DOCSLIB.ORG

Clinical Presentation and Genetic Profiles of Chinese Patients With

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Journal of Genetics (2019) 98:42

© Indian Academy of Sciences https://doi.org/10.1007/s12041-019-1090-5

RESEARCH ARTICLE

Clinical presentation and genetic profiles of Chinese patients with velocardiofacial syndrome in a large referral centre

DANDAN WU1,2, YANG CHEN1,2, QIMING CHEN1,2, GUOMING WANG1,2∗, XIAOFENG XU1,2, A. PENG3, JIN HAO4, JINGUANG HE5∗, LI HUANG6∗ and JIEWEN DAI1,2∗

1Department of Oral and Cranio-maxillofacial Surgery, National Clinical Research Center for Oral Disease, Shanghai Ninth People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200011, People’s Republic of China 2Shanghai Key Laboratory of Stomatology, Shanghai 200011, People’s Republic of China 3State Key Laboratory of Oral Diseases, West China School of Stomatology, Chengdu 610041, People’s Republic of China 4Harvard School of Dental Medicine, Harvard University, Boston 02125, USA 5Department of Plastic Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200011, People’s Republic of China 6Department of Oral and Maxillofacial Surgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou, People’s Republic of China

*For correspondence. E-mail: Jiewen Dai, [email protected]; Guoming Wang, [email protected]; Jinguang He, [email protected]; Li Huang, [email protected].

Received 29 November 2017; revised 8 January 2019; accepted 11 January 2019; published online 4 May 2019 Abstract. Diagnosis and treatment of velocardiofacial syndrome (VCFS) with variable genotypes and phenotypes are considered to be very complicated. Establishing an exact correlation between the phenotypes and genotypes of VCFS is still a challenging. In this paper, 88 Chinese VCFS patients were divided into five groups based on palatal anomalies and one or two of other four common phenotypes, and copy number variations (CNVs) were detected using multiplex ligation-dependent probe amplification (MLPA), array comparative genomic hybridization (aCGH) and quantitative polymerase chain reaction. The findings showed that palatal anomalies and characteristic malformation of face were important indicators for 22q11.2 microdeletion, and there was difference in the phenotypic spectrum between the duplication and deletion of 22q11.2. MLPA was a highly cost-effective, sensitive and preferred method for patients with 22q11.2 deletion or duplication. Our results also firstly reported that all three patients who simultaneously exhibited palatal anomalies and cognitive disorder, without other phenotypes, have Top3b duplication, which strongly suggested that Top3b may be a pathogenic gene for these patients. Further, the findings showed that patients with palatal anomalies and congenital heart disease or immune deficiency, with or without other uncommon phenotypes, exhibited heterogeneity in CNVs, including 4q34.1- qter, 6q25.3, 4q23, Xp11.4, 13q21.1, 17q23.2, 7p21.3, 2p11.2, 11q24.3 and 16q23.3, and some possible pathogenic genes, including

BCOR, PRR20A, TBX2, SMYD1, KLKB1 and TULP4 have been suggested. For these patients, aCGH, whole genomic sequencing,

combined with references and phenomics database to find pathogenic gene, may be choices of priority. Taking these findings together, we offered an alternative method for diagnosis of Chinese VCFS patients based on this phenotypic strategy.

Keywords. diagnosis; Chinese patients; velocardiofacial syndrome patients; phenotypic strategy.

Introduction

Velocardiofacial syndrome (VCFS) (MIM: 192430, also named DiGeorge syndrome, MIM: 188400), affects ∼1

Dandan Wu, Yang Chen and Qiming Chen contributed equally to this work.

Electronic supplementary material: The online version of this article (https://doi.org/10.1007/s12041-019-1090-5) contains supplemen- tary material, which is available to authorized users.

1

42 Page 2 of 11

Dandan Wu et al.

in 2000–7000 individuals (Kobrynski and Sullivan 2007; Materials and methods Wu et al. 2013; Kruszka et al. 2017). Phenotypes in

Patients

every patient with VCFS exhibited great variety, and more than 180 clinical features involving almost all organs and systems have been reported. The five most common symptoms for VCFS patients include palatal anomalies, congenital heart disease (CHD), characteristic malformation of face (CMF), immune deficiency and cognitive or behavioural disorder. However, no single phenotype occurs in all patients, and no patient would exhibit all reported phenotypes (Perez and Sullivan 2002; Kobrynski and Sullivan 2007; Lopez-Rivera et al. 2017).
Eighty-eight patients, diagnosed as VCFS based on clinical and auxiliary examinations, from the Center for Cleft Lip and Palate, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine were enrolled in this study. Some patients’ samples and materials from our previous study also were included in this study (Wu et al. 2013). Patients who exhibited at least two of the five most common phenotypes, including palatal abnormality, CHD, CMF, immune deficiency and cognitive or behavioural disorder were clinically diagnosed as VCFS. Except for these five common phenotypes, all the other phenotypes were defined as uncommon phenotypes. In this study, palatal abnormalities mean patients exhibited submucosal cleft palate, occult submucous cleft palate, complete cleft palate (CCP) or congenital velopharyngeal insufficiency (CVPI). CMF mean patients exhibited all of the following phenotypes: vertically long face, narrow palpebral fissures, fleshy nose with a broad nasal root, flattened malar region and retrognathia. CHD mean patients with one or several conotruncal CHDs, aortic arch anomalies or other phenotypes: tetralogy of fallot, atrial septal defect, interrupted aortic arch, patent ductus arteriosus and ventricular septal defect. Immune deficiency means patients had thymic hypoplasia, T-cell deficiency or history of recurrent infections. Cognitive or behavioural disorders mean mild mental retardation or intellectual disability. Every enrolled patient would receive a general physical examination in detail, and the phenotypes were diagnosed by specialist physicians. The basic information and clinical phenotypes of these patients are listed in table 1 in electronic supplementary material at http://www.ias.ac.in/ jgenet/.
In this study, we tried to classify VCFS patients based on the five most common phenotypes. All enrolled 88 patients in this study were divided into five groups (table 2 in electronic supplementary material): (i) group 1 (patients 1 to 66): patients exhibited palatal anomalies and CMF, with or without other phenotypes; (ii) group 2 (patients 67 to 69): patients exhibited palatal anomalies and cognitive or behavioural disorder, with or without other uncommon phenotypes; (iii) group 3 (patients 70 to 80): patients exhibited palatal anomalies and CHD, with or without other uncommon phenotypes; (iv) group 4 (patients 81 to 86): patients exhibited palatal anomalies and immune defi- ciency, with or without other uncommon phenotypesand (v) group 5 (patients 87 and 88): there were two patients exhibiting palatal anomalies, cognitive or behavioural disorder and immune deficiency, with or without other uncommon phenotypes.
Previous evidence showed that an autosomal dominant microdeletion on the long arm of chromosome 22(22q11.2) was the most common pathogenic factor for VCFS, and the vast majority of individuals with 22q11.2 microdeletion carry a typical 3-Mb deletion. In addition, some patients carry a proximal 1.5-Mb deletion nested to the typically deleted region (TDR), and only a few patients exhibited atypical deletions overlapping or nonoverlapping with the TDR (Perez and Sullivan 2002; Ensenauer et al. 2003; Kobrynski and Sullivan 2007; Panamonta e t a l. 2016a, b). However, exceptfor22q11.2microdeletion, previous findings also showed that some cases exhibited clinical phenotypes similar to those of VCFS having 22q11.2 duplication or copy number variations (CNVs) on other chromosomes. These patients were also clinically diagnosed as VCFS by some geneticists and doctors (Wu

et al. 2013).

Establishing an exact correlation between the phenotypes and genotypes of VCFS is still a challenge. With the development of biotechnology, such as whole-genome sequencing, array comparative genomic hybridization (aCGH) and multiplex ligation-dependent probe amplification (MLPA), detection of genetic variation in patients has become easier (Jalali et al. 2008; Poirsier et al. 2016). However, narrowing the detecting area and focus on some potential target based on the phenotypes may increase the precision of diagnosis and reduce patients’ cost. Humanphenotypeontologyoffersacomputationalbridge between genotypes and phenotypes (Zemojtel et al. 2014; Kohler et al. 2017). Our previous preliminary findings also showed that all VCFS patients with palatal anomalies and CMF would have a 22q11.2 microdeletion (Wu et al. 2013). All of these findings inspired us that VCFS patients may be divided into different groups based on clinical phenotypes, and these different groups may exhibit different genetic variations.
In this paper, 88 Chinese patients with clinical diagnosis of VCFS were divided into five groups based on palatal anomalies and one or two of other four common phenotypes, and these groups exhibited different CNVs. Further, some new possible pathogenic genes also were found based on this strategy, which offered a useful method for classification diagnosis of Chinese VCFS patients based on this phenotypic strategy.
One hundred normal patients were included in this study as a control. The summary of these control patients’ demographic data is listed in tables 3 and 4 in electronic

Clinical and genetic profiles of Chinese VCFS patients

Page 3 of 11 42

Figure 1. Algorithm for CNV testing in VCFS patients and controls. All VCFS patients and controls would firstly undergo MLPA analysis, and the patients without 22q11.2 microdeletion, a most common pathogenic factor of VCFS, being detected by MLPA would undergo aCGH analysis. Further, if the internal reference probe sites were similar to the sample’s sites, sample probes array floating and irregular, or there were less sample probes in the aCGH image, the aCGH results should be further evaluated by qPCR. CNVs, copy number variations.

supplementary material. Thirty available parent pairs (60 10–50 ng/μL DNA was prepared for MLPA analysis, parents) of subjects with typical 22q11 deletion were also aCGH or qPCR. included in this study to determine whether 22q11 deletion was inherited or de novo.

MLPA analysis

The VCFS patients, controls and parent pairs would undergo MLPA, aCGH or quantitative polymerase chain reaction (qPCR) analyses following the planed arrangement (figure 1).
The protocols for MLPA analysis is described in detail in the previous literature. Briefly, the SALSA MLPA KIT P250-B1 DiGeorge (MRC-Holland, Amsterdam, the Netherlands) was used for MLPA analysis according to the manufacturer’s instructions. Capillary electrophoresis on an ABI 3130XL Genetic Analyser (Applied Biosystems,

DNA extraction

Whole peripheral blood was collected, and genomic DNA Foster City, USA) was used to detect and quantify the was extracted from the peripheral blood using a Qiagen amplification products, and the files of electropherograms DNA blood kit (Qiagen, Hilden, Germany) following the were analysed using GeneMarker software v1.8 (Softgemanufacturer’s instructions. Then the concentration was netics, State College, USA). Forty-eight probes for 48 detected using a spectrophotometry method (NanoDrop different genes were included in this MLPA kit, and the 1000, Thermo Scientific, USA), and a concentration of detailed information on these probes is described in the

42 Page 4 of 11

Dandan Wu et al.

previous literature (Wu et al. 2013). Each MLPA analysis on the VCFS-related tissues, including cardiovascular

  • was carried out in triplicate.
  • system, brain, haemolymphoid system, branchial arch and

limb.

Array comparative genomic hybridization (aCGH)
Prediction of CNVs and possible pathogenic genes based on phenomics

The MLPA analysis results showed that there were 16 patients exhibiting no CNVs (patients 70–76, 78–80, 81–86), four patients with atypical 22q11.2 duplication (patients 77, 67–69) and one patient (patient 88) with 4q34 loss of heterozygosity. High-density probe microarray analyses were performed to evaluate the complete genomes of these 21 patients, who had no 22q11.2 microdeletion, to determine the other possible CNVs. Genomic DNA was extracted from whole blood using the QIAamp DNA Blood Maxi kit following the instructions described above. CNVs were analysed using the CytoScan HD array (Affymetrix, Santa Clara, USA) and Affymetrix Chromosome Analysis Suite (Affymetrix) software according to the manufacturer’s instructions. Briefly, the protocols included the following eight procedures before scanning the chip: genomic DNA digestion, Nsp I adapter ligation, fragment amplification by PCR, purifi- cation of PCR product, fragmentation of PCR product, end-labelling, hybridization and washing. The obtained CNVs were compared with the CNVs in the database of genomic variants (DGV).
We used the on-line database, phenolizer (http://phenolyze r.wglab.org/) and phenomizer (http://compbio.charite.de/ phenomizer/), to make a prediction of CNVs or possible pathogenic genes based on the patients’ phenotypes. Whenever there were many genes located in CNVs, the phenolizer database was also used to sort the possible pathogenicity for these genes based on the patients’ phenotypes.

Statistical analysis

The χ2 test was used to compare the CNVs and clinical characteristics among the five groups using SPSS 17.0 software, and P < 0.05 was considered significant.

Ethics statement

The protocols used in this study were carried out according to the principles of the Declaration of Helsinki, and were approved by the Ethics Committee in Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University, School of Medicine. Written informed consent was obtained from all participants or from their parents.

CNVs validation by qPCR

If the internal reference probe sites were similar to the sample’s sites, sample probes array floating and irregular or there were less sample probes in the aCGH image, the aCGH results should be further evaluated. In this study, the detected CNVs in patients 70, 71, 75, 79–86 and 88 by aCGH were selected for further validation by qPCR. SYBR Green analysis on an ABI 7900 HT Sequence Detection System (Applied Biosystems) was used to quantify copy numbers. Primer 5.0 was used to design primers to amplify the region of interest, and the sequences of these primers are listed in table 5 in electronic supplementary material. Each qPCR run included amplification of an endogenous control with known copy number (RPP30-71 and RPPH1-63). In total, 10 μL reaction solutions were used with 10 ng DNA according to the manufacturer’s recommended protocols. qPCR was conducted in duplicate. The CNVs were calculated as

Results

CNVs and clinical characteristics of VCFS patients in group 1

The MLPA results showed that all 66 patients (patients 1 to 66) who simultaneously exhibited CMF and palatal anomalies have 22q11.2 heterozygous deletion, of whom 62 (93.93%) exhibited typical 3-Mb deletion, and four (6.07%) displayed proximal 1.5-Mb deletion (table 1 in electronic supplementary material). No case was found with atypical deletion and duplication of 22q11.2.
For common phenotypes, 32 patients (48.48%) exhibited incomplete cleft palate (ICP) or occult submucous cleft palate, whereas 34 patients had CVPI among these 66 patients. Twenty-three patients (34.85%) suffered from CHDs, 50 patients (75.76%) exhibited cognitive or behaviouraldisorderand38patients(57.58%)hadimmune deficiency (table 1 in electronic supplementary material).
For uncommon phenotypes, 33 patients (50%) showed

21−(ꢀC samples−ꢀC internal reference)

.

Expression patterns of possible pathogenic genes

The expression patterns of possible pathogenic genes were other uncommon phenotypes, such as epilepsy, funnel obtained from the database of Mouse Genome Infor- chest and enamel hypomineralization. Among these matics(http://www.informatics.jax.org/), GeneExpression uncommon phenotypes, seven patients (10.61%) exhibited Atlas (http://www.ebi.ac.uk/rdf/services/atlas/) and NCBI epilepsy, and 16 (24.24%) showed growth retardation or (https://www.ncbi.nlm.nih.gov/gene/). We mainly focussed short stature. No patient exhibited CCP or cleft lip in

Clinical and genetic profiles of Chinese VCFS patients

Page 5 of 11 42

Figure 2. Images of MLPA analysis using the P250-B1 DiGeorge kit. (a) Patients exhibited normal copy numbers. (b) Patients 67–69 exhibited TOP3B heterozygous duplications within 22q11.2. (c) Patient 77 exhibited LZTR1 heterozygous deletion within 22q11.2. (d) Patient 88 exhibited 4q34 (SLC25A4, KLKB1) heterozygous deletion (red spots).

all these 66 patients (table 1 in electronic supplementary process (figure 3, b–e) (Wamstad and Bardwell 2007).

  • material).
  • Previous studies showed that Top3b plays a crucial role

No chromosomal abnormalities were detected by using in catalysing RNA transesterification, and works with the the MLPA kit in all 325 controls (figure 2a; tables 3 and fragile X syndrome protein to promote synapse forma4 in electronic supplementary material), which further tion (Stoll et al. 2013; Xu et al. 2013). Knock out of confirmed that nonsyndromic palate anomalies or CHD Top3b in mice would lead to reduced mean lifespan, and would exhibit no 22q11.2 deletion or duplication, and results in inflammation or autoimmunity in many impor-

  • most 22q11.2 deletion in patients was de novo.
  • tant organs (table 6 in electronic supplementary material)

(Kwan and Wang 2001; Kwan et al. 2003, 2007). Further, previous studies also reported Top3b duplication or deletioninasmallnumberofcaseswhenperformedascreening in a relatively large samples of CHD or schizophrenia patients (table 6 in electronic supplementary material) (Kaufman et al. 2016). In this study, we firstly reported that patients simultaneously having palatal anomalies and mild-cognitive disorder (without other phenotypes) would exhibit a higher ratio with Top3b duplication (3/3, 100%). Further, we also find that patient 67 has 7p21.3 duplication (figure 1 in electronic supplementary material;

CNVs and clinical characteristics of VCFS patients in group 2

The MLPA results showed that all the three patients had 22q11.2 duplication, and this region only includes Top3b (figure 2b; table 1 in electronic supplementary material). The aCGH results further confirmed the findings (figure 3a). The Gene Expression Atlas on-line database showed that Top3b expressed in the brain and branchial arch tissues during the mouse embryonic development

42 Page 6 of 11

Dandan Wu et al.

Figure 3. (a) aCGH detection results showed that one 264 kb copy duplication of 22q11.2 (22,315,092–22,578,983) in patients 67, 68 and 69. (b) Top3b expression patterns in the mouse brain obtained from the Gene Expression Atlas on-line database. (c–e) Top3b expression patterns in the E8.5 (c), E9.5 (d) and E10.5 (e) mouse tissues from first branchial arch obtained from the Gene Expression Atlas on-line database. E, embryonic.

  • table 1), which may contribute to growth retardation and
  • The MLPA results showed that patient 77 exhibited

morphology anomalies. Previous study reported a case LZTR1 duplication (figure 2c). But aCGH results did not with 7p21.3-p22 duplication exhibiting slow response, detectthisvariation, andexcludedthisfalse-positiveresult. facial anomalies, hypoimmunity and pulmonary hyperten- Although all patients in group 3 exhibited no deletion sion. Although, patient 67 exhibited no such phenotypes or duplication of 22q11.2, the aCGH and qPCR results at the current stage, we should pay attention in future showed that four patients (40.0%) exhibited other CNVs

  • follow-up.
  • in these patients (table 1).

We firstly showed that patient 70 has a deletion in
4q23 (figure 2a in electronic supplementary material), and only C4orf37 (also named STPG2) located in this region (table 1). Although no STPG2 variation related to human disease has been reported, previous findings showed that SRCAP mutation contributed to FloatingHarbour syndrome and would lead to STPG2 hypermethylate (Hood et al. 2016). Previous records also showed that STPG2 expressed in the cardiovascular system, brain and haemolymphoid system, which implied that STPG2

Recommended publications
  • DNA Topoisomerases and Cancer Topoisomerases and TOP Genes in Humans Humans Vs

    DNA Topoisomerases and Cancer Topoisomerases and TOP Genes in Humans Humans Vs

    DNA Topoisomerases Review DNA Topoisomerases And Cancer Topoisomerases and TOP Genes in Humans Humans vs. Escherichia Coli Topoisomerase differences Comparisons Topoisomerase and genomes Top 1 Top1 and Top2 differences Relaxation of DNA Top1 DNA supercoiling DNA supercoiling In the context of chromatin, where the rotation of DNA is constrained, DNA supercoiling (over- and under-twisting and writhe) is readily generated. TOP1 and TOP1mt remove supercoiling by DNA untwisting, acting as “swivelases”, whereas TOP2a and TOP2b remove writhe, acting as “writhases” at DNA crossovers (see TOP2 section). Here are some basic facts concerning DNA supercoiling that are relevant to topoisomerase activity: • Positive supercoiling (Sc+) tightens the DNA helix whereas negative supercoiling (Sc-) facilitates the opening of the duplex and the generation of single-stranded segments. • Nucleosome formation and disassembly absorbs and releases Sc-, respectively. • Polymerases generate Sc+ ahead and Sc- behind their tracks. • Excess of Sc+ arrests DNA tracking enzymes (helicases and polymerases), suppresses transcription elongation and initiation, and destabilizes nucleosomes. • Sc- facilitates DNA melting during the initiation of replication and transcription, D-loop formation and homologous recombination and nucleosome formation. • Excess of Sc- favors the formation of alternative DNA structures (R-loops, guanine quadruplexes, right-handed DNA (Z-DNA), plectonemic structures), which then absorb Sc- upon their formation and attract regulatory proteins. The
  • Derived from Chromosome 22, a Case Report

    Derived from Chromosome 22, a Case Report

    1802 Case Report Hypogonadotropic hypogonadism associated with another small supernumerary marker chromosome (sSMC) derived from chromosome 22, a case report Abdullah1#, Cui Li2#, Minggang Zhao2, Xiang Wang2, Xu Li2, Junping Xing1 1Department of Urology, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, China; 2Centre for Translational Medicine, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, China #These authors contributed equally to this work. Correspondence to: Junping Xing. Department of Urology, School of Medicine, The First Affiliated Hospital, Xi’an Jiaotong University, Xi’an 710061, China. Email: [email protected]. Abstract: The idiopathic hypogonadotropic hypogonadism (IHH) is portrayed as missing or fragmented pubescence, cryptorchidism, small penis, and infertility. Clinically it is characterized by the low level of sex steroids and gonadotropins, normal radiographic findings of the hypothalamic-pituitary areas, and normal baseline and reserve testing of the rest of the hypothalamic-pituitary axes. Delay puberty and infertility result from an abnormal pattern of episodic GnRH secretion. Mutation in a wide range of genes can clarify ~40% of the reasons for IHH, with the majority remaining hereditarily uncharacterized. New and innovative molecular tools enhance our understanding of the molecular controls underlying pubertal development. In this report, we aim to present a 26-year-old male of IHH associated with a small supernumerary marker chromosome (sSMC) that originated from chromosome 22. The G-banding analysis revealed a karyotype of 47,XY,+mar. High-throughput DNA sequencing identified an 8.54 Mb duplication of 22q11.1-q11.23 encompassing all the region of 22q11 duplication syndrome. Pedigree analysis showed that his mother has carried a balanced reciprocal translocation between Chromosomes 22 and X[t(X;22)].
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice

    Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice

    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
  • Screening of Copy Number Variants in the 22Q11.2 Region of Congenital

    Screening of Copy Number Variants in the 22Q11.2 Region of Congenital

    Pires et al. BMC Genetics 2014, 15:115 http://www.biomedcentral.com/1471-2156/15/115 RESEARCH ARTICLE Open Access Screening of copy number variants in the 22q11.2 region of congenital heart disease patients from the São Miguel Island, Azores, revealed the second patient with a triplication Renato Pires1,2, Luís M Pires3†, Sara O Vaz4†, Paula Maciel4, Rui Anjos5, Raquel Moniz1, Claudia C Branco1,2,6, Rita Cabral1, Isabel M Carreira3 and Luisa Mota-Vieira1,2,6* Abstract Background: The rearrangements in the 22q11.2 chromosomal region, responsible for the 22q11.2 deletion and microduplication syndromes, are frequently associated with congenital heart disease (CHD). The present work aimed to identify the genetic basis of CHD in 87 patients from the São Miguel Island, Azores, through the detection of copy number variants (CNVs) in the 22q11.2 region. These structural variants were searched using multiplex ligation-dependent probe amplification (MLPA). In patients with CNVs, we additionally performed fluorescent in situ hybridization (FISH) for the assessment of the exact number of 22q11.2 copies among each chromosome, and array comparative genomic hybridization (array-CGH) for the determination of the exact length of CNVs. Results: We found that four patients (4.6%; A to D) carried CNVs. Patients A and D, both affected with a ventricular septal defect, carried a de novo 2.5 Mb deletion of the 22q11.2 region, which was probably originated by inter-chromosomal (inter-chromatid) non-allelic homologous recombination (NAHR) events in the regions containing low-copy repeats (LCRs). Patient C, with an atrial septal defect, carried a de novo 2.5 Mb duplication of 22q11.2 region, which could have been probably generated during gametogenesis by NAHR or by unequal crossing-over; additionally, this patient presented a benign 288 Kb duplication, which included the TOP3B gene inherited from her healthy mother.
  • Arginine Methylation Facilitates the Recruitment of TOP3B to Chromatin to Prevent R Loop Accumulation

    Arginine Methylation Facilitates the Recruitment of TOP3B to Chromatin to Prevent R Loop Accumulation

    Molecular Cell Article Arginine Methylation Facilitates the Recruitment of TOP3B to Chromatin to Prevent R Loop Accumulation Yanzhong Yang,1 Kevin M. McBride,1 Sean Hensley,1 Yue Lu,1 Frederic Chedin,2 and Mark T. Bedford1,* 1The University of Texas MD Anderson Cancer Center, P.O. Box 389, Smithville, TX 78957, USA 2Department of Molecular & Cellular Biology, The University of California at Davis, Davis, CA 95616, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.molcel.2014.01.011 SUMMARY nine methyltransferase 1), which deposit the H4R3me2a and H3R17me2a marks, respectively (Yang and Bedford, 2013). Tudor domain-containing protein 3 (TDRD3) is a Both of these marks are recognized by the Tudor domain of major methylarginine effector molecule that reads TDRD3 (Yang et al., 2010), a protein that is enriched at the pro- methyl-histone marks and facilitates gene transcrip- moters of highly transcribed genes and can likely also associate tion. However, the underlying mechanism by which with the C-terminal domain (CTD) of RNA Polymerase II (RNAP II) TDRD3 functions as a transcriptional coactivator is (Sims et al., 2011). TDRD3 has no enzymatic activity of its unknown. We identified topoisomerase IIIB (TOP3B) own, but here we show that it is tightly complexed with DNA topoisomerase IIIb (TOP3B), an interaction that bestows, in as a component of the TDRD3 complex. TDRD3 part, coactivator activity on TDRD3. TOP3B is a member of serves as a molecular bridge between TOP3B and the 1A subfamily of DNA topoisomerases and, as such, targets arginine-methylated histones. The TDRD3-TOP3B underwound or negatively supercoiled DNA (Wang, 2002).
  • Human TOP3B ELISA Matched Antibody Pair

    Human TOP3B ELISA Matched Antibody Pair

    Version 01-06/20 User's Manual Human TOP3B ELISA Matched Antibody Pair ABPR-0990 This product is for research use only and is not intended for diagnostic use. For illustrative purposes only. To perform the assay the instructions for use provided with the kit have to be used. Creative Diagnostics Address: 45-1 Ramsey Road, Shirley, NY 11967, USA Tel: 1-631-624-4882 (USA) 44-161-818-6441 (Europe) Fax: 1-631-938-8221 Email: [email protected] Web: www.creative-diagnostics.com Cat: ABPR-0990 Human TOP3B ELISA Matched Antibody Pair Version 20-06/20 PRODUCT INFORMATION Intended Use This antibody pair set comes with matched antibody pair to detect and quantify protein level of human TOP3B. General Description This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Low expression of this gene may be related to higher survival rates in breast cancer patients. This gene has a pseudogene on chromosome 22. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. Reagents And Materials Provided Antibody pair set content: 1. Capture antibody: mouse monoclonal anti-TOP3B (100 μg) 2.
  • Supplementary Materials

    Supplementary Materials

    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
  • RECQ5-Dependent Sumoylation of DNA Topoisomerase I Prevents Transcription-Associated Genome Instability

    RECQ5-Dependent Sumoylation of DNA Topoisomerase I Prevents Transcription-Associated Genome Instability

    ARTICLE Received 20 Aug 2014 | Accepted 23 Feb 2015 | Published 8 Apr 2015 DOI: 10.1038/ncomms7720 RECQ5-dependent SUMOylation of DNA topoisomerase I prevents transcription-associated genome instability Min Li1, Subhash Pokharel1,*, Jiin-Tarng Wang1,*, Xiaohua Xu1,* & Yilun Liu1 DNA topoisomerase I (TOP1) has an important role in maintaining DNA topology by relaxing supercoiled DNA. Here we show that the K391 and K436 residues of TOP1 are SUMOylated by the PIAS1–SRSF1 E3 ligase complex in the chromatin fraction containing active RNA polymerase II (RNAPIIo). This modification is necessary for the binding of TOP1 to RNAPIIo and for the recruitment of RNA splicing factors to the actively transcribed chromatin, thereby reducing the formation of R-loops that lead to genome instability. RECQ5 helicase promotes TOP1 SUMOylation by facilitating the interaction between PIAS1, SRSF1 and TOP1. Unexpectedly, the topoisomerase activity is compromised by K391/K436 SUMOylation, and this provides the first in vivo evidence that TOP1 activity is negatively regulated at transcriptionally active chromatin to prevent TOP1-induced DNA damage. Therefore, our data provide mechanistic insight into how TOP1 SUMOylation contributes to genome maintenance during transcription. 1 Department of Radiation Biology, Beckman Research Institute, City of Hope, Duarte, California 91010-3000, USA. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to Y.L. (email: [email protected]). NATURE COMMUNICATIONS | 6:6720 | DOI: 10.1038/ncomms7720 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms7720 he prevention and efficient repair of DNA double-stranded transcriptionally active chromatin to prevent R-loops.
  • Gene Ontology Functional Annotations and Pleiotropy

    Gene Ontology Functional Annotations and Pleiotropy

    Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
  • FARE2021WINNERS Sorted by Institute

    FARE2021WINNERS Sorted by Institute

    FARE2021WINNERS Sorted By Institute Swati Shah Postdoctoral Fellow CC Radiology/Imaging/PET and Neuroimaging Characterization of CNS involvement in Ebola-Infected Macaques using Magnetic Resonance Imaging, 18F-FDG PET and Immunohistology The Ebola (EBOV) virus outbreak in Western Africa resulted in residual neurologic abnormalities in survivors. Many case studies detected EBOV in the CSF, suggesting that the neurologic sequelae in survivors is related to viral presence. In the periphery, EBOV infects endothelial cells and triggers a “cytokine stormâ€. However, it is unclear whether a similar process occurs in the brain, with secondary neuroinflammation, neuronal loss and blood-brain barrier (BBB) compromise, eventually leading to lasting neurological damage. We have used in vivo imaging and post-necropsy immunostaining to elucidate the CNS pathophysiology in Rhesus macaques infected with EBOV (Makona). Whole brain MRI with T1 relaxometry (pre- and post-contrast) and FDG-PET were performed to monitor the progression of disease in two cohorts of EBOV infected macaques from baseline to terminal endpoint (day 5-6). Post-necropsy, multiplex fluorescence immunohistochemical (MF-IHC) staining for various cellular markers in the thalamus and brainstem was performed. Serial blood and CSF samples were collected to assess disease progression. The linear mixed effect model was used for statistical analysis. Post-infection, we first detected EBOV in the serum (day 3) and CSF (day 4) with dramatic increases until euthanasia. The standard uptake values of FDG-PET relative to whole brain uptake (SUVr) in the midbrain, pons, and thalamus increased significantly over time (p&lt;0.01) and positively correlated with blood viremia (p≤0.01).
  • Top3b (NM 011624) Mouse Tagged ORF Clone Product Data

    Top3b (NM 011624) Mouse Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210989L3 Top3b (NM_011624) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Top3b (NM_011624) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Top3b Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(MR210989). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_011624 ORF Size: 2589 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Top3b (NM_011624) Mouse Tagged ORF Clone – MR210989L3 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_011624.2 RefSeq Size: 2987 bp RefSeq ORF: 2589 bp Locus ID: 21976 UniProt ID: Q9Z321, Q3UJF5 Gene Summary: Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex.
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name topoisomerase (DNA) III beta Gene Symbol TOP3B Organism Human Gene Summary This gene encodes a DNA topoisomerase an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination cellular aging and maintenance of genome stability. Alternative splicing of the C-terminus of this gene results in three transcript variants which have distinct tissue specificity; however not all variants have been fully described. Gene Aliases FLJ39376 RefSeq Accession No. NC_000022.10, NT_011520.12 UniGene ID Hs.436401 Ensembl Gene ID ENSG00000100038 Entrez Gene ID 8940 Assay Information Unique Assay ID qHsaCEP0057675 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000357179, ENST00000398793, ENST00000424393, ENST00000437929, ENST00000430142, ENST00000413067 Amplicon Context Sequence TGCAGGAACTTCACCATGTTCAGCTTGGGGTTAGCTTCTTTCTTCTCCGTGGGAG CTTGGCTGAACAGTTCTGCGGGGTCCACTTTGTCCCATTTGTTGTATTTTCCCAG GAAATCCAGGGTCAT Amplicon Length (bp) 95 Chromosome Location 22:22326985-22328747 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 96 R2 0.9994 cDNA Cq 21.67 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm