Human TOP3B ELISA Matched Antibody Pair

Total Page：16

File Type：pdf, Size：1020Kb

Version 01-06/20 User's Manual Human TOP3B ELISA Matched Antibody Pair ABPR-0990 This product is for research use only and is not intended for diagnostic use. For illustrative purposes only. To perform the assay the instructions for use provided with the kit have to be used. Creative Diagnostics Address: 45-1 Ramsey Road, Shirley, NY 11967, USA Tel: 1-631-624-4882 (USA) 44-161-818-6441 (Europe) Fax: 1-631-938-8221 Email: [email protected] Web: www.creative-diagnostics.com Cat: ABPR-0990 Human TOP3B ELISA Matched Antibody Pair Version 20-06/20 PRODUCT INFORMATION Intended Use This antibody pair set comes with matched antibody pair to detect and quantify protein level of human TOP3B. General Description This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Low expression of this gene may be related to higher survival rates in breast cancer patients. This gene has a pseudogene on chromosome 22. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. Reagents And Materials Provided Antibody pair set content: 1. Capture antibody: mouse monoclonal anti-TOP3B (100 μg) 2. Detection antibody: rabbit purified polyclonal anti-TOP3B (50 μg) Note: Reagents are sufficient for at least 3-5 x 96 well plates using recommended protocols. Reconstitution And Storage Store reagents of the antibody pair set at -20°C or lower. Please aliquot to avoid repeated freeze thaw cycle. Reagents should be returned to -20°C storage immediately after use. Tel: 1-631-624-4882 (USA) Fax: 1-631-938-8221 Tel: 44-161-818-6441 (Europe) Email: [email protected] 2/2.

Copy Link

Recommended publications

Clinical Presentation and Genetic Profiles of Chinese Patients With
Journal of Genetics (2019) 98:42 © Indian Academy of Sciences https://doi.org/10.1007/s12041-019-1090-5 RESEARCH ARTICLE Clinical presentation and genetic profiles of Chinese patients with velocardiofacial syndrome in a large referral centre DANDAN WU1,2, YANG CHEN1,2, QIMING CHEN1,2, GUOMING WANG1,2∗, XIAOFENG XU1,2,A.PENG3, JIN HAO4, JINGUANG HE5∗,LIHUANG6∗ and JIEWEN DAI1,2∗ 1Department of Oral and Cranio-maxillofacial Surgery, National Clinical Research Center for Oral Disease, Shanghai Ninth People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200011, People’s Republic of China 2Shanghai Key Laboratory of Stomatology, Shanghai 200011, People’s Republic of China 3State Key Laboratory of Oral Diseases, West China School of Stomatology, Chengdu 610041, People’s Republic of China 4Harvard School of Dental Medicine, Harvard University, Boston 02125, USA 5Department of Plastic Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200011, People’s Republic of China 6Department of Oral and Maxillofacial Surgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou, People’s Republic of China *For correspondence. E-mail: Jiewen Dai, [email protected]; Guoming Wang, [email protected]; Jinguang He, [email protected]; Li Huang, [email protected]. Received 29 November 2017; revised 8 January 2019; accepted 11 January 2019; published online 4 May 2019 Abstract. Diagnosis and treatment of velocardiofacial syndrome (VCFS) with variable genotypes and phenotypes are considered to be very complicated. Establishing an exact correlation between the phenotypes and genotypes of VCFS is still a challenging. In this paper, 88 Chinese VCFS patients were divided into five groups based on palatal anomalies and one or two of other four common phenotypes, and copy number variations (CNVs) were detected using multiplex ligation-dependent probe amplification (MLPA), array comparative genomic hybridization (aCGH) and quantitative polymerase chain reaction.
[Show full text]
DNA Topoisomerases and Cancer Topoisomerases and TOP Genes in Humans Humans Vs
DNA Topoisomerases Review DNA Topoisomerases And Cancer Topoisomerases and TOP Genes in Humans Humans vs. Escherichia Coli Topoisomerase differences Comparisons Topoisomerase and genomes Top 1 Top1 and Top2 differences Relaxation of DNA Top1 DNA supercoiling DNA supercoiling In the context of chromatin, where the rotation of DNA is constrained, DNA supercoiling (over- and under-twisting and writhe) is readily generated. TOP1 and TOP1mt remove supercoiling by DNA untwisting, acting as “swivelases”, whereas TOP2a and TOP2b remove writhe, acting as “writhases” at DNA crossovers (see TOP2 section). Here are some basic facts concerning DNA supercoiling that are relevant to topoisomerase activity: • Positive supercoiling (Sc+) tightens the DNA helix whereas negative supercoiling (Sc-) facilitates the opening of the duplex and the generation of single-stranded segments. • Nucleosome formation and disassembly absorbs and releases Sc-, respectively. • Polymerases generate Sc+ ahead and Sc- behind their tracks. • Excess of Sc+ arrests DNA tracking enzymes (helicases and polymerases), suppresses transcription elongation and initiation, and destabilizes nucleosomes. • Sc- facilitates DNA melting during the initiation of replication and transcription, D-loop formation and homologous recombination and nucleosome formation. • Excess of Sc- favors the formation of alternative DNA structures (R-loops, guanine quadruplexes, right-handed DNA (Z-DNA), plectonemic structures), which then absorb Sc- upon their formation and attract regulatory proteins. The
[Show full text]
Derived from Chromosome 22, a Case Report
1802 Case Report Hypogonadotropic hypogonadism associated with another small supernumerary marker chromosome (sSMC) derived from chromosome 22, a case report Abdullah1#, Cui Li2#, Minggang Zhao2, Xiang Wang2, Xu Li2, Junping Xing1 1Department of Urology, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, China; 2Centre for Translational Medicine, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, China #These authors contributed equally to this work. Correspondence to: Junping Xing. Department of Urology, School of Medicine, The First Affiliated Hospital, Xi’an Jiaotong University, Xi’an 710061, China. Email: [email protected]. Abstract: The idiopathic hypogonadotropic hypogonadism (IHH) is portrayed as missing or fragmented pubescence, cryptorchidism, small penis, and infertility. Clinically it is characterized by the low level of sex steroids and gonadotropins, normal radiographic findings of the hypothalamic-pituitary areas, and normal baseline and reserve testing of the rest of the hypothalamic-pituitary axes. Delay puberty and infertility result from an abnormal pattern of episodic GnRH secretion. Mutation in a wide range of genes can clarify ~40% of the reasons for IHH, with the majority remaining hereditarily uncharacterized. New and innovative molecular tools enhance our understanding of the molecular controls underlying pubertal development. In this report, we aim to present a 26-year-old male of IHH associated with a small supernumerary marker chromosome (sSMC) that originated from chromosome 22. The G-banding analysis revealed a karyotype of 47,XY,+mar. High-throughput DNA sequencing identified an 8.54 Mb duplication of 22q11.1-q11.23 encompassing all the region of 22q11 duplication syndrome. Pedigree analysis showed that his mother has carried a balanced reciprocal translocation between Chromosomes 22 and X[t(X;22)].
[Show full text]
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
[Show full text]
Screening of Copy Number Variants in the 22Q11.2 Region of Congenital
Pires et al. BMC Genetics 2014, 15:115 http://www.biomedcentral.com/1471-2156/15/115 RESEARCH ARTICLE Open Access Screening of copy number variants in the 22q11.2 region of congenital heart disease patients from the São Miguel Island, Azores, revealed the second patient with a triplication Renato Pires1,2, Luís M Pires3†, Sara O Vaz4†, Paula Maciel4, Rui Anjos5, Raquel Moniz1, Claudia C Branco1,2,6, Rita Cabral1, Isabel M Carreira3 and Luisa Mota-Vieira1,2,6* Abstract Background: The rearrangements in the 22q11.2 chromosomal region, responsible for the 22q11.2 deletion and microduplication syndromes, are frequently associated with congenital heart disease (CHD). The present work aimed to identify the genetic basis of CHD in 87 patients from the São Miguel Island, Azores, through the detection of copy number variants (CNVs) in the 22q11.2 region. These structural variants were searched using multiplex ligation-dependent probe amplification (MLPA). In patients with CNVs, we additionally performed fluorescent in situ hybridization (FISH) for the assessment of the exact number of 22q11.2 copies among each chromosome, and array comparative genomic hybridization (array-CGH) for the determination of the exact length of CNVs. Results: We found that four patients (4.6%; A to D) carried CNVs. Patients A and D, both affected with a ventricular septal defect, carried a de novo 2.5 Mb deletion of the 22q11.2 region, which was probably originated by inter-chromosomal (inter-chromatid) non-allelic homologous recombination (NAHR) events in the regions containing low-copy repeats (LCRs). Patient C, with an atrial septal defect, carried a de novo 2.5 Mb duplication of 22q11.2 region, which could have been probably generated during gametogenesis by NAHR or by unequal crossing-over; additionally, this patient presented a benign 288 Kb duplication, which included the TOP3B gene inherited from her healthy mother.
[Show full text]
Arginine Methylation Facilitates the Recruitment of TOP3B to Chromatin to Prevent R Loop Accumulation
Molecular Cell Article Arginine Methylation Facilitates the Recruitment of TOP3B to Chromatin to Prevent R Loop Accumulation Yanzhong Yang,1 Kevin M. McBride,1 Sean Hensley,1 Yue Lu,1 Frederic Chedin,2 and Mark T. Bedford1,* 1The University of Texas MD Anderson Cancer Center, P.O. Box 389, Smithville, TX 78957, USA 2Department of Molecular & Cellular Biology, The University of California at Davis, Davis, CA 95616, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.molcel.2014.01.011 SUMMARY nine methyltransferase 1), which deposit the H4R3me2a and H3R17me2a marks, respectively (Yang and Bedford, 2013). Tudor domain-containing protein 3 (TDRD3) is a Both of these marks are recognized by the Tudor domain of major methylarginine effector molecule that reads TDRD3 (Yang et al., 2010), a protein that is enriched at the pro- methyl-histone marks and facilitates gene transcrip- moters of highly transcribed genes and can likely also associate tion. However, the underlying mechanism by which with the C-terminal domain (CTD) of RNA Polymerase II (RNAP II) TDRD3 functions as a transcriptional coactivator is (Sims et al., 2011). TDRD3 has no enzymatic activity of its unknown. We identiﬁed topoisomerase IIIB (TOP3B) own, but here we show that it is tightly complexed with DNA topoisomerase IIIb (TOP3B), an interaction that bestows, in as a component of the TDRD3 complex. TDRD3 part, coactivator activity on TDRD3. TOP3B is a member of serves as a molecular bridge between TOP3B and the 1A subfamily of DNA topoisomerases and, as such, targets arginine-methylated histones. The TDRD3-TOP3B underwound or negatively supercoiled DNA (Wang, 2002).
[Show full text]
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
[Show full text]
RECQ5-Dependent Sumoylation of DNA Topoisomerase I Prevents Transcription-Associated Genome Instability
ARTICLE Received 20 Aug 2014 | Accepted 23 Feb 2015 | Published 8 Apr 2015 DOI: 10.1038/ncomms7720 RECQ5-dependent SUMOylation of DNA topoisomerase I prevents transcription-associated genome instability Min Li1, Subhash Pokharel1,*, Jiin-Tarng Wang1,*, Xiaohua Xu1,* & Yilun Liu1 DNA topoisomerase I (TOP1) has an important role in maintaining DNA topology by relaxing supercoiled DNA. Here we show that the K391 and K436 residues of TOP1 are SUMOylated by the PIAS1–SRSF1 E3 ligase complex in the chromatin fraction containing active RNA polymerase II (RNAPIIo). This modification is necessary for the binding of TOP1 to RNAPIIo and for the recruitment of RNA splicing factors to the actively transcribed chromatin, thereby reducing the formation of R-loops that lead to genome instability. RECQ5 helicase promotes TOP1 SUMOylation by facilitating the interaction between PIAS1, SRSF1 and TOP1. Unexpectedly, the topoisomerase activity is compromised by K391/K436 SUMOylation, and this provides the first in vivo evidence that TOP1 activity is negatively regulated at transcriptionally active chromatin to prevent TOP1-induced DNA damage. Therefore, our data provide mechanistic insight into how TOP1 SUMOylation contributes to genome maintenance during transcription. 1 Department of Radiation Biology, Beckman Research Institute, City of Hope, Duarte, California 91010-3000, USA. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to Y.L. (email: [email protected]). NATURE COMMUNICATIONS | 6:6720 | DOI: 10.1038/ncomms7720 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms7720 he prevention and efficient repair of DNA double-stranded transcriptionally active chromatin to prevent R-loops.
[Show full text]
Gene Ontology Functional Annotations and Pleiotropy
Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
[Show full text]
FARE2021WINNERS Sorted by Institute
FARE2021WINNERS Sorted By Institute Swati Shah Postdoctoral Fellow CC Radiology/Imaging/PET and Neuroimaging Characterization of CNS involvement in Ebola-Infected Macaques using Magnetic Resonance Imaging, 18F-FDG PET and Immunohistology The Ebola (EBOV) virus outbreak in Western Africa resulted in residual neurologic abnormalities in survivors. Many case studies detected EBOV in the CSF, suggesting that the neurologic sequelae in survivors is related to viral presence. In the periphery, EBOV infects endothelial cells and triggers a â€œcytokine stormâ€. However, it is unclear whether a similar process occurs in the brain, with secondary neuroinflammation, neuronal loss and blood-brain barrier (BBB) compromise, eventually leading to lasting neurological damage. We have used in vivo imaging and post-necropsy immunostaining to elucidate the CNS pathophysiology in Rhesus macaques infected with EBOV (Makona). Whole brain MRI with T1 relaxometry (pre- and post-contrast) and FDG-PET were performed to monitor the progression of disease in two cohorts of EBOV infected macaques from baseline to terminal endpoint (day 5-6). Post-necropsy, multiplex fluorescence immunohistochemical (MF-IHC) staining for various cellular markers in the thalamus and brainstem was performed. Serial blood and CSF samples were collected to assess disease progression. The linear mixed effect model was used for statistical analysis. Post-infection, we first detected EBOV in the serum (day 3) and CSF (day 4) with dramatic increases until euthanasia. The standard uptake values of FDG-PET relative to whole brain uptake (SUVr) in the midbrain, pons, and thalamus increased significantly over time (p<0.01) and positively correlated with blood viremia (pâ‰¤0.01).
[Show full text]
Top3b (NM 011624) Mouse Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210989L3 Top3b (NM_011624) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Top3b (NM_011624) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Top3b Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(MR210989). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_011624 ORF Size: 2589 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Top3b (NM_011624) Mouse Tagged ORF Clone – MR210989L3 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_011624.2 RefSeq Size: 2987 bp RefSeq ORF: 2589 bp Locus ID: 21976 UniProt ID: Q9Z321, Q3UJF5 Gene Summary: Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex.
[Show full text]
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name topoisomerase (DNA) III beta Gene Symbol TOP3B Organism Human Gene Summary This gene encodes a DNA topoisomerase an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination cellular aging and maintenance of genome stability. Alternative splicing of the C-terminus of this gene results in three transcript variants which have distinct tissue specificity; however not all variants have been fully described. Gene Aliases FLJ39376 RefSeq Accession No. NC_000022.10, NT_011520.12 UniGene ID Hs.436401 Ensembl Gene ID ENSG00000100038 Entrez Gene ID 8940 Assay Information Unique Assay ID qHsaCEP0057675 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000357179, ENST00000398793, ENST00000424393, ENST00000437929, ENST00000430142, ENST00000413067 Amplicon Context Sequence TGCAGGAACTTCACCATGTTCAGCTTGGGGTTAGCTTCTTTCTTCTCCGTGGGAG CTTGGCTGAACAGTTCTGCGGGGTCCACTTTGTCCCATTTGTTGTATTTTCCCAG GAAATCCAGGGTCAT Amplicon Length (bp) 95 Chromosome Location 22:22326985-22328747 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 96 R2 0.9994 cDNA Cq 21.67 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm
[Show full text]