MicroRNA-100 Suppresses Chronic Vascular Inflammation by Stimulation of Endothelial Autophagy
Franziska Pankratz1, Catherine Hohnloser1, Xavier Bemtgen1, Caterina Jaenich1, Sheena Kreuzaler1, Imo Hoefer2, Gerard Pasterkamp2, Justin Mastroianni3, Robert Zeiser3, Christian Smolka1, Laura Schneider1, Julien Martin1, Maike Juschkat1, Thomas Helbing1, Martin Moser1, Christoph Bode1 1 Sebastian Grundmann
1Department of Cardiology and Angiology I, University Heart Center Freiburg, Germany; 2Experimental Cardiology Laboratory, University Medical Center Utrecht, The Netherlands, and;3Department of Hematology and Oncology, University Hospital Freiburg, Germany.
Running title: MiR-100 Suppresses Chronic Vascular Inflammation
Downloaded from
http://circres.ahajournals.org/
by guest on January 9, 2018
Subject Terms: Atherosclerosis Basic Science Research Inflammation Gene Expression and Regulation
Address correspondence to: Dr. Sebastian Grundmann Department of Cardiology and Angiology I Heart Center, University of Freiburg Hugstetter Str. 55 79106 Freiburg Germany Tel: +49 (0) 761 270 70460 Fax: +49 (0) 761 270 70450 [email protected]
In November 2017, the average time from submission to first decision for all original research papers submitted to Circulation Research was 11.99 days.
DOI: 10.1161/CIRCRESAHA.117.311428 1
ABSTRACT
Rationale: The interaction of circulating cells within the vascular wall is a critical event in chronic inflammatory processes such as atherosclerosis, but the control of the vascular inflammatory state is still largely unclear.
Objective: This study was undertaken to characterize the function of the endothelial-enriched microRNA miR-100 during vascular inflammation and atherogenesis.
Methods and Results: Based on a transcriptome analysis of endothelial cells after miR-100 overexpression, we identified miR-100 as potent suppressor of endothelial adhesion molecule expression, resulting in attenuated leukocyte-endothelial interaction in vitro and in vivo as shown by flow cytometry and intravital imaging approach. Mechanistically, miR-100 directly repressed several components of mTORC1-signalling, including mTOR and raptor, which resulted in a stimulation of endothelial autophagy and attenuated NF-κB signaling in vitro and in vivo. In a LDLR-deficient atherosclerotic mouse model, pharmacologic inhibition of miR-100 resulted in enhanced plaque lesion formation and a higher macrophage content of the plaque, whereas a systemic miR-100 replacement Downloaded from therapy had protective effects and attenuated atherogenesis, resulting in a decrease of plaque area by 45%. Finally, analysis of miR-100 expression in more than 70 samples obtained during carotid endarterectomy revealed that local miR-100 expression was inversely correlated with inflammatory cell content in patients. http://circres.ahajournals.org/ Conclusion: In summary, we describe an anti-inflammatory function of miR-100 in the vascular response to injury and inflammation and identify an important novel modulator of mTOR signaling and autophagy in the vascular system. Our findings of miR-100 as a potential protective "anti-athero-miR" suggest that the therapeutic replacement of this miRNA could be a potential strategy for the treatment of chronic inflammatory diseases such as atherosclerosis in the future.
Keywords: MicroRNA, atherosclerosis, inflammation, endothelium, arteriosclerosis, gene expression/regulation. by guest on January 9, 2018
DOI: 10.1161/CIRCRESAHA.117.311428 2
Nonstandard Abbreviations and Acronyms:
Athero-Express Atherosclerotic plaque expression in relation to vascular events and patient characteristics CD Cluster of differentiation eNOS Endothelial NO synthase HDL High-density lipoprotein HEK Human embryonic kidney cells HFD High fat diet HMGCoA 3-hydroxy-3-methylglutaryl-coenzyme A HUVECs Human umbilical vein endothelial cells ICAM-1 Intracellular adhesion molecule 1 IKK IᴋB kinase IL Interleukin Keap-1 Kelch-like ECH associated protein 1 KLF2 Kruepple like factor 2 LDL Low-density lipoprotein Downloaded from LDLR Low-density lipoprotein receptor MCP-1 Monocyte chemoattractant protein 1 MIP-1 Macrophage inflammatory protein 1 miRNA microRNA mTOR Mammalian target of rapamycin http://circres.ahajournals.org/ mTORC1 mTOR complex 1 NFᴋB Nuclear factor 'kappa-light-chain-enhancer' of activated B-cells oxLDL Oxidized low-density lipoprotein sICAM-1 Soluble intracellular adhesion molecule 1 SMA Smooth muscle actin
by guest on January 9, 2018 INTRODUCTION
Inflammation is an important component of the host defense reaction against external pathogens and injury, but can also induce and maintain harmful conditions such as autoimmune diseases, atherosclerosis, in-stent restenosis or ischemia/reperfusion injury. The endothelial cell layer of blood vessels is a critical modulating structure in this process, as circulating immune cells need to attach to the endothelium and migrate into the vessel wall or the perivascular space to exert their function. In fact, the up-regulation of endothelial adhesion molecules due to alterations in fluid shear forces, hypertension or elevated LDL-cholesterol levels is one of the earliest steps in the initiation of atherosclerosis, which is now generally regarded as a chronic inflammatory disease1-3.
Many attempts to modulate leukocyte-endothelial interaction to prevent or reduce excessive inflammatory reactions were made in the past. However, the basic regulatory principles of the endothelial inflammatory process remain unclear. It seems that the inhibition of individual components of the inflammatory cascade, e.g. by a single antibody against an adhesion molecule, may not be enough to achieve a sustained effect on vascular inflammation.
In the past years, microRNAs (miRNAs) have been identified as important regulators of gene expression in a wide range of organisms and biological processes. MiRNAs are short (17-24 base pairs), non-coding, single stranded RNA-molecules that are transcribed as precursor molecules and processed to mature miRNAs. MiRNAs regulate the expression of their target genes by translational repression or mRNA degradation. MiRNAs play a key role in cellular proliferation, development and tissue remodeling. Currently, 2603 human and 1920 mouse miRNAs are annotated in the miRBASE 21.0 database, but even more human miRNAs are predicted and their identification and functional characterization is ongoing.
DOI: 10.1161/CIRCRESAHA.117.311428 3
Several studies have implicated miRNAs as pivotal players in the regulation of different aspects of vascular biology. Our own group recently used miRNA-transcriptome profiling to screen for miRNAs involved in the regulation of adaptive neovascularization. We identified miR-100 as an endothelial enriched miRNA that attenuates blood vessel growth in response to ischemia following arterial occlusion in mice via repression of the pro-angiogenic and pro-arteriogenic signal transducer mammalian target of rapamycin (mTOR)4. In the present study we now aimed to explore the regulation and function of this miRNA in endothelial cells. Starting from a global transcriptome analysis of human umbilical vein endothelial cells (HUVECs) after miR-100 overexpression, we identified a potent regulatory role of miR-100 in the endothelial inflammatory response to injury. In addition, we demonstrate the modulation of miR-100 levels by pro- and anti-inflammatory stimuli and describe a novel mechanism by which miR-100 exerts strong anti-inflammatory properties in endothelial cells via the augmentation of endothelial autophagy.
METHODS
Downloaded from The detailed protocols of this study are available from the first author upon request. Transgenic mice are available from the commercial vendors. The microarray data created for this study have been made publicly available at the NCBI gene expression and hybridization array data repository (GEO, http://www.ncbi.nlm.nih.gov/geo/) and can be accessed under the accession number GSE 20668. http://circres.ahajournals.org/ A more detailed description of material and methods used in the manuscript can be found in the supplement.
Cell culture experiments. Human umbilical vein endothelial cells (HUVECs) were isolated from donated umbilical cords, cultivated and used until passage five. HEK293A cells were cultured in Dulbecco`s Modified Eagle Medium (DMEM), Life technologies, Darmstadt, Germany, supplemented with 10 % FBS. For transfection protocols please refer to the online supplement. by guest on January 9, 2018 Autophagy detection kit. HUVECs were sowed in culture slides and miRNA expression levels were modulated. As positive control, cells were treated with 50 μM chloroquine for 24 h to artificially generate autophagosomes. Endothelial autophagy was analyzed by immunofluorescence staining against LC3B positive autophagosomes using the “LC3B antibody kit for autophagy”, Life technologies, Darmstadt, Germany. Following staining, the average number of LC3-II-positive autophagosomes per cell was counted in a randomly chosen imaging field (20 cells/ imaging field). The results of 20 cells were averaged.
Animal experiments. C57/BL6J mice were purchased either from Charles River or from the local stock of the animal facility at University Hospital Freiburg, Germany. NF-ᴋB-RE-luc mice (BALB/c-Tg(Rela-luc)31Xen, #10499- M) were purchased from Taconic, Hudson, NY, USA and B6.129S7-Ldlrtm1Her/J (LDLR-/-) mice were obtained from the Jackson Laboratory. Mice were bred in a specific pathogen free animal facility of the University Hospital Freiburg. Animal protocols were approved by the Regierungspraesidium Freiburg, Germany and all studies conformed to the Guide for the Care and Use of Laboratory Animals published by the directive 2010/63/EU of the European Parliament.
Intravital imaging of mesenteric venules. Intravital imaging of mesenteric venules was performed 24 hours following i.v. injection of an antisense oligonucleotide (AntagomiR-100) or the corresponding control compound (AntagomiR-cont.) or PBS as a vehicle in C57/BL6J male mice, three weeks of age. No co-stimulation was conducted.
In vivo bioluminescence imaging of NF-ᴋB promotor activity. NF-ᴋB-RE-luc male mice were used at age of 12 weeks and 24 h before performing imaging miR-100 was systemically inhibited using AntagomiR-100. An oligonucleotide with an irrelevant sequence
DOI: 10.1161/CIRCRESAHA.117.311428 4
(AntagomiR-cont.) served as control. At date of experiment, mice were i.p. injected with D-Luciferin to visualize NF-ᴋB-activity and 10 minutes following injection, mice were imaged for 5 minutes using an IVIS200 charge-coupled device (CCD) imaging system.
Simvastatin treatment of mice. C57/BL6J male mice, 12 weeks of age were daily i.p. injected with 20 mg/kg simvastatin for three days. Subsequently, mice were sacrificed and RNA from the descending aorta was isolated.
Atherosclerosis mouse study. To induce plaque lesion formation under inhibition of miR-100, LDLR-/- male mice, eight weeks of age, received a high-fat diet (HFD, D12108 mod., ssniff® Spezialdiaeten GmbH, Soest Germany) with 21% crude fat and 12,35 mg/kg Cholesterol for 16 weeks and were i.v. injected in intervals of four weeks (day 0, 28, 56, 84) with a cholesterol-conjugated antisense oligonucleotide against miR-100 (AntagomiR-100) or the corresponding control compound (AntagomiR-cont.) at a concentration of 8 µg/g solved in 0,9 % NaCl. Detailed sequence of the used antisense-oligonucleotides can be found in the Supplementary Table I. For the atherosclerosis study with the gain-of-function approach, LDLR-/- mice, 8 weeks of age, were fed for 8 weeks with HFD and miR-100-specific precursor molecules (miR- Downloaded from 100 mimic) or the corresponding control compound (control) were i.v. injected in time intervals of 4 weeks at a concentration of 10 µg/g in combination with the in vivo transfection reagent jetPEI, Polyplus transfection, Illkirch, France, according to manufacturer’s instructions.
Measurement of miR-100 expression in human atherosclerotic plaque lesions. http://circres.ahajournals.org/ Plaque samples were obtained from the biobank Athero-Express (Atherosclerotic plaque expression in relation to vascular events and patients characteristics) from the University Medical Center, Utrecht, The Netherlands. 37 unstable lesions with a high fat and macrophage content and 40 stable plaque lesions characterized by low intra-plaque macrophage number and a fat content less than 40% were analyzed and ten non-diseased mammary arteries served as control. Details to the histological classification of the plaques can be found in the online supplement.
Statistical analysis. by guest on January 9, 2018 Data were expressed as mean and SEM. Treatment groups were compared by unpaired Student´s t test with Prism 5 for Windows (GraphPad Software Inc, San Diego, CA, USA). One-way ANOVA was used for multiple comparisons of >2 groups.
The Bonferroni post-test for multiple comparisons was used if the P-value for the overall ANOVA comparison was statistically significant. Because normal distribution of our data could not be statistically verified for all experiments owing to sample size, additional nonparametric testing was performed with Mann-Whitney U tests (for 2 groups) or Kruskal-Wallis tests (for >2 groups), whenever appropriate. Fisher´s exact t-test was used to compare categorical variables. Values of P<0.05 were considered statistically significant.
DOI: 10.1161/CIRCRESAHA.117.311428 5
RESULTS
Overexpression of miR-100 suppresses endothelial adhesion molecule expression and attenuates leukocyte rolling and adhesion to the endothelium in vitro and in vivo.
Overexpression of miR-100 in cultured endothelial cells resulted in a significant alteration of the endothelial transcriptome, with the top-20 down-regulated genes after miR-100 overexpression including two adhesion molecules (Supplementary Table II), namely E-Selectin (rank 1) and VCAM-1 (rank 16). Validating these array results, miR-100 was either overexpressed or inhibited by transfection with specific miR-100 precursor oligonucleotides (premiRs) or antisense-inhibitors (antimiRs). Using a transfection protocol for miRNA-modulation, we achieved a transfection efficacy of >90% and a significant positive or negative modulation of miRNA-levels, respectively (Supplementary Figure I) and we could show a strong suppression of the endothelial adhesion molecules E-Selectin, ICAM-1 and VCAM-1 on mRNA (Supplementary Figure II) and protein level using both flow cytometry analysis (Figure 1A-F) and western blot approach (Supplementary Figure III) by miR-100 following TNF-α stimulation. Stimulation with other pro-inflammatory molecules such as LPS, IL-1β and oxLDL following overexpression of miR-100 in HUVECs revealed similar but less pronounced effects on Downloaded from endothelial adhesion molecules mRNA expression compared to TNF-α treatment (Supplementary Figure IV).
Investigating the functional relevance of these findings, we applied physiological venous shear stress on an endothelial layer using a flow chamber apparatus following modulation of miR-100 levels. http://circres.ahajournals.org/ The overexpression of miR-100 attenuated both rolling and adhesion of leukocytes on the endothelial layer (Figure 1G-I), whereas inhibition of this miRNA significantly increased leukocyte endothelial interaction (Figure 1L-N).
To validate the in vivo relevance of these in vitro findings, we used a mouse model of intravital microscopy and quantified the effects of miR-100 inhibition on leukocyte-endothelial interaction in vivo. We found a strong stimulation of rolling as well as adhesion of leukocytes following miR-100 inhibition (Figure 1J+K+O), in good correspondence with our in vitro findings. by guest on January 9, 2018 MiR-100 induced suppression of endothelial adhesion molecules is mTORC1-dependent.
As bioinformatics target prediction tools (miRanda5-7, Targetscan8-10) did not reveal any miR-100 binding sites within the mRNA sequences of the three adhesion molecules, the mechanism by which miR-100 exerted its effects on leukocyte-endothelial interactions remained unclear. As we recently identified the direct miR-100 target mTOR (mammalian target of rapamycin) as the downstream mediator of miR-100 effects on angiogenesis, we hypothesized that direct modulation of mTOR signaling by miR-100 could contribute to these anti-inflammatory effects. As a first step, we inhibited mTOR and assessed its effects on adhesion molecule expression. Indeed, our results demonstrated that treatment with the direct inhibitor of the mTOR-complex-1 (mTORC1) rapamycin suppressed the expression of E-Selectin, ICAM-1 as well as VCAM-1 (Figure 2A-F) in response to endothelial cell activation with TNF-α. In addition, mTOR inhibition could abolish the effects of miR- 100 inhibition on endothelial adhesion molecule protein expression, showing that intact mTOR- signaling was a necessary component for miR-100 to exert its anti-inflammatory effects (Figure 2G-I). This dependency was also detectable on a functional level in flow chamber experiments, where concomitant inhibition of miR-100 and mTOR in endothelial cells significantly attenuated the effects of isolated miR-100 inhibition on leukocyte rolling and adhesion (Figure 2J+K+N). Again, these functional in vitro results could be reproduced in vivo using intravital microscopy of mesenteric venules: when mice were injected with rapamycin and a cholesterol-conjugated oligonucleotide against miR-100 (AntagomiR-100) 24h before performing microscopy, this simultaneous inhibition of miR-100 and mTORC1 significantly reduced rolling as well as adhesion of leukocytes on the endothelial wall compared to the stimulatory effect of single miR-100 inhibition (Figure 2L+M+O). As these in vitro and in vivo results demonstrated a dependency of the anti-inflammatory miR-100 properties on inhibition of mTORC1 signaling, our next aim was to integrate miR-100 in the mTOR-dependent endothelial signaling cascade.
DOI: 10.1161/CIRCRESAHA.117.311428 6
Stimulation of endothelial autophagy following overexpression of miR-100 reduces NF-κB activity in vitro and in vivo.
In good correspondence with previous studies in non-vascular cells11, 12, we found that miR-100 did not only directly target mTOR itself, but also the mTORC1-complex signaling partner Raptor (Figure 3D-H), both key modulators of endothelial metabolism and autophagy. Previous studies suggested an interaction between the mTOR-dependent metabolic state and the inflammatory properties of endothelial cells13. We now found a significant induction of endothelial autophagy following overexpression of miR-100 (Figure 3A-C), whereas inhibition of this miRNA led to a significant reduction of LC3B-positive autophagosomes per cell. In addition, miR-100 overexpression increased the expression of the autophagy marker Atg3 and the conjugation of Atg5 and Atg12 downstream of mTORC1, whereas miR-100 inhibition had the opposite effect (Figure 3I-L). Correspondingly, we could show an enhancement of the conversion of LC3 to LC3II if miR-100 was overexpressed, again indicating a stimulation of endothelial autophagy by miR-100 (Figure 3M). As autophagy can be regulated by mTOR via distinct pathways such as the phosphorylation of ULK1/2 or the translocation of the transcription factor TFEB into the nucleus, we analyzed the expression of both proteins following Downloaded from miR-100 overexpression and found an enrichment of TFEB in the nucleus, but no significant alteration of ULK phosphorylation in total cell lysate (Figure 3N-O), indicating a TFEB-dependent stimulation of endothelial autophagy by miR-100. This stimulation of endothelial autophagy correlated with a decreased expression of IKKβ-kinase, resulting in an increase of non-phosphorylated IκBα and a reduced expression of the NF-κB p65 subunit. Again, the loss-of-function approach had the opposite http://circres.ahajournals.org/ effect (Figure 3Q-U). Besides these observations, we found a decreased NF-ᴋB promotor activity following miR-100 overexpression in vitro and the transfection of antimiR-100 oligonucleotides had the opposite effect (Figure 3V), suggesting the control of this pivotal inflammatory transcription factor by miR-100. As the in vitro observations can differ from the in vivo situation, we next monitored the NF- ᴋB-activity in the transgenic NF-ᴋB-RE-luc mouse strain following modulation of miR-100 expression level. We found a strongly increased NF-ᴋB-activity, if miR-100 was inhibited, indicating that miR-100 expression is linked to NF-ᴋB-activity (Figure 3W+X). Interestingly, if endothelial autophagy was artificially inhibited by Bafilomycin, which prevents the maturation of autophagic vacuoles by inhibiting by guest on January 9, 2018 the fusion between autophagosomes and lysosomes (Figure 4A-C), the anti-inflammatory signaling effects of miR-100 downstream mTOR-inhibition were abrogated (Figure 4D-F), demonstrating their dependency on autophagy-induction in endothelial cells. In addition, we could show a direct interaction of autophagy with NF-κB promotor activity, as inhibition of autophagy significantly stimulated NF-κB promotor activity (Figure 4G). Based on these results, we hypothesized that the regulation of endothelial adhesion molecules expression might be dependent on the level of endothelial autophagy. Indeed, concomitant overexpression of miR-100 and inhibition of autophagy by Bafilomycin strongly attenuated the effect of miR-100 overexpression on protein expression of the endothelial adhesion molecules E- Selectin, ICAM-1 as well as VCAM-1 (Figure 4I-K).
Endothelial miR-100 is down-regulated by the pro-inflammatory cytokine TNF-α in a NF-κB dependent manner and up-regulated in response to simvastatin via a HMG-CoA reductase dependent pathway.
While our results shown above indicated a pivotal role of miR-100 in endothelial inflammation, the regulation of this miRNA itself was still unknown. Screening for possible cytokines as modulators of miR-100 expression in endothelial cells by stimulation with the pro-inflammatory cytokine TNF-α (Figure 5A) revealed a significant down-regulation of miR-100. This decrease in expression was dependent on an intact function of NF-κB: pre-treatment of HUVECs with the NF-κB inhibitor PS1145 abrogated the down-regulation of miR-100 by this cytokine (Figure 5B), as did the transfection of a plasmid coding for IκBα-superrepressor (IᴋBα-SR, Figure 5C).
On the other hand, stimulation of endothelial cells with simvastatin resulted in a significant increase of miR-100 expression both under basal as well as under pro-inflammatory culture conditions (Figure 5D+E). Supplementation of the downstream metabolite isoprenoid mevalonate was able to antagonize the observed effect of simvastatin on miR-100 expression, demonstrating the specificity of the simvastatin effect and its dependency on the canonical HMG-CoA reductase dependent pathway
DOI: 10.1161/CIRCRESAHA.117.311428 7
(Figure 5F+G). Mice treated with simvastatin for three days showed a significant up-regulation of miR- 100 in aortic tissue (Figure 5H), in good correspondence with our in vitro data.
Inhibition of miR-100 stimulates atherogenesis in mice.
As our findings on leukocyte-endothelial interaction indicated that miR-100 might influence atherosclerotic lesion development, we investigated the effects of chronic miR-100 inhibition on murine atherogenesis in LDLR-deficient mice on high cholesterol diet. As previously described4, intravenous AntagomiR-100 treatment resulted in a significant down-regulation of miR-100 expression levels in multiple tissues including the vasculature (Supplementary Figure V A+C). Weight gain and blood leukocyte count was comparable between the AntagomiR-cont. and AntagomiR-100-treated groups (Supplementary Figure V B+D). MiR-100 inhibition resulted in a significant increase in atherosclerotic plaque area compared to treatment with a control oligonucleotide (Figure 6A-E). Also, the histological plaque phenotype was significantly altered by chronic miR-100 inhibition, as smooth-muscle-actin (SMA) content decreased and at the same time macrophage accumulation in the plaque increased (Figure 6H-J). Additionally, picrosirius red staining showed that atherosclerotic lesions in AntagomiR- 100 treated mice contained less collagen (Figure 6F+G). Taken together, these results indicated that Downloaded from plaque morphology shifts to a more macrophage-rich phenotype, in good correspondence with our previous observation of increased leukocyte-endothelial interaction under conditions of miR-100 inhibition. Additionally, while baseline triglyceride as well as total cholesterol and HDL/LDL cholesterol levels were equal between the experimental groups (Supplementary Figure V E-H), inhibition of miR-100 resulted in an increase in triglyceride, total cholesterol and LDL cholesterol levels http://circres.ahajournals.org/ (Supplementary Figure V I-L), whereas HDL cholesterol was significantly decreased over the treatment period compared to the control group (Supplementary Figure V J). Additionally, we found an enrichment of mTOR in liver tissue of AntagomiR-100 treated mice (Supplementary Figure V M). As mTOR is not only a miR-100 target but also a regulator of the metabolic state14, 15, we hypothesized a link between increased mTOR expression following miR-100 inhibition and observed effects on triglyceride as well as cholesterol levels. Critical regulators of fatty acid and cholesterol biosynthetic gene expression are the SREBP family members16, and it is known that mTORC1 complex positively regulates their activation17, 18. Indeed, we found an up-regulation of transcription factor SREBP-2, which by guest on January 9, 2018 mainly controls cholesterol biosynthesis16, on mRNA as well as protein (Supplementary Figure V N-P) expression levels in liver tissue of the AntagomiR-100 treated group, indicating an influence of miR- 100 on cholesterol- and triglyceride biosynthesis.
Overexpression of miR-100 protects against atherosclerotic lesion formation.
Next, we asked whether a pharmacologically overexpression of miR-100 might have protective effects against atherosclerotic lesion formation and as our in vitro data demonstrated a more pronounced effect of miR-100 overexpression than of inhibition, we chose the longer 16 weeks’ time period for the AntagomiR treatment group to increase the sensitivity, but a 8 week period for the miR-100 treatment. Again, parameters such as weight gain and leukocyte count did not differ between the treatment groups injected with either a miR-100 mimicking oligonucleotide (miR-100 mimic) or an irrelevant control sequence (Supplementary Figure VI C+D). Injection of the miR-100 mimic resulted in a 2.5-fold increase of miR-100 in the aortic tissue and a significant downregulation of the direct miR-100 target mTOR (Supplementary Figure VI A+B). Corresponding to our finding of an increased plaque size following miR-100 inhibition, we found that an overexpression of this miRNA attenuated plaque lesion formation in the aortic root (Figure 7A+B) as well as in the abdominal aortia (Figure 7D+E), whereas we could not detect a significant difference in plaque size in the aortic arches (Figure 7C). In addition, we found a significantly lower number of Mac-3 positive cells in the atherosclerotic lesions of the aortic roots if miR-100 was overexpressed (Figure 7F+G).
While baseline triglyceride and cholesterol level did not differ between the treatment groups (Supplementary Figure VI E-H), we found decreased serum levels of total triglyceride- and cholesterol as well as LDL-cholesterol, but increased levels of HDL-cholesterol (Supplementary Figure VI I-L) under treatment with the miR-100 mimic. The expression of miR-100 was significantly enhanced in liver tissue of miR-100 mimic treated mice and subsequently, mTOR and the transcription factor
DOI: 10.1161/CIRCRESAHA.117.311428 8
SREBP-2, which controls lipid metabolism in hepatocytes were significantly suppressed compared to the control treatment (Supplementary Figure VI M-O).
MiR-100 plays a minor role in the circulating cell population.
The recruitment of immune cells in the inflammatory response is among others dependent on both adhesion molecule expression on the endothelial surface and the circulating cell population. As we identified a profound role of miR-100 on endothelial adhesion molecule expression we next investigated the baseline expression of miR-100 in different circulating cell populations compared to human endothelial cells and found a rare expression of miR-100 in circulating cells (Supplementary Figure VII A). We next investigated whether miR-100 regulates the expression of the integrin family member CD11b, which regulates leukocyte adhesion as well as migration in the inflammatory response and found an only moderate reduction of CD11b following miR-100 overexpression in THP-1 cells under baseline and pro-inflammatory conditions (Supplementary Figure VII D+F). Functional, we found a reduction of TNF-α secretion under miR-100 overexpression in THP-1 cells (Supplementary Figure VII B). However, miR-100 inhibition had no effect on both CD11b expression and TNF-α secretion (Supplementary Figure VII G+E+G). As THP-1 cells are an immortalized cell-population we Downloaded from determined the influence of miR-100 expression on migration capacity in human monocytes isolated by negative bead-isolation in whole blood and again found only a minor reduction of migration capacity if miR-100 was overexpressed (Supplementary Figure VII H+I). As we postulate a regulation of endothelial adhesion molecules by miR-100 via direct mTOR-targeting, we next analyzed the mTOR expression following miR-100 modulation in THP-1 cells. Whereas the inhibition of miR-100 did not http://circres.ahajournals.org/ result in a significant expression change, miR-100 overexpression reduced the expression of mTOR (Supplementary Figure VII J). Overall, our results indicate only a minor role of miR-100 in the circulating cell population, underlying that the observed effects of miR-100 on endothelial-leukocyte interaction are mainly mediated by the suppression of endothelial adhesion molecules.
In humans, miR-100 is highly suppressed in macrophage- and fat-rich atherosclerotic plaques compared to lesions with a low macrophage or fat content.
by guest on January 9, 2018 As our findings on murine atherogenesis suggested that miR-100 might play a modulating role in this chronic vascular inflammatory disease, we next evaluated the relevance of our experimental findings for atherosclerotic disease in humans. We measured the expression of miR-100 in atherosclerotic tissue obtained during carotid endarterectomy of 40 patients with stable plaques characteristics such as low fat and macrophage content in histology, 37 patients with macrophage- and fat-rich atherosclerotic lesions and ten non-diseased mammary arteries from the “AtheroExpress”19 biobank using Taqman-based stem-loop PCR. For detailed patients characteristics please refer to Supplementary Table III. Interestingly, we could not detect a difference in miR-100 expression between plaque lesions with a minor fat/macrophage content and healthy arteries, but we found a significant suppression of miR-100 expression levels in macrophage- and fat-rich lesions compared to the other groups (Figure 8C+D). In addition, miR-100 expression levels were negatively correlated with intra- plaque levels of soluble ICAM-1 (sICAM-1) and the cytokines IL-8, MCP-1 and MIP-1 as well as with the absolute number of infiltrating macrophages (Supplementary Table IV). However, we could not detect any differences in miR-100 expression level in neither macrophage-rich lesions nor plaques with a low macrophage content, when comparing between calcium-antagonism or statin user (Supplementary Figure VIII).
DOI: 10.1161/CIRCRESAHA.117.311428 9
DISCUSSION
While acute inflammation is an essential component of an organisms defence against injury and invading pathogens, a chronic and excessive inflammatory activation of the endothelium can have a harmful effect on the vasculature, driving endothelial dysfunction and progression of atherosclerotic lesion development. In our current study, we now demonstrate that miR-100 restrains vascular inflammation in vitro and in vivo by suppressing endothelial adhesion molecule expression and thereby attenuating leukocyte-endothelial interaction. This is achieved by direct targeting at least two individual components of the mTORC1 complex (mTOR4 and Raptor11, 12), altering TOR-dependent endothelial signaling and thereby stimulating endothelial autophagy and inhibiting NF-κB-activity (Figure 8E). Our findings that this miRNA is dynamically regulated by pro- and anti-inflammatory stimuli and that its expression levels correlate with the histological phenotype of human atherosclerotic lesions make miR- 100 a potential target for the treatment of human vascular inflammatory diseases.
Human miR-100 belongs to the miR-99 family of miRNAs and genetically maps to chromosome 11q24.1, where it lies in a cluster with let-7A2 and miR-125B. While most studies on this miRNA addressed its expression levels and function in neoplastic disease20-22, our own interest in miR-100 was Downloaded from based on a previous study from our group, were we used miRNA-profiling to identify miR-100 as a potent inhibitor of mTOR-dependent angiogenesis and arteriogenesis in mice4. In the present investigation, we use an unbiased genomic screen to identify biological processes modulated by miR- 100 overexpression in endothelial cells. We focused on inflammatory pathways and especially leukocyte-endothelial interaction, because on an individual gene level, the 20 overall most strongly http://circres.ahajournals.org/ down-regulated genes include both VCAM-1 and E-Selectin, with the latter showing the most prominent down-regulation of all genes analyzed. However, these genes do not contain a miR-100 binding site and are therefore no direct miR-100 target genes. As we could previously identify mTOR as a direct miR- 100 target in endothelial cells4 by similar analysis limited to downregulated genes predicted as potential miR-100 targets by two bioinformatic algorithms, we next investigated this pathway as the possible mediating signaling cascade.
The mTOR kinase exists in two multiprotein-complexes (mTORC1 and mTORC2) with by guest on January 9, 2018 overlapping but also divergent functions in the regulation of cellular growth, metabolism and vascular biology. Their role in vascular inflammation remains largely unclear, as previous studies described both pro- and anti-inflammatory roles of mTOR, depending on the affected cell type, experimental conditions and co-stimulatory events23, 24. In addition to mTOR itself, we now find that miR-100 also targets Raptor in endothelial cells, thereby directly suppressing two main components of the mTORC1-complex. Our experiments using the pharmacological inhibitor rapamycin demonstrate a dependency of the anti- inflammatory properties of miR-100 on inhibition of mTORC1 signaling, as this is the TOR-complex predominantly affected by this inhibitor. In response to nutrient starvation or cellular stress, a decrease in mTORC1 activity can initiate autophagy, which utilizes the degradation of cellular components in lysosomes to maintain homeostasis under stress conditions25. Autophagy activation leads to translocation of the mTOR-substrate complex from the cytosol to the endoplasmic reticulum, followed by elongation as well as maturation of the autophagosome, which requires among other components the ubiquitin-like conjugates Atg12 and Atg5, as well as the Atg8 homologues LC3, produced by Atg3. All of these conjugates were found to be increased in response to miR-100. Autophagy and inflammation are known to interact on multiple levels26, with a prominent cross-talk between NF-κB and autophagic signaling pathways. For example, autophagy is known to degrade IKKβ, which is one of the key molecules in the NFᴋB signaling pathway by different mechanisms such as the regulation of Kelch-like ECH associated protein 1 (Keap-1), which is an interactor of IKKβ27 or the Ro52-mediated autophagy degradation of IKKβ28. Indeed, overexpression of miR-100 suppresses NF-ᴋB promotor activity if autophagic function is intact, but not if the initiation of autophagosomes is inhibited. In summary, our findings demonstrate that miR-100 mediates its anti-inflammatory effects by directly targeting mTOR as well as Raptor, resulting in stimulated endothelial autophagy and diminished activity of the pro- inflammatory transcription factor NF-ᴋB.
Interestingly, our results demonstrate that miR-100 does not only control endothelial inflammation, but that its expression itself is modulated in response to pro- and anti-inflammatory
DOI: 10.1161/CIRCRESAHA.117.311428 10
stimuli. While the relatively high expression of miR-100 in the vasculature is well documented29, our present experiments show for the first time a decrease in expression in response to the inflammatory cytokine TNF-α. While hundreds of genes are induced during the induction of endothelial dysfunction, the down-regulation of genes is a relatively rare event30. Among the few well characterized examples are Kruepple like factor 2 (KLF2) and endothelial NO synthase (eNOS), which are both reduced following TNF-α stimulation in a NF-κB dependent manner31, 32, in a similar pattern as we now observe for miR-100. Our results also identify simvastatin as the first drug with the ability to increase miR-100 levels in endothelial cells. Supplementation of simvastatin treated cells with the downstream isoprenoid mevalonate completely reverses the effect of the HMGCoA-inhibitor on miR-100 expression, demonstrating that its regulation is dependent on the cholesterol synthesis pathway. As miR-100 has a relatively short biological half-life in endothelial cells4, our results suggest that the up-regulation and stabilization of miR-100 levels could be a novel mediator of the pleiotropic effects of statins. Our data are supported by a publication of Lefer and colleagues, who found that simvastatin inhibits leukocyte- endothelial interaction in a rat model of intravital microscopy of mesenteric venules33 and Wei and coworkers recently showed that simvastatin enhances autophagy via inhibition of mTOR signaling in coronary artery myocytes34.
Downloaded from Also, Liu et al. demonstrated that atorvastatin attenuates vascular smooth muscle cells calcification by inducing autophagy35, which is in good correspondence with our own results on the effects of miR-100 on endothelial autophagy.
In the past years, several miRNAs with both pro- and anti-inflammatory effects in endothelial http://circres.ahajournals.org/ cells have been identified. Most recently, Sun and coworkers used the systemic delivery of miRNA- 181b-mimicking oligonucleotides to inhibit NF-κB activation and atherogenesis in ApoE-deficient mice36. In contrast to our findings on miR-100, miR-181b modulates inflammatory signaling further downstream by directly targeting importin-α3, demonstrating that NF-κB-dependent signaling effects are controlled by several miRNAs.
One of the most abundant and best-studied miRNAs in endothelial cells is miR-126. Apoptotic body-mediated delivery of miR-126 exerts anti-inflammatory effects by increasing athero-protective by guest on January 9, 2018 CXCL12 production. In another recent landmark paper, Schober and coworkers showed that miR-126- 5p limits atherosclerosis by suppressing the Notch1 inhibitor Dlk1 in ApoE-deficient mice37, via a mechanism distinct from the previously described function of miR-126-3p38. In contrast to these negative modulators of endothelial activation, miR-92a is up-regulated in atheroprone vascular regions exposed to low shear stress, contributing to atherosclerotic lesion development by targeting SOCS-539. MiR-10a again represses NF-κB activity by targeting MAP3K7 and beta-TRC40, whereas Cheng and coworkers recently showed that miR-146b blunts endothelial activation by targeting the RNA-binding protein HuR, eventually decreasing NF-κB activity41. Our own findings now add miR-100 to this regulatory network of anti-inflammatory miRNAs, suggesting that these regulatory RNAs play a critical role in the restraint of vascular inflammation and the maintenance of an endothelial equilibrium.
One caveat of our murine in vivo experiments is that the AntagomiRs had to be given systemically. Although vascular endothelial cells are directly exposed to the injected agent after intravenous application, a significant amount is taken up by hepatocytes. Also, we found evidence that miR-100 inhibition modulated mTOR signaling in multiple extravascular tissues including the liver, possibly effecting basic metabolic processes that influence vascular inflammation and atherogenesis. While weight gain and glucose levels do not differ between the groups, miR-100 inhibition results in an increase of circulating lipid levels, in good correspondence with the known effects of systemic mTOR- inhibitor treatments42, 43, e.g. rapamycin or everolimus. Indeed, treatment with the miR-100 inhibitor decreases the expression of SREBP-2, a rapamycin sensitive gene involved in the regulation of lipid metabolism (Supplementary Figure III M-O), suggesting that miR-100 affects vascular inflammation and atherosclerosis on multiple levels, similar to other mTOR-inhibitors. As the recruitment of immune cells is dependent on both adhesion molecule expression on the endothelial surface and on circulating cells, we also investigated the function of miR-100 monocytes and macrophages. Our results point to a marginal influence of miR-100 in circulating cells. However, we cannot exclude potential additional effects of miR-100 in other cell populations contributing to atherosclerosis not investigated in this study,
DOI: 10.1161/CIRCRESAHA.117.311428 11
such as vascular smooth muscle cells. Although we performed extensive in vitro experiments in the isolated endothelial and circulating cell population, which exclude a confounding influence of lipid levels, we think that both the influence of miR-100 on lipid metabolism and the suppression of endothelial-leukocyte interaction by miR-100 contribute to the overall phenotype of our mice.
MiR-100 is highly conserved between species, with an identical sequence between mice and humans and a largely overlapping set of predicted target genes, including the components of TOR- signaling described in our experiments. What makes our findings relatively unique is the good correlation of functional experimental results with clinical histopathology data obtained from more than 70 human atherosclerotic plaque specimens. Although these “vulnerable plaque” characteristics have been originally derived from cross sectional studies in which cause and consequence cannot be separated, there is increasing evidence that this concept is valid also for clinical outcome. For example, Stone and coworkers recently showed that such “vulnerable” local plaque characteristics in intravascular ultrasonography correlate well with future events44. The Athero-Express biobank used in our study was initiated in 2002 and has so far allowed the identification of multiple proteins that could play a role in plaque destabilization. 45, 46.
Downloaded from Our observations differ from the results of a smaller previous study by Raitoharju et al.47, where no differential regulation of miR-100 between different atherosclerotic lesions and healthy arteries could been identified. One explanation could be that Raitoharju et al. did not distinguish between stable and unstable plaque lesions as we did in our experimental setting. Our data suggest miR-100 as a potential biomarker of plaque vulnerability and this is supported by a study of Soeki et al.48, which provides http://circres.ahajournals.org/ evidence that miR-100 is released into the coronary circulation from lipid-rich plaques as a compensatory mechanism to stabilize the plaque by direct suppression of mTOR. In contrast to this study, Cipollone and colleagues described an increased expression of miR-100 in symptomatic human carotid artery lesions (defined by the presence of stroke) compared to asymptomatic ones 49. These findings are difficult to compare to our own results, as the experimental groups were defined by a previous clinical event and not by plaque morphology.
In summary, our findings describe a complex function of miR-100 in the vascular response to by guest on January 9, 2018 injury and inflammation and identify an important novel modulator of mTOR signaling and autophagy flux in the vascular system. As first attempts of miRNA-replacement therapy are on their way to clinical trials, the therapeutic manipulation of miRNA-expression could eventually offer a new treatment option for the growing number of patients with cardiovascular disease. Our findings of a reduced expression of this miRNA in human atherosclerotic plaque lesions with an instable phenotype suggest that the therapeutic replacement of this miRNA could be a potential strategy for the treatment of chronic inflammatory diseases such as atherosclerosis in the future.
ACKNOWLEDGEMENT We would like to thank Dr. Ute Woelfe, University Hospital Freiburg, Freiburg, Germany, for the friendly gift of the NF-κB as well as the renilla-control plasmid.
SOURCE OF FUNDING This study is supported by the Deutsche Forschungsgemeinschaft, Germany to SG (GR 3459/2-1).
DISCLOSURES None.
DOI: 10.1161/CIRCRESAHA.117.311428 12
REFERENCES
1. Ross R. Atherosclerosis: An inflammatory disease. N Engl J Med. 1999;340:115-126 2. Hansson GK, Libby P. The immune response in atherosclerosis: A double-edged sword. Nature reviews. Immunology. 2006;6:508-519 3. Libby P, Hansson GK. Inflammation and immunity in diseases of the arterial tree: Players and layers. Circulation research. 2015;116:307-311 4. Grundmann S, Hans FP, Kinniry S, Heinke J, Helbing T, Bluhm F, Sluijter JP, Hoefer I, Pasterkamp G, Bode C, Moser M. Microrna-100 regulates neovascularization by suppression of mammalian target of rapamycin in endothelial and vascular smooth muscle cells. Circulation. 2011;123:999-1009 5. Betel D, Koppal A, Agius P, Sander C, Leslie C. Comprehensive modeling of microrna targets predicts functional non-conserved and non-canonical sites. Genome biology. 2010;11:R90 6. Betel D, Wilson M, Gabow A, Marks DS, Sander C. The microrna.Org resource: Targets and expression. Nucleic acids research. 2008;36:D149-153 7. Enright AJ, John B, Gaul U, Tuschl T, Sander C, Marks DS. Microrna targets in drosophila. Genome biology. 2003;5:R1 Downloaded from 8. Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mrnas are conserved targets of micrornas. Genome research. 2009;19:92-105 9. Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP. Microrna targeting specificity in mammals: Determinants beyond seed pairing. Molecular cell. 2007;27:91-105 10. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates http://circres.ahajournals.org/ that thousands of human genes are microrna targets. Cell. 2005;120:15-20 11. Doghman M, El Wakil A, Cardinaud B, Thomas E, Wang J, Zhao W, Peralta-Del Valle MH, Figueiredo BC, Zambetti GP, Lalli E. Regulation of insulin-like growth factor-mammalian target of rapamycin signaling by microrna in childhood adrenocortical tumors. Cancer research. 2010;70:4666-4675 12. Wang FZ, Weber F, Croce C, Liu CG, Liao X, Pellett PE. Human cytomegalovirus infection alters the expression of cellular microrna species that affect its replication. Journal of virology. 2008;82:9065-9074 by guest on January 9, 2018 13. Bruneau S, Nakayama H, Woda CB, Flynn EA, Briscoe DM. Deptor regulates vascular endothelial cell activation and proinflammatory and angiogenic responses. Blood. 2013;122:1833-1842 14. Duvel K, Yecies JL, Menon S, Raman P, Lipovsky AI, Souza AL, Triantafellow E, Ma Q, Gorski R, Cleaver S, Vander Heiden MG, MacKeigan JP, Finan PM, Clish CB, Murphy LO, Manning BD. Activation of a metabolic gene regulatory network downstream of mtor complex 1. Molecular cell. 2010;39:171-183 15. Porstmann T, Santos CR, Griffiths B, Cully M, Wu M, Leevers S, Griffiths JR, Chung YL, Schulze A. Srebp activity is regulated by mtorc1 and contributes to akt-dependent cell growth. Cell metabolism. 2008;8:224-236 16. Horton JD, Goldstein JL, Brown MS. Srebps: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. The Journal of clinical investigation. 2002;109:1125-1131 17. Lewis CA, Griffiths B, Santos CR, Pende M, Schulze A. Regulation of the srebp transcription factors by mtorc1. Biochemical Society transactions. 2011;39:495-499 18. Bakan I, Laplante M. Connecting mtorc1 signaling to srebp-1 activation. Current opinion in lipidology. 2012;23:226-234 19. de Kleijn DP, Moll FL, Hellings WE, Ozsarlak-Sozer G, de Bruin P, Doevendans PA, Vink A, Catanzariti LM, Schoneveld AH, Algra A, Daemen MJ, Biessen EA, de Jager W, Zhang H, de Vries JP, Falk E, Lim SK, van der Spek PJ, Sze SK, Pasterkamp G. Local atherosclerotic plaques are a source of prognostic biomarkers for adverse cardiovascular events. Arterioscler Thromb Vasc Biol. 2010;30:612-619 20. Oliveira JC, Brassesco MS, Morales AG, Pezuk JA, Fedatto PF, da Silva GN, Scrideli CA, Tone LG. Microrna-100 acts as a tumor suppressor in human bladder carcinoma 5637 cells. Asian Pacific journal of cancer prevention : APJCP. 2011;12:3001-3004
DOI: 10.1161/CIRCRESAHA.117.311428 13
21. Chen D, Sun Y, Yuan Y, Han Z, Zhang P, Zhang J, You MJ, Teruya-Feldstein J, Wang M, Gupta S, Hung MC, Liang H, Ma L. Mir-100 induces epithelial-mesenchymal transition but suppresses tumorigenesis, migration and invasion. PLoS genetics. 2014;10:e1004177 22. Xiao F, Bai Y, Chen Z, Li Y, Luo L, Huang J, Yang J, Liao H, Guo L. Downregulation of hoxa1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of mir-100. European journal of cancer. 2014;50:1541-1554 23. Li G, Barrett EJ, Ko SH, Cao W, Liu Z. Insulin and insulin-like growth factor-i receptors differentially mediate insulin-stimulated adhesion molecule production by endothelial cells. Endocrinology. 2009;150:3475-3482 24. Montagnani M, Golovchenko I, Kim I, Koh GY, Goalstone ML, Mundhekar AN, Johansen M, Kucik DF, Quon MJ, Draznin B. Inhibition of phosphatidylinositol 3-kinase enhances mitogenic actions of insulin in endothelial cells. J Biol Chem. 2002;277:1794-1799 25. Jung CH, Ro SH, Cao J, Otto NM, Kim DH. Mtor regulation of autophagy. FEBS letters. 2010;584:1287-1295 26. Trocoli A, Djavaheri-Mergny M. The complex interplay between autophagy and nf-kappab signaling pathways in cancer cells. American journal of cancer research. 2011;1:629-649 27. Stepkowski TM, Kruszewski MK. Molecular cross-talk between the nrf2/keap1 signaling Downloaded from pathway, autophagy, and apoptosis. Free radical biology & medicine. 2011;50:1186-1195 28. Niida M, Tanaka M, Kamitani T. Downregulation of active ikk beta by ro52-mediated autophagy. Molecular immunology. 2010;47:2378-2387 29. Kuehbacher A, Urbich C, Dimmeler S. Targeting microrna expression to regulate angiogenesis. Trends in pharmacological sciences. 2008;29:12-15 http://circres.ahajournals.org/ 30. Berk BC, Abe JI, Min W, Surapisitchat J, Yan C. Endothelial atheroprotective and anti- inflammatory mechanisms. Annals of the New York Academy of Sciences. 2001;947:93-109; discussion 109-111 31. SenBanerjee S, Lin Z, Atkins GB, Greif DM, Rao RM, Kumar A, Feinberg MW, Chen Z, Simon DI, Luscinskas FW, Michel TM, Gimbrone MA, Jr., Garcia-Cardena G, Jain MK. Klf2 is a novel transcriptional regulator of endothelial proinflammatory activation. The Journal of experimental medicine. 2004;199:1305-1315 32. Anderson HD, Rahmutula D, Gardner DG. Tumor necrosis factor-alpha inhibits endothelial by guest on January 9, 2018 nitric-oxide synthase gene promoter activity in bovine aortic endothelial cells. J Biol Chem. 2004;279:963-969 33. Pruefer D, Scalia R, Lefer AM. Simvastatin inhibits leukocyte-endothelial cell interactions and protects against inflammatory processes in normocholesterolemic rats. Arteriosclerosis, thrombosis, and vascular biology. 1999;19:2894-2900 34. Wei YM, Li X, Xu M, Abais JM, Chen Y, Riebling CR, Boini KM, Li PL, Zhang Y. Enhancement of autophagy by simvastatin through inhibition of rac1-mtor signaling pathway in coronary arterial myocytes. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology. 2013;31:925-937 35. Liu D, Cui W, Liu B, Hu H, Liu J, Xie R, Yang X, Gu G, Zhang J, Zheng H. Atorvastatin protects vascular smooth muscle cells from tgf-beta1-stimulated calcification by inducing autophagy via suppression of the beta-catenin pathway. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology. 2014;33:129-141 36. Sun X, He S, Wara AK, Icli B, Shvartz E, Tesmenitsky Y, Belkin N, Li D, Blackwell TS, Sukhova GK, Croce K, Feinberg MW. Systemic delivery of microrna-181b inhibits nuclear factor-kappab activation, vascular inflammation, and atherosclerosis in apolipoprotein e- deficient mice. Circulation research. 2014;114:32-40 37. Schober A, Nazari-Jahantigh M, Wei Y, Bidzhekov K, Gremse F, Grommes J, Megens RT, Heyll K, Noels H, Hristov M, Wang S, Kiessling F, Olson EN, Weber C. Microrna-126-5p promotes endothelial proliferation and limits atherosclerosis by suppressing dlk1. Nature medicine. 2014;20:368-376 38. Zernecke A, Bidzhekov K, Noels H, Shagdarsuren E, Gan L, Denecke B, Hristov M, Koppel T, Jahantigh MN, Lutgens E, Wang S, Olson EN, Schober A, Weber C. Delivery of microrna-126 by apoptotic bodies induces cxcl12-dependent vascular protection. Sci Signal. 2009;2:ra81
DOI: 10.1161/CIRCRESAHA.117.311428 14
39. Loyer X, Potteaux S, Vion AC, Guerin CL, Boulkroun S, Rautou PE, Ramkhelawon B, Esposito B, Dalloz M, Paul JL, Julia P, Maccario J, Boulanger CM, Mallat Z, Tedgui A. Inhibition of microrna-92a prevents endothelial dysfunction and atherosclerosis in mice. Circulation research. 2014;114:434-443 40. Fang Y, Shi C, Manduchi E, Civelek M, Davies PF. Microrna-10a regulation of proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. Proceedings of the National Academy of Sciences of the United States of America. 2010;107:13450-13455 41. Cheng HS, Sivachandran N, Lau A, Boudreau E, Zhao JL, Baltimore D, Delgado-Olguin P, Cybulsky MI, Fish JE. Microrna-146 represses endothelial activation by inhibiting pro- inflammatory pathways. EMBO molecular medicine. 2013;5:949-966 42. Morrisett JD, Abdel-Fattah G, Hoogeveen R, Mitchell E, Ballantyne CM, Pownall HJ, Opekun AR, Jaffe JS, Oppermann S, Kahan BD. Effects of sirolimus on plasma lipids, lipoprotein levels, and fatty acid metabolism in renal transplant patients. Journal of lipid research. 2002;43:1170- 1180 43. Tenderich G, Fuchs U, Zittermann A, Muckelbauer R, Berthold HK, Koerfer R. Comparison of sirolimus and everolimus in their effects on blood lipid profiles and haematological parameters in heart transplant recipients. Clinical transplantation. 2007;21:536-543 Downloaded from 44. Stone GW, Maehara A, Lansky AJ, de Bruyne B, Cristea E, Mintz GS, Mehran R, McPherson J, Farhat N, Marso SP, Parise H, Templin B, White R, Zhang Z, Serruys PW, Investigators P. A prospective natural-history study of coronary atherosclerosis. N Engl J Med. 2011;364:226- 235 45. Bot PT, Grundmann S, Goumans MJ, de Kleijn D, Moll F, de Boer O, van der Wal AC, van http://circres.ahajournals.org/ Soest A, de Vries JP, van Royen N, Piek JJ, Pasterkamp G, Hoefer IE. Forkhead box protein p1 as a downstream target of transforming growth factor-beta induces collagen synthesis and correlates with a more stable plaque phenotype. Atherosclerosis. 2011;218:33-43 46. Bot PT, Pasterkamp G, Goumans MJ, Strijder C, Moll FL, de Vries JP, Pals ST, de Kleijn DP, Piek JJ, Hoefer IE. Hyaluronic acid metabolism is increased in unstable plaques. European journal of clinical investigation. 2010;40:818-827 47. Raitoharju E, Lyytikainen LP, Levula M, Oksala N, Mennander A, Tarkka M, Klopp N, Illig T, Kahonen M, Karhunen PJ, Laaksonen R, Lehtimaki T. Mir-21, mir-210, mir-34a, and mir- by guest on January 9, 2018 146a/b are up-regulated in human atherosclerotic plaques in the tampere vascular study. Atherosclerosis. 2011;219:211-217 48. Soeki T, Yamaguchi K, Niki T, Uematsu E, Bando S, Matsuura T, Ise T, Kusunose K, Hotchi J, Tobiume T, Yagi S, Fukuda D, Taketani Y, Iwase T, Yamada H, Wakatsuki T, Shimabukuro M, Sata M. Plasma microrna-100 is associated with coronary plaque vulnerability. Circulation journal : official journal of the Japanese Circulation Society. 2015;79:413-418 49. Cipollone F, Felicioni L, Sarzani R, Ucchino S, Spigonardo F, Mandolini C, Malatesta S, Bucci M, Mammarella C, Santovito D, de Lutiis F, Marchetti A, Mezzetti A, Buttitta F. A unique microrna signature associated with plaque instability in humans. Stroke. 2011;42:2556-2563
DOI: 10.1161/CIRCRESAHA.117.311428 15
FIGURE LEGENDS
Figure 1: MiR-100 influences leukocyte-endothelial interaction in vivo and in vitro by down- regulating adhesion molecule expression in endothelial cells. MiR-100 expression levels were modulated in HUVECs by transfection of precursor- (premiR-100) or antisense oligonucleotides (antimiR-100) and irrelevant sequences served as control (premiR-cont./antimiR-cont.). Subsequently, cells were stimulated with TNF-α (10ng/ml) for 24h. A-F: Protein expression of adhesion molecules was reduced following miR-100 overexpression and increased if miR-100 was inhibited, as determined by flow cytometry (n=3). For functional analyses, transfected HUVECs were stimulated with TNF-α (30ng/ml) for 24h and shear stress of venous blood flow (1 dynes/cm²) was induced using a flow chamber apparatus. G+L: Representative pictures of rolling and adherent PBMCs on the endothelial surface under different transfection conditions. H+I, M+N: Overexpression of miR-100 in endothelial cells led to a reduction of rolling and adherent PBMCs, whereas an inhibition of miR-100 had the opposite effect (n≥4). J+K+O: Intravital imaging of mesenteric venules 24 hours following i.v. injection of a cholesterol-conjugated antisense-oligonucleotide against miR-100 (AntagomiR-100) resulted in a higher number of adherent as well as rolling leukocytes on the endothelial surface compared to control mice (n=6). Data represent mean values with SEM. *P<0.05 vs. the corresponding control. Downloaded from Figure 2: Regulation of endothelial adhesion molecule expression is mTORC1 dependent. A-F: Expression of E-Selectin, ICAM-1 and VCAM-1 decreased if mTORC1 complex was inhibited by rapamycin. Human umbilical vein endothelial cells (HUVECs) were either stimulated with DMSO or with 10ng/ml rapamycin followed by TNF-α stimulation for 24h and adhesion molecule expression was http://circres.ahajournals.org/ either determined by real-time PCR or flow cytometry (n=3). G-I: Simultaneous inhibition of miR-100 and mTORC-1 reversed the effects of single miR-100 inhibition on protein expression of E-Selectin, ICAM-1 as well as VCAM-1 (n=7). J+K+N: Enhanced leukocyte-endothelial interaction following miR-100 inhibition was weakened if mTORC1 complex was suppressed by rapamycin. MiR-100 expression level were modulated in HUVECs and cells were simultaneously stimulated either with DMSO or rapamycin (10ng/ml) followed by a TNF-stimulation (30ng/ml) for 24h. Venous shear stress was applied using a flow chamber apparatus. Numbers of rolling (J) or adherent (K) peripheral mononuclear cells (PBMCs) were quantified (n≥6). L+M+O: Intravital imaging of mesenteric venules by guest on January 9, 2018 24 hours following i.v. injection of a cholesterol-conjugated antisense-oligonucleotide against miR-100 (AntagomiR-100) or the corresponding control (AntagomiR-cont.) in combination with solvent DMSO or rapamycin resulted in a reduction of rolling and adherent cells if miR-100 and mTORC1 were simultaneously suppressed compared to control group (n=6). Data represent mean values with SEM. *P<0.05 vs. the corresponding control.
Figure 3: MiR-100 promotes endothelial autophagy, resulting in a decreased activity of the NF-κB signaling pathway. MiR-100 expression levels were modulated in unstimulated HUVECs by transfection of either precursor-oligonucleotides (premiR-100) or antisense oligonucleotides (antimiR- 100) against this miRNA. A: LC3B positive autophagosomes appear in red and nuclei in blue. B+C: Overexpression of miR-100 resulted in induction of LC3B-positive autophagosomes whereas inhibition of this miRNA had the opposite effect as determined using immunofluorescence staining (n=4). D: Representative western blots of miR-100 targets mTOR and raptor. E-M: MiR-100 overexpression suppressed expression of mTOR as well as raptor resulting in induction of autophagy marker Atg3 and Atg5-Atg12 conjugate as well as enhanced LC3 turnover. N-Q: MiR-100 overexpression enhanced the expression of transcription factor TFEB in the nucleus fraction, but did not alter P-ULK expression. P- U: Overexpression of miR-100 resulted in a reduction of IKKβ kinase protein which led to enhanced expression levels of non-phosphorylated IκBα and diminished protein expression of NF-κB-p65. MiR- 100 inhibition had the opposite effect (n≥4). V: HEK cells were simultaneously transfected with either precursor nucleotides (premiR-100) or antisense miR-100 inhibitors (antimiR-100) or the corresponding control compounds (premiR-cont./antimiR-cont.) and a NF-κB promotor construct. Relative NF-κB promotor activity decreased following miR-100 overexpression and increased under miR-100 inhibition (n=6). Firefly luciferase activity was normalized to renilla activity. W: Representative pictures of NF- ᴋB-activity in transgenic mice following inhibition of miR-100. X: Inhibition of miR-100 in vivo enhanced NF-ᴋB activity. Transgenic NF-ᴋB-RE-luc mice were imaged for NF-ᴋB dependent luminescence 24 hours following i.v. injection of either a cholesterol-conjugated antisense-
DOI: 10.1161/CIRCRESAHA.117.311428 16
oligonucleotide specific for miR-100 (AntagomiR-100) or the corresponding control compound (AntagomiR-cont.) using a CCD imaging system (n=6). Data represent mean values with SEM. *P<0.05 vs. the corresponding control.
Figure 4: Autophagy inhibition abrogates effects of miR-100 overexpression on downstream components of NF-κB signaling. MiR-100 expression levels were modulated in HUVECs and cells were stimulated either with autophagy inhibitor Bafilomycin or DMSO as solvent control for 24h. Then analysis of protein expression of signaling components was performed. A: Representative western blot images. B+C: Autophagy inhibition resulted in significant downregulation of autophagy marker proteins Atg3 (n=7) as well as Atg12 (n=16). D-F: Inhibition of autophagy abrogated effects of miR-100 overexpression on downstream components of NF-κB signaling (n≥10). G: NF-κB promotor activity increased under conditions of autophagy inhibition. Hela cells were transfected with a NF-κB promotor construct and either stimulated with autophagy inhibitor Bafilomycin or DMSO as solvent control. Firefly luciferase activity was normalized to renilla activity (n=6). H: Hela cells were simultaneously transfected with miR-100 specific precursor-oligonucleotides (premiR-100) or the corresponding control compound (premiR-cont.) as well as a NF-κB promotor construct and stimulated with either autophagy inhibitor Bafilomycin or DMSO (n=6). I-K: Stimulation of HUVECs with Bafilomycin Downloaded from abrogated the effect of miR-100 overexpression on adhesion molecule expression. Endothelial cells were simultaneously transfected with precursor-oligonucleotides for miR-100 (premiR-100) or the corresponding control compound (premiR-cont.) and stimulated with Bafilomycin or DMSO. Adhesion molecule expression was determined by flow cytometry (n=6). Data represent mean values with SEM. *P<0.05 vs. the corresponding control. http://circres.ahajournals.org/ Figure 5: MiR-100 is down-regulated by the pro-inflammatory cytokine TNF-α in a NF-κB dependent manner and simvastatin up-regulates miR-100 expression via a HMG-CoA reductase dependent pathway in human endothelial cells. A: Human umbilical vein endothelial cells (HUVECs) were stimulated with TNF-α (10ng/ml) for the indicated time periods and RNA was isolated at different time points. Quantification of expression levels using Taqman-based stem-loop PCR revealed a significant down-regulation of miR-100 after 18 and 24 hours of stimulation (n=6). B: Inhibition of NF- κB with PS1145 circumvented down-regulation of miR-100 following TNF-α stimulation. HUVECs by guest on January 9, 2018 were treated with NF-κB inhibitor PS1145 in presence and absence of TNF-α (10ng/ml, 24h) and miR- 100 expression levels were determined using Taqman-based stem-loop PCR. C: NF-κB inhibition by overexpression of superrepressor IκBα-SR in endothelial cells abolished down-regulation of miR-100 by TNF-α (10ng/ml, 24h n=4). D+E: MiR-100 was up-regulated in HUVECs following simvastatin (0.5µM, 24h) stimulation under basal culture conditions as well as following TNF-α (10ng/ml, 24h) stimulation (n≥6). F: Up-regulation of miR-100 by simvastatin was HMG-CoA reductase dependent. HUVECs were stimulated with different combinations of 0.5µM simvastatin and 200µM mevalonolactone (n≥7). G: Simvastatin stimulation enhanced eNOS mRNA expression levels, whereas concomitant stimulation with mevalonate reversed the observed effects as determined using real-time PCR (n≥7). H: Simvastatin treatment in vivo resulted in the upregulation of miR-100. Mice were i.p. injected with simvastatin (20mg/kg) for three days and miR-100 expression was analyzed in descending aortic tissue (n=7). Data represents mean values with SEM. *P<0.05 vs. the corresponding control.
Figure 6: Inhibition of miR-100 in mice stimulates atherogenesis. LDLR-/- mice were set on a high cholesterol diet for 16 weeks and at day 0, 28, 56 and 84 i.v. injected with a cholesterol-conjugated antisense-oligonucleotide against miR-100 (AntagomiR-100) or the corresponding control compound (AntagomiR-cont.). Inhibition of miR-100 significantly increased the size of atherosclerotic plaque lesions. A+B: MOVAT staining of aortic roots (n≥7). C: Oil red O staining of aortic arches (n=7). D+E: Oil red O staining of the descending aorta (n=10). F+G: Picrosirius-Red staining revealed a decrease of plaque collagen content in mice treated with AntagomiR-100 compared to control mice (n=4). H+I+J: Immunofluorescent staining for Mac-3 and for SMA showed an increase of infiltrating macrophages but a decrease of smooth muscle cells in adjacent plaque areas in AntagomiR-100 treated mice. Mac-3 positive cells appear in red, nuclei in blue and smooth muscle cells in green (n=8). Data represents mean values with SEM. *P<0.05 vs. the corresponding control.
DOI: 10.1161/CIRCRESAHA.117.311428 17
Figure 7: Overexpression of miR-100 protects against atherosclerotic lesion formation. LDLR-/- mice were set on a high cholesterol diet for 8 weeks and in time intervals of 4 weeks i.v. injected with either precursor molecules specific for miR-100 (MiR-100 mimic) or the corresponding control compound (Control). Overexpression of miR-100 significantly diminished the size of atherosclerotic plaque lesions. A+B: Oil-Red-O staining of aortic roots (n=11). C: Oil red O staining of aortic arches (n=8). D+E: Oil red O staining of the descending aorta (n=11). F+G: Immunofluorescent staining for Mac-3 showed diminished infiltrating macrophages in adjacent plaque of miR-100 mimic treated mice. Mac-3 positive cells appear in red, nuclei in blue and smooth muscle cells in green (n=11). Data represents mean values with SEM. *P<0.05 vs. the corresponding control.
Figure 8: In humans, miR-100 is not decreased in stable atherosclerotic lesions compared to healthy controls, but highly suppressed in unstable plaques. Atherosclerotic plaque lesions with different phenotypes were obtained from the biobank Athero-Express (Atherosclerotic plaque expression in relation to vascular events and patient characteristics), University Medical Center Utrecht, The Netherlands. MiR-100 expression levels were analyzed in plaque lesions using Taqman-based stem- loop PCR. A+B: Representative pictures of plaque lesions with different characteristics. C+D: Plaque phenotype was classified by either fat in the atheroma (C) or the content of infiltrating macrophages (D) Downloaded from and both classifications systems showed no decrease in miR-100 expression in lesions with a low content of fat or macrophages compared to the healthy control, but we found a strong suppression of miR-100 expression in fat- and macrophage-rich lesions compared to the other groups, (n≥10). E: Scheme of suggested role of miR-100 in the inflammatory response. Data represent mean and SEM values; *P<0.05 vs. the corresponding control. http://circres.ahajournals.org/
by guest on January 9, 2018
DOI: 10.1161/CIRCRESAHA.117.311428 18
NOVELTY AND SIGNIFICANCE
What Is Known?
Several microRNAs (miRNAs) have been found to modulate inflammation and atherogenesis.
MicroRNA-100 (miR-100) is an endothelial-enriched miRNA. It inhibits angiogenesis and arteriogenesis in mice by targeting the mammalian target of rapamycin (mTOR).
Transcriptome analysis of endothelial cells transfected with miR-100 oligonucleotides suggests that this miRNA inhibits endothelial molecule expression.
What New Information Does This Article Contribute?
MiR-100 attenuates leukocyte-endothelial interaction by downregulating endothelial adhesion molecule expression. Downloaded from
Intravenous injection of miR-100-mimicking oligonucleotides reduces atherosclerotic lesion formation in mice and decreases both markers of vascular inflammation as well as circulating lipid levels, whereas miR-100 inhibition has the opposite effect. http://circres.ahajournals.org/ Expression levels of this miRNA correlate with histologic markers of plaque stability in patients.
Chronic inflammation is a pathological condition, which contributes to a large spectrum of diseases, including atherosclerosis inflammation and results in the migration and perivascular infiltration of circulating cells, which is mediated by adhesion molecules expressed by the endothelial surface layer. In this study, we found that miRNA-100 suppresses the expression of the adhesion molecules ICAM-1,
by guest on January 9, 2018 VCAM-1 and E-Selectin in endothelial cells, resulting in an attenuated leukocyte-endothelial interaction in vitro and in vivo. This was mediated by a direct suppression of the mTOR, resulting in enhanced endothelial autophagy and suppression of the NFᴋB pathway. In LDLR-/- mice the inhibition of miR- 100 resulted in enhanced atherosclerotic lesion formation and increased indicators of destabilization of the plaque. Intravenous injection of a miR-100 mimicking oligonucleotide resulted in a decrease in plaque area and a more stable plaque phenotype, while both markers of inflammation as well as circulating lipid levels were decreased. These findings suggest the potential use of the therapeutic modulation of miR-100 for the treatment of atherosclerosis and other inflammation-driven diseases.
DOI: 10.1161/CIRCRESAHA.117.311428 19 FIGURE 1 Downloaded from http://circres.ahajournals.org/ by guest on January 9, 2018 FIGURE 2 Downloaded from http://circres.ahajournals.org/ by guest on January 9, 2018 FIGURE 3 Downloaded from http://circres.ahajournals.org/ by guest on January 9, 2018 FIGURE 4 Downloaded from http://circres.ahajournals.org/ by guest on January 9, 2018 FIGURE 5 Downloaded from http://circres.ahajournals.org/ by guest on January 9, 2018 FIGURE 6 Downloaded from http://circres.ahajournals.org/ by guest on January 9, 2018 FIGURE 7 Downloaded from http://circres.ahajournals.org/ by guest on January 9, 2018 FIGURE 8 Downloaded from http://circres.ahajournals.org/ by guest on January 9, 2018 MicroRNA-100 Suppresses Chronic Vascular Inflammation by Stimulation of Endothelial Autophagy Franziska Pankratz, Catherine Hohnloser, Xavier Bemtgen, Caterina Jaenich, Sheena Kreuzaler, Imo Downloaded from E Hoefer, Gerard Pasterkamp, Justin Mastroianni, Robert Zeiser, Christian Smolka, Laura A Schneider, Julien Martin, Maike Juschkat, Thomas Helbing, Martin Moser, Christoph Bode and Sebastian Grundmann
http://circres.ahajournals.org/ Circ Res. published online December 5, 2017; Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2017 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7330. Online ISSN: 1524-4571
by guest on January 9, 2018 The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circres.ahajournals.org/content/early/2017/12/04/CIRCRESAHA.117.311428
Data Supplement (unedited) at: http://circres.ahajournals.org/content/suppl/2017/12/04/CIRCRESAHA.117.311428.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at: http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at: http://circres.ahajournals.org//subscriptions/
* Long In Vivo Checklist Circulation Research - Preclinical Animal Testing: A detailed checklist has been developed as a prerequisite for every publication involving preclinical studies of experimental treatments in animals. Checklist items must be clearly presented in the manuscript, and if an item is not adhered to, an explanation should be provided. If this information (checklist items and/or explanations) cannot be included in the main manuscript because of space limitations, please include it in an online supplement. If the manuscript is accepted, this checklist will be published as an online supplement. See the explanatory editorial for further information.
This study involves testing of therapeutic or diagnostic agent in animal models: Yes
St udy Design
The experimental group(s) have been clearly defined in the article, including number of animals in Yes each experimental arm of the study.
An overall study timeline is provided. Yes
The protocol was prospectively written Yes
The primary and secondary endpoints are specified Yes
For primary endpoints, a description is provided as to how the type I error multiplicity issue was Yes addressed (e.g., correction for multiple comparisons was or was not used and why). (Note: correction for multiple comparisons is not necessary if the study was exploratory or hypothesis-generating in nature).
A description of the control group is provided including whether it matched the treated groups. Yes
Inclusion and Exclusion crit eria
Inclusion and exclusion criteria for enrollment into the study were defined and are reported in the Yes manuscript.
These criteria were set a priori (before commencing the study). Yes
Randomizat ion
Animals were randomly assigned to the experimental groups. If random assignment was not used, Yes adequate explanation has been provided.
Type and methods of randomization have been described. Yes
Allocation concealment was used. Yes
Methods used for allocation concealment have been reported. Yes
Blinding
Blinding procedures with regard to masking of group/treatment assignment from the experimenter Yes were used and are described. The rationale for nonblinding of the experimenter has been provided, if such was not performed.
Blinding procedures with regard to masking of group assignment during outcome assessment were Yes used and are described.
If blinding was not performed, the rationale for nonblinding of the person(s) analyzing outcome has Yes been provided.
Sample size and power calculat ions
Formal sample size and power calculations were conducted before commencing the study based Yes on a priori determined outcome(s) and treatment effect(s), and the data are reported.
If formal sample size and power calculation was not conducted, a rationale has been provided. Yes
Dat a Report ing Baseline characteristics (species, sex, age, strain, chow, bedding, and source) of animals are Yes reported.
The number of animals in each group that were randomized, tested, and excluded and that died is Yes reported. If the experimentation involves repeated measurements, the number of animals assessed at each time point is provided is provided for all experimental groups.
Baseline data on assessed outcome(s) for all experimental groups are reported. Yes
Details on important adverse events and death of animals during the course of the experiment are Yes reported for all experimental groups.
Numeric data on outcomes are provided in the text or in a tabular format in the main article or as Yes supplementary tables, in addition to the figures.
To the extent possible, data are reported as dot plots as opposed to bar graphs, especially for Yes small sample size groups.
In the online Supplemental Material, methods are described in sufficient detail to enable full Yes replication of the study.
St at ist ical met hods
The statistical methods used for each data set are described. Yes
For each statistical test, the effect size with its standard error and P value is presented. Authors are Yes encouraged to provide 95% confidence intervals for important comparisons.
Central tendency and dispersion of the data are examined, particularly for small data sets. Yes
Nonparametric tests are used for data that are not normally distributed. Yes
Two-sided P values are used. Yes
In studies that are not exploratory or hypothesis-generating in nature, corrections for multiple Yes hypotheses testing and multiple comparisons are performed.
In "negative" studies or null findings, the probability of a type II error is reported. Yes
Experiment al det ails, et hics, and funding st at ement s
Details on experimentation including formulation and dosage of therapeutic agent, site and route of Yes administration, use of anesthesia and analgesia, temperature control during experimentation, and postprocedural monitoring are described.
Both male and female animals have been used. If not, the reason/justification is provided. Yes
Statements on approval by ethics boards and ethical conduct of studies are provided. Yes
Statements on funding and conflicts of interests are provided. Yes
Date completed: 11/30/2017 06:08:29 User pid: 181629 Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Material
A) Supplementary material and methods
B) Supplementary Tables I. Primer sequences and antibodies. II. Top 20 of down-regulated genes following miR-100 overexpression in HUVECs. III. Detailed patient characteristics. IV. Correlation of miR-100 expression with pro-inflammatory parameters in adjacent plaque area of patients suffering from carotid artery disease.
C) Supplementary Figures I. MicroRNA-100 transfection efficacy and viability following transfection procedure in human endothelial cells. II. Adhesion molecule mRNA expression level following microRNA-100 modulation in HUVECs under baseline condition and following TNF-α stimulation. III. Additional western blot data on endothelial adhesion molecules expression under different transfection/stimulation conditions. IV. Adhesion molecule mRNA expression under different pro-inflammatory stimulation conditions. V. Additional information on atherosclerosis mouse study after microRNA-100 inhibition. VI. Additional information on atherosclerosis mouse study after microRNA-100 overexpression. VII. MicroRNA-100 plays a minor role in the circulating cell population. VIII. Additional information on analyzed human carotid plaque specimen.
1
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary methods
Cell culture Human umbilical vein endothelial cells (HUVECs) were isolated from donated umbilical cords and cultivated in endothelial basal medium supplemented with EGF single quots (PELOBiotech GmbH, Martinsried, Germany) plus 10 % FBS and used until passage five.
Autophagy was inhibited in HUVECs using Bafilomycin (600 nM, InvivoGen, San Diego, CA, USA).
HEK293A cells were cultured in Dulbecco`s Modified Eagle Medium (DMEM), Life technologies, Darmstadt, Germany, supplemented with 10 % FBS.
mRNA microarray analysis Total RNA was isolated from HUVECs 48h after transfection with premiR-100 or an irrelevant control oligonucleotide. Gene expression profiles of two independent samples per condition were assessed with the Agilent human 4x44K microarray system. A detailed methodology and complete raw data level of the microarray results were deposited at the NCBI gene expression and hybridization array data repository (GEO, http://www.ncbi.nlm.nih.gov/geo/) and can be accessed under the accession number GSE 20668.
MicroRNA transfection For miRNA transfection, HUVECs were cultured to 70 % confluence and starved for 2 hours in Opti-MemTM medium, Thermo Fisher, MA, USA followed by the transfection with 5 nM precursor (premiR-100) or 10 nM antisense (antimiR-100) oligonucleotides or the corresponding control compounds (premiR-cont./antimiR-cont.) using Lipofectamin RNAiMax (all Life technologies, Darmstadt, Germany) according to manufacturer’s instructions. For the analysis of protein expression of autophagy markers and signaling components, HUVECs were transfected without previous starvation.
PS1145 stimulation and IκBα-superrepressor transfection HUVECs were either stimulated with 10 µM of IKK inhibitor PS1145 or 10 ng/ml TNF-α or combination of both for 24 h and then RNA was isolated. For plasmid transfection, HUVECs were cultured to 70 % confluence and either transfected with 1 µg of IκBα superrepressor pCDNA3-IκBα (IᴋBα-SR), lacking the amino-terminal 70 amino acids required for TNF-α induced degradation of IκBα, or with 1 µg of control plasmid pcDNA3 using promofectine, according to manufacturer’s instructions. Following the transfection procedure, HUVECs were stimulated with TNF-α (10 ng/ml) for 24 h and RNA was isolated.
Taqman-based stem-loop PCR for microRNA expression and real-time PCR for mRNA- expression MiRNA expression was validated by quantitative stem-loop PCR technology (TaqMan MiRNA Assays, Life technologies, Darmstadt, Germany) as previously described1. The use of target-specific reverse transcription primers and TaqMan hybridization probes allows the specific detection of mature miRNAs. MiRNA expression was normalized to the expression of
2
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement the small RNA rnu19.
For quantitative analysis of mRNA-levels up to 1 μg total RNA was transcribed to cDNA (iScript, BioRad, München, Germany) and real-time PCR was performed on a MyIQ (BioRad) as previously described2. The expression of mRNA was normalized to human RNA polymerase II (HRPII). For primer sequences please refer to Supplementary Table I.
MTT viability assay To exclude direct toxic effects of pre- and antimiR transfection procedure, cellular viability was assessed 24 hours after transfection of HUVECs by measuring the metabolization of MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide]. HUVECs were cultured in six well plates and six hours after transfection 5 mg/ml MTT (Sigma Aldrich, St. Louis, MO, USA) was added. Cells were cultured for additional three hours before adding 2.5 ml of MTT solvent (4 mM HCl, 0.1 % Igepal CA-630 in isopropanol). Samples were transferred in triplicates to a 96 well plate and absorbance was measured in a plate reader at 590 nm with reference filter set at 620 nm.
Luciferase assay HEK293A cells were plated in a 96 well plate and cultured to 70 % confluence and either transfected with 50 ng NF-κB plasmid or the corresponding control plasmid (all GeneCopoeiaTM/tebu-bio, Le Perray-en-Yvelines Cedex, France), both containing the firefly luciferase gene from photinus pyralis. For determination of transfection efficacy, a plasmid containing the renilla gene from renilla reniformis and miR-100 specific precursor (premiR- 100) or antisense oligonucleotides (antimiR-100) or the respective control compounds (premiR-cont./antimiR-cont.) was used. 24 hours following transfection, Dual-Glow-luciferase assay (GeneCopoeiaTM) was performed according to manufacturer’s instructions using a Glomax, 96 microplate luminometer from Promega Madison, WI, USA and obtained firefly activity was normalized to renilla activity. The NFκB plasmid as well as the renilla control plasmid were a friendly gift from Dr. Ute Woelfle, University Hospital Freiburg, Freiburg, Germany.
Dynamic adhesion assay HUVECs were plated in a 35-mm dish and cultured to 70 % confluence and transfected with precursor (premiR-100) or antisense (antimiR-100) oligonucleotides and 24 h after transfection stimulated with 30 ng/ml TNF-α for 24 h. Peripheral mononuclear cells (PBMCs) from healthy donors were isolated by bicoll separation and stained with CFDA (12 μM, Life technologies, Darmstadt, Germany). PBMCs were activated with PMA (200 ng/ml) ten minutes before starting the experiment. The GlykoTech flow chamber was assembled with the dish at the bottom of the resulting parallel flow chamber. Chambers and tubes were filled with PBS supplemented with calcium and magnesium before the experiment. Subsequently, shear stress was applied with a syringe pump (PHD 2000, Harvard apparatus, Holliston, Massachusetts, USA) with flow rates of 1 dyne/cm2 for a total time of 10 minutes/well. Adherent and rolling PBMCs on the endothelial surface were recorded in three random regions for 15 s and subsequently recorder streams were analyzed by a blinded investigator.
Autophagy detection kit HUVECs were sowed in culture slides (3x10*4 cells/dish) and either transfected with 5 nM precursor (premiR-100) or 10 nM antisense (antimiR-100) oligonucleotides or the corresponding control compounds (premiR-cont./antimiR-cont.) using Lipofectamin 3
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
RNAiMAX (Life technologies, Darmstadt, Germany) according to manufacturer’s instructions. As positive control, cells were treated with 50 μM chloroquine for 24 h to artificially generate autophagosomes. Endothelial autophagy was analyzed by immunofluorescence staining against LC3B positive autophagosomes using the “LC3B antibody kit for autophagy” (Cat. # L10382), Life technologies, Darmstadt, Germany. Staining was performed according to manufacturer’s protocol and the primary antibody LC3B was used in a concentration of 0,5 μg/ml. Secondary staining was performed using Alexa Flour 555 (for further information please refer to Supplementary Table I). Following staining, the average number of LC3-II- positive autophagosomes per cell was counted in a randomly chosen imaging field (20 cells/ imaging field) under a planar microscope (Zeiss, Oberkochen). Representative pictures were taken under a Leica TCS SP2 AOBS spectral confocal microscope (Leica Camera, Solms, Germany).
Flow cytometry VCAM-1, ICAM-1 and E-Selectin protein expression was determined in transfected and TNF-α stimulated (10 ng/ml, 12 h) HUVECs using flow cytometer BD FACSCantoTM II (BD Biosciences, Franklin Lakes, New Jersey, USA).
For detailed information about antibodies used, please refer to Supplementary Table I.
Intravital imaging of mesenteric venules Intravital imaging of mesenteric venules was performed 24 hours following i.v. injection of an antisense oligonucleotide (AntagomiR-100) or the corresponding control compound (AntagomiR-cont.) or PBS as a vehicle in C57/BL6J male mice, three weeks of age, under anesthesia with ketamine (100 mg/kg) and xylazine (2 mg/kg). No co-stimulation with an proinflammatory agent such as LPS was used. For the experiments with combined mTOR and miR-100 inhibition, mice were either injected with rapamycin (3mg/kg) or the corresponding amount of DMSO as solvent control. To visualize leukocytes 60 µl of fluorescent dye rhodamine 6G (1 mg/ml, Sigma-Aldrich, St. Louis, MO, USA) was injected intravenously. An ileal loop was exteriorized through a midline incision in the abdominal wall and placed in a plastic dish to observe the peri-intestinal microcirculation in the mesentery by intravital imaging. Rolling and adherent leukocytes on the endothelium were recorded for one minute in three veins per mouse. Afterwards a blinded investigator quantified the number of rolling and adherent cells. The determined diameter of examined venules was normalized to 100 m.
Atherosclerosis mouse study B6.129S7-Ldlrtm1Her/J (LDLR-/-) mice were purchased from the Jackson Laboratory, ME, USA and only male mice were used as estrogen has been shown to affect chronic vascular inflammation3. Mice were hold in a specific pathogen free animal facility of the University Hospital Freiburg.
To induce plaque lesion formation under inhibition of miR-100, LDLR-/- male mice, eight weeks of age, received a high-fat diet (HFD, D12108 mod., ssniff® Spezialdiaeten GmbH, Soest Germany) with 21% crude fat and 12,35 mg/kg Cholesterol for 16 weeks and were i.v. injected in intervals of four weeks (day 0, 28, 56, 84) with a cholesterol-conjugated antisense oligonucleotide against miR-100 (AntagomiR-100) or the corresponding control compound (AntagomiR-cont.) at a concentration of 8 µg/g solved in 0,9 % NaCl (total volume 100 µl). The control AntagomiR was based on a partly scrambled sequence of the miR-100 specific AntagomiR4 and was tested against a previously published control-sequence5 and showed 4
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement no significant effect on different phenotypes in different mouse disease models4, 6. The injection in the tail vein was done under narcosis with isoflurane (3-4 Vol% isoflurane, FiO2 > 0,3 and maintenance of narcosis with 2% isoflurane). Detailed sequence of the used antisense-oligonucleotides can be found in the Supplementary Table I.
For the atherosclerosis study with the gain-of-function approach, LDLR-/- mice, 8 weeks of age, were fed for 8 weeks with HFD as described above and miR-100-specific precursor molecules (miR-100 mimic) or the corresponding control compound (control) were i.v. injected in time intervals of 4 weeks at a concentration of 10 µg/g in combination with the in vivo transfection reagent jetPEI, Polyplus transfection, Illkirch, France, according to manufacturer’s instructions (total injection volume 100 µl). The injection in the tail vein was done under narcosis with isoflurane (3-4 Vol% isoflurane, FiO2 > 0,3 and maintenance of narcosis with 2% isoflurane).
Before starting the experiment group sizes were calculated with an expected variance of 0.1 (10 %), desired power of 0.95 and a significance level alpha of 0.05. The assignment of the mice to the experimental groups was conducted randomly (10 mice per group). All animals were included in the study and the definition of inclusion and exclusion criteria as well as primary and secondary endpoints was not applicable. The evaluation of the histological staining was done by a blinded investigator.
Animal protocol was approved by the Regierungspraesidium Freiburg, Germany (approval number G-14/046) and all studies conformed to the Guide for the Care and Use of Laboratory Animals published by the directive 2010/63/EU of the European Parliament.
Timeline of the atherosclerotic mouse studies.
In vivo bioluminescence imaging of NF-ᴋB promotor activity NF-ᴋB-RE-luc mice (BALB/c-Tg(Rela-luc)31Xen, #10499-M) were purchased from Taconic, Hudson, NY, USA. This mouse strain carries a transgene containing NF-ᴋB responsive elements placed upstream of a basal SV40 promotor and a modified firefly luciferase cDNA, allowing the in vivo analysis of NF-ᴋB-activity. Exclusively male mice were used as estrogen has been shown to affect chronic vascular inflammation3. Mice were hold in a specific pathogen free animal facility of the University Hospital Freiburg.
Mice were used at age of 12 weeks and 24 h before performing imaging, miR-100 was systemically inhibited by i.v. injection of a cholesterol-conjugated antisense oligonucleotide specific for miR-100 (AntagomiR-100). For the control group an oligonucleotide with an 5
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement irrelevant sequence was injected (AntagomiR-cont.) Oligonucleotides were used at concentration of 8 µg/g solved in 0,9% NaCl (total injection volume 100 µl). At date of experiment, mice were i.p. injected with D-Luciferin (VivoGloTM Luciferin, in vivo grade, Promega, Madison, WI, USA, 120mg/kg in 0,9 % NaCl, total injection volume 200 µl) to visualize NF-ᴋB-activity and 10 minutes following injection, mice were imaged for 1 minute using an IVIS200 charge-coupled device (CCD) imaging system (Xenogen, Alameda, CA, USA). Imaging and injection was done under anesthesia with isoflurane (3-4 Vol% isoflurane, FiO2 > 0,3 and maintenance of narcosis with 2% isoflurane). Imaging data were analyzed by a blinded investigator and quantified with Living Image Software (Xenogen, Alameda, CA) and IgorProCarbon (WaveMetrics, Lake Oswego, OR).
Before starting the experiment group sizes were calculated with an expected variance of 0.1 (10 %), desired power of 0.95 and a significance level alpha of 0.05. The assignment of the mice to the experimental groups was conducted randomly (6 mice per group). All animals were included in the study and the definition of inclusion and exclusion criteria as well as primary and secondary endpoints was not applicable.
Animal protocol was approved by the Regierungspraesidium Freiburg), Germany (approval number G-16/103) and all studies conformed to the Guide for the Care and Use of Laboratory Animals published by the directive 2010/63/EU of the European Parliament.
Timeline of in vivo bioluminescence imaging of NF-ᴋB promotor activity.
Histological stainings Abdominal aortas were fixed in formalin, pinned, and stained with oil red O (ORO) to detect lipid deposition.
Cryostat sections (5 µm) of mouse aortic roots were air-dried, fixed in acetone at −20°C and MOVAT stained. Sections of aortic arches were fixed in 4 % paraformaldehyde or acetone and either lipids were stained using ORO protocol or immunofluorescent staining for macrophages (Mac-3) as well as smooth-muscle cells (anti-smooth muscle actin) and collagen (Picrosirius red) was performed. The total wall area (= intima + media), intimal lesion area (intima), as well as the percentage of positively stained area for macrophages (anti-mouse Mac-3), lipids (Oil-Red-O), collagen (Picrosirius red), smooth muscle cells (anti- α-actin) were analyzed by a blinded investigator.
Measurement of miR-100 expression in human atherosclerotic plaque lesions.
Plaque samples were obtained from the biobank Athero-Express (Atherosclerotic plaque expression in relation to vascular events and patients characteristics) from the University Medical Center, Utrecht, The Netherlands. 37 unstable lesions with a high fat and macrophage content and 40 stable plaque lesions characterized by low intra-plaque macrophage number and a fat content less than 40 % were analyzed and ten non-diseased mammary arteries served as control. Plaques were histologically classified by CD68 macrophage staining as well as picro Sirius red collagen staining and determination of cell dominance fat was done using haematoxylin eosin staining in combination with picro Sirius
6
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement red. A plaque was considered as atheromatous plaque if >40 % of the cross-sectional area was occupied by fat. Further explanation to the classifications can be found in the Athero- Express study design published by Verhoeven et al. in the European Journal of Epidemiology7.
7
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Table I
Primer sequences, antibodies, miRNA assays.
Primer Gene Species Forward Reverse E-Selectin human 5´GGTTTGGTGAGGTGTGCTC3` 5´TGATCTTTCCCGGAACTGC3` VCAM-1 human 5´ACAGTCAAGTGTTCAGTTGC3` 5´GAGTCTCCAATCTGAGCAGC3` ICAM-1 human 5´CACAGTCACCTATGGCAACG3` 5´CAATCCCTCTCGTCCAGTCG3` mTOR mouse 5´ACCGGCACACATTTGAAGAAG3` 5´CTCGTTGAGGATCAGCAAGG3` HRPII human/ 5’GCACCACGTCCAATGACAT3` 5’GTGCGGCTGCTTCCATAA3` mouse
Taqman Assay Assay name Assay ID Kit Part No. Company rnu19 001003 4440886 Life technologies mmu/hsa-miR-100 000437 4440886 Life technologies
Primary antibodies Against Host species Clone ID Company (label) Atg 3 rabbit polyclonal Cell Signaling Atg 5 rabbit D1G9 Cell Signaling Atg 12 rabbit D88H11 Cell Signaling α-tubulin mouse 5H1 BD Pharmingen IᴋB-α mouse L35A5 Cell Signaling IKK-β rabbit 2C8 Cell Signaling Mac-3 rat M3/84 BD Pharmingen mTOR rabbit 7C10 Cell Signaling NF-ᴋB p65 rabbit D14E12 Cell Signaling
Primary antibodies Against Host species Clone ID Company (label) TFEB rabbit D207D Cell Signaling P-ULK1 rabbit D706U Cell Signaling ICAM-1 rabbit polyclonal Cell Signaling VCAM-1 mouse Sc-13160 Santa Cruz LC3A/B rabbit D3U4C Cell Signaling PARP-1 mouse Sc-8007 Santa Cruz Raptor rabbit 24C12 Cell Signaling SMA mouse 1A4 Sigma-Aldrich FITC
8
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Secondary antibodies Against Host species Clone ID Company (label) Rat goat - Chemicon International Cy3 Rabbit donkey - Life technologies Alexa Fluor® 555 Rabbit IgG goat - Thermo Scientific HRP Mouse IgG goat - R&D Systems HRP
FACS antibodies Against Host species Clone ID Company (label) Human CD11b Mouse Bear1 Beckman Coulter PE IgG1 mouse N/A 679.1Mc7 Beckman Coulter PE CD106 mouse 51-10C9 BD Biosciences FITC CD54 mouse HA58 BD Biosciences APC CD62E mouse 68-5H11 BD Biosciences PE IgG1 mouse N/A X40 BD Biosciences APC IgG1 mouse N/A MCA928F AbD Serotec FITC miRNA Cat # ID# Company premiR-cont. AM17110 N/A Life technologies premiR-100 AM17100 PM10188 Life technologies antimiR-cont. AM17010 N/A Life technologies antimiR-100 AM17000 AM10188 Life technologies
AntagomiR- Sequence Modifications Company Oligo AntagomiR- 5´CACCAGTTAGGCTCTACGGATT3` 3´Cholesterol VBC Genomic cont. 2´O-methyl-RNA 3´: 4xPTO 5´: 2xPTO AntagomiR-100 5´CACAAGTTCGGATCTACGGGTT3` 3´Cholesterol VBC Genomic 2´O-methyl-RNA 3´: 4xPTO 5´: 2xPTO
Mimic-Oligo Product type Cat # Company MiR-100 mimic mirVana® miRNA mimic 4464070 Thermo Fisher miR-100-5p, 250nmol, in vivo ready control mirVana® miRNA mimic 4464061 Thermo Fisher control, 250nmol in vivo ready
9
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Table II
Top 20 of down-regulated genes following miR-100 overexpression in HUVECs under basal culture conditions. Gene Symbol Fold change Description P-value
SELE -14,65 Selectin E (SELE), mRNA [NM_000450] 0,0080
IFI44L -11,18 Interferon-induced protein 44-like (IFI44L), 0,0011 mRNA [NM_006820] IFIT1 -10,44 Interferon-induced protein with 0,0006 tetratricopeptide repeats 1 (IFIT1), transcript variant 2, mRNA [NM_001548] ENST00000357303 -9,54 Baculoviral IAP repeat-containing 3 0,0020 (BIRC3), transcript variant 1, mRNA [NM_001165] KYNU -9,41 Kynureninase (L-kynurenine hydrolase) 0,0100 (KYNU), transcript variant 2, mRNA [NM_001032998] PRND -9,37 Prion protein 2 (dublet) (PRND), mRNA 0,0065 [NM_012409] IFIH1 -9,10 Interferon induced with helicase C domain 1 0,0291 (IFIH1), mRNA [NM_022168] TNIP3 -8,51 TNFAIP3 interacting protein 3 (TNIP3), 0,0002 transcript variant 1, mRNA [NM_024873] SAMD9L -8,33 Sterile alpha motif domain containing 9-like 0,0333 (SAMD9L), mRNA [NM_152703] DNAJB4 -7,66 DnaJ (Hsp40) homolog, subfamily B, 0,0097 member 4 (DNAJB4), mRNA [NM_007034] DNAJB4 -7,40 DnaJ (Hsp40) homolog, subfamily B, 0,0072 member 4 (DNAJB4), mRNA [NM_007034] BIRC3 -7,30 Baculoviral IAP repeat-containing 3 0,0262 (BIRC3), transcript variant 1, mRNA [NM_001165] LCP1 -7,12 Lymphocyte cytosolic protein 1 (L-plastin) 0,0010 (LCP1), mRNA [NM_002298] SLC7A14 -7,06 solute carrier family 7 (cationic amino acid 0,0006 transporter, y+ system), member 14 (SLC7A14), mRNA [NM_020949] CSF2 -6,42 colony stimulating factor 2 (granulocyte- 0,0008 macrophage) (CSF2), mRNA [NM_000758] VCAM-1 -6,39 vascular cell adhesion molecule 1 0,0154 (VCAM1), transcript variant 1, mRNA [NM_001078] UACA -6,32 uveal autoantigen with coiled-coil domains 0,0463 and ankyrin repeats (UACA), transcript variant 2, mRNA [NM_001008224] HNMT -6,26 histamine N-methyltransferase (HNMT), 0,0449 transcript variant 1, mRNA [NM_006895] PAPLN -6,2 papilin, proteoglycan-like sulfated 0,0004 glycoprotein (PAPLN), mRNA [NM_173462] OASL -6,04 2'-5'-oligoadenylate synthetase-like (OASL), 0,0175 transcript variant 1, mRNA [NM_003733]
10
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Table III
Detailed characteristics of patients suffering from carotid artery disease and harboring stable or unstable plaque lesions.
Patient characteristic Unstable plaque Stable plaque P-value lesions n=37 lesion n=40 Age at time of surgery, mean, (SD) 70 (8,3) 68 (9,1) 0.51 Female, (%) 13 (35) 22 (55) 0.11 BMI>25, (%) 23 (81) 21 (53) 0.66 Smoking, (%) 17 (35) 15 (38) 0.49 Hypertension, (%) 30 (62) 33 (83) 1.00 Diabetes, (%) 13 (46) 11 (28) 0.62 Coronary artery disease, (%) 09 (24) 07 (18) 0.58 Peripheral arterial occlusive disease, (%) 06 (16) 09 (23) 0.57 Transient ischemic attack, (%) 27 (73) 28 (70) 0.81 Stroke, (%) 08 (22) 08 (20) 1.00 Asymptomatic, (%) 02 (05) 04 (10) 0.68 Statins, (%) 17 (46) 29 (73) 0.02 Aspirin, (%) 30 (81) 30 (75) 0.59 Beta-blocker, (%) 14 (38) 17 (43) 0.82 Anticoagulants, (%) 06 (16) 05 (13) 0.75 ACE-inhibitor, (%) 08 (22) 10 (25) 0.79 Calcium-antagonist, (%) 02 (05) 09 (23) 0.04 Angiotensin II antagonist, (%) 06 (16) 08 (20) 0.77 Dipyridamole, (%) 13 (35) 11 (28) 0.62 Clopidogrel, (%) 01 (03) 07 (18) 0.06
11
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Table IV
MiR-100 expression was negatively correlated with pro-inflammatory parameters in adjacent plaque area of patients suffering from carotid artery disease (Spearrman correlation of 74 cases).
Negative correlation R-value P-value sICAM -0,47 0,0030 Mean number of macrophages -0,3 0,0268 IL-8 -0,59 0,0002 MCP-1 -0,39 0,0158 MIP-1 -0,35 0,0334
12
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Figure I Transfection efficacy and viability of HUVECs. Representative picture of transfected fluorescence control to determine transfection efficacy (A). Transfection of miR-100 specific precursor- or antisense oligonucleotides or the corresponding control compounds resulted in 200-fold overexpression respective a significant suppression of miR-100 as determined by stemloop-based taqman PCR 24 h following transfection (B+C). Metabolization of MTT 24h following transfection showed a comparable viability of all transfection conditions (D).
13
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Figure II Adhesion molecule expression on mRNA expression level in human umbilical vein endothelial cells (HUVECs) following transfection of miR-100 specific precursor (premiR-100) or antisense (antimiR-100) oligonucleotides or the corresponding control compounds (premiR-cont./antimiR-cont.) under basal culture conditions (A-F) or following TNF-α (10 ng/ml) stimulation for 24h (G-K), n≥8.
14
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Figure III Western Blot analysis of the endothelial adhesion molecules ICAM-1 as well as VCAM-1 under different transfection/stimulation conditions. A+B: HUVECs were either transfected with miR-100 specific precursor oligonucleotides (premiR-100) or the corresponding control compound (premiR-cont.) and stimulated with TNF-α (10ng/ml) for 24 h, n≥6 C+D: HUVECs were either stimulated with Rapamycin (10ng/ml) or DMSO as solvent control and subsequently cells were stimulated with 10 ng/ml TNF-α for 24 h, n=6. E+F: HUVECs were either transfected with miR-100 specific precursor oligonucleotides (premiR-100) or the corresponding control compound (premiR-cont.) and simultaneously stimulated with the autophagy inhibitor Bafilomycin (600 nM) or DMSO as solvent control and 24 h following treatment protein was isolated, n≥5.
15
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Figure IV Adhesion molecule expression under different pro-inflammatory stimulation conditions (24 h) such as LPS (10 ng/ml, A-C), IL-1β (10 ng/ml, D-E), oxLDL (10 µg/ml, G-I) following miR-100 overexpression, n≥5.
16
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Figure V Additional information on atherosclerosis mouse study under microRNA-100 inhibition. LDRL-/- mice were set on high cholesterol diet for 16 weeks and every four weeks either i.v. injected with a cholesterol-conjugated oligonucleotide against miR-100 (AntagomiR-100) or the corresponding control compound (AntagomiR-cont.). A: AntagomiR-100 treatment led to a significant suppression of miR-100 expression level in aortic tissue compared to control group as determined by Taqman-based stem-loop PCR. B: Feeding of high cholesterol diet led to strong weight gain compared to control group with standard diet. C: In liver tissue, miR-100 expression was reduced following AntagomiR-100 treatment, compared to control group. D-H: Parameters such as leukocyte count, triglyceride as well as total cholesterol and HDL/LDL cholesterol were equal between the treatment groups at beginning of experiment. I- L: At the endpoint of the experiment triglyceride as well as total cholesterol and LDL level were significantly increased in AntagomiR-100 treated mice. In contrast, HDL level were decreased under condition of miR-100 inhibition, n=10. M: mTOR, as direct miR-100 target and central regulator of cell metabolism was increased in liver tissue following miR-100 inhibition, as revealed by real-time PCR. N-P: Transcription factor SREBP-2 was increased on mRNA as well as on protein expression level following miR-100 inhibition.
17
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Figure VI Additional information on atherosclerosis mouse study under microRNA-100 overexpression. LDRL-/- mice were set on high cholesterol diet for 8 weeks and every four weeks either i.v. injected with a precursor oligonucleotide specific for miR-100 (miR-100 mimic) or the corresponding control compound (control). A: MiR-100 mimic treatment led to a significant enhanced expression of miR-100 in aortic tissue compared to control group as determined by Taqman-based stem-loop PCR. B: The mRNA expression of the direct miR-100 target mTOR was significantly reduced in aortic tissue following miR-100 mimic treatment as determined by real-time PCR. C-H: Parameters as weight gain, leukocyte count, triglyceride as well as total cholesterol and HDL/LDL cholesterol were equal between the treatment groups at beginning of experiment. I-L: At endpoint of experiment triglyceride as well as total cholesterol and LDL level were significantly decreased in miR-100 mimic treated mice. In contrast, HDL level were increased under condition of miR-100 overexpression, n=10. M: MiR-100 expression level in liver tissue were also affected by miR-100 mimic treatment, as shown using Taqman-based stem-loop PCR. N: mTOR, as direct miR-100 target and central regulator of cell metabolism was decreased in liver tissue following miR-100 overexpression, as shown by real-time PCR. O: mRNA expression of transcription factor SREBP-2 was also diminished following miR-100 overexpression as determined using real-time PCR. 18
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Figure VII MicroRNA-100 plays a minor role in the circulating cell population. A: Analysis of miR-100 expression in different cell lines revealed a relatively low expression of miR-100 in circulating cells compared to human umbilical vein endothelial cells (HUVECs) as determined using Taqman-based stem-loop PCR. (THP-1: acute monocytic leukemia cell line, Monocytes: primary human monocytes obtained from negative bead-isolation out of whole blood. Macrophages: primary monocytes differentiated to macrophages using phorbol 12-myristate 13-acetate, PMA) B+C: MiR-100 expression level were modulated in THP-1 cells differentiated into macrophage lineage by stimulation with PMA and cells were stimulated for 12 h with LPS following transfection procedure. TNF-α concentration was analyzed using ELISA and results were normalized to cell viability as determined in the MTT metabolization assay (n=3). D-G: MiR-100 expression level was modulated in undifferentiated THP-1 cells and protein expression of CD11b was determined by flow cytometry under baseline conditions and following LPS stimulation for 24 h (n=3). H+I: Primary human monocytes were isolated out of whole blood using negative bead-isolation and miR-100 expression level was modulated and migration capacity was analyzed in response to chemoattractant MCP-1(10 ng/ml) in a modified Boyden chamber (n=3). J: Western blot analysis of differentiated and transfected THP-1 cells showed a significant reduction in the expression of mTOR after overexpression of miR-100 (n=3). 19
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
Supplementary Figure VIII Additional information on analyzed human carotid plaque specimen. A-D: MiR-100 expression in human plaque lesions classified in lesions with either a low or a moderate/heavy content of macrophages plus either statin user or non-statin user (A+B) or user of calcium-antagonists or non-user (C+D). E: TNF-α protein expression was quantified in the atherosclerotic plaque by Fluorescent Bead Immunoassay as previously described8. The sample numbers are stated below the graphs. 20
Pankratz et al., MiR-100 suppresses chronic vascular inflammation, Data supplement
References
1. Thum T, Galuppo P, Wolf C, Fiedler J, Kneitz S, van Laake LW, Doevendans PA, Mummery CL, Borlak J, Haverich A, Gross C, Engelhardt S, Ertl G, Bauersachs J. Micrornas in the human heart: A clue to fetal gene reprogramming in heart failure. Circulation. 2007;116:258-267 2. Grundmann S, Schirmer SH, Hekking LH, Post JA, Ionita MG, de Groot D, van Royen N, van den Berg B, Vink H, Moser M, Bode C, de Kleijn D, Pasterkamp G, Piek JJ, Hoefer IE. Endothelial glycocalyx dimensions are reduced in growing collateral arteries and modulate leucocyte adhesion in arteriogenesis. Journal of cellular and molecular medicine. 2009;13:3463-3474 3. Hodgin JB, Maeda N. Minireview: Estrogen and mouse models of atherosclerosis. Endocrinology. 2002;143:4495-4501 4. Grundmann S, Hans FP, Kinniry S, Heinke J, Helbing T, Bluhm F, Sluijter JP, Hoefer I, Pasterkamp G, Bode C, Moser M. Microrna-100 regulates neovascularization by suppression of mammalian target of rapamycin in endothelial and vascular smooth muscle cells. Circulation. 2011;123:999-1009 5. Bonauer A, Carmona G, Iwasaki M, Mione M, Koyanagi M, Fischer A, Burchfield J, Fox H, Doebele C, Ohtani K, Chavakis E, Potente M, Tjwa M, Urbich C, Zeiher AM, Dimmeler S. Microrna-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 2009;324:1710-1713 6. Leonhardt F, Grundmann S, Behe M, Bluhm F, Dumont RA, Braun F, Fani M, Riesner K, Prinz G, Hechinger AK, Gerlach UV, Dierbach H, Penack O, Schmitt-Graff A, Finke J, Weber WA, Zeiser R. Inflammatory neovascularization during graft-versus-host disease is regulated by alphav integrin and mir-100. Blood. 2013;121:3307-3318 7. Verhoeven BA, Velema E, Schoneveld AH, de Vries JP, de Bruin P, Seldenrijk CA, de Kleijn DP, Busser E, van der Graaf Y, Moll F, Pasterkamp G. Athero-express: Differential atherosclerotic plaque expression of mrna and protein in relation to cardiovascular events and patient characteristics. Rationale and design. European journal of epidemiology. 2004;19:1127-1133 8. Peeters W, Hellings WE, de Kleijn DP, de Vries JP, Moll FL, Vink A, Pasterkamp G. Carotid atherosclerotic plaques stabilize after stroke: Insights into the natural process of atherosclerotic plaque stabilization. Arteriosclerosis, thrombosis, and vascular biology. 2009;29:128-133
21