: the stronger level of Rboh-promoter activation and a higher H2O2 accumulation that possibly impact cell death levels during the progress of the necrosis. Therefore, it is likely that changes in ABA levels and other hormones such as ET, might contribute to modulate RbohD and RbohF level and function during Pc infection.

Interestingly, RbohD promoter is also activated upon infection with the non-adapted isolate Pc2127, which is unable to successfully colonize Arabidopsis and does not generate necrosis (Figure 5). Moreover, RbohD promoter is up-regulated in response to chitin (Figure 8A). These data point to a role for RbohD in non-host resistance, possibly during the recognition

RESULTS AND DISCUSSION

of the fungus by Arabidopsis. As a matter of fact, rbohD rbohF double mutant presents more symptoms and supports enhanced fungal growth than wild-type Col-0 plants after inoculation with Pc2127 (Figure 7), showing that the plant NADPH oxidases are required for full non-host resistance to this fungal isolate. This result is in agreement with the enhanced susceptibility of Nicotiana benthamiana to Phytophthora infestans upon NbRbohA and NbRbohB virus induced silencing (Yoshioka et al. 2003). Nevertheless while in this study, silencing of NbRbohA or NbRbohB lead to enhance disease symptoms and disease progression, we only detected enhanced Arabidopsis susceptibly to Pc2127 in the double rbohD rbohF mutant. The absence of a susceptibility phenotype to Pc2127 in rbohD or rbohF single mutant plants might be due to the partial functional redundancy between both oxidases previously reported in several biotic interactions (Marino et al., 2012; Suzuki et al., 2011). Additionally, RbohF function has been already associated with Arabidopsis non-host resistance to Magnaporthe oryzae, (Nozaki et al., 2013). Thus, it is likely that, depending on the interaction analysed, RbohD, RbohF or both oxidases might be relevant for non-host resistance, as occurs in the orchestration of the full immune response in different patho-systems (Marino et al., 2012; Torres et al., 2013).

Intrinsic differences among RbohD and RbohF promoters differentially modulate the spatial pattern of ROS production during Arabidopsis immune response

RbohD is the NADPH oxidase responsible for the generation of ROS in the response of Arabidopsis to all pathogens tested (Marino et al., 2012; Suzuki et al., 2011). To help deciphering the relevance of transcriptional regulation of RbohD and RbohF to specify ROS production during Arabidopsis immune response, we set up a promoter-swap strategy. Our Rboh promoter-swap experiments revealed that only the construct harboring the structural part of RbohD, driven by its own promoter was able to restore H2O2 production in response to PcBMM in the rbohD mutant (Figure 12). Thus, the promoter region of RbohD is essential for ROS production in response to pathogens dependent on this oxidase. This data suggests that the spatio-temporal expression of these Rboh that is determined by their promoters, is required to achieve their specific function in immunity.

Our analyses of RbohD and RbohF promoter activity and the promoter swap strategy, indicate differences between the CREs present in the 5´UTR sequences of both genes that might be responsible for their differential transcriptional regulation. In agreement, we predicted the presence of common and distinct putative CREs in RbohD and RbohF promoters which might be potentially involved in their transcriptional reprogramming upon pathogen challenge. Our in silico phylogenetic shadowing data, point towards a potential role of WRKY TFs in RbohD transcriptional regulation during plant immunity. Moreover GT-1 TFs might also be important for RbohD and RbohF transcriptional regulation during pathogen response and salt stress (Figure 13, Table 3). Nevertheless further experimental work needs to be performed in order to validate this in silico data.

RESULTS AND DISCUSSION

rbohD but not rbohF single mutants fail to produce ROS in response to PAMPs, fungal and bacterial pathogens (Marino et al., 2012). Since constructs harboring the RbohF gene driven by RbohD promoter (and also by its own promoter) are unable to complement ROS production in response to PcBMM, intrinsic differences at the structural part of RbohD and RbohF genes, might also determine the differential ROS production ability of these NADPH oxidases. In this regard, we observed that the level of immunodetected RBOHF protein in our western blot assays is invariably lower than that of RBOHD, regardless of the promoter driving the expression (Fig 11A-C, 12B). This could be due to a lower transcript or protein stability of RBOHF constructs in comparison to the RBOHD ones. In the present study, the constructs employed for the complementation assays were generated using Rboh cDNA, and it has been shown that introns are key elements for correct expression of proteins in Arabidopsis, like the RLK ERECTA (Karve et al., 2011). Therefore, since RbohF harbors 14 introns in comparison with the 7 present in the structural part of RbohD (Torres et al., 2002), it might be possible that transcripts or proteins derived from our RbohF cDNA constructs present lower stability than the endogenous ones, therefore lowering their ROS production ability. Congruent with this, it has been proposed that alternative splicing in another NADPH oxidase gene, AtRbohB, could play an important role in the regulation of seed dormancy and after ripening (Muller et al., 2009).

Differential regulatory residues might also contribute to the functional specificity of RBOHD and RBOHF. In this regard, the N-terminal cytosolic extension plays an important role in the regulation of RBOH activity by phosphorylation (Suzuki et al 2011; Marino et al., 2012), and several RBOH regulators through their N-termini have been recently identified (Sirichandra et al., 2009; Drerup et al., 2013; Dubiella et al., 2013; Gao et al., 2013; Kimura et al., 2013; Kadota et al., 2014). As shown in Table 4, the N-termini of RBOHD and RBOHF show lower similarity than the transmembrane or C-termini domains. Thus the differences between the N- termini of both RBOHs might also contribute to the specific regulation of these oxidases.

RBOHD and RBOHF Full lenght N-term TM C-term TM + C-term proteins alignment 494/938 144/381 248/368 99/179 347/547 Identity (52.7%) (37.8%) (67.4%) (55.3%) (63.4%) 638/938 211/381 289/368 132/179 421/547 Similarity (68.0%) (55.4%) (78.5%) (73.7%) (77.0%) 76/938 60/381 3/368 13/179 16/547 Gaps (8.1%) (15.7%) (0.8%) (7.3%) ( 2.9%)

Table 4. Differences between RBOHD and RBOHF aminoacid sequence are higher at the N-terminal region compared with other domains. A summary of the comparison between different protein domains of RBOHD and RBOHF is shown. RBOH aminoacid sequences retrieved from NCBI were submitted for pairwise alignment with EMBOSS Water to calculate the local alignment of two sequences. N-termini (N- term), transmembrane domains (TM) and C-termini (C-term) were predicted with the DAS and TMpred servers. The degree of identity and similarity between the different regions of both proteins is underlined.

RESULTS AND DISCUSSION

Through the analysis of transgenic lines with RbohD or RbohF promoters driving the GUS and luciferase reporter genes, we have shown that these oxidases present a differential spatio-temporal expression pattern and gene expression level during the plant immune response. Moreover, these expression studies helped to uncover a new role of these NADPH oxidases in Arabidopsis non-host resistance to non-adapted necrotrophic fungi. In addition, the spatial and temporal correlation between RbohD and RbohF promoter activation with the level of ROS production and cell death in response to adapted and non-adapted microbes, suggests that the transcriptional regulation of these oxidases might contribute to the modulation of the strength of the immune response to different microbial threats. In fact, our promoter-swap experiments showed that location and level of expression of RbohD driven by its own promoter is required for H2O2 accumulation in response to pathogens, whereas the RbohF promoter fails to restore RbohD-dependent ROS production. However, the RbohD is not sufficient to restore ROS production when directing RbohF expression, suggesting that intrinsic differences at the structural part of RbohD and RbohF genes might also determine the differential ROS production ability of these NADPH oxidases. Future experimental efforts need to be done to find the transcription factors that specifically regulate RbohD and RbohF gene expression upon pathogen challenge. These studies should contribute to further understand the molecular mechanisms that regulate ROS production and to broaden our knowledge of signaling during plant immunity.

RESULTS AND DISCUSSION

4.2 ASCERTAINING THE ROLE OF HETEROTRIMERIC G PROTEINS IN THE REGULATION OF RBOH-MEDIATED IMMUNE SIGNALLING

RESULTS AND DISCUSSION

4.2 INTRODUCTION

The RBOH-NADPH oxidases are required for pathogen-induced ROS production and mediate different signaling roles in plant immunity (Marino et al., 2012; Torres and Dangl, 2005; Suzuki et al., 2011). The expression and activity of these pleiotropic enzymes is tightly regulated by different components of the plant immune response, among them: Ca2+ signaling (Oda et al., 2010; Ogasawara et al., 2008; Wong et al., 2007), phosphatidic acid (Zhang et al., 2009), hormone signaling including the SA, ET, JA and ABA signaling pathways (Marino et al., 2012; Torres et al., 2010; Suzuki et al., 2011; Wrzaceck et al., 2013), phosphorylation by different protein kinases (Drerup et al., 2013; Dubiella et al., 2013; Gao et al., 2013; Kadota et al., 2014; Kimura et al., 2013; Li et al., 2014; Nüshe et al., 2007) and S-nytrosothiolation by NO derivatives (Yun et al., 2011). In turn, RBOH-dependent ROS interplay with some of these signaling elements to mediate different plant responses to pathogens such as: cell wall alterations and ligning biosynthesis (Dennes et al., 2011), stomatal closure (Song et al., 2013) or the control of pathogen induced cell death (Pogany et al., 2009; Torres et al., 2005). The interaction of RBOH-dependent ROS with diverse cell signaling components may explain the multiple physiological responses that these oxidases mediate. However, despite many signals modulate and are coordinated with RBOH activity in response to pathogens, the interplay between RBOH-dependent signaling with many key components of plant defense to fine tune the plant immune response, remains to be fully determined.

Plant heterotrimeric G proteins mediate responses to environmental, developmental and nutrient status cues (Temple and Jones 2007). Increasing evidence shows that these proteins play also an important role in signal transduction pathways mediating the plant immune response (Trusov et al., 2010). In rice, the Gα subunit is required for full hypersensitive response (HR) and resistance to avirulent races of the rice blast fungus Magnaporthe grisea (Suharsono et al., 2002). However, in Arabidopsis, the Gα subunit (GPA1) has been related to fewer plant-pathogen interactions, being involved in the response to the bacterial elicitor Harpin from Erwinia amylovora (Zhang et al., 2012b) and playing a role in PAMP triggered stomatal closure in response to the bacterial elicitor flg22 (Zhang et al., 2008; Zhang and He., 2010). In contrast the Gβ subunit (AGB1) and the Gγ subunits (AGG1/AGG2) are the ones required for full resistance against necrothophic fungi in Arabidopsis (Delgado-Cerezo et al., 2012; Llorente et al., 2005; Trusov et al., 2006; Trusov et al., 2007; Trusov et al., 2009). In addition, AGB1 also seems to be involved in non-host resistance, specifically in Arabidopsis penetration resistance against Magnaporthe oryzae (Maeda et al., 2009).

Among the plethora of signals coordinated with RBOH activity, pharmacological and genetic evidence indicates that heterotrimeric G proteins participate in the same signaling pathways as the RBOH–derived ROS in different plant responses to the environment. As a matter of fact, exposure to high levels of exogenous ozone (O3), drive a spatial and a temporal progression of ROS production that is similar to the pathogen-induced oxidative burst (Joo et al., 2005). This oxidative burst is largely dependent on RbohD and RbohF, which were related

RESULTS AND DISCUSSION

to the intercellular signaling and ultimate cell death arising from high levels of O3 exposure. It is noteworthy that heterotrimeric G proteins were shown to mediate this ROS production and sensitivity to O3 (Joo et al., 2005). Additionally, heterotrimeric G proteins have also been implicated in plant responses to ABA as well as to high light stress (Wang et al., 2001; Fan et al., 2008; Galvez-Valdivieso et al., 2009), processes which are also mediated by RBOH- dependent ROS (Kwak et al., 2003; Miller et al., 2009). In wild-type plants, ABA stimulates the production of ROS by RBOHD and RBOHF in guard cells (Kwak et al., 2003). Interestingly, induction of ROS production by ABA is impaired in gpa1 mutant plants (Zhang et al., 2011).

Furthermore, heterotrimeric G proteins were also shown to stimulate H2O2 production in response to extracellular calmodulin to mediate stomatal closure (Chen et al. 2004). Pharmacological evidence also suggests that, during plant defense responses, RBOH- dependent ROS production is mediated by heterotrimeric G proteins (Vera-Estrella et al., 1994). In a genetic analysis carried out in rice, it was shown that OsRac1, a small GTPase involved in the activation of the NADPH oxidase, acts downstream of the Gα subunit in response to infection with Magnaporthe grisea (Suharsono et al., 2002). Moreover, in Arabidopsis, the agb1 null mutant displays reduced bacterial elicitor induced ROS production (Ishikawa, 2009). From these various studies, we hypothesized that heterotrimeric G proteins could interact with RBOH- derived ROS and play a role in the regulation of RBOH immune signaling.

To test this hypothesis, we first analysed the defense response to pathogens with different lifestyles of the Arabidopsis mutants in: RbohD and RbohF NADPH oxidases, in different subunits of the heterotrimeric G protein complex and in the combinatorial mutants between rbohD rbohF, agb1 and gpa1. Specifically, we tested the susceptibility and several immune responses of these mutants to different strains of the hemibiotrophic bacterial pathogen Pseudomonas syringae pv tomato DC3000 (Pto DC3000) and the necrotrophic fungus, Plectosphaerella cucumerina BMM (PcBMM). Furthermore we analysed the implication of heterotrimeric G protein signaling in two RBOH-dependent PTI responses, the ROS burst and the flg22 triggered stomatal closure. To further investigate whether heterotrimeric G proteins take part in the protein complexes that mediate RBOHD dependent ROS production during plant immunity, we also explored the potential association during PAMP perception between AGB1 with: RBOHD, RBOHF and with the RBOHD regulatory kinase BIK1. Our results illustrate the complex relationship between RBOH and heterotrimeric G proteins signaling, that varies depending on the type of plant-pathogen interaction. In addition, we show that AGB1 is involved in RBOH-dependent immune responses and that it might associate with the RLCK BIK1.

RESULTS

4.2.1 The β-subunit of heterotrimeric G-proteins (AGB1) is a component of Arabidopsis immune response to Pto DC3000 that plays a role in basal resistance and ETI

We examined whether mutants in the Arabidopsis heterotrimeric G protein subunits Gβ (agb1-2) (Ullah et al., 2003) and Gα (gpa1-4) (Jones et al., 2003; Ullah et al., 2001) show differences

RESULTS AND DISCUSSION

compared with wild-type Col-0 plants in response to the infection with different strains of the hemibiotrophic bacteria Pto DC3000 (Figure 1A to D).

After bacterial inoculation with Pto DC3000, the agb1 mutant displayed increased chlorotic symptoms (Figure 1A). These symptoms correlated with enhanced bacterial growth in agb1 as compared with the wild-type in response to: virulent Pto DC3000, avirulent Pto DC3000(avrRpm1) and Pto DC3000hrcC, strain deficient in the type III secretion system that only induces PTI (Figure 1B-D). Quantification of Pto DC3000hrcC is shown at 5 dpi, when a significant enhanced growth of this Pto mutant strain on agb1 was detected. Thus, AGB1 is required for basal resistance against P. syringae and is a component of Effector triggered immunity (ETI) in response to avirulent bacteria. On the other hand, gpa1 displayed the same level of bacterial growth as wild-type plants, whereas bacterial growth in agb1 gpa1 was similar to that determined in agb1 (Figure 1B-1D). These data indicate that AGB1 is required for basal and specific resistance to P. syringae.

A B Col-0 agb1 gpa1 agb1 gpa1 day 0 Pto DC3000 day 3 8 * *

) 7 2 6

5 DC3000

Log(CFU/cm Pto 3 2 Col-0 agb1 gpa1 agb1 gpa1 C D day 0 day 0 Pto DC3000hrcC day 5 Pto DC3000(avrRpm1) day 3

8 8

) ) 2 7 7 2 * * 6 * * 6 5 5

Log(CFU/cm 4 4 Log(CFU/cm 3 3 2 2 Col-0 agb1 gpa1 agb1 gpa1 Col-0 agb1 gpa1 agb1 gpa1

Figure 1. The agb1 mutant displays an impaired immune response to Pto DC3000. (A) Symptoms on 4.5 week-old plants of the genotypes listed, 5 days after spray inoculation with a 5 × 107 CFU.ml–1 concentration of P. syringae pv. tomato DC3000. (B to D) Quantification of bacterial growth on the heterotrimeric G protein mutants after injection with a 2,5 105 CFU.ml–1 concentration of: the virulent bacterial strain P. syringae pv. tomato DC3000, the avirulent strain P. syringae pv. tomato DC3000(avrRpm1) and the type III secretion mutant P. syringae pv. tomato DC3000hrcC, respectively.

Values represented are the means of logarithmic bacterial growth ± standard error (SE) of four biological replicates in one representative experiment out of 3 performed. Asterisks indicate significant differences in bacterial growth in mutant lines compared with wild-type Col-0 by ANOVA and Bonferroni post hoc test.

RESULTS AND DISCUSSION

4.2.2 The agb1 mutant is impaired in ROS production during PTI and ETI

We set to test whether the RBOHD-dependent oxidative burst was impaired in agb1 and gpa1

null mutants during PTI and ETI. Therefore we monitored both H2O2 production and the HR cell

death associated with infection by avirulent bacteria. H2O2 accumulation appeared to be slightly diminished in the agb1 mutant in response to Pto DC3000(avrRpm1) as revealed by DAB staining (Figure 2A). Similarly, agb1 displayed a slight reduction of DAB stain after inoculation with Pto DC3000hrcC (Fig 2B). To quantify the apparent reduction of ROS production in agb1

during PTI, we monitored H2O2 production in response to flg22, the active epitope of bacterial elicitor flagellin (Felix et al., 1999).

A Pto DC3000(avrRpm1) 5 hpi C 35 Col-0Col-0 30 agb1

100 25 DAB agg1 20 agg1 agg2

RLUs x RLUs 15 agg2

10 rbohD rbohF

TB 5 gpa1 agb1 gpa1 0 0 4 8 12 16 20 24 28 32 Time after flg22 treatment (min-1) Col-0 gpa1 agb1 agb1 gpa1 B D 25 a a a Pto DC3000hrcC 2 hpi a

20 1000 15 b

10 b RLUs x RLUs 5

Total c c Col-0 gpa1 agb1 agb1 gpa1 0 ColCol-0-0 agb1 agg1 agg1 agg2 rbohD gpa1 agb1 agg2 rbohF gpa1

Figure 2. The agb1 mutant displays reduced ROS production in response to Pto DC3000(avrRpm1)

and after flg22 treatment. (A) Detection of H2O2 accumulation by DAB staining (above) and cell death by TB staining (below) 5 hpi after injection with with 2.5 × 107 CFU.ml–1 of Pto DC3000(avrRpm1) in leafs from

4 week-old plants of the genotypes listed. (B) H2O2 detection by DAB staining 2 hpi after infiltration of Pto DC3000hrcC in the genotypes listed. (C, D) Oxidative burst triggered by 100 nM flg22 in the genotypes listed measured in a luminol-based assay as relative light units (RLUs). Data are represented as a time course over 32 minutes and as total RLUs (below). Values are average + SE (n = 12). Letters indicate groups with homogenous means determined by ANOVA (5%) using genotype as factor. Statistically significant differences were determined by Bonferroni post hoc test.

Luminol assays following treatment with 100 nM flg22 confirmed that H2O2 production in agb1 was significantly reduced compared with that determined in wild-type Col-0 plants (Figure 2C-2D), as previously reported (Ishikawa, 2009; Jiang et al., 2012b). Moreover, in the double

RESULTS AND DISCUSSION

mutant agg1 agg2, the oxidative burst in response to flg22 was completely abolished. Thus, the Gβγ dimer is required for the full RBOHD-dependent ROS burst after pathogen recognition during PTI and ETI. On the other hand, the Gα subunit does not mediate ROS production in response to flg22, since the gpa1 mutant displays comparable ROS levels than the wild-type.

In addition, cell death after inoculation with Pto DC3000(avrRpm1), monitored by trypan blue staining, was not affected in agb1, gpa1 or agb1 gpa1 plants. This result indicates that, despite AGB1 is involved in ETI signaling, GPA1 and AGB1 play no evident role in cell death consecution in response to avirulent bacteria.

4.2.3 Agb1 loss of function attenuates some phenotypes of the rbohD rbohF mutant

Epistasis analyses between the heterotrimeric G protein null alleles gpa1 and agb1 and the double mutant rbohD rbohF showed that, the impaired growth phenotype of rbohD rbohF adult plants, was partially restored in the rbohD rbohF agb1 mutant (Figure 3A). Moreover, we found that agb1 restored to wild-type levels the impaired cell death exhibited by rbohD rbohF during the HR in response to avirulent bacteria (Torres et al., 2002).

A rbohD rbohF rbohD rbohF Col-0 agb1 agb1 gpa1 rbohD rbohF agb1 agb1 gpa1

B Col-0 100

agb1

1 - 80 gpa1

60 agb1 gpa1

40 rbohD rbohF rbohD rbohF agb1 Conductivity µScm Conductivity 20 rbohD rbohF agb1 0 gpa1 1 2 3 4 5 6 7 8 Time after inoculation (h) with Pto DC3000(avrRpm1)

Figure 3. Agb1 loss of function attenuates the altered rosette growth and reverts the impaired HR of the rbohD rbohF mutant. (A) Rosettes from 6 week-old plants of the indicated genotypes. (B) Conductivity measurement after 4 week-old plants injection with 2.5 × 107 CFU.ml–1 of the avirulent strain Pto DC3000(avrRpm1). Data represented are means + SE of conductivity (µS cm–1) calculated from 6 ml of water containing four leaf discs (four repetitions per genotype) over time. Experiments were repeated three times with similar results.

RESULTS AND DISCUSSION

Upon inoculation with Pto DC3000(avrRpm1), conductivity (a measurement of ion leakage correlated with cell death) in agb1 rbohD rbohF increased towards levels comparable to those found in wild-type plants (Figure 3B). By contrast, GPA1 loss of function did not affect the conductivity level displayed by rbohD rbohF. As expected, the rbohD rbohF agb1 gpa1 quadruple mutant exhibited the same phenotypes as rbohD rbohF agb1 (Figure 3A-B).

Although the rbohD rbohF mutant displays a similar level of bacterial growth compared to wild-type in response to Pto DC3000 (Torres et al., 2002), we tested the possibility of an additive effect in susceptibility to Pto DC3000 in the rbohD rbohF agb1 mutant (Figure 4).

Col-0 agb1 rbohD rbohF rbohD rbohF agb1

DC3000 Pto

Pto DC3000 B 9 * day 0 ) 8 * * * 2 day 3 7 6 5 4

Log(CFU/cm 3 2 Col-0Col-0 agb1 gpa1 agb1 gpa1 rbohD rbohD rbohD rbohF rbohF rbohF agb1 agb1 gpa1

C Pto DC3000hrcC 9 day 0

) 8 2 day 5 7 6 * * * * 5 4 .

Log(CFU/cm 3 2 Col-0Col-0 agb1 gpa1 agb1 gpa1 rbohD rbohD rbohD rbohF rbohF rbohF agb1 agb1 gpa1 Figure 4. The combinatorial mutant rbohD rbohF agb1 lacks an additive phenotype in response to Pto DC3000. (A) Symptoms of 4.5 week-old plants of the indicated genotypes, 8 days after spray inoculation with a 5 × 10 7 CFU ml–1 concentration of Pto DC3000. (B and C) Quantification of bacterial growth on 4.5 week-old plants after syringe inoculation with a concentration of 2,5 x 105 CFU ml–1 of the virulent bacterial strain Pto DC3000 and Pto DC3000 hrcC, respectively. Values represented are the means of logarithmic bacterial growth ± SE of four biological replicates in one representative experiment out of 3 performed. Asterisks indicate significant differences in bacterial growth in mutant lines compared with wild-type Col-0 by ANOVA and Bonferroni post hoc test.

RESULTS AND DISCUSSION

After spray inoculation with Pto DC3000 and Pto DC3000hrcC, the triple rbohD rbohF agb1 showed enhanced bacterial growth and chlorotic symptoms comparable to agb1. Similarly, the quadruple mutant rbohD rbohF agb1 gpa1 also displayed enhanced susceptibility compared to wild-type, also equivalent to agb1 (Figure 4). Thus, it is unlikely that the NADPH oxidases participate in additional signaling pathways than those mediated by AGB1 in response to Pto, given the lack of an additive effect in susceptibility to P. syringae in the rboh and the hetrotrimeric G protein combinatorial mutants.

4.2.4 The RBOH-NADPH oxidases act independently of AGB1 during Arabidopsis immune response to the necrotrophic fungus Plectosphaerella cucumerina isolate BMM.

Agb1 is required for full disease resistance to Plectosphaerella cucumerina (Llorente et al., 2005). We sought to ascertain whether RBOH signaling plays a role in the immune response to PcBMM and if this putative signaling role concurs with heterotrimeric G proteins.

A rbohD rbohF rbohD rbohF

Col-0 agb1 gpa1 agb1 gpa1 rbohD rbohF agb1 agb1 gpa1

Mock PcBMM

B C PcBMM 40 c

35 0

- c

30 abundance

) ) 25 to Colto

fold -

(n 15 b b b relative 10 5

PcBtub a a 0 ColC-0 agb1 gpa1 agb1 rbohD rbohD rbohD gpa1 rbohF rbohF rbohF agb1 agb1 Col-0 gpa1 agb1 agb1 gpa1 gpa1

Figure 5. agb1 and rbohD rbohF display additive disease susceptibility to the necrotrophic fungus P. cucumerina isolate BMM. (A) Disease symptoms of the genotypes listed, 7 days after spray inoculation with PcBMM (4 x 106 spores ml-1) compared to mock inoculated plants. (B) Quantification of PcBMM genomic biomass. Fungal DNA (Pc -tubulin) was quantified by q-PCR at 3 dpi. Bars represent

averages (+ SE) of fungal DNA levels relative to Arabibopsis Col-0 plants (Ubiquitin). Data was obtained from 3 biological replicates. Statistical analysis was performed by ANOVA 5%, corrected with Bonferroni

post hoc test. Letters indicate statistically significant differences. The experiment was repeated three times with similar results.

RESULTS AND DISCUSSION

We sprayed spores of PcBMM onto the rbohD rbohF mutant, onto the heterotrimeric G protein mutants (agb1, gpa1, and agb1 gpa1) and onto the combinatorial mutants. Analysis of the symptoms and quantification of the fungal biomass by q-PCR showed that the rbohD rbohF double mutant was, like agb1, more susceptible than the wild-type to this fungus (Figure 5). Interestingly, agb1 rbohD rbohF displayed increased susceptibility compared with either agb1 or rbohD rbohF. On the other hand, the RBOHD-dependent H2O2 accumulation detected by DAB is not altered in the heterotrimeric G protein mutants after infection with PcBMM (Figure 5C). These results indicate that RbohD, RbohF and Agb1 are all required for the full immune response to PcBMM. In addition, contrary to what we observed in response to the hemibiotrophic bacterial pathogen Pto DC3000 (Figures 2 to 4), the NADPH oxidase and the heterotrimeric G protein complex signaling, seem to act independently during the immune response to PcBMM.

4.2.5 The agb1 mutant is impaired in stomatal closure in response to flg22

Stomatal closure is induced upon PAMP perception as part of plant pre-invasive immunity (Melotto et al., 2006; Mersman et al., 2013). After flg22 treatment the gpa1 mutant is unable to prevent stomatal opening (Zhang et al., 2008) and rbohD loss of function also causes impaired stomatal closure in response to PAMPs (Mersman et al., 2010; Macho et al., 2012). We wanted to test if AGB1 is also involved in this response.

A B

0,6 mock Col-0 a a a a 0,5 flg22 a a b 0,4

c Mock

0,3

0,2 5

Stomatal aperture W/L aperture Stomatal 0,1 flg22

0 Col-0 rbohF agb1 rbohD

Figure 6. Agb1 is required for flg22 induced stomatal closure. (A) Stomatal aperture is shown for wild- type Col- 0 and rbohF, agb1, and rbohD mutants. Leaf punches from 5 different 5 week-old plants from indicated genotypes were measured 1 h after mock or 5 µM flg22 treatment. Stomatal aperture was measured microscopically and the width to length ratio (W/L) calculated. Values are averages + SE from at least 30 stomata measured per genotype and treatment (n = 30). Differences in stomatal aperture according to genotype were analysed by ANOVA 5%, and statistically significant differences determined by Bonferroni post hoc test and indicated by letters. The experiment was performed three times with similar results. (B) Detail of mock and flg22 treated stomata illustrating the flg22 triggered stomatal closure in wild-type plants.

RESULTS AND DISCUSSION

Treatment of wild-type adult leaves with 5 µM flg22 for 1 hour induced a significant reduction in the stomatal aperture, response that was prevented in rbohD and agb1 mutant plants (Figure 6). The rbohF mutant displayed lower sensitivity to flg22 treatment than wild-type Col-0 plants partially closing the stomata, but being more reactive than the insensitive rbohD or agb1. Hence, AGB1, like RBOHD, are required for the flg22 induced stomatal closure, whereas RBOHF seems to contribute to this physiological response to a lower extent.

4.2.6 RbohD transcript accumulation in response to flg22 is impaired in agb1

We have shown that several RBOH-mediated immune responses to bacterial pathogens are affected by loss of function of the Gβ. These include PAMP and effector triggered ROS production, HR-cell death after inoculation with avirulent bacteria and stomatal immunity (Figures 2, 3B and 6). Therefore, we set to test if an abnormal expression level of RbohD and RbohF occurs in agb1, which could contribute to explain these impaired RBOH- dependent immunity phenotypes observed in the Gβ mutant. We monitored RbohD and RbohF transcript accumulation in agb1 and wild-type Col-0 seedlings upon treatment with the bacterial elicitor flg22. Expression analyses by qRT-PCR showed that in 1 week-old agb1 seedlings RbohD and RbohF expression was not significantly different from wild-type plants. Interestingly, treatment with 500 nM flg22 induced the accumulation of Rboh transcripts in Col-0 wild-type plants. However, this upregulation of RbohD was significantly lower in agb1. RbohF remained unaltered after flg22 treatment. This result suggests that RbohD transcriptional regulation during the immune response is altered in agb1, thus providing a partial explanation for some of the agb1 mutant phenotypes observed.

RbohD 6 6 RbohF *c Mock Mock 5 flg22 5 flg22 4 4 *b 3 3 ab

2 2 foldexpression

foldexpression a a -

- a n n 1 1 a a 0 0 ColCol-0-0 agb1 Col-0Col-0 agb1

Figure 7. RbohD transcriptional upregulation triggered by flg22 is impaired in agb1. RbohD and RbohF expression in 1 week-old Col-0 and agb1 seedlings, mock and 90 minutes post-treatment with 500 nM flg22 . Rboh gene expression was normalized using Ubiquitin10 gene as endogenous control. Bars represent n-fold relative expression of RbohD and RbohF after flg22 treatment relative to the calibrator sample (Col-0 mock), with the value in Col-0 mock plants set to one. Data represent the average of three biological replicates (mean ± SE) from one representative experiment out of two performed. Differences in gene expression between groups were analysed by ANOVA 5%. Different letters indicate groups with homogenous means and asterisks indicate statistically significant differences in expression compared with Col-0 mock values determined by Bonferroni post hoc test.

RESULTS AND DISCUSSION

4.2.7 Analysis of AGB1 potential association with RBOHD, RBOHF and the RBOHD regulatory kinase BIK1 during PTI

RBOHD is part of receptor protein complexes responsible for perception of PAMPs (Kadota et al., 2014; Li et al., 2014) that activate downstream signaling cascades including MAP Kinase activity, ROS production, callose deposition and defense genes expression. Since AGB1 appears to participate in several RBOH dependent pathways in plant immunity (Figures 2, 3 and 6), we set to test whether the Gβ is recruited to the same protein complexes as the RBOH- NADPH oxidases during early stages of the plant immune response. First we generated a YFP- tagged version of AGB1 (35S::YFP::Agb1; Fig 8A) whose expression was detected by confocal microscopy at the plasma membrane as well as in the some diffuse areas close to the nucleus and the cytoplasm (Figure 9), as reported (Anderson et al., 2007). A genetic construct expressing a YFP-tagged recombinant version of RBOHD (35S::YFP::RbohD) previously generated in our laboratory was used as plasma membrane localization control.

eYFP Agb1 cDNA

p35S::YFP::Agb1 (YFP-AGB1) 720 bp 1134 bp

eYFP RbohD cDNA

p35S::YFP::RbohD (YFP-RBOHD)

35s CaMV promoter RbohD cDNA p35S::FLAG::RbohD (FLAG-RBOHD) 343 bp 2726 bp 1 kb

3xFLAG RbohF cDNA

p35S::FLAG::RbohF (FLAG-RBOHF) 72 bp 2835 bp

Bik1 cDNA 3xHA 35S::Bik1::HA (BIK1-HA) p 1188 bp 81 bp

Figure 8. Schematic representation of the genetic constructs employed in this study. (A) Diagrams depicting the YFP-tagged Agb1 under the 35S CaMV promoter generated in this study and a YFP-tagged RbohD construct previously generated in our laboratory. The size of the 35S promoter, the cDNA fragments and the tags used are indicated in base pairs (bp) below the diagrams. (B) Diagram of FLAG- tagged RbohD (Kadota et al., 2014) and RbohF genetic constructs, and HA-tagged Bik1 construct under the control of the 35S CaMV promoter, provided by Dr. Yasuhiro Kadota and Dr. Shuta Asai (The Sainsbury Laboratory). For cloning procedures see the materials and methods section.

RESULTS AND DISCUSSION

OVERLAY

CHLOROPHYLL

BRIGHT FIELD BRIGHT FIELD

YFP BRIGHT FIELD FIELD OVERLAY BRIGHT

YFP-RBOHD YFP-AGB1

Figure 9. Transient expression of YFP-AGB1 and YFP-RBOHD in Nicotiana benthamiana. N. benthamiana plants were agroinfiltrated with YFP-AGB1 under the control of the 35S CaMv promoter. Confocal microscope images were obtained 48h after infiltration. The 35S::YFP::RbohD construct was included in this experiment as a plasma membrane marker protein (left). These overlay projections show: merged red light (excitation 633 nm) and visible channels (top); and merged yellow fluorescent light (excitation 514 nm) and visible channels (botton). Scale bars = 50µm.

To test if AGB1 associates with RBOHD and/or RBOHF protein complexes during PTI, we performed co-immunoprecipitation assays employing a N. benthamiana transient expression system. We transiently expressed the 35S::YFP::Agb1 construct alone or in combination with the 35S::FLAG::RbohD or 35S::FLAG::RbohF constructs which are schematically represented in Figure 8B. Of note, 72 hpi with 35::FLAG::RbohD, the PAMP-triggered ROS burst is complemented in N. benthamiana plants silenced in NbRbohB, the orthologue of RbohD (Kadota et al., 2014). To evoke the early events of plant-pathogen recognition and induce the dimerization of the flagelline receptor complex, its activation and the generation of the RBOHD- dependent oxidative burst, we treated the agroinfiltrated leaves with flg22 72 hpi. Treated and untreated leaves were subjected to total protein extraction followed by immunoprecipitation with anti-FLAG antibodies conjugated to agarose beads as described (Schwessinger et al., 2011). The potential protein associations were revealed by western-blot analysis with anti-GFP and anti-FLAG antibodies to detect YFP-AGB1 and FLAG-RBOHD or FLAG-RBOHD, respectively (Figure 10A).

RESULTS AND DISCUSSION

In one out of 2 independent experiments, we observed after immunoprecipitation of total proteins with agarose beads conjugated with anti-FLAG antibody that AGB1 co- immunoprecipitated with RBOHF, indicating that both proteins could associate in the same complex (Figure 10A, second pannel). Interestingly, we detected a faint band indicative of a putative co-Immunoprecipitation of AGB1 with RBOHD only upon flg22 treatment (Figure 10A, second pannel). Intriguingly we could only detect the FLAG-tagged RBOHD or RBOHF proteins after immunoprecipitation (Figure 10A, upper panel) but not in the crude extracts (Figure 10A, third panel), where only an unspecific band was observed. In a second repetition of the experiment, we observed a faint band around 70 KDa indicative of co-immunoprecipitation of YFP-AGB1 with FLAG-RBOHF after flg22 treatment (data not shown). Again we failed to detect RBOH proteins and we obtained a low quality detection of YFP-AGB1 in the crude extracts. Thus, a putative association of AGB1 with RBOHD or RBOHF could occur during PTI, although further repetitions of the experiment have to be performed to confirm this.

A B FLAG-RBOHD + + - - - - FLAG-RBOHF - - + + - - YFP-AGB1 - - + + + + YFP-AGB1 + + + + + + BIK1-HA + + - - + + flg22 - + - + - + flg22 - + - + - +

anti-GFP 70 anti-FLAG ** -100 GFP FLAG IP -70 IP anti-HA 40 anti-GFP Crude anti-GFP 70 anti-FLAG * -100 extract Crude anti-HA 40 extract anti-GFP -70 *

Figure 10. Co-Immunoprecipitation of AGB1 with RBOHD, RBOHF and BIK1 before and after PAMP treatmen t. (A) Co-Immunoprecipitation of YFP-AGB1 with FLAG-RBOHD and FLAG-RBOHF. N. benthamiana leaves expressing 35S::YFP::Agb1 alone or in combination with 35S::FLAG::RbohD or

35S::FLAG::RbohF were treated (+) or not (−) with 100 nM flg22 for 15 minutes. Protein extracts were prepared and subjected to immunoprecipitation with FLAG conjugated agarose beads, followed by immunoblot analysis with anti-FLAG antibodies to detect FLAG-RBOHD or FLAG-RBOHF, and anti-GFP antibodies to detect YFP-AGB1. The upper and mid panels show the immunoprecipitated proteins, the lower ones the proteins detected in the input extracts. Of notice, the lanes where samples from total protein crude extracts before immunoprecipitation were loaded (YFP-AGB1 alone) are not shown due to a breakage of the blot prior to immunoblotting. The experiment was performed twice with variable results.

Asterisks indicate unspecific bands. (B) Co-Immunoprecipitation of BIK1-HA with YFP-AGB1. Nicotiana

benthamiana leaves expressing 35S::YFP::Agb1, 35S::Bik1::HA or co-expressing both constructs were treated (+) or not (−) with 100 nm flg22 for 15 minutes. Total proteins (input) were subjected to immunoprecipitation with GFP magnetic beads followed by immunoblot analysis with anti-HA antibodies, to detect BIK1-HA, and anti-GFP antibodies, to detect YFP-AGB1. Molecular mass is indicated in kDa. Experiment was performed twice with the same results.

87 * RESULTS AND DISCUSSION

It has been recently demonstrated that the cytoplasmic Botrytis induced kinase 1 (BIK1) directly interacts with, and phosphorylates RBOHD N-terminus in response to PAMP perception to positively regulate ROS production (Kadota et al., 2014; Li et al., 2014). To further explore a putative interaction of AGB1 with one of the known regulatory mechanisms of RBOHD, we tested whether the BIK1 kinase and AGB1 associate in the same protein complex during PTI. We overexpressed an HA-tagged version of BIK1 (35S::Bik1::HA) together with 35S::YFP::Agb1 in N. benthamiana plants and conducted co-immunoprecipitation assays (Figure 10B). After immunoprecipitation of total proteins with magnetic beads conjugated with anti-GFP antibody, we detected YFP-AGB1 (Figure 10B, upper panel) and BIK1-HA (Figure 10B, second panel) in the lanes where protein extracts from plants co-expressing YFP-AGB1 and BIK1-HA were loaded. This indicates a putative interaction between AGB1 and the cytoplasmic kinase BIK1, pointing towards the presence of AGB1 and BIK1 in the same protein complexes. However, the amount of BIK1-HA protein detected before and after elicitation with flg22 was similar and we could not conclude that the putative interaction was ligand-dependent. Hence, although an unspecific interaction between YFP-AGB1 and BIK1-HA cannot be fully discarded, our results suggest that AGB1 and BIK1 could associate in the same protein complexes.

4.2.8 DISCUSSION

The Gβ subunit of heterotrimeric G proteins (AGB1) plays a crucial role in the immune response to P. syringae

Previous studies indicated that the Arabidopsis Gβ subunit of the heterotrimeric G proteins, AGB1, is important for resistance to several fungi, including the necrotroph PcBMM (Delgado- Cerezo et al., 2012; Llorente et al., 2005; Trusov et al., 2006, 2009). We have extended the relevance of AGB1 in modulating Arabidopsis immune response to pathogens by demonstrating that AGB1 also contributes to basal defense to the bacterium Pto DC3000. The agb1 plants inoculated, either by infiltration or spray, with different Pto DC3000 strains clearly showed increased bacterial growth and disease symptoms compared with those determined in wild-type plants (Figures 1 and 4). Previous studies reported no alterations of bacterial growth in the same agb1 mutant allele after syringe inoculation with either virulent (DC3000) or avirulent (JL1065) strains of P. syringae (Trusov et al., 2006). We cannot rule out that these contradictory results could be due to slight differences in the experimental conditions that we used in comparison with those described previously (Trusov et al., 2006). However, the enhanced susceptibility of the agb1 mutant was corroborated in agb1 gpa1, which was as susceptible as agb1 to all the Pto DC3000 strains tested, including Pto DC3000hrcC (Figures 1 and 4), further indicating that AGB1 contributes to some defensive layers of the immune response to this bacterial pathogen. Two additional studies corroborated the role of the Gβ in the immune response to Pto DC3000 (Liu et al., 2013; Lorek et al., 2013). In agreement with the results of our susceptibility tests, agb1 plants were shown to be impaired in PAMP induced resistance to Pto DC3000 (Liu et al., 2013). It has also been reported that AGB1 is required for the Arabidopsis defense response against: Agrobacterium tumefaciens (Ishikawa, 2009), P.

RESULTS AND DISCUSSION

syringae pv. maculicola, P syringae pv. phaseolicola and P. syringae pv. tabaci (Lee et al., 2013b). Taken all together, these data suggest that heterotrimeric G proteins, and particularly AGB1, could mediate a common signaling mechanism of response to infection by bacteria in plants. Additionally agb1 supports higher growth than wild-type plants of the avirulent bacteria strain Pto DC3000(avrRpm1), which is recognized by the CC-NB-LRR Resistance protein RPM1 (Debener et al., 1991). This was also shown for Pto DC3000(avrRpst2; Torres et al., 2013), indicating that AGB1 takes part in ETI mediated by CC-NB-LRR Resistance protein in Arabidopsis.

Unlike agb1, the gpa1 mutant lacked a susceptibility phenotype to all Pto DC3000 strains tested. On the other hand, agb1 gpa1 showed similar bacterial growth and disease symptoms as agb1 (Figure 1A-B). In line with this data, only agb1 and the agg1 agg2 but not gpa1 plants showed impaired PAMP induced resistance to Pto DC3000 (Liu et al., 2013). Collectively, these data and previous susceptibility analyses in response to necrotrophic and vascular fungi (Delgado-Cerezo et al., 2012; Llorente et al., 2005; Trusov et al., 2006, 2009), indicate that the Gβγ dimer plays a key role in the regulation of Arabidopsis immune response to a wide range of pathogens, whereas the Gα subunit does not seem to play an evident role during these processes. However, a different signaling pathway in Arabidopsis, where GPA1 has a preeminent role, has recently been proposed for Pseudomonas aeruginosa (Cheng et al., 2015). This is a pathogen that infects both plants and animals, which could explain the requirement for different heterotrimeric G proteins subunits.

Although RbohD and RbohF have been related to ROS production in response to many pathogens, we did not observed a susceptibility phenotype to Pto DC3000 in rbohD rbohF, in agreement with previous studies (Marino et al., 2012; Torres et al., 2002). This might be due to the over-accumulation of SA, ET and antimicrobial compounds detected in rbohD and rbohF mutants upon pathogen infection (Chaouch et al., 2012; Pogany et al., 2009), which may compensate for impaired RBOHD and RBOHF downstream responses. We showed that the rbohD rbohF agb1 mutant is as susceptible as agb1 (Figure 3). This result indicates that, in response to Pto DC3000, the RBOH-NADPH oxidases would not participate in additional signaling pathways than those mediated by AGB1.

AGB1 plays a role in several RBOH-dependent immune responses to bacterial pathogens but acts independently of the NADPH oxidases in response to P. cucumerina

In mammals, heterotrimeric G proteins mediate the synthesis of secondary messengers that amplify downstream signaling in response to extracellular cues (Hancock, 2005). H2O2, the end product of RBOH-NADPH oxidases meets the criteria to serve as a secondary messenger in cell signaling and is involved in multiple cell signaling processes (Hancock, 2005; Mitler et al.,

2011). Accordingly, luminol assays showed that the production of RBOH-dependent H2O2 upon flg22 treatment is severely compromised in the agb1 mutant (Figure 2C-D). The ROS burst in response to the fungal PAMP chitin is also impaired in agb1 (Liu et al., 2013). These data

RESULTS AND DISCUSSION

suggest that AGB1 mediates ROS production in response to bacterial and fungal PAMPs.

However, in treatments with full pathogens, DAB staining (stain that detects H2O2 accumulation) was similar in agb1 to that in wild-type plants in response to P. cucumerina (Figure 5C) and was only slightly diminished in agb1 compared to wild-type after inoculation with Pto DC3000hrcC mutant (Figure 2B). Previous reports exist describing that necrotrophic PcBMM infection triggered similar levels of H2O2 accumulation in agb1 as in Col-0 (Llorente et al., 2005). Therefore, additional mechanisms leading to ROS production may exist in these plant-pathogen interactions that work independently of heterotrimeric G proteins.

Activation of heterotrimeric G proteins requires the dissociation of the Gα and the Gβγ subunits (Temple and Jones, 2007). Accordingly, Arabidopsis Gβ forms an obligate dimer with either one of the Arabidopsis Gγ subunits (γ1/AGG1, γ2/AGG2, or γ3/AGG3). Moreover, the Gβ and Gγ1+γ2 subunits were shown to function in the control of Arabidopsis immune responses (Delgado-Cerezo et al., 2012; Jiang et al., 2012b). In line with this model of action, we found that the production of RBOHD-dependent ROS after flg22 treatment, was compromised in agg1 agg2 whereas, in either agg1 or agg2, the level of ROS generated was comparable to wild-type plants (Figure 2C-D). Remarkably, ROS production impairment in agg1 agg2 was similar to that observed in rbohD rbohF, disproving any significant contribution of AGG3 to flg22-triggered ROS production. These results demonstrate that the Gβγ1+γ2 heterodimer constitute the active complex that mediates ROS production during PTI, and are in line with the preeminent contribution of these subunits to the regulation of Arabidopsis innate immunity. These data also suggest that heterotrimeric G proteins could function downstream of some pattern recognition receptors (PRRs), such as the flg22 receptor FLS2 which initiates the signaling pathway for the RBOHD dependent oxidative burst in response to this PAMP (Zhang et al., 2007), as recently demonstrated (Liu et al., 2013).

In our studies the gpa1 mutant displayed wild-type accumulation of H2O2 in response to all the pathogens tested as well as in response to flg22 (Figure 1). Interestingly, we used the same gpa1-4 mutant allele that failed to activate ROS generation by NADPH oxidases in response to high levels of exogenous ozone (Joo et al., 2005). In agreement with our data, it was shown that gpa1 does not contribute to the PAMP triggered ROS burst (Ishikawa, 2009; Jiang et al., 2012b), results that have been recently corroborated (Lee et al., 2013b; Liu et al., 2013). However, silencing of both Gα and Gβ subunits in Nicotiana benthamiana affects defense responses regulated by several microbial elicitors (Zhang et al., 2012b). Thus, the participation of heterotrimeric G proteins subunits in NADPH oxidase derived ROS production can also vary depending on the stress.

In the heterotrimeric G protein mutants tested, we did not observed alterations in cell death, monitored either quantitatively, via conductivity assays (Figure 3B), or qualitatively, by means of TB staining (Figure 2A and 5C). These results are in contrast to those reported following high levels of exogenous ozone or in the response to rice blast (Joo et al. 2005; Suharsono et al. 2002). However, in response to avirulent bacteria, AGB1 loss of function in

RESULTS AND DISCUSSION

leads to reduced RBOHD-dependent ROS production during ETI (Figure 2A) but at the same time restores cell death levels of rbohD rbohF to wild-type values in the rbohD rbohF agb1 combinatorial mutant (Figure 3B). Again, these data indicates that AGB1 functions in the same signaling pathway mediated by the RBOH-NADPH oxidases during avrRpm1 triggered cell death. Given this observations, it is tempting to speculate that AGB1 plays a dual role in cell death regulation during ETI by mediating ROS production and additionally, acting as a negative regulator of cell death in response to avirulent bacteria. A plausible scenario is that AGB1 positively modulates RBOH-dependent ROS production during ETI, whereas the strong accumulation of RBOH-derived ROS during this response could play a negative role in AGB1 signaling which might, in turn, act as a negative regulator of cell death in response to avirulent bacteria in an RBOH-independent manner. On the contrary, GPA1 does not seem to play an evident role in cell death control during Arabidopsis immune response (Figure 2A and 5C). Therefore, our analyses suggest that Gα and Gβ subunits of heterotrimeric G proteins can perform different signaling roles in cell death regulation in different cellular contexts, as previously described during phytochrome-dependent cell death in seedlings and leaf cell death triggered by tunicamycin (Zhang et al., 2012a).

Another line of evidence pointing towards the participation of AGB1 in RBOHD and RBOHF dependent pathways is the partial restoration of the reduced size phenotype of rbohD rbohF observed in six week-old rbohD rbohF agb1 plants (Figure 3A). Alterations in the composition of the cell wall are related to impaired plant growth (Cosgrove, 2005). RBOHD and RBOHF mediate lignification in different cell types (Deness et al., 2011; Lee et al., 2013a) and agb1 was shown to present an altered cell wall composition (Delgado-Cerezo et al., 2012). Thus, it is possible that the specific cell wall composition in rbohD rbohF agb1 could contribute to alleviate the rbohD rbohF mutant phenotype. Moreover, additional work carried out in our research group has shown that the enhanced disease resistance in response to a virulent Hyaloperonospora arabidopsidis isolate in rbohD rbohF, is restored to wild-type values in rbohD rbohF agb1, pointing that Rboh and Gβ signaling might act in the same defense signaling pathway against this biotroph (Torres et al., 2013).

RBOHD plays an important role in the PAMP triggered stomatal closure (Mersman et al., 2010; Macho et al., 2012). Our data indicate that stomata in agb1 are more insensitive to flg22 than in wild-type Col-0 (Figure 6). Hence, we show again evidence of AGB1 taking part in an immune response also mediated by RBOHD. In agreement with our results, AGB1 is required for stomatal immunity against pathogenic bacteria adapted and non-adapted to Arabidopsis (Lee et al., 2013b). In addition, the N. benthamiana Gβ1 and Gβ2 subunits were also shown to be required for full elicitor induced stomatal closure (Zhang et al., 2012b). Intriguingly, RbohF was not previously related to flg22 triggered stomatal closure (Mersman et al., 2010). In contrast, our stomatal closure measurements indicate that rbohF displays a lower sensitivity to flg22 than wild-type Col-0 plants. These apparently contradictory results might be explained by differences in the developmental stage and growth conditions of the plants

RESULTS AND DISCUSSION

employed in our assays, (soil grown, 5-week old plants), and those used by Mersman and collaborators (in vitro grown, 2-week old seedlings).

Similarly to our observations in response to Pto DC3000 strains, gpa1 displayed a similar phenotype as wild-type Col-0 plants in response to PcBMM, whereas the gpa1 agb1 mutant supported the same fungal growth as agb1 (Figure 5). Interestingly, the agg1 agg2 mutant is, like agb1, more susceptible to PcBMM (Delgado-Cerezo et al., 2012), whereas gpa1 plants were shown to display slightly enhanced resistance against this pathogen (Delgado- Cerezo et al., 2012; Llorente et al., 2005). It is tempting to speculate that in the absence of GPA1, that regulates heterotrimer formation and dissociation according to the GTP pool (Urano and Jones, 2014), the Gβγ dimer is free to interact with downstream effectors that mediate immune responses which might compensate for gpa1 loss of function. Our susceptibility tests indicate that, like in response to ozone (Joo et al., 2005), the specific roles of the Gα and Gβ subunits in the plant immune response to necrotrophic fungi can also be different.

Previous data indicate that NADPH oxidases do not operate in all defense signaling pathways in which heterotrimeric G proteins are involved (Suharsono et al., 2002). We found that NADPH oxidases play a role in the immune response to the necrotrophic fungus PcBMM, since rbohD rbohF displayed enhanced susceptibility to this pathogen. However, this function is independent of AGB1, given that rbohD rbohF agb1 plants displayed an enhanced susceptibility to this fungal necrotroph compared with the individual mutants (Figure 5A-B). In agreement with previous studies our epistasis analyses, together with the normal ROS production exhibited by gpa1 or agb1 in response to the necrotrophic fungus (Figure 5C), lead us to conclude that AGB1 mediates additional, RBOH-independent functions in the immune response to PcBMM.

AGB1 plays a putative role in the regulation of RbohD expression and potentially associates with NADPH oxidase protein complexes in plant immunity

We have shown that the Gβγ heterodimer plays a role in RBOH-dependent signaling in response to bacterial pathogens. To further understand the role that heterotrimeric G proteins play in the RBOH regulation of ROS production during the immune response, we first checked if AGB1 loss of function influenced Rboh expression during the plant immune response. Our qRT- PCR analyses revealed that the induction of RbohD upon flg22 treatment was significantly lower than in wild type Col-0 seedlings, whereas RbohF expression remained unaltered (Figure 7). Thus, at least in this developmental stage, RbohD transcriptional regulation during the immune response seems to be altered in agb1. We have previously shown that induction of RbohD and RbohF genes parallels ROS production and cell death in response to different pathogens (Chapter 4.1, Figures 2 and 5). Therefore, the observed alteration of RbohD expression in agb1, could partially explain the impairment in RBOHD-mediated immune responses to bacterial pathogens displayed by the Gβ loss of function mutant. The observed alteration of RbohD expression might contribute to explain the agb1 phenotype in responses occurring later such as the impaired ROS production during ETI (Figure 2A) and the compromised stomatal closure in

RESULTS AND DISCUSSION

response to flg22 (Figure 6). However this reduction in RbohD transcript accumulation, does not explain the diminished PAMP-triggered oxidative burst in agb1 plants (Figure 2), which is an early PTI event that occurs between 5 to 20 minutes after PAMP treatment (Nicaise et al., 2009). Interestingly, it has been reported that RbohF expression is altered 12 and 24 hpi with host and non-host bacterial pathogens in gpa1, agb1 and agg1 agg2 mutants (Lee et al., 2013b). Hence, heterotrimeric G proteins seem to play a broad role in Rboh transcriptional regulation. Whether the Gα subunit or the Gβγ heterodimer directly participates in the signaling pathway that controls Rboh expression during the immune response, and how this regulation takes place, remains to be determined.

We also tested the potential association between AGB1 with protein complexes that activate RBOHD in early events of the immune response (Kadota et al., 2014). Although the contribution of RBOHF in ROS production during PTI remains elusive, NbRbohA, the N. benthamiana orthologue of RbohF is required for full elicitor induced stomatal closure (Zhang et al., 2009). Moreover, RbohF and AGB1 have been shown to mediate ABA dependent stomatal regulation (Fan et al., 2008; Kwak et al., 2003). Therefore, we also evaluated the putative association of AGB1 with RBOHF during PTI. We employed a YFP-tagged version of AGB1 and FLAG-tagged versions of RBOHD (Kadota et al., 2014) and RBOHF, to conduct co- immunoprecipitation experiments (Schwessinger et al., 2011). The transiently overexpressed version of AGB1 was detected at the plasma membrane and the nucleus of epidermal cells, as previously described (Anderson et al., 2007), indicating that an interaction between the chimeric Gβ and the plasma membrane located RBOH-NADPH oxidases (Torres and Dangl, 2005) is possible (Figure 9). In one out of two co-immunoprecipitation assays, we observed that YFP- AGB1 co-immunoprecipitated with FLAG-RBOHF (Figure 10A). Moreover, upon flg22 treatment we detected a faint band indicative of a putative co-immunoprecipitation of AGB1 with RBOHD (Figure 10A). Thus, both RBOH proteins could associate in the same complex with AGB1.

Given that AGB1 is required for the ROS burst triggered by different PAMPs and some PTI responses initiated by RKs (Liu et al., 2013; Nitta et al., 2014), the association of AGB1 in the same protein complexes than RBOHD during PTI is plausible. Interestingly, reports exist indicating that the Gβ and RBOHF are involved in the regulation of stomatal aperture in response to pathogen elicitors (Zhang et al., 2009; Zhang et al., 2012b) and ABA (Fan et al., 2008; Kwak et al., 2003; Wang et al., 2001). In addition, our results indicate that AGB1 and RBOHD also plays a key role in stomatal closure in response to flg22 (Figure 7), in agreement with the AGB1 described role in stomatal immunity (Lee et al., 2013b). Therefore the regulation of guard cells could be a convergent physiological response where AGB1 and these NADPH oxidases could interact. However, we were not able to reproduce our co-immunoprecipitation results, and due to the technical issues described previously, the potential interaction between AGB1 and RBOHD and/or RBOHF remains to be confirmed.

Recently it has been shown that RBOHD exists in plasma membrane receptor complexes that recognize bacterial PAMPs. There, RBOHD associates with different RKs and is

RESULTS AND DISCUSSION

activated through BIK1 phosphorylation to generate ROS after PAMP perception (Kadota et al., 2014; Li et al., 2014). Evidences pointed towards a probable interaction between this receptor- like cytoplasmic kinase BIK1 and AGB1. BIK1 functions downstream of PRRs (FLS2, EFR and CERK1) to regulate the PAMP-triggered oxidative burst, and like agb1 and agg1 agg2 mutants, bik1 plants exhibit reduced ROS production after treatment with flg22, elf18 and chitin (Lu et al., 2010; Zhang et al., 2010). Similarly, AGB1 and AGG1/2 have been shown to function downstream of the RKs FLS2, EFR and CERK1 to regulate defense signaling upon PAMP perception, including the PAMP-triggered oxidative burst (Liu et al., 2013). Here we show that when transiently overexpressed in N. benthamiana, BIK1-HA associates with YFP-AGB1. The combination of GFP (which is structurally very similar to YFP) and HA tagged proteins, has been previously used to successfully carry out co-immunoprecipitation assays between EFR and the co-receptor BAK1 or the RLCK BIK1 (Roux et al., 2011; Holton et al., 2015). This indicates that although unspecific interactions between YFP-AGB1 and BIK1-HA cannot be completely ruled out, they are not likely to occur. However, BIK1-HA was co-immunoprecipitated with YFP-AGB1 in a ligand independent manner, since we observed a similar level of BIK1-HA co-immunoprecipitated before and after elicitation with flg22 (Figure 10B). Thus, although we observed a putative association between these two signaling nodes of plant immunity in the same protein complexes, the biological relevance of this interaction remains to be addressed.

Our results indicate a complex relationship between the signaling roles of ROS produced by NADPH oxidase and the heterotrimeric G proteins, in which their functional interaction varies depending of the type of plant-pathogen interaction studied. The diversity of functions observed between the heterotrimeric G proteins subunits, may be based on the complexity of multiple, specific interactions of the Gβγ and the Gα functional subunits with potential signaling components that exist in plants (Klopffleisch et al., 2011). We have shown evidence that indicates a potential association between AGB1 and BIK1 and a putative implication of the Gβ in RbohD expression. These findings might contribute to understand the role of the Arabidopsis heterotrimeric G-protein β-subunit in RBOH-mediated immune signaling. Moreover, increasing data indicate that heterotrimeric G proteins transduce signals from different leucine rich receptors in different contexts (Bomert et al., 2013; Liu et al., 2013; Shuarshono et al., 2002; Zhang et al., 2008; this work). Thus, further protein-protein interaction experiments between AGB1, BIK1 and additional leucine rich repeats RKs present in the receptor complexes in Arabidopsis might help positioning heterotrimeric G protein function in PTI and to infer the mechanism of activation.

GENERAL DISCUSSION

5. GENERAL DISCUSSION

GENERAL DISCUSSION

5. GENERAL DISCUSSION

The RBOH-NADPH oxidases comprise an enzymatic family that produces ROS acting as signals in a wide range of processes in plants. Two of these oxidases, RBOHD and RBOHF, play many different signaling roles in plant immunity (Suzuki et al., 2011; Marino et al., 2012). However, the precise way in which these two oxidases are regulated and achieve their functional specificity is not fully understood. We hypothesize that transcriptional regulation, on one hand, and protein interaction with regulatory partners, on the other, may contribute to specify the signaling role of these enzymes.

In this work, we explored the gene expression pattern of RbohD and RbohF during different events of the Arabidopsis immune response, and the relevance of their promoter regions to determine the specific ROS production during the Arabidopsis response to pathogens. Moreover, to broaden the map of interactors that modulate RBOHD and RBOHF signaling during plant microbe interactions, we explored the functional interplay of RBOH- NADPH oxidases and heterotrimeric G-proteins, a modular system of proteins that plays an important signaling role in plant immunity.

During PTI, RBOHD acts downstream of the PRRs and actively generates ROS that, in coordination with other signals, mediates responses such as: callose deposition, stomatal closure and defense gene activation (Dubiella et al., 2013; Luna et al., 2011; Kadota et al., 2014; Mersman et al., 2013). In early PTI, within the first 5 minutes after PAMP treatment, RBOHD has been shown to be part of PRR receptor complexes were it is first phosphorylated by the RLCK BIK1. This phosphorylation activates ROS production by this oxidase and seems to poise RBOHD for the subsequent phosphorylation by CPKs (Dubiella et al., 2013; Kadota et al., 2014; Li et al 2014). In this context, it is interesting to speculate with the possibility of AGB1 interacting with members of this receptor complex that includes RBOHD. As depicted in Figure 1, the Gβγ heterodimer of heterotrimeric G-proteins is required for full ROS production in response to flg22 (Chapter 4.2, Figure 2). Moreover, the Gβγ was shown to act downstream of PRRs in PTI and to modulate ROS production in response to elf18 and chitin in addition to flg22 (Liu et al., 2013). Therefore, the potential association between AGB1 with the RBOH during PTI would provide a possible explanation on how AGB1 mediates ROS production in response to pathogens (Chapter 4.2, Figure 10A). Our co-immunoprecipitation experiments point also towards an association of AGB1 and BIK1 in the same protein complexes, although this association was ligand-independent (Chapter 4.2, Figure 10B). Therefore, this putative interaction would contribute with an additional mechanism to explain how AGB1 could possibly regulate ROS production. However, further analyses in the Arabidopsis stable expression system are needed to understand the relevance of this association for the regulation of the ROS burst and other PTI responses and to clarify the mechanism of action.

Stomatal closure is one of the physiological responses after PAMP treatment in which heterotrimeric G proteins and NADPH oxidases also coalesce. In line with the impairment of

GENERAL DISCUSSION

agb1 in antibacterial stomatal immunity (Lee et al., 2013b), we found that the Gβ is required for flg22 triggered stomatal closure (Chaper 4.2, Figure 6). Interestingly, we also found evidence pointing towards RBOHF being required for full PAMP triggered stomatal closure. These results agree with increasing data showing that heterotrimeric G-proteins are involved in PAMP and ABA mediated stomatal closure (Nitta et al., 2014), responses that are also modulated by RBOHD and RBOHF (Mersman et al., 2013; Song et al., 2013). Therefore, stomatal regulation might be a convergent physiological response for RBOH and heterotrimeric G protein signaling.

PAMPs (flg22)

PRRs (FLS2) P 2+ ? Ca BIK1 Gβγ1/2 P CPKs P RBOHD Early events < (5 mpt) RBOHF ROS

Defense gene Callose activation Stomatal deposition closure WRKY? GT-1? RbohD Late events

Figure 1. Regulation of RbohD gene expression and RBOH-dependent immune signaling during PTI.

In Arabidopsis, flg22 perception triggers the phosphorylation of the cytoplasmic domains of FLS2 and BAK1, as well as the RLCK BIK1. Activated BIK1 gets released from the receptor complex, leading to phosphorylation and activation of the NADPH oxidase RBOHD. Likewise, BIK1 is required for the ROS burst triggered by the chitin-induced activation of CERK1. One of the earliest PAMP-induced intracellular signaling events is an increase in the intracellular Ca2+ concentration and the associated activation of CPK5 which leads to RBOHD phosphorylation. The AGB1/(AGG1/AGG2) heterodimer acts downstream of PRRs after PAMP perception and plays a role in RBOHD-dependent ROS production by a yet unknown mechanism that could involve an interaction between the Gβγ and BIK1. RBOHD dependent ROS mediates, in coordination with additional signals, subsequent later defense responses including: callose deposition, stomatal closure and defense gene activation. Like RBOHD, AGB1 is also required for flg22 triggered stomatal closure whereas RBOHF seems to play a minor role in this response. Interestingly, RbohD gene expression itself is induced 20 minutes after PAMP treatment, possibly contributing to the recycling of RBOHD proteins to the plasma membrane to ensure ROS production if the pathogen threat persists. Putative CIS elements for the binding of WRKY and GT-1 transcription factors were predicted in

RbohD promoter, indicating a putative role of these TFs in RbohD transcriptional regulation in response to PAMPs or other immunity related cues.

GENERAL DISCUSSION

The functional analysis of the promoter region of RbohD and RbohF reveals that these two genes are differentially activated in response to pathogens (Chapter 4.1, Figures 3 to 6). Moreover, our promoter-swap experiments suggest that the differential spatio-temporal upregulation of these genes is important to specify ROS production during immunity (Chapter 4.1, Figure 12). The promoter of RbohD is necessary to drive RbohD-dependent ROS production, since pRbohD-HA-RbohD restores DAB staining after PcBMM inoculation in rbohD mutant background, whereas pRbohF-HA-RbohD fails to complement the mutant phenotype. Therefore, the promoter of these genes must contain important features that specify ROS production in response to pathogens. However, the RbohD promoter is not sufficient to drive this ROS production since pRbohD-HA-RbohF does not complement either the rbohD mutant, further indicating that the structural part of these RBOH proteins harbors important determinants that fine-tune ROS production by different isoforms of the plant NADPH oxidase in the context of the defense response.

Interestingly, RbohD promoter activity is rapidly upregulated upon PAMP treatment. This activation starts around 20 mpt with flg22 and is maintained in the presence of the PAMP (Chapter 4.1, Figure 8). This induction possibly ensures a continuous supply of NADPH oxidases to the plasma membrane to maintain ROS production while the threat for the plant persists. Additionally, the phylogenetic comparison of RbohD promoters indicate the presence of putative CIS elements for WRK1 and GT-1, which are involved in transcriptional reprograming in response to pathogens (Chapter 4.1, Figure 13). Therefore, it is plausible that some of this type of TFs could control RbohD expression during the immune response. Further experiments are needed to find the transcriptional regulators of RBOHD in response to PAMPs. In this regard, the determination of the core sequence of RbohD promoter for gene induction in response to flg22, using the pD-LUC line and one-hybrid experiments between this region and different members of the WRKY and GT-1 transcription factor families, combined with the analysis of ROS production in different wrky and gt-1 loss of function mutants would provide valuable information about the mechanism that regulates RbohD expression during immunity. Interestingly, we observed that RbohD induction after PAMP treatment is compromised by loss of function of Agb1 (Chapter 4.2, Figure 7), pointing towards a putative implication of AGB1 not only in the fast activation of RBOHD at the protein level, but also in a later induction of RbohD gene expression.

In response to avirulent bacteria infection, a transient activation of RbohD and RbohF promoters between 4 and 6 hpi was observed temporally matching the accumulation of H2O2 monitored by DAB (Chapter 4.1, Figure 3; Torres et al., 2002). Again, this transcriptional induction may allow the maintenance of NADPH oxidase levels necessary to generate the high amount of H2O2 that correlates with the successful recognition of avirulent pathogens by the plant. WRKY46 (among other WRKYs) might be a good candidate for this regulation, since the release of AvrRpm1 within the plant cell triggers a strong induction of WRKY46 between 2 and 6 hpi in a Ca2+ dependent manner (Gao et al., 2013). This induction is dependent on CPKs and

GENERAL DISCUSSION

other WRKYs. AvrRpm1 induces the expression of CPKs 1/2/4/5/6/11. CPKs 4/5/6/11 have been shown to phosphorylate in vitro WRKY 8, 28 and 48 enhancing the binding activity of these TFs to the W-boxes of the WRKY46 promoter. Additionally, CPKs 1/2/4/11 were shown to phosphorylate in vitro the N-termini of RBOHD and RBOHF and CPKs 1/2 are required for the effector-triggered ROS burst (Gao et al., 2013). Since WRKY 8, 28 and 48 were shown to regulate the WRKY46 TF (Gao et al., 2013), and we predicted several putative W-boxes in RbohD promoter, it is tempting to speculate that some of these WRKYs could be involved in the induction of RbohD expression during ETI. Intriguingly, although RBOHF is required for the HR (Torres et al., 2002), the specific contribution of RBOHF to ROS production during ETI remains elusive. It has been proposed that could positively modulate RBOHD-dependent ROS production in response to avirulent bacteria (Chaouch et al., 2012). In line with this idea, we detected that RbohF follows a similar trend of transcriptional activation as RbohD in response to Pto DC3000(avrRpm1) (Chapter 4.1, Figure 3 and 4). Hence, although the mechanism remains elusive, our data is in agreement with RBOHF playing a role in ETI in coordination with RBOHD.

One of the main focuses in our laboratory is the study of the defense mechanisms of Arabidopsis against the necrotrophic fungus Plectosphaerella cucumerina. Previous work described that AGB1 is an important mediator of the defense response to this pathogen (Delgado-Cerezo et al., 2012; Llorente et al., 2005). We have shown that RbohD and RbohF promoters activity is strongly induced in response to PcBMM. Of particular interest is the observed RbohD promoter upregulation that matches the pattern of ROS accumulation and cell death in the infected plant tissues (Chapter 4.1, Figure 5 and 6). This transcriptional activation fits with the RbohD role during early events of the plant immune response (Zhang et al., 2007; Kadota et al., 2014) and during the regulation of cell death in response to pathogens (Pogany et al., 2009; Torres et al., 2005), pointing towards a preeminent function of this oxidase in the immune response to this necrotroph. As a matter of fact, our susceptibility assays show that RbohD and RbohF are required for the full resistance against PcBMM (Chapter 4.2, Figure 5).

In line with our data, RbohD has been related to the Arabidopsis immune response to several necrotrophic pathogens (Marino et al., 2012). However, some studies report that pathogens with a necrotrophic phase could benefit from ROS produced by the host to promote cell death, contributing to disease progression (Torres et al., 2010). While the double mutant rbohD rbohF is more susceptible to Sclerotinia sclerotiorum compared to wild-type Col-0 (Perchepied et al., 2011), rbohD was shown to be equally resistant to Botrytis cinerea (Galleti et al., 2008) and even more resistant to Alternaria brassicicola (Pogany et al., 2009). Thus, although the RBOHD and RBOHF contribute to the immune signaling in response to necrotrophs, their roles in disease progression may vary depending on the pathosystem analysed and even plant growth conditions or inoculation methods. In view of the role of RBOH- dependent ROS in the response to necrotrophic pathogens, it might be useful to contemplate these ROS produced in response to external threats, as signal transducers that balance the cell fate between life and death rather than noxious chemicals that just kill the pathogen (Torres et

GENERAL DISCUSSION

al., 2010; Coll et al., 2011; O´Brien et al., 2012). It is also interesting to bare in mind that rbohD and rbohF mutants are known to accumulate different antimicrobial compounds and increased SA and ET levels upon infection (Chaouch et al., Pogany et al., 2009). These possibly act as compensatory mechanisms for the partial loss of immunity normally caused by impaired PAMP- induced responses mediated by RbohD (Kadota et al 2014). Therefore, despite the susceptibility assays using rbohD and rbohF mutants have been essential to pin point the functions mediated by plant NADPH oxidases, they may lead to misleading conclusions about the actual role of RBOH-dependent ROS during innate immunity.

Intriguingly, our epistasis analyses indicate that heterotrimeric G proteins are not required for RBOHD-dependent ROS production in response to P. cucumerina and that RBOH- mediated immune signaling in response to this necrotroph is independent of the Gβγ heterodimer (Chapter 4.2, Figure 5). Arabidopsis immune response to necrotrophic fungi is genetically complex. In the defense response to PcBMM, genetic analyses have demonstrated that ET, JA and SA signaling cooperate to arrest the progression of Arabidopsis colonization by the pathogen, whereas ABA signaling has a complex function in Arabidopsis basal resistance, negatively regulating SA/JA/ET mediated resistance to PcBMM (Sanchez-Vallet et al., 2010). Moreover the RLK ERECTA and the Gβγ heterodimer are required for the full immune response to PcBMM and mediate independent defense signaling pathways (Delgado-Cerezo et al., 2012; Llorente et al., 2005; Trusov et al., 2006). Interestingly, ERECTA and the Gβγ mediate independently cell wall derived signaling upon PcBMM infection (Hernández-Blanco et al., 2007; Sánchez-Rodriguez et al., 2009; Delgado-Cerezo et al., 2012). Also, secondary metabolites, such as phytoalexins (e.g. camalexin) or other tryptophan-derived metabolites (e.g. indolglucosinolates), contribute to Arabidopsis resistance to PcBMM (Sánchez-Vallet et al., 2010). To further understand the interplay between ROS production and other key players of the early immune response to necrotrophic fungi, it would be interesting to analyze if RBOH- dependent ROS production is coordinated and acts downstream of the RLK ERECTA and if the alteration in cell wall structure and composition upon PcBMM attack impinges ROS production by the NADPH oxidases. Additionally, since BIK1, has been shown to regulate RBOHD activity upon bacterial PAMP perception (Kadota et al., 2014; Li et al., 2014), it would be relevant to test if this is a conserved mechanisms of regulation in ROS production by the NADPH oxidase in response to necrotrophic fungi.

Arabidopsis resistance to the non-adapted P. cucumerina isolate 2127 (Pc2127) is mainly mediated by tryptophan-derived secondary metabolites, while ET/SA/JA signaling pathways and the cell wall structure play a minor contribution to this response (Sánchez-Vallet et al., 2010). Our work indicates that the RBOH-NADPH oxidases also function in Arabidopsis non-host resistance. Treatment with the fungal PAMP chitin induces RbohD promoter activity (Chapter 4.1, Figure 8). Moreover, RbohD promoter was strongly induced 24 hpi after inoculation with Pc2127 in the absence of macroscopic necrotic lesions (Chaper 4.1, Figure 5). Thus, RbohD likely participates in early recognition of the fungus. In agreement with previous

100

GENERAL DISCUSSION

studies that suggested a role for RBOHD and RBOHF in non-host resistance (Yoshioka et al., 2003; Nozaki et al., 2013), our expression and susceptibility assays show that RBOHD and RBOHF are required for full non-host resistance to Pc2127 (Chapter 4.1, Figures 5, 6 and 7). Interestingly, in comparison with PcBMM, the expression of RbohD was notably lower after Pc2127, and induction of RbohF promoter almost undetectable, indicating a correlation between the spatial and temporal promoter activation of RbohD and RbohF with the level of ROS production and cell death in response to adapted and non-adapted P. cucumerina isolates (Chapter 4.1, Figure 5 and 6). These data suggest that the transcriptional regulation of these oxidases might contribute to modulate the strength of the immune response to different microbial threats.

Pc2127

PAMPs Trp derived DAMPs metabolites Cell wall SA ? ET ? JA RbohD RbohF

ROS

MODULATION OF THE IMMUNE RESPONSE

NON-HOST RESISTANCE

Figure 2. RbohD and RbohF play a role in the Arabidopsis non-host resistance to P. cucumerina isolate 2127. After germination of Pc2127 spores the activation of defense mechanisms takes place and the synthesis and release of tryptophan secondary metabolites arrest the fungus hyphal development. The cell wall structure and hormone signaling pathways play a minor role in these defense responses. RbohD, which acts in coordination with the SA ET and JA pathways during plant immunity, is transcriptionally induced and activated for ROS production in response to this fungus. Fungal PAMPs including chitin but also DAMPs released from the cell wall during P. cucumerina germination might induce the expression and activation of this NADPH oxidase. Although RbohF is not notably induced in early stages of this interaction, the rbohD rbohF mutant displayed enhanced susceptibility to the non-adapted fungus than wild-type Col-0 or the individual mutants rbohD and rbohF, indicating that both oxidases act coordinately and are required for full Arabidopsis non-host resistance to Pc2127.

101

GENERAL DISCUSSION

Fine tuning ROS signaling to provide an appropriate response to environmental threats is a key aspect for plant survival (Mittler et al., 2004; 2011). RBOH-NADPH oxidases mediate multiple processes essential for plants, such as immune responses, cell death control, root-hair formation, pollen tube growth, lignification, systemic signaling, salinity and drought stress response and stomatal closure (Suzuki et al., 2011; Marino et al., 2012). This multiplicity of functions, together with the capability of RBOHs to integrate different transduction pathways indicate the relevance of these proteins and place them as important nodes in the plant ROS- signaling network. Although the involvement of RBOHs in the plant immune response is known for several years, we are just starting to understand how RBOH-dependent ROS signaling specificity is determined during plant immunity. The research work presented here provides further insights into the regulation of NADPH oxidase signaling in immunity at the transcriptional level and by other modulators of the defense response such as heterotrimeric G proteins. Future efforts are needed to unravel the specific molecular mechanisms by which ROS generated by RBOHD and RBOHF mediate the physiological responses that contribute to resistance in plant-microbe interactions.

102

CONCLUSIONS

6. CONCLUSIONS

103

CONCLUSIONS

6. CONCLUSIONS

1. RbohD and RbohF dispaly a differential spatio-temporal expression pattern and gene expression level during the Arabidopsis immune response. Through the analysis of transgenic lines with RbohD or RbohF promoters driving the β-glucuronidase and Luciferase reporter genes, we showed that these two Rboh present a differential activation and expression pattern in response to the hemibiotrophic bacterium Pto DC3000 and to the necrotrophic fungus P. cucumerina.

2. The spatio-temporal expression pattern driven by RbohD and RbohF promoters correlates with the level of ROS production and cell death in response to adapted and non-adapted microbes, suggesting that the transcriptional regulation of these oxidases might contribute to modulate the strength of the immune response to different microbial threats.

3. PAMPs and ABA differentially regulate Rboh promoter activity. While PAMPs up-regulate RbohD, ABA induces RbohF. These defense-related cues might contribute to modulate the specific transcriptional regulation of RbohD and RbohF during immunity.

4. The promoter region of RbohD is necessary to drive RbohD-dependent ROS production in response to pathogens, as indicated by the promoter-swap strategy. Thus, intrinsic differences between RbohD and RbohF promoters govern the pattern of ROS production during Arabidopsis immune response. However, the RbohD promoter is not sufficient to drive ROS by these oxidases.

5. Binding regions for common and distinct cis-regulatory DNA elements have been predicted in the promoter regions of RbohD and RbohF. These elements are potential modulators of RbohD and RbohF transcriptional control upon pathogen challenge.

6. RbohD and RbohF are required for Arabidopsis non-host resistance to non-adapted P. cucumerina, since the rbohD rbohF double mutant is more susceptible to isolate Pc2127.

7. The β-subunit of heterotrimeric G-proteins (AGB1) is a component of Arabidopsis immune response to P. syringae. Patho-tests carried out using different strains of Pto DC3000 revealed that AGB1 plays a role in basal resistance to this bacterium and is involved in ETI.

8. The Gβγ heterodimer is required for RbohD-dependent ROS production during PTI and ETI. Histochemical DAB stains and quantitative luminol assays showed that ROS production is impaired in the agb1 mutant and abolished in the agg1 agg2 mutant.

104

CONCLUSIONS

9. AGB1 is necessary for the activation of some defense signalling pathways mediated by RbohD and RbohF. Epistasis analyses indicate that Agb1 loss of function attenuates the reduced cell death phenotype of the rbohD rbohF mutant during the HR. In addition, the agb1 mutant is impaired in flg22 triggered stomatal closure, a response also mediated by RbohD.

10. The RBOH-NADPH oxidases act independently of AGB1 during the Arabidopsis immune response to P. cucumerina. Epistasis analyses showed an additive susceptibility in the rbohD rbohF agb1 combinatorial mutant as compared with the rbohD rbohF and agb1 mutants.

11. AGB1 is required for full RbohD transcript accumulation in response to flg22. Our expression analyses indicate that AGB1 plays a potential role in the regulation of RbohD expression in plant immunity.

12. AGB1 could form part of the same protein complexes with the RBOHD regulatory kinase BIK1. BIK1 was co-immunoprecipitated with AGB1 after transient overexpression in N. benthamiana. Since this association was ligand-independent, the biological relevance of this potential association remains to be addressed.

105

REFERENCES

7. REFERENCES

106

REFERENCES

Agrios, G. N. (2005). Plant pathology, 5th edn, Elsevier Academic Press, Burlington, Mass: 887-901

Alvarez, M. E., Pennell, R. I., Meijer, P. J. , Ishikawa, A., Dixon, R. A., and Lamb, C. (1998) Reactive oxygen intermediatesmediate a systemic signal network in the establishment of plant immunity. Cell, 92(6): 773–784.

Anderson, D.J, and Botella, JR. (2007). Expression analysis and subcellular localization of the Arabidopsis thaliana G-protein beta-subunit AGB1. Plant Cell Reports, 26(9): 1469-1480.

Apel, K., & Hirt, H. (2004). Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology, 55: 373–99.

Arthikala, M.K., Sánchez-López, R., Nava, N., Santana, O., Cárdenas, L., Quinto, C. (2014). RbohB, a Phaseolus vulgaris NADPH oxidase gene, enhances symbiosome number, bacteroid size, and nitrogen fixation in nodules and impairs mycorrhizal colonization. New Phytologist, 202(3): 886-900.

Asada, K. (2006). Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiology, 141(2): 391–6.

Bais, H. P., Vepachedu, R. and Gilroy, S. (2003). Allelopathy and Exotic Plant Invasion. Science, 301(September): 1377–1380.

Banfi, B., Tirone, F., Durussel, I., Knisz, J., Moskwa, P., Molnar, G.Z., Krause, K.H. and Cox, J.A. (2004). Mechanism of Ca21 activation of the NADPH oxidase 5 (NOX5). Journal of Biological Chemistry, 279: 18583–18591

Bari, R. and Jones, J.D. (2009). Role of plant hormones in plant defence responses. Plant Molecular Biology, 69: 473–488

Bedard, K., Lardy, B. and Krause, K.H. (2007). NOX family NADPH oxidases: not just in mammals. Biochimie, 89(9), 1107–12.

Bednarek, P., Piślewska-Bednarek, M., Svatoš, A., Schneider, B., Doubský, J., Mansurova, M., Humphry, M., Consonni, C., Panstruga, R., Sanchez-Vallet, A., Molina, A. and Schulze-Lefert, P. (2009). A Glucosinolate Metabolism Pathway in Living Plant Cells Mediates Broad-Spectrum Antifungal Defense. Science, 323 (5910 ): 101–106.

Berrocal-Lobo, M. and Molina, A. (2004). Ethylene response factor 1 mediates Arabidopsis resistance to the soilborne fungus Fusarium oxysporum. Molecualr Plant Microbe Interactions, 17(7): 763-70.

107

REFERENCES

Berrocal-Lobo, M., Molina, A. and Solano, R. (2002). Constitutive expression of ETHYLENE- RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. Plant Journal, 29: 23–32.

Berrocal-Lobo, M., Stone, S., Yang, X., Antico, J., Callis, J., Ramonell, K.M. and Somerville, S. (2010) ATL9, a RING zinc finger protein with E3 ubiquitin ligase activity implicated in chitin- and NADPH oxidase- mediated defense responses. PloS ONE, 2: e501

Bestwick, C.S., Bennett, M.H., Mansfield, J.W. (1995). Hrp mutant of Pseudo- monas syringae pv. phaseolicola induces cell wall alterations but not membrane damage leading to the hypersensitive reaction in lettuce. Plant Physiology. 108: 503–516.

Bethke, P.C. and Jones, R.L. (2001). Cell death of barley aleurone protoplasts is mediated by reactive oxygen species. Plant Journal. 25(1):19-29.

Bhattacharjee, S. (2005). Reactive oxygen species and oxidative burst : Roles in stress , senescence and signal transduction in plants. Current Science, 89(7).

Bhattacharjee, S. (2012). The Language of Reactive Oxygen Species Signaling in Plants. Journal of Botany: 1–22.

Bienert, G. P., Schjoerring, J. K., and Jahn, T. P. (2006). Membrane transport of hydrogen peroxide. Biochimica et Biophysica Acta, 1758: 994–1003.

Boffelli, D., McAuliffe, J., Ovcharenko, D., Lewis, K.D., Ovcharenko, I., Pachter, L. and Rubin, E.M. (2003). Phylogenetic shadowing of primate sequences to find functional regions of the human genome. Science, 299: 1391–1393.

Bommert, P., Je, B.I., Goldshmidt, A. and Jackson, D. (2013). The maize Ga gene COMPACT PLANT2 functions in CLAVATA signalling to control shoot meristem size. Nature, 502: 555–558.

Booker, F., Burkey, KBouchez, O., Huard, C., Lorrain, S., Roby, D. and Balague, C. (2007). Ethylene is one of the key elements for cell death and defense response control in the Arabidopsis lesion mimic mutant vad1. Plant Physiol 145: 465–477

Bouchez, O., Huard, C., Lorrain, S., Roby D. and Balague, C. (2007) Ethylene is one of the key elements for cell death and defense response control in the Arabidopsis lesion mimic mutant vad1. Plant Physiology, 145: 465–477.

Boudsocq, M. and Sheen, J. (2013). CDPKs in immune and stress signaling. Trends Plant Science,18(1):30–40.

108

REFERENCES

Bradley, D.J., Kjellbom, P., and Lamb, C.J. (1992). Elicitor- and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: A novel, rapid defense response. Cell, 70: 21–30

Cadenas, E. (1989). Biochemistry of oxygen toxicity. Annual Review Biochemistry, 58:79-110.

Calderon-Villalobos, L. I. a, Kuhnle, C., Li, H., Rosso, M., Weisshaar, B. and Schwechheimer, C. (2006). LucTrap vectors are tools to generate luciferase fusions for the quantification of transcript and protein abundance in vivo. Plant Physiol, 141, 3–14.

Canton, J. and Grinstein, S. (2014). Priming and activation of NADPH oxidases in plants and animals. Trends in Immunology, 35(9): 405–7.

Cantu, D., Vicente, A.R., Labavitch, J.M., Bennett, A.B., and Powell, A.L. (2008). Strangers in the matrix: plant cell walls and pathogen susceptibility. Trends in Plant Science 13: 610– 617.

Cartharius, K., Frech, K., Grote, K., Klocke, B., Haltmeier, M., Klingenhoff, A., Frisch, M., Bayerlein, M. and Werner, T. (2005) MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics, 21 (13): 2933-2942.

Chakravorty, D., Trusov, Y., Zhang, W., Acharya, B.R., Sheahan, M.B., McCurdy, D.W., Assmann, S.M., and Botella, J.R. (2011). An atypical heterotrimeric Gprotein gamma- subunit is involved in guard cell K(+)-channel regulation and morphological development in Arabidopsis thaliana. Plant Journal, 67: 840-851.

Chaouch, S., Queval, G. and Noctor, G. (2012). AtRbohF is a crucial modulator of defence- associated metabolism and a key actor in the interplay between intracellular oxidative stress and pathogenesis responses in Arabidopsis. Plant Journal, 69(4): 613–27.

Chen, Y. L., Huang, R., Xiao, Y. M., Lu, P., Chen, J., and Wang, X. C. (2004). Extracellular

calmodulin-induced stomatal closure is mediated by heterotrimeric G protein and H2O2. Plant Physiology, 136: 4096-4103.

Chen, S.X. and Schopfer, P. (1999). Hydroxyl-radical production in physiological reactions. A novel function of peroxidase. European Journal of Biochemistry, 260: 726–735.

Chen J.G, Willard FS, Huang J, Liang J, Chasse SA, Jones A.M. and Siderovski D.P. (2003). A seven-transmembrane RGS protein that modulates plant cell proliferation. Science, 301:1728–31

109

REFERENCES

Cheng, C., Xu, X., Gao, M., Li, J., Guo, C., Song, J. and Wang, X. (2013). Genome-wide analysis of respiratory burst oxidase homologs in grape (Vitis vinifera L.). International Journal of Molecular Sciences, 14: 24169–24186.

Cheng, Z., Li, J.F., Niu, Y., Zhang, X.C., Woody, O.Z., Xiong, Y., Djonović, S., Millet, Y., Bush, J., McConkey, B.J., Sheen, J. and Ausubel, F.M. (2015). Pathogen-secreted proteases activate a novel plant immune pathway. Nature, March. [Epub ahead of print].

Cliften, P.F., Hillier, L.W., Fulton, L., Graves, T., Miner, T., Gish, W.R., Water- ston, R.H. and Johnston, M. (2001) Surveying Saccharomyces genomes to identify functional elements by comparative DNA sequence analyses. Genome Research, 11: 1175–1186.

Clore, A.M., Doore, S.M. and Tinnirello, S.M. (2008) Increased levels of reactive oxygen species and expression of a cytoplasmic aconitase/iron regulatory protein 1 homolog during the early response of maize pulvini to gravistimulation. Plant Cell and Environment, 31: 144–158

Clough, S.J. and Bent, F. (1998). Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant Journal, 16(6):735-43.

Coll, N. S., Epple, P. and Dangl, J. L. (2011). Programmed cell death in the plant immune system. Cell Death and Differentiation, 18(8): 1247–56.

Collmer, a, Badel, J. L., Charkowski, a O., Deng, W. L., Fouts, D. E., Ramos, a R., Rehm AH, Anderson, D.M., Schneewind, O., van Dijk, K. and Alfano, J.R. (2000). Pseudomonas syringae Hrp type III secretion system and effector proteins. Proceedings of the National Academy of Sciences of the United States of America, 97: 8770–8777.

Considine, M. J., and Foyer, C. H. (2014). Redox regulation of plant development. Antioxidants & Redox Signaling, 21(9): 1305–26.

Cosgrove, D.J. (2005). Growth of the plant cell wall. Nature Reviews Molecular Cell Biology, 6(11): 850-61.

Cross, A. R., and Segal, A. W. (2004). The NADPH oxidase of professional phagocytes-- prototype of the NOX electron transport chain systems. Biochimica et Biophysica Acta, 28;1657(1):1-22.

Dangl, J. L., Horvath, D. M., and Staskawicz, B. J. (2013). Pivoting the plant immune system from dissection to deployment. Science, 341(6147): 746–51.

Dangl, J. L. and Jones, J. D. G. (2001). Plant pathogens and integrated defence responses to infection. Nature,14;411(6839): 826-33.

110

REFERENCES

Debener, T., Lehnackers, H., Arnold, M., and Dangl, J.L. (1991). Identification and molecular mapping of a single Arabidopsis thaliana locus determining resistance to a phytopathogenic Pseudomonas syringae isolate. Plant Journal, 1:289-302.

Delgado-Cerezo, M., Sánchez-Rodríguez, C., Escudero, V., Miedes, E., Fernández, P. V., Jordá, L., Sanchez-Vallet, A., Bednarek, P., Schulze-Lefert, P., Somerville, S. C., Estevez, J. M., Persson, S. and Molina, A. (2012). Arabidopsis heterotrimeric G-protein regulates cell wall defense and resistance to necrotrophic fungi. Molecular Plant, 5(1): 98– 114.

Delledonne, M., Zeier, J., Marocco, A., and Lamb, C. J. (2001). Signal interactions between nitric oxide and reactive oxygen intermediates in the plant hypersensitive disease resistance response. Proceedings of the National Academy of Sciences U.S.A, 98:13454- 13459.

Del Río, L. a, Sandalio, L. M., Corpas, F. J., Palma, J. M. and Barroso, J. B. (2006). Reactive oxygen species and reactive nitrogen species in peroxisomes. Production, scavenging, and role in cell signaling. Plant Physiology, 141(2): 330–5.

Denancé, N., Sánchez-Vallet, A., Goffner, D. and Molina, A. (2013). Disease resistance or growth: the role of plant hormones in balancing immune responses and fitness costs. Frontiers in Plant Science, 4(155).

Denby, K.J., Kumar, P. and Kliebenstein, D.J. (2004). Identification of Botrytis cinerea susceptibility loci in Arabidopsis thaliana. Plant Journal, 38: 473–486.

Denness, L., McKenna, J. F., Segonzac, C., Wormit, A., Madhou, P., Bennett, M., Mansfield J., Zipfel C. and Hamann, T. (2011). Cell wall damage-induced lignin biosynthesis is regulated by a ROS- and jasmonic acid dependent process in Arabidopsis thaliana. Plant Physiology, 156(3):1364-74

Desikan, R., Cheung, M.K., Bright, J., Henson, D., Hancock, J.T. and Neill, S.J. (2004). ABA, hydrogen peroxide and nitric oxide signalling in stomatal guard cells. Journal of Experimental Botany, 55: 205–212

Devadas SK, Enyedi A and Raina R. (2002) The Arabidopsis hrl1 mutation reveals novel overlapping roles for salicylic acid, jasmonic acid and ethylene signalling in cell death and defence against pathogens. Plant Journal, 30: 467–480

Dickman, M. B. and Fluhr, R. (2013). Centrality of host cell death in plant-microbe interactions. Annual Review of Phytopathology, 51: 543–70.

111

REFERENCES

Dillard, H.R., Cobb, A.C., Shah, D.A. and Straight, K.E. (2005). Identification and characterization of russet on snap beans caused by Plectosporium tabacinum. Plant Disease, 89: 700–704.

Dinneny J.R. and Benfey P.N. (2008). Plant stem cell niches: Standing the test of time. Cell, 132: 553–557.

Doczi, R., Brader, G., Pettko-Szandtner, A., Rajh, I., Djamei, A., Pitzschke, A., Teige, M., and Hirt, H. (2007). The Arabidopsis mitogen-activated protein kinase kinase MKK3is upstream of groupCmitogen-activated protein kinases and participates in pathogen signaling. Plant Cell, 19: 3266–3279.

Dodds, P. N. and Rathjen, J. P. (2010). Plant immunity: towards an integrated view of plant- pathogen interactions. Nature Reviews Genetics, 11(8): 539–48.

Dodman R. L. (1979). Seeing Red: How the defenses are breached. In Plant disease, an advanced treatisee, edited by Horsfall J. G., Cowling E. B., Academic Press, Inc.: 145- 147.

Drerup, M.M., Schlu¨ cking, K., Hashimoto, K., Manishankar, P., Steinhorst, L., Kuchitsu, K., and Kudla, J. (2013). The Calcineurin B-like calcium sensors CBL1 and CBL9 together with their interacting protein kinase CIPK26 regulate the Arabidopsis NADPH oxidase RBOHF. Molecular Plant, 6, 559–569.

Dubiella, U., Seybold, H., Durian, G., Komander, E., Lassig, R., Witte, C.P., Schulze, W.X., and Romeis, T. (2013). Calcium-dependent protein kinase/ NADPH oxidase activation circuit is required for rapid defense signal propagation. Proceedings of the National Academy of Sciences of USA, 110: 8744–8749.

Durrant, W.E., and Dong, X. (2004). Systemic acquired resistance. Annu Rev Phytopathol 42: 185–209

Ellis, C., and Turner, J.G. (2001). The Arabidopsis mutant cev1 has constitutively active jasmonate and ethylene signal pathways and enhanced resistance to pathogens. Plant Cell, 13:1025-1033.

Fan, L.M., Zhang, W., Chen, J.G., Taylor, J.P., Jones, A.M., and Assmann, S.M. (2008). Abscisic acid regulation of guard-cell K+ and anion channels in Gbeta- and RGS-deficient Arabidopsis lines. Proceedings of the National Academy of Sciences of USA, 105: 8476- 8481.

112

REFERENCES

Felix, G., Duran, J. D., Volko, S., and Boller, T. (1999). Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. Plant Journal, 18:265-276.

Ferrari, S., Plotnikova, J.M., Lorenzo, G.D., and Ausubel, F.M. (2003). Arabidopsis local resistance to Botrytis cinerea involves salicylic acid and camalexin and requires EDS4 and PAD2, but not SID2, EDS5 or PAD4. The Plant Journal, 35:193-205.

Fester, T. and Hause, G. (2005). Accumulation of reactive oxygen species in arbuscular mycorrhizal roots. Mycorrhiza, 15: 373–379

Foreman, J., Demidchik, V., Bothwell, J. H. F., Mylona, P., Miedema, H., Torres, M.A., Linstead, P.,Costa, S., Brownlee, C., Jones, J.D.G., Davies J.M. and Dolan, L. (2003). Reactive oxygen species produced by NADPH oxidase regulate plant cell growth, 422: 442–446.

Frazer, K.A., Pachter, L., Poliakov, A., Rubin, E.M. and Dubchak, I. (2004) VISTA: computational tools for comparative genomics. Nucleic Acids Research, 1(32) (Web Server issue):W273-9.

Galletti, R., Denoux, C., Gambetta, S., Dewdney, J., Ausubel, F. M., De Lorenzo, G. and Ferrari, S. (2008). The AtrbohD-mediated oxidative burst elicited by oligogalacturonides in Arabidopsis is dispensable for the activation of defense responses effective against Botrytis cinerea. Plant Physiology, 148(3): 1695–706.

Galvez-Valdivieso, G., Fryer, M.J., Lawson, T., Slattery, K., Truman, W., Smirnoff, N., Asami, T., Davies, W.J., Jones, A.M., Baker, N.R. and Mullineaux, P.M. (2009). The high light response in Arabidopsis involves ABA signaling between vascular and bundle sheath cells. Plant Cell, 21: 2143-2162.

Gao, X., Chen, X., Lin, W., Chen, S., Lu, D., Niu, Y., Li, L., Cheng, C., McCormack, M., Sheen, J., Shan L. and He, P. (2013). Bifurcation of Arabidopsis NLR immune signaling via Ca2+-dependent protein kinases. PLoS Pathogens, 9(1): e1003127.

Gapper, C. and Dolan, L. (2006). Control of Plant Development by Reactive Oxygen Species. Plant Physiology, 141: 341–345.

García-Olmedo, F., Rodríguez-Palenzuela, P., Molina, A., Alamillo, J. M., López- Solanilla, E., Berrocal-Lobo and Porra-Carrión, C.(2001). Antibiotic activities of peptides, hydrogen peroxide and peroxynitrite in plant defence. FEBS Letters, 498: 219–222.

Gechev, T.S. and Hille, J. (2005). Hydrogen peroxide as a signal controlling plant programmed cell death. Journal of Cell Biology, 168:17–20

113

REFERENCES

Gechev T.S., Minkov I.N. and Hille J. (2005) Hydrogen peroxide-induced cell death in Arabidopsis: transcriptional and mutant analysis reveals a role of an oxoglutarate- dependent dioxygenase gene in the cell death process. IUBMB Life, 57:181–188

Gilbert, D.L. (1981). Oxygen and Living Processes: An Inter-Disciplinary Approach. Springer, New York.

Gilroy, S., Suzuki, N., Miller, G., Choi, W.-G., Toyota, M., Devireddy, A. R., and Mittler, R. (2014). A tidal wave of signals: calcium and ROS at the forefront of rapid systemic signaling. Trends in Plant Science, 19(10), 623–630.

Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annual Review of Phytopathology. 43:205-227.

Gomez-Gomez, L. and Boller, T. (2000). FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Molecules and Cells, 5: 1003– 1011.

Goodstein, D.M., Shu, S., Howson, R. David M. Neupane, R., Hayes, R.D., Fazo, J., Mitros, T., Dirks, W., Hellsten U., Putnam, N. and Rokhsar D.S. (2012) Phytozome: a comparative platform for green plant genomics. Nucleic Acids Research, 40: 1178–1186.

Grant, M.R., Godiard, L., Straube, E., Ashfield, T., Lewald, J., Sattler, A., Innes, R.W. and Dangl, J.L. (1995). Structure of the Arabidopsis RPM1 gene enabling dual specificity disease resistance. Science, 11;269(5225): 843-6.

Greenberg, J. T. (1997). Programmed cell death in plant-pathogen interactions. Annual Review of Plant physiology . Plant Molecular Biology, 48: 525–45

Grigston, J.C., Osuna, D., Scheible, W.R., Liu, C., Stitt, M., and Jones, A.M. (2008). D- Glucose sensing by a plasma membrane regulator of G signaling protein, AtRGS1. FEBS Letters, 582: 3577-3584.

Grovrin, E.M. and Levine, A. (2002) Infection of Arabidopsis with a necrotrophic pathogen, Botrytis cinerea, elicits various defense responses but does not induce systemic acquired resistance (SAR). Plant Molecular Biology, 48: 267–276.

Halliwell, B. (2001). Free Radicals and Other Reactive Species in Disease. Encyclopedia of Life Sciences, 1–7.

Halliwell, B. (2006). Reactive species and antioxidants. Redox biology is a fundamental theme of aerobic life. Plant Physiology, 141(2): 312–22.

114

REFERENCES

Halliwell, B. & Gutteridge, J.M.C. (1984) Oxygen toxicity, oxygen radicals, transition metals and disease. Biochemical Journal, 219: 1–14

Hallman J.S. (2001) Seeing Red: Plant interactions with endophytic bacteria.” In Biotic interactions in Plant-pathogen Associations, edited by Jeger M. J., Spence N. J., CAB International: 97-98.

Hancock, J.T. (2005) Seeing Red: Chapter 5 (Cyclic nucleotides, cyclases and G proteins) and Chapter 8 (Reactive oxygen species, reactive nitrogen species, and redox signalling). In "Cell signalling" edited by Hancock J.T., Oxford University Press: 134-142 and 228-238.

Hardin, S.C., Larue, C.T., Oh, M.H., Jain, V. and Huber, S.C. (2009). Coupling oxidative signals to protein phosphorylation via methionine oxidation in Arabidopsis. Biochemical Journal, 422: 305–312.

He, P., Shan, L., Lin, N.C., Martin, G.B., Kemmerling, B., Nürnberger, T., and Sheen, J. (2006) Specific bacterial suppressors of MAMP signaling upstream of MAPKKK in Arabidopsis innate immunity. Cell, 125: 563–575.

Hernandez-Blanco, C., Feng, D.X., Hu, J., Sanchez-Vallet, A., Deslandes, L., Llorente, F., Berrocal-Lobo, M., Keller, H., Barlet, X., Sanchez-Rodriguez, C., Anderson, L.K., Somerville, S., Marco, Y., and Molina, A. (2007). Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell, 19: 890-903.

Holton, N., Nekrasov, V., Ronald, P.C. and Zipfel C. (2015) The Phylogenetically-Related Pattern Recognition Receptors EFR and XA21 Recruit Similar Immune Signaling Components in Monocots and Dicots. PLoS Pathogens, 11(1), e1004602.

Hong, R.L., Hamaguchi, L., Busch, M.A. and Weigel, D. (2003). Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing. Plant Cell, 15: 1296–1309.

Iglesias-Fernández, R., Barrero-Sicilia, C., Carrillo-Barral, N., Oñate-Sánchez, L. and Carbonero, P. (2013) Arabidopsis thaliana bZIP44: a transcription factor affecting seed germination and expression of the mannanase-encoding gene AtMAN7. Plant Journal, 74(5): 767–80.

Ishikawa, A. (2009). The Arabidopsis G-protein β-subunit is required for defense response against Agrobacterium tumefaciens. Bioscience, Biotechnology and Biochemistry 73: 47- 52.

115

REFERENCES

Jamet, A., Sigaud, S., Van de Sype, G., Puppo, A. and Herouart, D. (2003). Expression of the bacterial catalase genes during Medicago sativa –Sinorhizobium meliloti symbiosis and their crucial role during the infection process. Molecular Plant Microbe Interactions, 16: 217–225

Jaspers, P., and Kangasjärvi, J. (2010). Reactive oxygen species in abiotic stress signaling. Physiologia Plantarum, 138(4): 405–13.

Jakubowicz, M., Gałgańska, H., Nowak, W., and Sadowski, J. (2010). Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh- oxidase genes in broccoli seedlings. Journal of Experimental Botany, 61(12): 3475–91.

Jiang, C., Belfield, E. J., Mithani, A., Visscher, A., Ragoussis, J., Mott, R., Smith, J.A.C and Harberd, N. P. (2012a). ROS-mediated vascular homeostatic control of root-to-shoot soil Na delivery in Arabidopsis. The EMBO Journal, 31(22): 4359–70.

Jiang, K., Frick-Cheng, A., Trusov, Y., Delgado-Cerezo, M., Rosenthal, D.M., Lorek, J., Panstruga, R., Booker, F.L., Botella, J.R., Molina, A., Ort, D.R. and Jones, A.M. (2012b). Dissecting Arabidopsis Gbeta signal transduction on the protein surface. Plant Physiology, 159: 975-983.

Jimenez, P. and Zitter, T.A. (2005) First report of Plectosporium blight on pumpkin and squash caused by Plectosporium tabacinum in New York. Plant Disease. 89: 432.

Jones, J. D. G. and Dangl, J. L. (2006). The plant immune system. Nature, 444(7117): 323–9.

Jones, A.M., Ecker, J.R. and Chen, J.G. (2003). A reevaluation of the rol of the heterotrimeric G protein in coupling light responses in Arabidopsis. Plant Physiology, 131: 1623-1627.

Jones, J.D.G., Shlumukov, L., Carland, F., English, J., Scofield, S.R., Bishop, G.J., Harrison, K. (1992). Effective vectors for transformation, expression of heterologous genes, and assaying transposon excision in transgenic plants. Transgenic Research, 1(6): 285-97.

Jones, J.C., Temple, B.R.S., Jones, A.M., Dohlman, H.G. (2011). Functional reconstitution of an atypical G protein heterotrimer and regulator of G protein signaling protein (RGS1) from Arabidopsis thaliana. Journal of Biological Chemistry, 286: 13143–50

Joo, J.H., Bae, Y.S., and Lee, J.S. (2001). Role of auxin-induced reactive oxygen species in root gravitropism. Plant Physiology, 126: 1055–1060

116

REFERENCES

Joo, J.H., Wang, S., Chen, J.G., Jones, A.M., and Fedoroff, N.V. (2005a). Different signaling and cell death roles of heterotrimeric G protein alpha and beta subunits in the Arabidopsis oxidative stress response to ozone. Plant Cell, 17: 957-970

Joo, J.H., Yoo, H.J., Hwang, I., Lee, J.S., Nam, K.H., and Bae, Y.S. (2005b) Auxin-induced reactive oxygen species production requires the activation of phosphatidylinositol 3-kinase. FEBS Letters, 579: 1243–1248

Keller, T., Damude, H. G., Werner, D., Doerner, P., Dixon, R., and Lamb, C. (1998). A plant homolog of the neutrophil NADPH oxidase gp91phox subunit gene encodes a plasma membrane protein with Ca2+ binding motifs. The Plant Cell, 10(2): 255–266.

Kadota, Y., Sklenar, J., Derbyshire, P., Stransfeld, L., Asai, S., Ntoukakis, V., Jones, J.D., Shirasu, K., Menke, F., Jones, A., and Zipfel, C. (2014). Direct Regulation of the NADPH Oxidase RBOHD by the PRR-Associated Kinase BIK1 during Plant Immunity. Molecular Cell, 54(1):43-55.

Karve, R., Liu, W., Willet, S. G., Torii, K. U., and Shpak, E. D. (2011). The presence of multiple introns is essential for ERECTA expression in Arabidopsis. RNA, 17(10): 1907– 21.

Kaya, H., Nakajima, R., Iwano, M., Kanaoka, M. M., Kimura, S., Takeda, S., Kawarazaki, T., Senzaki, E., Hamamura, Y., Higashiyama, T., Takayama, S., Abe, M., Kuchitsu, K. (2014). Ca2+-activated reactive oxygen species production by Arabidopsis RbohH and RbohJ is essential for proper pollen tube tip growth. The Plant Cell, 26(3): 1069–80.

Kimura, S., Kaya, H., Kawarazaki, T., Hiraoka, G., Senzaki, E., Michikawa, M., and Kuchitsu, K. (2012). Protein phosphorylation is a prerequisite for the Ca2+-dependent activation of Arabidopsis NADPH oxidases and may function as a trigger for the positive feedback regulation of Ca2+ and reactive oxygen species. Biochimica et Biophysica Acta, 1823: 398–405.

Kimura, S., Kawarazaki, T., Nibori, H., Michikawa, M., Imai, A., Kaya, H., and Kuchitsu, K. (2013). The CBL-interacting protein kinase CIPK26 is a novel inter- actor of Arabidopsis NADPH oxidase AtRbohF that negatively modulates its ROS-producing activity in a heterologous expression system. Journal of Biochemistry, 153: 191–195.

117

REFERENCES

Klopffleisch, K., Phan, N., Augustin, K., Bayne, R.S., Booker, K.S., Botella, J.R., Carpita, N.C., Carr, T., Chen, J.G., Cooke, T.R., Frick-Cheng, A., Friedman, E.J., Fulk, B., Hahn, M.G., Jiang, K., Jorda, L., Kruppe, L., Liu, C., Lorek, J., McCann, M.C., Molina, A., Moriyama, E.N., Mukhtar, M.S., Mudgil, Y., Pattathil, S., Schwarz, J., Seta, S., Tan, M., Temp, U., Trusov, Y., Urano, D., Welter, B., Yang, J., Panstruga, R., Uhrig, J.F., and Jones, A.M. (2012). Arabidopsis G-protein interactome reveals connections to cell wall carbohydratesand morphogenesis. Molecular Systems Biology, 7(532).

Kobayashi, M., Ohura, I., Kawakita, K., Yokota, N., Fujiwara, M., Shimamoto, K., Doke, N., and Yoshioka, H. (2007). Calcium-dependent protein kinases regulate the production of reactive oxygen species by potato NADPH oxidase. The Plant Cell, 19(3): 1065–80.

Kotchoni, S. and Gachomo, E. (2006). The reactive oxygen species network pathways:an essential prerequisite for perception of pathogen attack and the acquired disease resistance in plants. Journal of Bioscience, 31: 389–404

Kwak, J. M., Mori, I. C., Pei, Z., Leonhardt, N., Torres, M. A., Dangl, J. L., Rowland, O., Jones J.D.G. and Schroeder, J. I. (2003). NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis. EMBO Journal, 22(11): 2623– 2633.

Lai, Z. and Mengiste, T. (2013). Genetic and cellular mechanisms regulating plant responses to necrotrophic pathogens. Current Opinion in Plant Biology, 16(4): 505–12.

Lamb, C., and Dixon, R.A. (1997). The oxidative burst in plant disease resistance. Annual Review of Plant Physiology. Plant Molecular Biololgy, 48: 251–275.

Lease, K.A., Wen, J., Li, J., Doke, J.T., Liscum, E., and Walker, J.C. (2001). A mutant Arabidopsis heterotrimeric G-protein beta subunit affects leaf, flower, and fruit development. Plant Cell, 13: 2631-2641.

Lee, Y., Rubio, M. C., Alassimone, J. and Geldner, N. (2013a). A mechanism for localized lignin deposition in the endodermis. Cell, 153(2): 402–12.

Lee, S., Rojas, C.M., Ishiga, Y., Pandey, S., and Mysore, K.S. (2013b). Arabidopsis heterotrimeric G-proteins play a critical role in host and nonhost resistance against Pseudomonas syringae pathogens. PLoS One, 8: e82445.

Leshem, Y., Seri, L., and Levine, A. (2007). Induction of phosphatidylinositol 3-kinase- mediated endocytosis by salt stress leads to intracellular production of reactive oxygen species and salt tolerance. The Plant Journal : For Cell and Molecular Biology, 51(2): 185– 97.

118

REFERENCES

Levine, A., Pennell, R.I., Alvarez, M.E., Palmer, R. and Lamb, C. (1996) Calcium-mediated apoptosis in a plant hypersensitive disease resistance response. Current Biology, 6: 427– 437

Li, A., Wang, X., Leseberg, C.H., Jia, J. and Mao, L. (2008). Biotic and abiotic stress responses through calcium-dependent protein kinase (CDPK) signalling in wheat (Triticum aestivum L.). Plant Signalling and Behavior, 3: 654–656.

Li, L., Li, M., Yu, L., Zhou, Z., Liang, X., Liu, Z., Cai. G., Gao, L., Zhang, X., Wang, Y., Chen, S. and Zhou, J.-M. (2014). The FLS2-Associated Kinase BIK1 Directly Phosphorylates the NADPH Oxidase RbohD to Control Plant Immunity. Cell Host & Microbe, 15(3), 329– 338.

Li, T., Li, H., Zhang, Y.X. and Liu, J.Y. (2011). Identification and analysis of seven H2O2- responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica). Nucleic Acids Research, 39: 2821–2833.

Lin, Z., Yin, K., Wang, X., Liu, M., Chen, Z., Gu, H. and Qu, L.J. (2007). Virus induced gene silencing of AtCDC5 results in accelerated cell death in Arabidopsis leaves. Plant Physiology and Biochemistry, 45(1): 87–94.

Liu P. P., Bhattacharjee S., Klessig D. F. and Moffett P. (2010). Systemic acquired resistance is induced by R gene-mediated responses independent of cell death. Molecular Plant Pathology, 11: 155–160

Liu, J., Ding, P., Sun, T., Nitta, Y., Dong, O., Huang, X., Yang, W., Li, X., Botella, J.R., and Zhang, Y. (2013). Heterotrimeric G proteins serve as a converging point in plant defense signaling activated by multiple receptor-like kinases. Plant Physiology, 161: 2146-2158

Liu, P., Li, R.L., Zhang, L., Wang, Q.L., Niehaus, K., Baluska, F., Samaj, J., and Lin J.X. (2009). Lipid microdomain polarization is required for NADPH oxidase-dependent ROS signaling in Picea meyeri pollen tube tip growth. Plant Journal, 60(2): 303–313.

Llorente, F., Alonso-Blanco, C., Sánchez-Rodriguez, C., Jorda, L. and Molina, A. (2005). ERECTA receptor-like kinase and heterotrimeric G protein from Arabidopsis are required for resistance to the necrotrophic fungus Plectosphaerella cucumerina. Plant Journal, 43: 165–180.

Loots, G., Ovcharenko,I., Pachter,L., Dubchak,I. and Rubin, E. (2002). rVISTA for comparative sequence-based discovery of functional transcription factor binding sites. Genome Research, 12: 832-839.

119

REFERENCES

Lorang, J.M., Sweat, T.A. and Wolpert, T.J. (2007). Plant disease susceptibility conferred by a ‘‘resistance’’ gene. Proceedings of the National Academy of Sciences of USA, 104: 14861-14866.

Lorek, J., Griebel, T., Jones, A.M., Kuhn, H. and Panstruga, R. (2013). The role of Arabidopsis heterotrimeric G-protein subunits in MLO2 function and MAMPtriggered immunity. Molecular Plant Microbe Interactions, 26: 991-1003.

Love, A.J., Yun, B.W., Laval, V., Loake, G.J. and Milner, J.J. (2005). CauliXower mosaic virus, a compatible pathogen of Arabidopsis, engages three distinct defense-signaling pathways and activates rapid systemic generation of reactive oxygen species. Plant Physiology, 139: 935–948.

Lozano-Durán, R., Macho, A.P., Boutrot, F., Segonzac, C., Somssich, I.E. and Zipfel, C.(2013). The transcriptional regulator BZR1 mediates trade-off between plant innate immunity and growth. Elife, 31;2:e00983.

Lu, D., Wu, S., Gao, X., Zhang, Y., Shan, L. and He, P. (2010). A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proceedings of the National Academy of Sciences of USA, 107: 496-501.

Luna, E., Pastor, V., Robert, J., Flors, V., Mauch-Mani, B. and Ton, J. (2011). Callose deposition: a multifaceted plant defense response. Molecular Plant-Microbe Interactions : Molecular Plant Microbe Interactions, 24(2), 183–93.

Ma, H., Yanofsky, M.F. and Meyerowitz, E.M. (1990). Molecular cloning and characterization of GPA1, a G protein alpha subunit gene from Arabidopsis thaliana. Proceedings of the National Academy of Sciences of USA, 87: 3821-3825.

Ma. L., Zhang, H., Sun, L., Jiao, Y., Zhang, G., Miao, C. and Hao, F. (2012). NADPH oxidase AtrbohD and AtrbohF function in ROS-dependent regulation of Na/K homeostasis in Arabidopsis under salt stress. Journal of Experimental Botany, 63: 305–317

Maeda, K., Houjyou, Y., Komatsu, T., Hori, H., Kodaira, T. and Ishikawa, A. (2009). AGB1 and PMR5 contribute to PEN2-mediated preinvasion resistance to Magnaporthe oryzae in Arabidopsis thaliana. Molecular Plant Microbe Interactions, 22: 1331-1340.

Macho, A. P., Boutrot, F., Rathjen, J. P., and Zipfel, C. (2012). Aspartate oxidase plays an important role in Arabidopsis stomatal immunity. Plant Physiology, 159(4): 1845–56.

Macho, A. P. and Zipfel, C. (2014). Plant PRRs and the activation of innate immune signaling. Molecular Cell, 54(2): 263–72.

120

REFERENCES

Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R. and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2- mediated resistance. Cell, 112: 379–389.

Malinovsky, F., Batoux, M., Schwessinger, B., Youn, J.H., Stransfeld, L., Win, J., Kim, S.K. and Zipfel, C. (2014). Antagonistic regulation of growth and immunity by the Arabidopsis bHLH transcription factor HBI1. Plant Physiology, 3: 1443–1455.

Marino, D., Andrio, E., Danchin, E. G. J., Oger, E., Gucciardo, S., Lambert, A., Puppo, A. and Pauly, N. (2011). A Medicago truncatula NADPH oxidase is involved in symbiotic nodule functioning. The New Phytologist, 189(2): 580–92.

Marino, D., Dunand, C., Puppo, A. and Pauly, N. (2012). A burst of plant NADPH oxidases. Trends in Plant Science, 17(1): 9–15.

Mason, M.G., and Botella, J.R. (2000). Completing the heterotrimer: isolation and characterization of an Arabidopsis thaliana G protein gamma-subunit cDNA. Proceedings of the National Academy of Sciences of USA, 97: 14784-14788.

McCudden, C.R., Hains, M.D., Kimple, R.J., Siderovski, D.P., and Willard, F.S. (2005). G- protein signaling: back to the future. Cellular and Molecular Life Sciences, 62: 551-577.

Melotto, M., Underwood, W., Koczan, J., Nomura, K. and He, S. Y. (2006). Plant stomata function in innate immunity against bacterial invasion. Cell, 126: 969-980.

Meng, X., Xu, J., He, Y., Yang, K.-Y., Mordorski, B., Liu, Y. and Zhang, S. (2013). Phosphorylation of an ERF transcription factor by Arabidopsis MPK3/MPK6 regulates plant defense gene induction and fungal resistance. Plant Cell, 25(3): 1126–42.

Menke, F.L., van Pelt, J.A., Pieterse, C.M. and Klessig, D.F. (2004). Silencing of the mitogen- activated protein kinase MPK6 compromises disease resistance, Cell, 16: 897–907

Mersmann, S., Bourdais, G., Rietz, S. and Robatzek, S. (2010) Ethylene Signaling Regulates Accumulation of the FLS2 Receptor and Is Required for the Oxidative Burst Contributing to Plant Immunity. Plant Physiology, 154(1): 391–400.

Miedes, E., Vanholme, R., Boerjan, W. and Molina, A. (2014). The role of the secondary cell wall in plant resistance to pathogens. Frontiers in Plant Science, 5:1–13.

Miller, G., Schlauch, K., Tam, R., Cortes, D., Torres, M. A., Shulaev, V., Dangl J.L. and Mittler, R. (2009). The plant NADPH oxidase RBOHD mediates rapid systemic signaling in response to diverse stimuli. Science Signaling, 2(84): ra45.

121

REFERENCES

Miller, G., Suzuki, N., Ciftci-Yilmaz, S. and Mittler, R. (2010). Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant, Cell & Environment, 33(4): 453–67.

Mittler, R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends in Plant Science 7, 405–410

Mittler, R., Vanderauwera, S., Gollery, M., and Van Breusegem, F. (2004). Reactive oxygen gene network of plants. Trends in Plant Science, 9(10): 490–8.

Mittler, R., Vanderauwera, S., Suzuki, N., Miller, G., Tognetti, V. B., Vandepoele, K., Gollery, M., Shulaev, V. and Van Breusegem, F. (2011). ROS signaling: the new wave? Trends in Plant Science, 16(6): 300–9.

Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y., Kawakami, N., Kaku, H. and Shibuya, N. (2007). CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proceedings of the National Academy of Sciences of USA,104: 19613–19618.

Monshausen, G.B., Bibikova, T.N., Messerli, M.A., Shi, C. and Gilroy, S. (2007). Oscillations in extracellular pH and reactive oxygen species modulate tip growth of Arabidopsis root hairs. Proceedings of the National Academy of Sciences USA, 104: 20996–21001.

Monshausen, G. B., Bibikova, T. N., Weisenseel, M. H. and Gilroy, S. (2009). Ca2+ regulates reactive oxygen species production and pH during mechanosensing in Arabidopsis roots. The Plant Cell, 21(8): 2341–56.

Møller, I.M., Jensen, P.E. and Hansson, A. (2007). Oxidative modifications to cellular components in plants. Annual Review of Plant Biology, 58: 459–481

Müller, K., Carstens, A. C., Linkies, A., Torres, M. A., and Leubner-Metzger, G. (2009). The NADPH-oxidase AtrbohB plays a role in Arabidopsis seed after-ripening. The New Phytologist, 184(4): 885–97.

Mur, L.A., Kenton, P., Lloyd, A.J., Ougham, H. and Prats, E. (2008). The hypersensitive response; the centenary is upon us but how much do we know? Journal of Experimental Botany, 59: 501–520

Nakagawa, T., Kurose, T., Hino, T., Tanaka, K., Kawamukai, M., Niwa, Y., Toyooka, K., Matsuoka, K., Jinbo, T. and Kimura, T. (2007). Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. Journal of Bioscience and Bioengineering,104(1): 34-41.

122

REFERENCES

Nathan, C., and Cunningham-Bussel, A. (2013). Beyond oxidative stress: an immunologist's guide to reactive oxygen species. Nature Reviews Immunology, 13: 349-361.

Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O. and Jones, J.D. (2006). A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science, 312: 436–439.

Neill, S., Desikan, R., and Hancock, J. (2002). Hydrogen peroxide signalling. Current Opinion in Plant Biology, 5(5): 388–95.

Nicaise, V., Roux, M. and Zipfel, C. (2009). Recent advances in PAMP-triggered immunity against bacteria: pattern recognition receptors watch over and raise the alarm. Plant Physiology, 150(4): 1638–47.

Niehrs, C. and Pollet, N. (1999). Synexpression groups in eukaryotes. Nature, 402: 483–7.

Nitta, Y., Ding, P. and Zhang, Y. (2014). Heterotrimeric G proteins in plant defense against pathogens and ABA signaling. Environmental and Experimental Botany. In Press.

Noctor, G. and Foyer. (1998). Ascorbate and glutathione: keeping active oxygen under control. Annual review of plant biology, 49(1): 249-279

Noctor, G., Gomez, L., Vanacker, H., and Foyer, C.H. (2002). Interactions between biosynthesis, compartmentation and transport in the control of glutathione homeostasis and signalling. Journal of Experimental Botany, 53(372): 1283–1304.

Noirot, E., Der, C., Lherminier, J., Robert, F., Moricova, P., Kiêu, K., Leborgne-Castel, N., Simon-Plas, F. and Bouhidel, K. (2014). Dynamic changes in the subcellular distribution of the tobacco ROS-producing enzyme RBOHD in response to the oomycete elicitor cryptogein. Journal of Experimental Botany, 65(17): 5011–22.

Nozaki, M., Kita, K., Kodaira, T. and Ishikawa, A. (2013). AtRbohF contributes to non-host resistance to Magnaporthe oryzae in Arabidopsis. Bioscience, Biotechnology, and Biochemistry, 77(6): 1323–5.

Nuhse, T.S., Bottrill, A.R., Jones, A.M. and Peck, S.C. (2007). Quantitative phosphoproteomic analysis of plasma membrane proteins reveals regulatory mechanisms of plant innate immune responses. Plant Journal, 51: 931–940.

Nurnberger, T. and Scheel, D. (2001) Signal transmission in the plant immune response. Trends in Plant Science, 6: 372–379

123

REFERENCES

O’Brien, J., Daudi, A., Butt, V. and Bolwell, G. (2012). Reactive oxygen species and their role in plant defence and cell wall metabolism. Planta, 765–779.

Oda, T., Hashimoto, H., Kuwabara, N., Akashi, S., Hayashi, K., Kojima, C., Wong, H.L., Kawasaki, T., Shimamoto, K., Sato, M. and Shimizu, T. (2010). Structure of the N- terminal regulatory domain of a plant NADPH oxidase and its functional implications. Journal of Biological Chemistry, 8, 285(2):1435-45.

Ogasawara, Y., Kaya, H., Hiraoka, G., Yumoto, F., Kimura, S., Kadota, Y., Kadota. Y., Hishinuma, H., Senzaki, E., Yamagoe, S., Nagata, K., Nara, M., Suzuki, K., Tanokura, M., and Kuchitsu, K. (2008). Synergistic activation of the Arabidopsis NADPH oxidase AtrbohD by Ca2+ and phosphorylation. The Journal of Biological Chemistry, 283(14): 8885–92.

Oldham, W.M. and Hamm H.E. (2008). Heterotrimeric G protein activation by G-protein- coupled receptors. Nature Reviews Molecular Cell Biology, 9: 60–71

Oliver, R. P. and Solomon, P. S. (2010). New developments in pathogenicity and virulence of necrotrophs. Current Opinion in Plant Biology, 13(4): 415–419.

Ozgur, R., Turkan, I., Uzilday, B. and Sekmen, A. H. (2014). Endoplasmic reticulum stress triggers ROS signalling, changes the redox state, and regulates the antioxidant defence of Arabidopsis thaliana. Journal of Experimental Botany, 65(5): 1377–90.

Palm, M.E., Gams, W. and Nierenberg, H.I. (1995) Plectosporium, a new genus for Fusarium tabacinum, the anamorph of Plectosphaerella cucumerina. Mycologia, 87; 397–406.

Pandey, S., Chen, J.G., Jones, A.M. and Assmann, S.M. (2006). G-protein complex mutants are hypersensitive to abscisic acid regulation of germination and postgermination development. Plant Physiology, 141: 243–56.

Pandey, S. P. and Somssich, I. E. (2009). The role of WRKY transcription factors in plant immunity. Plant Physiology, 150(4): 1648–55.

Panstruga, R. and Dodds, P. N. (2009). Terrific protein traffic: the mystery of effector protein delivery by filamentous plant pathogens. Science, 324: 748–750.

Park, H. C., Kim, M. L., Kang, Y. H., Jeon, J. M., Yoo, J. H., Kim, M. C. and Lee, S. Y. (2004). Pathogen- and NaCl-Induced Expression of the SCaM-4 Promoter Is Mediated in Part by a GT-1 Box That Interacts with a GT-1-Like Transcription Factor 1. Plant Physiology, 135: 2150–2161.

124

REFERENCES

Pei, Z.M., Murata, Y., Benning, G., Thomine, S., Klusener, B., Allen, G.J., Grill, E. and Schroeder, J.I. (2000). Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells. Nature, 406: 731–734.

Peng, M. and Kuc, J. (1992) Peroxidase-generated hydrogen peroxide as a source of antifungal activity in vitro and on tobacco leaf disks. Phytopathology, 82:696–699.

Penfield, S., Li, Y., Gilday, A. D., Graham, S., and Graham, I. A. (2006) Arabidopsis ABA INSENSITIVE4 Regulates Lipid Mobilization in the Embryo and Reveals Repression of Seed Germination by the Endosperm. Plant Cell, 18: 1887–1899.

Petrov, V. D. and Van Breusegem, F. (2012). Hydrogen peroxide-a central hub for information flow in plant cells. AoB Plants: pls014.

Perchepied, L., Balagué, C., Riou, C., Claudel-Renard, C., Rivière, N., Grezes-Besset, B. and Roby, D. (2010). Nitric oxide participates in the complex interplay of defense-related signaling pathways controlling disease resistance to Sclerotinia sclerotiorum in Arabidopsis thaliana. Molecular Plant-Microbe Interactions, 23(7): 846–60.

Pitzschke, A., Djamei, A., Bitton, F. and Hirt, H. (2009). A major role of the MEKK1-MKK1/2- MPK4 pathway in ROS signalling. Molecular Plant, 2: 120–137.

Pogány, M., von Rad, U., Grün, S., Dongó, A., Pintye, A., Simoneau, P., Bahnweg,G., Kiss, L., Barna, B. and Durner, J. (2009). Dual roles of reactive oxygen species and NADPH oxidase RBOHD in an Arabidopsis-Alternaria pathosystem. Plant Physiology, 151(3), 1459–75.

Potocký, M., Jones, M. a, Bezvoda, R., Smirnoff, N. and Zárský, V. (2007). Reactive oxygen species produced by NADPH oxidase are involved in pollen tube growth. New Phytologist, 174(4): 742–51.

Quandt, K., Frech, K., Karas, H., Wingender, E. and Werner, T. (1995) MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Research, 11(23): 4878-84.

Ramos, B., González-Melendi, P., Sánchez-Vallet, A., Sánchez-Rodríguez, C., López, G., & Molina, A. (2013). Functional genomics tools to decipher the pathogenicity mechanisms of the necrotrophic fungus Plectosphaerella cucumerina in Arabidopsis thaliana. Molecular Plant Pathology, 14(1): 44–57.

Reina-Pinto J.J. and Yephremov A. (2009). Surface lipids and plant defenses. Plant Physiology and Biochemistry, 47(6): 540-549

125

REFERENCES

Rentel, M.C., Lecourieux, D., Ouaked, F., Usher, S.L., Petersen, L., Okamoto, H., Knight, H., Peck, S.C., Grierson, C.S., Hirt, H. and Knight, M.R. (2004) OXI1 kinase is necessary for oxidative burst-mediated signalling. Nature, 427: 858–861

Romeis, T., Ludwig, A.A., Martin, R. and Jones, J.D. (2001). Calcium-dependent protein kinases play an essential role in a plant defence response. EMBO Journal, 20(20): 5556– 5567.

Ros-Barceló, A.R. and Gómez-Ros, L.V.G. (2009). Seeing Red: Reactive Oxygen Species in Plant Cell Walls in: "Reactive Oxygen Species in Plant Signaling", edited by del Rio L.A. and Puppo A. Springer, Dordrecht: 73-94.

Ross, E.M., and Wilkie, T.M. (2000). GTPase-activating proteins for heterotrimeric G proteins: regulators of G protein signaling (RGS) and RGS-like proteins. Annual review of biochemistry, 69: 795-827.

Roux, M., Schwessinger, B., Albrecht, C., Chinchilla, D., Jones, A., Holton, N., Malinovsky, F.G., Tor, M., de Vries, S. and Zipfel, C. (2011). The arabidopsis leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to Hemibiotrophic and Biotrophic pathogens. Plant Cell, 23: 2440-2455.

Sagi, M., and Fluhr, R. (2001). Superoxide production by plant homologues of the gp91(phox) NADPH oxidase. Modulation of activity by calcium and by tobacco mosaic virus infection. Plant Physiology, 126(3): 1281–90.

Sagi, M., and Fluhr, R. (2006). Production of Reactive Oxygen Species by Plant NADPH oxidases. Plant Physiology, 141(2), 336–340.

Sanchez-Rodriguez, C., Estevez, J.M., Llorente, F., Hernandez-Blanco, C., Jorda, L., Pagan, I., Berrocal, M., Marco, Y., Somerville, S., and Molina, A. (2009). The ERECTA Receptor-Like Kinase Regulates Cell Wall Mediated Resistance to Pathogens in Arabidopsis thaliana. Molecular Plant-Microbe Interactions, 22: 953-963.

Sanchez-Vallet, A., Ramos, B., Bednarek, P., López, G., Piślewska-Bednarek, M., Schulze- Lefert, P. and Molina, A. (2010). Tryptophan-derived secondary metabolites in Arabidopsis thaliana confer non-host resistance to necrotrophic Plectosphaerella cucumerina fungi. Plant Journal, 63: 115–127.

Sánchez-Vallet, A., López, G., Ramos, B., Delgado-Cerezo, M., Riviere, M.-P., Llorente, F., Fernández, P.V., Miedes, E., Estevez, J.M. and Molina, A. (2012). Disruption of abscisic acid signaling constitutively activates Arabidopsis resistance to the necrotrophic fungus Plectosphaerella cucumerina. Plant Physiology, 160(4): 2109–24.

126

REFERENCES

Santos, R., Herouart, D., Sigaud, S., Touati, D. and Puppo, A. (2001). Oxidative burst in alfalfa-Sinorhizobium meliloti symbiotic interaction. Molecular Plant Microbe Interactions, 14: 86–89.

Sawinski, K., Mersmann, S., Robatzek, S. and Böhmer, M. (2013). Guarding the green: pathways to stomatal immunity. Molecular Plant-Microbe Interactions, 26(6): 626–32.

Schulze-Lefert, P. and Panstruga, R. (2011). A molecular concept connecting nonhost- resistance and pathogen speciation. Trends in Plant Science, 16: 117-125.

Siddique, S., Matera, C., Radakovic, Z. S., Hasan, M. S., Gutbrod, P., Rozanska, E., Sobczak, M., Torres, M.A. and Grundler, F. M. W. (2014). Parasitic worms stimulate host NADPH oxidases to produce reactive oxygen species that limit plant cell death and promote infection. Science Signaling, 7(320): ra33.

Simon-Plas, F., Elmayan, T. and Blein, J.P. (2002). The plasma membrane oxidase NtrbohD is responsible for AOS production in elicited tobacco cells. Plant Journal, 31: 137–147.

Sirichandra, C., Gu, D., Hu, H.-C., Davanture, M., Lee, S., Djaoui, M., Valot, B., Zivy, M., Leung, J., Merlot, S., and Kwak, J. M. (2009). Phosphorylation of the Arabidopsis AtrbohF NADPH oxidase by OST1 protein kinase. FEBS Letters, 583(18): 2982–6.

Slusarenko, A.J., Croft, K.P. and Voisey, C.R. (1991). Seeing red.: Biochemical and molecular events in the hypersensitive response of bean to Pseudomonas syringae pv. phaseolicola. In: Biochemistry and Molecular Biology of Host-Pathogen Interactions. Edited by C. J. Smith, Oxford University Press, Oxford: 126-146.

Song, Y., Ahn, J., Suh, Y., Davis, M. E. and Lee, K. (2013) Identification of novel tissue- specific genes by analysis of microarray databases: a human and mouse model. PloS one, 8(5): e64483.

Song, Y., Miao, Y. and Song, C. (2014). Behind the scenes : the roles of reactive oxygen species in guard cells. Tansley review. New Phytologist, 201, 1121–1140.

Spoel, S. H. and Dong, X. (2012). How do plants achieve immunity? Defence without specialized immune cells. Nature Reviews. Immunology, 12(2): 89–100.

Strickland, J.S., England, G.K. and McGovern, R.J. (2007) Plectosporium Blight of Cucurbits. UF Department of Plant Pathology, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. P237: 1–4.

127

REFERENCES

Suharsono, U., Fujisawa, Y., Kawasaki, T., Iwasaki, Y., Satoh, H. and Shimamoto, K. (2002). The heterotrimeric G protein alpha subunit acts upstream of the small GTPase Rac in disease resistance of rice. Proceedings of the National Academy of Science U.S.A., 99: 13307-13312.

Suhita, D., Raghavendra, A. S., Kwak, J. M. and Vavasseur, A., (2004). Cytoplasmic Alkalization Precedes Reactive Oxygen Species Production during Methyl Jasmonate- and Abscisic Acid-Induced Stomatal Closure. Plant Physiology, 134(4): 1536–1545.

Sumimoto, H. (2008). Structure, regulation and evolution of Nox-family NADPH oxidases that produce reactive oxygen species. The FEBS Journal, 275(13): 3249–3277.

Suzuki, N., Miller, G., Morales, J., Shulaev, V., Torres, M. A., and Mittler, R. (2011). Respiratory burst oxidases: the engines of ROS signaling. Current Opinion in Plant Biology, 14(6): 691–699.

Suzuki, N., Miller, G., Salazar, C., Mondal, H. , Shulaev, E., Cortes, D. F., Shulaev, E., Cortes, D.F., Shuman, J.L., Luo, X., Shah, J., Schlauch, K., Shulaev, V. and Mittler, R. (2013). Temporal-spatial interaction between reactive oxygen species and abscisic acid regulates rapid systemic acclimation in plants. The Plant Cell, 25(9): 3553–3569.

Spadaro, D., Yun, B.-W., Spoel, S. H., Chu, C., Wang, Y.-Q. and Loake, G. J. (2010). The redox switch: dynamic regulation of protein function by cysteine modifications. Physiologia Plantarum, 138(4): 360–371.

Swanson, S. and Gilroy, S. (2010). ROS in plant development. Physiologia Plantarum, 138(4): 384–392.

Schwessinger, B., Roux, M., Kadota, Y., Ntoukakis, V., Sklenar, J., Jones, A. and Zipfel, C. (2011). Phosphorylation-dependent differential regulation of plant growth, cell death, and innate immunity by the regulatory receptor-like kinase BAK1. PLoS Genetics, 7(4): e1002046

Tada. Y,, Mori, T., Shinogi, T., Yao N, Takahashi, S., Betsuyaku, S., Sakamoto, M., Park, P., Nakayashiki, H., Tosa, Y., (2004) Nitric oxide and reactive oxygen species do not elicit hypersensitive cell death but induce apoptosis in the adjacent cells during the defense response of oat. Molecular Plant Microbe Interactions, 17: 245–253.

Taiz, L. and Zeiger, E. (2010). Topic 15.5: The mechanical properties of cell walls: Studies with Nitella. Plant Physiology, Fifth Edition Online: .

128

REFERENCES

Takahashi, F., Mizoguchi, T., Yoshida, R., Ichimura, K. and Shinozaki, K. (2011). Calmodulin-Dependent Activation of MAP Kinase for ROS Homeostasis in Arabidopsis. Molecular Cell, 41(6): 649–60.

Takeda, S., Gapper, C., Kaya, H., Bell, E., Kuchitsu, K.and & Dolan, L. (2008). Local positive feedback regulation determines cell shape in root hair cells. Science, 319(5867): 1241.

Temple, B. R. S. and Jones, A. M. (2007). The plant heterotrimeric G-protein complex. Annual Review of Plant Biology, 58: 249–66.

Thomma, B.P., Cammue, B.P. and Thevissen, K. (2002). Plant defensins. Planta 216: 193– 202.

Thomma, B.P., Eggermont, K., Penninckx, I.A., Mauch-Mani, B., Vogelsang, R., Cammue, B.P., Broekaert, W.F. (1998). Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proceedings of the National Academy of Sciences of USA, 95: 15107–15111

Thomma, B. P., Nürnberger, T. and Joosten, M. H. a J. (2011). Of PAMPs and effectors: the blurred PTI-ETI dichotomy. The Plant Cell, 23(1): 4–15.

Thung, L., Trusov, Y., Chakravorty, D. and Botella, JR. (2012). Gγ1+Gγ2+Gγ3=Gβ: the search for heterotrimeric G-protein γ subunits in Arabidopsis is over. Journal of Plant Physiology, 2012 Mar 15;169(5): 542-545.

Toledano, M.B., Delaunay, A., Biteau, B., Spector, D. and Azevedo S. (2003). Seeing red: Oxidative stress responses in yeast in "Topics in Current Genetics (Yeast Stress Responses)". Edited by Hohmann, S. and Mager, W. H. Springer Berlin: 241-303.

Ton, J. and Mauch-Mani, B. (2004) Beta-amino-butyric acid-induced resistance against necrotrophic pathogens is based on ABA-dependent priming for callose. Plant Journal, 38: 119–130.

Torres, M.A. (2010). ROS in biotic interactions. Physiologia Plantarum, 138(4): 414–429.

Torres, M.A. and Dangl, J.L. (2005). Functions of the respiratory burst oxidase in biotic interactions, abiotic stress and development. Current Opinion in Plant Biology, 8(4): 397– 403.

Torres, M.A., Dangl, J.L. and Jones, J.D.G. (2002). Arabidopsis gp91phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response. Proceedings of the National Academy of Sciences of USA, 99(1): 517-522.

129

REFERENCES

Torres, M.A., Jones, J.D.G. and Dangl, J.L. (2005). Pathogen-induced, NADPH oxidase- derived reactive oxygen intermediates suppress spread of cell death in Arabidopsis thaliana. Nature genetics, 37(10): 1130–1134.

Torres, M.A., Morales, J., Sánchez-Rodríguez, C., Molina, A. and Dangl, J. (2013). Functional interplay between Arabidopsis NADPH oxidases and heterotrimeric G protein. Molecular Plant-Microbe Interactions, 26(6): 686–694.

Torres, M.A., Onouchi, H., Hamada, S., Machida, C., Hammond-Kosack, K. E. and Jones, J.D. G. (1998). Six Arabidopsis thaliana homologues of the human respiratory burst oxidase (gp91phox). The Plant Journal, 14(3): 365–370.

Trusov, Y., Jorda, L., Molina, A., and Botella, J. R. (2010). G proteins and plant innate immunity. Pages 221-250 in: Integrated G Proteins Signaling In Plants, Signaling and Communication Series. Edited by: S. Yalovsky, F. Baluska, and A. Jones. Springer, Berlin.

Trusov, Y., Rookes, J. E., Chakravorty, D., Armour, D. and Schenk, P. M. (2006). Heterotrimeric G Proteins Facilitate Arabidopsis Resistance to Necrotrophic Pathogens and Are Involved in Jasmonate Signaling. Plant Physiology, 140(1): 210–220.

Trusov, Y., Rookes, J.E., Tilbrook, K., Chakravorty, D., Mason, M.G., Anderson, D., Chen, J.G., Jones, A.M., and Botella, J.R. (2007). Heterotrimeric G protein gamma subunits provide functional selectivity in G-beta-gamma dimer signaling in Arabidopsis. Plant Cell, 19: 1235-1250.

Trusov, Y., Sewelam, N., Rookes, J. E., Kunkel, M., Nowak, E., Schenk, P.M. and Botella, J. R. (2009). Heterotrimeric G proteins-mediated resistance to necrotrophic pathogens includes mechanisms independent of salicylic acid-, jasmonic acid/ethylene- and abscisic acid-mediated defense signaling. Plant Journal, 58: 69-81.

Trusov, Y., Zhang, W., Assmann, S. M. and Botella, J. R. (2008). Gγ1 + Gγ2 not equal Gβ: Heterotrimeric G protein Gγa-deficient mutants do not recapitulate all phenotypes of Gβ- deficient mutants. Plant Physiology, 147: 636-649.

Tsuda, K. and Katagiri, F. (2010). Comparing signaling mechanisms engaged in pattern- triggered and effector-triggered immunity. Current Opinion in Plant Biology, 13(4): 459–65.

Ullah, H., Chen, J. G., Temple, B., Boyes, D. C., Alonso, J. M., Davis, K.R., Ecker, J. R., and Jones, A. M. (2003). The β-subunit of the Arabidopsis G protein negatively regulates auxin-induced cell division and affects multiple developmental processes. Plant Cell, 15: 393-409.

130

REFERENCES

Ullah, H., Chen, J.G., Young, J.C., Im, K.H., Sussman, M.R., and Jones, A.M. (2001). Modulation of cell proliferation by heterotrimeric G protein in Arabidopsis. Science, 292: 2066-2069.

Underwood, W. (2012). The plant cell wall: a dynamic barrier against pathogen invasion. Frontiers in Plant Science, 3(85).

Urano, D. and Jones, A. M. (2014). Heterotrimeric G protein-coupled signaling in plants. Annual Review of Plant Biology, 65: 365–84.

Valério, L., De Meyer, M., Penel, C., and Dunand, C. (2004) Expression analysis of the Arabidopsis peroxidase multigenic family. Phytochemistry, 65: 1331–42.

Van Doorn, W. G., Beers, E. P., Dangl, J. L., Franklin-Tong, V. E., Gallois, P., Hara- Nishimura, I., Jones A.M., Kawai-Yamada M., Lam E., Mundy J. , Mur L.A.J., Petersen M., Smertenko A., Taliansky M., Van Breusegem F., Wolpert T., Woltering E., Zhivotovsky B. and Bozhkov, P. V. (2011). Morphological classification of plant cell deaths. Cell Death and Differentiation, 18(8): 1241–6.

Vellosillo, T., Vicente, J., Kulasekaran, S., Hamberg, M. and Castresana, C. (2010). Emerging complexity in reactive oxygen species production and signaling during the response of plants to pathogens. Plant Physiology, 154(2): 444–8.

Vera-Estrella, R., Higgins, V.J. and Blumwald, E. (1994). Plant defense response to fungal pathogens. II. G-protein-mediated changes in host plasma membrane redox reactions. Plant Physiology, 106: 97-102.

Vidhyasekaran., P. (2013). Seeing Red: Reactive Oxygen Species and Cognate Redox Signaling System in Plant Innate Immunity in: "PAMP Signals in Plant Innate Immunity". Springer, Dordrecht: 283-306

Vitale, S., Maccaroni, M. and Belisario, A. (2007) First report of zucchini collapse by Fusarium solani f. sp. cucurbitae Race 1 and Plectosporium tabacinum in Italy. Plant Disease, 91, 325.

Vorwerk, S., Somerville, S. and Somerville, C. (2004). The role of plant cell wall polysaccharide composition in plant disease resistance. Trends in Plant Science. 9: 203– 209.

Wang, X. (2005). Regulatory functions of phospholipase D and phosphatidic acid in plant growth, development, and stress responses. Plant Physiology, 139(2), 566–73.

131

REFERENCES

Wang, Y., Chen, Z., Zhang, B., Hills, A. and Blatt. M.R. (2013a). PYR/PYL/RCAR ABA receptors regulate K+ and Cl- channels through reactive oxygen species-mediated activation of Ca2+ channels at the plasma membrane of intact Arabidopsis guard cells. Plant Physiology, 163: 566–577.

Wang, P., Du, Y., Zhao, X., Miao, Y. and Song, C.P. (2013b). The MPK6-ERF6-ROS- responsive cis-acting Element7/GCC box complex modulates oxidative gene transcription and the oxidative response in Arabidopsis. Plant Physiology, 161: 1392–1408.

Wang G.F., Li W.Q., Li W.Y., Wu G.L., Zhou C.Y. and Chen K.M. (2013c). Characterization of rice NADPH oxidase genes and their expression under various environmental conditions. Int. Journal of Molecular Science, 14: 9440–9458.

Wang, X.Q., Ullah, H., Jones, A.M. and Assmann, S.M. (2001). G protein regulation of ion channels and abscisic acid signaling in Arabidopsis guard cells. Science, 292: 2070-2072.

Wang, H.X., Weerasinghe, R.R., Perdue, T.D., Cakmakci, N.G., Taylor, J.P., Marzluff, W.F. and Jones, A.M. (2006). A Golgi-localized hexose transporter is involved in heterotrimeric G protein-mediated early development in Arabidopsis. Molecular Biology of the Cell, 17: 4257-4269.

Wan, J., Zhang, X.C., Neece, D., Ramonell, K.M., Clough, S., Kim, S.Y., Stacey, M.G. and Stacey, G. (2008). A LysM receptor-like kinase plays a critical role in chitin signaling and fungal resistance in Arabidopsis. Plant Cell, 20: 471–481.

Weiss, C.A., Garnaat, C.W., Mukai, K., Hu, Y. and Ma, H. (1994). Isolation of cDNAs encoding guanine nucleotidebinding protein β-subunit homologues from maize (ZGB1) and Arabidopsis (AGB1). Proceedings of the National Academy of Sciences of USA, 91: 9554–58

Willard, F.S., Siderovski, D.P. (2004). Purification and in vitro functional analysis of the Arabidopsis thaliana regulator of G-protein signaling-1. Methods in Enzymology, 389: 320– 38

Wong, H. L., Pinontoan, R., Hayashi, K., Tabata, R., Yaeno, T., Hasegawa, K., Kojima, C., Yoshioka, H., Iba, K., Kawasaki, T. and Shimamoto, K. (2007). Regulation of rice NADPH oxidase by binding of Rac GTPase to its N-terminal extension. Plant Cell, 19(12): 4022–34.

132

REFERENCES

Wu, J., Shang, Z., Jiang, X., Moschou, P.N., Sun, W., Roubelakis- Angelakis, K.A. and

Zhang, S. (2010). Spermidine oxidase-derived H2O2 regulates pollen plasma membrane hyperpolarization- activated Ca2+-permeable channels and pollen tube growth. Plant Journal, 63: 1042–1053.

Wrzaczek, M., Brosché, M. and Kangasjärvi, J. (2013). ROS signaling loops - production, perception, regulation. Current Opinion in Plant Biology, 16(5): 575–82.

Xie, Y.-J., Xu, S., Han, B., Wu, M.-Z., Yuan, X.-X., Han, Y., Gu, Q., Xu, D., Yang Q and Shen, W.B. (2011). Evidence of Arabidopsis salt acclimation induced by up-regulation of HY1 and the regulatory role of RbohD-derived reactive oxygen species synthesis. Plant Journal, 66(2): 280–92.

Xie, H.T., Wan, Z.Y., Li, S. and Zhang, Y. (2014). Spatiotemporal Production of Reactive Oxygen Species by NADPH Oxidase Is Critical for Tapetal Programmed Cell Death and Pollen Development in Arabidopsis. Plant Cell, 26: 2007–2023

Xin, X.F. and He, S.Y. (2013). Pseudomonas syringae pv. tomato DC3000: a model pathogen for probing disease susceptibility and hormone signaling in plants. Annual Review of Phytopathology, 51: 473–98.

Yoshioka, H., Numata, N., Nakajima, K., Katou, S., Kawakita, K., Rowland, O., Jones, J.D.G. and Doke, N. (2003). Nicotiana benthamiana gp91 phox Homologs NbrbohA and

NbrbohB Participate in H2O2 Accumulation and Resistance to Phytophthora infestans. Plant Cell, 15(3): 706–718.

Yun, B.-W., Feechan, A., Yin, M., Saidi, N. B. B., Le Bihan, T., Yu, M., Moore, J.W., Kang J., Kwon, E., Spoel, S.H., Pallas, J.A. and Loake, G. J. (2011). S-nitrosylation of NADPH oxidase regulates cell death in plant immunity. Nature, 478(7368): 264–268.

Zeng, W., and He, S.Y. (2010). A prominent role of the flagellin receptor FLAGELLIN SENSING2 in mediating stomatal response to Pseudomonas syringae pv tomato DC3000 in Arabidopsis. Plant Physiology, 153: 1188-1198.

Zhang, H., Fang, Q., Zhang, Z., Wang, Y. and Zheng, X. (2009a). The role of respiratory burst oxidase homologues in elicitor-induced stomatal closure and hypersensitive response in Nicotiana benthamiana. Journal of Experimental Botany, 60(11): 3109–3122.

Zhang, W., He, S.Y. and Assmann, S.M. (2008). The plant innate immunity response in stomatal guard cells invokes G-protein-dependent ion channel regulation. Plant Journal, 56: 984-996.

133

REFERENCES

Zhang, J., Li, W., Xiang, T., Liu, Z., Laluk, K., Ding, X., Zou, Y., Gao, M., Zhang, X., Chen, S., Mengiste, T., Zhang, Y. and Zhou, J.M. (2010). Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector. Cell Host Microbe, 7: 290-301.

Zhang J, Shao F, Li Y, Cui H, Chen L, Li H, Zou Y, Long C, Lan L, Chai J, Chen, S., Tang, X., and Zhou, J.M. (2007) A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP-induced immunity in plants. Cell Host Microbe, 1: 175–185

Zhang, H., Gao, Z., Zheng, X. and Zhang, Z. (2012a) The role of G-proteins in plant immunity. Plant Signal Behavior, 1;7(10): 1284-8.

Zhang, H., Wang, M., Wang, W., Li, D., Huang, Q., Wang, Y., Zheng, X. and Zhang, Z. (2012b). Silencing of G proteins uncovers diversified plant responses when challenged by three elicitors in Nicotiana benthamiana. Plant Cell and Environment, 35: 72-85.

Zhang, Y., Zhu, H., Zhang, Q., Li, M., Yan, M., Wang, R., Wang, L., Welti, R.,, Zhang, W., and Wang, X. (2009). Phospholipase dalpha1 and phosphatidic acid regulate NADPH oxidase activity and production of reactive oxygen species in ABA-mediated stomatal closure in Arabidopsis. The Plant Cell, 21(8): 2357–2377.

Zhang, W., Jeon, B.W., and Assmann, S.M. (2011). Heterotrimeric G-protein regulation of ROS signalling and calcium currents in Arabidopsis guard cells. Journal of Experimental Botany, 62: 2371-2379.

Zeier, J., Delledonne, M., Mishina, T., Severi, E., Sonoda, M. and Lamb, C.J. (2004). Genetic elucidation of nitric oxide signaling in incompatible plant- pathogen interactions. Plant Physiology, 136: 2875–2886

Zipfel, C. (2014). Plant pattern-recognition receptors. Trends in Immunology, 35(7): 345–351.

Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D., Boller, T. and Felix, G. (2006). Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium- mediated transformation. Cell, 125: 749–760

Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E. J., Jones, J. D., Felix, G. and Boller, T. (2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature, 428: 764-767.

134

REFERENCES

135