The Mechanism of Mammalian Pexophagy

Graeme Sargent

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Biochemistry Department University of Toronto

Graeme Sargent

Doctor of Philosophy

Biochemistry Department University of Toronto

2016

Abstract

The mechanism of mammalian pexophagy is poorly understood. Although ubiquitination is thought to be involved in the process, the upstream and downstream effectors of ubiquitination remain elusive. Specifically, the E3 ligase responsible for mediating ubiquitination is not known, the site(s) of ubiquitination on the peroxisomal membrane are not known, and the key autophagy receptor which binds ubiquitin at the surface of the peroxisome is not known.

In the first chapter of this thesis, I introduce the peroxisome and the key players in general autophagy, as well as in the selective autophagy of the peroxisome. In the second chapter, I explain the reagents and techniques used in this thesis. In the third chapter, I identify and characterize the peroxisomal E3 ubiquitin ligase PEX2 as the causative agent for mammalian pexophagy, identify two peroxisomal membrane proteins which are ubiquitinated by PEX2, and identify NBR1 as the primary receptor in PEX2-mediated pexophagy. In the fourth chapter, I examine the regulation of PEX2 and demonstrate how a key metabolic stimulus, protein restriction, initiates signaling through the mTORC1 pathway which leads to pexophagy in cultured cells as well as in a mouse model. Finally, I conclude my thesis with a discussion on my findings and some general thoughts on the current state of the field. III

Acknowledgments

There are more people who contributed to this work than there are pages in this thesis. It would be impossible to acknowledge each of these people here. Instead, I will use this space to focus on five groups of people who were essential to the completion of this thesis. For everyone else, I know who you are and greatly appreciate everything you did.

To the Kim lab: thanks for everything both inside and outside the lab. At various time throughout the Ph.D. you guys have been my hands, my brain, and my sanity.

To my family 3374km away: completing a Ph.D. in biochemistry isn’t only about cells, proteins and peroxisomes. It’s also about resourcefulness, determination, and drive. More than anyone else it’s been you guys who have kept me going when things weren’t working.

To my committee members Alex Palazzo, Allen Volchuk, and Greg Fairn: I never understood why so many graduate students dread their committee meetings. Perhaps I was lucky, but I found myself looking forward to each one for a new rush of ideas to try out in the lab.

To my supervisor Peter: I have learned so much from you. You have the amazing ability to be both critical and supportive; and both demanding and understanding as the situation requires. It feels very strange to see my name as author without your name beside it – this is as much your thesis as it is mine.

And finally to my fiancée Yuqing: thank you for your unwavering support in everything I do. We did this together. IV

Table of Contents

Contents

Acknowledgments...... 3

Table of Contents ...... 4

List of Figures ...... 9

List of Abbreviations ...... 11

Chapter 1 ...... 1

1 Introduction ...... 1

1.1 Peroxisomes ...... 1

1.1.1 Overview ...... 1

1.1.2 Catabolism of Lipids ...... 2

1.1.3 Synthesis of Bile Acids and Plasmalogens ...... 2

1.1.4 Peroxisomes in Redox Homeostasis ...... 3

1.1.5 The Peroxisome Import Cycle ...... 4

1.1.6 Regulation of Peroxisome Numbers ...... 7

1.2 Autophagy ...... 8

1.2.1 Overview ...... 8

1.2.2 TOR Regulation of Autophagy ...... 10

1.2.3 The Autophagy Machinery ...... 11

1.2.4 Selective Autophagy ...... 14

1.2.5 Autophagy in Disease ...... 18

1.3 Autophagy Receptor Proteins ...... 18

1.3.1 Overview ...... 18

1.3.2 p62...... 19 V

1.3.3 NBR1 ...... 20

1.3.4 Other Autophagy Receptors ...... 22

1.4 Pexophagy ...... 23

1.4.1 Overview ...... 23

1.4.2 Pexophagy in Yeasts ...... 23

1.4.3 Pexophagy in Mammals ...... 26

1.4.4 Ubiquitination in Pexophagy ...... 31

1.5 The Peroxisomal E3 Ubiquitin Ligases ...... 32

1.5.1 Overview ...... 32

1.5.2 Peroxisomal E3 Ubiquitin Ligases in Import ...... 33

1.5.3 Peroxisomal E3 Ubiquitin Ligases in Pexophagy ...... 34

1.5.4 Differences between the Peroxisomal E3 Ubiquitin Ligases ...... 34

1.5.5 Rationale for Studying the Peroxisomal E3 Ubiquitin Ligases ...... 36

Chapter 2 ...... 37

2 Materials and Methods ...... 37

2.1 Reagents ...... 37

2.1.1 Plasmids ...... 37

2.1.2 siRNAs ...... 37

2.1.3 Antibodies ...... 38

2.2 Cultured Cells ...... 38

2.2.1 Cell Lines ...... 38

2.2.2 Growth Media ...... 39

2.3 Transfections ...... 39

2.3.1 siRNA ...... 39

2.3.2 Plasmids ...... 39

2.4 Microscopy and Quantification of Microscope Images ...... 40 VI

2.4.1 Imaging ...... 40

2.4.2 Peroxisome Density ...... 40

2.4.3 Total PMP70 Fluorscence ...... 40

2.4.4 Mander’s Coefficient ...... 41

2.5 Immunoblotting...... 41

2.6 Immunofluorescence ...... 42

2.7 Immunoprecipitation ...... 42

2.8 Quantitative PCR ...... 42

2.9 Peroxisome Purification ...... 43

2.10 Rat Liver Heptatocyte Extraction ...... 43

2.11 Animal Work ...... 43

Chapter 3 ...... 45

3 PEX2 is Necessary and Sufficient for Peroxisomal Degradation via Autophagy ...... 45

3.1 Introduction ...... 45

3.2 Results ...... 45

3.2.1 Expression of PEX2 causes Loss of Peroxisomes ...... 45

3.2.2 PEX2-mediated Peroxisome Loss requires the PEX2 Active Site ...... 46

3.2.3 PEX2-mediated Peroxisome Loss requires the Autophagic Machinery ...... 50

3.2.4 Autophagic Machinery Colocalizes with Peroxisomes during PEX2 Expression ...... 51

3.2.5 Peroxisomes are Degraded during Amino Acid Starvation of Cultured Cells ...... 52

3.2.6 PEX2 is Required for Amino Acid Starvation Induced Pexophagy ...... 54

3.2.7 NBR1 is Recruited to Peroxisomes during Amino Acid Starvation ...... 57

3.2.8 NBR1 is Required for PEX2-mediated Pexophagy ...... 58

3.2.9 PEX2 Expression induces Ubiquitination of the Peroxisome Surface ...... 60

3.2.10 PEX2 Expression induces Ubiquitination of PEX5 and PMP70 ...... 61 VII

3.3 Discussion ...... 63

3.3.1 PEX2 is Necessary and Sufficient for Mammalian Pexophagy...... 63

3.3.2 PEX5 and PMP70 Ubiquitinated by PEX2 during Pexophagy ...... 65

3.3.3 NBR1 is the key Autophagy Receptor in Pexophagy ...... 65

3.3.4 Impact of Work ...... 66

Chapter 4 ...... 67

4 PEX2 is Regulated by the mTORC1 Signaling Pathway during Amino Acid Starvation ...... 67

4.1 Introduction ...... 67

4.2 Results ...... 67

4.2.1 Peroxisome Loss occurs in the Mouse Liver during Protein Starvation ...... 67

4.2.2 PEX2 Protein Levels Increase during Protein Starvation in the Mouse Liver ...... 69

4.2.3 PEX2 Protein Levels Increase during Amino Acid Starvation in Cultured HeLa Cells ...... 70

4.2.4 PEX2 Protein Levels Increase during Amino Acid Starvation in Primary Liver Hepatocytes ...... 71

4.2.5 PEX2 is Stabilized during mTORC1 Inhibition ...... 71

4.2.6 PEX2 Regulation Kinetics are Similar to LC3 Conversion ...... 72

4.2.7 Peroxisomes are Degraded during mTORC1 Inhibition ...... 73

4.2.8 PEX2 mRNA is Unaffected by Amino Acid Starvation or mTORC1 Inhibition ..74

4.2.9 PEX2 Protein Levels are Stabilized by Proteasomal Inhibition or Depletion of PEX1/6/26 ...... 75

4.2.10 Development of an Inducible PEX2 Expressing Cell Line ...... 78

4.2.11 Exogenously Expressed PEX2 is Stabilized during Amino Acid Starvation or mTORC1 Inhibition ...... 78

4.3 Discussion ...... 80

4.3.1 Amino Acid Starvation and mTORC1 Inhibition Cause an Increase in PEX2 Protein Levels ...... 80 VIII

4.3.2 Peroxisome Loss occurs in a Mouse Model for Protein Starvation and is Concomitant with an Increase in PEX2 Protein ...... 82

4.3.3 The PEX2 Protein is Unstable ...... 83

4.3.4 Impact of Work ...... 83

Chapter 5 ...... 85

5 Discussion ...... 85

5.1 Overview ...... 85

5.2 Future Directions ...... 85

5.2.1 The Role of PEX2, PEX10, and PEX12 at the Mammalian Peroxisome ...... 85

5.2.2 p62 – Jack of All Trades, Master of One? ...... 87

5.2.3 How is a Signal Transduced from mTORC1 to PEX2? ...... 89

5.2.4 Why do Cells Degrade their Peroxisomes during Amino Acid Starvation? ...... 90

5.2.5 How do Cells Target Individual Peroxisomes for Degradation? ...... 91

5.3 Conclusions ...... 93

References ...... 94

List of Figures

Chapter 1. Introduction Figure 1.1. The Peroxisome Import Cycle Figure 1.2. The Matrix Protein Import Cycle Figure 1.3. The Three Types of Autophagy Figure 1.4. The Formation of the Phagophore Figure 1.5. Phagophore Extension into an Autophagosome Figure 1.6. The Mechanism of Macroautophagy Figure 1.7. Schematic Representation of Ubiquitin-Binding Autophagy Receptors Figure 1.8. The Yeast Pexophagic Receptor Protein Complex Figure 1.9. The Mammalian Pexophagic Receptor Protein Complex Figure 1.10. Differences in PEX2/10/12 Activity

Chapter 3. PEX2 is Necessary and Sufficient for Peroxisome Degradation via Autophagy Figure 3.1. Overexpression of the E3 Ubiquitin Ligase PEX2 causes Peroxisome Loss Figure 3.2. PEX2 Expressing Cells Retain Similar Morphology to Wildtype Cells Figure 3.3. PEX2-mediated Peroxisome Loss requires the RING-finger E3 Ubiquitin Ligase Domain Figure 3.4. PEX2-mediated Peroxisome Loss is an Autophagic Process Figure 3.5. PEX2-mediated Autophagy Recruits NBR1, LC3, and Lamp1 Figure 3.6. Peroxisomes are Selectively Degraded during Amino Acid Starvation Figure 3.7. PEX2 is Required for Amino Acid Starvation Induced Pexophagy Figure 3.8. PEX2 Expression Complements PEX2 Knockdown Figure 3.9. NBR1 is Recruited to Peroxisomes during Amino Acid Starvation Figure 3.10. PEX2-mediated Pexophagy requires the NBR1 Autophagy Receptor Figure 3.11. PEX5 and PMP70 are Ubiquitinated by PEX2 Figure 3.12. PEX2 Expression Induces Ubiquitination of the Peroxisome Surface

Chapter 4. PEX2 is Regulated by the mTORC1 Signaling Pathway during Amino Acid Starvation Figure 4.1. Peroxisomes are Degraded in a Protein Restricted Mouse Model Figure 4.2. PEX2 Protein Levels Increase in a Protein Restricted Mouse Model Figure 4.3. PEX2 Protein Levels Increase during Amino Acid Starvation in HeLa Cells Figure 4.4. PEX2 Protein Levels Increase during Amino Acid Starvation in Primary Rat Hepatocytes Figure 4.5. PEX2 Protein Levels Increase during mTORC1 Inhibition Figure 4.6. LC3 Conversion and PEX2 Regulation occur on a Similar Timescale Figure 4.7. Rapamycin Treatment Results in Peroxisome Loss Figure 4.8. PEX2 mRNA Expression is Unaffected by Amino Acid Starvation or mTORC1 Inhibition X

Figure 4.9. PEX2 is Stabilized by Proteasomal Inhibition or Depletion of the Peroxisomal AAA- ATPase Complex Figure 4.10. Characterization of the Inducible PEX2-FLAG HeLa Cell Line Figure 4.11. PEX2 is Stabilized during Amino Acid Starvation or mTORC1 Inhibition Figure 4.12. Proposed Model for PEX2 and mTORC1 in Mammalian Pexophagy XI

List of Abbreviations

11-BS – Atg11 binding site

AAA – ATPases associated with diverse cellular activities

AIM – Atg8 interacting motif

ATG – autophagy-related

ATP – adenosine truphosphate

CC – coiled coil

CCCP – carbonyl cyanide m-chlorophenyl hydrazone cDNA – complementary DNA

CFP – cyan fluorescent protein

CoA – coenzyme A

DMEM – Dulbecco’s Modified Eagle’s Medium

E1 – ubiquitin activating enzyme

E2 – ubiquitin conjugating enzyme

E3 – ubiquitin ligase

FBS – fetal bovine serum

GFP – green fluorescent protein

HRP – horseradish peroxidase

HBSS – Hank’s Balanced Salt Solution

HEK – human embryonic kidney XII

HeLa – Henrietta Lachs pancreatic cell line

LIR – LC3 interacting region

MEF – mouse embryonic fibroblast mTOR – mammalian target of rapamycin mTORC1 – mTOR complex 1

NEM – n-ethyl maleamide

NES – nuclear export signal

NLS – nuclear localization signal

PB – Phox and Bem1p domain

PEX – peroxin

PMP – peroxisomal membrane protein

PPAR – peroxisome proliferator-activated receptor

PVDF – polyvinylidene fluoride qPCR – quantitative PCR

RIPA – radioimmunoprecipitation assay

ROS – reactive oxygen species

SDS – sodium dodecyl sulfate siCntl – non-targeting siRNA siRNA – short interfering RNA

Ub – ubiquitin 1

Chapter 1 1 Introduction 1.1 Peroxisomes

1.1.1 Overview

Peroxisomes are essential organelles, which are well conserved in nearly all eukaryotic organisms. They have a wide variety of functions including the catabolism of lipids, the synthesis of specialized lipids such as bile acids and plasmalogens, and the detoxification of reactive oxygen species (ROS). In order to accomplish these functions, peroxisomes must import a number of enzymes from the cytosol where they are synthesized by free ribosomes (Goldman and Blobel, 1978). This is mediated by the PEX5 import cycle, a system that uniquely allows the peroxisome to import proteins without unfolding them (Dodt and Gould, 1996).

Peroxisomes were first identified and described as organelles by Rhodin (1954), and the name peroxisome came into usage following a landmark publication by de Duve and Baudhin (1966). Within three years of de Duve’s work, peroxisomes were already being described as ‘dynamic’ (Poole et al., 1969). The eukaryotic cell manipulates its peroxisomal activity by regulating peroxisome numbers (Zwart et al., 1979) as well as by regulating the synthesis of peroxisomal proteins (Furuta and Miyazawa, 1982). Cells will both increase their peroxisome numbers via biogenesis (Issemann and Green, 1990) and decrease their peroxisome numbers via autophagy (Hutchins et al., 1999) in response to their environment.

There are many differences between peroxisomes in yeasts and in mammals. In particular, the mechanisms of peroxisome biogenesis and degradation differ significantly between the two systems (Agrawal and Subramani, 2016; Katarzyna and Suresh, 2016). The experiments described in the body of this thesis have only further our knowledge of these differences. Unless otherwise stated, all the information in this thesis refers to the mammalian system.

1.1.2 Catabolism of Lipids

In the mammalian cell, most of the beta-oxidation in the cell takes place in the mitochondria (Jones, John and Blecher, 1965). However, mitochondria are unable to process very-long chain fatty acids (fatty acids with more than 22 carbon atoms) (Foerster et al., 1981; Alexson, 1984). For these substrates, the initial oxidation steps take place in the peroxisome. Likewise, the alpha-oxidation of branched chain fatty acids such as phytanic acid (Stokke et al., 1967), and the degradation of some prostaglandins (Granstrom et al., 1968), and some leukotrienes (Jedlitschky et al. 1993) are mediated by peroxisomal enzymes. Importantly, the peroxisome does not couple β-oxidation with ATP synthesis, and only oxidizes these substrates until octanoyl-CoA is formed (Lazarow, 1978). From this point, the mitochondria will complete the oxidation of these medium chain species, ensuring that the cell is able to generate at least some energy from these unconventional substrates.

In individuals lacking key peroxisomal enzymes, accumulation of these species can cause disease. In particular, Refsum’s disease is caused by the accumulation of phytanic acid leading to neurological damage (Alexander, 1966), and neonatal and X-linked adrenoleukodystrophy are caused by the accumulation of very-long chain fatty acids causing adrenal insufficiency (Jaffe et al., 1982). It is clear that lipid catabolism is more than simply a way for cells to generate energy and peroxisomes play a key role in this process.

1.1.3 Synthesis of Bile Acids and Plasmalogens

Peroxisomes are essential to synthesize important biomolecules such as bile acids. Bile acids are the predominant mechanism to excrete excess cholesterol, and also play an important role in the solubilization of dietary cholesterol, lipids, and other vitamins and nutrients (Dobrowsky and Ballas, 1987). In individuals lacking peroxisomes, such as Zellweger syndrome patients, cytotoxic bile acid intermediates accumulate and cause liver damage (Ferdinandusse et al., 2009). Additionally, bile acid deficiency can disrupt normal vitamin absorption, compounding the problem (Olson, 1964).

In addition to bile acids, peroxisomes are also essential in the synthesis of plasmalogens. Plasmalogens are ether phospholipids required for the proper function of some integral 3 membrane proteins. Plasmalogens are particularly important in the proper function of the nervous system, immune system and cardiovascular system (Luoma et al., 2015). In individuals who lack the ability to the synthesize plasmalogens, cell membranes are altered (Hermetter et al., 1989), cholesterol trafficking is impaired (Mandel et al., 1998), fatty alcohols accumulate (Rizzo et al., 1993), and cells are more sensitive to reactive oxygen species (Zoeller et al., 2002). Similar to lipid catabolism, lipid anabolism in the peroxisomes is essential for healthy life in complex organisms.

1.1.4 Peroxisomes in Redox Homeostasis

Maintaining control of the cellular redox environment, especially the concentrations of various ROS, is important given that low level ROS is associated with signaling while high level ROS is associated with cellular damage. Peroxisomes contain many enzymes which can produce - ROS species as byproducts such as superoxide radicals (O2• ), hydroxyl radicals (•OH), and hydrogen peroxide (H2O2) (Halliwell and Gutteridge, 1997). Importantly, these species are membrane-permeable and can cause irreversible damage to the cell such as protein carbonylation (Andrus et al., 1998) or DNA strand breaks (Fahl et al., 1984). However, peroxisomes also contain enzymes which can convert these potentially dangerous species into less harmful species (Hoffmann et al., 1970). Peroxisomes therefore play a key role in maintaining cellular redox homeostasis.

Superoxide is produced in the peroxisome as a byproduct in the catabolism of nucleic acids by xanthine oxidoreductase (XOD/XDH) (Chan, Phillip and Bielski, 1974) and also during ureide metabolism by uricase (Sandalio et al., 2013). In order to control the levels of superoxide, the peroxisome houses SOD1 (Islinger et al., 2009) which effectively converts superoxide into hydrogen peroxide by initially transferring the singlet electron to a coordinated metal (copper, zinc or manganese), and then reducing the oxygen into H2O2 (Haan et al., 1992).

Hydroxyl radicals are thought to be produced by ascorbate in the peroxisomal matrix through Fenton-type reactions, although this has only been speculated at this time (Upham and Jahnke, 1986). These species are known to be present in the peroxisome as they have has been detected by electron spin spectroscopy (Sandalio et al., 1988). 4

Hydrogen peroxide is produced from several sources in the peroxisome: as a byproduct of β-oxidation by acyl CoA oxidase (Rojas et al., 1985), in the catabolism of polyamines by di- - and poly-amine oxidases (Krasna, 1965), and from the reduction of O2• into H2O2 by SOD1 (Haan et al., 1992). In order to control hydrogen peroxide levels, catalase in the peroxisome rapidly reduces hydrogen peroxisome into water (Evans, 1907).

Superoxide, hydroxyl radicals, and hydrogen peroxide are all short-lived due to the strong reducing environment in the peroxisome and the presence of SOD1 and catalase. In addition to these methods of exerting redox homeostasis, the peroxisome also contains Lon proteases which selectively degrade oxidatively damaged proteins (Bartoszewska et al., 2012).

1.1.5 The Peroxisome Import Cycle

Peroxisomal proteins can be classified into three groups: the peroxisome biogenesis proteins or ‘early peroxins’ PEX3, PEX16, and PEX19, the peroxisome membrane proteins (PMPs), and the peroxisome matrix proteins. In the life cycle of a peroxisome from de novo biogenesis to maturity, the three groups of proteins are successively recruited in this order.

PEX3, PEX16, and PEX19 are the peroxisome biogenesis proteins – uniquely, the loss of any one of these proteins prevents the formation of peroxisome membranes. PEX16 is required for transport of proteins and lipids from the ER to the peroxisomes (Kim et al., 2006) and has been shown to recruit PEX3 to both the peroxisomes (Matsuzaki and Fujiki, 2008). PEX3 is the docking factor for PEX19 (Gotte et al., 1998); and PEX19 binds newly synthesized peroxisomal membrane proteins (PMPs) in the cytosol and transports them to the peroxisome surface (Snyder et al., 1999) where PEX19 and its cargo bind PEX3 (Fang et al., 2004). Together, these three proteins work in concert to establish pre-peroxisomes, and they are both necessary and sufficient to begin recruiting other PMPs to the pre-peroxisomes (Figure 1.1). 5

Figure 1.1 The Peroxisome Import Cycle The initial steps in the formation of the mammalian peroxisome are not entirely clear. PEX16 activity recruits PEX3 to a membrane and the newly localized PEX3 subsequently recruits PEX19. The formation of this membrane containing PEX16, PEX3, and PEX19 is referred to as a ‘pre-peroxisome’ or a ‘peroxisome membrane’. Next, PEX19 shuttles a variety of PEX and PMP membrane proteins to the pre-peroxisome through protein-protein interactions. The new structure, complete with a full complement of peroxins and PMPs is referred to as an ‘import competent peroxisome’. Finally, the activity of the peroxins brings matrix proteins into the peroxisome establishing a ‘mature peroxisome’.

PMPs can be broadly grouped into two types. The first type, peroxins (PEX proteins), are defined as proteins which are required for the formation of mature, import-competent peroxisomes. The second type, other PMPs, are proteins which are not required for the formation of mature peroxisomes such as PMP34, the transporter for several cofactors including coenzyme A, FAD and NAD+ (Wylin et al., 1998); and PMP70, an ATP-binding transporter for long-chain fatty acids and long-chain fatty acyl-CoA groups (Kamijo et al., 1990).

The peroxins work together to establish the matrix protein import cycle (Figure 1.2) which is based on the unique properties of PEX5. PEX5 is a shuttling receptor which can recognize and bind peroxisomal matrix proteins in the cytosol and transport them to the peroxisome (Dodt and Gould, 1996). At the peroxisome, PEX5 binds its docking factor PEX13/14 and matrix proteins are imported into the matrix of the peroxisome while PEX5 remains bound at the surface (Bottger et al., 2000). Next, the peroxisomal E3 ubiquitin ligases PEX2/10/12 ubiquitinate PEX5, which is the signal for PEX5 to be recycled back to the cytosol 6

(Miyata and Fujiki, 2005). PEX5 recycling is mediated by the peroxisomal AAA-ATPase complex PEX1/6/26, which work together to pull ubiquitinated PEX5 out of the membrane (Miyata and Fujiki, 2005). The AAA-ATPase complex is dynamic with PEX26 embedded in the membrane and PEX1 and PEX6 cycling between the cytosol and the peroxisome surface (Tamura et al., 2014). Once PEX5 is recycled back to the cytosol, it will be deubiquitinated by USP9X and can begin another round of import (Grou et al., 2012).

Figure 1.2. The Matrix Protein Import Cycle The matrix protein import cycle begins with free PEX5 in the cytosol. Here, PEX5 can interact with peroxisomal matrix proteins through a C-terminal SKL motif on the matrix protein. PEX5 then shuttles the matrix proteins to the surface of the peroxisome and the matrix proteins are imported. Next, PEX5 is ubiquitinated by PEX2/10/12 and removed from the membrane by PEX1/6/26. Once in the cytosol again, PEX5 is deubiquitinated by USP9X to prepare the cycling receptor for another round of import.

1.1.6 Regulation of Peroxisome Numbers

Peroxisome numbers are maintained by the competing forces of biogenesis and turnover. Biogenesis includes both de novo biogenesis, which was briefly covered in the previous section, and peroxisomal growth and division, where a mother peroxisome divides into two or more daughter peroxisomes. (Agrawal and Subramani, 2016). Turnover is mediated by the autophagic machinery and is thought to occur at a basal rate to maintain the quality of peroxisomes, and also to be upregulated in response to environmental cues. There is also evidence that peroxisomes are turned over via 15-LOX-dependent membrane autolysis (Yokota et al., 2001). These mechanisms are all discussed in the following paragraphs.

De novo biogenesis of peroxisomes is thought to be a minor contributor to peroxisome proliferation during steady state conditions. Mammalian cells are capable of de novo biogenesis, as cell lines deficient in the early peroxins (and therefore peroxisomes) can repopulate themselves with peroxisomes upon complementation with a functional peroxin (Gould and Valle, 2000). It is tempting to assume that the de novo PEX16 to PEX3 to PEX19 to PMPs pathway is kinetically inefficient compared to growth and division. Under the growth and division model, one might expect that PEX19 can directly recruit newly synthesized PMPs to newly divided peroxisomes, allowing the cell to bypass PEX16 altogether. In practice however, depletion of PEX16 has been shown to increase the incorporation rate of PMPs into peroxisomes (Aranovich et al., 2014), suggesting that PEX16 plays an important role during steady state conditions.

Growth and division of peroxisomes is mediated by PEX11β, dynamin-like protein 1 (DLP1), mitochondrial fission factor (Mff), and Fission 1 (Fis1) (Li and Gould, 2003). PEX11β accumulates in regions of the peroxisome membrane and the activity of PEX11β at these regions causes a perpendicular elongation from these regions. The tail anchored proteins Mff and Fis1 are then recruited to these regions and these proteins in turn recruit DLP1. All four proteins (PEX11β, Mff, Fis1 and DLP1) are thought to form a complex which can restrict the peroxisome membrane enough to cause spontaneous fission, asymmetrically dividing the peroxisome into two distinct membrane bound compartments (Li and Gould, 2003). From here, the daughter peroxisome can gradually grow through the recruitment of lipids and PMPs. Growth and division can be dramatically increased by expression of PEX11β (Marshall et al., 1995), exposure to the β-oxidation substrate docosahexaenioc acid (DHA) (Craemer et al., 1994), or treatment with 8 peroxisome proliferator-activating receptor (PPAR) agonists such as fibrates (Green, 1990). Curiously, while many peroxisomal proteins are upregulated by the PPAR pathway, PEX11β expression has been shown to be unaffected (Li et al., 2002).

Autophagy of peroxisomes, or pexophagy, is the mechanism by which peroxisomes are degraded inside of a double membrane structure called an autophagosome. This process is thought to occur selectively to degrade old or malfunctioning peroxisomes (Huybrechts et al., 2009), ensuring that peroxisome quality is maintained. Additionally, pexophagy can be upregulated in response to various stimuli such as amino acid starvation (Hara-Kuge and Fujiki, 2008). Pexophagy is covered in depth in section 1.4.

The evidence for 15-LOX-dependent autolysis of peroxisomes comes from Yokota et al. (2001). Following incubation with the lipoxygenase 15-LOX, peroxisome membranes were found to be disrupted and the peroxisomal matrix protein catalase was diffused around these membranes. Furthermore, immunogold staining showed that 15-LOX colocalized with peroxisomes and membrane disruption was reduced the presence of 15-LOX inhibitors (Yokota et al., 2001). However, no other research groups have investigated 15-LOX-dependent autoplysis of peroxisomes in the past 15 years.

1.2 Autophagy

1.2.1 Overview

Proteasomal degradation is the default mechanism for the cell to degrade proteins. For many other substrates, such as large protein complexes, ubiquitinated protein aggregates, superfluous organelles, and invading pathogens, the proteasome is unsuitable for degradation. Autophagy occurs via three different mechanisms (Yang and Klionsky, 2010a) (Figure 1.3). In microautophagy, the substrate directly invaginates the lysosome (Mortimore et al., 1983). The bulging membrane walls then fuse, enclosing the substrate inside an autophagic body inside the lysosomal lumen. The autophagic body is then released into the interior of the lysosome. Microautophagy is not thought to degrade peroxisomes in mammalian cells (Iwata et al. 2006) and will not be further discussed in this thesis. 9

In chaperone-mediated autophagy, Hsc70 and other chaperones recognize the KFERQ motif on substrate proteins and bind, forming a complex (Agarraberes and Dice, 2001). This complex is then recognized by LAMP-2A monomers on the lysosomal membrane. LAMP-2A then multimerizes, unfolding the substrate and pulling the substrate inside the lysosomal lumen. The substrate is subsequently degraded inside the lysosome, and LAMP-2A multimers disassemble to prepare for the next substrate. Likewise, as chaperone-mediated autophagy cannot degrade an entire peroxisome, it will not be discussed further.

In macroautophagy, a phagophore forms around substrate, enclosing the substrate and the surrounding cytosol inside of a double membrane structure called an autophagosome. An autophagy receptor forms a bridge connecting the substrate with the autophagosome membrane via lipidated LC3 (Tanida et al., 2004b). In Figure 1.3, the substrate is depicted as being ubiquitinated; however this is not essential for all autophagy receptors. The autophagosome and its contents will then fuse with a lysosome, leading to the formation of an autolysosome and mixing the contents of each organelle. Inside the autolysosome, the activity of the lysosomal hydrolases will degrade the substrate and recycle it back to the cell as nutrients.

In the mammalian system, macroautophagy is the most well studied form of autophagy (Feng et al., 2014), in terms of both its mechanism and its relationship to disease. There are many differences between the yeast and mammalian autophagy systems and this thesis will focus on the mammalian system. For simplicity, ‘macroautophagy’ will be referred to as simply ‘autophagy’ for the duration of this thesis. 10

Figure 1.3. The Three Types of Autophagy Autophagy refers to any process by which the lysosome uptakes cytosolic cargos, including macroautophagy, where a crescent-shaped phagopore surrounds and engulfs a portion of the cytosol; microautophagy, where the lysosome penetrates and sequesters a selected target; and chaperone mediated autophagy, where unfolded proteins are directly localized across the lysosome membrane.

1.2.2 TOR Regulation of Autophagy

Autophagy is regulated by the mammalian target of rapamycin (mTOR), a serine/threonine kinase that regulates cell growth, cell proliferation, cell motility, cell survival, protein synthesis, and transcription (Hay and Sonenberg, 2004). During growth conditions, the cell is able to gain nutrition from its external environment and the mTORC1 (mTOR complex 1) is active (Sancak et al., 2011). mTORC1 is activated by high concentrations of amino acids (Jewell et al., 2014), insulin (Menon et al., 2014), or growth factors (Inoki et al., 2002). 11

However, mTORC1 is inactivated by low amino acids, stress (Budanov and Karin, 2008), hypoxia (Brugarolas et al., 2004), or a high AMP/ATP ratio (Menon et al., 2014). Upstream mTORC1 regulation is complex and for the purposes of this thesis we are most interested in how mTORC1 responds to amino acid concentration.

During high amino acid conditions, amino acids are transported across the lysosomal membrane and back into the cytosol through v-ATPase at the lysosomal membrane (Zoncu et al., 2011). The amino acids leucine and arginine in particular are crucial to mTORC1 activation (Hara et al., 1998). The transport of these amino acids causes a conformational shift in v-ATPase (Zoncu et al., 2011) which derepresses a bound GEF, the Ragulator (also called LAMTOR2) (Bar-Peled et al., 2012). The derepressed Ragulator converts the functionally redundant RagA/RagB to an active GTP-bound state and the functionally redundant RagC/RagD to an active GDP-bound state (Bar-Peled et al., 2012). The active Rags can then recruit the mTOR kinase to the lysosomal surface (Jewell et al., 2014) to form the mTORC1 complex where the mTOR kinase is activated by GTP-bound RheB (Efeyan et al., 2013).

During low amino acid conditions, v-ATPase is bound to LAMTOR2, preventing its activity (Zoncu et al., 2011). Without an active GEF, RagA/RagB remain GDP-bound, RagC/RagD remain GTP-bound (Bar-Peled et al., 2012), and the mTOR kinase is not recruited to the mTORC1 complex (Jewell et al., 2014). Therefore, mTORC1 remains inactive.

Downstream to mTORC1 we are most interested in the signaling which leads to autophagy. Active mTORC1 phosphorylates the kinase ULK1, inactivating ULK1 and leading to repression of autophagy (Hosokawa et al., 2009). In contrast, when mTORC1 is inactive, ULK1 becomes dephosphorylated, and autophagy is derepressed (Young et al., 2006). The role of ULK1 in autophagy signaling is expanded upon in the following section.

1.2.3 The Autophagy Machinery

The autophagy mechanism initiates with the formation of an inclusion membrane (Tanida et al., 2004b). Three complexes (ATG14-Vps34-Beclin1, the ULK1 complex, and ATG9•ATG18 are required for the formation of this membrane (Ichimura et al., 2000) (Figure 1.4). First, in order to generate PI(3)P at the membrane, the class III PI3-K Vps34 12 phosphorylates PI. ATG14 and Beclin1 serve to tether the complex to the inclusion membrane. Silencing of ATG14 has been shown to prevent autophagosome formation (Itakura et al., 2008) and complementation of ATG14-depleted cells with a mutant version of ATG14 that cannot interact with Vps34 or Beclin-1 did not restore function (Obara and Ohsumi, 2011). Next, the activity of the dephosphorylated active ULK1 complex causes relocalization of mATG9 to the isolation membrane where it is conjugated to the PI(3)P-binding protein ATG18 (Young et al., 2006). The recruitment of mATG9 is essential for the formation of a phagophore.

Figure 1.4. The Formation of the Phagophore Inhibition of mTORC1 causes dephosphorylation and activation of the ULK1 complex. ULK1 activity can then relocalize mATG9 to ATG18. ATG18 is localized to the phagophore membrane through the activity of the ATG14-Vps34-Beclin1 complex. Vps34 phosphorylates PI at the phagophore and ATG18 binds the newly formed PI(3)P.

In the same way that mATG9 recruitment marks the transition from isolation membrane to phagophore, the conjugation of LC3 to the membrane (LC3 conversion) marks the transition from phagophore to autophagosome. In order to conjugate LC3, two ubiquitin-like conjugation systems (ATG12 and LC3/GABARAP proteins) are required (Figure 1.5). ATG12 possesses a ubiquitin-like fold that is activated by the binding of ATG7, an E1-like enzyme (Mizushima et al. 1998). ATG12 is then transferred to ATG10, an E2-like enzyme (Ichimura et al., 2000; 13

Mizushima et al., 1998). Finally, ATG12 is conjugated to ATG5, and ATG12•ATG5 forms a complex with ATG16L which is known as the ATG16 complex (Kuma et al. 2004). The ATG16 complex then targets to the site of isolation membrane formation. In the second ubiquitin-like conjugation system of autophagy, proLC3 is initially cleaved by ATG4 in the cytosol to form LC3-I (Kabeya et al., 2000, 2004). Similar to ATG12, LC3-I is activated by the same E1-like ATG7 and then transferred to an E2-like enzyme ATG3 (Tanida et al., 2002, 2003). At this time, the activity of the ATG16 complex at the surface of the isolation membrane causes LC3 to be conjugated to phosphatidylethanolamine (PE) (Sou et al., 2006; Tanida et al., 2004a). The conjugated, or lipidated, LC3 is now referred to as LC3-II (Kabeya et al., 2000). Through the activity of LC3-II, the phagophore grows into a double-membrane structure called an autophagosome (Mizushima et al., 2001).

While yeast only have one LC3 homolog (Atg8), mammalian cells have six functional LC3 homologs (Lang et al., 1998; Kirisako et al., 1999). LC3A, LC3B, and LC3C form the LC3 superfamily and GABARAP, GEC1, and GATE-16 form the GABARAP superfamily (Kabeya et al., 2004). The autophagy receptors p62 and NBR1 have similar binding affinity to all six LC3/GABARAP homologs (von Muhlinen et al., 2012); however, during starvation-induced (mTORC1-induced) autophagy, the LC3 superfamily are recruited to the autophagosome while the GABARAP superfamily are not (Weidberg et al., 2010). The subtle differences between these proteins remain understudied and I will simply refer to these families of proteins as LC3 for the duration of this thesis.

Figure 1.5. Phagophore Extension into an Autophagosome Two ubiquitin-like systems lead to phagophore extension. In the first, ATG12 is conjugated to ATG5 and subsequently bound to ATG16. The ATG16 complex can then act as the E3 in LC3 conversion. In the second, proLC3 is cleaved by ATG4 to generate LC3-I. LC3-I is then conjugated to PE at the phagophore membrane. The activity of LC3-II at the membrane leads to phagophore extension and the formation of an autophagosome.

1.2.4 Selective Autophagy

Autophagy was once considered to be a non-selective bulk degradation of the cytoplasm. However, more recent studies revealed that autophagy can also be a selective process which is able to discriminate and degrade specific cytoplasmic substrates (Pankiv et al., 2007). The autophagic degradation of specific substrates is known by various names based on the substrate being targeted. Mitophagy (mitochondria), ribophagy (ribosomes), ERphagy (endoplasmic reticulum), pexophagy (peroxisomes), xenophagy (invading organisms) and aggrephagy (protein aggregates) are all commonly used terms. Known collectively as selective autophagy, the selective degradation of these cytoplasmic components shares a common mechanism mediated by four distinct steps (Figure 1.6). The first step is the designation of the substrate for degradation, where a specific individual substrate is identified as a target for lysosomal destruction. The second step is the targeting and binding of the substrate by autophagy receptors to the designated target. In this recruitment step, ubiquitin frequently serves as an intermediate. The third step is the recruitment of the autophagy receptor bound substrate to the nascent autophagosome. The fourth and final step is degradation where lysosomal hydrolases degrade and recycle the substrate. 15

Figure 1.6. The Mechanism of Selective Macroautophagy The mechanism of macroautophagy begins with designation of the substrate. Next, the substrate is targeted by an autophagy receptor protein. Shown here, the substrate was designated by ubiquitination and targeted through a ubiquitin-binding motif, however some autophagy receptors such as Nix and FAM134b target their substrates directly via a transmembrane domain (Novak et al., 2010; Khaminets et al., 2015). Next, the receptor-bound substrate is recruited to the phagophore and bound to membrane-conjugated LC3-II. The phagophore then surrounds and engulfs the substrate, enclosing it inside of a double membrane structure called an autophagosome. Finally, the autophagosome fuses with a lysosome and the substrate is degraded and recycled.

1.2.3.1 Designation of Substrates

Designation involves the labeling or marking of a cytoplasmic substrate for degradation. Substrates are labeled in various ways; however, ubiquitination of the substrate is the most common strategy of designating a cytoplasmic material for autophagic degradation. Substrates 16 such as mitochondria (Narendra et al., 2008), ribosomes (Kraft et al., 2008) and peroxisomes (Kim et al., 2008) can be ubiquitinated prior to engulfment in the autophagosome. For these organelles, labeling occurs on membrane proteins at the cytosolic face of the organelle. Protein aggregates, both in the cytosol and in the nucleus, invading pathogens, and midbodies are also labelled by ubiquitination (Nakagawa et al., 2004; Levine, 2005; Pankiv et al., 2007, 2010; Pohl and Jentsch, 2009; Zheng et al., 2009; Kuo et al., 2011).

The upstream impetus to label these substrates varies. Although this impetus is unclear for some substrates, there is ample evidence to suggest that selective autophagy of all substrate is tightly regulated by specific cellular signals. For example, amino acid starvation results in the degradation of both ribosomes and peroxisomes, but under these conditions mitochondria are protected by adaption into a tubular elongated morphology (Gomes et al., 2011; Rambold et al., 2011). Conversely, treatment with the chemical ionpore CCCP initiates mitophagy but not pexophagy (Lazarou et al., 2012; Deosaran et al., 2013). In order to ensure selectivity, each substrate must differ in the mechanism by which they are designated such that the upregulation of one particular type of selective autophagy does not cause other autophagy substrates to be degraded.

1.2.3.2 Targeting of Autophagy Receptors

In order to be recruited to the autophagosome selectively, substrates next need to be targeted by an autophagy receptor protein (also known as an autophagy adaptor protein, or a ubiquitin receptor) (Kirkin et al., 2009b). The autophagy receptor proteins are a group of cytosolic scaffold proteins that mediate the targeting of specific, designated cytoplasmic components to nascent autophagosomes. These include p62/SQSTM1, NBR1, OPTN, Nix/BNIP3 and NDP52/TAX1BP1 (Birgisdottir et al., 2013). Autophagy receptors all share two common features: the ability to bind a substrate and the ability to bind a member of the LC3/GABARAP family of proteins on the nascent autophagosomes.

As the receptor proteins possess different affinities for different substrates, there is an opportunity to modulate substrate designation at the level of the receptors. For instance, expression of the mitophagy receptor Nix initiates mitochondria degradation during reticulocyte 17 maturation (Zhang and Ney, 2009; Novak et al., 2010). Likewise, exogenous expression of the autophagy receptor protein NBR1 causes an increase in the rate of pexophagy in HeLa cells (Deosaran et al., 2013). Autophagy receptors are covered in depth in section 1.3.

1.2.3.3 Recruitment to the Autophagosome

Autophagy receptors recruit targeted substrates to the nascent autophagosome via their LC3-interaction region (LIR domain), which allow the receptors to bind to autophagosome- bound LC3. This region is characterized by a consensus sequence [W/F/Y]XX[L/I/V], sometimes described as a WXXL motif (Birgisdottir et al., 2013). By binding to the targeted substrate and the autophagosome simultaneously, autophagy receptors effectively form a bridge between substrate and autophagosome, bringing the substrate to its final destination.

Autophagy receptors also facilitate autophagy by clustering substrates. Although p62 is not required for mitochondrial degradation, it is targeted to mitochondria during mitochondrial depolarization and leads to the clustering of dysfunctional mitochondria (Narendra et al., 2010a). Clustering or aggregation of substrates may be a mechanism to allow for more efficient targeting to autophagosomes. Similarly, overexpression of NBR1 causes clustering of peroxisomes and overexpression of p62 causes clustering of Salmonella typhimurium (Zheng et al., 2009). p62 is also implicated in the clustering of ubiquitinated protein aggregates (Wong et al., 2012).

1.2.3.4 Degradation in the Lysosome

Once a substrate has been designated for degradation and targeted to the nascent autophagosome by an autophagy receptor, the autophagosome surrounds and engulfs the substrate, trapping the substrate inside (Tanida et al., 2004b). At this time, the mature autophagosome will fuse with a lysosome to form an autolysosome and the activity of the lysosomal hydrolases will cause the contents of the autolysosome to be degraded (Feng et al., 2014). The products will eventually be recycled back to the cell as nutrients.

1.2.5 Autophagy in Disease

The loss, inhibition or malfunction of autophagy is strongly linked with a number of diseases including cancer (Mancias and Kimmelman, 2016), Crohn’s disease (Nguyen et al., 2013) and diabetes (Chen et al., 2011). The majority of research regarding autophagy in disease has been focused on neurodegenerative disorders however (Nixon, 2013). Suppression of autophagy has been shown to cause neurodegeneration in mice (Komatsu et al., 2006) and loss of autophagy has been shown to cause neuronal loss and the neuronal accumulation of polyubiquitinated proteins (Hara et al., 2006). The most well characterized examples of disease resulting from autophagy defects are neurodegenerative diseases due to the loss or malfunction of mitophagy. In particular, mitophagy has been intimately linked to Parkinson’s disease and Alzheimer’s disease (Lansbury Jr. and Brice, 2002). It is not clear at this time if defects in pexophagy are similarly problematic.

Neurodegenerative diseases have been further linked to defects in the autophagy receptors, which will be introduced in section 1.3. This suggests that disease resulting from dysfunctional autophagy may also result from dysfunctional selective autophagy. For example, mutations in p62 (Fecto et al., 2013) have been strongly linked to familial amyotrophic lateral sclerosis (ALS). Furthermore, mutations in the UBA domain of p62 are linked to Paget’s bone disease (Hocking et al., 2002), the inability to target ubiquitinated proteins to the proteasome, the inability to form poly-ubiquitinated aggregates and the inability to perform autophagic clearance (Kraft et al., 2010). p62 and NBR1 mutations have also been linked to late-infantile neuronal ceroid lipofuscinosis (CLN2), a neurodegenerative lysosomal disease (Micsenyi et al., 2013).

1.3 Autophagy Receptor Proteins

1.3.1 Overview

Autophagy receptors are scaffold proteins possessing a variety of binding domains to bring together a wide-ranging group of cell signaling factors. However, all autophagy receptors share two common features: the ability to target autophagic substrates, and the ability to bind to the LC3 family of proteins (Figure 1.7). The two autophagy receptors highlighted in this thesis, p62 and NBR1, bind to ubiquitin motifs on targeted substrates via a ubiquitin-associated (UBA) 19 domain. They also possess other important protein interacting domains: some known to be involved in autophagy function and others that still undergoing investigation. I will introduce p62 and NBR1 in the following sections.

Figure 1.7. Schematic Representation of Ubiquitin-Binding Autophagy Receptors All autophagy receptors possess at least two domains, a mechanism of binding substrate and a mechanism of binding LC3. Shown is the domain architecture of the four known ubiquitin- binding autophagy receptors, which bind substrate indirectly through a ubiquitin binding domain.

1.3.2 p62

p62 was the first of the autophagy receptors that was shown to play a role in selective autophagy (Bjørkøy et al., 2005). Initially shown to be involved in polyubiquitinated protein aggregate turnover, p62 has since been reported to be involved in the degradation of several cytoplasmic components including mitochondria, peroxisomes, ribosomes, invading pathogens, and the clearance of both nuclear and cytosolic ubiquitin aggregates (Katsuragi et al., 2015).

p62 contains a LC3-interacting region (LIR) which was originally mapped to amino acids 321 to 342 (Pankiv et al., 2007). This region is essential for the function of p62 in autophagic clearance. When the aspartic acid residues in this region were mutated to alanine, LC3 binding 20 was greatly inhibited (Pankiv et al., 2007). Later, the interaction with LC3 was confirmed to be an intermolecular parallel β-sheet between p62 and LC3 involving amino acids 337-343 (DDDWTHL). The [W/F/Y]XX[L/I/V] motif is well conserved among LIR motifs (Birgisdottir et al., 2013).

p62 also contains a C-terminal UBA domain which is essential for its interaction with ubiquitinated proteins. The UBA domain is a 50 amino acid three-helix bundle which preferentially binds to K63-linked poly-ubiquitin chains (Pankiv et al., 2007). However, p62 can also bind to mono-ubiquitinated proteins (Kim et al., 2008) and K48-linked ubiquitin chains (Long et al., 2008), albeit with less affinity.

p62 has been shown to have a role in pexophagy. Using immunofluorescence, Kim et al. (2008) showed that ubiquitination at the surface of peroxisomes recruited p62 to the peroxisomes. These peroxisomes were then rapidly degraded in an autophagic process. Likewise, Zhang et al. (2015) found that p62 was recruited to peroxisomes when cells were treated with exogenous H2O2 and that peroxisomes were subsequently degraded (Zhang et al., 2015).

While most researchers agree that p62 is involved in pexophagy, its presence is not essential. Kim et al. (2008) found that peroxisomes were still degraded when p62 expression was knocked down, albeit less efficiently. This was further validated by Deosaran et al. (2013) who showed that overexpression of NBR1 and not p62 induced pexophagy, and that knockdown of p62 slowed but did not prevent pexophagy during NBR1 overexpression. Yamashita et al. (2014) also found that p62 slowed but did not prevent pexophagy during PEX3-HA overexpression induced pexophagy. The prevailing opinion in the literature holds that NBR1 is the primary autophagy receptor in pexophagy (Deosaran et al., 2013; Yamashita et al., 2014; Walter et al., 2014). This is discussed in greater detail below.

1.3.3 NBR1

NBR1, originally named as the neighbouring gene to BRCA1, has taken on a name of its own in the field of autophagy. The structure of NBR1 closely resembles that of p62 with an N- terminal PB1 domain, a ZZ domain, an LIR domain and a C-terminal UBA domain. The LIR domain of NBR1 was mapped to 730-736 (EDYIIIL), analogous to the 335-341 DDDWTHL 21 sequence of p62 (Kirkin et al., 2009a). A second LIR motif was also identified, although it appears to be of lesser importance. It is not clear what advantage a second LIR motif would confer.

The PB1 motif of NBR1 allows it to interact with the PB1 motif of p62. The two autophagy receptors have been shown to colocalize in clusters in the cell, however either protein can be efficiently targeted to autophagosomes in the absence of the other (Kirkin et al., 2009a). NBR1 has been shown to have a role in pexophagy, midbody autophagy, and the clearance of ubiquitin aggregates (Deosaran et al. 2013, Kuo et al. 2011, Kirkin et al. 2009a).

The major differences in the structures of NBR1 and p62 appear to be the two coiled-coil domains and the J-domain immediately adjacent to the UBA sequence in the structure of NBR1. The two coiled coil domains allow NBR1 to homo-oligomerize (Kirkin et al., 2009a), leading to the formation of NBR1 clusters in the cytosol. Clustering is essential for the efficient uptake of a wide variety of substrates into the autophagosome including two known NBR1 targets: peroxisomes and ubiquitin aggregates. Accordingly, NBR1 lacking the first coiled coil domain (ΔCC1) did not homo-oligomerize (Kirkin et al., 2009a) and was inhibited in autophagic clearance.

The J domain of NBR1 is a membrane-interacting amphipathic α-helix shown to have a role in targeting NBR1 to late endosomes and peroxisomes (Mardakheh et al., 2010; Deosaran et al., 2013). Mutation analysis showed that the J domain and the UBA domain of NBR1 are both required for NBR1 binding to peroxisomes (Deosaran et al., 2013). Exogenous expression of NBR1 increased the rate of pexophagy, but NBR1 lacking the J domain (ΔJ) was unable to upregulate pexophagy. Further mutation analysis showed that the UBA domain is sufficient to target NBR1 to ubiquitinated peroxisomes but that the J domain is required to anchor the autophagy receptor to the peroxisomal membrane. The ability of the combined J and UBA region (J-UBA) of NBR1 to target proteins to peroxisomes was explicitly shown using a p62 mutant with its UBA domain replaced by the J-UBA domain of NBR1. p62 containing the J-UBA domain from NBR1 not only bound to peroxisomes but was also able to induce pexophagy. These findings suggest that the combination of the J and UBA domains assist in targeting NBR1 to ubiquitinated peroxisomes. 22

siRNA depletion of NBR1 results in an increase in the number of peroxisomes, comparable to cells defective in autophagy, while depletion of p62 has no effect on peroxisome numbers (Deosaran et al., 2013). This difference is partially explained by the J domain, but may be also be due to the ability of NBR1 to bind to certain ubiquitin linkages more efficiently than p62. The UBA domain of p62 has a higher affinity for K63-linked polyubiquitin chains while the UBA domain of NBR1 binds both K48 and K63-linked chains with similar affinity, as well as mono-ubiquitination moieties to a lesser extent (Johansen and Lamark, 2011; Kirkin et al., 2009a). This suggests that substrate specificity in autophagy may be partly conferred by differences in the binding ability of the receptors to ubiquitin.

1.3.4 Other Autophagy Receptors

At least two other autophagy receptors, optineurin (OPTN) and nuclear dot protein 52 (NDP52) also possess the LIR and UBA domains necessary in order to be an autophagy receptor for ubiquitinated substrates such as peroxisomes. Both OPTN and NDP52 are intimately linked to the autophagic degradation of mitochondria and cytosolic pathogens (Thurston et al., 2009; Wild et al., 2011; Heo et al., 2015; Lazarou et al., 2015; Richter et al., 2016). Interestingly, the molecular basis for NDP52 ubiquitin recognition has been investigated and NDP52 was found to bind mono-ubiquitination moieties preferentially (Xie et al., 2015), similar to NBR1. Deosaran et al. (2013) examined a potential role for NDP52 in pexophagy and found that it was not required for pexophagy at steady state conditions but did not reject the possibility that it could be involved in selective pexophagy. The involvement and contribution of NDP52 and OPTN in pexophagy therefore remain an open question in the field. 23

1.4 Pexophagy

1.4.1 Overview

As early as 1983, Osumi’s group was beginning to characterize pexophagy in the methylotrophic yeasts Hansenula polymorpha and Pichia pastoris (Veenhuis et al., 1983). Progress was rapid at first; and due to the ease of inducing pexophagy and quantifying peroxisomes in these species, peroxisomes became a preferred substrate for autophagy researchers. 33 years later however, pexophagy research has fallen behind other forms of autophagy in both the yeast and mammalian systems as money and interest has gravitated towards mitochondria and the associated neurodegenerative diseases. Accordingly, in terms of research groups, publications, and general understanding, the peroxisome has been surpassed by the mitochondria as the preferred organelle to study autophagy.

Contributing to the poor understanding of mammalian pexophagy, yeast and mammals initiate pexophagy in different ways and knowledge from the better-studied yeast system has historically not translated well to mammals. While both systems employ the same core autophagic machinery, designation of peroxisomes for degradation differs dramatically with yeasts employing autophagy receptors directly to peroxisomal proteins while mammals utilize ubiquitin as an intermediate. Importantly, ubiquitin is not thought to play a role in yeast pexophagy (Nuttall et al., 2014), which is not surprising considering that yeast autophagy receptors do not contain ubiquitin binding domains. Because of these differences, yeast and mammalian pexophagy researchers need to have a strong understanding of these differences. The two systems will be explored in depth in the remainder of section 1.4.

1.4.2 Pexophagy in Yeasts

Due to the rapid induction of pexophagy in response to changing carbon sources, as well as historic reasons, methylotrophic yeasts such as P. pastoris and H. polymorpha became a preferred model organism for researchers. Simultaneously, a well-established library of knockout strains and the ability to cross these strains led many researchers to work with Saccharomyces cerevisiae as well. 24

In P. pastoris, shifting methanol grown cells to ethanol rendered peroxisomes superfluous and induced pexophagy (Tuttle and Dunn, 1995). The same was true in H. polymorpha (Bellu and Kiel, 2003). This process was found to be dependent on a P. pastoris autophagy receptor protein called Atg30 and the formation of the pexophagic receptor protein complex (RPC) (Nazarko et al., 2014) (Figure 1.8). Atg30 possesses three key features that enable this activity: an Atg8-interacting motif (AIM, analogous to a mammalian LIR), an Atg11 binding site (11-BS, no mammalian equivalent), and the ability to interact with peroxisomal membrane proteins. At the peroxisome, Atg30 has been shown to interact with Pex3, Pex14, and another novel autophagy protein Atg37 (Nazarko et al., 2014). Burnett et al. (2015) showed a hierarchy to these events, whereby Pex3 recruits Atg30 to the peroxisome membrane and phosphorylates Atg30 on S112 near the AIM, allowing binding between the phosphorylated AIM and Atg8 (Burnett et al., 2015).

Figure 1.8. The Yeast Pexophagic Receptor Protein Complex P. pastoris Atg30 (PpAtg30) and S. cerevisiae Atg36 (ScAtg36) are the key autophagy receptors in yeast pexophagy. Depicted are some of the known interactions between PpAtg30/ ScAtg36 and other members of the yeast RPC.

Upstream to all of these events, Atg37 has been shown to bind acyl-CoA in vitro, leading some to speculate a connection between β-oxidation and pexophagy (Oku and Sakai, 2016). According to this model, acyl-CoA concentrations fluctuate depending on β-oxidation. When acyl-CoA concentrations are high, Atg37 binding to Atg30 is inhibited, preventing Atg30 recruitment. When acyl-CoA concentrations are low, Atg37 is recruited and becomes the binding site for Atg30, which is then phosphorylated by Pex3 allowing for binding to the AIM. This is an attractive model because it offers a role for all the players that have been shown to be required and also suggests a potential signaling pathway by which methylotrophic yeasts can respond to peroxisome proliferative conditions. 26

In S. cerevisiae, shifting oleate grown cells to a glucose media lacking nitrogen also induces pexophagy (Hutchins et al., 1999); however the pexophagic machinery is dissimilar and the signal transduction is completely different from methylotrophic yeast. The primary autophagy receptor is Atg36, which is analogous to P. pastoris Atg30 in some respects. Like Atg30, Atg36 has been shown to possess the same three key regions: an AIM, an 11-BS, and a third site which can interact with the peroxisomal membrane (Farre et al., 2013). However, Atg30 and Atg36 are not homologous outside of these key binding sites. While Atg36 has been shown to bind Pex3 in S. cerevisiae, curiously ScPex3p does not phosphorylate Atg36. Instead, phosphorylation is mediated by the kinase Hrr25 which phosphorylates Atg36 at S97 (Tanaka et al., 2014), the equivalent to S112 in P. pastoris. This phosphorylation event regulates interactions between Atg11 and Atg36 as in methylotrophic yeast (Tanaka et al., 2014). Adding to the complexity, in S. cerevisiae both Atg36 and Atg11 have been shown to interact with the peroxisome fission machinery Dnm1 and Vps1 and simultaneous knockdown of both Dnm1 and Vps1 inhibited pexophagy (Motley et al., 2008). It is thought that these interactions may be some of the first events in pexophagy since they occur when other interactions are prevented (Mao et al., 2014).

In order to sense the shift from oleate to glucose, S. cerevisiae is thought to respond to the presence of glucose via the membrane glucose sensor GPR1, as knockout of this gene prevents glucose-induced pexophagy (Nazarko et al., 2008b). In contrast, knockout of the analogous sensor Snf3 in methylotrophic yeast does not prevent pexophagy (Nazarko et al., 2008a). Furthermore, a shift to glucose induces macropexophagy (engulfment by an autophagosome and subsequent fusion with a lysosome) in S. cerevisiae but induces micropexophagy (direct invagination of the lysosomal membrane) in methylotrophic yeast (Tuttle and Dunn, 1995). It is clear that even among different yeast species, pexophagy regulation has diverged.

1.4.3 Pexophagy in Mammals

Mammalian pexophagy differs further from the yeast species discussed, with evidence that micropexophagy does not take place (Iwata et al., 2006), no homolog for Atg11, and no homolog for either Atg30 or Atg36 (Nazarko et al., 2014) (Figure 1.9). Instead, the autophagy 27 receptors p62 and NBR1 indirectly target to the peroxisome membrane through ubiquitinated peroxisomal membrane proteins. This was first demonstrated by Kim et al. (2008) who showed that an exogenously expressed fusion construct of ubiquitin translated in frame with peroxisomal membrane proteins induced p62 recruitment and peroxisome degradation via autophagy. In follow up work, the relative contributions of p62 and NBR1 were assessed and it was determined that NBR1 was the primary pexophagy receptor (Deosaran et al., 2013), as was discussed in section 1.3. The major question in mammalian pexophagy for the past eight years has been how peroxisomes are ubiquitinated. To this end, several groups have demonstrated that a variety of stimuli can induce pexophagy in mammals.

Figure 1.9. The Mammalian Pexophagy Receptor Protein Complex NBR1 is the key autophagy receptor in mammalian pexophagy. Depicted are some of the key interactions between NBR1 and other members of the mammalian pexophagy receptor complex.

1.4.3.1 Pexophagy is a Basal Process 28

Peroxisomes are known to be continually turned over by the cell, and this is thought to maintain the quality of the peroxisomes. Through the use of HaloTag technology, a pulse-chase experiment where green and red fluorescent ligands which bind peroxisomal matrix proteins were pulsed sequentially, Huybrechts et al. (2009) were able to track the age of peroxisomes. They showed that the half-life of peroxisomes in cultured cells is approximately 2-3 days and could be extended significantly by autophagy inhibition (Huybrechts et al., 2009). In addition, older peroxisomes were more likely to be degraded than newer peroxisomes (Huybrechts et al., 2009). In a mouse model, Iwata et al. (2006) showed that by feeding a diet of phthalate esters, the proliferation of peroxisomes in the liver was strongly induced. The phthalate esters were then removed from the diet, eliminating the stimulus and leading to rapid peroxisome degradation of the excess peroxisomes via autophagy (Iwata et al., 2006). These experiments suggest that pexophagy is a continuous process which occurs at a certain basal rate, and others have suggested that basal pexophagy is a quality control process (Till et al., 2012; Lee et al., 2014). Furthermore, Deosaran et al. (2013) showed that p62 and NBR1 are critical components of the basal pexophagic process. By knocking down NBR1 expression, peroxisomes increased three fold and by knocking down p62, peroxisomes increased two fold (Deosaran et al., 2013). Additionally, exogeneous expression of NBR1 led to robust pexophagy, even in the absence of any other stimuli (Deosaran et al., 2013). Taken together, these findings suggest that basal pexophagy is constantly turning over aged peroxisomes, that ubiquitination is likely involved, and that autophagy receptors may be the limiting factor in this process.

1.4.3.2 Amino Acid Starvation Induces Pexophagy

Similar to what was observed in yeast, Hara-Kuge and Fujiki (2008) found that depleting cells of amino acids in Hank’s Balanced Salt Solution (HBSS) led to the induction of pexophagy in mammalian cells. During these conditions, PEX14 was found to immunoprecipitate with the autophagosomal marker LC3-II (Hara-Kuge and Fujiki, 2008). PEX14 is a peroxisomal membrane protein which is part of the matrix protein import complex and acts as the binding site for the shuttling receptor PEX5 during matrix protein import. During starvation conditions, LC3- II but not PEX5 was found to immunoprecipitate with PEX14 while during growth conditions 29

PEX5 but not LC3 was found to immunoprecipate with PEX14 during normal conditions (Hara- Kuge and Fujiki, 2008).

Follow up in vitro work performed the same group showed that PEX14 and LC3-II directly interact and suggested competitive binding between LC3-II and PEX5 for PEX14 (Jiang et al., 2015). The authors suggest that this supports a model in which amino acid starvation decreases matrix protein import, leading to a decrease in PEX5 import and freeing PEX14 at the peroxisome surface to interact with LC3-II, leading to pexophagy. Oddly, the authors also investigated whether NBR1 was involved in the process. During amino acid starvation, NBR1 was recruited to peroxisomes and knockdown of NBR1 expression was found to slow amino acid starvation induced pexophagy (Jiang et al., 2015). However, the author’s new model has no need for an autophagy receptor given that they observe direct interaction between PEX14 and LC3-II. Instead, they end their analysis by simply stating that ‘it is equally likely that NBR1 is an association factor in PEX14-LC3-II binding’ (Jiang et al., 2015). The mechanism of amino acid starvation induced pexophagy therefore remains unclear.

1.4.3.3 PEX3 Overexpression Induces Pexophagy

Because of the known role that PEX3 plays in yeast pexophagy, Yamashita et al. (2014) investigated a potential role for PEX3 in mammals. In these studies, it was found that overexpression of PEX3-HA2 also induced autophagy. Targeting PEX3-HA2 to mitochondria did not induce either pexophagy or mitophagy, suggesting that peroxisomal localization was essential (Yamashita et al., 2014). Additionally, NBR1 was required for pexophagy, while p62 enabled peroxisomal clustering but was not required for pexophagy (Yamashita et al., 2014). Finally, Yamashita et al. (2014) showed that peroxisomes were ubiquitinated, but that ubiquitination of PEX3-HA2 did not occur and PEX3-HA2 did not interact with NBR1. This article marked a confusing chapter in mammalian pexophagy, especially when considering that the authors declined to suggest a model for their observations.

1.4.3.4 Oxidative State Induces Pexophagy

Peroxisomes are responsible for as much as 20% of O2 consumption and 35% of H2O2 production in the liver (Fransen et al., 2012). Because of the role that ROS play in autophagy (Scherz-Shouval et al., 2007) and mitophagy (Wang et al., 2012), it is tempting to speculate that the redox state of peroxisomes may promote pexophagy. Given that a primary function of peroxisomes is to maintain the redox environment of the cell, dysfunctional peroxisomes which are unable to maintain their own redox state should theoretically also be excellent targets for quality control mediated pexophagy.

Walter et al. (2014) showed that hypoxic conditions led to the induction of pexophagy. The transcription factor hypoxia inducible factor 2α (Hif-2α) is normally rapidly ubiquitinated and targeted to the proteasome by the E3 ubiquitin ligase Vhl. During hypoxia however, Vhl activity was inhibited and Hif-2α was stabilized in the cell, allowing the protein to carry out its functions as a transcription factor (Walter et al., 2014). The authors took advantage of this by utilizing Vhl-/- mouse livers as a model for hypoxia and Vhl-/-/Hif2α-/- as a model for hypoxia in the absence of Hif-2α. In Vhl-/- livers but not Vhl-/-/Hif2α-/- livers, peroxisomes were degraded by autophagy. Knocking down NBR1 prevented this pexophagy, and NBR1 mRNA levels were not altered in the presence or absence of Hif-2α. Additionally, exogenous expression of Hif-2α also induced pexophagy. Together, these findings suggested that Hif-2α promotes pexophagy, and indirectly suggested that hypoxia promotes pexophagy via Hif-2α. However, the signaling pathway from Hif-2α to pexophagy was not elucidated.

Around the same time, Zhang et al. (2015) showed that targeting ROS to peroxisomes induced pexophagy by a novel mechanism. When cultured cells were treated with clofibrate, a peroxisome proliferating compound which induces peroxisomal ROS, the kinase ataxia- telangiectasia mutated (ATM) was activated at the peroxisome (Zhang et al., 2015). Activated ATM at the peroxisome then had two functions: to repress mTORC1 via the peroxisomal TSC signaling node; and to phosphorylate the shuttling receptor PEX5. The repression of mTORC1 subsequently led to the induction of general autophagy, and phosphorylated PEX5 became ubiquitinated by the peroxisomal E3 ubiquitin ligases PEX2/10/12, leading to p62 recruitment and pexophagy. 31

Although Zhang et al. (2015) propose an exciting new model; there is a plausible concern that they are studying a cell-wide phenotype rather than a peroxisome specific phenotype. DHE staining of superoxide production was observed throughout the entire cell during clofibrate treatment, and many of the experiments utilize the exogenous addition of H2O2 rather than peroxisome targeted ROS (Zhang et al., 2015). Additionally, Wang et al. (2012) showed that targeting the superoxide generating fluorophore KillerRed to peroxisomes did not cause pexophagy.

Altogether, these various pexophagic conditions remain understudied, and it is not clear where there is overlap between them. The one constant in all of these observations has been the roles of p62 and NBR1 as autophagy receptors. Once these autophagy receptors are recruited, all parties can agree on a common mechanism where targeted peroxisomes are sent to the autophagosome and eventually the lysosome for degradation. However, because there are so many upstream mechanisms to recruit the autophagy receptors, mammalian pexophagy has become a confusing, fragmented field.

1.4.4 Ubiquitination in Pexophagy

Ubiquitination is a promising way to unify all these mechanisms. Nearly a decade ago, Kim et al. (2008) showed that an exogenously expressed construct of ubiquitin fused to peroxisomal membrane proteins caused recruitment of p62 and subsequent pexophagy. More recently, Nordgren et al. (2015) showed that PEX5 fused to a ‘bulky’ C-terminal GFP tag inhibited PEX5 export and led to PEX5 monoubiquitination and subsequent pexophagy. Nordgren et al. (2015) suggested a new model where a bulky tag mimics a cargo protein which cannot be released, leading to PEX5 becoming stuck at the peroxisome membrane (Nordgren et al., 2015). PEX5 is then ubiquitinated at C11 and peroxisomes are degraded via autophagy.

However, two major questions followed this work. First, knockdown of either p62 or NBR1 did not cause a significant change in peroxisome numbers during PEX5-GFP expression, although NBR1 knockdown did cause a trend towards reduced pexophagy. This is in direct contrast with basically all other pexophagy groups (Deosaran et al., 2013; Yamashita et al., 2014; Walter et al., 2014; Jiang et al., 2015; Zhang et al., 2015). Second, although Zhang et al. (2015) 32 also show mono-ubiquitination of PEX5, they found that the peroxisomal ROS led to phosphorylation of PEX5 at S141 and ubiquitination of PEX5 at K209, a different site for ubiquitination. Compounding the problem, both Zhang et al. (2015) and Nordgren et al. (2015) found that mutating their ubiquitinated residue prevented pexophagy, suggesting that they may be studying completely different mechanisms.

In spite of these questions, it is reassuring that the mammalian pexophagy community finally has at least some consensus that ubiquitination is involved. Interestingly in yeast, four different peroxisomal proteins Pex5 (the PTS1 receptor), Pex7 (the PTS2 receptor), Pex20 (the PTS2 co-receptor), and Pex4 (the ubiquitin conjugating enzyme) have been shown to be ubiquitinated (Liu et al., 2013) but none are thought to be involved in pexophagy. In mammals, only PEX5 is known to be ubiquitinated. For all of these reasons, a prominent review recently referred to PEX5 as a ‘credible’ target for ubiquitination in pexophagy (Katarzyna and Suresh, 2016), a giant step forward from the past ten years of confusion.

1.5 The Peroxisomal E3 Ubiquitin Ligases

1.5.1 Overview

A logical next step is to study the mechanism by which peroxisomes are ubiquitinated. The mammalian cell has approximately 600 E3 ubiquitin ligases (Deshaies and Joazeiro, 2009), but only three are known to localize to the peroxisome: PEX2, PEX10, and PEX12. These ligases make up a complex which is well known for its role in recycling the PEX5 shuttling receptor back to the cytosol, but recently were shown to play a role in pexophagy as well (Zhang et al., 2015). While the three E3 ubiquitin ligases are commonly considered to be one complex with one function, differences in the activity of these enzymes have been shown both in vivo and in vitro (Platta et al., 2009; El Magraoui et al., 2012). Furthermore, it is not clear why the cell would evolve three redundant enzymes to catalyze one specific function when one enzyme would theoretically suffice. Therefore, I hypothesized that one or more of these enzymes is involved in mammalian pexophagy.

1.5.2 Peroxisomal E3 Ubiquitin Ligases in Import

Briefly, the peroxisomal E3 ubiquitin ligases PEX2/10/12 play an essential role in PEX5 recycling, ubiquitinating PEX5 as a signal to the peroxisomal AAA/ATPase to recycle PEX5 back to the cytosol. These ligases are classified as peroxins, because loss of function in any of these enzymes results in the inability of the cell to produce mature peroxisomes. For this reason, PEX2 knockouts are frequently used as a model for Zellweger spectrum disorder, a spectrum of conditions resulting from peroxisome biogenesis defects (Faust et al., 2001).

During steady state conditions, PEX5 recycling is mediated by mono-ubiquitination on C11. Mutation of the C11 residue was shown to prevent recycling of PEX5 back to the cytosol (Carvalho et al., 2007). Although cysteine ubiquitination is rarer than lysine ubiquitination, it is well-known for its role during the covalent attachment of ubiquitin to E2 ubiquitin conjugating enzymes (Scheffner et al., 1995). Additionally, there is precedent for at least one other substrate, the major histocompatibility complex class I heavy chain, to be terminally cysteine ubiquitinated (Cadwell and Coscoy, 2006).

C11 ubiquitination is removed by the cytosolic deubiquitinase USP9X (Grou et al., 2012). Logically, the thioester bond formed during cysteine ubiquitination is weaker than the isopeptide bond formed during lysine ubiquitination, and therefore it may be desirable given that PEX5 ubiquitination is transient. In yeast, replacing the equivalent cysteine residue with a lysine residue (Pex5C6K) was not found to interfere with import; however the steady state levels of Pex5 were decreased when the yeast deubiquitinase Ubp15p was knocked down, suggesting that the less-stable thioester modification may help protect Pex5 from proteasomal degradation (Debelyy et al., 2011; Schwartzkopff et al., 2015).

In mammals, monoubiquitination of PEX5 was shown to utilize the UbcH5 family of enzymes (UbcH5a/b/c) as an E2 ubiquitin conjugating enzyme (Grou et al., 2008). This was shown in in vitro experiments, where purified peroxisomes were supplemented with import buffer containing E1 and ATP and probed for ubiquitination of PEX5 in the presence and absence of UbcH5c (Grou et al., 2008). Furthermore, PEX5 monoubiquitination was only observed in the presence of this E2. This data also indirectly supported the notion that the E3 ubiquitin ligase responsible for monoubiquitination of PEX5 is a peroxisomal enzyme. 34

1.5.3 Peroxisomal E3 Ubiquitin Ligases in Pexophagy

Most of what is known about PEX2/10/12 comes from yeast where ubiquitin is not thought to play a role in pexophagy. However, given the recent interest in PEX5 as a ubiquitinated substrate in pexophagy, at least one group has investigated the roles of the peroxisomal E3 ubiquitin ligases in pexophagy as well. Zhang et al. (2015) found that knockdown of any of the three peroxisomal E3 ubiquitin ligases prevented ATM-induced PEX5 ubiquitination. Additionally, while treatment with exogenous H2O2 normally caused loss of the peroxisomal proteins PEX1 and PEX14 via pexophagy; during the simultaneous knockdown of PEX2, PEX10 and PEX12 this loss was alleviated (Zhang et al., 2015). Unfortunately, Zhang et al. (2015) did not demonstrate the specificity of their knockdowns. Given that there is homology between the peroxisomal E3 ubiquitin ligases and that Zhang et al. (2015) used a pool of siRNA constructs targeted against each E3 ubiquitin ligase, there is plausible concern that they may have seen off-target effects during their knockdowns. Therefore, it is still possible that PEX2/10/12 behave differently in oxidative stress induced pexophagy.

1.5.4 Differences between the Peroxisomal E3 Ubiquitin Ligases

To that point, although most research groups treat PEX2/10/12 as a single complex, there is data to suggest that the peroxisomal E3 ubiquitin ligases behave differently from one another. In S. cerevisiae, the ability of the peroxisomal E3 ubiquitin ligases to ubiquitinate Pex5p was tested in vitro with Pex4p (the yeast ortholog for UbcH5a/b/c) and with Ubc4p (the yeast ortholog for UbcE2D2 and a well-known promiscuous E2 enzyme) (Platta et al., 2009). Pex12p, but not Pex2p or Pex10p, was able to mono-ubiquitinate Pex5p when incubated with Pex4p while Pex2p, but not Pex10p or Pex12p, was able to poly-ubiquitinate Pex5p when incubated with Ubc4. In vivo, it was found that Pex12 knockouts did not mono-ubiquitinate Pex5p while Pex2 knockouts did not poly-ubiquitinate Pex5p. The authors proposed that mono-ubiquitination of Pex5p is the recycling signal and is mediated by Pex12, while poly-ubiquitination of Pex5p is the signal for proteasomal degradation and is mediated by Pex2 (Figure 1.10).

Figure 1.10. Differences in PEX2/10/12 Activity The three peroxisomal E3 ubiqutin ligases have been shown to have different modes of action against Pex5. In combination with the E2 enzyme Ubc4, Pex2 polyubiquitinates Pex5. In combination with the E2 enzyme Pex4, Pex12 monoubiquitinates Pex5. Pex10 is not thought to have direct activity against Pex5 (El Magraoui et al., 2012).

In S. cerevisiae, Pex2p, Pex10p and Pex12p were found to have distinct roles in the ubiquitination of Pex18p (El Magraoui et al., 2013). Both in vivo and in vitro, Pex2p and Pex10p were able to polyubiquitinate Pex18p in combination with the E2 Ubc4p. Likewise, both in vivo and in vitro, Pex10p and Pex12p were able to monoubiquitinate Pex18p in combination with the E2 Pex4p. In contrast, in P. pastoris, no differences have been observed between the E3 ligases and all three were found to be required for both mono- and poly-ubiquitination of Pex20p (Liu et al., 2012).

In mammals, PEX2/10/12 have fundamental differences in their amino acid sequences, particularly their RING-finger active site domains. All three enzymes are topologically similar with two transmembrane domains and the N- and C-termini located in the cytosol. All three enzymes are classified as RING-finger E3 ubiqutin ligases, which transfer ubiquitin from the E2 ubiquitin-conjugating enzyme to the substrate directly. PEX2 and PEX10 are classified as

C3HC4-type RING-finger enzymes, characterized by the sequence C-X2-C-X[9-39]-C-X[1-3]-H- 36

X[2-3]-C-X2-C-X[4-48]-C-X2-C (Borden and Freemontt, 1996). In E3 ubiquitin ligases containing this sequence, the eight cysteine and histidine residues coordinate two Zn2+ ions which comprise the active site. In contrast, PEX12 only contains five of the eight residues, and has been classified as a C5 RING-finger enzyme (Prestele et al., 2010). It is therefore thought to only coordinate one Zn2+ ion and to have reduced or even no activity as a result (Stone et al., 2005).

1.5.5 Rationale for Studying the Peroxisomal E3 Ubiquitin Ligases

It seems likely at this time that ubiquitination of the peroxisome membrane and pexophagy are intimately related. To demonstrate this relationship, it is imperative to identify the key mechanistic players: the E3 ubiquitin ligase responsible for ubiquitination of the peroxisome, the peroxisomal substrate of ubiquitination, and the primary autophagy receptor protein.

Most research up to this point has focused on the substrate of ubiquitination since ubiquitin modifications are easily detected by techniques such as Western blotting and mass spectrometry. However, my thesis project approaches this problem from the opposite perspective. Rather than searching through over 20 PMPs to find a substrate for ubiquitination, I decided to study the three peroxisomal E3 ubiquitin ligases PEX2/10/12 to investigate whether any of these ligases are involved in pexophagy. With just three candidates to test, the search can be more thorough and more rapid. Furthermore, once the pexophagy E3 ubiquitin ligase has been discovered, identifying the substrate for ubiquitination and the autophagy receptor will be a much easier task.

In addition to identifying the key players in pexophagy, I further examine the mechanism by which pexophagy is regulated. Specifically, I am interested in the key signaling pathway which interconnects amino acid starvation and pexophagy. By understanding the key players in this pathway, I gain a much more complete understanding of cellular homeostasis and the starvation response. 37

Chapter 2 2 Materials and Methods 2.1 Reagents

2.1.1 Plasmids

PMP34-GFP, mCherry-LC3, Lamp1-GFP have all been previously described (Deosaran et al., 2013) HA-Ub has been previously described (Coyaud et al., 2015). PEX2-GFP, PEX10- GFP, PEX12-GFP, PEX2-Δ243-306-GFP, PEX2-Δ243-283-GFP, PEX2-Δ270-283-GFP, PEX2- CFP, PEX2-FLAG, PEX2-siR-FLAG, and PEX2-FlpIn-FLAG were synthesized for this work. For these constructs, open reading frames were sourced from SIDNET (Hospital for Sick Children, Toronto, Canada), primers were sourced from Sigma Genosys, and constructs were sequenced by The Center for Applied Genomics (Toronto, Canada).

2.1.2 siRNAs

siRNA Target Sequence siCntl non-targeting AAUAAGGCUAUGAAGAGAUAC siPEX2-1 PEX2 GCUAGUUUGGUCCCAGUUU siPEX2-2 PEX2 GAAGAACGAUGCUAUGAUU siPEX10 PEX10 UCACUUAUUUGGACGGGAUUUC siPEX12 PEX12 UGUUGCCUUAUCCCUGUCUA sip62 p62 GCAUUGAAGUUGAUAUCGAUTT siNBR1 NBR1 GAACGUAUACUUCCCAUUGUU siAtg12 Atg12 GUGGGCAGUAGAGCGAACAUU siPEX14 PEX14 GGCAGGCAUUGCAUUUTT

2.1.3 Antibodies

Rabbit polyclonal α-PMP70 was purchased from Invitrogen. Rabbit polyclonal α-NBR1 was a generous gift from Ivan Dikic. Human polyclonal α-P0 was a generous gift from Alex Palazzo. Mouse monoclonal α-TOMM20 was purchased from Santa Cruz. Mouse monoclonal α- Mfn2 was purchased from Cedarlane. Rabbit monoclonal α-Calnexin was a generous gift from David Williams. Mouse monoclonal α-HA was purchased from Covance. Rabbit polyclonal α- Atg12 was purchased from Cell Signaling Technology. Rabbit polyclonal α-PEX14 was purchased from Millipore. Rabbit polyclonal α-PEX2 was generated from peptide by GenScript. Rabbit polyclonal α-PEX2 was purchased from Abcam. Rabbit polyclonal α-PEX5 was generated by GenScript. Rabbit polyclonal α-catalase was purchased from Calbiochem. Rabbit monoclonal α-4E-BP was a generous gift from John Brumell. Mouse monoclonal α-FLAG was purchased from Sigma-Aldrich.

HRP-conjugated goat polyclonal α-mouse secondary and HRP-conjugated goat polyclonal α-rabbit secondary was purchased from Cedarlane. HRP-conjugated mouse monoclonal α-GAPDH was purchased from Abcam. Fluorescent goat polyclonal α-rabbit Alexa- 568 secondary antibody and goat polyclonal α-mouse Alexa-488 secondary antibody were purchased from Invitrogen.

2.2 Cultured Cells

2.2.1 Cell Lines

HeLa cells were purchased from ATCC (ATCC CCL-2) and were cultured in 10% FBS DMEM.

ATG5+/+ and ATG5-/- MEFs were a generous donation from John Brumell and were cultured in 10% FBS DMEM

Stably transfected HA-Ub HEK293 cells were a generous donation from Brian Raught and were cultured in 10% FBS DMEM containing G418. 39

HeLa FlpIn cells were a generous donation from William Trimble and were cultured in 10% FBS DMEM. Following transfection with PEX2-FlpIn plasmid, puromycin was added to the growth media.

2.2.2 Growth Media

DMEM was purchased from HyClone (SH3008101) and supplemented with 10% FBS purchased from Invitrogen and L-glutamine purchased from Invitrogen.

HBSS was purchased from Lonza (10-527F) and contains 1g/L glucose.

2.3 Transfections

2.3.1 siRNA

In all experiments where siRNA was transfected, cells were transfected 72 hours prior to fixation or lysis, media was changed 64 hours prior to fixation or lysis, cells were re-transfected 48 hours prior to fixation or lysis, and media was changed 40 hours prior to fixation or lysis. Transfections used either FuGene-HD purchased from either Roche or Promega or used either Lipofectamine-2000 or Lipofectamine-3000 purchased from Invitrogen.

2.3.2 Plasmids

In all experiments where siRNA was transfected, cells were transfected 24-48 hours prior to fixation or lysis and media was changed 8 hours following transfection. Transfections used either Lipofectamine-2000 or Lipofectamine-3000 purchased from Invtirogen.

2.4 Microscopy and Quantification of Microscope Images

2.4.1 Imaging

All fluorescent imaging were performed on a Zeiss LSM710 with a 63x/1.4 Plan- Apochromat oil objective using Zen 2009 (Zeiss). Z-stack images were acquired at thicknesses of between 0.60M and 1.00μM. Live cell imaging was performed at 37C in CO2-independent medium (ThermoFisher) containing FBS, leupeptin and E-64 as specified. For all treatments within an experiment, image acquisitions were obtained on the same day using the same microscope settings. The images were acquired in 1024×1024 pixels at the depth of 12 bits. For visual presentation only the brightness was adjusted.

2.4.2 Peroxisome Density Images were analyzed using Volocity software purchased from Perkin Elmer. For quantification of peroxisome density in HeLa and MEF cells, the number of PMP70-stained structures was determined by Volocity via the FindSpots function and divided by the volume of each cell determined by Z-stacks. The FindSpots function is a three-step process where first global thresholding is performed to ignore any voxels below a threshold intensity, second adjacent voxels above the threshold are grouped together into a Spot, and third all Spots above a certain volume and counted and quantified. The average peroxisome density was then normalized to the wildtype controls. At least 50 cells were analyzed for each trial and at least three trials were performed.

2.4.3 Total PMP70 Fluorscence To determine the total fluorescent intensity of PMP70 within a cell, the fluorescent signal from the entire cell was obtained and subtracted from background. All the treatments were prepared and imaged at the same time and imaged with the same setting at the same day. At least 50 cells were analyzed for each trial and at least three trials were performed.

2.4.4 Mander’s Coefficient

Mander’s Coefficient was used as described previously by Hua et al. (2015). Briefly, all voxels with a PMP70 signal above threshold were checked for whether they contained an NBR1 signal above threshold. These colocalization events were then registered as a 1 (positive for NBR1) or a 0 (negative for NBR1) and weighted based on the amount of PMP70 signal in each voxel. Finally, the results were averaged across the cell. Coarsely, the end result is the likelihood of a PMP70 voxel being positive for NBR1.

2.5 Immunoblotting

For cell lysates, cells were lysed with 100 mM Tris pH 9 containing 1% SDS and Halt protease inhibitor cocktail purchased from Thermo Scientific, and the lysate was heated at 95C with vortexing for 15 minutes. For animal lysates, protein lysates were prepared by lysing cells in RIPA buffer, samples were run on SDS polyacrylamide gel and transferred to nitrocellulose membrane. For liver lysates, livers were homogenized in tissue lysis buffer (ThermoFisher) with protease inhibitor (Sigma) and 20 ng of protein was analyzed on a gradient gel (Novex) and transferred using on a PVDF membrane (Novex). For pulldowns, cells were lysed in 1% SDS, diluted tenfold in 1% NP-40 pH 9, incubated with primary antibody and Protein G Sepharose overnight, washed three times in 1% NP-40, and boiled in 1% SDS to release antibody from the beads.

The protein concentration in the supernatant was determined by BCA assay purchased from EMD Novagen. Equivalent sample amounts were subjected to SDS-PAGE. Protein was transferred to 0.45 m BioTrace PVDF membrane purchased from Pall and probed with the appropriate primary and HRP-conjugated secondary antibodies following standard protocols.

Blots were developed using Luminata Crescendo purchased from Millipore or with ECL Plus or ECL Advance reagents purchased from GE Healthcare or Super Signal West Dura- Extended Duration Substrate (Thermo Scientific). Proteins were detected on either a ChemiDoc (Biorad) or using a FluorChem E detector purchased from Protein Simple.

2.6 Immunofluorescence

For immunofluorescence, cells were fixed using 3.7% paraformaldehyde purchased from Electron Microscopy Sciences in PBS for 15 minutes and permeabilized using 0.1% Triton X- 100 purchased from ThermoFisher in PBS for 15 minutes, followed by incubation with the appropriate primary and secondary antibodies for 2 hours and 1 hour respectively. Alexa488 signal was acquired using a 488 nm Argon laser with a 493-565 nm bandpass filter and Alexa 561 were acquired using a 561 nm diode laser with a 600-700 nm bandpass filter.

2.7 Immunoprecipitation

HEK293 cells stably transfected with HA-Ub plasmid under the control of a tamoxifen promoter were treated as described in Sections 3.2.9 and 3.2.10. Cells were washed in PBS and lysed in 500μL of lysis buffer containing 1% NP-40, 1% SDS, 10mM Tris-HCl buffered to pH 9, 133mM NaCl, 1mM EDTA and protease inhibitor cocktail. The lysis buffer either did or did not contain 10nM MG132 and 10nM NEM as described in the main body. Lysates were boiled for 15 minutes, cleared via centrifugation and diluted to 5mL in the same lysis buffer without SDS. Lysates were then incubated with primary antibody and Protein G Sepharose overnight. In the morning, beads were washed three times using the same lysis buffer and proteins were eluted by boiling in SDS-containing sample buffer for 15 minutes.

2.8 Quantitative PCR

RNA was collected and isolated using the Promega RNA SV Isolation Kit. A cDNA library was synthesized by first-strand synthesis using the Applied Biosystems High-Capacity cDNA Archive Kit. qPCR was performed on the Applied Biosystems StepOne Real Time PCR System using TaqMan Fast Advanced Master Mix and FAM-labelled probes. Quantities of RNA transcripts are shown relative to Abt1 loading control.

2.9 Peroxisome Purification

HA-Ub stably transfected HEK cells were simultaneously treated with 10µM tamoxifen and transfected with plasmid. 8 hours after transfection, the media was changed to remove lipofectamine and add fresh tamoxifen. 24 hours after transfection, cells were trypsinized, washed and resuspended in Peroxisome Extraction Buffer (Sigma). The Sigma PEROX1 protocol was then followed, using a metal cell homogenizer to mechanically lyse the cells. Two 15cm dishes of cells were used for each treatment.

2.10 Rat Liver Heptatocyte Extraction

Rat liver hepatocytes were isolated by a two-step perfusion method using collagenase as described by Moshage et al. (1990). In brief, the liver was first perfused through the portal vein, with the dissected inferior vena cava used as the outflow port. Perfusion was performed with Ca2+ free Krebs Ringer Hepes buffer, pH 7.4, maintained at 37°C (10 min, flow rate =25 2+ ml/min), followed by perfusion with Mg free Krebs Ringer Hepes buffer containing Ca2+ (5.7 mmol/L) and collagenase type I (Sigma-Aldrich; 0.12–0.16 U/ml, 10 min, flow rate 8 ml/min). The liver was then removed and placed in the same buffer containing 1% bovine serum albumin (BSA; Sigma-Aldrich) without collagenase. Hepatocytes were then released by gentle touch of the liver and filtered through 60-mesh sterile nylon gauze. Cells were washed three times with HBSS at 50 g for 5 min and the supernatant was discarded. The final cell pellet was re-suspended and cultured in William's E medium at 37°C and 5% CO2.

2.11 Animal Work

Immediately after weaning, male C57BL/6 mice (Charles River) were placed on either a control diet (18% protein, Harlan Labs) or a low protein diet (1% protein, Harlan Labs) for a period of 12 days. Malnourished animals were also given carbohydrates (42 g/L with 55% Fructose and 45% Sucrose by weight) dissolved in their drinking water. All animals had ad libitum access to food and were housed in Lab Animal Services at the Hospital for Sick Children (Toronto, CA). Animals were sacrificed by cervical dislocation and liver tissue was snap frozen after harvest and stored at -80oC until analysis.

Chapter 3 3 PEX2 is Necessary and Sufficient for Peroxisomal Degradation via Autophagy

All experiments were performed by me. Figures 3.1-3.12 inclusive are adapted from Sargent et al. (2016). PEX2 is the E3 Ubiquitin Ligase Required for Pexophagy during Starvation. JCB.

3.1 Introduction

Although recent data suggests that PEX5 plays a key role in pexophagy as a target for ubiquitination on the surface of the peroxisome (Nordgren et al., 2015; Zhang et al., 2015), at the time that this project began very little was known about the mechanism of mammalian pexophagy. By investigating the known peroxisomal E3 ubiquitin ligases, I was successful in identifying PEX2 as the E3 ubiquitin ligase in pexophagy, PEX5 and PMP70 as substrates for membrane ubiquitination, and NBR1 as the primary autophagy receptor. Additionally, I demonstrated that amino acid depletion induced pexophagy is mediated by PEX2.

3.2 Results

3.2.1 Expression of PEX2 causes Loss of Peroxisomes

In order to investigate whether any of the peroxisomal E3 ubiquitin ligases were sufficient to induce peroxisome loss in cultured cells, I created constructs of PMP34, PEX2, PEX10 and PEX12 fused at the C-terminus to GFP. PMP34 is a peroxisome membrane protein responsible for ATP transport into the matrix of the peroxisome and should not have an effect on peroxisome numbers (Kim et al., 2008); therefore, it was used as a negative control. The constructs were transfected and expressed in HeLa cells for 48 hours, after which time the cells were fixed and immunostained for the peroxisome marker PMP70 in order to identify and quantify peroxisomes. These cells were then imaged by confocal microscopy to allow for the 46 quantification of the number of PMP70 puncta, the volume of each cell, and the total PMP70 fluorescence.

Expression of the PEX2-GFP construct, but not the PMP34-GFP, PEX10-GFP, or PEX12-GFP constructs, caused a significant loss in the peroxisome density (number of PMP70 puncta divided by the cell volume) (Figure 3.1AB). One concern was that PEX2 expression may have affected the morphology of the cell and thereby the denominator of the peroxisome density equation. However, total PMP70 fluorescence was also found to decrease (Figure 3.1C), and PEX2-GFP expression was not found to affect the morphology of the cells (Figure 3.2A). I therefore concluded that expression of PEX2 caused a loss of peroxisomes in HeLa cells.

3.2.2 PEX2-mediated Peroxisome Loss requires the PEX2 Active Site

I was next curious whether PEX2-mediated peroxisome loss was an enzymatic function of the PEX2 gene product. To determine whether PEX2-mediated peroxisome loss required the PEX2 active site, I created mutant constructs of PEX2 where the C-terminus, including the 243- 283 RING domain active site, was deleted and then progressively restored (Figure 3.3A), in accordance with (Deshaies and Joazeiro, 2009). PEX2-GFP, PEX2-Δ243-306-GFP, PEX2-Δ243- 283-GFP, and PEX2-Δ270-283-GFP were transfected and expressed in HeLa cells for 48 hours, then cells were fixed and stained for PMP70 and peroxisomes were quantified as before.

Expression of the PEX2-GFP construct, but not any of the mutant constructs, caused a significant loss in the peroxisome density (Figure 3.3BC). I therefore concluded that the PEX2 active site was required for PEX2-mediated peroxisome loss. 47

Figure 3.1. Overexpression of the E3 Ubiquitin Ligase PEX2 Causes Peroxisome Loss (A) HeLa cells were transfected with PMP34 or with each of the peroxisomal E3 ubiquitin ligases, PEX2, PEX10 and PEX12; fused to GFP. The cells were grown for 48 hours, then fixed and stained for the peroxisomal membrane protein PMP70. Scale bars measure 20µm. (B) Box plot of the peroxisomal density of cells expressing these constructs. The peroxisomal density was calculated by quantifying the fluorescent PMP70 puncta and dividing by the cell volume. The boxes show the 25th, 50th, and 75th percentiles and the lines show one-way standard deviations. Points represent all cells which did not fall within one standard deviation. (C) Box plot of the total PMP70 fluorescence intensity from the entire cell. Plotted are a total of 150 cells from 3 independent trials. ** p < 0.01. *** p < 0.001. 48

Figure 3.2. PEX2 Expressing Cells Retain Similar Morphology to Wildtype Cells (A) HeLa cells were transfected with PEX2-GFP. 48 hours later, the cells were fixed and stained for the peroxisomal membrane protein PMP70. Scale bars measure 20µm. White lines represent the boundary of the cell.

Figure 3.3. PEX2-mediated Peroxisome Loss requires the RING-finger E3 Ubiquitin Ligase Domain (A) Schematic of the PEX2 deletion mutants. TM represents transmembrane regions, RING represents the RING-finger active site. (B) HeLa cells were transfected with various PEX2-GFP mutants. 48 hours later, the cells were fixed and stained for the peroxisomal membrane protein PMP70. Scale bars measure 20µm. (C) Box plot of the peroxisomal density of cells expressing these constructs. The peroxisomal density was calculated by quantifying the fluorescent PMP70 puncta and dividing by the cell volume. Plotted are a total of 150 cells from 3 independent trials. ** p < 0.01. 50

3.2.3 PEX2-mediated Peroxisome Loss requires the Autophagic Machinery

Next, I wanted to determine whether PEX2-mediated peroxisome loss was occurring via autophagy. A mouse embryonic fibroblast (MEF) lacking the ATG5 gene product has previously been shown to be incapable of both micro- and macro-autophagy (Kuma et al., 2004). In this cell line, peroxisome loss via autophagy would be prevented while other types of peroxisome loss would proceed as normal. PMP34-GFP and PEX2-GFP were transfected and expressed in ATG5+/+ and ATG5-/- MEF cells for 48 hours, then cells were fixed and stained for PMP70 and peroxisomes were quantified as before.

In the ATG5+/+ MEF cell line, expression of the PEX2-GFP construct, but not PMP34- GFP, caused a significant loss in the peroxisome density (Figure 3.4AB). However, in the ATG5-/- MEF cell line, peroxisome loss upon PEX2-GFP expression was not significant. I concluded that PEX2-mediated peroxisome loss required the ATG5 gene product and was therefore likely occurring via autophagy.

Figure 3.4. PEX2-mediated Peroxisome Loss is an Autophagic Process (A) ATG5+/+ and ATG5-/- MEF cells were mock transfected, or transfected with PMP34-GFP or with PEX2-GFP. 48 hours later, the cells were fixed and stained for the peroxisomal membrane protein PMP70. Scale bars measure 20µm. (B) Box plot of the peroxisomal density of cells in (A). The peroxisomal density was calculated by quantifying the fluorescent PMP70 puncta and dividing by the cell volume. Plotted are a total of 150 cells from 3 independent trials. Scale bars measure 20µM. ** p < 0.01. ns not significant. 51

3.2.4 Autophagic Machinery Colocalizes with Peroxisomes during PEX2 Expression

If PEX2-mediated peroxisome loss occurs via autophagy, then I would expect recruitment of autophagic machinery, such as autophagy receptors, autophagosomes and autophagolysosomes to the peroxisomes in PEX2-expressing cells. To determine whether the autophagy receptor NBR1 was recruited, I decided to fix HeLa cells 24 hours after the transfection of either PMP34-GFP or PEX2-GFP and examine NBR1 localization via immunofluorescence. To determine whether the autophagosome marker LC3 was recruited, I coexpressed PMP34-GFP or PEX2-GFP with mCherry-LC3 for 48 hours; and to determine the autophagolysosome marker Lamp1 was recruited, I coexpressed PMP34-CFP or PEX2-CFP with Lamp1-GFP for 48 hours.

Colocalization of endogenous NBR1, mCherry-LC3 and Lamp1-GFP were observed in PEX2 expressing cells but not in PMP34 expressing cells (Figure 3.5ABC). These findings confirmed that the PEX2 gene product is sufficient to induce pexophagy and that PEX2- mediated peroxisome loss occurs via autophagy. Hereafter in this thesis, I will refer to this process as PEX2-mediated pexophagy.

Figure 3.5. PEX2-mediated Autophagy Recruits NBR1, LC3, and Lamp1 (A) HeLa cells were transfected with PMP34 or PEX2 tagged with a fluorescent marker. To detect NBR1, 24 hours later, the cells were fixed and stained using an antibody against NBR1 and then imaged. (B) To detect autophagosomes, cells were co-transfected with mCherry-LC3 and 24 hours later the cells were fixed and imaged. (C) To detect lysosomes, cells were co- transfected with Lamp1-GFP and 48 hours later the cells were fixed and then imaged. Scale bars measure 20µm.

3.2.5 Peroxisomes are Degraded during Amino Acid Starvation of Cultured Cells

Next, I wanted to investigate amino acid starvation as this stimulus has previously been shown to induce pexophagy in cultured cells. During amino acid starvation, the mTORC1 signaling pathway is inhibited which leads to derepression of autophagy (Kim et al., 2011). It has previously been shown that ribosomes and peroxisomes are degraded via autophagy during amino acid starvation (Hara-Kuge and Fujiki, 2008; Kraft et al., 2008) but that mitochondria are protected from autophagy by taking on an elongated morphology (Gomes et al., 2011).

To replicate these findings, I performed a timecourse where HeLa cells were starved of amino acids for timepoints between 0 and 24 hours in Hank’s Balanced Salt Solution (HBSS). Cell lysates were collected, separated on an acrylamide gel, and blotted for the peroxisome 53 marker PMP70, the ribosome marker P0, the mitochondrial marker TOMM20 and the cytosol marker GAPDH. A significant loss of PMP70 and P0 protein was observed following 24 hours of amino acid starvation in HBSS; however, TOMM20 was not significantly degraded (Figure 3.6AB).

I also repeated the peroxisome density assay in HeLa cells starved of amino acids for 0 or 24 hours. Cells starved of amino acids in HBSS had significantly fewer peroxisomes per unit of cell volume than cells which were not starved (DMEM) (Figure 3.6CD). I concluded that peroxisomes and ribosomes are selectively degraded during amino acid starvation.

Figure 3.6. Peroxisomes are Selectively Degraded during Amino Acid Starvation (A) HeLa cells were starved of amino acids for 0 to 24 hours as indicated in Hank’s Balanced Salt Solution (HBSS) and analyzed by immunoblotting for the peroxisomal marker PMP70, the ribosomal marker PO, the mitochondrial marker TOMM20, and the cytosolic marker GAPDH. (B) Line graphs show the amount of each protein which remains, relative to GAPDH, as amino acid starvation continues. (C) HeLa cells grown in HBSS media or regular growth media (DMEM) for 24 hours were fixed and stained for the peroxisomal membrane protein PMP70. Scale bars measure 20µm. (D) Box plots represent the peroxisomal density from 150 cells from three trials. * p < 0.05. ns p > 0.05 (not significant). 54

3.2.6 PEX2 is Required for Amino Acid Starvation Induced Pexophagy

Having shown that PEX2 is sufficient to induce pexophagy, I was next curious whether PEX2 was required for amino acid starvation induced pexophagy. I utilized siRNA knockdowns in order to deplete the cell of the PEX2, PEX10, and PEX12 gene products and to repeat the amino acid starvation experiments in these cells. Cells were transfected with siRNA 72 hours prior to fixation, re-transfected 48 hours prior to fixation and were grown in complete media (DMEM) or starved of amino acids (HBSS) 16 hours prior to fixation. The cells were then stained with an antibody against PMP70 as before.

When grown in compete media, cells depleted of PEX10 or PEX12 did not have a significantly different peroxisome density from cells transfected with a non-targeting siRNA (siCtrl) (Figure 3.7AB). However, cells depleted of PEX2 by either siPEX2-1 or siPEX2-2 had significantly more peroxisomes, suggesting that basal pexophagy may be inhibited. Furthermore, when cells were starved of amino acids, cells transfected with siPEX10 or siPEX12 had the normal loss of peroxisome density, in line with what was observed in control cells. However, cells depleted of PEX2 did not have a significantly different peroxisome density, suggesting that depletion of PEX2 prevented the normal amino acid starvation induced pexophagic response.

Because PEX2, PEX10 and PEX12 share homology, it was imperative to design siRNAs such that the other peroxisomal E3 ubiquitin ligases would not be affected. I designed siRNAs and tested the specificity using quantitative PCR. HeLa cells were transfected with siRNA 72 hours and 48 hours prior to lysis, and following lysis a cDNA library was created from the cellular RNA using first-strand synthesis. Here, I observed at least 80% knockdown for siPEX2- 1, siPEX2-2, siPEX10, and siPEX12 against their intended targets (Figure 3.7C, shown in dark grey), but no significant off-target effects (shown in light grey). Additionally, siPEX2-1 knockdown could be complemented by expression of a siRNA-resistant construct (Figure 3.8A- B) suggesting that changes in peroxisome density were due to knockdown of PEX2 and not off- target effects. I concluded that PEX2 is required for amino acid starvation induced pexophagy. 55

Figure 3.7. PEX2 is Required for Amino Acid Starvation Induced Pexophagy (A) HeLa cells were transfected with non-targeting siRNA (siCtrl) or with siRNA against PEX2, PEX10, or PEX12 for 48 hours. The cells were then grown in regular DMEM media or starved of amino acids in HBSS media for 16 hours. The cells were then fixed and stained for the peroxisomal membrane protein PMP70. Scale bars measure 20µm. (B) Box plot of the peroxisomal density of cells following amino acid starvation. Plotted are a total of 150 cells from 56

3 independent trials. Significance is as with respect to siCtrl DMEM. (C) HeLa cells were mock transfected, transfected with non-targeting siRNA (siCntl) or transfected with siRNA against PEX2, PEX10, or PEX12 for 72 hours. A cDNA library was created from the cell lysates and the relative quantities of PEX2, PEX10, and PEX12 transcripts was determined by qPCR. Light grey bars denote off-target effects and dark grey bars denote expected knockdowns. * p < 0.05; ** p < 0.01; ns p > 0.05 (not significant).

Figure 3.8. PEX2 Expression Complements PEX2 Knockdown (A) HeLa cells were transfected with non-targeting siRNA or with siRNA against PEX2 for 48 hours and co-transfected with PEX2-siR-FLAG, a construct which is not knocked down by siPEX2-1. The cells were then fixed and stained for the peroxisomal membrane protein PMP70. Scale bars measure 20µm. (B) Box plot of the peroxisomal density of cells following amino acid starvation. Plotted are a total of 10 cells. Significance is as with respect to siCtrl-mock or siPEX2-1-mock. ** p < 0.01. 57

3.2.7 NBR1 is Recruited to Peroxisomes during Amino Acid Starvation

To confirm that the PEX2-induced pexophagy and the amino acid starvation induced pexophagy were indeed occurring via the same mechanism, I next examined whether NBR1 was recruited to the peroxisomes during amino acid starvation. HeLa cells were starved of amino acids in HBSS media for timepoints between 0 and 4 hours, and I examined the recruitment of NBR1 to peroxisomes using immunofluorescent staining of NBR1 and PMP70. To quantify recruitment, a one-way Manders’ coefficient of NBR1 on PMP70 was calculated.

Following one hour of HBSS starvation, NBR1 recruitment to peroxisomes increased significantly, and continued to increase up to 4 hours following amino acid starvation (Figure 3.9AB). I concluded that NBR1 was being recruited to peroxisomes during amino acid starvation and that both PEX2 expression and amino acid starvation induce pexophagy through the same general mechanism.

Figure 3.9. NBR1 is Recruited to Peroxisomes during Amino Acid Starvation (A) HeLa cells were grown in either the growth media DMEM or the amino acid starvation media HBSS. Scale bar measures 20µm. (B) Box plot of Manders’ coefficients showing the fraction of NBR1 which is colocalized with PMP70-positive puncta. Plotted are 150 cells from three trials. * p < 0.05. *** p < 0.001. ns p > 0.05 (not significant).

3.2.8 NBR1 is Required for PEX2-mediated Pexophagy

To further examine the importance of NBR1 in pexophagy, I investigated whether NBR1 was required for PEX2-mediated pexophagy. 72 and 48 hours prior to fixation, HeLa cells were transfected with non-targeting siRNA, or with siRNA against two different autophagy receptors, p62 and NBR1. 24 hours prior to fixation, HeLa cells were transfected with PEX2-FLAG to induce pexophagy. The cells were then fixed and stained for PMP70 and the peroxisome density was quantified as before.

In mock transfected cells, cells transfected with non-targeted siRNA, and cells transfected with siRNA against p62, peroxisome loss occurred as normal upon expression of PEX2 (Figure 3.10AB). However, in cells transfected with siRNA against NBR1, peroxisome loss was not observed following PEX2 expression. I concluded that NBR1 is required for PEX2- mediated pexophagy.

______Figure 3.10. PEX2-mediated Pexophagy requires the NBR1 Autophagy Receptor (A) HeLa cells were mock transfected, transfected with non- targeting siRNA (siCtrl) or with siRNA against p62 or NBR1 for 48 hours. The cells were then transfected with PEX2-FLAG for 24 hours and then fixed and stained for the peroxisomal membrane protein PMP70 and with an antibody against the FLAG epitope. Scale bars measure 20µm. (B) Box plot of the peroxisomal density of cells following PEX2 expression. Plotted are a total of 50 cells from 3 independent trials. ** p < 0.01; ns p > 0.05 (not significant). 59

3.2.9 PEX2 Expression induces Ubiquitination of the Peroxisome Surface

To better understand the mechanism of PEX2-mediated pexophagy, I next wanted to identify the substrate(s) of PEX2 enzymatic activity. Based on a literature review, PMP70 and PEX5 were identified as likely substrates of ubiquitination. The matrix protein catalase was also examined as a negative control. In order to determine whether these proteins were ubiquitinated during amino acid starvation, stably expressed HA-Ub was immunoprecipitated from the HEK293 cell line and the immunoprecipitated proteins were separated on an acrylamide gel and probed with antibodies against the candidate proteins.

In cells starved of amino acids, PMP70 and PEX5 but not catalase were found to be ubiquitinated during amino acid starvation (Figure 3.11A). However, in cells grown in normal growth media, ubiquitination of PMP70 and PEX5 was not detected. I concluded that PMP70 and PEX5 are ubiquitinated during amino acid starvation.

Next, I wanted to determine whether PMP70 and PEX5 ubiquitination was mediated by PEX2. The experiment was repeated with knockdowns of PEX2, PEX10, or PEX12. In PEX2- depleted cells, ubiquitination of PMP70 and PEX5 no longer occurred (Figure 3.11B). However, in PEX10 and PEX12-depleted cells, ubiquitination proceeded as normal during amino acid starvation in HBSS. I concluded that PMP70 and PEX5 are ubiquitinated by PEX2 during amino acid starvation. 61

Figure 3.11. PEX5 and PMP70 are Ubiquitinated by PEX2 (A) HEK293 cells stably expressing an HA-Ub construct under the control of a tamoxifen- inducible promoter were depleted of amino acids for four hours in HBSS media which either contained or did not contain the proteasomal inhibitor MG132 (10µM) and the lysosomal inhibitor chloroquine (10nM). Ubiquitinated proteins were immunoprecipitated with an antibody against the FLAG epitope and lysates and immunoprecipitatations were blotted for PMP70, PEX5, catalase, and HA. (B) The same cell line was transfected with non-targeting siRNA (siCntl) or with siRNA against PEX2, PEX10, or PEX12.

3.2.10 PEX2 Expression induces Ubiquitination of PEX5 and PMP70

To investigate the mechanism of PEX2-mediated pexophagy, I next asked whether ubiquitination of the peroxisomes occurs during PEX2 expression. A HEK293 cell line stably transfected with an HA-Ub construct under the control of a tamoxifen-inducible promoter was used to express tagged ubiquitin. From these cells, lysates were collected and a membrane fraction was prepared by centrifugation at 25,000g. Next, the membrane fraction was further 62 enriched for peroxisomes by centrifugation at 100,000g on an iodixanol gradient gel, and the enriched peroxisome fraction was separated on an acrylamide gel and probed for ubiquitination. PMP70 was used as a marker of peroxisomes, calnexin was used as a marker of the endoplasmic reticulum, and Mfn2 was used as a marker of mitochondria.

24 hours prior to lysis, cells were transfected with PEX2-FLAG, and expression of HA- Ub was induced by tamoxifen. The cells were then lysed in a buffer containing the proteasomal inhibitor MG132. Peroxisomes were enriched into the medium and heavy fractions while the ER and mitochondria preferentially migrated to the light and medium fractions. In cells expressing both HA-Ub and PEX2-FLAG, ubiquitination of the medium and heavy fractions was significantly increased compared to cells expressing only HA-Ub (Figure 3.12AB). I concluded that PEX2 ubiquitinates the peroxisome surface.

Figure 3.12. PEX2 Expression Induces Ubiquitination of the Peroxisome Surface (A) The stably transfected HA-Ub HEK293 cell line was transfected with either an empty FLAG vector or PEX2-FLAG. Four hours prior to lysis, the cells were treated with the proteasomal inhibitor MG132 (10µM). Following treatment, cell lysates were collected (WCL), the total membrane fraction was separated (TM), and the TM fraction was further separated into light (lig), medium (med), heavy (hea), and pellet (pel) fractions. Each fraction were then analyzed by immunoblot using antibodies against HA, PMP70 (peroxisome membrane), Mfn2 (mitochondrial outer membrane), calnexin (ER membrane), and FLAG as indicated. (B) Bar graph showing the relative HA signal greater than 48kDa from the total membrane fraction (TM) and the heavy fraction (heavy) lanes from three independent experiments. * p < 0.05; ns p > 0.05 (not significant).

3.3 Discussion

3.3.1 PEX2 is Necessary and Sufficient for Mammalian Pexophagy

This project identifies the E3 ubiquitin ligase PEX2 as the causative agent for pexophagy. I demonstrate that PEX2 is necessary for pexophagy as depletion of this enzyme results in the inability of cells to clear their peroxisomes when challenged by amino acid starvation. 64

Furthermore, I demonstrate that PEX2 is sufficient for pexophagy as expression of this enzyme results in peroxisomal degradation via autophagy.

Interestingly, depletion of PEX10 and PEX12 did not prevent pexophagy during amino acid starvation. PEX10 is thought to be structurally important to the PEX2/10/12 complex (El Magraoui et al., 2012) and is thought to enhance PEX2 activity (El Magraoui et al., 2013). The best explanation for my findings is that the starved cell upregulates PEX2 expression enough to compensate for the lack of PEX10.

Overexpression of PEX10 and PEX12 did not induce significant loss of peroxisomes. PEX12 has previously been shown to monoubiquitinate PEX5 (Platta et al., 2009) and monoubiquitinated PEX5 has been shown to lead pexophagy from a variety of experiments (Kim et al., 2008; Nordgren et al., 2015; Zhang et al., 2015) as well as in unpublished experiments from our group. The most likely explanation for these findings is that PEX2 and PEX12 ubiquitinate their substrates on different residues or with different linkages. Certain types of ubiquitination are removed more effectively than others and indeed, it is thought that the thioester bond formed during cysteine ubiquitination is more readily removed than lysine ubiquitination.

PEX2 has previously been shown to polyubiquitinate PEX5 (Platta et al., 2009). However, Nordgren et al. (2015), Zhang et al. (2015), and my own work only found monoubiquitinated PEX5 during pexophagy. A fusion construct of UbK0-PMP34, which contains a lysine-less ubiquitin in frame with a peroxisomal membrane protein, was also shown to lead to pexophagy (Kim et al., 2008). This construct cannot be poly-ubiquitinated, which suggests that poly-ubiquitination is not a requirement for pexophagy. The best way to investigate whether polyubiquitination occurs would be to perform mass spectrometry on purified PEX5 or PMP70 from starved or PEX2 expressing cells.

In yeast, all three E3 ubiquitin ligases Pex2, Pex10, and Pex12 have been shown to ubiquitinate Pex3 leading to its degradation (Williams and van der Klei, 2013). Furthermore, degradation of Pex3 has been linked to pexophagy (Bellu and Kiel, 2003; Motley et al., 2008; Burnett et al., 2015). Despite these two findings, ubiquitination of the yeast peroxisome surface is not thought to induce pexophagy (Nuttall et al., 2014), and yeast autophagy receptors such as Atg30 and Atg36 would not be influenced by Pex3 ubiquitination as they do not contain UBA 65 domains. Therefore, the purpose of Pex3 ubiquitination is not clear at this time. It is important to clarify that in spite of my data on the mammalian system, I believe that Pex2 likely does not play a similar role in yeast pexophagy.

3.3.2 PEX5 and PMP70 Ubiquitinated by PEX2 during Pexophagy

I demonstrated that PEX2 activity led to ubiquitination of at least PEX5 and PMP70 during amino acid starvation, if not other PMPs as well. In yeast, mutation of the ubiquitinated lysine on Pex3 led to Pex3 being ubiquitinated on other residues instead (personal correspondence with Dr. Chris Williams), suggesting that the yeast peroxisomal E3 ubiquitin ligase is promiscuous in its activity as well. One major question that follows from this is whether the site of ubiquitination leads to differing signaling through downstream effectors. As a counterpoint however, linear fusion of ubiquitin to PMP34 also led to pexophagy (Kim et al., 2008), suggesting that the site of ubiquitination may not be important after all.

Unpublished work from our lab shows that the AAA-ATPase is a key regulator of pexophagy. The AAA-ATPase complex is known to remove ubiquitinated PEX5 from the surface of the peroxisome and unpublished work from our group has shown that loss or inhibition of the complex led to loss of peroxisomes. The AAA-ATPase complex has only been shown to operate on PEX5; however, prior to this project it had also not been shown that other PMPs can be ubiquitinated. It would be interesting to examine whether the AAA-ATPase complex indiscriminately removes all ubiquitinated proteins from the peroxisome or whether its activity is specific to PEX5.

3.3.3 NBR1 is the key Autophagy Receptor in Pexophagy

The autophagy receptor NBR1 is the key receptor in PEX2-mediated pexophagy. My work shows that NBR1 is rapidly recruited to PEX2-expressing peroxisomes and that loss of NBR1 inhibits PEX2-mediated peroxisome loss. Although several autophagy receptors, including p62, NBR1, OPTN, and NDP52, contain a ubiquitin binding domain and a LIR region, 66 the J domain of NBR1 uniquely qualifies NBR1 as a pexophagic receptor by allowing NBR1 to interact with peroxisomal membranes even in the absence of ubiquitination.

Multiple publications have shown that p62 plays a role in pexophagy (Kim et al., 2008; Deosaran et al., 2013; Zhang et al., 2015) and in my work, although depletion of p62 did not cause a significant change in peroxisome density, I did observe that fewer sip62 cells had very low peroxisome density (Figure 3.10B). I therefore propose a model where NBR1 acts the primary autophagy receptor and p62 acts as a secondary autophagy receptor. Through the J domain, NBR1 is associated with peroxisomes and ideally located to bind ubiquitinated PMPs. Through the PB1 domain, NBR1 is able to recruit other NBR1 molecules as well as p62, leading to the formation of an autophagy receptor complex. This complex causes ubiquitinated peroxisomes to cluster together, as I observed in multiple experiments (Figure 3.1A, Figure 3.2B, Figure 3.3B, Figure 3.4A, Figure 3.5A, Figure 3.8A), and to be more efficiently packaged into autophagosomes. Supporting this model, p62 was found to stimulate clustering of ubiquitinated mitochondria, and to accelerate mitochondrial degradation, but was not required for mitophagy (Narendra et al., 2010a).

3.3.4 Impact of Work

The identification of Parkin (Narendra et al., 2008), an E3 ubiquitin ligase which is necessary and sufficient for both ROS-induced and CCCP-induced mitophagy, led to a rush of publications regarding mitophagy. Within just a few years of Parkin identification, several substrates for ubiquitination were identified (Chan et al., 2011), novel regulatory mechanisms such as the fusion and fission of mitochondria were described (Gomes and Scorrano, 2012), ubiquitination of Parkin was observed (Durcan et al., 2012), and phosphorylation of ubiquitin in mitophagy was shown to play an important role (Kazlauskaite et al., 2014). Furthermore, second order effects such as the deubiquitination of ubiquitinated substrates (Bingol et al., 2014; Cunningham et al., 2015) are now becoming better understood. I hope that the identification of PEX2 and its role in amino acid starvation will lead to a similar renaissance in the mammalian pexophagy field. 67

Chapter 4 4 PEX2 is Regulated by the mTORC1 Signaling Pathway during Amino Acid Starvation

Dr. Valeria Di Giovanni performed all mouse work for Figure 4.1 and Figure 4.2. Dr. Ling Zhang performed catalase, PMP70, TOMM20, and GAPDH Western blotting for Figure 4.2. Ms. Tatiana Shatseva performed PEX2 Western blotting for Figure 4.1 and Figure 4.2, PMP70 tissue staining and imaging of mouse livers for Figure 4.2 and cell culturing and Western blotting for Figure 4.6Dr. Tim van Zutphen performed rat hepatocyte extraction, cell culturing and Western blotting for Figure 4.4. Dr. Moshe Kim assisted in the construction of the PEX2-FlpIn-FLAG construct for Figure 4.10 and Figure 4.11. All other experiments were performed by me. Figures 4.1-4.7 inclusive and Figure 4.8A-C are adapted from Sargent et al. (2016). PEX2 is the E3 Ubiquitin Ligase Required for Pexophagy during Starvation. JCB.

4.1 Introduction

In the first chapter, I thoroughly characterized a novel function for PEX2 as the E3 ligase and causative agent in pexophagy. However, many of these experiments utilize exogenous expression of PEX2 that would not be possible in nature. Put another way, it is not clear how cells regulate the function of PEX2. In the second chapter, I show that PEX2 is regulated at the post-translational level via mTORC1 signaling and use a mouse model to show how mammals respond to protein starvation by degrading their peroxisomes via autophagy.

4.2 Results

4.2.1 Peroxisome Loss occurs in the Mouse Liver during Protein Starvation

Peroxisome loss has previously been observed in Kwashiorkor patients: children under the age of 5 who are nutritionally protein deficient. In collaboration with Dr. Robert Bandsma’s 68 group, we decided to investigate whether peroxisome loss also occurs in a mouse model for protein restriction. The liver was chosen as the key organ of interest because of the important role that peroxisomes play in the liver (Baes and Veldhoven, 2016), as well as the severe loss of liver function observed in Kwashiorkor patients. To replicate this condition, control animals were free-fed a diet consisting of 18% (w/w) protein, while starved animals were free-fed a diet of 1% (w/w) protein to replicate this condition. Newly weaned mice were fed their diet for 12 days, and then the animals were sacrificed by cervical dislocation and examined.

In the livers of protein restricted mice, visible loss of peroxisomes was observed when compared with the control mice (Figure 4.1A). We concluded that protein starvation causes loss of peroxisomes in the livers of our animal model.

Figure 4.1. Peroxisomes are Degraded in a Protein Restricted Mouse Model (A) Mice were fed a control diet containing 18% protein (w/w) or a protein restriction diet containing 1% protein (w/w). Thin slices of the livers were stained with PMP70 (green) as a peroxisomal marker and with DAPI (blue) as a marker of the nucleus. Shown are images from two different animals for each condition.

4.2.2 PEX2 Protein Levels Increase during Protein Starvation in the Mouse Liver

Next, we were curious whether peroxisome loss caused concomitant changes in PEX2 expression. Following 12 days of protein restriction, we examined PEX2 expression by immunoblotting for PEX2 and peroxisome loss by immunoblotting for the peroxisome markers PMP70 and catalase. As a control, we also probed for the mitochondria marker TOMM20 and the cytosol marker GAPDH.

Following protein restriction, PEX2 protein levels were 3.5 fold higher (Figure 4.2AC), suggesting a dramatic increase in PEX2 expression. Additionally, there was a reduction in the peroxisomal proteins PMP70 and catalase, but not in the mitochondrial protein TOMM20, suggesting that selective peroxisome loss was occurring. To confirm that the loss of PMP70 was due to autophagy, we treated the mice with the lysosome inhibitor chloroquine at 50mg/kg/day (Figure 4.2BC). We concluded that PEX2 protein levels were increased in the liver during protein starvation and that PEX2 regulation was concomitant with peroxisome loss.

Figure 4.2. PEX2 Protein Levels Increase in a Protein Restricted Mouse Model 70

(A) Whole liver lysates from control and protein restricted mice were separated by SDS-PAGE and blotted for PEX2, catalase, PMP70, TOMM20, and GAPDH. (B) Whole liver lysates from control mice and mice fed a protein restricted diet containing chloroquine were separated by SDS-PAGE and blotted for PMP70 and GAPDH. (C) Bar graphs represent the relative expression of proteins in (A) and (B) relative to GAPDH. * p < 0.05. ns not significant.

4.2.3 PEX2 Protein Levels Increase during Amino Acid Starvation in Cultured HeLa Cells

I next returned to the cultured cell model to examine the kinetics of these cellular events. I performed a timecourse experiment where HeLa cells were starved for 0-24 hours in HBSS media. From these cells, lysates were collected, separated on an acrylamide gel, and blotted for PEX2, PMP70 as a marker of peroxisomes, and GAPDH as a loading control.

Following 1 hour of amino acid starvation, PEX2 was found to be significantly increased while PMP70 protein levels were unchanged (Figure 4.3A). At the 4 hours timepoint, as well as subsequent timepoints up to 24 hours, PEX2 returned to basal levels. I concluded that PEX2 expression during amino acid starvation is biphasic, and that PEX2 protein levels increase rapidly following amino acid starvation.

Figure 4.3. PEX2 Protein Levels Increase during Amino Acid Starvation in HeLa cells (A) HeLa cells were starved of amino acids for 0 to 24 hours as indicated in Hank’s Balanced Salt Solution (HBSS) and analyzed by immunoblotting for PEX2, the peroxisomal marker PMP70, and GAPDH. Line graphs show the amount of each protein relative to GAPDH as amino acid starvation continues.

4.2.4 PEX2 Protein Levels Increase during Amino Acid Starvation in Primary Liver Hepatocytes

To confirm our findings in a primary cell line, rat hepatocytes were isolated and a similar timecourse experiments was performed with timepoints from 0-6 hours. As before, lysates were collected, separated on an acrylamide gel and blotted for PEX2, PMP70 as a marker of peroxisomes, TOMM20 as a marker of mitochondria, and GAPDH as a loading control.

Following 1 hour of amino acid starvation, PEX2 was significantly increased while PMP70 protein levels were unchanged (Figure 4.4). At the 4 hours timepoint, PEX2 expression returned to basal levels. It was reassuring to replicate the findings in a primary cell line.

Figure 4.4. PEX2 Protein Levels Increase during Amino Acid Starvation in Primary Rat Hepatocytes (A) Primary rat hepatocytes were starved of amino acids for 0 to 6 hours as indicated in Hank’s Balanced Salt Solution (HBSS) and analyzed by immunoblotting for PEX2, the peroxisomal marker PMP70, the mitochondrial marker TOMM20, and GAPDH. Line graphs show the amount of each protein relative to GAPDH as amino acid starvation continues.

4.2.5 PEX2 is Stabilized during mTORC1 Inhibition

I next wanted to determine whether TOR signaling was involved in the signal transduction which leads to an increase in PEX2 protein during amino acid starvation. TOR is the major signaling pathway in growth and proliferation and is known to be active in the presence of amino acids and inactive in the absence of amino acids (Hara et al., 1998). The mammalian TOR complex (mTORC1) member raptor is inhibited by rapamycin, leading to tight 72 binding and inhibition of the mTORC1 complex (Kim et al., 2002; Hara et al., 2002). Therefore, if PEX2 protein levels increase by a TOR-dependent mechanism, I would expect treatment with rapamycin to likewise cause an increase in PEX2 protein levels.

HeLa cells were treated with 5µM rapamycin for 0 to 24 hours. This concentration of rapamycin is known to inhibit mTORC1 but not mTORC2 (Thoreen et al., 2009). Following 1 and 2 hours of rapamycin treatment, PEX2 levels were increased, akin to what was observed for amino acid depletion (Figure 4.5A). At the 4 hour timepoint, as well as longer timepoints up to 24 hours, PEX2 protein levels returned to their basal level. I concluded that PEX2 protein levels increase during mTORC1 inhibition and that the regulation of PEX2 during amino acid starvation is likely mTORC1 dependent.

Figure 4.5. PEX2 Protein Levels Increase during mTORC1 Inhibition (A) HeLa cells were treated with 5µM rapamycin for 0 to 24 hours as indicated to inhibit mTORC1 and cell lysates were analyzed by immunoblotting for PEX2, the peroxisomal marker PMP70, and GAPDH. Line graphs show the amount of each protein relative to GAPDH as amino acid starvation continues.

4.2.6 PEX2 Regulation Kinetics are Similar to LC3 Conversion

We were curious whether the kinetics of PEX2 regulation were similar to those of other autophagy proteins such as LC3. LC3 is an autophagosomal protein which is also under the control of mTORC1 signaling. During the induction of autophagy, LC3-I is conjugated to PE at the phagophore and assists in the elongation of the phagophore and in substrate recognition. The conjugated species is gel shifted and is referred to as LC3-II. HeLa cells were grown in HBSS or were treated with rapamycin to induce autophagy. Following 0-6 hours of autophagy induction, lysates were collected and blotted for PEX2 and 73

LC3. We found that LC3 conversion and the initial upregulation of PEX2 occur on a similar timescale during either amino acid starvation or mTORC1 inhibition (Figure 4.6A-B).

Figure 4.6. LC3 Conversion and PEX2 Regulation occur on a Similar Timescale (A) HeLa cells were grown in HBSS for 0-6 hours as indicated to starve the cells of amino acids and cell lysates were analyzed by immunoblotting for PEX2, LC3, and GAPDH. Line graphs show the amount of each protein relative to GAPDH as amino acid depletion continues. (B) HeLa cells were treated with 5µM rapamycin for 0 to 24 hours as indicated to inhibit mTORC1 and cell lysates were analyzed by immunoblotting for PEX2, the peroxisomal marker PMP70, and GAPDH. Line graphs show the amount of each protein relative to GAPDH as rapamycin treatment continues. * p < 0.05.

4.2.7 Peroxisomes are Degraded during mTORC1 Inhibition

I hypothesized that peroxisome loss during amino acid starvation was dependent on a TOR-mediated increase in PEX2 expression. To test this hypothesis, HeLa cells were treated with rapamycin for 0 to 48 hours and then fixed and stained with an antibody against PMP70 as before. After 24 and 48 hours of rapamycin treatment, there was a significant decrease in peroxisome density (Figure 4.7AB). I concluded that direct inhibition of mTORC1 caused an increase in PEX2 protein levels and subsequently lead to pexophagy. 74

Figure 4.7. Rapamycin Treatment Results in Peroxisome Loss (A) HeLa cells were treated with 5uM rapamycin for 0-48 hours and then fixed and stained for the peroxisomal membrane protein PMP70. (B) Box plot of the peroxisomal density of cells in (A). The peroxisomal density was calculated by quantifying the fluorescent PMP70 puncta and dividing by the cell volume. Plotted are a total of 150 cells from 3 independent trials.

4.2.8 PEX2 mRNA is Unaffected by Amino Acid Starvation or mTORC1 Inhibition

It is unusual that PEX2 protein levels increase during mTORC1 inhibition. Most cap- dependent gene products decrease during mTORC1 inhibition as active mTORC1 phosphorylates 4E-BP, leading to its dissociation from eIF4E and the activation of cap- dependent mRNA translation (Gingras et al., 1999). Furthermore, the kinetics of PEX2 regulation are uncommonly rapid: I observed a twofold increase in just an hour (Figure 4.3A, Figure 4.4, Figure 4.5A). To account for the speed of this regulation, I hypothesized that PEX2 expression may be regulated in a post-translational manner.

Protein expression can be regulated at any of four levels: transcription, mRNA stability, translation, or protein stability. If PEX2 expression is regulated at the level of transcription or mRNA stability, I would expect to see an increase in PEX2 mRNA during amino acid starvation or mTORC1 inhibition. However, if PEX2 expression is regulated at the level of translation or protein stability, I would expect to see no change in PEX2 mRNA during amino acid starvation. To investigate PEX2 mRNA levels, qPCR was performed on a cDNA library synthesized by first-strand synthesis. 75

As a control, I knocked down PEX2 mRNA expression using either of two siRNA constructs. Although PEX2 mRNA levels were significantly affected by siRNA treatment, I was unable to observe a significant change in PEX2 mRNA levels during amino acid starvation or rapamycin treatment (Figure 4.8A). I concluded that PEX2 regulation during both amino acid starvation and mTORC1 inhibition occurs post-transcriptionally.

Figure 4.8. PEX2 mRNA Expression is Unaffected by Amino acid starvation or mTORC1 Inhibiton (A) HeLa cells were transfected with a non-targeting siRNA (siControl) for 72 hours, transfected with siRNA against PEX2 for 72 hours, starved of amino acids in HBSS for 1 hour or treated with 5uM rapamycin for 1 hour. A cDNA library was created from the cell lysates and the relative quantity of PEX2 transcripts was determined by qPCR. Bars represent an average of three independent trials. * p < 0.05.

4.2.9 PEX2 Protein Levels are Stabilized by Proteasomal Inhibition or Depletion of PEX1/6/26

One possible mechanism by which PEX2 could be regulated at the level of protein stability is through ubiquitination and proteasomal degradation. Given that PEX2 is known to interact with at least two other E3 ubiquitin ligases, I hypothesized that PEX2 may be ubiquitinated. Additionally, I had noticed during previous experiments that the PEX2-FLAG construct expressed poorly compared to the PEX10-FLAG and PEX12-FLAG constructs in spite of identical promoters, identical topologies, similar primary amino acid sequences and a smaller molecular weight (Figure 4.9A). 76

I hypothesized that inhibition of the proteasome would protect ubiquitinated PEX2 from degradation and stabilize PEX2 expression. To investigate, I treated cells with the proteasomal inhibitor MG132 for 0 to 4 hours and examined PEX2 protein levels. PEX2 expression more than doubled in four hours, implying a half-life of less than four hours (Figure 4.9B-C).

Unpublished work from our lab has suggested that ubiquitinated proteins are rapidly removed from the peroxisome surface by the AAA-ATPase PEX1/6/26. I hypothesized that if PEX2 is ubiquitinated, it may be removed by the AAA-ATPase prior to its degradation. I was curious whether depletion of this complex with siRNA would stabilize the ubiquitinated pool and increase steady state PEX2 protein levels. The expression of PEX1 or PEX26 was depleted using siRNA and PEX2-FLAG was co-expressed. During PEX1 or PEX26 depletion, PEX2 protein levels increased (Figure 4.9D). I concluded that PEX2 is rapidly degraded by the proteasome during basal conditions and that it may be removed from the peroxisome by the AAA-ATPase complex. However, follow up experiments should be performed to further investigate this phenomenon.

Figure 4.9. PEX2 is Stabilized by Proteasomal Inhibition or Depletion of the Peroxisomal AAA-ATPase Complex (A) HeLa cells were transfected with PEX2-FLAG, PEX10-FLAG, or PEX12-FLAG. The cells were then treated with the proteasomal inhibitor MG132 for 2 hours and cell lysates were collected, separated on an acrylamide gel, and blotted with an antibody against the FLAG epitope. (B) HeLa cells were transfected with PEX2-FLAG and treated with the proteasomal inhibitor MG132 for 0-4 hours. (C) Bar graphs show the amount of each protein relative to PMP70 as MG132 treatment continues. (D) HeLa cells were transfected with non-targeting siRNA or with siRNA against PEX1 or PEX26. The cells were then cotransfected with PEX2- FLAG. Lysates were collected, separated on an acrylamide gel, and blotted for FLAG to show PEX2 protein levels, PMP70 and PEX14 to show peroxisome levels, PEX1 to demonstrate knockdown, and GAPDH as a loading control.

4.2.10 Development of an Inducible PEX2 Expressing Cell Line

In order to further investigate PEX2 protein stability, I developed an inducible PEX2- FLAG stable HeLa cell line under the control of a tetracycline promoter using the FlpIn system (ThermoFisher). This cell line expresses PEX2-FLAG in the presence of the tetracycline derivative doxycycline and is therefore independent of any PEX2 transcriptional regulation, allowing for the isolation of post-transcriptional regulation in experiments.

The inducible cell line was treated with doxycycline for 24 hours. After 24 hours, cells were fixed and stained for the FLAG epitope and for PMP70. Visible loss of peroxisomes was observed and quantified in the stable cell line when compared to untransfected or uninduced cells (Figure 4.10AB). In a separate experiment, protein lysates were collected from the cell line following 48 hours of doxycycline treatment. Lysates were probed using antibodies against FLAG and PMP70. An increase in PEX2-FLAG expression and a loss of PMP70 protein was observed in the stable cell line when compared to untreated or untransfected cells (Figure 4.10C).

4.2.11 Exogenously Expressed PEX2 is Stabilized during Amino Acid Starvation or mTORC1 Inhibition

Using the inducible cell line, I induced the expression of PEX2-FLAG using doxycycline for 24 hours to create a pulse of PEX2 expression, then chased with amino acid starvation, or rapamycin treatment. Treatments were performed in the presence or absence of cyclohexamide to prevent or allow new protein translation, in order to see if protein synthesis was required for PEX2 regulation. Following one hour amino acid starvation or TOR inhibition, PEX2 protein stability was increased, and the increase in PEX2 protein stability did not require new protein translation (Figure 4.11AB). I concluded that the key effector for PEX2 is translated upstream to mTORC1 signaling.

Figure 4.10. Characterization of the Inducible PEX2-FLAG HeLa Cell Line (A) HeLa cells were stably transfected with the PEX2-FlpIn plasmid. Expression of this construct was induced by 24 hour treatment with doxycycline at 2µg/mL. These cells were stained with antibody against PMP70 and the FLAG epitope. (B) Box plots represent the peroxisomal density from 10 cells. (C) Lysates were collected from these cells after 48 hours of induction, separated on an acrylamide gel and blotted using antibodies against PMP70, GAPDH, and the FLAG epitope.

Figure 4.11. PEX2 is Stabilized during Amino Acid Starvation or mTORC1 Inhibition (A) HeLa cells were transfected with PEX2-FLAG and grown in DMEM or HBSS for one hour in the presence or absence of cyclohexamide (5µM). Cell lysates were collected and blotted for FLAG and PMP70 as a marker of peroxisomes. (B) Bars represent three independent trials and show the amount FLAG signal relative to PMP70 signal. * p < 0.05.

4.3 Discussion 4.3.1 Amino Acid Starvation and mTORC1 Inhibition Cause an Increase in PEX2 Protein Levels

During amino acid starvation or direct mTORC1 inhibition, the expression of most proteins is downregulated with the dephosphorylation of 4E-BP and associated decrease in cap- dependent translation (Gingras et al., 1999). In contrast, PEX2 expression was found to increase during either of these conditions. There are other proteins which follow a similar pattern, such as plasma membrane amino acid transporters; however, these proteins typically have slower 81 kinetics than what I observe for PEX2. Based on these fast kinetics, and the fact that PEX2 mRNA transcripts do not increase during the same period, I concluded that PEX2 is regulated post-transcriptionally. Importantly, this finding is the final link in the connection between amino acid starvation and pexophagy.

Based on my findings I propose a new model (Figure 4.12).

Figure 4.12. Proposed Model for PEX2 and mTORC1 in Mammalian Pexophagy During basal conditions, PEX2 is rapidly degraded through mTORC1 activity and the AAA-ATPase is able to remove peroxisome membrane proteins as fast as they are ubiquitinated. Therefore, peroxisomes are protected. During pexophagic conditions however, mTORC1 is inhibited, PEX2 is stabilized and peroxisomal membrane proteins are rapidly ubiquitinated. The AAA-ATPase is overwhelmed, leading to the stabilization of surface ubiquitination and subsequent pexophagy.

It is still not clear how individual peroxisomes are targeted for degradation, for example during quality control. By increasing the expression of PEX2, the cell can effectively target all peroxisomes for degradation, but cannot target individual peroxisomes. Other research groups have shown that plant peroxisomes are subjected to quality control via autophagy (Shibata et al., 2013; Yoshimoto et al., 2014), suggesting that there must be some mechanism to target PEX2 to specific peroxisomes selectively, to spatially regulate PEX2 activity on specific peroxisomes, or to regulate the ubiquitin signal on specific peroxisomes. This will expanded upon in the Discussion section.

4.3.2 Peroxisome Loss occurs in a Mouse Model for Protein Starvation and is Concomitant with an Increase in PEX2 Protein

I was able to replicate the PEX2 regulation findings in a mouse model for protein starvation, a primary rat hepatocyte model and a cultured cell model; however, I curiously observed that the PEX2 expression pattern differed between the chronic protein-starved animal model and the acute amino acid starved cell culture model. Specifically, I found that PEX2 expression was elevated in mouse livers by 3.5 fold as long as 12 days after starvation, and furthermore that this data corroborated with previous data from a chronically protein-starved rat model which was not included in this thesis. This was in contrast with the cultured cell model where PEX2 expression was found to be elevated between one and two hours following amino acid starvation but had returned to normal by four hours following amino acid starvation.

One key difference in these experiments is the cell type. HeLa cells are a human pancreatic cancer cell line, while the liver lysates include a number of cell types in the murine liver. Furthermore, the livers are connected via the bloodstream to a complex organism which may have some compensatory functions to alleviate the starvation phenotype. It would be interesting to further investigate these differences.

I observed loss of peroxisomes in the mouse liver, as was previously observed in human Kwashiorkor patients. Excitingly, this suggests a potential mechanism by which protein starvation inhibits mTORC1, leading to an increase in PEX2 expression and subsequent peroxisome degradation. The logical next step would be to utilize PEX2-/- knockout mice to 83 examine whether peroxisome loss still occurs. Unfortunately, PEX2-/- knockout mice do not have any peroxisomes at all due to the role of PEX2 in biogenesis (Faust et al., 2001). However, tissue specific PEX2-/- or NBR1-/- knockout mice could be used to investigate the importance of pexophagy in the survival of protein-starved mice. Additionally, the animals could be treated with peroxisome proliferators to increase the number of peroxisomes in order to isolate the effect of protein starvation in the absence of peroxisome loss.

4.3.3 The PEX2 Protein is Unstable

The PEX2 protein has a very short half-life, is rapidly degraded by the proteasome, and may be regulated by the peroxisomal AAA-ATPase. Additionally, the PEX2 regulatory machinery is itself regulated post-translationally due to the fact that PEX2 regulation occurs as normal in the presence of cyclohexamide. The most likely conclusion of these data is that PEX2, or the enzyme(s) which lead to its degradation, are regulated by mTORC1 phosphorylation. This will be discussed in greater detail in the Discussion section.

Because PEX2 is necessary for pexophagy, it is essential for the cell to express PEX2 constitutively in order to mediate quality control of the peroxisomes. However, because PEX2 is sufficient for pexophagy, the expression of PEX2 must be tightly regulated to protect functional peroxisomes from autophagy. I propose a model where, during pexophagic conditions, this regulation is relaxed to allow for rapid degradation of the peroxisomes. This is an elegant model for regulation, however some of the key players are still not known. It is not clear whether PEX1/6/26 is involved in this regulation. One can easily imagine a model where PEX2 is constitutively ubiquitinated and recycled by the proteasome at all times, but can be stabilized on the peroxisomes during pexophagic conditions by inhibition of the AAA-ATPase complex.

4.3.4 Impact of Work

Understanding the regulation of PEX2 is imperative to understanding its function. While the first chapter in this thesis identifies PEX2 as the key E3 ubiquitin ligase in pexophagy, the second chapter mechanistically illustrates how cells transduce a signal from stimulus to response. 84

Importantly, it also shows a key difference between the regulation of PEX2 in cultured cells and complex organisms which is imperative to better understand if this work is to be translated to the clinic.

There is still much to learn about PEX2 regulation. How is PEX2 targeted to the proteasome? How is PEX2 stabilized during amino acid starvation and TOR inhibition? How are individual peroxisomes selectively degraded during quality control? These future directions will be expanded upon in the Discussion section. 85

Chapter 5 5 Discussion 5.1 Overview

Although this thesis brings us much closer to an understanding of the mechanism of mammalian pexophagy, there is still much more to be done. This chapter will highlight some of the key remaining knowledge gaps in pexophagy. I will focus on identifying and characterizing the key molecular players and their upstream and downstream effectors as well as more general questions, such as why cells degrade their peroxisomes during amino acid starvation, and how cells could target individual peroxisomes for autophagic degradation. Finally, I will finish my thesis with some final thoughts on the present state of the field.

5.2 Future Directions

5.2.1 The Role of PEX2, PEX10, and PEX12 at the Mammalian Peroxisome

A major finding from my work is that PEX2, PEX10, and PEX12 are not interchangeable enzymes. PEX2 is uniquely involved in mammalian pexophagy; while PEX10 and PEX12 seem to be dispensable. The key knowledge gap which remains is the physiological role of PEX10 and PEX12 in mammals. It is logical that each of the three E3 ligases would have unique roles but little has been done to identify what these roles are. Here, I will briefly highlight what is known about the E3 ligases in yeasts, plants, and mammals and analyze what their roles could be.

In S. cerevisiae, Pex2p, Pex10p, and Pex12p have distinct roles in the ubiquitination of the shuttling receptors Pex5p and Pex18p. Pex2p is uniquely thought to act as the E3 ligase in the poly-ubiquitination of Pex5p (Platta et al., 2009). Furthermore, Pex2p and Pex10p, but not Pex12p, are able to polyubiquitinate Pex18p (El Magraoui et al., 2013). It is unlikely that ubiquitination of these proteins plays a role in yeast pexophagy as the yeast autophagy adaptors do not possess ubiquitin binding domains; however, it is interesting that Pex2p is unique in these activities. 86

In A. thaliana, temperature sensitive pex6 mutants have very low levels of PEX5 (Burkhart et al., 2014), likely due to inefficient recycling of PEX5. However, pex2pex6 double mutants restore the normal levels of PEX5 while pex10pex6 double mutants do not. Furthermore, overexpression of PEX5 is able to complement pex10 mutations but not pex2 mutations (Burkhart et al., 2014). The authors conclude that PEX2 plays a role in PEX5 poly-ubiquitination and degradation while PEX10 plays a role in PEX5 mono-ubiquitination and recycling. Supporting this, Kaur et al. (2013) identified DSK2b, a member of the ubiquitin receptor family known to shuttle polyubiquitinated proteins to the proteasome, as a novel interactor with PEX2 (Kaur et al., 2013). While it is difficult to put too much weight on these findings carrying over to other species given that A. thaliana PEX12 is not required for import either (Prestele et al., 2010), it is interesting that PEX2 is again the more active enzyme.

The take away from these experiments is that, in comparison to PEX10 and PEX12, PEX2 is promiscuous in its activity. In S. cerevisiae, PEX2 can uniquely add additional ubiquitin moieties on Pex5p and Pex18p. In A. thaliana, PEX2 can uniquely add additional ubiquitin moieties on PEX5. In my own work in mammals, I also find that PEX2 is uniquely promiscuous in its ability to ubiquitinate PMP70.

Based on these findings, I propose a new model for the roles of PEX2/10/12. In my new model, differences in the function of the peroxisomal E3 ubiquitin ligases arise from features unique to each of the ligases: the promiscuity and tight regulation of PEX2, the central localization of PEX10 in the PEX2/10/12 complex (El Magraoui et al., 2012), and the mutated structure of the PEX12 active site (Prestele et al., 2010).

In my model for the roles of these enzymes, PEX2 is the most potent of the ligases and is promiscuous against multiple substrates. I propose that PEX2 is uniquely capable of lysine ubiquitinating PEX5 and ‘other’ PMPs such as PMP70. Because lysine ubiquitination is terminal, PEX2 is tightly regulated by the cell to keep protein expression low in order to prevent erroneous peroxisome degradation. The combination of low expression and high activity means that PEX2 has moderate activity during steady state conditions. It is essential that PEX2 is expressed at all times due to its role in biogenesis (Faust et al., 2001), and this constitutive expression is what allows the cells to quickly respond to pexophagy signals in the environment. 87

In my model, PEX10 serves primarily a structural role. In lower organisms, ubiquitination of the peroxisomal membrane does not lead to pexophagy and Pex10p is a functional E3 ligase with the ability to mono- and poly-ubiquitinate Pex18p. However, in mammals I propose that this activity has been lost to protect the cell from unnecessary loss of peroxisomes. Zhang et al. (2015) found that siPEX10 cells were not able to ubiquitinate PEX5 during oxidative stress, and this may be due to a critical structural role in the PEX2/10/12 complex. Additionally, loss of PEX10 was found to have the most pronounced effect on matrix protein import in PBD patients (Warren et al., 1998).

In my model, PEX12 plays a role exclusively in the cysteine-ubiquitination of PEX5. Due to its incomplete active site, PEX12 is an impotent enzyme and is unable to lysine- ubiquitinate PEX5 and other PMPs. This means that mammalian cells can express the protein at all times, ensuring that the PEX5 import cycle is functional while protecting the cell from unnecessary loss of functional peroxisomes.

Finally, in my model, the PEX1/6/26 complex serves as a threshold of ubiquitin signal. The complex removes ubiquitinated PEX5 faster than the basal level of PEX2/10/12 ubiquitination, ensuring that the peroxisome population is maintained. During pexophagic conditions, PEX2 activity exceeds this threshold and peroxisomes are targeted for autophagy. It is also possible that the PEX1/6/26 activity is modified, for example by ROS, on malfunctioning peroxisomes in order to lower or raise the threshold for pexophagy.

It is worth mentioning that this new model does not distinguish between mono- and poly- ubiquitination events. Zhang et al. (2015), Nordgren et al. (2015), and my own work did not detect any poly-ubiquitination of peroxisomes. However, more experimentation should be done to further investigate poly-ubiquitination, especially given that the autophagy receptors are known to differentially and preferentially bind certain poly-ubiquitin linkages.

5.2.2 p62 – Jack of All Trades, Master of One?

Among the autophagy receptors, p62 is the jack of all trades. It has been shown to be recruited during the autophagy of mitochondria, peroxisomes, ribosomes, invading pathogens, and cytosolic ubiquitin aggregates. While p62 does accelerate some of these autophagic events, 88 curiously, p62 does not seem to be required for any of them. In mitophagy, OPTN is the major player (Heo et al., 2015) and p62 has been shown to be dispensable (Narendra et al., 2010b). In xenophagy, OPTN, NDP52, and p62 have all been shown to have non-redundant roles (Cemma et al., 2011; Wild et al., 2011), although OPTN seems to be the primary autophagy receptor (Thurston et al., 2009). Furthermore, in both mitophagy and xenophagy, OPTN can be phosphorylated by TBK1 to increase its binding affinity for ubiquitinated proteins (Richter et al., 2016), suggesting an additional mode of regulation which is inaccessible to p62. In pexophagy, NBR1 is the primary autophagy receptor and p62 is not required (Deosaran et al., 2013). Likewise, in cytosolic aggrephagy, NBR1 is the primary receptor while p62 is not required (Zhou et al., 2015). Ribophagy is relatively understudied compared to other autophagic substrates with just three articles from two groups (Kraft et al., 2008, 2010; Ossareh-Nazari et al., 2014) but a role of p62 in ribophagy has not been shown either.

The only other known form of autophagy that p62 may be required for is nuclear aggrephagy and here p62 is thought to be the primary autophagy receptor (Pankiv et al., 2010). Uniquely among the autophagy receptors, p62 contains two nuclear localization signals (NLS) and a nuclear export signal (NES). Although the nucleus does contain proteasomes, proteasomes are unable to degrade ubiquitinated aggregates and therefore aggregates would need to be shuttled out of the nucleus for their degradation in lysosomes. p62 is an ideal candidate for to act as a shuttle for nuclear aggrephagy as it contains a nuclear import signal to enter the nucleus, a ubiquitin binding domain to bind ubiquitin, a nuclear export signal to exit the nucleus, and an LIR to bring ubiquitin aggregates to the autophagic machinery. Furthermore, p62 has been shown to rapidly shuttle between the nucleus and the cytosol based on phosphorylation events and was shown to be essential in the cytosolic accumulation of promyelocytic leukemia bodies during nuclear protein export defects (Pankiv et al., 2010).

Although p62 was the first autophagy receptor to be identified, today it is arguably the least exciting of the autophagy receptors in terms of its functions. This thesis further demonstrates that p62 plays, at best, a minor role in pexophagy (Figure 3.10AB). However, given the strong connection between p62 and disease (Moscat and Diaz-Meco, 2009), p62 must have some important unique function. I propose that this function is likely in nuclear aggrephagy and it is unfortunate that so little is being done to understand this function. 89

5.2.3 How is a Signal Transduced from mTORC1 to PEX2?

Based on my work, the role of mTORC1 in pexophagy is apparent. Inhibition of mTORC1 stabilizes PEX2 in a post-translational manner. Based on the fact that PEX2 is degraded by the proteasome during basal conditions but stabilized during mTORC1 inhibition, it seems likely that mTORC1 activity leads to ubiquitination of PEX2. However, the nature of the signaling pathway from mTORC1 to PEX2 remains an open question. Three major possibilities should be investigated.

The first possibility is that mTORC1 phosphorylates PEX2, leading to its degradation. Two major pieces of evidence provide support for this possibility. First, the kinetics of PEX2 regulation are extremely fast (Figure 4.3AB) and do not require additional synthesis of protein (Figure 4.11AB). Phosphorylation of mTORC1 substrates occurs on a similar timescale to PEX2 stabilization with phosphorylation of 4E-BP and S6K occurring within minutes following insulin treatment (Miron et al., 2003) and LC3 conversion likewise occurring within minutes (Figure 4.6B). Second, Zhang et al. (2015) show that phosphorylation of PEX5 during oxidative stress leads to its ubiquitination, suggesting that phosphorylation of other peroxisomal proteins may also lead to their ubiquitination. These findings, together with my findings regarding rapamycin and PEX2 stabilization, suggest that mTORC1 and PEX2 may be intimately connected and lend support to a model where mTORC1 directly phosphorylates PEX2 during steady state conditions.

The second possibility is that mTORC1 phosphorylates an unknown E3 ubiquitin ligase, leading to activation of this E3 ubiquitin ligase and degradation of PEX2. Here, because PEX2 is known to directly interact with both PEX10 and PEX12, these enzymes would be logical place to investigate. However, if either PEX10 or PEX12 was the E3 ubiquitin ligase for PEX2, I would expect knockdown of PEX10 or PEX12 to lead to an increase in PEX2 and subsequent pexophagy, which was not observed in my experiments (Figure 3.7AB). It is therefore more likely that an unknown E3 ubiquitin ligase which is not normally localized to the peroxisomes plays a role in this process and this has been observed in the case of mitophagy, where the cytosolic E3 ubiquitin ligase Parkin is recruited to mitochondria (Narendra et al., 2008). 90

Finally, the third possibility which should be investigated is mTORC1 phosphorylation of the peroxisomal AAA-ATPase complex consisting of PEX1, PEX6, or PEX26. During PEX1 or PEX26 knockdown, I observed stabilization of PEX2. PEX2 may need to be removed from the peroxisome by PEX1/6/26 in order to be degraded. Here, one can envision a pathway where active mTORC1 phosphorylates PEX1, PEX6, or PEX26, leading to these enzymes being active. However, during amino acid starvation or mTORC1 inhibition, mTORC1 is inactive and the AAA-ATPase becomes dephosphorylated and inactive, preventing PEX2 from being removed and leading to PEX2 stabilization.

All three of these possibilities should be further investigated. For the first, PEX2 protein from lysates treated with and without rapamycin should be run on a phospho-gel. For the second, a high-throughput screen should be performed where a library of siRNAs against all 600 mammalian E3 ligases is transfected into cells and the peroxisome density of the cells is quantified. For the third, PEX1, PEX6 and PEX26 protein from lysates treated with and without rapamycin should be run on a phospho-gel. These experiments should hopefully help determine how PEX2 is being regulated by mTORC1.

5.2.4 Why do Cells Degrade their Peroxisomes during Amino Acid Starvation?

The current thought in the literature is that autophagy is activated during amino acid starvation to provide cells with amino acids from pre-existing proteins. My work suggests that this may be due to the activation of selective autophagy of peroxisomes. Although it had already been shown that peroxisomes are degraded via autophagy during amino acid starvation (Hara- Kuge and Fujiki, 2008), my thesis work demonstrates the mechanism by which autophagy is mediated. Based on my findings, I support the idea that peroxisomes have a function as a protein bank which the cell can rely upon during extreme protein restriction.

Peroxisomes are a logical substrate for starvation induced autophagy for two major reasons. First, peroxisomes have high protein content due to the very efficient matrix protein import cycle. By targeting organelles with more protein in a smaller physical space, the cell gets more protein from fewer autophagic events which is particularly important during starvation. 91

Second, peroxisome functions are ‘long term’ in their nature. Oxidation events in the peroxisome do not generate energy, and lipid and ROS homeostasis can be disrupted without resulting in cell death. As a result, cells and even higher organisms are viable in the short term without peroxisomes (Faust 2014), which is not necessarily true for other potential substrates of autophagy.

In mammals, peroxisome loss has been observed in the livers of Kwashiorkor patients (Brooks and Gordon, 1992), children under the age of 5 who are nutritionally protein deficient. We also observed peroxisome loss in the livers of protein restricted mice. Pexophagy may be activated during chronic protein starvation in the livers of Kwashiorkor patients, and it would be interesting to investigate whether loss of peroxisomes is involved in the progression of the disease. Perhaps the most pertinent question in this area is whether pexophagy is an appropriate response to protein starvation or an unintended side effect. Are siPEX2 or siNBR1 cells more or less viable than control cells during amino acid starvation conditions? Do NBR1-/- mice have better or worse outcomes during chronic protein starvation than control mice?

The current treatment for Kwashiorkor patients is aimed at restoring a normal diet in these patients, and it is not very successful (Grover and Ee, 2009). A possible alternative treatment could be to restore the peroxisome population, either through inhibition of autophagy or PEX2 or NBR1; or through increased biogenesis via treatment with peroxisome proliferators. These possibilities should be investigated further.

5.2.5 How do Cells Target Individual Peroxisomes for Degradation?

A final question that results from my work is how the cell targets individual peroxisomes for degradation. With our current understanding of PEX2-mediated autophagy, it is not clear how a cell could selectively target old or dysfunctional peroxisomes for autophagy and yet, this is known to happen in both plants and mammals (Huybrechts et al., 2009; Shibata et al., 2013; Yoshimoto et al., 2014). There are three ways in which I propose pexophagy could be targeted to individual peroxisomes: selective targeting of PEX2, local activation of PEX2, and removal of ubiquitinated proteins from the peroxisome. I will go through each of these possibilities in turn. 92

For selective targeting of PEX2, it is not clear how this would be mediated. As a peroxisomal membrane protein, PEX2 is synthesized in the cytosol, transported to the peroxisomal membrane by PEX19, and finally received by PEX3 at the peroxisome surface. PEX2 protein synthesis has been covered in great detail in other sections of this thesis, and it is not clear how PEX2 protein synthesis could selectively target the enzyme to certain peroxisomes. Likewise, although PEX2 has been shown to have two different PEX19 binding sites (147-161 and 199-213) in vitro (Halbach et al., 2005); it is difficult to propose how manipulating PEX2 binding to PEX19 would yield the intended result. The last step in PEX2 targeting is PEX19- PEX3 binding. Manipulating this binding event may be a possible way to selectively target PEX2 to certain peroxisomes. One could hypothesize that dysfunctional peroxisomes can increase PEX19 recruitment and binding, leading to an increase in PEX2 import. However there are two major problems with this model. First, this would have the unintended side effect of increasing PMP transport to peroxisomes which are to be degraded: a needless waste of energy. Second, I do not observe peroxisomes with more or less PEX2 in immunofluorescent or live-cell images. It therefore seems unlikely the PEX2 is selectively targeted to peroxisomes to initiate their degradation.

For localized activation of PEX2, one could hypothesize that PEX2 may be inhibited on functional peroxisomes and fully active on dysfunctional peroxisomes. This model is attractive for a few reasons. First, it would ensure that functional peroxisomes are protected. Second, this model is consistent with the cell expressing PEX2 at all times and regulating its function downstream. Third, it would explain why the PEX2-expressing cells in my experiments are never completely devoid of peroxisomes. And fourth, it may help explain the findings of Nordgren et al. (2015) that PEX5 fused to a bulky tag becomes stuck on the peroxisome surface and leads to pexophagy. If import-competence is the hallmark of a functional peroxisome, then import-incompetence, as in the PEX5-GFP case, is the hallmark of a dysfunctional peroxisome. The main issues with this model are that it would be very difficult to demonstrate and that it is not clear how the model would work mechanistically.

Instead, I favour a model where peroxisomes are uniformly ubiquitinated by PEX2, and quality control is mediated by the removal of ubiquitinated proteins. Earlier in the discussion, I discussed the activity of the AAA-ATPase acting as a threshold. If ubiquitination exceeds this threshold, ubiquitin will accumulate on the peroxisomes; however, beneath this threshold, 93 ubiquitinated surface proteins would be rapidly removed and peroxisomes would be protected. In addition to these assumptions, I propose that this threshold can vary. Functional peroxisomes are more adept at removing ubiquitinated proteins, allowing these peroxisomes to persist. However, dysfunctional peroxisomes are unable to remove ubiquitinated surface proteins and are selectively degraded. In combination with this model, it is important to mention that PEX1 and PEX6 are not peroxisome membrane proteins in the sense that they are not embedded in the peroxisome membrane and instead bound to the membrane anchored PEX26 (Tamura et al., 2014). I propose that PEX1/6 recruitment to PEX26 is regulated such that they are preferentially recruited to functioning peroxisomes, enabling the removal of PEX2 from these peroxisomes.

5.3 Conclusions

When I first began working on these projects, the mammalian pexophagy field was full of questions. What is the E3 ligase in pexophagy? What does it ubiquitinate? Which autophagy receptor does ubiquitination recruit? As I conclude these projects, the field is changed. The E3 ligase, the substrates of ubiquitination, and the autophagy receptor are now known. And yet, the more things change, the more they remain the same. The field is still full of questions and the function of PEX10 and PEX12, the signal transduction mechanism from mTORC1 to PEX2, the mechanism of quality control, and the function of pexophagy during amino acid starvation are all largely unknown. It is an exciting time to be part of the field.

References

Agarraberes, F.A., and J.F. Dice. 2001. A molecular chaperone complex at the lysosomal membrane is required for protein translocation. J. Cell. Sci. 114(13): 2491-9.

Agrawal, G., and S. Subramani. 2016. De novo peroxisome biogenesis: Evolving concepts and conundrums. Biochim. Biophys. Acta. 1863:892-901.

Alexander, W.S. 1966. Phytanic acid in Refsum’s syndrome. Biochim. Biophys. Acta. 29:412- 416.

Alexson, S. E. and Cannon, B. 1984. A direct comparison between peroxisomal and mitochondrial preferences for fatty-acyl beta-oxidation predicts channelling of medium- chain and very-long-chain unsaturated fatty acids to peroxisomes. Biochim. Biophys. Acta. 796:1-10.

Andrus, P. K., Fleck, T. J., Gurney, M. E. and Hall, E. D. 1998. Protein oxidative damage in a transgenic mouse model of familial amyotrophic lateral sclerosis. J. Neurochem. 71(5): 2041-8.

Aranovich, A., R. Hua, A.D. Rutenberg, and P.K. Kim. 2014. PEX16 contributes to peroxisome maintenance by constantly trafficking PEX3 via the ER. J. Cell Sci. 127(17): 3675-3686.

Baes, M., and P.P. Van Veldhoven. 2016. Hepatic dysfunction in peroxisomal disorders. Biochim. Biophys. Acta. 1863(5): 956-970.

Bar-Peled, L., L.D. Schweitzer, R. Zoncu, and D.M. Sabatini. 2012. An expanded Ragulator is a GEF for the Rag GTPases that signal amino acid levels to mTORC1. Cell. 150:1196-1208.

Bartoszewska, M. et al. 2012. Peroxisomal Proteostasis Involves a Lon Family Protein That Functions as Protease and Chaperone. J. Biol. Chem. 287(33): 27380-27395.

Bellu, A.R., and Kiel, J.A. 2003. Selective Degradation of Peroxisomes in Yeasts. Microsc. Res. Tech. 61(2): 161-170. 95

Bingol, B., J.S. Tea, L. Phu, M. Reichelt, C.E. Bakalarski, Q. Song, O. Foreman, D.S. Kirkpatrick, and M. Sheng. 2014. The mitochondrial deubiquitinase USP30 opposes parkin- mediated mitophagy. Nature. 510: 370-5.

Birgisdottir, B., T. Lamark, and T. Johansen. 2013. The LIR motif – crucial for selective autophagy. J. Cell Sci. 126: 3237-47.

Bjørkøy, G., T. Lamark, A. Brech, H. Outzen, M. Perander, A. Overvatn, H. Stenmark, and T. Johansen. 2005. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 171: 603-14.

Borden, K.L.B., and P.S. Freemontt. 1996. The RING finger domain: a recent example of a sequence-structure family. Curr. Opin. Struct. Biol. 6(3): 395-401.

Bottger, G., P. Barnett, T.J. Klein, A. Kragt, H.F. Tabak, and B. Distel. 2000. Saccharomyces cerevisiae PTS1 Receptor Pex5p Interacts with the SH3 Domain of the Peroxisomal Membrane Protein Pex13p in an Unconventional, Non-PXXP-related Manner. Mol. Biol. Chem. 11: 3963-76.

Brugarolas, J., K. Lei, R.L. Hurley, B.D. Manning, J.H. Reiling, E. Hafen, L.A. Witters, L.W. Ellisen, and W.G. Kaelin Jr. 2004. Regulation of mTOR function in response to hypoxia by REDD1 and the TSC1 / TSC2 tumor suppressor complex. Genes Dev. 18(23): 2893-904.

Budanov, A. V, and M. Karin. 2008. p53 Target Genes Sestrin1 and Sestrin2 Connect Genotoxic Stress and mTOR Signaling. Cell. 134(3): 451-60.

Burkhart, S.E., Y. Kao, and B. Bartel. 2014. Peroxisomal Ubiquitin-Protein Ligases Peroxin 2 and Peroxin 10 Have Distinct But Synergistic Roles in Matrix Protein Import and Peroxin 5. Plant Physiol. 166(3): 1329-44.

Burnett, S.F., J. Farré, T.Y. Nazarko, and S. Subramani. 2015. Peroxisomal Pex3 Activates Selective Autophagy of Peroxisomes via Interaction with the Pexophagy Receptor. J. Biol. Chem. 290(13): 8623-31.

Cadwell, K., and L. Coscoy. 2005. Ubiquitination on Nonlysine Residues by a Viral E3 Ubiquitin Ligase. Science. 309(5731): 127-30. 96

Carvalho, A.F., C.P. Grou, M.P. Pinto, and I.S. Alencastre. 2007. Functional characterization of two missense mutations in Pex5p C11S and N526K. Biochim. Biophys. Acta. 1773(7): 1141-8.

Cemma, M., P.K. Kim, and J.H. Brumell. 2011. The ubiquitin-binding adaptor proteins p62/SQSTM1 and NDP52 are recruited independently to bacteria-associated microdomains to target Salmonella to the autophagy pathway. Autophagy. 7(3): 341-5.

Chan, N.C., A.M. Salazar, A.H. Pham, M.J. Sweredoski, N.J. Kolawa, R.L.J. Graham, S. Hess, and D.C. Chan. 2011. Broad activation of the ubiquitin-proteasome system by Parkin is critical for mitophagy. Hum. Mol. Genet. 20(9): 1-12.

Chan, P. and B. Bielski. 1974. Enzyme-catalyzed free radical reactions with nicotinamide adenine nucleotides. J. Biol. Chem. 249(4): 1317-9.

Chen, Z. et al. 2011. The double-edged effect of autophagy in pancreatic beta cells and diabetes. Autophagy. 7: 12-16.

Coyaud, E., M. et al. 2015. BioID-based Identification of Skp Cullin F-box. Mol. Cell. proteomics. 14(7):1781-95. de Craemer, D. et al. 1994. Peroxisomes in liver , heart , and kidney of mice fed a commercial fish oil preparation: original data and review on peroxisomal changes induced by high-fat diets. J. Lipid Res. 35(7): 1241-50.

Cunningham, C.N. et al. 2015. USP30 and parkin homeostatically regulate atypical ubiquitin chains on mitochondria. Nat. Cell Biol. 17(2): 160-9.

Debelyy, M.O. et al. 2011. Ubp15p, a Ubiquitin Hydrolase Associated with the Peroxisomal Export Machinery. J. Biol. Chem. 286(32): 28223-34.

Deosaran, E. et al. 2013. NBR1 acts as an autophagy receptor for peroxisomes. J. Cell Sci. 126(4): 939-52.

Deshaies, R.J., and C. A. Joazeiro. 2009. RING domain E3 ubiquitin ligases. Annu. Rev. Biochem. 78:399-434. 97

Dobrowsky, R.T., and L.M. Ballas. 1987. Peroxisomal Dihydroxyacetone Phosphate Acyltransferase. J. Biol. Chem. 262(7): 3136-9.

Dodt, G., and S.J. Gould. 1996. Multiple PEX Genes Are Required for Proper Subcellular Distribution and Stability of Pex5p, the PTS1 Receptor: Evidence That PTS1 Protein Import Is Mediated by a Cycling Receptor. J. Cell. Biol. 135(6): 1763-1774.

Durcan, T.M., M. Kontogiannea, N. Bedard, S.S. Wing, and E. A. Fon. 2012. Ataxin-3 deubiquitination is coupled to Parkin ubiquitination via E2 ubiquitin-conjugating enzyme. J. Biol. Chem. 287: 531-41.

De Duve, C., and P. Baudhuin. 1966. Peroxisomes (microbodies and related particles). Physiol. Rev. 46(2): 323-57.

Efeyan, A. et al. 2013. Regulation of mTORC1 by the Rag GTPases is necessary for neonatal autophagy and survival. Nature. 493(7434): 679-683.

Evans, C. A. L. 1907. On the catalytic decomposition of hydrogen peroxide by the catalase of the blood. Biochem. J. 2(4): 133-154.

Fahl, W. E. et al. 1984. DNA damage related to increased hydrogen peroxide generation by hypolipidemic drug-induced liver peroxisomes. Proc. Natl. Acad. Sci. USA. 81(24): 7827- 30.

Fang, Y. et al. 2004. PEX3 functions as a PEX19 docking factor in the import of class I peroxisomal membrane proteins. J. Cell. Biol. 164(6): 863-75.

Farre, J. C. et al. 2013. Phosphorylation of mitophagy and pexophagy receptors coordinates their interaction with Atg8 and Atg11. 14(5): 441-9.

Faust, P.L. et al. 2001. The Peroxisome Deficient PEX2 Zellweger Mouse. J. Mol. Neurosci. 16(2): 289-97.

Fecto, F. et al. 2013. SQSTM1 Mutations in Familial and Sporadic Amyotrophic Lateral Sclerosis. Arch. Neurol. 68(11): 1440-6.

Feng, Y. et al. 2014. The machinery of macroautophagy. Cell Res. 24: 24-41. 98

Ferdinandusse, S., S. Denis, G. Dacremont, and R.J.Wanders. 2009. Toxicity of peroxisomal C27-bile acid intermediates. Mol. Genet. Metab. 96(3): 121-8.

Foerster, E.C. et al. 1981. Peroxisomal fatty acid oxidation as detected by H202 production in intact perfused rat liver. Biochem. J. 196(3): 705-712.

Fransen, M. et al. 2012. Role of peroxisomes in ROS / RNS-metabolism: Implications for human disease. Biochim. Biophys. Acta. 1822(9): 1363-73.

Furuta, S., S. Miyazawa, and T. Hashimoto. 1982. Biosynthesis of enzymes of peroxisomal beta- oxidation. J. Biochem. 92(2): 319-26.

Gingras, A. C. et al.. 1999. Regulation of 4E-BP1 phosphorylation : a novel two-step mechanism. Genes Dev. 13(11):1422-37.

Goldman, B.M., and G. Blobel. 1978. Biogenesis of peroxisomes: Intracellular site of synthesis of catalase and uricase. Proc. Natl. Acad. Sci. USA. 75(10): 5066-70.

Gomes, L.C., G. Di Benedetto, and L. Scorrano. 2011. During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nat. Cell Biol. 13(5): 589-98.

Gomes, L.C., and L. Scorrano. 2012. Mitochondrial morphology in mitophagy and macroautophagy. Biochim. Biophys. Acta. 1833: 205-12.

Gotte, K. et al. 1998. Pex19p, a Farnesylated Protein Essential for Peroxisome Biogenesis. Mol. Cell Biol. 18: 616-28.

Gould, S.J., and D. Valle. 2000. Peroxisome biogenesis disorders genetics and cell biology. Trends Genet. 16(8): 340-5.

Granstrom, E., W. Lands, and B. Samuelsson. 1968. Biosynthesis of 9-alpha,15-dihyroxy-11- ketoprost-13-enoic acid. J. Biol. Chem. 243(15): 4104-8.

Grou, C. P. et al. 2008. Members of the E2D (UbcH5) Family Mediate the Ubiquitination of the Conserved Cysteine of Pex5p , the Peroxisomal Import Receptor. J. Biol. Chem. 283(21): 14190-7. 99

Grou, C. P. et al. 2012. Identification of Ubiquitin-specific Protease 9X (USP9X ) as a Deubiquitinase Acting on Ubiquitin-Peroxin 5 (PEX5) Thioester Conjugate. J. Biol. Chem. 287(16): 12815-27.

Grover, Z., and L.C. Ee. 2009. Protein energy malnutrition. Pediatr. Clin. North Am. 56(5): 1055-68. de Haan, J.B., J.D. Newman, and I. Kola. 1992. Cu/Zn superoxide dismutase mRNA and enzyme activity , and susceptibility to lipid peroxidation , increases with aging in murine brains. Brain Res. Mol. Brain Res.13(3): 179-87.

Halbach, A. et al. 2005. Function of the PEX19-binding site of human ALDP as targeting motif in man and yeast: PMP targeting is evolutionarily conserved. J. Biol. Chem. 280(22): 21176-82.

Halliwell, B., and J. M. Gutteridge. 1997. Lipid Peroxidation in Brain Homogenates : The Role of Iron and Hydroxyl Radicals. J. Neurochem. 69(3): 1330-1.

Hara, K. et al. 1998. Amino Acid Sufficiency and mTOR Regulate p70 S6 Kinase and eIF-4E BP1 through a Common Effector Mechanism. J. Biol. Chem. 273(23): 14484-94.

Hara, K. et al. 2002. Raptor , a Binding Partner of Target of Rapamycin (TOR), mediates TOR Action. Cell. 110(2): 177-89.

Hara, T. et al. 2006. Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature. 441:885-889.

Hara-Kuge, S., and Y. Fujiki. 2008. The peroxin Pex14p is involved in LC3-dependent degradation of mammalian peroxisomes. Exp. Cell Res. 314(19): 3531-41.

Hay, N., and N. Sonenberg. 2004. Upstream and downstream of mTOR. 1926-45. Genes Dev. 18(16): 1926-45.

Heo, J. et al. 2015. The PINK1-PARKIN Mitochondrial Ubiquitylation Pathway Drives a Program of OPTN / NDP52 Recruitment and TBK1 Activation to Promote Mitophagy. Mol. Cell. 60: 7-20. 100

Hermetter, A. et al. 1989. Influence of plasmalogen deficientcy on membrane fluidity of human skin fibroblasts: a fluorescence anisotrophy study. Biochim. Biophys. Acta. 978: 151-57.

Hocking, L.J. et al. 2002. Domain-specific mutations in sequestosome 1 (SQSTM1) cause familial and sporadic Paget’s disease. Hum. Mol. Genet. 11(22): 2735-39.

Hoffmann, H., A. Szabo, and C.J. Avers. 1970. Cytochemical Localization of Catalase Activity in Yeast Peroxisomes. 104: 581-84.

Hosokawa, N. et al. 2009. Nutrient-dependent mTORC1 Association with the ULK1-Atg13- FIP200 Complex Required for Autophagy. Mol. Biol. Cell. 20(7): 1981-91.

Hua, R. et al. 2015. Multiple Domains in PEX16 Mediate Its Trafficking and Recruitment of Peroxisomal Proteins to the ER. Traffic. 16(8): 832-52.

Hutchins, M.U., M. Veenhuis, and D.J. Klionsky. 1999. Peroxisome degradation in Saccharomyces cerevisiae is dependent on machinery of macroautophagy and the Cvt pathway. J. Cell Sci. 112(22): 4079-87.

Huybrechts, S.J. et al. 2009. Peroxisome Dynamics in Cultured Mammalian Cells. Traffic. 10(11): 1722-33.

Ichimura, Y. et al. 2000. A ubiquitin-like system mediates protein lipidation. Nature. 408(6811): 488-92.

Inoki, K. et al. 2002. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat. Cell Biol. 4(9): 648-57.

Islinger, M. et al. 2009. Hitchhiking of Cu/Zn Superoxide Dismutase to Peroxisomes – Evidence for a Natural Piggyback. Traffic. 10(11): 1711-21.

Issemann, I. and S. Green. 1990. Activator of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature. 347(6294): 645-50.

Itakura, E. et al. 2008. Beclin 1 Forms Two Distinct Phosphatidylinositol 3-Kinase Complexes with Mammalian Atg14 and UVRAG. Mol. Biol. Cell. 19(12): 5360-72. 101

Iwata, J. et al. 2006. Excess peroxisomes are degraded by autophagic machinery in mammals. J. Biol. Chem. 281(7): 4035-41.

Jaffe, R. et al. 1982. Neonatal Adrenoleukodystrophy Clinical, Pathologic, and Biochemical Delineation. Am. J. Pathol. 108: 100-11.

Jewell, J.L., R.C. Russell, and K. Guan. 2013. Amino acid signalling upstream of mTOR. Nat. Rev. Mol. Cell Biol.14: 133-9.

Jiang, L. et al. 2015. Peroxin Pex14p is the key component for coordinated autophagic degradation of mammalian peroxisomes by direct binding to LC3-II. Genes Cells. 20: 36- 49.

Johansen, T., and T. Lamark. 2011. Selective autophagy mediated by autophagic adapter proteins. Autophagy. 7(3): 279-96.

Jones, J. A. and M. Blecher. 1965. On the Mechanism of β-Oxidation by Liver Mitochondria of Long Chain Fatty from Normal and Alloxan-diabetic Rats. J. Biol. Chem. 240: 68-71.

Kabeya, Y. et al. 2000. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J. 19(21): 5720-8.

Kabeya, Y. et al. 2004. LC3, GABARAP and GATE16 localize to autophagosomal membrane depending on form-II formation. J. Cell Sci. 117(13): 2805-12.

Kamijo, K. et al. 1990. The 70-kDa Peroxisomal Membrane Protein Is a Member of the Mdr (P- glycoprotein)-related ATP-binding protein superfamily. J. Biol. Chem. 265(8): 4534-40.

Katarzyna, Z., and S. Suresh. 2016. Autophagic degradation of peroxisomes in mammals. Biochem. Soc. Trans. 44(2): 431-40.

Katsuragi, Y., Y. Ichimura, and M. Komatsu. 2015. p62 / SQSTM1 functions as a signaling hub and an autophagy adaptor. 282(24): 4672-8.

Kaur, N. et al. 2013. Arabidopsis RING Peroxins are E3 Ubiquitin Ligases that Interact with Two Homologous Ubiquitin Receptor Proteins. J. Integr. Plant Biol. 55: 108-20. 102

Kazlauskaite, A. et al. 2014. Parkin is activated by PINK1-dependent phosphorylation of ubiquitin at Ser65. Biochem. J. 460: 127-39.

Khaminets, A. et al. 2015. Regulation of endoplasmic reticulum turnover by selective autophagy. Nature. 522(7556): 354-8.

Kim, D. H. et al. 2002. mTOR Interacts with Raptor to Form a Nutrient-Sensitive Complex that Signals to the Cell Growth Machinery. Cell. 110(2): 163-75.

Kim, J. et al. 2011. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 13(2): 132-41.

Kim, P.K. et al. 2006. The origin and maintenance of mammalian peroxisomes involves a de novo PEX16-dependent pathway from the ER. J. Cell Biol. 173(4): 521-32.

Kim, P.K. et al. 2008. Ubiquitin signals autophagic degradation of cytosolic proteins and peroxisomes. Proc. Natl. Acad. Sci. USA. 105(52): 20567-74.

Kirisako, T. et al. 1999. Formation Process of Autophagosome Is Traced with Apg8/Aut7p in Yeast. J. Cell Biol. 147(2): 435-46.

Kirkin, V. et al. 2009a. A role for NBR1 in autophagosomal degradation of ubiquitinated substrates. Mol. Cell. 33(4): 505-16.

Kirkin, V. et al. 2009b. A role for ubiquitin in selective autophagy. Mol. Cell. 34(3): 259-69.

Komatsu, M. et al. 2006. Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature. 441(7095): 880-4.

Kraft, C. et al. 2008. Mature ribosomes are selectively degraded upon starvation by an autophagy pathway requiring the Ubp3p/Bre5p ubiquitin protease. Nat. Cell Biol. 10(5): 602-10.

Kraft, C., M. Peter, and K. Hofmann. 2010. Selective autophagy: ubiquitin-mediated recognition and beyond. Nat. Cell Biol. 12(9): 836-41.

Krasna, A.I. 1965. Nonparticipation of Hydrogen Peroxide in the Cytochrome Oxidase Reaction. Arch. Biochem. Biophys. 112: 209-11. 103

Kuma, A. et al. 2004. The role of autophagy during the early neonatal starvation period. Nature. 432: 1032-5.

Kuo, T. C. et al. 2011. Midbody accumulation through evasion of autophagy contributes to cellular reprogramming and tumorigenicity. Nat. Cell Biol. 13(10): 1214-23.

Lang, T. et al. 1998. Aut2p and Aut7p , two novel microtubule-associated proteins are essential for delivery of autophagic vesicles to the vacuole. EMBO J. 17(13): 3597-607.

Lansbury Jr., P.T. and A. Brice. 2002. Genetics of Parkinson’s disease and biochemical studies of implicated gene products. Curr. Opin. Genet. Dev. 12(3): 299-306.

Lazarou, M. et al. 2012. Role of PINK1 binding to the TOM complex and alternate intracellular membranes in recruitment and activation of the E3 ligase Parkin. Dev. Cell. 22(2): 320-33.

Lazarou, M. et al. 2015. The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature. 524(7565): 309-14.

Lazarow, B. 1978. Rat Liver Peroxisomes Catalyze the β-Oxidation of fatty acids. J. Biol. Chem. 253(5): 1522-8.

Lee, H.N., J. Kim, and T. Chung. 2014. Degradation of plant peroxisomes by autophagy. Front. Plant Sci. 5(139): 1-4.

Levine, B. 2005. Eating Oneself and Uninvited Guests: Autophagy-Related Pathways in Cellular Defense. Cell. 120(2): 159-62.

Li, X. et al. 2002. PEX11α Is Required for Peroxisome Proliferation in Response to 4- Phenylbutyrate but Is Dispensable for Peroxisome Proliferator-Activated Receptor Alpha- Mediated Peroxisome Proliferation. Mol. Cell Biol. 22(23): 8226-40.

Li, X., and S.J. Gould. 2003. The Dynamin-like GTPase DLP1 Is Essential for Peroxisome Division and Is Recruited to Peroxisomes in Part by PEX11. J. Biol. Chem. 278(19): 17012- 20.

Liu, X., C. Ma, and S. Subramani. 2012. Recent advances in peroxisomal matrix protein import. Curr. Opin. Cell Biol. 24(4): 484-9. 104

Long, J. et al. 2008. Ubiquitin Recognition by the Ubiquitin-associated Domain of p62 Involves a Novel Conformational Switch. J. Biol. Chem. 283(9): 5427-40.

Luoma, A. M. et al. 2015. Plasmalogen phospholipids protect internodal myelin from oxidative damage. Free Radic. Biol. Med. 84: 296-310.

El Magraoui, F. et al. 2012. The RING-type ubiquitin ligases Pex2p, Pex10p and Pex12p form a heteromeric complex that displays enhanced activity in an ubiquitin conjugating enzyme- selective manner. FEBS J. 279(11): 2060-70.

El Magraoui, F. et al. 2013. Distinct ubiquitination cascades act on the peroxisomal targeting signal type 2 co-receptor Pex18p. Traffic. 14(12): 1290-301.

Mancias, J.D., and A.C. Kimmelman. 2016. Mechanisms of Selective Autophagy in Normal Physiology and Cancer. J. Mol. Biol. 428(9): 1659-80.

Mandel, H. et al. 1998. Plasmalogen Phospholipids Are Involved in HDL-Mediated Cholesterol Efflux: Insights from Investigations with Plasmalogen-Deficient Cells. Biochim. Biophys. Res. Commun. 250(2): 369-73.

Mao, K. et al. 2014. The progression of peroxisomal degradation through autophagy requires peroxisomal division. Autophagy. 10(4): 652-61.

Mardakheh, F. K. et al. 2010. Nbr1 Is a Novel Inhibitor of Ligand-Mediated Receptor Tyrosine Kinase Degradation Nbr1 Is a Novel Inhibitor of Ligand-Mediated Receptor Tyrosine Kinase Degradation. Mol. Cell. Biol. 30(24): 5672-85.

Marshall, P. A. et al. 1995. Pmp27 Promotes Peroxisomal Proliferation. J. Cell Biol. 129: 345- 55.

Matsuzaki, T., and Y. Fujiki. 2008. The peroxisomal membrane protien import receptor Pex3p is directly transported to peroxisomes by a novel Pex19p- and Pex16p-dependent pathway. J. Cell Biol. 183(7): 1275-86.

Menon, S. et al. 2014. Spatial Control of the TSC Complex Integrates Insulin and Nutrient Regulation of mTORC1 at the Lysosome. Cell. 156(4): 771-85. 105

Micsenyi, M.C. et al. 2013. Lysosomal Membrane Permeability Stimulates Protein Aggregate Formation in Neurons of a Lysosomal Disease. J. Neurosci. 33(26): 10815-27.

Miron, M., P. Lasko, and N. Sonenberg. 2003. Signaling from Akt to FRAP / TOR Targets both 4E-BP and S6K in Drosophila melanogaster. Mol. Cell Biol. 23(24): 9117-26.

Miyata, N., and Y. Fujiki. 2005. Shuttling Mechanism of Peroxisome Targeting Signal Type 1 Receptor Pex5: ATP-Independent Import and ATP-Dependent Export. Mol. Cell Biol. 25(24): 10822-32.

Mizushima, N. et al. 1998. A protein conjugation system essential for autophagy. Nature. 395(6700): 395-8.

Mizushima, N. et al. 2001. Dissection of Autophagosome Formation using Apg5-deficient Mouse Embryonic Stem Cells. J. Cell Biol. 152(4): 657-68.

Mortimore, G.E., N.J. Hutson, and C.A. Surmacz. 1983. Quantitative correlation between proteolysis and macro- and microautophagy in mouse hepatocytes during starvation and refeeding. Proc. Natl. Acad. Sci. USA. 80(8): 2179-83.

Moscat, J., and M.T. Diaz-Meco. 2009. p62 At the Crossroads of Autophagy, Apoptosis, and Cancer. Cell. 137(6): 1001-4.

Moshage, H., A. Cassini, and C.S. Lieber. 1990. Acetaldehyde Selectively Stimulates Collagen Production in Cultured Rat Liver Fat-storing Cells but not in Hepatocytes. Hepatology. 12(3): 511-8.

Motley, A.M., G.P. Ward, and E.H. Hettema. 2008. Dnm1p-dependent peroxisome fission requires Caf4p , Mdv1p and Fis1p. J. Cell Sci. 121(10): 1633-40. von Muhlinen, N. et al. 2012. LC3C, Bound Selectively by a Noncanonical LIR Motif in NDP52, Is Required for Antibacterial Autophagy. Mol. Cell. 48(3): 329-342.

Mukai, A. et al. 2008. Dynamic regulation of ubiquitylation and deubiquitylation at the central spindle during cytokinesis. J. Cell Sci. 121(8): 1325-33. 106

Nakagawa, I et al. 2004. Autophagy Defends Cells Against Invading Group A Streptococcus. Science 306(5698): 1037-40.

Narendra, D. et al. 2008. Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J. Cell Biol. 183(5): 795-803.

Narendra, D. et al. 2010a. p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both. Autophagy. 6(8): 1090-106.

Narendra, D. et al. 2010b. PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol. 8(1): e1000298.

Nazarko, V. Y. et al. 2008a. Differences in glucose sensing and signaling for pexophagy in the baker’ s yeast Saccharomyces cerevisiae and the methylotrophic yeast Pichia pastoris. Autophagy. 4(3): 381-4.

Nazarko, V.Y., J.M. Thevelein, and A.A. Sibirny. 2008b. G-protein-coupled receptor Gpr1 and G-protein Gpa2 of cAMP-dependent signaling pathway are involved in glucose-induced pexophagy in the yeast Saccharomyces cerevisiae. Cell Biol. Intl. 32(5): 502-4.

Nazarko, V. Y. et al. 2014. Peroxisomal Atg37 binds Atg30 or palmitoyl-CoA to regulate phagophore formation during pexophagy. J. Cell Biol. 204(4): 541-57.

Nguyen, H. T. et al. 2013. Autophagy and Crohn’s disease. J. Innate Immun. 5(5): 434-43.

Nixon, R. A. 2013. The role of autophagy in neurodegenerative disease. Nat. Med. 19: 983-97.

Nordgren, M. et al. 2015. Export-deficient monoubiquitinated PEX5 triggers peroxisome removal in SV40 large T antigen-transformed mouse embryonic fibroblasts. Autophagy. 11(8): 1326-40.

Novak, I. et al. 2010. Nix is a selective autophagy receptor for mitochondrial clearance. EMBO Rep. 11: 45-51.

Nuttall, J. M., A. M. Motley, and E. H. Hettema. 2014. Deficiency of the exportomer components Pex1, Pex6, and Pex15 causes enhanced pexophagy in Saccharomyces cerevisiae. Autophagy. 10(5): 835-45. 107

Obara, K., and Y. Ohsumi. 2011. Atg14: A Key Player in Orchestrating Autophagy. Int. J. Cell Biol. 2011(2): 7134-5.

Oku, M., and Y. Sakai. 2016. Pexophagy in yeasts. Biochim. Biophys. Acta. 1863(5): 992-8.

Olson, J. A. 1964. The effect of bile and bile salts on the uptake and cleavage of B-carotene into retinol ester (vitamin A ester) by intestinal slices. J. Lipid Res. 5: 402-8.

Ossareh-Nazari, B. et al. 2014. Ubiquitylation by the Ltn1 E3 ligase protects 60S ribosomes from starvation-induced selective autophagy. J. Cell Biol. 204(6): 909-17.

Pankiv, S. et al. 2007. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J. Biol. Chem. 282(33): 24131-45.

Pankiv, S. et al. 2010. Nucleocytoplasmic Shuttling of p62 / SQSTM1 and Its Role in Recruitment of Nuclear Polyubiquitinated Proteins to Promyelocytic Leukemia Bodies. J. Biol. Chem. 285(8): 5941-53.

Platta, H.W. et al. 2009. Pex2 and Pex12 function as protein-ubiquitin ligases in peroxisomal protein import. Mol. Cell. Biol. 29(20): 5505-16.

Pohl, C. and S. Jentsch. 2009. Midbody ring disposal by autophagy is a post-abscission event of cytokinesis. Nat. Cell Biol. 11(1): 65-70.

Poole, B., F. Leighton, and C. de Duve. 1969. The Synthesis and Turnover of Rat Liver Peroxisomes. II. Turnover of Peroxisome Proteins. J. Cell Biol. 41(2): 536-46.

Prestele, J. et al. 2010. Different functions of the C3HC4 zinc RING finger peroxins PEX10, PEX2, and PEX12 in peroxisome formation and matrix protein import. Proc. Natl. Acad. Sci. USA. 107(33): 14915-20.

Rambold, A. et al. 2011. Tubular network formation protects mitochondria from autophagosomal degradation during nutrient starvation. Prot. Natl. Acad. USA. 108(25): 10190-5.

Richter, B. et al. 2016. Phosphorylation of OPTN by TBK1 enhances its binding to Ub chains and promotes selective autophagy of damaged mitochondria. Proc. Natl. Acad. Sci. USA. 113(15): 4039-44. 108

Rizzo, W. et al. 1993. Fatty Alcohol Accumulation in the Autosomal Recessive Form of Rhezomelic Chondrodysplasia Punctata. Biochem. Med. Metab. Biol. 50(1): 93-102.

Rojas, C., J. Schmidt, M. Lee, W.G. Gustafson, and J.T. Mcfarland. 1985. Structure-Function Correlation of Fatty Acyl-CoA Dehydrogenase and Fatty. 2947-2954.

Sancak, Y. et al. 2011. Ragulator-Rag complex targets mTORC1 to the lysosomal surface and is necessary for its activation by amino acids. Cell. 141(2): 290-303.

Sandalio, L. et al. 1988. Superoxide Free Radicals Are Produced in Glyoxysomes. Plant Physiol. 87(1): 1-4.

Sandalio, L. et al. 2013. Role of Peroxisomes as a Source of Reactive Oxygen Species (ROS) Signaling Molecules. Subcell. Biochem. 69: 231-55.

Scheffner, M., U. Nuber, and J.M. Hulbregtse. 1995. Protein ubiquitination involving an E1-E2- E3 enzyme ubiquitin thioester cascade. Nature. 373(6509): 81-3.

Scherz-Shouval, R. et al. 2007. Reactive oxygen species are essential for autophagy and specifically regulate the activity of Atg4. EMBO J. 26(7): 1749-60.

Schwartzkopff, B. et al. 2015. Cysteine-specific ubiquitination protects the peroxisomal import receptor Pex5p against proteasomal degradation. Biosci. Rep. 35(3): e00215.

Shibata, M. et al. 2013. Highly Oxidized Peroxisomes Are Selectively Degraded via Autophagy in Arabidopsis. Plant Cell. 25(12): 4967-83.

Snyder, W. et al. 1999. Pex19p Interacts with Pex3p and Pex10p and Is Essential for Peroxisome Biogenesis in Pichia pastoris. Mol. Biol. Cell. 10(6): 1745-61.

Sou, Y. et al. 2006. Phosphatidylserine in Addition to Phosphatidylethanolamine is an in vitro Target of the Mammalian Atg8 Modifiers, LC3, GABARAP, and GATE-16. J. Biol. Chem. 281(6): 3017-24.

Stokke, O., K. Try, and L. Eldjarn. 1967. α-oxidation as an alternative pathway for the degradation of branched-chain fatty acids in man, and its failure in patients with Refsum's disease. Biochim. Biophys. Acta. 144(2): 271-84. 109

Stone, S. et al. 2005. Functional Analysis of the RING-Type Ubiquitin Ligase Family of Arabidopsis. Plant Physiol. 137(1): 13-30.

Tamura, S., et al. 2014. AAA Peroxins and their recruiter Pex26p modulate the Interactions of Peroxins Involved in Peroxisomal Protein Import. J. Biol. Chem. 289(35): 24336-46.

Tanaka, C. et al. 2014. Hrr25 triggers selective autophagy-related pathways by phosphorylating receptor proteins. J. Cell Biol. 207(1): 91-105.

Tanida, I. et al. 2002. Human Apg3p / Aut1p Homologue Is an Authentic E2 Enzyme for Multiple Substrates, GATE-16, GABARAP, and MAP-LC3, and Facilitates the Conjugation of hApg12p to hApg5p. J. Biol. Chem. 277(16): 13739-44.

Tanida, I. et al. 2003. GATE-16 and GABARAP are authentic modifiers mediated by Apg7 and Apg3. Biochem. Biophys. Res. Commun. 300(3): 637-44.

Tanida, I. et al.. 2004a. HsAtg4B / HsApg4B / Autophagin-1 Cleaves the Carboxyl Termini of Three Human Atg8 Homologues and Delipidates Microtubule-associated Protein Light Chain 3- and GABAa Receptor-associated Protein-Phospholipid Conjugates. J. Biol. Chem. 279(35): 36268-76.

Tanida, I., T. Ueno, and E. Kominami. 2004b. LC3 conjugation system in mammalian autophagy. Int. J. Biochem. Cell Biol. 36(12): 2503-18.

Thoreen, C.C. and D.M. Sabatini. 2009. Rapamycin inhibits mTORC1, but not completely. Autophagy. 5(5): 725-6.

Thurston, T. et al. 2009. The TBK1 adaptor and autophagy receptor NDP52 restricts the proliferation of ubiquitin-coated bacteria. Nat. Immunol. 10(11): 1215-21.

Till, A. et al. 2012. Pexophagy: The Selective Degradation of Peroxisomes. Int. J. Cell Biol. 2012: e512721.

Tuttle, D. and W. Dunn. 1995. Divergent modes of autophagy in the methylotrophic yeast Pichia pastoris. J. Cell Sci. 108(1): 25-35. 110

Upham, B. and L. Jahnke. 1986. Photooxidative reactions in chloroplast thylakoids. Evidence for a Fenton-type reaction promoted by superoxide or ascorbate. Photosyn. Res. 8(3): 235-47.

Veenhuis, M. et al. 1983. Degradation and Turnover of Peroxisome in the Yeast Hansenula polymorpha Induced by Selective Inactivation of Peroxisomal Enzymes. Arch. Microbiol. 134(3): 193-203.

Walter, K. et al. 2014. Hif-2α promotes degradation of mammalian peroxisomes by selective autophagy. Cell Metab. 20(5): 882-97.

Wang, Y. et al. 2012. ROS-induced mitochondrial depolarization initiates PARK2/PARKIN- dependent mitochondrial degradation by autophagy. Autophagy. 8(10): 1462-76.

Warren, D. et al. 1998. Identification of PEX10 , the Gene Defective in Complementation Group 7 of the Peroxisome-Biogenesis Disorders. Am. J. Human Genet. 63(2): 347-59.

Weidberg, H. et al. 2010. LC3 and GATE-16/GABARAP subfamilies are both essential yet act differently in autophagosome biogenesis. EMBO J. 29(11): 1792-802.

Wild, P. et al. 2011. Phosphorylation of the Autophagy Receptor Optineurin Restricts Salmonella Growth. Science. 333(6039): 228-33.

Williams, C. and I.J. van der Klei. 2013. Pexophagy-linked degradation of the peroxisomal membrane protein Pex3p involves the ubiquitin-proteasome system. Biochem. Biophys. Res. Commun. 438(2): 395-401.

Wong, E. et al. 2012. Molecular determinants of selective clearance of protein inclusions by autophagy. Nat. Commun. 3: 1240.

Wylin, T. et al. 1998. Identification and characterization of human PMP34 , a protein closely related to the peroxisomal integral membrane protein PMP47 of Candida boidinii. Eur. J. Biochem. 258(2): 332-8.

Xie, X. et al. 2015. Molecular basis of ubiquitin recognition by the autophagy receptor CALCOCO2. Autophagy. 11(10): 1775-89. 111

Yamashita, S. et al. 2014. The membrane peroxin PEX3 induces peroxisome-ubiquitination- linked pexophagy. Autophagy. 10(9): 1549-64.

Yang, Z. and D.J. Klionsky. 2010a. Mammalian autophagy: core molecular machinery and signaling regulation. Curr. Opin. Cell Biol. 22(2): 124-31.

Yang, Z. and D.J. Klionsky. 2010b. Eaten alive: a history of macroautophagy. Nat. Cell Biol. 12(9): 814-22.

Yokota, S., T. Oda, and H.D. Fahimi. 2001. The Role of 15-lipoxygenase in Disruption of the Peroxisomal Membrane and in Programmed Degradation of Peroxisomes in Normal Rat Liver. J. Histochem. Cytochem. 49(5): 613-21.

Yoshimoto, K. et al. 2014. Organ-specific quality control of plant peroxisomes is mediated by autophagy. J. Cell Sci. 127(6): 1161-8.

Young, A. et al. 2006. Starvation and ULK1-dependent cycling of mammalian Atg9 between the TGN and endosomes. J. Cell Sci. 119(18): 3888-900.

Zhang, J. and P. Ney. 2009. Autophagy-dependent and -independent mechanisms of mitochondrial clearance during reticulocyte maturation. Autophagy. 5(7): 1064-5.

Zhang, J. et al. 2015. ATM functions at the peroxisome to induce pexophagy in response to ROS. Nat. Cell Biol. 17(10): 1259-69.

Zheng, Y. et al. 2009. The adaptor protein p62/SQSTM1 targets invading bacteria to the autophagy pathway. J. Immunol. 183(9): 5909-16.

Zhou, L. et al. 2015. Bcl-2 Decreases the Affinity of SQSTM1 / p62 to Poly-Ubiquitin Chains and Suppresses the Aggregation of Misfolded Protein in Neurodegenerative Disease. 52(3): 1180-9.

Zoeller, R. et al. 2002. Increasing plasmalogen levels protects human endothelial cells during hypoxia. Am. J. Physiol. Heart Circ. Physiol. 283(2): 671-9.

Zoncu, R. et al. 2011. mTORC1 Senses Lysosomal Amino Acids through an Inside-Out Mechanism that Requires the Vacuolar H+-ATPase. Science. 334(6056): 678-83. 112

Zwart, K., M. Veenhuis, and W. Harder. 1979. Biogenesis and breakdown of peroxisomes in the yeast Hansenula polymorpha in relation to environmental changes. Antonie Van Leeuwenhoek. 45(2): 331-2.