Γ to Estrogen-Related Receptor T Cell Activation and Maps + Mediates

Murine Lupus Susceptibility Locus Sle1c2 Mediates CD4 + T Cell Activation and Maps to Estrogen-Related Receptor γ

This information is current as Daniel J. Perry, Yiming Yin, Tiffany Telarico, Henry V. of September 25, 2021. Baker, Igor Dozmorov, Andras Perl and Laurence Morel J Immunol 2012; 189:793-803; Prepublished online 18 June 2012; doi: 10.4049/jimmunol.1200411

http://www.jimmunol.org/content/189/2/793 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2012/06/18/jimmunol.120041 Material 1.DC1 http://www.jimmunol.org/ References This article cites 56 articles, 21 of which you can access for free at: http://www.jimmunol.org/content/189/2/793.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Murine Lupus Susceptibility Locus Sle1c2 Mediates CD4+ T Cell Activation and Maps to Estrogen-Related Receptor g

Daniel J. Perry,* Yiming Yin,* Tiffany Telarico,†,‡,x Henry V. Baker,{ Igor Dozmorov,‖ Andras Perl,†,‡,x and Laurence Morel*

Sle1c is a sublocus of the NZM2410-derived Sle1 major lupus susceptibility locus. We have shown previously that Sle1c contributes to lupus pathogenesis by conferring increased CD4+ T cell activation and increased susceptibility to chronic graft-versus-host disease (cGVHD), which mapped to the centromeric portion of the locus. In this study, we have reﬁned the centromeric sublocus to a 675-kb interval, termed Sle1c2. Mice from recombinant congenic strains expressing Sle1c2 exhibited increased CD4+ T cell intrinsic activation and cGVHD susceptibility, similar to mice with the parental Sle1c. In addition, B6.Sle1c2 mice displayed a robust expansion of IFN-g–expressing T cells. NZB complementation studies showed that Sle1c2 expression exacerbated B cell activation, autoantibody production, and renal pathology, verifying that Sle1c2 contributes to lupus pathogenesis. The Sle1c2 Downloaded from interval contains two genes, only one of which, Esrrg, is expressed in T cells. B6.Sle1c2 CD4+ T cells expressed less Esrrg than B6 CD4+ T cells, and Esrrg expression was correlated negatively with CD4+ T cell activation. Esrrg encodes an orphan nuclear receptor that regulates oxidative metabolism and mitochondrial functions. In accordance with reduced Esrrg expression, B6. Sle1c2 CD4+ T cells present reduced mitochondrial mass and altered mitochondrial functions as well as altered metabolic pathway utilization when compared with B6 CD4+ T cells. Taken together, we propose Esrrg as a novel lupus susceptibility gene regulating

CD4+ T cell function through their mitochondrial metabolism. The Journal of Immunology, 2012, 189: 793–803. http://www.jimmunol.org/

he murine NZM2410 strain spontaneously develops an This region overlaps with syntenic human SLE quantitative trait autoimmune disease that mimics systemic lupus eryth- loci, 1q22–23 and 1q41–42, suggesting that similar genetic factors T ematosus (SLE), including the presence of anti-nuclear may mediate pathogenesis in both species (3). Subsequent studies autoantibody, immune activation, and immune-complex–induced using congenic mice demonstrated distinct functional requirements glomerulonephritis (GN). Derived from the classic (NZB 3 NZW) that Sle1 imparted in the induction of murine lupus. Specifically, F1 (NZB/W F1) lupus model, it has an advantage over its parental B6.Sle1 mice display B and T cell intrinsic loss of tolerance to strains in that it is homozygous, making it an ideal model to chromatin (4–6). Furthermore, complementation analyses with the by guest on September 25, 2021 identify novel genetic determinants of lupus (1). Linkage analysis other NZM2410-derived SLE susceptibility loci (7) and with the of NZM2410 to GN identified the major lupus susceptibility locus NZW genome (8) demonstrated that Sle1 expression was neces- Sle1 as an NZW-derived interval on telomeric chromosome 1 (2). sary for disease to develop in this model. Still, the identification of the underlying genetic determinants of SLE pathogenesis in this 62-Mb region, which contains an estimated 350 genes, remained *Department of Pathology, Immunology, and Laboratory Medicine, University of a daunting task. Florida, Gainesville, FL 32610; †Department of Medicine, College of Medicine, State ‡ Sle1 Sle1a Sle1b Sle1c University of New York, Syracuse, NY 13210; Department of Pathology, College of Three subloci, , , and , contribute to the Medicine, State University of New York, Syracuse, NY 13210; xDepartment of production anti-chromatin autoantibodies, revealing the complexity Microbiology and Immunology, College of Medicine, State University of New York, { of this locus (9). Further phenotypic characterization of these sub- Syracuse, NY 13210; Department of Microbiology and Molecular Genetics, Uni- + versity of Florida, Gainesville, FL 32610; and ‖Oklahoma Medical Research Foun- loci revealed increased activation of CD4 T cells by Sle1a and dation, Oklahoma City, OK 73104 Sle1c and defective B cell tolerance by Sle1b (9–11). Through the Received for publication February 1, 2012. Accepted for publication May 20, 2012. use of congenic recombinants, Sle1c was determined to corre- This work was supported by National Institutes of Health Grants R01 AI045050 (to spond to at least two subloci, Sle1c1 and Sle1c2 (12). Complement L.M.) and R01 AI072648 (to A.P.). receptor 2 (Cr2) was identified as a candidate gene for Sle1c (3) The microarray data presented in this article have been submitted to the Gene and subsequently found to cosegregate with telomeric Sle1c1 (12). Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE31702. Ensuing human association studies validated these findings by Address correspondence and reprint requests to Dr. Laurence Morel, Department of identifying a haplotype that alters Cr2 splicing that was associated Pathology, Immunology, and Laboratory Medicine, University of Florida, Box with SLE (13, 14). In addition, Sle1b has been attributed to 100275, Gainesville, FL 32610. E-mail address: morel@ufl.edu polymorphisms in the signaling lymphocytic activation molecule The online version of this article contains supplemental material. (SLAM) gene cluster, with direct evidence for one SLAM family Abbreviations used in this article: atRA, all-trans retinoic acid; BM, bone marrow; member Slamf6 (11, 15, 16). More recently, evidence has shown that cGVHD, chronic graft-versus-host disease; DAR-4M, diaminorhodamine-4M; ERR, estrogen-related receptor; Esrrg, estrogen-related receptor g; Fluo-3AM, fluo-3- expression of Slamf1, Slamf2,andSlamf4, other members of the acetoxymethyl ester; GN, glomerulonephritis; HE, hydroethidine; MFI, mean fluores- SLAM family located within Sle1b, also is involved in controlling cence intensity; MTG, MitoTracker Green-FM; PI, propidium iodide; ROI, reactive anti-nuclear autoantibody production (17, 18). Finally, Sle1a1 cor- oxygen intermediate; SLAM, signaling lymphocytic activation molecule; SLE, systemic lupus erythematosus; SNP, single-nucleotide polymorphism; Tem, T effector memory responds to a novel splice isoform of Pbx1, which is found more cell; TMRM, tetramethylrhodamine methyl ester; Treg, regulatory T cell; VDAC, frequently in SLE patients than in healthy controls (19). Thus, voltage-dependent anion channel. a variety of novel lupus susceptibility genes have been identified Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00 so far in the Sle1 locus that affect both B and T cell functions. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1200411 794 Sle1c2 REGULATES T CELL ACTIVATION THROUGH Esrrg EXPRESSION

We have reported previously that Sle1c2 is associated with in- (II/41), CD80 (16-10A1), CD86 (GL1), I-Ab (AF6-120.1), and isotype creased activation and proliferation of CD4+ T cells (12). In the controls were used in predetermined amounts. SA-PerCP-Cy5.5 (BD current study, we mapped Sle1c2 to estrogen-related receptor g Biosciences) was used to detect biotinylated Abs. IFN-g (XMG1.2), IL-4 (11B11), IL-17A (TC11-18H10), and Foxp3 (FJK-16s) were detected using (Esrrg), which encodes the orphan nuclear receptor ERR-g. The Fixation/Permeabilization kits (eBiosciences) according to the manu- expression of this gene, which regulates oxidative metabolism facturer’s protocol. When cytokine profiles were analyzed, cells were (20), has not been reported previously in T cells. We showed that treated with leukocyte activation mixture (BD Biosciences) before the NZW allele is associated with reduced Esrrg expression in staining. All of the Abs were from BD Biosciences except for anti-Foxp3 + which was from eBiosciences. Analysis was performed on a FACSCalibur CD4 T cells, which strongly correlates with increased cell acti- cytometer (BD Biosciences) with at least 50,000 events per sample col- vation, and the expansion of IFN-g–secreting T cells. In addition, lected, and lymphocyte populations were gated based on forward and side B6.Sle1c2 CD4+ T cells showed reduced mitochondrial mass and scatter characteristics. For metabolic labeling, splenocytes derived from 2- to 3-mo-old B6, B6. hyperpolarization consistent with their reduced Esrrg expression. a Finally, we demonstrated that Sle1c2 contributes to lupus pheno- Thy1 , and B6.Sle1c2 mice were stained in RPMI 1640 medium at a density of 1 3 106 cells per milliliter with cell-permeable metabolic dyes at types in two disease models. These results suggest that Esrrg is a 37˚C for 30–120 min, followed by surface staining with PE-Cy7–conjugated novel lupus susceptibility gene that regulates CD4+ T cell function CD3 (17A2), PerCP-conjugated CD4 (GK1.5), allophycocyanin-Cy7–con- and activation through their mitochondrial metabolism. jugated CD8a (53-6.7), PE-conjugated CD11b (M1/70), allophycocyanin- conjugated CD11c (N418), and Alexa Fluor 700-conjugated CD19 (6D5) Abs for 30 min at 4˚C. All of the Abs for this experiment were obtained Materials and Methods from Biolegend. Metabolic indicators were used for the measurement of Mice NO, mitochondrial transmembrane potential, mitochondrial mass, Ca2+ stores, superoxide production, apoptosis, and necrosis (22, 23). Diaminorhodamine- Downloaded from B6.Sle1c mice that contain an NZW-derived interval at the telomeric end 4M (DAR-4M) was used to evaluate peroxynitrite production, a by-product of chromosome 1 have been described previously (9). The loci previously of increased NO production. Mitochondrial transmembrane potential was w b referred to as Sle1c.Cr2 -1 on the telomeric end and Sle1c.Cr2 -1 on the measured using the potentiometric indicator tetramethylrhodamine methyl centromeric end (12) have been renamed Sle1c1 and Sle1c2, respectively, ester (TMRM). Mitochondrial mass was measured by fluorescence of to be more consistent with the terminology for the other loci. To generate MitoTracker Green-FM (MTG). Calcium stores were measured by fluores- 3 3 additional recombinant subcongenic strains, (B6 B6.Sle1c)F1 B6 cence of fluo-3-acetoxymethyl ester (Fluo-3AM) (1 mM). Hydroethidine (HE), backcross progeny were genotyped for recombination in the Sle1c interval dihydrorhodamine 123 (DHR), and 29,79-dichlorofluorescin were used as with microsatellites that are polymorphic between NZW and B6 mice. indicators for superoxide production. Apoptosis and necrosis were evaluated http://www.jimmunol.org/ Recombinants were bred to B6 mice, and the progeny of this expansion by costaining with FITC-conjugated Annexin V and propidium iodide (PI). backcross then were bred to homozygosity. To fine-map the ends of the TMRM, MTG, HE, Fluo-3AM, and PI were obtained from Invitrogen- recombinant congenic intervals, single-nucleotide polymorphisms (SNPs) Molecular Probes, DAR-4M from Calbiochem, and FITC-conjugated that are polymorphic for B6 and NZW mice were selected from the Mouse Annexin V from BD Biosciences. The metabolic profiling was evaluated Phenome Database (http://phenome.jax.org/SNP), and alleles were deter- on a LSR-II flow cytometer (BD Biosciences), with 50,000 events per mined by sequencing. C57BL/6 (B6), B6.Cg-Tg(TcraTcrb)425Cbn/J (B6. sample collected. Data were analyzed using FlowJo cytometry analysis bm12 a a a OTII), B6(C)-H2-Ab1 /KhEgJ (B6.bm12), B6.Cg-Igh Thy1 Gpi1 /J software (Tree Star, Ashland, OR). Mean fluorescence intensity (MFI) a tm1Mom tm1Mom 2/2 (B6.Thy1 ), B6.129P2-Tcrb Tcrd /J (B6.Tcrbd ), and NZB values of B6.Sle1c2 mice were normalized to the means obtained for B6 mice were purchased from The Jackson Laboratory. B6.Foxp3eGFP mice mice studied in parallel and set at 1.0.

(21) were a kind gift from Dr. Vijay Kuchroo (Harvard Medical School). by guest on September 25, 2021 All of the mice were bred and maintained at the University of Florida Gene expression analyses under specific pathogen-free conditions, and experiments were performed Total RNA was isolated using RNeasy mini kits, QIAshredders, and RNase- using age- and sex-matched cohorts at the ages indicated in the text. All of free DNase sets (Qiagen). cDNA then was synthesized using the ImProm-II the experiments were conducted according to protocols approved by the Reverse Transcription System (Promega). Primers for ERR-g target genes University of Florida Institutional Animal Care and Use Committee. (Supplemental Table I) were designed with the Primer3 software (http:// Cell isolation and culture frodo.wi.mit.edu/primer3/) and used in Sybr Green (Applied Biosystems)- based quantitative RT-PCR. Taqman Gene Expression Assays (Applied Single-cell suspensions were prepared from spleens, and RBCs were lysed. Biosystems) were used to measure Esrrg (Mm00516269_mH, spans Cells then were washed in ice-cold 5% FCS in PBS and passed through 30-mm exons3and4oftranscript1)andGapdh control expression. Relative nylon mesh to remove debris. Splenocyte suspensions were enriched for quantity of gene expression was calculated using the comparative CT + 2DDCt CD4 T cells by negative selection with magnetic beads (Miltenyi Biotec). method (RQ = 2 ) normalized to the average DCT of the B6 samples. RPMI 1640 medium supplemented with 10% FCS, HEPES, 2-ME, and Global gene expression was compared between negatively bead-selected penicillin/streptomycin was used as the culture medium. Cells were stimu- CD4+ T cells from 6-mo-old B6 and B6.Sle1c2 mice (n = 5 per strain). Their lated either with plate-bound 5 ml/ml anti-CD3e (145-2C11) and 2.5 ml/ml cDNA was synthesized, fragmented, and biotin-labeled using the Ovation anti-CD28 (37.51) (BD Biosciences) or with 0.5 mg/ml PMA and 1 mM Biotin RNA Amplification and Labeling System (NuGEN Technologies), ionomycin (Sigma-Aldrich). For Ag-specific proliferation assays, irradiated then hybridized to Affymetrix Mouse Genome 430 2.0 arrays. Data analysis (2000 rad) B6 splenocytes were pulsed for 2 h at 37˚C with either OVA323–339 was based on the use of “internal standards” and generalization of the “Error or histone H476–90 at the indicated concentrations. The Ag-loaded spleno- Model” (24) as presented elsewhere (25). cytes then were cocultured 1:1 with CD4+ T cells from B6.OTII or B6. Sle1c2.OTII mice in triplicate. [3H]Thymidine was added at 1 mCi/200 ml ELISA for the last 18 h of 72-h cultures to measure proliferation. Cells then were Anti-dsDNA and anti-chromatin IgG were measured by ELISAs as de- harvested onto glass filter paper to measure thymidine incorporation. For + scribed previously (4). Sera were tested in duplicate in a 1:100 dilution. Th17 polarization, CD4 T cells were cultured with anti-CD3e and anti- Relative units were standardized using serial dilutions of a positive serum CD28, 2.5 ng/ml TGF-b (Peprotech), and 25 ng/ml IL-6 (Peprotech) for 48 h. + + + from a B6.Sle1.Sle2.Sle3 (BcN/LmoJ) mouse, arbitrarily setting the 1:100 For CD4 Foxp3 regulatory T cell (Treg) induction, FACS-sorted CD4 dilution reactivity to 100 U. GFP2 T cells from B6.Foxp3eGFP or B6.Sle1c2.Foxp3eGFP mice were culturedwithanti-CD3eandanti-CD28and2.5ng/mlTGF-b with or Western blot analysis without 10 nM all-trans retinoic acid (Sigma-Aldrich). Cell lysates prepared from splenic CD4+ T cells purified by negative se- Flow cytometry lection were probed with rabbit polyclonal ERR-g Ab (Z-21; Santa Cruz Biotechnology) and revealed with HRP-conjugated anti-rabbit IgG (Sigma Cell suspensions were blocked with 10% normal rabbit serum and anti-CD16/ Aldrich). HRP-conjugated anti-GAPDH Ab (Sigma Aldrich) was used as 32 (2.4G2) in staining buffer (5% FCS and 0.05% sodium azide in PBS) and a control. The membranes were developed by enhanced SuperSignal West incubated on ice for 30 min. Biotinylated or fluorophore-conjugated Abs Pico Chemiluminescent substrate (Thermo Scientific, Rockford, IL). The specific for CD3 Molecular Complex (17A2), CD4 (RM4-5), CD8a (53- bands were quantified using AlphaVew software (Alpha Innotech). 6.7), CD44 (IM7), CD62L (MEL-14), CD25 (7D4), CD69 (H1.2F3), For voltage-dependent anion channel (VDAC) expression, protein lysates CD90.1 (OX-7), CD90.2 (53-2.1), B220 (RA3-6B2), CD19 (1D3), IgM were prepared from splenocytes and negatively isolated T cells (Dynal The Journal of Immunology 795 mouse T cell negative isolation kit; Invitrogen) through lysis in radio- Statistical analysis immunoprecipitation assay buffer [150 mM NaCl, 2% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris (pH 8.0), 1 mM PMSF, 1 mg/ml Statistical analyses were performed using GraphPad Prism 5 software. aprotinin, 1 mg/ml pepstatin, 1 g/ml leupeptin, 1 mM NaF, 1 mM sodium Unless indicated, graphs show mean and SEM for each group. For com- orthovanadate, 0.1 mM sodium molybdate, and 10 mM sodium pyrophos- parisons between two groups, two-tailed Mann–Whitney tests were used 7 , phate] at a density of 4 3 10 cells per milliliter on ice, followed by the when n $ 5 and Student t tests were used either when n 5 or when data addition of equal volumes of Laemmli buffer and were heated to 95˚C for sets passed D’Agostino and Pearson omnibus normality tests as indicated. 5 min before separation via SDS-PAGE and transferred to 0.45-mm nitro- ANOVAwith Dunn’s posttest and two-way ANOVAwith Bonferroni posttest cellulose membranes. VDAC/porin was detected with rabbit polyclonal Ab corrections were used for multiple comparisons as appropriate. Each in vitro (Abcam, #ab34726), and b-actin was detected with mouse mAb (Millipore, experiment was performed at least twice. #MAB1501R). Western blots were imaged using a Kodak Image Station 440CF and quantified by automated densitometry using Kodak1D software Results (Eastman Kodak, Rochester, NY). Increased CD4+ T cell activation maps to the centromeric end Mixed bone marrow chimera of Sle1c Chimeras were prepared as described previously (5). In brief, 4- to 5-mo- In order to narrow the number of candidate genes responsible for 2 2 old B6.Tcrbd / recipients were lethally irradiated with two doses of 525 the increased CD4+ T cell activation displayed by Sle1c congenic rad 4–6 h apart the day before reconstitution. Bone marrow (BM) cell mice, six subcongenic strains were generated in which recombi- suspensions from B6.Thy1a and B6.Sle1c2 were mixed 1:1 after depleting T cells using anti-CD5 magnetic beads (Miltenyi Biotec). Recipients re- nant screening was targeted to the centromeric end of the interval ceived 107 BM cells from sex-matched donors by i.v. injections, and grafts (Fig. 1A). Phenotypic screening showed that two strains, REC2b were allowed to reconstitute for 8 wk. and REC5, displayed increased spleen weight and CD4/CD8 Downloaded from T cell ratio in aged mice as compared with B6 (Fig. 2A). In Chronic graft-versus-host disease addition, these two strains displayed increased CD4+ Tcellac- Chronic graft-versus-host disease (cGVHD) was induced as described tivation with a significantly higher percentage of CD69+ Tcells 3 7 2 previously (26). In brief, B6 and B6.Sle1c2 hosts received 8 10 B6. and of CD44hiCD62L T effector memory cells (Tems). Because bm12 splenocytes via i.p. injections. Sera were collected weekly after induction and screened for anti-dsDNA and anti-chromatin IgG. Hosts the strain with the shortest interval necessary for increased activa- were sacrificed 3 wk after transfer, kidneys were prepared for histol- tion is the REC5 subcongenic and REC1, REC2, REC3, and REC8 ogy, and splenocytes were analyzed by flow cytometry. The presence of were B6-like, Sle1c2 then was defined as the 675-kb region between http://www.jimmunol.org/ immune complexes in the kidneys was evaluated on frozen tissue SNPs rs30920616 and rs32528185 (Fig. 1). Except where noted, the sections stained with FITC-conjugated anti-C3 (Cappel) and anti-IgG H+L chains (Jackson ImmunoResearch). Staining intensity was eval- REC5 strain was used as B6.Sle1c2 for the remainder of this study. uated in a blind manner on a semiquantitative 0–3 scale and averaged As opposed to the splenomegaly phenotype, which is age- on at least 10 glomeruli per section. Two separate sets of cGVHD dependent, CD4+ T cell increased activation was detectable induction were performed with at least five mice per strain, yielding as early as 2–3 mo of age (Supplemental Fig. 1A), suggesting that similar results. it is a primary consequence of Sle1c2 expression. Importantly, as Experimental autoimmune encephalomyelitis shown previously for the entire Sle1c interval (12), a mixed BM +

chimera experiment showed that increased CD4 T cell activation by guest on September 25, 2021 Experimental autoimmune encephalomyelitis was induced in 4-mo-old male B6 or B6.Sle1c2 mice. On day 0, mice received an emulsion of 50 was intrinsic to Sle1c2-expressing T cells (Supplemental Fig. 1B). mg myelin oligodendrocyte glycoprotein peptide sequence 35–55 and 500 Because we have reported previously an increased proliferation of mg Mycobacterium tuberculosis (Difco) in IFA (Sigma-Aldrich) via s.c. B6.Sle1c CD4+ T cells (12), we screened the congenic recombi- injections at the base of the tail. In addition, 500 ng pertussis toxin (List nants to discern whether this phenotype also mapped to the refined Biologicals) was administered i.p. on days 0 and 2. Daily clinical scores were assessed by the following criteria: 0, no disease, 1, flaccid tail, 2, hind Sle1c2 locus. To assess whether the increased proliferation was limb paraparesis, 3, hind limb paralysis, 4, quadriplegia. Mice were eu- Ag-specific, B6.Sle1c2.OTII double-congenic mice were gener- thanized at a score of 4 or 40 d after induction. ated for comparison with B6.OTII mice, which carry a transgenic

FIGURE 1. Physical map of Sle1c.(A) Sle1c and its recombinant intervals (REC1 to REC8) are shown on the telomeric end of chromosome 1 with NZW-derived regions in white and B6-derived regions in black. All of the known polymorphic Massachusetts Institute of Technology microsatellite markers as well as SNPs that define recombination intervals are depicted. (B) Sle1c2 is defined by the nonoverlapping centromeric end of Sle1c that carries the NZW alleles in REC5 and REC2b (Sle1c2w) and the B6 alleles in the other strains (Sle1c2b). The SNPs defining the areas of recombination on both ends are shown, along with the exon– intron structure of the two known protein-coding genes located in Sle1c2. Scale is in Mb, and all of the posi- tions are current with Ensemble release 67 (http:// www.ensembl.org/Mus_musculus/), which is based on National Center for Biotechnology Information m37. 796 Sle1c2 REGULATES T CELL ACTIVATION THROUGH Esrrg EXPRESSION Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 2. Phenotypic mapping of Sle1c2.(A) Comparison of spleen weights, CD4/CD8 ratios, CD69 expression, and Tem percentages of CD4+ T cells from spleens of 10- to 14-mo-old mice. Significance levels indicate ANOVA with Dunn’s multiple comparison analysis to B6. (B–D) Ag-specific (B), polyclonal (C), and PMA-induced (D) proliferation of CD4+ T cells from 3- to 5-mo-old mice was measured by [3H]thymidine incorporation, and stimulation indexes were calculated relative to cultures with medium only. Both REC2b.OTII and REC5.OTII strains were used as Sle1c2.OTII. Two-way ANOVA (‡‡) was used to measure strain effect on Ag-specific proliferation with Bonferroni’s posttest indicating significance at each concentration in(B). The Mann–Whitney test was used in (C), and the t test was used in (D). (E and F) Absolute numbers of splenic CD4+ T cells (E) and of B and CD8+ T cells (F) were compared between B6 and B6.Sle1c2 in 5- to 8-mo-old and 10- to 14-mo-old cohorts. Naive T cells were defined as CD4+CD44loCD62L+, and Tems were defined as CD4+CD44hiCD62L2. Significance levels indicate Mann–Whitney comparisons to B6 mice of the same age group. *p # 0.05, **p # 0.01, ***p # 0.001, ‡‡p # 0.001.

TCR that is specific for the OVA323–339 peptide. Increased pro- (Supplemental Fig. 2A, 2B). Intracellular staining confirmed that liferation was observed with Ag-specific OVA (Fig. 2B), poly- a larger percentage of Sle1c2 CD4+ splenocytes expressed IFN-g clonal TCR (Fig. 2C), and PMA/ionomycin (Fig. 2D) stimulation as compared with B6 (Fig. 3A). Importantly, CD4+ T cells from of B6.Sle1c2.OTII as compared with B6.OTII T cells. This in- the parental B6.Sle1c strain showed a similar percentage of IFN- creased activation and proliferation resulted in an expansion of the g+ T cells as the B6.Sle1c2 subcongenic strain. No difference was CD4+ T cell compartment in older mice, specifically Tems to the observed for IL-4 production (data not shown). expense of naive CD4+ T cells (Fig. 2E). Age-dependent expan- The microarray analysis also revealed that several genes in- sion of the B and CD8+ T cell compartments also were observed in volved in Th17/Treg homeostasis were upregulated in B6.Sle1c2 B6.Sle1c2 mice (Fig. 2F). However, surface marker analysis found CD4+ T cells (Supplemental Fig. 2C). These included Foxp3, no evidence of increased activation in these cells (data not shown). Il2ra, and IL10 for Tregs and Irf4, Rora, Il17a, IL21, and Il22 for Taken together, these results mapped the CD4+ T cell activation Th17 cells. In addition, the Ahr and Hif1a pathways, which have phenotype observed in Sle1c mice to the 675-kb Sle1c2 interval. been implicated in Th17/Treg homeostasis (22, 27, 28), also were This drastically reduced the set of candidate genes from 48 to 2, upregulated (Supplemental Fig. 2B, 2C). Given this altered gene namely, Esrrg, encoding ERR-g,andUsh2a, encoding Usher syn- expression profile, we examined whether Sle1c2 expression aug- drome 2A homolog (Fig. 1B). mented Treg and Th17 differentiation. Using Foxp3eGFP reporter

+ mice, we showed that TGF-b with or without all-trans retinoic B6.Sle1c2 CD4 T cells exhibit marked Th1 skewing acid equally induced Foxp3 expression in B6 and B6.Sle1c2 CD4+ A gene expression and pathway analysis of CD4+ splenocytes GFP2 T cells (Supplemental Fig. 1C). Moreover, contrary to revealed that a large number of genes related to IFN-g expression our previous reports that described a decrease in the percentage were upregulated in B6.Sle1c2 mice, suggesting Th1 skewing of Tregs deﬁned as CD4+CD62L+CD25+ (10, 12), the size of the The Journal of Immunology 797

FIGURE 3. Sle1c2 upregulates IFN-g expression. (A) Representative histo- grams and quantification of ex vivo IFN-g intracellular staining in CD4+ T cells were from the spleens of 2- to 3- Downloaded from mo-old mice. Significance levels indicate ANOVA with Dunn’s multiple comparison analysis to B6. (B) Representative plots and quantification of Foxp3+IFN- g+ double-positive CD4+ T cells after 3 d of culture with plate-bound anti-CD3/

CD28 and TGF-b. Cells were collected http://www.jimmunol.org/ from 1- to 3-mo-old and 8- to 10-mo-old mice. (C and D) Representative plots (C) and quantiﬁcation (D) of intracellular staining for IFN-g, Foxp3, and IL-17 in CD4+ T cells from 8- to 10-mo-old mice after 3 d of Th0 (anti-CD3 and anti-CD28 only), Treg (stimulation plus TGF-b), and Th17 (stimulation plus TGF-b and IL-6) polarizing conditions. In (B)and (D), t tests compare B6 to Sle1c2 mice for by guest on September 25, 2021 each age or treatment group. *p # 0.05, **p # 0.01, ***p # 0.001.

CD4+Foxp3+ Treg compartment was similar between B6 and B6. again the Th1 skewing induced by Sle1c2 expression. Finally, Sle1c2 mice, with an expansion of Foxp3+ Tregs in older B6.Sle1c2 experimental autoimmune encephalomyelitis was used as a model mice (Supplemental Fig. 1D). Interestingly, in vitro Treg polariza- to test for differences in Th17/Treg homeostasis in vivo, and no tion produced significantly more Foxp3+IFN-g+ cells in B6.Sle1c2 differences were observed in day of onset or severity between the mice at 8–10 mo of age, but not 1–3 mo of age (Fig. 3B, 3D). This two strains (Supplemental Fig. 1E). Hence, although the global gene not only confirms the strong Th1 skewing associated with Sle1c2 expression analysis predicted increased commitment to Th1, Treg, but also suggests that B6.Sle1c2 mice may accumulate Tregs and Th17 lineages, cellular assays only revealed strong Th1 skewing. corresponding to a plastic population of IFN-g+ adaptive Tregs that have been linked to autoimmunity (23). Sle1c2 exacerbates lupus in the induced cGVHD model and via Th17 in vitro polarization did not reveal differences in IL-17 epistatic interactions with the NZB genome production between the two strains (Fig. 3C, 3D). However, as To determine whether the CD4+ T cell phenotypes that segregate with Treg polarization, IFN-g production was increased in the B6. with Sle1c2 are relevant to lupus pathogenesis, we used the cGVHD- Sle1c2 Th17-polarized CD4+ T cells (Fig. 3C, 3D), highlighting induced lupus model (29). Preliminary results mapped increased 798 Sle1c2 REGULATES T CELL ACTIVATION THROUGH Esrrg EXPRESSION cGVHD susceptibility to the centromeric portion of Sle1c that T cell phenotype is recessive (data not shown). Our findings includes Sle1c2 (12). In this study, we showed that CD4+ T cells showed that, in 12-mo-old NZB hybrids, splenomegaly, CD4/CD8 were significantly more activated in B6.Sle1c2 recipients of B6. T cell ratio, percentage of Tems, and B7-2 expression on B cells bm12 splenocytes as compared with B6 recipients (Fig. 4A). In were increased significantly in mice with the homozygous NZW addition, B6.Sle1c2 CD11c+ dendritic cells and B cells displayed Sle1c2 allele (Fig. 5A). Moreover, the expression of Sle1c2 sig- altered activation (Fig. 4B, 4C) that was concurrent with increased nificantly enhanced the production of anti-dsDNA IgG triggered serum autoantibody production (Fig. 4D). Finally, the kidneys of by the NZB hemigenome as the mice aged (Fig. 5B). Finally, IgG cGVHD-induced B6.Sle1c2 mice showed increased deposition of immune complex deposition was exacerbated greatly by Sle1c2 IgG2a immune complexes as compared with those of B6 mice (Fig. 5C, 5D) but did not result in clinical disease. Taken together, (Fig. 4E). These results demonstrate that the activated phenotype of these data establish that Sle1c2 can contribute to lupus through Sle1c2 CD4+ T cells contributes to induced humoral autoimmunity. interactions with the NZB genome. We have shown previously that Sle1c expression increases lupus Esrrg expression is downregulated in B6.Sle1c2 CD4+ T cells phenotypes presented by (NZB 3 B6)F1 hybrids (30). Using the same model, we compared the phenotypes of (NZB 3 B6)F1 and The 675-kb Sle1c2 interval contains two protein-coding genes, (NZB 3 B6.Sle1c2)F1 mice, in which the NZB hemigenome Esrrg and Ush2a (Fig. 1B), with the latter having no detectable interacts with either the B6 or the NZW Sle1c2 alleles, respectively. expression in CD4+ cells (data not shown). Esrrg message ex- Importantly, the NZB and NZW strains share the same haplotype at pression was detected in CD4+ splenocytes and at a lower level in the chromosome 1 189.80–190.050 Mb interval that includes the CD42 splenocytes and in thymocytes (Fig. 6A). Furthermore, Esrrg

Sle1c2 portion of Esrrg, as determined for all 228 published SNPs expression was signiﬁcantly lower in the B6.Sle1c2 CD4+ T cell Downloaded from that are polymorphic between B6 and NZW, with an NZB allele fraction as compared with that in the B6 CD4+ Tcellfraction known or imputed with conﬁdence $0.9 (data not shown). There- (40.6 6 11.4% less). No difference between strains was observed fore, the Sle1c2 locus is predicted to be homozygous for the NZB/ in CD42 splenocytes. Esrrg expression in CD4+ T cells is low NZW allele in (NZB 3 B6.Sle1c2)F1 mice and heterozygous in compared with that in liver, heart, brain, and kidney, highly + (NZB 3 B6)F1 mice. This is relevant because the Sle1c2 CD4 metabolic tissues in which Esrrg expression has been reported http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 4. Sle1c2 enhances induced lupus phenotypes in the cGVHD model. cGVHD was induced in B6 (ﬁlled circles) and B6.Sle1c2 (open circles), and splenic compartments were compared by ﬂow cytometry 3 wk later. Age-matched noninduced mice also are shown as a control. (A) CD4+ T cell activation was assessed by high forward scatter (indicative of blasting cells), CD69 expression, and expansion of Tems. (B) Dendritic cell activation was indicated by B7-2 (CD86) expression. (C) B cell activation was measured by CD22, CD69, B7-1 (CD80), and B7-2 expression. (D) Glomerular IgG2a and C3 deposition was detected in frozen kidney sections. Sections were separately scored for each Ab, and additive values (IgG2a score + C3 score) are shown. (E) Weekly serum anti-chromatin and anti-dsDNA IgG were measured by ELISA. (A)–(C) and (E) were compared by Mann–Whitney tests, and (D) was compared by two-way ANOVA with Bonferroni’s posttest. *p # 0.05, **p # 0.01, ***p # 0.001. The Journal of Immunology 799

FIGURE 5. Sle1c2 exacerbates spontaneous lupus phenotypes induced by the NZB genome. (A) Spleen weight, CD4/ CD8 ratios, and percentage of CD62L2 CD44hiCD4+ and B7-2+B220+ splenocytes in 12-mo-old (NZB 3 B6)F1 and (NZB 3 B6.Sle1c2)F1 mice (n = 14 and 25, respectively). (B) Serum anti-dsDNA IgG is shown as unit values at 5 and 12 mo of age and as relative individual increase between these two ages for each strain. (C and D) Glomerular IgG and C3 deposition was Downloaded from detected in frozen kidney sections with FITC-conjugated anti-C3 and anti-IgG Abs. Sections were scored separately for each Ab, and additive values (IgG score + C3 score) are shown in (C). Representative sections (original magniﬁcation 3100) are D shownin( ). Mann–Whitney tests: *p # http://www.jimmunol.org/ 0.05, **p # 0.01, ***p # 0.001. by guest on September 25, 2021

(31–33), going from ∼4 times lower than that in liver to ∼50 times To determine if decreased Esrrg expression in CD4+ T cells had lower than that in kidney (Supplemental Fig. 3A). In our micro- transcriptional consequences on its putative targets, we selected 12 array analysis, five probes were located within the Esrrg locus genes (Supplemental Table I) that were differentially expressed (with only one actually probing the ERR-g coding sequence). by B6.Sle1c2 CD4+ T cells in the microarray analysis and that However, the signal for all five probes was below the detectable also were known to have ERR-g bound to their promoters by threshold. CD4+ TcellERR-g protein expression was detected chip-on-chip analyses (34, 35). The expression of five of these in CD4+ T cells (Fig. 6B). We were not able, however, to show a genes, transcriptional regulators c-myc binding protein (Mycbp)and difference between B6.Sle1c2 and B6. Esrrg overexpression in retinoic acid receptor a (Rara), a subunit of electron transport cell lines showed that messages and protein levels were not tightly complex I (Ndusf1), a mitochondrial protein modifier (Ppif), and a correlated, suggesting important posttranscriptional regulation (data mitochondrial oxidoreductase (Rtn4ip1), was decreased signifi- not shown). Regardless of age or strain, Esrrg message expression cantly in Sle1c2 CD4+ T cells (Supplemental Fig. 3C). These data in splenic CD4+ T cells showed strong negative correlation with suggest that the decreased Esrrg expression induced by Sle1c2 both CD69+ T cell and Tem percentages (Fig. 6C), suggesting that affects Esrrg target gene expression. Esrrg negatively regulates CD4+ T cell activation. Because Esrrg is known to regulate glycolytic and oxidative Esrrg expression was compared between B6.Sle1c2 and B6 adult metabolic programs (34), we analyzed the expression of several brain, heart, kidney, and liver. Esrrg expression was decreased genes involved in these pathways by quantitative PCR. Hif1a and significantly in B6.Sle1c2 brain, and a trend for decreased ex- Slc16a3, encoding monocarboxylic acid transporter 4, which are pression was observed in kidney and liver (Supplemental Fig. 3B). both mediators of glycolysis (22), were expressed at a higher level Interestingly, an opposite trend was observed in heart. Esrrg- in B6.Sle1c2 CD4+ T cells (Fig. 6D). In addition to glycolysis, deficient mice die postnatally due to a defective switch from gly- a microarray pathway analysis revealed an influence of Sle1c2 colytic to oxidative metabolism (34). Consistent with this result and in several other metabolic pathways, including glutaminolysis, reduced Esrrg expression in B6.Sle2c2 mice, we have observed glycogenesis, and fatty acid oxidation (Fig. 6E). Furthermore, high mortality in B6.Sle1c2 neonates (69% total litter loss, cor- genes regulating the electron transport chain also were differ- responding to 34 litters lost out of 49 born) as compared with that entially regulated, indicating altered mitochondrial function. in B6 neonates (18% litter loss corresponding to 13 out 71 born Finally, out of the seven metabolic genes that were analyzed in during the same period of time and in the same room). It is pos- both the Esrrg2/2 heart (34) and the Sle1c2 CD4+ T cells in this sible that, in response to reduced Esrrg expression, a compensa- study, five of them (Eno2, Gsk3, Cox6a2, Ndufa10,andNdufs1) tory mechanism may increase Esrrg expression in the myocardium showed an expression change in the same direction. Overall, of a percentage of B6.Sle1c2 neonates, resulting in their survival. these data provide evidence that Sle1c2 results in an altered 800 Sle1c2 REGULATES T CELL ACTIVATION THROUGH Esrrg EXPRESSION Downloaded from http://www.jimmunol.org/

FIGURE 6. Esrrg expression is decreased in Sle1c2 CD4+ T cells. (A) Quantitative PCR comparing Esrrg expression in thymocytes, splenocytes, CD4+ T cells, and CD42 fractions between B6 and B6.Sle1c2 (8–10 mo of age, n = 7 per strain). The t tests were used to compare B6.Sle1c2 Esrrg expression to B6 for each cell population. (B) ERR-g expression was analyzed in B6 and B6.Sle1c2 CD4+ T cells by semiquantitative Western blot analysis, with cell lysates undiluted or diluted 1:2 (0.5) and 1:4 (0.25). The ERR-g protein abundance was normalized to the expression of GAPDH. The numbers on the y-axis by guest on September 25, 2021 indicate the ratio of normalized ERR-g protein abundance in B6.Sle1c2 CD4+ cells to that in B6 CD4+ cells. (C) Correlation between Esrrg expression and CD69+ and Tem percentages of splenic CD4+ T cells. The young and old cohorts were 2- to 3-mo-old and 7- to 8-mo-old, respectively. The significance that slopes do not equal zero (p) and correlation coefficients for linear regressions (R2) are shown. (D) Quantitative PCR analysis of Hif1a, Slc16a3, and Pkm2 expression in B6 and B6.Sle1c2 CD4+ splenocytes, compared with Mann–Whitney tests. (E) Percentage change in the expression of genes in metabolic pathways from microarray analysis comparing B6.Sle1c2 to B6 CD4+ T cells. *p # 0.05, **p # 0.01, ***p # 0.001. metabolic profile in CD4+ T cells, due to decreased Esrrg ex- death by necrosis that has been reported previously in lupus pression. T cells (36). Interestingly, VDAC levels were increased significantly in Sle1c2 + B6.Sle1c2 CD4 T cells exhibit mitochondrial dysfunction CD4+ T cells (Fig. 7G), which may correspond to a compensatory Esrrg expression has been reported to directly correlate with mi- mechanism to maintain mitochondrial membrane potential despite tochondrial biogenesis and functions (33). Accordingly, decreased reduced Esrrg expression. A reduced mitochondrial mass was not Esrrg expression is predicted to reduce mitochondrial mass and observed in other Sle1c2 immune cell populations, except CD11c+ function in Sle1c2 CD4+ T cells. This indeed was verified in the cells (Table I). This may be related to the fact that Esrrg expression 2 spleens of 2- to 3-mo-old mice, in which the difference in T cell is very low in CD4 splenocytes (Fig. 6A), therefore not affecting activation is still minimal and therefore not likely to induce sec- mitochondria in these cell types. Other parameters showed signifi- ondary metabolic changes. The mitochondrial membrane potential cant differences between the two strains in non-CD4+ cell types, and mass were decreased significantly in Sle1c2 CD4+ T cells as such as NO levels, which were reduced significantly in CD8+ compared with those in B6 T cells (Fig. 7A, 7B), and this was T cells, B cells, and CD11b+ and CD11c+ splenocytes (Table I), associated with decreased Ca2+ and NO levels (Fig. 7D, 7E). In indicating that the metabolic consequences of Esrrg deficiency turn, the production of reactive oxygen intermediates (ROIs), as may not be confined to T cells. measured by HE fluorescence, was increased in Sle1c2 CD4+ T cells. However, no difference in ROIs was found between the Discussion two strains when measured with the 29,79-dichlorofluorescin or Within the major NZM2410 lupus susceptibility Sle1 locus, in- dihydrorhodamine 123 dyes (data not shown). These findings are creased CD4+ T cell activation mapped to both Sle1a and Sle1c suggestive of mitochondrial dysfunction, characterized by an (10), with each of these loci corresponding to two subloci (12, 37). inability to maintain transmembrane potential while leaking The current study focused on the functional characterization and ROIs. Consistent with impaired mitochondrial function, a sig- mapping of the CD4+ T cell phenotypes associated with Sle1c. nificant increase of necrosis was observed in Sle1c2 splenocytes Originally defined as the 7.72 Mb at the telomeric end of chromo- (Fig. 7F). This corresponds to a predisposition to proinflammatory some 1, Sle1c contains 48 protein-coding genes and 4 microRNAs. The Journal of Immunology 801 Downloaded from

FIGURE 7. Mitochondrial function is impaired in the CD4+ T cells of B6.Sle1c2 mice. (A–E) Splenic CD3+CD4+ T cells were assessed by ﬂow cytometry for mitochondrial mass (A), mitochondrial membrane potential (B), oxidation (C), Ca2+ (D) and NO (E) contents. The graphs show mean 6 SEM MFI normalized to B6 mean values. (F) Viability analysis of ex vivo splenocytes based on annexin V (Ann V) and PI staining. Live cells were Ann V2PI2. (G) VDAC expression in CD4+ T cells analyzed by Western blot analysis. The b-actin expression is shown as a control. The graph on the right shows http://www.jimmunol.org/ the densitometry analysis of the VDAC/b-actin ratios normalized to one B6 sample. All of the data were collected from the same 2- to 3-mo-old mice. B6 and B6.Thy1a (B6a) values were pooled in the graphs under B6 and compared with B6.Sle1c2 values with Mann–Whitney tests. *p # 0.05, **p # 0.01, ***p # 0.001.

Previous analyses have identified Cr2 on the telomeric end of Sle1c to autoimmunity, and relevant to this study, it has been shown as the candidate gene associated with impaired B cell responses (3). to strongly downregulate IFN-g production (45). This raises the In this study, we confirmed that centromeric Sle1c2 enhances possibility that ERR-g may mediate environmental triggers of CD4+ T cell activation and have established that Sle1c2 CD4+ autoimmunity. by guest on September 25, 2021 T cells are characterized by strong Th1 skewing. In addition, we ERRs are important regulators of metabolism and energy ho- have demonstrated the contribution of Sle1c2 to autoimmune meostasis, and Esrrg expression is highly restricted to metaboli- pathology by showing that its expression enhances both induced cally active tissues (42). Esrrg transactivates genes involved in and spontaneous lupus. Furthermore, congenic mapping and gene mitochondrial biogenesis, lipid transport and metabolism, tricar- expression analysis have identified Esrrg, one of the two genes lo- boxylic acid cycle, electron transport chain, and oxidative phos- cated in the critical interval, as the candidate gene for Sle1c2. Finally, phorylation, allowing for energy production by efficient fatty acid consistent with published works that have established that Esrrg is oxidation. This vital function is demonstrated in Esrrg null mice, a potent regulator of mitochondrial metabolism (33), the decreased where the lack of a critical switch from glycolytic to lipid-based expression of Esrrg in Sle1c2 CD4+ T cells is associated with metabolism in the myocardium results in perinatal lethality (34). decreased mitochondrial mass and with significant alterations of Conversely, Esrrg overexpression in skeletal muscle resulted in mitochondrial function. increased mitochondrial biogenesis and function as well as exer- ERR-g belongs to a family of nuclear receptors that are tran- cise capacity (33). Activation and proliferation by T cells also is scription factors whose activities are mediated by endogenous metabolically demanding (46). However, contrary to other meta- ligands and other coregulatory proteins. Several nuclear receptors bolically demanding tissues, activated T cells use aerobic gly- already have been implicated in T cell biology, including retinoic colysis to meet energy requirements. Known as the Warburg acid receptor a, retinoic acid-related orphan receptor g,PPARg, effect, this form of metabolism generates glucose metabolites at the vitamin D and the glucocorticoid receptors, and the estrogen the expense of ATP production (47). Remarkably, when ERR-g receptors (38–40). ERR-g, belonging to the ERR family, is expression is suppressed by microRNA, the Warburg effect is expressed at low levels in human spleen and thymus (41) but does induced (48). The rate of glycolysis has direct consequences on not yet have an established role in T cell biology. ERRs are CD4+ T cell activation and differentiation. GLUT1 transgenic structurally related to estrogen receptors but do not bind natural mice, which have increased glucose uptake in their T cells, show estrogens. In fact, ERR endogenous ligands have not been iden- T cell activation phenotypes very similar to B6.Sle1c2 mice, tified, and they thus are referred to as orphan nuclear receptors. It namely, age-dependent accumulation of CD69+ T cells and Tems, has been shown, however, that ERRs are constitutively active due increased proliferation, and increased IFN-g production (49). to the properties of their ligand-binding domains (42). Regardless, Consequently, aged mice suffered from hypergammaglobuline- several synthetic compounds augment ERR-g–mediated trans- mia and GN, exhibiting a direct connection between T cell me- activation of its target genes, demonstrating its potential as a tabolism and autoimmunity. Conversely, as reported recently in therapeutic target (43). Interestingly, bisphenol A, an industrial Myc-deficient mice, T cells display impaired proliferation with component known to be an endocrine disruptor, binds to and alters an altered activation phenotype when the switch to aerobic gly- the activity of ERR-g (44). Bisphenol A exposure has been linked colysis is obstructed (50). 802 Sle1c2 REGULATES T CELL ACTIVATION THROUGH Esrrg EXPRESSION

We hypothesize that Sle1c2 contributes to the Warburg effect in CD4+ T cells because decreased Esrrg expression would limit the 0.04 0.04 0.04 0.06 0.06 transcription of target genes that regulate oxidative lipid-based 6 6 6 6 6 metabolism, skewing toward glucose-based programs. This hy- Sle1c2 0.01, and italic

, pothesis is supported ﬁrst by the decreased expression of Esrrg p target genes, Ndufs1, Ppif, and Rtn4ip1, which regulate metabolism and mitochondrial function (51–53), and second by the decreased Fluo-3AM mitochondrial biogenesis and functions in Sle1c2 CD4+ T cells. 0.19 0.45 0.24 0.45 0.28 0.79 0.120.04 0.62 0.98 Recently, Michalek et al. (54) reported that ERR-a functions as a 6 6 6 6 6 B6 regulator of T cell metabolism. This isoform, encoded by a sepa- 0.95 0.93 1.00 0.96 1.00 rate gene, Esrra, binds to the same consensus DNA sequence as

0.05, underline indicates ERR-g and shares the same general function as a metabolic regu-

, lator. However, contrary to the increased T cell activation observed p in B6.Sle1c2 mice, which have reduced Esrrg expression in CD4+ 0.03 0.08 0.03 0.03 2 2 0.06 T cells, Esrra / mice lacked an expansion of Tems as they aged. 6 6 6 6 6 2/2 + Sle1c2 Interestingly, Esrra CD4 T cells were not defective in their proliferative and glycolytic capacities in response to TCR activation, whereas wild-type T cells in which ERR-a was acutely

inhibited were deficient in these capacities. This suggested that Downloaded from DAR-4M a developmental compensatory mechanism was offsetting the ef- 0.040.02 0.54 0.45 0.08 0.42 0.070.04 0.65 0.69 fect of Esrra deficiency, and indeed the authors observed alter- 6 6 6 6 6 B6 ations in mTOR and AMPK pathways. At this point, it is not clear 0.99 1.04 1.03 1.00 why chronic ERR-g deficiency leads to increased activation, whereas ERR-a deficiency results in a more naive phenotype. It is

conceivable that these two isoforms use different cofactors to dic- http://www.jimmunol.org/ tate their function. Overall, these ﬁndings validate our observations 0.17 0.14 0.07 0.06 g 6 6 6 6 that deﬁciencies in ERR- cause globally augmented metabolism in

Sle1c2 CD4+ T cells and result in altered T cell function. Dysregulated T cells are a major contributor to SLE pathogenesis, and targeting them is an important focus for therapeutic intervention HE (55). Mitochondrial dysfunctions have been identiﬁed speciﬁcally as a characteristic of human lupus T cells, which may offer addi- 0.05 1.18 + 0.02 0.99 0.11 1.66 0.06 1.35 0.080.03 1.16 1.19 6 6 6 6 6

B6 tional therapeutic targets (56). Recent studies have highlighted the by guest on September 25, 2021 and B6 mice regulation of metabolism as an important checkpoint of T cell 0.98 0.98 1.00 activation and effector functions. Our study associates, for the

Sle1c2 ﬁrst time, to our knowledge, a gene known as a major regulator of metabolism, mitochondrial dysfunction, and CD4+ T cell ac- 0.03 0.05 0.97 0.03 1.02 0.03 0.03 tivation Th1 polarization in a lupus model. A better understanding + 6 6 6 6 6 of the role of ERR-g in CD4 T cells will provide a better un- Sle1c2 derstanding of how metabolism regulates immune functions in the 0.31 0.48 context of autoimmunity. SEM for ﬁve mice per strain. Values were compared between the strains for each parameter. Bold indicates 6 TMRM Acknowledgments 0.920.40 0.35 0.69 0.34 0.32 0.18 0.11 We thank Dr. Eric Sobel, Dr. Clayton Matthews, Dr. Alberto Riva, and 6 6 6 6 6 B6 Dr. Margaret Wallace for valuable discussions, Leilani Zeumer and Xuekun

0.96 0.98 Su for excellent technical help, and Celia Lopez for microarray processing.

Disclosures The authors have no ﬁnancial conﬂicts of interest. 0.09 0.130.08 1.43 1.05 0.80 0.08 0.98 6 6 6 6 6 Sle1c2

0.65 References 1. Perry, D., A. Sang, Y. Yin, Y. Y. Zheng, and L. Morel. 2011. Murine models of systemic lupus erythematosus. J. Biomed. Biotechnol. 2011: 271694. MTG 2. Morel, L., U. H. Rudofsky, J. A. Longmate, J. Schiffenbauer, and E. K. Wakeland. 1994. Polygenic control of susceptibility to murine systemic 0.09 0.100.200.09 0.98 0.97 0.70 0.09 0.68 lupus erythematosus. Immunity 1: 219–229. 6 6 6 6 6 B6 3. Boackle, S. A., V. M. Holers, X. J. Chen, G. Szakonyi, D. R. Karp, E. K. Wakeland, and L. Morel. 2001. Cr2, a candidate gene in the murine Sle1c 1.04 1.04 0.98 0.98 0.97 lupus susceptibility locus, encodes a dysfunctional protein. Immunity 15: 775– 785. 4. Mohan, C., E. Alas, L. Morel, P. Yang, and E. K. Wakeland. 1998. Genetic

0.001. dissection of SLE pathogenesis. Sle1 on murine chromosome 1 leads to a se- + + , T T

+ lective loss of tolerance to H2A/H2B/DNA subnucleosomes. J. Clin. Invest. 101: p + + 1362–1372. 5. Sobel, E. S., C. Mohan, L. Morel, J. Schiffenbauer, and E. K. Wakeland. 1999. CD19 CD11c Cell Type CD4 CD8 CD11b MFI values were normalized to B6 means set at 1.0. The values indicate mean Genetic dissection of SLE pathogenesis: adoptive transfer of Sle1 mediates the indicates Table I. Comparison of mitochondrial function in the major splenic cell subsets between B6. loss of tolerance by bone marrow-derived B cells. J. Immunol. 162: 2415–2421. The Journal of Immunology 803

6. Sobel, E. S., M. Satoh, Y. Chen, E. K. Wakeland, and L. Morel. 2002. The major cardiac, gastric, and renal potassium homeostasis. Mol. Endocrinol. 24: 299– murine systemic lupus erythematosus susceptibility locus Sle1 results in ab- 309. normal functions of both B and T cells. J. Immunol. 169: 2694–2700. 32. Lorke, D. E., U. Su¨sens, U. Borgmeyer, and I. Hermans-Borgmeyer. 2000. 7. Morel, L., B. P. Croker, K. R. Blenman, C. Mohan, G. Huang, G. Gilkeson, and Differential expression of the estrogen receptor-related receptor gamma in the E. K. Wakeland. 2000. Genetic reconstitution of systemic lupus erythematosus mouse brain. Brain Res. Mol. Brain Res. 77: 277–280. immunopathology with polycongenic murine strains. Proc. Natl. Acad. Sci. USA 33. Rangwala, S. M., X. Wang, J. A. Calvo, L. Lindsley, Y. Zhang, G. Deyneko, 97: 6670–6675. V. Beaulieu, J. Gao, G. Turner, and J. Markovits. 2010. Estrogen-related receptor 8. Morel, L., X. H. Tian, B. P. Croker, and E. K. Wakeland. 1999. Epistatic modifiers gamma is a key regulator of muscle mitochondrial activity and oxidative ca- of autoimmunity in a murine model of lupus nephritis. Immunity 11: 131–139. pacity. J. Biol. Chem. 285: 22619–22629. 9. Morel, L., K. R. Blenman, B. P. Croker, and E. K. Wakeland. 2001. The major 34. Alaynick, W. A., R. P. Kondo, W. Xie, W. He, C. R. Dufour, M. Downes, murine systemic lupus erythematosus susceptibility locus, Sle1, is a cluster of J. W. Jonker, W. Giles, R. K. Naviaux, V. Gigue`re, and R. M. Evans. 2007. functionally related genes. Proc. Natl. Acad. Sci. USA 98: 1787–1792. ERRgamma directs and maintains the transition to oxidative metabolism in the 10. Chen, Y., C. Cuda, and L. Morel. 2005. Genetic determination of T cell help in postnatal heart. Cell Metab. 6: 13–24. loss of tolerance to nuclear antigens. J. Immunol. 174: 7692–7702. 35. Dufour, C. R., B. J. Wilson, J. M. Huss, D. P. Kelly, W. A. Alaynick, M. Downes, 11. Kumar, K. R., L. N. Li, M. Yan, M. Bhaskarabhatla, A. B. Mobley, C. Nguyen, R. M. Evans, M. Blanchette, and V. Gigue`re. 2007. Genome-wide orchestration J. M. Mooney, J. D. Schatzle, E. K. Wakeland, and C. Mohan. 2006. Regulation of of cardiac functions by the orphan nuclear receptors ERRalpha and gamma. Cell B cell tolerance by the lupus susceptibility gene Ly108. Science 312: 1665–1669. Metab. 5: 345–356. 12. Chen, Y., D. Perry, S. A. Boackle, E. S. Sobel, H. Molina, B. P. Croker, and 36. Perl, A., P. Gergely, Jr., G. Nagy, A. Koncz, and K. Banki. 2004. Mitochondrial L. Morel. 2005. Several genes contribute to the production of autoreactive B and hyperpolarization: a checkpoint of T-cell life, death and autoimmunity. Trends T cells in the murine lupus susceptibility locus Sle1c. J. Immunol. 175: 1080– Immunol. 25: 360–367. 1089. 37. Cuda, C. M., L. Zeumer, E. S. Sobel, B. P. Croker, and L. Morel. 2010. Murine 13. Wu, H., S. A. Boackle, P. Hanvivadhanakul, D. Ulgiati, J. M. Grossman, Y. Lee, lupus susceptibility locus Sle1a requires the expression of two sub-loci to induce N. Shen, L. J. Abraham, T. R. Mercer, E. Park, et al. 2007. Association of inflammatory T cells. Genes Immun. 11: 542–553. a common complement receptor 2 haplotype with increased risk of systemic 38. Pernis, A. B. 2007. Estrogen and CD4+ T cells. Curr. Opin. Rheumatol. 19: 414– lupus erythematosus. Proc. Natl. Acad. Sci. USA 104: 3961–3966. 420. 14. Douglas, K. B., D. C. Windels, J. Zhao, A. V. Gadeliya, H. Wu, K. M. Kaufman, 39. Mora, J. R., M. Iwata, and U. H. von Andrian. 2008. Vitamin effects on the Downloaded from J. B. Harley, J. Merrill, R. P. Kimberly, G. S. Alarcoń, et al. 2009. Complement immune system: vitamins A and D take centre stage. Nat. Rev. Immunol. 8: 685– receptor 2 polymorphisms associated with systemic lupus erythematosus mod- 698. ulate alternative splicing. Genes Immun. 10: 457–469. 40. Glass, C. K., and K. Saijo. 2010. Nuclear receptor transrepression pathways that 15. Wandstrat, A. E., C. Nguyen, N. Limaye, A. Y. Chan, S. Subramanian, regulate inflammation in macrophages and T cells. Nat. Rev. Immunol. 10: 365– X. H. Tian, Y. S. Yim, A. Pertsemlidis, H. R. Garner, Jr., L. Morel, and 376. E. K. Wakeland. 2004. Association of extensive polymorphisms in the SLAM/ 41. Heard, D. J., P. L. Norby, J. Holloway, and H. Vissing. 2000. Human ERR- CD2 gene cluster with murine lupus. Immunity 21: 769–780. gamma, a third member of the estrogen receptor-related receptor (ERR) sub-

16. Keszei, M., C. Detre, S. T. Rietdijk, P. Munõz, X. Romero, S. B. Berger, family of orphan nuclear receptors: tissue-specific isoforms are expressed during http://www.jimmunol.org/ S. Calpe, G. Liao, W. Castro, A. Julien, et al. 2011. A novel isoform of the Ly108 development and in the adult. Mol. Endocrinol. 14: 382–392. gene ameliorates murine lupus. J. Exp. Med. 208: 811–822. 42. Eichner, L. J., and V. Gigue`re. 2011. Estrogen related receptors (ERRs): a new 17. Brown, D. R., S. Calpe, M. Keszei, N. Wang, S. McArdel, C. Terhorst, and dawn in transcriptional control of mitochondrial gene networks. Mitochondrion A. H. Sharpe. 2011. Cutting edge: an NK cell-independent role for Slamf4 in 11: 544–552. controlling humoral autoimmunity. J. Immunol. 187: 21–25. 43. Gigue`re, V. 2008. Transcriptional control of energy homeostasis by the estrogen- 18. Koh, A. E., S. W. Njoroge, M. Feliu, A. Cook, M. K. Selig, Y. E. Latchman, related receptors. Endocr. Rev. 29: 677–696. A. H. Sharpe, R. B. Colvin, and E. Paul. 2011. The SLAM family member CD48 44. Takayanagi, S., T. Tokunaga, X. Liu, H. Okada, A. Matsushima, and (Slamf2) protects lupus-prone mice from autoimmune nephritis. J. Autoimmun. Y. Shimohigashi. 2006. Endocrine disruptor bisphenol A strongly binds to hu- 37: 48–57. man estrogen-related receptor gamma (ERRgamma) with high constitutive ac- 19. Cuda, C. M., S. Li, S. Liang, Y. Yin, H. H. Potula, Z. Xu, M. Sengupta, Y. Chen, tivity. Toxicol. Lett. 167: 95–105. E. Butfiloski, H. Baker, et al. 2012. Pre-B cell leukemia homeobox 1 is asso- 45. Sawai, C., K. Anderson, and D. Walser-Kuntz. 2003. Effect of bisphenol A on

ciated with lupus susceptibility in mice and humans. J. Immunol. 188: 604–614. murine immune function: modulation of interferon-gamma, IgG2a, and disease by guest on September 25, 2021 20. Alaynick, W. A. 2008. Nuclear receptors, mitochondria and lipid metabolism. symptoms in NZB X NZW F1 mice. Environ. Health Perspect. 111: 1883–1887. Mitochondrion 8: 329–337. 46. Michalek, R. D., and J. C. Rathmell. 2010. The metabolic life and times of a T- 21. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, cell. Immunol. Rev. 236: 190–202. and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation 47. Vander Heiden, M. G., L. C. Cantley, and C. B. Thompson. 2009. Understanding of pathogenic effector TH17 and regulatory T cells. Nature 441: 235–238. the Warburg effect: the metabolic requirements of cell proliferation. Science 324: 22. Shi, L. Z., R. Wang, G. Huang, P. Vogel, G. Neale, D. R. Green, and H. Chi. 2011. 1029–1033. HIF1alpha-dependent glycolytic pathway orchestrates a metabolic checkpoint for 48. Eichner, L. J., M. C. Perry, C. R. Dufour, N. Bertos, M. Park, J. St-Pierre, and the differentiation of TH17 and Treg cells. J. Exp. Med. 208: 1367–1376. V. Gigue`re. 2010. miR-378(p) mediates metabolic shift in breast cancer cells via 23. McClymont, S. A., A. L. Putnam, M. R. Lee, J. H. Esensten, W. Liu, the PGC-1b/ERRg transcriptional pathway. Cell Metab. 12: 352–361. M. A. Hulme, U. Hoffmu¨ller, U. Baron, S. Olek, J. A. Bluestone, and 49. Jacobs, S. R., C. E. Herman, N. J. Maciver, J. A. Wofford, H. L. Wieman, T. M. Brusko. 2011. Plasticity of human regulatory T cells in healthy subjects J. J. Hammen, and J. C. Rathmell. 2008. Glucose uptake is limiting in T cell and patients with type 1 diabetes. J. Immunol. 186: 3918–3926. activation and requires CD28-mediated Akt-dependent and independent path- 24. Dozmorov, I., and I. Lefkovits. 2009. Internal standard-based analysis of ways. J. Immunol. 180: 4476–4486. microarray data. Part 1: analysis of differential gene expressions. Nucleic Acids 50. Wang, R., C.-P. Dillon, L.-Z. Shi, S. Milasta, R. Carter, D. Finkelstein, L.- Res. 37: 6323–6339. L. McCormick, P. Fitzgerald, H. Chi, J. Munger, and D.-R. Green. 2011. The 25. Dozmorov, I., and M. Centola. 2003. An associative analysis of gene expression transcription factor Myc controls metabolic reprogramming upon T lymphocyte array data. Bioinformatics 19: 204–211. activation. Immunity 35: 871–882. 26. Xu, Z., A. Vallurupalli, C. Fuhrman, D. Ostrov, and L. Morel. 2011. An NZB- 51. Hu, W.-H., O. N. Hausmann, M.-S. Yan, W. M. Walters, P. K. Wong, and derived locus suppresses chronic graft versus host disease and autoantibody J. R. Bethea. 2002. Identiﬁcation and characterization of a novel Nogo- production through non-lymphoid bone-marrow derived cells. J. Immunol. 186: interacting mitochondrial protein (NIMP). J. Neurochem. 81: 36–45. 4130–4139. 52. Giorgio, V., M. E. Soriano, E. Basso, E. Bisetto, G. Lippe, M. A. Forte, and 27. Stockinger, B., M. Veldhoen, and B. Martin. 2007. Th17 T cells: linking innate P. Bernardi. 2010. Cyclophilin D in mitochondrial pathophysiology. Biochim. and adaptive immunity. Semin. Immunol. 19: 353–361. Biophys. Acta 1797: 1113–1118. 28. Dang, E.-V., J. Barbi, H. Y. Yang, D. Jinasena, H. Yu, Y. Zheng, Z. Bordman, 53. Deng, W.-J., S. Nie, J. Dai, J.-R. Wu, and R. Zeng. 2010. Proteome, phospho- J. Fu, Y. Kim, H. R. Yen, et al. 2011. Control of T(H)17/T(reg) balance by proteome, and hydroxyproteome of liver mitochondria in diabetic rats at early hypoxia-inducible factor 1. Cell 146: 772–784. pathogenic stages. Mol. Cell. Proteomics 9: 100–116. 29. Morris, S. C., R. L. Cheek, P. L. Cohen, and R. A. Eisenberg. 1990. Autoanti- 54. Michalek, R. D., V. A. Gerriets, A. G. Nichols, M. Inoue, D. Kazmin, bodies in chronic graft versus host result from cognate T-B interactions. J. Exp. C. Y. Chang, M. A. Dwyer, E. R. Nelson, K. N. Pollizzi, O. Ilkayeva, et al. 2011. Med. 171: 503–517. Estrogen-related receptor-a is a metabolic regulator of effector T-cell activation 30. Giles, B. M., S. N. Tchepeleva, J. J. Kachinski, K. Ruff, B. P. Croker, L. Morel, and differentiation. Proc. Natl. Acad. Sci. USA 108: 18348–18353. and S. A. Boackle. 2007. Augmentation of NZB autoimmune phenotypes by the 55. Crispı´n, J. C., V. C. Kyttaris, C. Terhorst, and G. C. Tsokos. 2010. T cells as Sle1c murine lupus susceptibility interval. J. Immunol. 178: 4667–4675. therapeutic targets in SLE. Nat Rev Rheumatol 6: 317–325. 31. Alaynick, W. A., J. M. Way, S. A. Wilson, W. G. Benson, L. Pei, M. Downes, 56. Perl, A., P. Gergely, Jr., and K. Banki. 2004. Mitochondrial dysfunction in T cells R. Yu, J. W. Jonker, J. A. Holt, D. K. Rajpal, et al. 2010. ERRgamma regulates of patients with systemic lupus erythematosus. Int. Rev. Immunol. 23: 293–313.

Supplemental Figure 1. A, Comparison of B6 and Sle1c subcongenic REC5 spleen weights and CD4+ + + T cell activation, as determined by percentage of Tem and CD69 CD4 T cells, as a function of age. B, FACS analysis of B6.Thy1a and B6.Sle1c2 (Thy1b) mixed BM chimeras of CD4+ gated splenocytes. C, GFP+ percentages from B6.FoxP3-eGFP and B6.Sle1c2.FoxP3-eGFP were measured by flow cytometry + - both ex vivo and after in vitro induction of FACS sorted CD4 FoxP3 T cells under TH0 (anti-CD3 and - + CD28 only), and Treg (with TGF and with or without atRA) polarizing conditions. D, GFP percentages of CD4+ T cells from B6.FoxP3-eGFP and B6.Sle1c2.FoxP3-eGFP was measured over the lifetime. E, EAE clinical scores did not significantly differ between B6 and B6.Sle1c2 (n=6). Student’s t-test: * P 0.05, ** P 0.01, *** P 0.001.

Supplemental Figure 2. Heat map (A) and pathway analysis (B) of genes related to Ifng expression. C, Heat Map of genes involved in TH17 and Treg homeostasis. In B, green and red symbols show genes significantly over-expressed in B6 and B6.Sle1c2 CD4+ T cells, respectively. White symbols show genes that represent functional intermediates in the pathways. Deduced common pathways are shown in blue boxes. In A and C, each column represents an individual mouse, and the red and green designations indicate genes with increased or decreased expression, respectively.

Supplemental Figure 3. A, Esrrg message expression in various B6 tissues, normalized to Gapgh and relative to CD4+ T cell expression. B, Esrrg expression in various B6.Sle1c2 tissues, normalized to Gapgh and relative to the B6 expression in the same tissue. C, Expression of ERR target genes in CD4+ T cells, normalized to Gapdh and relative to the B6 expression of that same gene. In B and C, statistical levels correspond to comparisons with B6 values * P 0.05, ** P 0.01, *** P 0.001.

Supplementary Table 1. ERR Target Genes Gene ID Gene Name Forward primer Reverse primer Reference As3mt arsenic (+3 oxidation state) methyltransferase CCAGGGCCGTTCTGAGTT TGTCCTTTAGCCACCCTCTTG (1) Cd59a CD59a antigen CTCATCTTACTCCTGCTGCTTCT CCAACACCTTTGATACACTTGC (1) Crtam cytotoxic and regulatory T cell molecule CATCATCGTTCAGCTCTTCATC TGGGCACTCTTCTTTGTTTTG (1) Esrra estrogen related receptor, alpha CTGAAAGCTCTGGCCCTTG CTGTCTGGCGGAGGAGTG (2) Fabp4 fatty acid binding protein 4, adipocyte GAAATCACCGCAGACGACA TTCATAACACATTCCACCACCA (3) Mycbp c-myc binding protein GCTGGACACGCTGACGAA TCTGGGTTTTCCGGGGTAG (1) Ndufs1 NADH dehydrogenase (ubiquinone) Fe-S protein 1 TGACCCACTCGTTCCACCT CGGCTCCTCTACTGCCTGA (1) Ppargc1a peroxisome proliferative activated receptor, gamma, coactivator 1 alpha TACGCAGGTCGAACGAAAC GTGGAAGCAGGGTCAAAATC (4) Ppif peptidylprolyl isomerase F (cyclophilin F) CGTGGTGCTGGAGTTAAAGG CTGTGCCATTGTGGTTGGT (1) Rara retinoic acid receptor, alpha TCCCCAAGATGCTGATGAA CCCGACTGTCCGCTTAGA (1) Rtn4ip1 reticulon 4 interacting protein 1 AGAACTGGTGGATGCAGGAA GGGAGAATGTGTGGTGAAGG (1) Steap3 STEAP family member 3 CCCGTCCATTGCTAATTCC GTCCAGCCGTAGGTGAGTGT (1)

References

1. Dufour, C. R., B. J. Wilson, J. M. Huss, D. P. Kelly, W. A. Alaynick, M. Downes, R. M. Evans, M. Blanchette, and V. Giguere. 2007. Genome-wide orchestration of cardiac functions by the orphan nuclear receptors ERRalpha and gamma. Cell Metab 5: 345-356.

2. Liu, D., Z. Zhang, and C. T. Teng. 2005. Estrogen-related receptor-+¦ and peroxisome proliferator-activated receptor-+¦ coactivator-1+¦ regulate estrogen-related receptor-+¦ gene expression via a conserved multi-hormone response element. Journal of Molecular Endocrinology 34: 473-487.

3. Alaynick, W. A., R. P. Kondo, W. Xie, W. He, C. R. Dufour, M. Downes, J. W. Jonker, W. Giles, R. K. Naviaux, V. Giguere, and R. M. Evans. 2007. ERRgamma directs and maintains the transition to oxidative metabolism in the postnatal heart. Cell Metab 6: 13-24.

4. Cheung, C. P., S. Yu, K. B. Wong, L. W. Chan, F. M. M. Lai, X. Wang, M. Suetsugi, S. Chen, and F. L. Chan. 2005. Expression and functional study of estrogen receptor-related receptors in human prostatic cells and tissues. J. Clin. Endocrinol. Metabol. 90: 1830-1844.