Phylogenetic Relationships of Orb-Weaving Spiders from Species to Superfamily

Phylogenetic Relationships of Orb-weaving Spiders from Species to Superfamily

by Robert James Kallal

B.A. in Political Science, May 2009, Frostburg State University M.S. in Biology, May 2011, Towson University

A Dissertation submitted to

The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

August 31, 2017

Dissertation directed by

Gustavo Hormiga Ruth Weintraub Professor of Biology

The Columbian College of Arts and Sciences of The George Washington University certifies that Robert James Kallal has passed the Final Examination for the degree of

Doctor of Philosophy as of June 5, 2017. This is the final and approved form of the dissertation.

Phylogenetic Relationships of Orb-weaving Spiders from Species to Superfamily

Robert James Kallal

Dissertation Research Committee:

Gustavo Hormiga, Ruth Weintraub Professor of Biology, Dissertation Director

Guillermo Ortí, Louis Weintraub Professor of Biology, Committee Member

Robert Alexander Pyron, Robert F. Griggs Assistant Professor of Biology, Committee Member

iii

Disclaimer

New taxon names and nomenclatural changes referred to this dissertation are disclaimed and unavailable for nomenclatural purposes (ICZN Art. 8.3).

Acknowledgments

The author wishes to acknowledge the Department of Biological Sciences, and

specifically the Weintraub and Harlan families, for their support throughout the

completion of this dissertation via fellowships and teaching assistantships.

Additional support was provided by the United States National Science Foundation

grants DEB 1144492, 114417, 1457300, and 1457539 to Gustavo Hormiga and

Gonzalo Giribet (Harvard University).

I would like to thank Gustavo Hormiga for all he has done for me, including

guidance, spider expertise, field excursions, conference travel, and pop culture

recommendations. One of the only things that did not improve in my time in his lab

was my Spanish. I must also acknowledge the other members of the lab, both long

term and short, over the course my time here: Jesus Ballesteros, Thiago da Silva

Moreira, Ligia Benavides, Siddharth Kulkarni, Daniela Andriamalala, Jimmy Cabra,

and Lidianne Salvatierra. I am especially indebted to Chuy after our southeastern

USA collecting excursion in 2014 and his guidance in the computational aspects of

my dissertation.

I would also like to acknowledge my dissertation committee, including

Guillermo Ortí, Alex Pyron, Diana Lipscomb, and Hannah Wood, whose comments,

critiques, and suggestions undoubtedly improved this work. Also at GWU, I would like to

acknowledge Adam Wong and the high performance cluster Colonial One resource,

without which much of this work would still be processing.

Gonzalo Giribet and his lab warrant special acknowledgment. The resources of

Gonzalo and Harvard University made the transcriptome chapter possible. I am indebted

v to him and the expertise of his lab, namely Rosa Fernández, Caitlin Baker, Julia

Cosgrove, and Vanessa Knutson, for their assistance, patience, and expertise. I would also like to thank Charles Griswold and Lauren Esposito for hosting me at the California

Academy of Sciences.

The field trip to New Zealand and Australia in early 2016 was the experience of a life time, including Gustavo Hormiga, Gonzalo Giribet, Rosa Fernández, Fernando

Álvarez-Padilla, Caitlin Baker, and Miquel Arnedo, as well as Cor Vink, Robert Raven,

Barbara Baehr, and Michael Rix. As Gustavo is fond of saying, good on you, mates!

Additionally, we acknowledge the following individuals for their contributions from collecting in Taiwan: Prof. Man-Miao Yang (NCHU Insect Collection, Department of

Entomology, National Chung Hsing University, Taichung) and her students and staff (Yi-

Shuo Liang, Bao-Cheng Lai, Yi-Chuan Li, Chang-Ti Tang, Wesley M. Hunting, Fu-Shen

Huang), Dimitar Dimitrov, Charles Griswold, Facundo Labarque, and Daniele Polotow.

I would like to acknowledge the following people and institutions for loans for this work: Gonzalo Giribet and Laura Leibensperger (Museum of Comparative Zoology,

USA),Charles Griswold, Lauren Esposito, Anthea Carmichael, and Darrel Ubick

(California Academy of Sciences, USA), Matjaž Kuntner (Slovenian Academy of Arts and Sciences, Slovenia), Robert Raven and Owen Seeman (Queensland Museum,

Australia), Mark Harvey and Julianne Waldock (Western Australia Museum, Australia),

Graham Milledge (Australian Museum, Australia), Jon Coddington, Hannah Wood, and

Dana de Roche (National Museum of Natural History, USA), Catherine Byrne (Tasmania

Museum and Art Gallery, Australia), Peter Lilywhite (Museum Victoria, Australia),

Volker Framenau (Phoenix Environmental Sciences), and Jeremy Miller (Naturalis,

Biodiversity Center, Netherlands). I would also like to acknowledge the following individuals for graciously allowing me to reproduce their photographs: Robert Whyte,

Laurence Sanders, and Iain Macaulay.

I also would like to acknowledge the following individuals for their support, friendship, comments, and more throughout the last five years: Andrew Moore, Lily C.

Hughes, Dominic and Ethel White, Andrew and Jacqueline Thompson, Catriona Hendry,

Belen Chavez, Sandra Lara, João Tonini and Larissa Rozindo, Josef Stiegler, Dimitar

Dimitrov, Sarah Crews, Dahiana Arcila, Hartmut Doebel, Tara Scully, Rob Donaldson,

John LaPolla, Lauren Spearman, and Martin, Jessie, and John Wiener Stolark.

Last but not least I must thank my family (Robin and Donald Micheletti; Mark,

Mandy, and Jennifer Kallal), and in particular my wife, Laura Kallal, who all now know more about spiders than they ever wanted or thought possible.

vii

Abstract of Dissertation

Phylogenetic Relationships of Orb-weaving Spiders from Species to Superfamily

Spiders are a speciose group of arachnids that are a dominant predator of

terrestrial arthropods. Among these, perhaps the most iconic are the orb-weavers, which

spin webs from silk produced in abdominal glands. Despite steps forward in spider

phylogenetics, there are still many undescribed species and a number of difficult

problems in understanding their phylogeny that must be remedied before one can

understand evolution of morphology and behavior that define these fascinating creatures.

In this work, I focus on two families of orb-weavers: Tetragnathidae and Araneidae. First,

I discuss the tetragnathid subfamily Metainae, which has not been previously revised, has

low support in previous works, and questionable inclusion of certain genera. My target

gene analyses on an increased taxon sampling of metaines found good support for the

subfamily for the first time, and suggest inclusion of a new genus, Zhinu, from Taiwan.

After synonymy of Prolochus and Menosira, I determined there are four genera in

Metainae: Zhinu, Meta, Metellina, and Dolichognatha. I also describe a new species of

Orsinome with exaggerated genitalic morphology. Second, I revise the Australasian leaf-

curling araneid genera Phonognatha and Deliochus using molecular and morphological

characters. I place these genera in the wider context of Araneidae, which lacks a family-

level treatment. Based on resulting phylogenies, I found evidence for a third genus,

Artifex, and monophyly of Araneidae following recent taxonomy changes. Furthermore,

this phylogeny allowed me to explore two comparative questions relating to these genera:

evolution of leaf retreats in orb-webs and biogeography. I found evolution and

subsequent loss of an integrated leaf retreat in these genera, and colonization of New

viii

Caledonia consistent with geology of the island. Finally, I used next next-generation transcriptome-based techniques to explore the phylogeny of Araneidae, which has been limited by the resolution power of current markers and morphology. Using a diverse sampling of 19 araneids, I examined the effects of orthology assessment methods and gene occupancy/missing data on the resulting topologies. The results showed broad congruence across most analytical treatments regardless of orthology method, occupancy, or tree inference method, with more genes (and more missing data) to be the best predictor of high node supports. I also found little overlap between transcripts used by orthology programs, suggesting good signal in the data.

Table of Contents

Acknowledgments ...... v

Abstract of Dissertation ...... vi ii

List of Figures ...... xi

List of Tables ...... xiv

Chapter 1: Introduction ...... 1

Chapter 2: An expanded molecular phylogeny of metaine spiders (Araneae, Tetragnathidae) with description of new taxa from Taiwan and the Philippines ...... 6

Chapter 3: Systematics and phylogeny of the Australasian orb-weaver genera Phonognatha Simon 1894, Deliochus Simon 1894, and Artifex new genus (Araneae, Araneidae), with comments on biogeography and retreat evolution ...... 49

Chapter 4: Phylogenetic relationships within the orb-weaving spider family Araneidae, and the effects of orthology assessment and gene occupancy on phylogenomic analyses ...... 221

Bibliography or References ...... 246

Appendices ...... 264

List of Figures

1. Tetragnathid phylogeny based on maximum likelihood…………………………..……19

2. Tetragnathid phylogeny based on Bayesian inference………………………………….20

3. Illustrations of metaine pedipalps……...…………………………….…………………22

4. Zhinu manmiaoyangi male……...…………………………….….….…………………33

5. Zhinu manmiaoyangi female…...…………………………….….….……………….....34

6. Zhinu manmiaoyangi web architecture……………………….….….…………………36

7. Distributions of Z. manmiaoyangi and Orsinome megaloverpa.…….….….…… ..….36

8. Orsinome megaloverpa female……...……..………………..……….………………....39

9. Orsinome megaloverpa male…...…...……..………………..………...... ……………..41

10. Orsinome megaloverpa male..…...…...……..……………..……….……………… ...42

11. Australasian Zygiellinae………………………………..………………………..……52

12. Web morphology of Phonognatha and Deliochus……..………………………..……56

13. Leaf retreats and their architects………………………..………………………..……57

14. Color change in P. graeffei……………………………..………………………..……60

15. Parsimony results……………………………………..………………………….……78

16. Model-based results…………………………………..………………………….……79

17. Rate-calibrated Bayesian results……………………..………………………….…….80

18. Biogeography results………………………………..…………………………...……82

19. Web reconstruction.…………………………………..………………………….……83

20. Schematic illustrations of zygielline palps..…………..………………………….……86

21. P. graeffei SEM……………………………………..………………………….……101

22. P. graeffei female..…………………………………..………………………….……102

23. P. graeffei male.……………………………………..………………………….……103

24. P. graeffei distribution..……………………………..………………………….……105

25. P. melania SEM……………………………………..………………………….……129

26. P.melania female...... ………………………………..………………………….……132

27. P. melania male....…………………………………..………………………….……133

28. P.melania distribution...……………………………..………………………….……136

29. P. neocaledonica SEM.……………………………..………………………….……145

30. P. neocaledonica female…...………………………..………………………….……146

31. P. neocaledonica male…..…………………………..………………………….……148

32. P.neocaledonica distribution………………………..………………………….……150

33. P. tanyodon SEM..…....……………………………..………………………….……152

34. P. tanyodon female..….……………………………..………………………….……153

35. P. tanyodon male..…………………………………..………………………….……155

36. P. tanyodon distribution..…..………………………..………………………….……157

37. D. zelivira SEM……....……………………………..………………………….……163

38. D. zelivira female.…….……………………………..………………………….……165

39. D. zelivira male.……………………………………..………………………….……167

40. D. zelivira distribution……..………………………..………………………….……168

41. D. humilis SEM……....……………………………..………………………….……173

42. D. humilis female..…………………………………..………………………….……174

43. D. humilis male.……………………………………..………………………….……176

44. D. humilis distribution……..………………………..………………………….……177

45. D. idoneus SEM……....……………………………..………………………….……184

xii

46. D. idoneus female.…………………………………..………………………….……186

47. D. idoneus male……………………………………..………………………….……187

48. D. idoneus distribution……..………………………..………………………….……189

49. A. melanopyga SEM.....……………………………..………………………….……199

50. A. melanopyga female..……………………………..………………………….……201

51. A. melanoyga male...………………………………..………………………….……203

52. Artifex distribution.…..………… …………………..………………………….……204

53. A. joannae SEM...…………… ……………………..………………………….……210

54. A. joannae female.…………………………………..………………………….……212

55. Zygiella x-notata SEM..……………………………..………………………….……214

56. Hypotheses of araneid relationships.………………..………………………….……225

57. Sampled araneid diversity……… …………………..………………………….……231

58. Highest supported topologies………………………..………………………….……236

59. Distribution of incongruences...……………………..………………………….……238

60. Transcript overlap….....……………………………..………………………….……243

xiii

List of Tables

1. Tetragnathid taxon sampling and accession numbers…………………………………..13

2. Tetragnathid partition schemes ……………………………………………………..…18

3. Araneid taxon sampling and accession numbers……………………………………….65

4. Primers used in araneid PCR...…………………..……………………………………..71

5. Araneid partition schemes...…………………..… ……………………………………..77

6. Unambiguous synapomorphies for relevant araneid clades...…………………………..81

7. Biogeography model-testing results...…………………………………………………..83

8. Newly sequences transcriptomes for this study..…………………………………..….232

9. Matrices analyzed in transcriptome study……………………………………………..235

xiv

Chapter 1: Introduction

There are over 46,000 described species of spiders (Arthropoda, Arachnida,

Araneae), making second only to mites in the class Arachnida (World Spider Catalog

2017). They can be found on all continents except Antarctica and are a dominant predator

of terrestrial invertebrates, including other spiders. Among the most iconic spiders are the

orb-weavers, which create intricate webs made of silk produced from specialized glands

in their abdomens. The architecture of these webs varies enormously, ranging from a

classic orb to a tangled cobweb to sheets and more. The web is a key adaptation in spider

evolution that allows them to sense their environment as well as augment their ability to

intercept, trap, and store prey.

One of the most diverse orb-weaving spider families is Araneidae, which includes more than 3,000 species. They vary hugely in size and appearance, with individuals in this family ranging from a few millimeters to 4 centimeters in body length. Some are drab mimics of twigs (e.g. Poltys, Dolophones) or bird dung (e.g. Celaenia, Cyrtarachne), or

are adorned with shining black spikes (e.g. Gasteracantha), or have elongate abdomens

(e.g. Arachnura, Ariamnes). Their webs range from river-spanning orbs several meters in

diameter (e.g., Caerostris) to reduced single lines tossed at moths attracted by exuded

chemical signals (e.g., Mastophora). Others protect themselves by integrating detritus

into their web (e.g. Cyclosa), or curling a leaf in their web or nearby in which to retreat

(e.g. Phonognatha, Acusilas). This stands in comparison to another orb-weaver family,

Tetragnathidae. There are approximately 1,000 described tetragnathids and a conserved

web architecture – typically an inclined to horizontal orb with an open hub. However,

Tetragnathidae is well known for their elongate chelicerae and exaggerated teeth in the

males of several lineages, which are so adapted for mating purposes that they are

precluded from feeding themselves as adults.

Much of our knowledge of araneid and tetragnathid diversity over the last quarter

millennium is thanks to the morphological examination of these species, principally the

genitalia. Rigorous examination and comparison of the male pedipalp – a modified limb

functioning as intromittent organ – has been invaluable in organizing spider diversity.

Web architecture, female genitalia, and spinneret morphology have also proven to be

good sources of characters. As more and more spiders are collected, and their described

diversity grows, wide ranging expertise is more difficult to attain and homologizing

disparate characters more challenging. When molecular markers began to be used toward

the end of the 20th century (Gillespie et al. 1994; Hausdorf 1999) and later combined with morphology (e.g. Álvarez-Padilla et al. 2009; Arnedo et al. 2001; Arnedo et al. 2009,

Dimitrov and Hormiga 2011, Wheeler et al. 2016, among others), areas of incongruence

in the spider tree of life between analyses were highlighted.

Spider systematists have been somewhat slow in moving into the molecular era of

phylogenetics. Six molecular markers – the so-called ‘usual suspects’ – are the core of spider phylogenetics, with a handful of less common ones used in particular cases (e.g. intraspecific relationships). This has been the state of the art for spider phylogenetics over the last decade or so, culminating with the expansive works of Dimitrov et al. (2016) and

Wheeler et al. (2016). However, even when paired with morphological and behavioral data, these markers seem insufficient to address deeper, conflicted relationships within the spider tree of life. Spider phylogeny has been further exacerbated by the limited fossil record of orb-weavers that can be attributed to family-level lineages older than recent

amber preservations (Dunlop et al. 2017); that is, reliable node-calibration is not possible.

However, since 2014, the use of transcriptomes promises that the orders of magnitude

more markers may be an effective method to explore the weakly supported relationships

in spider evolution (Fernández et al. 2014; Bond et al. 2014; Garrison et al. 2016;

Fernandez et al. in prep).

Araneidae is one such family that has been upturned with the advent of molecular

and total evidence analyses. Herbert W. Levi (1951-2013) has been most instrumental in

describing araneids over the past 60 years, but refrained from placing those taxa in an

explicitly phylogenetic context; numerous other workers in the field have also prolifically

described araneids from around the world. It was not until Scharff and Coddington (1997)

produced a cladistic analysis of Araneidae that a family-wide cladistic framework was put forth. Their morphology and behavior based analysis and those of subsequent molecular analyses (Kuntner et al. 2008, Álvarez-Padilla et al. 2009) bore several stark differences, even within the ‘core’ clades postulated by Levi and others. Two of those incongruences are relevant to this dissertation have to do with the subfamily araneid

Zygiellinae. First, Zygiella, long thought to be a tetragnathid, was supported to be within

Araneidae by both Scharff and Coddington (1997) and subsequent analyses; second,

Nephila (and by extension, at that time, Phonognatha) was placed outside Araneidae by

Scharff and Coddington (1997) but within the family by Kuntner et al. (2008) and

Álvarez-Padilla et al. (2009).

Results mounted supporting Phonognatha and its close relatives, including

Zygiella, as early diverging araneids by molecular and total evidence analyses (Kuntner et al. 2008; Álvarez-Padilla et al. 2009). Their relationship with Nephila remained

contentious, as that genus, and the family containing it, has moved about in the orb-

weaver tree in the last decade. Phonognatha in particular has both somatic and genitalic

morphology suggesting it is closely related to Nephila or tetragnathids. Its most

identifiable trait is a conspicuous leaf curl that it places at the hub of its incomplete orb-

web, which it uses as a retreat. Later analysis placing zygiellines sister to all other

araneids has made this clade a topic of interest for various studies including mating

behavior and web architecture (Krajl-Fišer et al. 2013; Gregorič et al. 2015; Dimitrov et al. 2016). As an early diverging clade, Zygiellinae is of phylogenetic importance as it helps define what at araneid is (though it seems to be a family defined by process of elimination) and the age of Araneidae. Its relative ease of collection and identification also make it a candidate for comparative studies, such as examination of its biogeography or characteristic leaf retreat.

Tetragnathidae, which has both fewer species and more intense, family-wide scrutiny, has well-supported subfamilies with less understanding of how those subfamilies are related to each other (Álvarez-Padilla et al. 2009; Dimitrov et al. 2011).

Two among these of special interest are Metainae and Leucauginae. Metainae is

described with three genera – Meta, Metellina, and Dolichognatha – but none of the

constituent genera have ever been revised, and much of the sampling is biased toward the

Nearctic and Palearctic fauna. For this reason, collections in Asia, Africa, Australia, and

New Zealand, to name a few, frequently have specimens of uncertain affinity within

these groups due to the lack of an overarching revision. Furthermore, the genus Meta is

especially rife with similar-looking spiders that do not seem to have close relationships

when scrutinized. Leucauginae is a much larger subfamily, dominated by the eponymous

genus Leucauge. As Metainae, there are many lineages remaining to be described and understood outside of North America and Europe. The diversity of Leucauge makes it an

intimidating prospect for revision despite recent inroads (Ballesteros and Hormiga, in

prep).

The aims of this thesis are as follows. First, I seek to revise the Australasian

spider genera Phonognatha, Deliochus, and the new genus Artifex. This will include

descriptions and redescriptions of the relevant species including images, maps, and

identification keys. Additionally, I explore the biogeography of these genera and

evolution of leaf retreats in Araneidae. Second, I examine Araneidae phylogeny using

transcriptomic methods. Backbone relationships are weakly supported or conflicting

using target loci and morphological approaches, and I will use various orthology

assessments, gene occupancy thresholds, and tree inference methods to attempt to explain

recalcitrant nodes and compare to the results in the previous chapter. This will be the

first attempt to use transcriptomes to examine phylogenetic relationships in detail in a

spider family. Third, I address the phylogeny of Tetragnathidae with emphasis on

Metainae and will describe two new members of the family from Southeast Asia,

including a new genus, and place them in a phylogenetic context. This chapter will also

address taxonomic issues in the subfamily Metainae, which requires much in the way of

taxonomic clarity, and comments on a new leucaugine in the genus Orsinome.

Chapter 2: An expanded molecular phylogeny of metaine spiders (Araneae, Tetragnathidae) with description of new taxa from Taiwan and the Philippines

Abstract

Despite numerous phylogenetic analyses of the orb-weaving spider family

Tetragnathidae, a number of relationships from the subfamily to species level are still questionable. One such standing question regards the validity and composition of the tetragnathid subfamily Metainae, which historically has mixed support and limited taxon sampling. Sequences for six genetic markers – 12S, 16S, 18S, 28S, cytochrome c oxidase

I, and histone 3, were analyzed for 78 taxa, including 10 which were completely new or with increased markers. Analyzed in both maximum likelihood and Bayesian frameworks, we find good support for Metainae including three previously described genera – Meta, Metellina, and Dolichognatha – in addition to one described herein, Zhinu

Kallal & Hormiga, nov. gen., from Taiwan. Also within Metainae, we synonymize

Metellina with Menosira and reaffirm the synonymy of Dolichognatha with Prolochus.

We also describe a new species of leucaugine tetragnathid from the Philippines,

Orsinome megaloverpa, nov. sp.

Introduction

Members of the orb-weaving spider family Tetragnathidae can be superficially recognized by the robust and/or elongate chelicerae found in some males and diagonal to horizontal orb-webs, but neither of these traits is found in all species in the family. In some cases it is difficult to identify tetragnathid females even to family level in absence of conspecific adult males, as evidenced by recent results on Guizygiella (Gregorič et al.

2015). Tetragnathid males have relatively simpler pedipalps in comparison to most

araneids (e.g., they lack a median apophysis) and often have fewer aciniform spigots on

the posterior median spinneret in the silk-spinning apparatus.

In the last two decades, the phylogeny of tetragnathid spiders has been examined and reexamined with increasing taxon sampling and more sophisticated methods

(Hormiga et al. 1995; Álvarez-Padilla et al. 2009; Álvarez-Padilla and Hormiga 2011,

Dimitrov and Hormiga 2011, Ballesteros and Hormiga, in prep.). Despite these works, the scope of tetragnathid diversity – 987 species in 48 genera – continues to make it a difficult problem which is only getting larger (World Spider Catalog 2017). For example, thirteen new species were described in 2016 alone (Simó et al. 2016; Cabra-García and

Brescovit 2016).

In the first cladistic analysis of Tetragnathidae, Levi (1980) recovered a highly polyphyletic topology, with araneids nested within Tetragnathidae. Levi (1980, 1986) discusses tetragnathids as three major clades – Tetragnathinae, ‘Metinae,’ and

Nephilinae; Leucauge and Azilia are unplaced at the subfamily level. Coddington (1990) also discussed tetragnathids in terms of these three lineages, with a resulting cladogram with Nephilinae sister to Tetragnathinae + ‘Metinae,’ which are in turn sister to symphytognathoids (i.e., Symphytognathidae, Anapidae, Mysmendiae, and

Theridiosomatidae). Despite the presence of the nephilines as the sister lineage to

Tetragnathidae, which Coddington (1990) composed based on Meta, Leucauge,

Tetragnatha, and Glenogantha, the family is monophyletic. Hormiga et al. (1995) found a similar topology, introducing morphological coding for the tetragnathids Dolichognatha and Chrysometa, and Tanikawa (2001) subsequently reported a monophyletic

Tetragnathidae expanded to include a number of additional terminals including

representatives of Okileucauge, Tylorida, Mesida, Metabus, and Metleucauge. At this

point, the inclusion of Nephila and close relatives in Tetragnathidae became contentious;

morphological and behavior data supported Nephilinae as sister to other tetragnathids,

and molecular sequence data supported nephilines as more closely related to araneids;

this led to the erection of Nephilidae, and Tetragnathidae including four major

subfamilies: Tetragnathinae, Metainae, Leucauginae, and Nanometinae (Álvarez-Padilla

2007; Álvarez-Padilla et al. 2009; Dimitrov and Hormiga 2009; Dimitrov and Hormiga

2011; Dimitrov et al. 2012; Ballesteros and Hormiga in prep.).

The subfamily including Meta L. Koch, 1836, has been referenced for decades

(e.g., Levi, 1980; Coddington, 1990; Hormiga et al. 1995), but its composition has varied

greatly. Levi (1980) argued that the subfamily ‘Metinae’ may also include Zygiella F.O.

Pickard-Cambridge, 1902. Coddington (1990) discussed the ‘metine-tetragnathine’ subfamily group, which was composed of Meta, Metellina, Chrysometa, Nanometa,

Metleucauge, Azilia, and Dolichognatha based on the metainae embolic apophysis and a sperm duct switchback in the tegulum, but disputed the inclusion of Zygiella. Álvarez-

Padilla et al. (2009) formally circumscribed Metainae (renamed due to a nomenclatural conflict with a family of copepods also named Metinae; see Álvarez-Padilla and Hormiga

2011) as one of the four major subfamilies of tetragnathids. The members of Metainae, as circumscribed by Álvarez-Padilla et al. (2009), include Meta, Metellina, Dolichognatha,

Chrysometa, and Diphya. The monophyly of Metainae is supported by the following morphological synapomorphies (Álvarez-Padilla et al. 2009): sclerotized spermathecae and copulatory ducts, shorter copulatory ducts relative to the spermathecae, wide

separation of spermathecae, cymbial ecto-basal process, and a single embolic apophysis

(the eponymous MEA). As explained by Álvarez-Padilla et al. (2009), the synapomorphies of the clade are homoplastic. However, some of the morphological/behavior analyses and many model-based molecular analyses included therein do not include Chrysometa and Diphya within Metainae, with only Meta,

Metellina, and Dolichognatha consistently emerging in subsequent analyses.

Morphological analyses and parsimony optimization of molecular datasets are seemingly more susceptible to including other taxa in Metainae, suggesting a degree of optimality- dependent results (e.g., Álvarez-Padilla et al. 2009; Dimitrov and Hormiga 2011), though they almost always include those three genera (Smith 2008, Dimitrov et al. 2010). In the molecular analyses of Dimitrov et al. (2011, 2012), for instance, the vast majority of treatments supported Dolichognatha sp. sister to Metellina segmentata (Clerck, 1757) and M. merianae (Scopoli, 1763), which were in turn sister to Meta menardi and M. ovalis. Dimitrov et al. (2016) expanded the taxon sampling to include an unidentified taxon described here. The placement of Chrysometa and Diphya do not find strong support in any established subfamily and their affinity remains conjectural.

As of 2017, none of the three constituent genera of Metainae has been revised.

Perhaps not least of the issues contributing to this status are the cosmopolitan nature of

those genera and the spurious taxa ascribed to the genus Meta in particular. The

phylogeny and taxonomy of Dolichognatha is the most updated. It includes 29 species

from tropical and subtropical regions from all over the world. Phylogenetic analyses

focusing on Dolichognatha include Smith (2008), which focused on Asian and Oceania

species, and Dimitrov et al. (2010), which described taxa from Sri Lanka and the

Comoros. Metellina is the least speciose of the three genera with only seven described taxa from the Holarctic region. By far, Meta is most problematic. This genus includes 34 species from around the world, and prior analyses (e.g., Dimitrov et al. 2016) demonstrate Meta is in need of taxonomic revision. Prolochus was recently elevated from synonymy with Dolichognatha to genus status based on the species P. longiceps

(Barrion-Dupo and Barrion 2014), which is frequently included in analyses as D. longiceps. See the taxonomy section for more on this taxon.

Southeast Asia and Oceania have been major areas of undescribed metaines, and several of the newly described metaines of the last few decades have been collected there (Smith 2008; Dimitrov et al. 2010; Barrion-Dupo and Barrion 2014). Other spider lineages (e.g., Leucauginae) also have much to be described from these regions, with more rigorous phylogenetic and taxonomic work being required to parse the volume of unknown material. Southeast Asia is a biodiversity hotspot; description of the taxa that inhabit this area is key to their conservation given the confluence of habitat loss and endemicity in that region (Myers et al. 2000; Sodhi et al. 2004; Marchese 2015). One such leucaugine lineage is the genus Orsinome. It is described from Asia and Oceania, and has 17 species (World Spider Catalog 2017). It is in need of revision, as the two sequenced taxa (O. sarasini and O. cf. vethi) are well supported in Nanometinae and

Leucauginae, respectively (Álvarez-Padilla et al. 2009, Dimitrov et al. 2016). The latter is taken for the taxonomically consistent placement of Orsinome.

This work expands up on previous analyses of tetragnathids, with a focus on the subfamily Metainae. We expand the tetragnathid taxon sampling of Dimitrov et al.

(2016) with a matrix including 78 taxa, ten of which are either unplaced in phylogenetic

10 analyses or have additional markers added. We seek support for the genera within

Metainae and for Metainae itself. We also describe two new species, one Orsinome

Thorell, 1895, and one member of a new genus, Zhinu. We also discuss the genera

Metellina, Menosira, Dolichognatha, and Prolochus with respect to the monophyly of existing genera and recent taxonomic works.

Methods and Materials

Measurements, Imaging, and Illustrations

Specimens were examined using a Leica MZ16A or a Leica M205 stereomicroscope. Photographs were captured using a Leica DFC 500 and DFC425 camera and the LAS 3.8 imaging suite. Multifocal plane images were then assembled using Helicon Focus 5.1. Illustrations were completed using an Olympus BX51 microscope with camera lucida. Epigyna were transferred to methyl salicylate (Holm,

1979) for examination under the microscope. For scanning electron microscopy (SEM), images were taken using the LEO 1430VP at the Department of Biology of The George

Washington University. To prepare the specimens for SEM, we critical point dried specimens then sputter-coated them in a gold-palladium alloy and mounted as described in Álvarez-Padilla and Hormiga (2008). Male palp sclerite homologies and nomenclature follow Álvarez-Padilla and Hormiga (2011). All measurements are presented in millimeters.

Taxon sampling

The taxon sampling for this study (Table 1) includes 78 terminals, with five newly sequenced taxa: Dolichognatha umbrophila Tanikawa, 1991, Dolichognatha incanescens

(Simon, 1895), Dolichognatha pentagona (Hentz, 1850), Chrysometa poas Levi, 1986,

and Chrysometa zelotypa, Levi, 1986. Additional terminals for Zhinu manmiaoyangi n. sp., Chrysometa alboguttata (O. Pickard-Cambridge, 1889), Prolochus longiceps Thorell,

1895, and Metellina mengei (Blackwall, 1869) are also included. Other samples were culled from GenBank (Arnedo et al. 2004; Agnarsson and Blackledge, 2009; Álvarez-

Padilla et al. 2009; Blackledge et al. 2009; Kuntner et al. 2013; Gregorič et al. 2015;

Jang and Hwang, unpubl. data) for a total of 78 terminals. This taxon sampling is

designed to maximize the diversity of putative metaines in an effort to clarify the

relationships between metaine genera and between Metainae and other subfamilies. Note

the Orsinome described here is present in Dimitrov et al. (2016) as “Tetragnathidae sp.”

and Zhinu manmiaoyangi n. sp. is represented by “Meta sp. 1404.” Metainae sp. 67

represents the taxon described as either ‘Metinae sp.’, ‘Metinae from Australia,’ or

‘Orsinome’ sarasini in various analyses, and is annotated as such to stem taxonomic

confusion until it can be properly treated.

Phylogenetic methods

Two to three legs per specimen were used for DNA extraction using the Qiagen

DNEasy kit. The rest of the spiders are preserved as vouchers and will be deposited at the

Table 1. Taxon sampling and GenBank accession numbers. Taxa and numbers in bold are new for these analyses.

Taxon 12S 16S 18S 28S COI H3 Allende EU003271 EU003368 EU003396 nigrohumeralis EU003370 Allende sp. 889 GU129574 GU129635 GU129649 Antillognatha GU129576 GU129603 GU129631 GU129647 lucida GU129577 Araneus EU003230 FJ525366 EU003242 EU153158 EU003278 EU003312 marmoreus EU003397 Argiope savignyi EU003231 EU003388 EU153159 EU003279 EU003398 Arkys cornutus FJ607448 FJ607482 FJ607521 FJ607556 FJ607595 Azilia EU003232 EU03262 EU003371 EU003399 EU003280 EU003313 guatemalensis EU003372 EU003373 Azilia sp. 834 GU129570 GU129581 GU129606 GU129624 GU129641 Azilia sp. 838 GU129582 GU129607 GU129625 GU129642 Chrysometa *** *** EU003389 EU153160 EU003314 alboguttata EU003400 Chrysometa poas *** *** *** *** *** *** Chrysometa *** *** *** *** *** *** zelotypa Clitaetra KC848906 KC849111 KC848979 KC848987 KC849067 KC849026 episinoides Cyclosa conica EU003233 EU003254 EU003343 EU003354 EU003282 EU003316 Cyrtognatha EU003344 EU153162 EU003283 espanola EU003402 Cyrtognatha sp. GU129609 GU129630 GU129645 773 Cyrtognatha sp. GU129610 GU129629 GU129646 774 Deinopis sp. EU003249 EU003382 EU003249 EU003383 Deliochus idoneus EU003234 EU003259 EU003345 EU003259 EU003284 Diphya spinifera GU129584 GU129611 GU129626 GU129643 GU129585 Dolichognatha *** *** *** *** *** *** incancescens Dolichognatha *** *** *** *** *** longiceps 12 Dolichognatha EU003346 EU153165 EU003285 longiceps 61 EU003405 Dolichognatha *** *** *** *** *** *** pentagona Dolichognatha *** *** *** *** umbrophila Dolichognatha sp. KR526440 KR526482 KR526575 KR526615 16 Epeirotypus EU003273 EU003347 EU003273 EU003286 EU003318 brevipes Gasteracantha EU003235 EJ003256 EU003348 EU003256 EY003287 EU003319 cancriformis Glenognatha GU129586 GU129612 GU129627 mendezi Herennia KC848913 EU003260 EU003384 EU003260 EU003288 KC849034 multipuncta EU003385 EU003386 Hispanognatha GU129587 GU129613 GU129633 guttata GU129588 Larinioides EU003237 EU003250 EU003349 EU003250 EU003289 EU003321 cornutus Leucauge argyra EU003264 EU003364 EU003427 EU003290 Leucauge blanda JN816495 JN816717 JN816926 JN817129 Leucauge venusta EU003238 FJ525356 EU003350 EU153169 EU003291 EU003322 EU003409

Linyphia EU003239 AY078664 EU003390 EU153170 EU003292 AY078702 triangularis EU003410 Mangora maculata EU003240 EU003258 EU003351 EU153171 EU003293 EU003323 EU003411 Mecynogea EU003241 EU003352 EU153172 EU003294 EU003324 lemniscata EU003412 Mecynometa sp. GU129614 GU129639 Mesida sp. GU129589 GH129615 GU129650 GU129590 Meta manchurica JN816499 JN816721 JN816930 JN817133 Meta menardi KC849121 EU003353 EU153173 EU003295 EU003325 EU003413 Meta ovalis FJ607460 FJ607497 FJ607571 FJ607609 Metabus EU003265 EU003354 EU153174 EJ003296 EU003326 ebanoverde EU003414 Metainae sp. EU003272 EU003357 EU153177 EU003299 EU003417 Metainae sp. 123 GU129591 GU129616 Metainae sp. 124 GU129592 GU129617 GU129593 GU129618 GU129594 Metainae sp. GU129595 GU129619 GU129639 128 GU129596 GU129620 GU129597 Metellina mengei *** *** *** *** *** Metellina EU003270 EU003356 EU153176 EU003297 merianae EU003416 Metellina ornata JN816498 JN816720 JN816929 JN817132 Metellina FJ607461 FJ607498 FJ607536 FJ607572 segmentata Metepeira EU003242 EU003253 EU0033455 EU153175 EU003327 labyrinthea EU003415 Metleucauge GU129599 GU129621 GU129636 banksi Metleucauge JN816500 JN816722 JN816931 JN817134 yunohamensis Micrathena FJ525359 EU003358 EU153178 EU003300 EU003329 gracilis EU003418 Mimetus sp. FJ607463 FJ607500 FJ607538 FJ607574 Mollemeta EU003269 GU129575 GH129623 GU129634 edwardsi Nanometa sp. EU003391 EU153179 EU003331 EU003420 Neoscona EU003243 EU003252 EU003359 EU003252 EU003301 EU003332 arabesca Nephila clavipes KC848918 KC849124 KC848965 KC848999 KC849081 KC849040 Nephilengys KC848934 KC849140 KC848959 KC849014 KC849099 KC849055 malabarensis Nephilingis KC849137 KC848976 KC849011 KC849051 cruentata Oncodamus bidens EU003274 EU003360 EU003436 EU003335 Opadometa sp. EU003266 EU003361 EU003423 EU003304 EU003336 Orsinome cf. vethi EU003267 EU003362 EU153181 EU003305 EU003337 EU003424 Orsinome KM486203 KM486413 megaloverpa Pachygnatha EU003261 EU003363 EU153182 EU003306 EU003338 degeeri EU003425 Parasteatoda AH425713 AY230955 EU003387 EU153157 EU003277 AY230989 tepedariorum EU003395 Phonognatha EU003245 FJ607496 EU003379 EU153183 graeffei EU003380 EU003426 EU003381 Pinkfloydia harveii GU129571 GU129601 GU129628 GU129640 GU129572 GU129602 GU129573 Steatoda borealis EU003393 EU153184 EU003307 EU003428 Tetragnatha AY230938 AY230895 AY231069 AY231027 mandibulata

Tetragnatha EU003446 EU003394 EU153185 EU003308 versicolor EU003429 Tylorida striata EU003365 EU153186 EU003309 EU003430 Uloborus EU003247 EU003366 EU003437 EU003310 EU003340 glomosus EU003438 Zhinu *** *** *** *** *** *** manmiaoyangi Zygiella x-notata EU003248 EU003251 EU003367 EU153187 EU003311 EU003341 EU003431

MCZ unless the research permit requires another repository or the specimen has already accessioned in another museum collection. Six markers were amplified for analysis.

These are mitochondrial ribosomal markers 12S rRNA (~400 bp) and 16S rRNA (~550 bp), ribosomal markers 18S rRNA (~1800 bp) and 28S rRNA (~2700 bp), nuclear protein-coding gene histone H3 (~327 bp), and mitochondrial protein-coding gene cytochrome c oxidase subunit I, or COI (771 bp). PCR was completed using the Promega

GoTaq kit. Amplified products were sent to Macrogen USA in Rockville, MD for sequencing. Contigs were formed using Geneious 6.0.6, then submitted to the NCBI

BLAST database to check for contamination. Multiple sequence alignments were completed using MAFFT v7 (Katoh and Standley 2013). Alignments of 12S and 16S were completed using L-INS-i, ideal for samples with a single conserved domain. For the more problematic 18S and 28s, the E-INS-i method was used. The protein-coding genes

COI and H3 were aligned using MACSE (Ranwez et al. 2011), which can detect frameshifts and stop codons in alignments. To account for missing data and poor alignment, trimAl v1.2 was used with the gappyout setting (Capella-Gutierrez et al.

2009).

The maximum likelihood analysis was conducted using RAxML 8 (Stamatakis

2014) on CIPRES (Miller et al. 2011) using the GTRGAMMA model. Partition schemes were tested using PartitionFinder 1.1.1 (Lanfear et al. 2012), with 10 possible partitions:

four non-protein coding markers (12S, 16S, 18S, 28S) and two protein-coding markers

(COI, H3) further partitioned by codon position. Support was computed using 1000

bootstrap pseudoreplicates. Trees were rooted using Uloborus glomosus. Relaxed clock

Bayesian analyses were conducted using MrBayes 3.2.6 (Ronquist and Huelsenbeck

2003) on the high performance cluster Colonial One at the George Washington

University. As in the maximum likelihood analysis, PartitionFinder 1.1.1 (Lanfear et al.

2012) was used to allocate models and link partitions from 10 possible partitions. We

used the fossilized birth-death prior for under sampled lineages and the independent

gamma rates model with broad speciation priors (exp[10]), extinction (beta[1,1]), and

fossilization (beta[1,1]) following Zhang et al. (2015) and Pyron (2017). The tree age

prior is set to 175–200 mya based on analyses by Dimitrov et al. (2016). The clock rate

prior is set by log normalizing the estimated substitution rate of cytochrome c oxidase I

(Bidegaray-Batista and Arnedo 2011). A total of 16 chains (4 cold, 12 heated) were run

for 100 million generations, with the first 25% discarded as burn-in. Convergence was considered achieved when estimated sample sizes (ESS) were below 100 and traces from log files examined in Tracer v1.6 (Rambaut et al. 2014) were plateaued. The fossil record of Tetragnathidae is limited to very recent specimens; Macryphantes cowdeni Selden,

1990, has been used previously but reexamination casts doubt on its family affinity

(Wunderlich 2015). For this reason, we have calibrated the phylogeny based on substitution rate only. Trees were rooted in maximum likelihood analyses.

Anatomical Abbreviations

C, conductor; CEBP, cymbial ecto-basal process; CBDP, cymbium basal-dorsal process;

CD, copulatory duct; CEMP, cymbial ecto-median process; CO, copulatory opening; Cy, cymbium; E, embolus; FD, fertilization duct; MEA, metaine embolic apophysis; P, paracymbium; S, spermatheca; ST, subtegulum; T, tegulum.

Institutional Abbreviations

CAS, California Academy of Sciences, San Francisco, CA, USA; GWU, The George

Washington University, Washington, DC; MCZ, Museum of Comparative Zoology,

Harvard University, Cambridge, Massachusetts, USA; NMNS National Museum of

Natural Science, Taipei, Taiwan; RMNH, Naturalis Biodiversity Center, Rijksmuseum van Natuurlijke Historie, Leiden, The Netherlands; USNM, National Museum of Natural

History, Smithsonian Institution, Washington, DC, USA.

Geolocations

Locations from labels are transcribed where possible. Coordinates estimated from non- coordinate label data are marked with an asterisk (*).

Results

The best schemes determined PartitionFinder differed when limited to RAxML-

compatible versus MrBayes-compatible models (Table 2). Analysis of the 10 possible

partitions resulted in 8 partitions in RAxML: 12S+16S, 18S, 28S, codon position 1 of

COI, position 2 of COI + position 2 of H3, codon position 1 of H3, and codon position 3

of H3. All were run with GTR+G. Analysis using MrBayes-compatible models did not

suggest combination of the second codon position of the protein-coding genes. The

models selected were also typically less parameter-rich than those selected by the

RAxML-limited method, with 12S+16S and 28S modeled with GTR+I+G, 18S and H3 codon positions 1 and 3 modeled using SYM+I+G, H3 codon position 2 modeled with

JC, and the remainder with HKY+I+G.

Table 2. Optimal partition schemes.

Analysis Partition & length (bp) Model RAxML 12s + 16s (774) GTR+G 18s (1764) GTR+G 28s (2030) GTR+G COI, pos. 1 (218) GTR+G COI, pos. 2 + H3 pos. 2 (325) GTR+G COI, pos. 3 (218) GTR+G H3, pos. 1 (107) GTR+G H3, pos. 3 (107) GTR+G MrBayes 12s + 16s (774) GTR+G+I 18s (1764) SYM+G+I 28s (2030) GTR+G+I COI, pos. 1 (218) HKY+G+I COI, pos. 2 (218) HKY+G+I COI, pos. 3 (218) HKY+G+I H3, pos. 1 (107) SYM+G+I H3, pos. 2 (107) JC H3, pos. 3 (107) SYM+G+I

Figure 1. Summary of results of maximum likelihood analysis. Nodes with circles are well supported (bootstrap ≥ 70). Notable families and subfamilies are highlighted.

Figure 2. Summary of results of rate-calibrated Bayesian inference analysis. Nodes with circles are well supported (posterior probability ≥ 0.95). Horizontal node bars represent 95% credibility intervals for node age estimates. Notable families and subfamilies are highlighted.

The results of the maximum likelihood are presented in Figure 1. Tetragnathidae

and the four subfamilies, including Metainae, were strongly supported as monophyletic in

both analyses conducted (bootstrap ≥ 70, posterior probability ≥ 95); the placement of

smaller, rogue clades, remains tenuous. Additionally, both analyses showed good support

for Arkyidae as sister to Tetragnathidae, and Mimetidae as sister to both. We defer to the

maximum likelihood hypothesis (Fig. 1) for the working understanding of relationships,

though the differences primarily lie in unsupported clades. Zhinu n. gen. is supported as

sister to Metellina (bootstrap = 71). Menosira is supported within Metellina.

Dolichognatha longiceps is nested within Dolichognatha. Orsinome cf. vethi and O.

megaloverpa are monophyletic within Leucauginae. Allende, Mollemeta, and

Metleucauge form a weakly supported clade sister to all other tetragnathids. Azilia and

Chrysometa are weakly supported as diverging near Nanometinae.

The results of the Bayesian inference analysis are presented in Figure 2. The

monophyly of Tetragnathidae and its subfamilial groups are supported, but its major

internal relationships are ambiguous. Relationships with Arkyidae and Mimetidae are as

in the maximum likelihood analysis. Zhinu n. gen. is strongly (posterior probability =

0.97). Dolichognatha (including D. longiceps) and Metellina (including Menosira) are

well supported (posterior probabilities = 0.99, 1, respectively). Mollemeta is supported as

sister to all other tetragnathids. Tetragnathidae diverged from Arkyidae approximately

120 (98.9–163.5) myr. Meta is the first diverging metaine genus at 88 (62.3–118.5) myr.

Metellina and Zhinu n. gen. are 65.8 (41.5–93.6) myr. Dolichognatha is the most recently diverged genus at 78.0 (52.7–106.4) myr. Orsinome split from Tylorida 42.8 (24.0–65.3) myr.

Discussion

Metainae is well supported in both analyses for the first time with molecular sequence data, as are most internal relationships among genera and species. The genera included in Metainae following these results are Meta, Metellina, Dolichognatha (Fig. 3), and Zhinu, nov. gen., with Prolochus and Menosira synonymized with Dolichognatha and Metellina, respectively (see taxonomy section). Meta is sister to the other metaines, a result found in other work (Álvarez-Padilla et al. 2009; Dimitrov and Hormiga 2011;

Dimitrov et al. 2012; Dimitrov et al. 2016). Dolichognatha is sister to Metellina and

Zhinu. This differs from the only other analysis to include these taxa (Dimitrov et al.

2016); this likely stems from more loci for Z. manmiaoyangi and more representatives of

Figure 3. Illustrations of pedipalps of established metaine genera. A, Meta ovalis. B, Metellina mengei. C, Dolichognatha longiceps. Scale bars (mm): 0.25.

Metellina in this study. Morphologically Zhinu itself is similar to Dolichognatha (Fig.

3C), not least of which include their somewhat rectangular pars cephalica, long chelicerae in males, similar CEBP, and epigynum structure. However, there are marked differences in the pedipalp, which includes a near circular gap in the cymbium and overall large size of the palp, which is nearly the length of chelicerae. It also bears several dissimilarities from Metellina (discussed below), including the sclerotization and complexity of the

MEA (which is more like Meta, Fig 3A) and CEBP, shape of cymbium (Fig. 3B), lack of

Metellina abdominal markings, and abdomen without humps. These notable differences between the new species from Taiwan and the described Metellina species would impose a major change in the diagnosis of Metellina if the genus were to include the new species.

Therefore a new genus, sister to Metellina, is erected here for the new Taiwanese species plus a close relative, Z. reticuloides, nov. sp.

The earliest diverging group consists of weakly supported nodes including

Allende, Mollemeta, and Metleucauge. These taxa were also early diverging in the

Bayesian tree, though not as closely related. This may be due in part to both limited sequenced loci and non-overlap of those loci. For instance, Allende species only had 3 markers each, of which only one was shared between them, allowing for limited overlap in the multiple sequence alignment. More sequences and additional taxon sampling for these genera may place them more conclusively in the tetragnathid tree in future studies.

The preferred hypothesis of Álvarez-Padilla et al. (2009) also found an early diverging

Mollemeta, and Dimitrov and Hormiga et al. (2011) found relatively weak support all of these taxa’s placements in their preferred phylogeny. More taxa and/or increased loci sequencing should be added before any claims of the placement of these taxa in the

tetragnathid tree.

Tetragnathinae is well supported as a subfamily. Álvarez-Padilla et al. (2009) suggest Tetragnatha, Pachygnatha, Glenognatha, Cyrtognatha, Antillognatha,

Doryonychus, Dyschiriognatha and Hispanognatha to be members of this subfamily, though the first four were the only ones that were tested. Dimitrov and Hormiga (2011) subsequently found support for the inclusion of Antillognatha and Hispanognatha, which were also supported here. This analysis found Tetragnatha to by polyphyletic, perhaps also due to limited overlap of loci (as in Allende). Doryonychus remains unplaced using molecular sequence data and Dyschiriognatha has only a single marker from a barcoding project (Ramage et al. 2016). Further sampling within Tetragnathinae may resolve the genera within.

Leucauginae emerges as sister to Diphya spinifera, which has been a rogue taxon. Álvarez-Padilla et al. (2009) include Diphya in Metainae, and it is unsupported sister to the problematic Mollemeta in molecular analyses but sister to Dolichognatha outside Metainae in morphological and behavioral analyses (Dimitrov and Hormiga

2011). Though Diphya spinifera has most markers coded, additional markers and/or additional Diphya species may be the only way to solidify its placement in the tetragnathid tree. Leucauginae itself is well supported, as are many internal relationships, in both the maximum likelihood (Fig.1) and Bayesian (Fig. 2) analyses. Both Opadometa and Mecynometa are found within Leucauge, which is itself a sprawling issue that is treated in part elsewhere (Ballesteros and Hormiga in prep). Tylorida is sister to

Orsinome in both analyses, which is supported in previous work (Álvarez-Padilla et al.

2009; Dimitrov and Hormiga 2011), though Mesida is also found between them in some

24 analyses (see supplemental information in Dimitrov et al. 2016). Orsinome megaloverpa, sp. nov., is supported as sister to O. cf. vethi in all analyses in which they both appear.

The identity of O. megaloverpa has been the subject of taxonomic discussion for decades, and even its family placement was unclear (R. Forster, pers. comm.). However, much of its morphology suggested an affinity with leucaugines. Female Orsinome are generally characterized trichobothria on femur IV, chilum, coiled, and sclerotized copulatory ducts beginning at a common ventral chamber (Álvarez-Padilla et al. 2011); furthermore, females seem to have unsclerotized spermathecae. Males have a higher pars cephalica, embolic base resting on subtegulum, and cuticular folds forming basal process

(Álvarez-Padilla et al. 2011). O. megaloverpa is recognizable by its extreme conductor/embolus/pars pendula complex, which is very similar to the less exaggerated palp of O. pilatrix. Orsinome requires a taxonomic revision, as many species lack one of the sexes, have description and illustration insufficient to place the taxon, or have morphological or molecular analyses indicating they need to be transferred to other groups, principally to its sister genus, Tylorida.

A number of taxa, however, are weakly supported in either analysis. These include Metleucauge, Mollemeta, Allende, Diphya, and Azilia. Increased sampling of species in these genera and more markers sequenced for those species may alleviate some of these issues in future analyses of Tetragnathidae. However, some remain intransigent.

For instance, the sampling for Chrysometa is tripled with good sampling per specimen, and while the monophyly of the genus is strongly supported in both analyses, its relationships beyond that are inconclusive, or at the very least supported as not being a metaine.

Chrysometa and Azilia are most closely related to Nanometinae. Like Diphya,

Chryometa was treated as a metaine (Álvarez-Padilla et al. 2009) but later analyses

(Dimitrov and Hormiga 2011), including this one, do not support this. Interestingly, both genera have multiple well sampled species, namely Chrysometa in which two additional species, C. poas and C. zelotypa, and additional markers for C. alboguttata have yielded little in the genera’s overall placement.

Nanometinae largely remains to be adequately revised, and currently included taxa have not been taxonomically treated except for Pinkfloydia, which is sister to all other nanometines. Pinkfloydia was slightly more nested in Dimitrov and Hormiga

(2011), but the same position recovered here was supported in Dimitrov et al. (2016).

Ongoing work on this subfamily aims to elucidate relationships within this subfamily

(Álvarez-Padilla and Hormiga in prep.).

The rate calibration (Fig. 2) is largely congruent with the fossil calibrations of

Dimitrov et al. (2016). That work showed Dolichognatha (+ Zhinu) diverging from

Metellina in the late Cretaceous, and Meta diverging from the other two in the mid-late

Cretaceous. Orsinome split from Tylorida in the early Paleogene.

There remains much still to learn about metaine tetragnathids. Numerous taxa have been collected from Africa, Asia, and Oceania which bear traits associated with

Metainae and are either undescribed or placed tentatively (and likely incorrectly) in the genus Meta (N. Scharff, pers. comm.). Others are placed there and are likely not metaines at all; for example, Meta rufolineata (Urquhart, 1889) from New Zealand is sister to

Nanometinae (Dimitrov et al. 2016) and not congeneric with the type species of Meta.

We hope this more complete picture of the state of Metainae will allow more specific

26 studies and placement of the numerous species included in the subfamily.

Tetragnathidae Menge

Genus Zhinu Kallal and Hormiga, gen. nov.

Figs. 4–7

Type species: Z. manmiaoyangi Kallal and Hormiga, sp. nov.

Material examined

Holotype. Taiwan, Taichung City Co., Heping District, Dasyueshan National

Forest Recreation Area, 24.25735 N, 121.00696 E, elev. 2205 m, 10-11.vii.2013, G.

Hormiga & F. Labarque, 1M (NMNS).

Paratype. Locality as holotype, 1F (NMNS). GH1404; Photos: DSC_1170–1213,

IMG_0847–0857.

Diagnosis.

Males of Zhinu can be recognized by its unique cymbium, with a pronounced, rounded emargination, complex CEMP, small CEMP, large, sclerotized epigynum, weakly sclerotized paracymbium, apparent lack of a conductor, and complex, heavily

sclerotized metaine emobolic process (Fig. 4E–I). No other related genus has the cymbium emargination. It is mostly likely confused with Dolichognatha based on the shape of the pars cephalica and long paturon (Fig. 4B). Males can be diagnosed from the

closely related genera Dolichognatha and Metellina based on its more complex CEBP

and emarginated cymbium, and from Meta based on its lack of a CEMP. Females have a

weakly sclerotized epigynum with wide, ventral-facing copulatory openings surrounded

by setae, opening broadly to the spermathecae, with fertilization ducts curving to

terminate dorsally (Fig. 5E–G). This is similar to some Dolichognatha, but with more

apparent copulatory openings and pronounced septum. Metellina has a flatter epigynum

with a sclerotized lip, which is not found in Zhinu, and the copulatory openings of Meta

open posteriorly, apparently the only metaine that does so. Both sexes have very dark endites and sternum, contrasting starkly from the lighter carapace and coxae (Fig. 4D,

5D).

Description.

Female. Total length 6.00–10.00. Carapace brownish yellow, with dark markings around eyes; pars cephalica and pars thoracica margins dark, with a dark pattern on and anterior to fovea. Sternum, endites dark brown. Eye rows slightly recurved. AME diameter 0.18; AME interdistance ca. 1/4 diameter of AME; AME–PME distance ca. 1/2

diameter of AME. Clypeus low, ca. diameter of AME. Chelicerae reddish brown, with 3

prolateral and 3–4 retrolateral teeth. Leg formula 1243, femora mottled with dark spots

on tan, becoming annulated on tibiae and tarsi. Abdomen mottled dark brown, red, and

tan with some silvery guanocytes, becoming more tan laterally. Epigynum with weakly

sclerotized copulatory openings, facing posteriorly, separated by more sclerotized septum

widest at posterior; copulatory ducts broadly connect to spermathecae; fertilization ducts

sclerotized, emerging dorsally and continuing posterior to copulatory openings before

turning medially (Fig. 5E-G).

Male. Total length 4.00–6.00. Carapace brownish yellow, with dark markings

around eyes; pars cephalica and pars thoracica margin dark, with a dark pattern on and

anterior to the fovea. Sternum and endites dark brown. Eye rows slightly recurved. AME

diameter 0.20; AME interdistance ca. 1/4 AME diameter; AME–PME distance ca. 1/2

AME. Clypeus ca. 3/4 AME diameter. Chelicerae dark brown, elongate, with 1–3

prolateral and 3–5 retrolateral teeth. Leg formula 1243; femora mottled with dark spots

on tan, becoming annulated on tibiae and tarsi. Abdomen mottled dark brown, red, and

tan with some silvery guanocytes. Palp with pronounced, round cymbial emargination;

tibiae with small distal process; palpal patella without macrosetae; large, complex CEBP;

weakly sclerotized paracymbium; short CEMP; sperm duct with multiple switchbacks,

sclerotized tegulum and embolus, with embolus curving around and following cymbial

emargination to its terminus; conductor absent; MEA large and heavily sclerotized (Fig.

4E–I).

Affinities

Zhinu is a member of the subfamily Metainae along with Meta, Metellina, and

Dolichognatha. Molecular analyses presented here place it sister to Metellina.

Natural History

Zhinu has been collected in damp areas such as stones and logs, and seem to prefer mountainous habitats (Kim and Lee 2013). It weaves a horizontal orb-web with an

29 open hub. See under Z. manmiaoyangi, new species, for more information.

Composition

The genus Zhinu is includes two species: Z. reticuloides (Yaginuma, 1958), new combination, and Z. manmiaoyangi Kallal & Hormiga, new species.

Distribution

This genus has a range including China, Japan, Korea, and Taiwan.

Etymology

The name of the genus is derived from a folk tale in which Zhinu (Chinese: the weaving damsel) weaves clouds, but departs heaven to encounter the cowherd Niu Lang.

They begin a romance forbidden by the Emperor, and Zhinu is summoned back to heaven. The two are divided by a celestial river except for once a year. The story is celebrated in countries where this genus has been collected. The name is an undeclinable, a proper name, and female in gender.

Zhinu manmiaoyangi, Kallal and Hormiga, sp. nov.

Figs. 4–7

Material examined

Holotype. Taiwan, Dasyueshan National Forest Recreation Area, 24.25735 N,

121.00696 E, elev. 2205 m, 10.vii.2013, G. Hormiga & F. Labarque, 1M (NMNS-7784-

001).

Paratype. Locality as holotype, 1F (NMNS-7784-002). GH1404; Photos:

DSC_1170–1213, IMG_0847–0857.

Diagnosis

On both sexes of Z. manmiaoyangi the posterior area of the pars cephalica and fovea are darker than in Z. reticuloides, forming a triangle-like pattern, whereas the latter species has a longitudinal stripe near the fovea. Males of Z. manmiaoyangi have a broader cymbium overall with the CEBP more robust and curved. The paracymbium is shorter and stouter than in Z. reticuloides. Z. reticuloides has hooked projections on its epigynum absent in Z. manmiaoyangi. Z. reticuloides females have one less tooth on the retrolateral margin of the paturon (3 vs. 4).

Description

Female (paratype; from Dasyueshan; Fig. 5). Total length 6.36. Carapace 2.76 long, 2.11 wide, 0.69 high, brownish yellow, with dark brown mask-like pattern around eyes; pars cephalica approaching fovea and fovea dark brown, forming triangle in dorsal view (Fig. 5A); sternum 1.39 long, 1.14 wide, uniformly dark brown, contrasting sharply with coxae. Eye rows slightly recurved. AME diameter 0.18; AME interdistance ca. 1/4

AME diameter; AME–PME distance ca. 1/2 AME diameter. Clypeus ca. AME diameter.

Paturon reddish brown, with 3 robust prolateral and 4 smaller teeth. Leg formula 1243, femora mottled with dark spots on tan, becoming annulated on tibiae and tarsi; femur I

3.56, patella I 1.22, tibia I 3.76, metatarsus I 3.44, tarsus I 1.45; femur II 2.89, patella II

1.01, tibia II 2.58, metatarsus II 2.41, tarsus II 1.13; femur III 1.77, patella III 0.67, tibia

III 1.17, metatarsus III 1.36, tarsus III 0.69; femur IV 2.74, patella IV 0.70, tibia IV 2.04,

metatarsus IV 1.97, tarsus IV 0.77. Abdomen 3.91 long, 3.54 wide, 3.04 high, mottled

dark brown, red, and tan with some silvery guanocytes, becoming more tan laterally;

venter dark brown between spinning field and epigastric furrow, with line of guanocytes on either side. Epigynum with weakly sclerotized copulatory openings, facing posteriorly, separated by more sclerotized septum widest at posterior; no external hooks present; copulatory ducts broadly connect to spermathecae; fertilization ducts sclerotized, emerging dorsally and continuing posterior to copulatory openings before turning medially (Fig. 5E–G).

Male (holotype, from Dasyueshan; Fig. 4). Total length 5.35. Carapace 2.94 long,

1.85 wide, 0.78 high, color and pattern as in female (Fig. 4A, C–D); sternum 1.48 long,

1.27 wide, uniformly dark brown, contrasting sharply with coxae. Eye rows slightly recurved. AME diameter 0.20; AME interdistance ca. 1/4 AME diamter; AME–PME distance ca. 1/2 AME diameter. Clypeus ca. 3/4 diameter of AME. Patruon dark brown and elongated, approximately 2/3 carapace length, 1.88 long, with one prolateral and three retrolateral teeth. Leg formula 1243; femora mottled with dark spots on tan, becoming annulated on tibiae and tarsi; femur I 5.01, patella I 1.41, tibia I 5.20, metatarsus I 5.13, tarsus I 1.56; femur II 3.92, patella II 1.25, tibia II 3.96, metatarsus II

Figure 4. Zhinu manmiaoyangi, sp. nov., male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A,C-D: 0.5; B,E-I: 0.25.

Figure 5. Zhinu manmiaoyangi, sp. nov., female. A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A,C-D: 0.5; B,E-G: 0.25.

3.19, tarsus II 1.11; femur III 2.23, patella III 0.81, tibia III 1.56, metatarsus III 1.56,

tarsus III 0.72; femur IV 2.80, patella IV 0.82, tibia IV 2.42, metatarsus IV 2.55; tarsus

IV 0.77. Abdomen 2.98 long, 1.94 wide, 1.79 high, mottled dark brown, red, and tan with

some silvery guanocytes, becoming more tan laterally; venter dark brown between

spinning field and epigastric furrow, with line of guanocytes on either side. Palps (Fig.

4E–I) relatively large, ca. 3/4 paturon length; cymbium with round emargination distally, small CEMP, and complex, sclerotized CEBP; sperm duct with multiple switchbacks, sclerotized tegulum and embolus, with embolus curving around and following the rounded cymbial emargination of to its terminus; conductor absent; MEA large and heavily sclerotized (Fig. 4E–I).

Natural history

Specimens collected from orb-webs near the ground, among boulders and along

fallen logs. Webs were horizontal, approximately 12–20 cm in diameter, with open hubs

and signal lines to hidden adjacent retreats (Fig. 6). Mostly juveniles collected, implying

most reach adulthood in late summer or early fall.

Distribution

This species is known solely from the type locality in Taiwan (Fig. 7).

Figure 6. Web architecture of Zhinu manmiaoyangi, sp. nov. A, orb-web collected with juvenile, diameter approximately 18 cm. B, orb-web with collected subadult male, diameter approximately 17cm.

Figure 7. Distribution of Orsinome megaloverpa, nov. sp. (squares), and Zhinu manmiaoyangi, sp. nov. (circle).

Etymology

This species is named after our Taiwanese colleague and friend Prof. Man Miao

Yang, in recognition of her instrumental support for our fieldwork in Taiwan and of her

contributions to systematic entomology.

Genus Orsinome Thorell

Type species: Orsinome vethi (Hasselt)

Orsinome megaloverpa, Hormiga and Kallal, sp. nov.

Figs. 7–10

Material examined

Holotype. Philippines: Leyte Island, Leyte Prov., 5 km E of Ormoc, 11.0273 N,

124.6669 E *, elev. 200 m, 3–11.x.1965, D. Davis, 1M (GH2532, MCZ).

Paratype. Locality as holotype. 1F (GH2532, MCZ).

Other material examined. Luzon Island, Camarines Sur Prov., Mt. Isarog, 9.3 km

E Naga City, 13.6654 N, 123.340 E, elev. 918 m, 31.v–2.vi.2011, C. Griswold, 1F

(PH0055, CASENT 9043459); Luzon Island, Camarines Sur Prov., Iriga, 500–600 m, 3–

6.iv.1962, H.M. Torrevillas, M,F (B. P. Bishop Museum; examined and illustrated

February 1991); Luzon Island, Laguna Prov., UP Los Baños campus, 2.5 km ESE Los

Baños, 14.1525 N, 121.2344 E, elev. 138 m, 27–28.v.2011, H. Wood, M. Yngente, N.

Chousou Polydouri, C. Griswold, V. San Juan, V. Knutson, 2FF, 2Juv (PH0050,

CASENT 9042114).

Diagnosis

O. megaloverpa can readily be distinguished from congenerics by the extreme

modifications of its epigynum and palp. The epigynum has a spiral copulatory duct that is readily visible through the cuticle when examined ventrally and that differs from all other described Orsinome except O. pilatrix (Thorell, 1878). The central sclerotized area comes

to a point caudally in O. megaloverpa (Fig. 8E–G) but ends bluntly in O. pilatrix. The

male palp of O. megaloverpa is most similar to that of O. pilatrix, but the former species

is unique in having an extremely long, fasciform and undulating conductor and an equally

long filiform embolus.

Description

Female (Fig. 8)(from Luzon Island, CASENT 9042114). Total length 8.28.

Carapace 3.46 long, 2.48 wide, 0.77 high, yellowish brown in color with darker pars

cephalica and margins of pars thoracica; sternum 1.35 long, 1.35 wide, dark brown in

color, as labium and proximal area of endites, contrasting starkly with paler coxae. Eye

rows recurved, AME slightly larger than other eyes, AMEs and lateral eyes on small

tubercles; AME diameter 0.19; AME interdistance ca. AME; AME–PME distance ca.

AME diameter. Clypeus ca. 1.5x AME diameter. Paturon dark brown, with 3 robust

prolateral and 4 retrolateral teeth; fang large and robust. Leg formula 1243, reddish

brown in color, covered in conspicuous setae; femur I 7.07, patella I 1.34, tibia I 6.71,

Figure 8. Orsinome megaloverpa, sp. nov., female. A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A,C-D: 0.5; B,E-G: 0.25.

39 metatarsus I 7.67, tarsus I 1.43; femur II 4.71, patella II 0.89, tibia II 4.10, metatarsus II

4.86, tarsus II 1.23; femur III 2.44, patella III 0.62, tibia III 1.48, metatarsus III 1.99, tarsus III 0.71; femur IV 4.15, patella IV 0.90, tibia IV 3.16, metatarsus IV 3.82, tarsus

IV 0.92; femur IV trichobothria ectal, in 2 rows, becoming more sparsely placed distally

Abdomen 5.91 long, 4.03 wide, 4.29 high, pale brown, covered with guanocytes, and grey brown mottling dorsally and laterally; venter brown with four patches of exposed guanocytes: two near ends of epigastric furrow, two near spinnerets. Epigynum with ventral facing shared copulatory chamber, with individual openings facing anteriorly, separated by arrow-shaped septum; copulatory duct coils outward and then back in, terminating in unsclerotized spermathecae; fertilization duct long, thin, curving ventral length of first copulatory duct coil (Figs. 8E–G).

Male (Figs. 9–10)(holotype; from Leyte, GH2532). Total length 7.43. Carapace

3.65 long, 2.48 wide, 0.77 high, reddish brown in color with darker fovea and pars cephalica, which is slightly elevated but overall relatively flattened; sternum 1.41 long,

1.35 wide, deep reddish brown in color, as labium, contrasting starkly with paler coxae.

Eye rows weakly recurved, AME slightly larger than other eyes, AMEs and lateral eyes on small tubercles; AME diameter 0.22; AME interdistance ca. 2/3 AME; AME–PME distance ca. AME diameter. Clypeus ca. 1.5x AME diameter. Paturon reddish brown, nearly length of carapace, with large, angular tooth (mastidion) medially, on prolateral margin; 2 prolateral and 1 retrolateral tooth; striae on rear face of proximal end of paturon, approximately 7 squarish notches; fang long and robust. Leg formula 1243; femur I 8.82, patella I 1.54, tibia I 4.30, metatarsus I 5.48, tarsus I 1.15; femur II 5.80,

Figure 9. Orsinome megaloverpa, sp. nov., male. A, dorsal; B, frontal; C, lateral; D, ventral, E, pedipalp: E, ectal. Scale bars (mm): A,C-D: 0.5; B,E: 0.25.

patella II 1.15, tibia II 5.38, metatarsus II 5.20, tarsus II 1.46; femur III 2.71, patella III

0.67, tibia III 1.90, metatarsus III 2.41, tarsus III 0.83; femur IV 4.93, patella IV 0.94, tibia IV 3.71, metatarsus IV 4.67, tarsus IV unknown. Abdomen 4.18 long, 2.12 wide,

2.05 long, with longitudinal rows of guanocytes on pale brown; distal end of abdomen with pair of dark markings; venter as female, with two pairs of guanocyte patches, one near epigastric furrow and one near spinnerets. Palp (Figs. 9E–I, 10) with long trochanter, tibia with at least six dorsal trichobothria, cymbium elongate, rectangular with pointed,

Figure 10. Orsinome megaloverpa, sp. nov., male. Pedipalps: A, ectal, illustrated. B, dorsal, illustrated. C, mesal, illustrated. D, ectal. E, dorsal. F, mesal. G, apical. H, ventral. I, basal. Scale bars (mm): A-C, 1.0; D-I: 0.5.

42 hooked CBDP; a sharp cuticular edge runs relatively straight from CBDP to paracymbium base; paracymbium sclerotized, narrow, slightly curved and apically widest, membranous on its internal face, extending less than half the length of the cymbium, where it connects with cymbium; tegulum ovoid; conductor fasciform, sclerotized with membranous flange encompassing embolus; conductor broad, semi- membranous at its origin on tegulum, curving several times at varying directions as it approaches its filiform apical region; the external margin of the conductor is heavily sclerotized, its internal area is edged by a thinly sclerotized groove that holds the embolus

(if not dislocated, as illustrated/photographed); conductor area in between sclerotized margins (pars pendula) semi translucent and membranous; embolic base fusiform, distal to tegulum, with filiform embolus emerging basally before curving to meet conductor groove.

Variation

Females (n=4) with total length 6.95–8.81; carapace 3.03–3.80 long, 2.40–3.03 wide, 0.75–0.92 high; sternum 1.31–1.55 long, 1.35–1.50 wide; abdomen 5.30–6.06 long,

2.48–4.09 wide, 2.90–4.64 high. Brownish colors fade to red in alcohol preservation.

Natural history

This species has been collected in forest habitats in a somewhat degraded habitat.

Distribution

Orsinome megaloverpa is known exclusively from the Philippines and it is the only member of the genus described from the Philippines, although this is likely an undersampling artifact.

Affinities

Orsinome megaloverpa is sister to O. cf. vethi. Morphologically these two species, along with O. vethi, share the male mastidion (forward-facing tooth on paturon) on large and robust chelicerae. Orsinome is nested within the subfamily Leucauginae, and its sister genus is Tylorida.

Etymology

The species epithet is derived for the Latin word verpa (penis), combined with the

Greek prefix μεγάλος (megálos; large, exaggerated), in reference to the remarkably large size of the intromittent organ and conductor of this species.

Misplaced taxa

Dolichognatha junlitjri (Barrion-Dupo & Barrion), comb. nov.

Dolichognatha longiceps (Thorell), comb. nov.

The genus Dolichognatha was initially described by O. Pickard-Cambridge

(1869) for a species from Sri Lanka (D. nietneri O. Pickard-Cambridge, 1869) and

described as having a large, elongated caput (pars cephalica), falces (chelicerae) long (up

to length of cephalothorax), trapezoidal maxillae (endites), large AME, and smaller,

contiguous PME. Phylogenetic study of the genus resulted in the synonymy of Atimiosa

Simon, 1895, Homalopoltys Simon, 1895, and Prolochus Thorell, 1895, as the type

species of those genera were nested between members of Dolichognatha (Smith 2008,

Dimitrov et al. 2010; see also Levi 1981).

More recently, Barrion-Dupo and Barrion (2014) removed Prolochus from

synonymy with Dolichognatha based on four features: absence of PME, absence of

dorsal abdominal humps or tubercles, ovoid to globular abdomen, and male palp

morphology, although they did not provide any specific details on what in the male palp

supports their action. These authors do not provide any phylogenetic reasoning for the

resurrection Prolochus. Their argument is essentially a phenetic one: that longiceps and the new species that they describe are different from species in Dolichognatha, and that the absence of PMEs justifies such proposal. Levi (1981:277) synonymized Prolochus under Dolichognatha based on “the structure of the chelicerae, the palpus, and the poorly preserved abdomen. Prolochus longiceps differs in lacking posterior median eyes, but in some species of Dolichognatha the posterior median eyes are reduced in size.” Dimitrov et al. (2010) corroborated the synonymy with Dolichognatha using an explicit phylogenetic argument, based on a cladistic analysis of morphological data. Their results showed Dolichognatha longiceps nested in the genus in such a way that recognition of

Prolochus renders Dolichognatha paraphyletic. Surprisingly, the Dimitrov et al. (2010) study is not even cited by Barrion-Dupo and Barrion (2014), nor is the phylogenetic justification of Dolichognatha provided by Álvarez-Padilla and Hormiga (2011). The

molecular phylogeny presented here corroborates the hypothesis of Dimitrov et al. (2010)

in that longiceps is nested in the genus Dolichognatha, with support for the genus and

relationships therein in both maximum likelihood and Bayesian inference analyses (Figs.

1–2). For these reasons, we reject the conclusions of Barrion-Dupo and Barrion (2014).

Prolochus should remain a junior synonym of Dolichognatha, resulting in in

Dolichognatha longiceps, comb. nov., and Dolichognatha junlitjri, comb. nov.

Furthermore, the “Dolichognatha” sampled in Gregorič et al. (2015) groups in

Leucauginae, sister to Mesida, and should be disregarded for the purposes of examining

the monophyly of Dolichognatha.

Dolichognatha can be diagnosed by the following suite of traits: relatively

rectangular pars cephalica; PME relatively close, juxtaposed, or absent; prominent AME

on small tubercle; low clypeus (<1 AME); long chelicerae, sometimes comparable in

length to carapace; wider than long abdomen, usually with tubercles; epigynum slightly

swollen in lateral view; male palpal patella macrosetae absent; cymbium without

emargination; CEBP present; CEMP absent; MEA somewhat simple, less sclerotized

(Fig. 3C) (Levi 1981; Smith 2008; Dimitrov et al. 2010; Álvarez-Padilla and Hormiga

2011).

Metellina ornata (Chikuni), comb. nov.

Menosira was described by Chikuni in 1955, though attributed within to Kishida,

1933 or 1939, and discussed later by Marusik et al. (2015). Its morphology was discussed briefly, noting its similarity and possible future synonymy with Metellina. The

descriptions of the genus and species lack differential diagnosis from related (or other

local) species. The genus Metellina was diagnosed by Chamberlin and Ivie (1941) as a

rather typical tetragnathid with abdominal humps, with bifurcate process (MEA) in males

and simple, single or double depressed atrium in epigynum of females. Levi (1980)

diagnosed Metellina with a longer than wide abdomen, sometimes with tubercles, a black band on the venter of the abdomen, and three teeth of the prolateral margin of the chelicerae; these traits are congruent with the description of Menosira by Chikuni (1955).

Though some favor the synonymy of Meta and Metellina (Wunderlich 1987), morphological, molecular, and total evidence analyses frequently place Metellina sister to

Dolichognatha or Zhinu rather than the morphologically similar Meta (Álvarez-Padilla et al. 2009, Dimitrov and Hormiga 2011, Dimitrov et al. 2012, Dimitrov et al. 2016), with this analysis finding Dolichognatha sister to Metellina + Zhinu. Our taxon sampling includes Metellina mengei, M. merianae, and M. segmentata, with Menosira ornata strongly supported as nested within Metellina. The latter genus is rendered paraphyletic if ornata is placed in its own genus. We propose Menosira be synonymized with Metellina, resulting in Metellina ornata comb. nov.

Metellina can be diagnosed by the following suite of traits: abdomen longer than wide, usually without tubercles; secondary eyes with canoe-shaped tapetum; PLE on single tubercle; flat epigynal plate; posterior-facing copulatory openings; fertilization ducts originating near anterior area of spermathecae; mass of accessory glands near copulatory ducts; palpal patella with one macroseta; large CEBP; CEMP absent; paracymbium longer than half cymbium length; sperm duct simple, without switchbacks;

MEA somewhat simple, weakly sclerotized (Fig. 3B) (Kaponen and Marusik 1992;

Álvarez-Padilla and Hormiga 2011). Meta can be diagnosed by the following suite of

traits: abdomen as high as long; PMS with >20 aciniform spigots; epigynum swollen

ventrally; copulatory openings typically ventral-facing; fertilization ducts inconspicuous, crossing spermathecae; CEMP and CEBP present; palpal patella with one macroseta; sperm duct complex, with switchbacks; MEA complex, heavily sclerotized (Marusik and

Koponen 1992; Álvarez-Padilla and Hormiga 2011).

Zhinu reticuloides (Yaginuma), comb. nov.

Meta reticuloides Yaginuma, 1958, has a number of features suggest that it and Z. manmiaoyangi represent two different but related species: overall coloration (e.g., markings on the cephalothorax), paracymbium width, embolus appearance, and lack of hook-shaped protrusions on epigynum (Yaginuma 1958, Namkung 2002, Kim and Lee

2013). Meta reticuloides is from a similar region as Z. manmiaoyangi. Based on its morphology (similar to that of Z. manmiaoyangi), it is certainly not congeneric with Meta as currently placed. Interestingly, Yaginuma (1958) remarked that, despite having his placement in Meta, Z. reticuloides was likely related to Metellina notwithstanding differences in the palp and epigynum, as did Wunderlich (2008). Morphological coding and molecular sequencing of this taxon, along with a more complete revision of

Metellina, should lead to clarity on the classification of this species.

Chapter 3: Systematics and phylogeny of the Australasian orb-weaver genera

Phonognatha Simon 1894, Deliochus Simon 1894, and Artifex new genus (Araneae, Araneidae), with comments on biogeography and retreat evolution

Abstract

We review the Australasian clade of the araneid subfamily Zygiellinae. These orb-

weaving species construct leaf retreats that, in the case of some, occur at the hub of their

webs. We gathered and analyzed a matrix of 95 taxa of zygiellines and close relatives

with sequence data from six markers (12S, 16S, 18S, 28S, COI, and H3), in addition to

235 morphological and behavioral characters. Analyses conducted using parsimony,

maximum likelihood, and Bayesian methods indicate Phonognatha is paraphyletic as

currently circumscribed. We erect Artifex new genus to accommodate two species formerly in Phonognatha. Our analyses support Zygiellinae as the earliest diverging araneid subfamily, at approximately 111 myr. Biogeographic analyses using

BioGeoBEARS support multiple colonizations of New Caledonia from Australia, congruent with the island's geology. Furthermore, analysis of the retreat types across various araneids show using leaf retreats integrated with the hub to have arisen at least

three times independently. We describe one new species, Phonognatha tanyodon new

species, redescribe three species of Phonognatha, three species of Deliochus (including

two transferred from Araneus), and two species of Artifex. Three species of Araneus and

Phonognatha are synonymized with these taxa, and four species are misplaced in

Zygiellinae.

Introduction

Australasia, including Australia, Zealandia (New Zealand and New Caledonia),

and New Guinea, has long been considered an important area of arachnid diversity, with

nearly 3,700 species of spiders described from Australia alone (ABRS 2014). As

relatively isolated islands since separation from Antarctica with the breakup of

Gondwana, the unique biota of Australia is supposed to have come about from endemics surviving in relictual habitats as the climate of the continent changed and became more arid, and later from immigrants after rifting (Crisp et al. 2004). Multiple examples of distinct spider lineages exclusive to Australia have been examined in recent years alone

(Framenau et al. 2010a; Framenau et al. 2010b; Joseph and Framenau 2012; Rix and

Harvey 2012; Wood et al. 2013; Harvey et al. 2015; Harvey et al. 2017; Rix et al. 2017).

The orb-weaving spider family Araneidae Clerck, 1757 includes nearly 3,100 species in 169 genera, with only Linyphiidae and Salticidae being more speciose spider families (World Spider Catalog 2017). This group is extremely diverse morphologically and behaviorally, but making sense of this diversity in a family-wide context remains elusive. A modern systematic analysis testing the monophyly of araneids, as well as the relationships within, remains to be done, and many genus-level relationships are weakly supported and unstable. The most recent analyses including many araneids show that the state of our understanding of both interfamilial and intrafamilial relationships is still in flux (Gregorič et al., 2015; Dimitrov et al., 2016). Major, family-level changes from

Dimitrov et al. (2016) include the elevation of Arkys and its kin to the family Arkyidae from its placement in Araneidae by Scharff and Coddington (1997), as arkyids are sister to tetragnathids (see also Benavides et al. in press), and Nephilidae became ranked as a subfamily within Araneidae. The subfamily Nephilinae is placed sister to Zygiellinae (the

clade including Zygiella F.O. Pickard-Cambridge, 1902, Leviellus Wunderlich, 2004,

Phonognatha, and Deliochus), which are all sister to the remaining araneids (Dimitrov et al. 2016).

The araneid subfamily Zygiellinae is an early diverging araneid lineage.

Depending on the analysis, it groups with nephilines as the earliest (Dimitrov et al. 2016)

or the next earliest after the nephilines (Gregorič et al. 2015). The subfamily is composed

of four genera: Phonognatha, Deliochus, Zygiella, and Leviellus. This is recently reduced

by a third by Gregorič et al. (2015), who synonymized Parazygiella (Wunderlich, 2004)

with Zygiella, and Stroemiellus (Wunderlich, 2004) with Leviellus. The emergence of the

term Zygiellinae is relatively new, as Zygiella (and its relatives as described by

Wunderlich 2004) was classically understood as deep within the araneid tree (Scharff and

Coddington, 1997), whereas Phonognatha and Deliochus were believed to be nephilids

from their initial description until about a century later (Simon, 1894; Hormiga et al.

1995). Zygiellinae, now broadly accepted as basally emerging in the araneid tree,

includes taxa that have been the subject of studies ranging from web architecture

evolution to mating behavior (Kralj-Fišer et al. 2013; Gregorič et al. 2015).

Taxonomy & Systematics

The genera Phonognatha Simon, 1894, and Deliochus Simon, 1894, have a long history of unstable family-level placement. Both genera were initially authored over 120 years ago from a hugely diverse region with many species unidentified and undescribed.

Figure 11. Australasian Zygiellinae. A, Phonognatha graeffei from Yuraygir National Park, New South Wales. Photo by RJK. B, Phonognatha tanyodon sp. nov. from Budderoo National Park, New South Wales. Photo by GH. C, Phonognatha graeffei from Lamington National Park, Queensland. Photo by GH. D, Artifex melanopyga from nr. Mareeba, Queensland. Photo by I. Macaulay. E, Deliochus zelivira from Royal Botanic Gardens, Cranbourne, Melbourne, Victoria. Photo by R. Whyte. F, Deliochus idoneus from Gindie, Queesland. Photo by L. Sanders.

These genera, along with Singotypa, were initially placed in Phonognatheae, within the nephiline subfamily of Argiopidae, in Simon’s Histoire Naturelle des Araignées (1894).

Simon described phonognathine females as ‘ambiguous’ in their morphology, with the males having robust chelicerae and pedipalps similar in appearance to tetragnathids (Fig.

11); morphological and behavioral similarity to tetragnathids as well as Nephila and close relatives would pervade the morphological placement of Phonognatha and Deliochus for a century. Phonognatha and Deliochus were described from Tasmania and Australia

(‘New Holland’), and totaled four species between them: P. graeffei (Keyserling, 1865),

S. melania (L. Koch, 1871) S. melanopyga (L. Koch, 1871), and D. zelivira (Keyserling,

1887). However, P. graeffei was described prior to the authorship of Phonognatha, and was placed in Epeira originally, while P. melania, P. melanopyga, and D. zelivira were placed in the now-tetragnathid genus Meta. Later, Singotypa was synonymized with

Phonognatha based on the lack of conclusive morphological differences in the genera, where they were classified as araneids (Dondale 1966), resulting in two Australasian zygielline genera: Phonognatha and Deliochus.

Over the course of the next century, Phonognatha and Deliochus remained unrevised, but taxonomic and systematic work continued. These taxa would be treated as nephilines, but Nephilinae would be placed in Araneidae (Roewer 1942), then Argiopidae

(Bonnet 1956), then back to Araneidae (Brignoli 1983; Wunderlich 1986) followed by placement in Tetragnathidae (Levi and von Eickstedt 1989). Hormiga et al. (1995) would provide morphological and behavioral evidence for both the monophyly of

Tetragnathidae and the placement of nephilines (including Phonognatha and Deliochus) therein. Nephilidae would be elevated to family status by Kuntner (2005), who placed

Phonognatha and Deliochus as early diverging nephilids; later analyses place those

genera as sister to all non-nephiline araneids (Kuntner et al. 2008). It is notable that both

some nephilines and Phonognatha leave the temporary, non-sticky spiral in the final web, and this was thought to be a significant synapomorphy until Phonognatha was confidently placed as a more distant relative of Nephila. Meanwhile, Zygiella was transferred to Araneidae from Tetragnathidae following its nested placement in the morphological analysis of Scharff and Coddington (1997).

Molecular and total evidence analyses by Álvarez-Padilla et al. (2009) showed

Phonognatha and Deliochus were early diverging araneids, and that Nephilidae and

Araneidae are sister families. It also showed a surprising placement of Zygiella, which has a somewhat typical araneid appearance, yet is closely related to Phonognatha and

Deliochus. Parsimony analyses of morphological characters supported a topology more akin to that of Scharff and Coddington (1997), with Zygiella nested within Araneidae and both Phonognatha and Deliochus as early diverging nephilids. The following analysis by

Kuntner et al. (2013) was equivocal with respect to the Phonognatha and Deliochus, with

various analyses placing the genera as sister to the rest of Araneidae (which itself was

paraphyletic), weakly supported as sister to nephilids. These authors also use the term

‘Zygiellidae,’ put forth by Wunderlich (2004), as a potential family-level designation that includes Phonognatha, Deliochus, Zygiella, Parazygiella, Leviellus, and Stroemiellus, as these taxa continued to be problematic in some analyses with respect to Araneidae and

Nephilidae. While Zygiellidae as proposed by Wunderlich (2004) does not stand up to systematic scrutiny (e.g. close relationships between Zygiella and Chrysometa are proposed, which defies established family boundaries based on various data; see

54 comments in Hormiga and Griswold 2014), the subfamily label remains. More recently,

Gregorič et al. (2015) show Phonognatha and Deliochus are early diverging araneids, but the former is not monophyletic, suggesting work to be done in explaining the generic boundaries within Zygiellinae. Dimitrov et al. (2016) synonymized Nephilidae with

Araneidae, but placed Phonognatha and Deliochus as more closely related to nephilines than other araneids, thus bringing their placement nearly full circle – that is, similar to that of Simon (1895).

Seven more species and subspecies would be attributed to Phonognatha. The first of these was P. wagneri (Rainbow, 1896), which was subsequently synonymized with P. graeffei by Dondale (1966). Simon (1907) described P. acanthopus from Africa, but this taxon would be transferred to Singafrotypa (Benoit 1962) by Kuntner and Hormiga

(2002). Another Western Australian species, P. pallida Dalmas, 1917, was described a decade later. Two taxa would later be described from New Caledonia: P. joannae

Berland, 1942, and P. graeffei neocaledonica Berland, 1924. The remaining two

Phonognatha were also described from non-Australian localities: P. vicitra Sherriffs,

1928 is the only Phonognatha described from India, and P. guanga Barrion and

Litsinger, 1995, was described from the Philippines. Deliochus had two additional taxa attributed to it: D. pulchra Rainbow, 1916, and D. pulchra melania Rainbow, 1916. Both of these are described from Gordonvale, Queensland, Australia.

Behavior

Phonognatha is more readily identified based on its web architecture than its

morphology (Fig. 11C, 12A, 13A). The temporary, non-sticky spiral remains in the

finished web (Fig. 12A, arrow). The web construction process, outlined more

exhaustively in Hormiga et al. (1995), concluded this was valuable behavioral character

allying Phonognatha with nephilines. However, subsequent molecular analyses (e.g.,

Álvarez-Padilla et al. 2009; Gregorič et al. 2015) clearly indicate this is a homoplasious

character. Even more diagnostic of Phonognatha webs is the presence of a curled leaf

retreat situated vertically at the hub of the web, which is shaped like the lower half of an

Figure 12. Web morphology of Phonognatha and Deliochus. Webs were dusted in cornstarch prior to photography. A, orb-web of P. melania in Walpole-Nornalup National Park, Western Australia. Web is typical of Phonognatha, featuring a single coiled leaf retreat integrated in the web, with the broad opening at the hub. The web is complete below the hub, with variable completion above the leaf. Apparent empty areas of the spiral are occupied by the temporary, non-sticky spiral remaining in the finished web (arrow). B, orb-web of D. humilis in Barrington Tops National Park, New South Wales. This complete orb-web has a downward displaced hub and adjacent retreat made of silk- bonded leaves. Photos by GH.

Figure 13. Leaf retreats and their architects. A, Phonognatha graeffei and web from Lamington National Park, Queensland, Australia; note curled leaf at hub of incomplete orb. Photo by GH. B, Acusilas sp. web from Khao Sok National Park, Thailand; web is similar to Phonognatha, though typically with more of upper web completed. Photo by

GH. C, Metepeira labyrinthea web, Chickasaw State Park, Tennessee, USA; web with detritus (sometimes including a leaf) is placed in barrier web adjacent to orb. Photo by J. Ballesteros. D, Spilasma duodecimgutta web, Reserva Florestal Alberto Ducke, Amazonas, Brazil; this unique web is horizontal with a central retreat reinforced with detritus. Photo by GH. E, Araneus marmoreus, New Germany State Park, Maryland, USA; this species makes a rudimentary retreat adjacent to the web by bonding together whatever material is available. F, Araneus dimidiatus, Yuraygir National Park, New South Wales, Australia; this spider's leaf curl is at the top of the orb rather than the hub, but its Phonognatha-like color scheme leads it to be sometimes misidentified.

average araneid orb-web. Use of leaves or other foreign substrate within the orb is

exhibited in some araneids, while others may have a web adjacent retreat made from silk

or leaves or none at all. In Australasian habitats, Araneus dimidiatus (L. Koch, 1871)

(Fig. 13F) and all species of Acusilas Simon, 1895, (Fig. 13D) also curl leaves in their

web, and the behavior appears in many theridiid species, among others (Eberhard et al.

2008). The web of Araneus dimidiatus can be distinguished from that of Phonognatha as

its orb is complete, and the centrally placed leaf curl is not at the hub, but rather that the

top of the orb.

Phonognatha select a leaf when their web is complete, then proceed to roll it

longitudinally, seal it with silk, and place it so the lower opening of the leaf curl is near

the orb-web hub. The front legs are often visible emerging from the lower opening of the

rolled leaf onto the web much in the same way other araneids rest. The leaf selection

process was examined by Thirunavukarasu et al. (1996), and they determined larger

spiders selecting larger leaves, and prefer green leaves to brown probably due to their

malleability. The female remains in the leaf curl during the day rather than retreat off the

web. A female will curl the leaf laterally when using it for an egg sac. P. graeffei males

have been observed to often cohabitate in the leaf curl and defend the web against rival

males, remaining in the web while the female reaches adulthood to mate with her (Fahey

and Elgar, 1997). The male may then be consumed by the female. Deliochus weaves a

complete orb-web more akin to a standard araneid (Fig. 12B). Unlike Phonognatha, it

removes the temporary spiral in the finished web (Kuntner et al. 2008). It uses green

leaves bonded with silk to make an off-web retreat, but males and females have been observed cohabitating as in Phonognatha. Without a phylogeny of Phonognatha and close relatives, the evolution of the leaf retreat cannot be understood in a comparative context.

Color change

A number of spiders have exhibited color change in two main ways: pigments and structure (Oxford 1997; Oxford and Gillespie 1998; Umbers et al. 2014). That is, either explicitly colored chemical molecules provide color (pigments), or reflection, refraction, or other interference of a surface influencing perceived colors (structure). Among these is

Phonognatha graeffei, first documented by Roberts (1936),who characterized a disappearance of its ‘creamy mottling’ pattern when disturbed from its web. That creamy mottling is a result of guanine crystals stored in guanocytes, which are specialized mid- gut cells located between the cuticle and gut diverticula. These guanocytes store the common spider metabolic product guanine and are found in numerous species.

Guanocyte-dependent color change is sometimes considered a structural color change

that behaves as a pigment as the whitish color is reflected from a structure that can be

quickly modified (Oxford and Gillespie 1998). At rest, the guanocytes of Phonognatha

Figure 14. Color change in Phonognatha graeffei from Barrington Tops National Park, New South Wales. A, spider at rest, with guanocytes appearing as clear, discrete white patches on abdomen. B, spider is disturbed, with guanocytes appearing small, indiscrete, and drowned in dull surrounding color. Photos by RJK.

are more apparent, leading to a whitish appearance of the abdomen, and when disturbed, either the abdomen expands or the guanocytes retract, leading to a darker appearance

(Fig. 14). This process takes place in seconds. Possible explanations for this phenomenon include thermoregulation (Robinson and Robinson 1978), where the lighter pattern reflects solar radiation though Phonognatha spends much of its time in its leaf curl when the sun is out. Crypsis is another explanation, as the more drab color is more difficult to spot on the ground. Wunderlin and Kropf describe muscles surrounding the guanocytes that may cover and expose them (2013). It may also be a result of the physiology of the spider going from a passive to active state, but study on this topic is concentrated on mygalomorphs (Kropf 2013). This topic requires more research, and the ease of collection of Phonognatha may make it a valuable model for reversible color change based on guanocytes given the abudance of P. graeffei in particular in the habitats in

which it occurs.

Biogeography

Previous estimates of the age of Zygiellinae place it at approximately 100 million years old (Dimitrov et al. 2016). Zygiella and Leviellus occur largely in the Nearctic and

Palearctic regions, with subsequent introduction to the southern hemisphere, whereas

other zygiellines occur in Australia, New Caledonia, and Papua New Guinea. Other less

well known zygiellines may occupy southeast Asia (e.g. Z. calyptrata), but are poorly

understood (D. Court, pers. comm.). The multiple islands dotting the Torres Strait allow a

feasible path between Cape York in Queensland and Papua New Guinea. Eastern

Australia is where most of these taxa co-occur, spanning the southern, temperate

sclerophyll forests in the south to the wet tropical forests in the north; this climatic

difference seems to be biologically important for some species and not others.

Specifically, the St. Lawrence Gap, which occurs south of Mackay and north of

Gladstone in central coastal Queensland, presents a boundary separating these two zones

that has been tested in prior spiders studies (Rix and Harvey 2013). Another such non-

oceanic boundary is the Nullarbor Plain, an expansive desert more than 1,000 kilometers

wide along Australia’s southern coast. Named for its absence of trees, this habitat seems

largely inimical to most life, spider and otherwise, and has been deemed important for

separating populations in more temperate, forested regions of Western Australia from

New South Wales and Victoria.

Perhaps the most imposing potential isolating boundary for Australasian

61 zygiellines is the Coral Sea, which separates New Caledonia from mainland Australia by approximately 1,300 kilometers. Biogeographic study with respect to New Caledonia has been informed by the hypothesis that the island has only been habitable for approximately 37 million years, prior to which it was submerged along with much of

Zealandia (Grandcolas et al., 2008). That is, there seems to be an earliest possible point for endemics to have colonized New Caledonia. However, studies on other arachnids raised the possibility of small islands remaining above sea level prior to that period

(Sharma and Giribet 2009). There are two Phonognatha species endemic to New

Caledonia: Artifex joannae (new combination from P. joannae) and P. neocaledonica

(formerly a synonym of P. graeffei; see results and taxonomy sections). Similarities between A. joannae and A. melanopyga in particular suggest a founding event of the latter developed into the former, while the morphology of P. neocaledonica does not suggest an obvious sister taxon prior to analysis. A time calibrated phylogeny with species inhabiting Australia and New Caledonia could indicate the time of colonization of

New Caledonia and whether other biogeographic boundaries (namely the St. Lawrence

Gap and Nullarbor Plain) pose an appropriately timed biogeographic boundary. In the case of New Caledonia, biogeographic analysis would corroborate one of two hypotheses. The first is colonization of New Caledonia in the last 37 million years, when most of the island would have been above water according to Grandcolas et al. (2008).

The second is colonization prior to the supposed submergence and survival as relicts on areas that were not submerged, as in the troglosironid opiliones (Sharma and Giribet

2009). Lord Howe Island, located approximately 585 km from Port Macquarie, New

South Wales, is populated by P. graeffei. While only half the distance as from Australia

to New Caledonia, this speaks to the dispersion or colonization ability of these taxa across sizeable inhospitable zones.

In this study we aim to test the monophyly of Araneidae and the Australasian zygiellines, taxonomically revise the taxa included in Phonognatha and Deliochus as well

as a new genus Artifex, placing them in the phylogenetic framework. With this

framework in place, we examinetwo questions relating to the biology of these spiders:

how many times various leaf retreats evolved in Zygiellinae and close relatives, and how

Australasian zygiellines colonized the often disparate habitable areas in Australia and

New Caledonia.

Material and Methods

Measurements, Imaging, and Illustrations

Specimens were examined using a Leica MZ16A stereomicroscope. Photographs

were captured using a Leica DFC 500 camera and the LAS 3.8 imaging suite. Multifocal

plane images were then assembled using Helicon Focus 5.1. Illustrations were completed

using an Olympus BX51 microscope with camera lucida. Epigyna were transferred to

methyl salicylate (Holm, 1979) for examination under the microscope. For scanning

electron microscopy (SEM), images were taken using the LEO 1430VP at the

Department of Biology of The George Washington University. To prepare the specimens

for SEM, we critical point dried specimens then sputter-coated them in a gold-palladium alloy and mounted as described in Álvarez-Padilla and Hormiga (2008). Male palp

sclerite homologies and nomenclature follow Álvarez-Padilla and Hormiga (2011) and

Hormiga et al. (1995). All measurements are presented in millimeters.

Taxon Sampling

Specimens were added to the data matrices of Kuntner et al. (2008) and Álvarez-

Padilla et al. (2009). A total of 95 terminals among 89 taxa were examined for the various analyses, summarized in Table 3, which includes accession numbers and whether morphology was coded for that terminal. Of those, 72 are araneids, and 26 of those are zygielline araneids. The only previously described and identified Phonognatha or

Deliochus in the molecular analyses was P. graeffei; A. melanopyga also appeared in the matrix from Kuntner et al. (2008). We sought to maximize the number of Phonognatha,

Deliochus, and Artifex representatives, as well as to sample the other main lineages of araneids and related families for a relatively broad sampling across Araneidae. This includes coding morphology only in the New Caledonia endemics A. joannae and P. neocaledonica for the biogeographic analysis, and other araneids with unique retreat architectures (e.g., Spilasma duodecimguttata (Keyserling, 1879)). As part of this study, we sequenced material collected in Australia as well as material graciously loaned from individuals and museums in Australia. This study includes 14 newly sequenced specimens, eight of which are lineages of Phonognatha, Deliochus, or Artifex. Non- zygielline araneid lineages include Acusilas dahoneus Barrion and Litsinger, 1995,

Dolophones Walckenaer, 1837, Eriophora transmarina (Keyserling, 1865),

Paraplectanoides crassipes Keyserling, 1865, and Spilasma duodecimguttata. Other

Table 3. Taxon sampling and accession numbers. Species in bold are new for this study.

Taxon Partition Family Species 12s 16s 18s 28s COI H3 morpholog y Araneidae Acanthepeira FJ607443 FJ607477 FJ607516 FJ607551 FJ607590 x stellata Araneidae Acusilas KR52638 KR52642 KR52646 KR52655 KR52660 x coccineus 8 5 6 9 2 Araneidae Acusilas x x x x x dahoneus Araneidae Arachnura KJ958092 KJ957944 KJ957997 logio Araneidae Arachnura KJ958094 KJ957946 scorpionoides Araneidae Araneus FJ607445 FJ607479 FJ607518 FJ607553 FJ607592 x diadematus Araneidae Araneus KC84890 KC84910 KC84895 KC84898 KC84906 KC84902 dimidiatus 4 9 1 5 5 4 Araneidae Araneus EU00323 EU00334 EU15315 EU00327 EU00331 marmoreus 0 1 8 8 2 EU00334 EU00339 1 7 EU00334 EU00339 1 7 Araneidae Araniella JN816530 JN816749 JN816957 JN817163 yaginumai Araneidae Argiope FJ607446 FJ607480 FJ607519 FJ607554 FJ607593 x argentata Araneidae Argiope FJ525365 FJ525402 FJ525383 FJ525332 FJ525347 x aurantia Araneidae Argiope EU00323 EU00338 EU15315 EU00327 savignyi 1 8 9 9 EU00338 EU00339 8 8 EU00339 8 Araneidae Artifex x x x x x x melanopyga RJKDNA025 Araneidae Artifex x x x x x x melanopyga RJKDNA026 Araneidae Artifex x joannae Araneidae Caerostris sp. KM48622 KM48628 KM48642 1230 3 3 6 Araneidae Caerostris sp. KM48622 KM48628 KM48613 KM48635 KM48642 1243 † 4 4 3 0 7 Araneidae Caerostris sp. KM48622 KM48628 KM48635 KM48613 KM48642 1248 5 5 1 4 8 Araneidae Chorizopes JN816751 JN816959 JN817165 nipponicus Araneidae Clitaetra KC84890 KC84911 KC84897 KC84898 KC84906 KC84902 episinoides 6 1 9 7 7 6 Araneidae Clitaetra thisbe KC84890 KC84911 KC84907 KC84902 9 4 0 9 Araneidae Cyclosa conica EU00323 EU00325 EU00334 EU15316 EU00328 EU00331 3 4 3 1 2 6 EU00340 1 Araneidae Cyrtarache KR25980 KR25980 nagasakiensis 2 2 Araneidae Cyrtophora FJ607451 FJ607486 FJ607525 FJ607560 FJ607599 moluccensis Araneidae Deliochus x x x x x x x zelivira Araneidae Deliochus x x x x x x x humilis

Araneidae Deliochus EU00323 EU00325 EU00334 EU15316 EU00328 idoneus 4 9 5 4 4 EU00340 4 Araneidae Deliochus x x x x x x x idoneus Araneidae Dolophones sp. x x x x x x Araneidae Eriophora x x x x x x ravilla Araneidae Eriophora x x x x x x transmarina Araneidae Eustala sp. FJ525353 FJ525390 FJ525372 FJ525320 FJ525339 Araneidae Herennia EU00323 EU00326 EU00338 EU00343 EU00328 EU00332 multipuncta 6 0 4 2 8 0 EU00338 EU00343 5 3 EU00338 6 Araneidae Gasteracantha EU00323 EU00325 EU00334 EU15316 EU00328 EU00331 x cancriformis 5 6 8 7 7 9 EU00334 EU00340 8 7 EU00334 EU00340 8 7 Araneidae Gnolus sp. KP27155 KP27162 JN010182 KP27175 1023 8 0 6 Araneidae Guizygiella KR52640 KR52644 KR52648 KR52657 KR52661 nadleri 3 1 4 7 6 Araneidae Hypsosinga KR25980 KR25980 pygmaea 3 3 Araneidae Larinioides EU00323 EU00325 EU00334 EU15316 EU00328 EU00332 x cornutus 7 0 9 8 9 1 EU00340 8 Araneidae Leviellus KR52640 KR52644 KR52648 KR52657 KR52661 inconveniens 5 3 6 9 8 Araneidae Levielleus KR52641 KR52646 KR52650 KR52659 KR52663 poriensis 9 0 3 6 2 Araneidae Levellus KR52641 KR52645 KR52649 KR52659 KR52662 stroemi 6 6 9 2 8 Araneidae Leviellus KR52640 KR52644 KR52648 KR52658 KR52661 thorelli 6 4 7 0 9 Araneidae Mangora EU00324 EU00325 EU00335 EU15317 EU00329 EU00332 x maculata 0 8 1 1 3 3 EU00341 1 EU00341 1 Araneidae Mastorphora FJ607458 FJ607495 FJ607534 FJ607569 FJ607607 phrynosoma Araneidae Mecynogea EU00324 EU00335 EU15317 EU00329 EU00332 x lemniscata 1 2 2 4 4 EU00341 2 Araneidae Metepeira EU00324 EU00325 EU00335 EU15317 EU00329 EU00332 x labyrinthea 2 3 5 5 7 7 EU00341 5 Araneidae Micrathena FJ525359 x gracilis Araneidae Milonia sp. H KR52640 KR52644 KR52648 KR52658 KR52662 8 6 9 2 1 Araneidae Neoscona EU00324 EU00325 EU00335 EU15318 EU00330 EU00333 arabesca 3 2 9 0 1 2 EU00335 EU00342 9 1 EU00335 EU00342 9 1 Araneidae Neoscona FJ525360 FJ525397 FJ525378 FJ525327 x crucifera

Araneidae Nephila KC84891 KC84912 KC84897 KC84899 KC84908 KC84904 x clavipes 8 4 0 8 1 0 Araneidae Nephila edulis KC84892 KC84912 KC84897 KC84900 KC84908 KC84904 x 1 6 2 1 3 2 Araneidae Nephilengys KC84893 KC84914 KC84895 KC84901 KC84909 KC84905 x malabarensis 4 0 9 4 9 5 Araneidae Nephilingis KC84913 KC84897 KC84901 KC84905 x cruentata 7 6 1 2 Araneidae Oarces sp. JN010171 JN010179 JN010193 JN010212 Araneidae Ordgarius AB91047 AB91050 AB82088 hobsoni 2 3 2 Araneidae Paraplectana AB91046 AB91049 AB54697 sakaguchii 5 6 6 Araneidae Paraplectanoid x x x x x es crassipes Araneidae Pasilobus AB91046 AB91050 AB91044 hupingensis 9 0 3 Araneidae Perilla teres KC84893 KC84905 KC84895 KC84901 7 8 3 7 Araneidae Phonognatha EU00324 EU00337 EU15318 x graeffei EU 5 9 3 EU00338 EU00342 0 6 EU00338 1 Araneidae Phonognatha FJ607469 FJ607508 FJ607543 FJ607582 FJ607620 graeffei FJ Araneidae Phonognatha * * * * graeffei GH Araneidae Phonognatha KC84893 KC84914 KC84894 KC84901 KC84910 KC84905 graeffei KC 8 3 4 8 3 9 Araneidae Phonognatha x x x x x x x melania RJKDNA002 Araneidae Phonognatha x x x x x melania RJKDNA003 Araneidae Phonognatha x neocaledonica Araneidae Phonognatha x x x x x x x tanyodon Araneidae Plebs astridae JN816542 JN816760 JN816969 JN817176 Araneidae Poltys sp. A KR52641 KR52645 KR52649 KR52659 5 4 7 0 Araneidae Spilasma x x x x x duodecimgutta Araneidae Verrucosa FJ525364 FJ525401 FJ525382 FJ525331 FJ525346 arenata Araneidae Yaginumia sia KR52641 KR52645 KR52650 KR52662 7 7 0 9 Araneidae Zygiella atrica KR52645 KR52650 KR52659 KR52663 8 1 4 0 Araneidae Zygiella dispar JF886866 Araneidae Zygiella KR52641 KR52645 KR52650 KR52659 KR52663 keyserlingi 8 9 2 5 1 Araneidae Zygiella KR52641 KR52645 KR52649 KR52658 KR52662 montana 2 1 4 7 6 Araneidae Zygiella GU68400 nearctica 1 Araneidae Zygiella sp. KR52641 KR52645 KR52649 KR52658 KR52662 3 2 5 8 7 Araneidae Zygiella x- EU00324 EU00325 EU00336 EU15318 EU00331 EU00334 x notata 8 1 7 7 1 1 EU00336 EU00343 7 1 EU00336 EU00343 7 1 Arkyidae Arkys cornutus FJ607448 FJ607482 FJ607521 FJ607556 FJ607595 x Arkyidae Archemorus sp. KM48621 KM48627 KM48612 KM48634 KM48647 1242 4 5 7 2 6

Deinopidae Deinopis sp. EU00324 EU00338 EU15316 x 9 2 3 EU00338 EU00340 3 3 EU00338 EU00340 3 3 Linyphiidae Linyphia EU00323 AY07866 EU00339 EU15317 EU00329 AY07870 x triangularis 9 4 0 0 2 2 EU00339 EU00341 0 0 EU00341 0 Mimetidae Australomimetu KP27153 KP27165 KP27172 KP27179 KP27185 s sp. 1115 0 3 8 8 5 Mimetidae Eros sp. 1092 KP27160 KP27166 KP27166 KP27173 KP27180 4 3 3 8 4 Mimetidae Gelanor KP27155 KP27167 KP27175 KP27181 KP27188 x insularis 2 8 0 7 1 Nicodamidae Oncodamus EU00327 EU00336 EU00343 EU00333 x bidens †† 4 0 6 5 Tetragnathidae Leucauge EU00323 FJ525356 EU00335 EU15316 EU00329 EU00332 x venusta 8 0 9 0 2 EU00340 9 Tetragnathidae Meta menardi KC84912 EU00335 EU15317 EU00329 EU00332 x 1 4 4 6 6 EU00341 4 Tetragnathidae Nanometa sp. EU00339 EU15317 EU00333 x 66 1 9 1 EU00342 0 Tetragnathidae Tetragnatha EU00324 EU00339 EU15318 EU00330 x versicolor 6 4 5 8 EU00342 9 EU00342 9 Theridiidae Steatoda EU00339 EU15318 EU00330 x borealis 3 4 7 EU00339 EU00342 3 8 EU00342 8 Theriodiosomatid Epeirotypus EU00327 EU00334 EU15316 EU00328 EU00331 x ae brevipes 3 7 6 6 8 EU00334 EU00340 7 6 EU00334 7 Uloboridae Uloboros EU00324 EU00336 EU00343 EU00331 EU00334 x glomosus 7 6 7 0 0 EU00336 EU00343 6 8 EU00336 EU00343 6 9 † Caerostris morphology information arbitrarily appended to this taxon for total evidence analysis †† Morphological coding supplemented by Ambicodamus sp. following Álvarez-Padilla et al. (2009).

sequences were culled from GenBank (Arnedo et al. 2004; Agnarsson and Blackledge,

2009; Álvarez-Padilla et al,. 2009; Blackledge et al., 2009; Kuntner et al., 2009; Kuntner

et al., 2013; Tanikawa et al., 2014; Gregorič et al., 2015; Dimitrov et al., 2016; Jang and

Hwang, unpubl. data).

Parsimony Analyses

Static homology analyses of morphological data were conducted using TNT

(Goloboff et al. 2004; Goloboff et al. 2008). Traditional and new technology searches were performed on the 42 taxon by 235 character matrix (coded specimens marked with an ‘x’ in Table 3). These taxa were culled from the studies of Kuntner et al. (2008) and

Álvarez-Padilla et al. (2009), with additional morphological coding of members of

Phonognatha, Deliochus, Artifex, and Zygiella. A summary of morphological characters examined can be found in the appendix. A total of 1,000 Wagner tree builds were searched for the traditional analysis, with subsequent subtree pruning and regrafting

(SPR) and tree bisection and reconnection (TBR) branch rearrangement methods were applied. Bootstrap, jackknife, and Bremer support methods of resampling were used to evaluate nodal support. Morphological data for Caerostris from Kuntner et al. (2008) was arbitrarily assigned to sequence data associated with Caerostris sp. 1243, and

Nicodamidae is a composite following Álvarez-Padilla et al. (2009). One of the

conspecific sequenced Phonognatha, Deliochus, and Artifex was arbitrarily assigned

morphological and behavioral data. Character state changes were be mapped onto the

total evidence tree using Winclada (Nixon, 1999) and examined under unambiguous and

ambiguous (ACCTRAN and DELTRAN) optimizations.

Model-based Analyses

Specimens used in this study are presented in the appendix, including locality and

voucher information. Specimens preserved in 95% ethanol were used for DNA extraction

using the Qiagen DNEasy kit. Left legs were used for extractions and the remainders are

preserved as vouchers. Six markers were amplified for analyses. These are mitochondrial

ribosomal markers 12S rRNA (~400 bp) and 16S rRNA (~550 bp), ribosomal markers

18S rRNA (~1800 bp) and 28S rRNA (~2700 bp), nuclear protein-coding gene histone

H3 (~327 bp), and mitochondrial protein-coding gene cytochrome c oxidase subunit I, or

COI (~800 bp). PCR was completed using the Promega GoTaq kit using the primers in

Table 4. The generalized thermocycle was initial denaturation at 94 °C for 2 minutes,

followed by a cycle of denaturation at 94 °C for 30 seconds, annealing at 40-56 °C for 35

seconds (see details following), and elongation at 65 °C for 30 seconds repeated 34 times,

with a final elongation step at 72 °C for 3 minutes, followed by cooldown for 10 °C for

30 minutes, then held at 4 °C. Annealing temperatures were started at the following

temperatures, then modified up or down by 2 °C to achieve clean, thin bands on a 1.5%

agarose gel: 12S (46-48 °C), 16S (46-48 °C), 18S (48-52 °), 28s (48-52 °C), COI (40-48

°C), and H3 (53-56 °C). Amplified products were sent to Macrogen USA in Rockville,

MD for sequencing. Contigs were formed using Geneious 6.0.6

(http://www.geneious.com, Kearse et al. 2012), then queried against NCBI BLAST nucleotide database to check for contamination.

Table 4. Primers used for this study.

Marker Direction Primer Sequence (5’3’) Reference 12s forward 12S-ai AAACTAGGATTAGATACCCTATTAT Köcher et al. (1989) 12s reverse 12S-bi AAGAGCGACGGGCGATGTGT Köcher et al. (1989) 16s forward 16S-A CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 16s reverse 16S-B CTCCGGTTTGAACTCAGATCA Palumbi et al. (1991) 18s1 forward 18S-1F TACCTGGTTGATCCTGCCAGTAG Giribet et al. (1996) 18s1 reverse 18S-5R CTTGGCAAATGCTTTCGC Giribet et al. (1996) 18s2 forward 18S-4F CCAGCAGCCGCGCTAATTC Giribet et al. (1996) 18s2 reverse 18S-7R GCATCACAGACCTGTTATTGC Giribet et al. (1996) 18s3 forward 18S-a2.0 ATGGTTGCAAAGCTGAAA Whiting et al. (1997) 18s3 reverse 18S-9R GATCCTTCCGCAGGTTCACCTAC Giribet et al. (1996) 28s1 forward 28S-rd1a CCCSCGTAAYTTAGGCATAT Crandall, Harris, & Fetzner Jr. (2000) 28s1 reverse 28S-Rd4b CCTTGGTCCGTGTTTCAAGAC Crandall, Harris, & Fetzner Jr. (2000) 28s2 forward 28S-A GACCCGTCTTGAAGCACG Whiting et al. (1997) 28s2 reverse 28S-B TCGGAAGGAACCAGCTACTA Whiting et al. (1997) 28s3 forward 28S-Rd4.8a ACCTATTCTCAAACTTTAAATGG Whiting (2002) 28s3 reverse 28S-Rd7b1 GACTTCCCTTACCTACAT Whiting (2002) COI forward LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COI reverse HCOout CCAGGTAAAATTAAAATATAAACTTC Carpenter & Wheeler (1999) COI forward SL-F CTGCTATAGTTGGAACAGCTATAAG da Silva-Moreira & Hormiga (in prep) COI reverse SL-R AAATGAGCTACTACATAATAAGTATCATG da Silva-Moreira & Hormiga (in prep) H3 forward aF ATGGCTCGTACCAAGCAGACVGC Colgan et al. (1998) H3 reverse aR ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998)

Multiple sequence alignments were completed using MAFFT v7.017 (Katoh and

Standley 2013). Alignments of 12S and 16S were completed using L-INS-i, ideal for samples with a single conserved domain. For 18S and 28s, the E-INS-i method was used, which is used to account for missing fragments. The protein-coding genes COI and H3 were aligned using MACSE (Ranwez et al. 2011), which can detect frameshifts and stop codons in alignments. To account for missing data and poor alignment, trimAl v1.2 was used with the gappyout setting (Capella-Gutierrez et al. 2009). The concatenated molecular sequence matrix consisted of 6,028 bp.

The maximum likelihood analysis was conducted using RAxML 8.2.8

(Stamatakis 2014) on CIPRES (Miller et al. 2011). A total of 93 taxa with molecular sequence data were included. Partition schemes were tested using PartitionFinder 1.1.1

(Lanfear et al. 2012), with 10 possible partitions: four non-protein coding markers (12S,

16S, 18S, 28S) and two protein-coding markers (COI, H3) further partitioned by codon

position. The rapid bootstrapping algorithm option to find a single best-scoring tree with the GTRGAMMA model was used. Bootstrap iterations were set to 1,000. The root was set as Uloborus glomosus (Uloboridae).

Relaxed clock Bayesian analyses were conducted using MrBayes 3.2.6 (Ronquist and Huelsenbeck 2003) on the high performance cluster Colonial One at The George

Washington University. A molecular matrix of 93 taxa and a total evidence matrix including 95 taxa (two additional Phonognatha that could not be sequenced) were analyzed. As in the maximum likelihood analysis, PartitionFinder 1.1.1 (Lanfear et al.

2012) was used on the molecular partitions; the morphological partition was analyzed using the Mk model (Lewis 2001). We used the fossilized birth-death prior for under sampled lineages sampled for diversity, and the independent gamma rates model with broad speciation priors (exp[10]), extinction (beta[1,1]), and fossilization (beta[1,1]) following Zhang et al. (2015) and Pyron (2017). The tree age prior is set to 175–200 mya based on analyses by Dimitrov et al. (2016). The clock rate prior is set by log normalizing the estimated substitution rate of cytochrome c oxidase I (Bidegaray-Batista and Arnedo 2011). A total of 16 chains (4 cold, 12 heated) were run for 100 million generations, with the first 25% discarded as burn-in. Convergence was considered achieved when estimated sample sizes (ESS) were below 100 and traces from log files examined in Tracer v1.6 (Rambaut et al. 2014) were plateaued. The early fossil record of many orb-weaving spider clades is sparse, and interpreting the fossils described so far is difficult due to quality of preservation. There are two fossils currently described as early araneids: Mesozygiella dunlopi Penney & Ortuño, 2006, and Olindarachne martinsnetoi

(Downen, 2011), both from the late Aptian Age (115–121 myr). Nevertheless, the

placement of these taxa as araneids seems somewhat tenuous, at least in part due to the

synapomorphies allowing attribution to Araneidae being very limited (e.g. Coddington

1986; Dimitrov et al. 2016). Therefore, despite the strengths of additional calibrations, we have opted to calibrate solely based on the substitution rate rather than introduce uncertainty from incorrect fossil placement. Trees were rooted as in maximum likelihood analyses.

Biogeography

The R package BioGeoBEARS was used for ancestral range estimation as it includes a framework for comparison of various models of biogeography (Matzke, 2013).

This method allows for modeling using the LAGRANGE DEC model (Ree and Smith,

2008) and maximum-likelihood approximations of DIVA (Ronquist 1997) and BayArea

(Landis et al. 2013). These biogeographic models have various strengths and weaknesses:

DEC has parameters for dispersal and extinction that may change at cladogenetic events

(Ree and Smith, 2008; Matzke, 2014); DIVALIKE approximates the parsimony effects of

DIVA (Ronquist, 1997), namely dispersal and vicariance; BAYAREALIKE (Landis et al., 2013), which is suited to broad sympatry. Furthermore, BioGeoBEARS implements another free parameter, j, which is designed for ‘jump’ speciation, or a founder effect from colonization from a main population. The j parameter can be applied to each of the three biogeographic models, allowing for six possible configurations for comparison which were applied to the time-calibrated total evidence results from MrBayes.

Seven areas were allocated for the 20 zygielline taxa included in this study;

species represented by more than one terminal were culled to one. These are Palearctic

(P), Nearctic (N), Indomalayan (I), New Caledonia (C), Queensland north of the St.

Lawrence Gap (Q), eastern Australia south of the St. Lawrence Gap (S), and Western

Australia (W). The first three areas represent biogeographic realms, and the latter four are

more specific to Australia and New Caledonia, and have been informed by prior studies

of biogeography (including spiders) in the area (Crisp et al. 2004; Rix and Harvey 2013).

Queensland north of the St. Lawrence Gap (Q) represents tropical wet forests that

sometimes have a distinct fauna from more temperate forests to the south (S) and is

thought to be biologically relevant since the early Tertiary Period. The appearance of the

Nullarbor Plain is thought to occur during the early Miocene, and could be a viciarance

event separating Western Australia (W) from the southeast (S). The 20 zygielline taxa

were coded as present or absent for each of these areas based on material examined for

the taxonomic revision. Additionally, a dispersal matrix approximating relative

probability of movement between two areas was also applied, with intercontinental

dispersal coded as less likely (0.1) than intracontinental dispersal (1.0). The nested

models (with and without the founding parameter j) were compared using likelihood ratio

tests. AIC scores were calculated for comparison of the six models.

Retreat evolution

A total of 89 unique species in the total evidence data matrix were coded based on the retreat form used by that species. The terminal taxa were coded in one of the following five character states based on our own observations or literature records: no

snare web (e.g., Arkyidae, Mimetidae), snare web and no retreat (e.g., most

tetragnathids), web with adjacent retreat (typically composed of leaves modified with

silk, Fig. 13E), web with integrated leaf retreat (Fig. 12A, 13A-B), and web with

integrated detritus retreat (Fig. 13C-D). This is a modification of the analysis of Gregorič et al. (2015), who broadly classify all retreats relatively complex retreats as silk tubes.

We divided the silk tube class further, and decided to include relatively simple leaf-

curling as a retreat adjacent to the web, to better examine the variation of retreats within

Araneidae. It must be emphasized retreat type can vary within genera, and the coding is

for the specifically sampled taxon.

The ultrametric tree from the total evidence analysis was analyzed in R (R Core

Team, 2015) using the packages ape (Paradis et al. 2004), phytools (Revell 2012), and

geiger (Harmon et al., 2007). Three discrete character likelihood models were applied:

equal transition rates between all states (ER), equal symmetric transition rates between

two states that differ from a different relationship between two states (SYM), and

different rates for each state, where each rate is parameterized separately (ARD). This

was carried out using the rerootingMethod and fitMk functions in phytools, and results

were scored using AIC. The best scoring model was used to perform an ancestral state

reconstruction on web retreats using stochastic character mapping using the phytools

function make.simmap. The time-calibrated total evidence tree from the Bayesian

analysis was overlaid with 1,000 stochastic character maps from the posterior distribution

(nsim=1000, q=“mcmc”), allowing a probability at each node for the

likelihood of the five retreat codings, to be represented by a pie chart.

Results

Parsimony Analyses

The parsimony analyses of morphological data, using both traditional and new

technology searches, resulted in the same four optimal topologies of 681 steps (the strict

consensus is presented in Fig. 15). The consistency index of these trees is 0.372, and the

retention index is 0.623. Araneidae is monophyletic. Zygiellinae is paraphyletic with

respect to Nephilinae. Deliochus is well supported as monophyletic without internal

resolution. Artifex n. gen. (previously P. melanopyga + P. joannae) is supported as sister to Deliochus, rendering Phonognatha paraphyletic as currently circumscribed. The other

Phonognatha species are, as Deliochus, supported as a clade but unresolved within.

Outside zygiellinae, non-congeneric relationships receive little support.

Model-based Analyses

The best partition scheme limited to RAxML-compatible models resulted in eight partitions, with 12S and 16S combined, and the first two codon positions of histone 3 combined (Table 5). All resulting partitions were run with GTR+G. In the MrBayes- compatible run, 12S and 16S were combined only, using GTR+I+G+I. The partition for

28S also used GTR+G+I. The model HKY+G+I was used for all codon positions of cytochrome c oxidase I, SYM+G was used for histone 3 positions 1 and 3, SYM+G+I was used for 18S, and JC+G was used for histone 3 position 2. Though a more

parameter-rich GTR model was suggested for cytochrome c oxidase I, poor estimated

sample size values for those partitions in early runs were detected, which are sometimes

associated with issues related to the Jeffreys prior, for which the general solution is

reducing parameterization (A. Rambaut, pers. comm.).

The summary of the maximum likelihood analysis of the molecular partition,

Bayesian analysis of the molecular partition, and total evidence Bayesian analysis are presented in Figure 16. Monophyly of Araneidae is highly supported in all analyses

(bootstrap = 94; posterior probability = 1). The monophyly of Phonognatha and

Deliochus within the zygielline araneids is also highly supported (bootstrap = 99; posterior probability = 1). Most clades within Phonognatha, Deliochus, and Artifex are

Table 5. Optimal partitions for model-based analyses.

Analysis Length (bp) Partition & length (bp) Model RAxML (molecular) 6028 12s + 16s (792) GTR+G 18s (1674) GTR+G 28s (2830) GTR+G COI, pos. 1 (399) GTR+G COI, pos. 2 (399) GTR+G COI, pos. 3 (399) GTR+G H3, pos. 1 + 2 (218) GTR+G H3, pos. 3 (109) GTR+G MrBayes (molecular) 6028 12s + 16s (792) GTR+G +I 18s (1674) SYM+G+I 28s (2830) GTR+G+I COI, pos. 1 (399) HKY+G+I COI, pos. 2 (399) HKY+G+I COI, pos. 3 (399) HKY+G+I H3, pos. 1 (109) SYM+G H3, pos. 2 (109) JC+G H3, pos. 3 (109) SYM+G MrBayes (combined) 6263 morphology (235) Mk (others as molecular only)

Figure 15. Result of strict consensus of four most parsimonious trees based on morphological and behavioral partition; length = 681, consistency index = 0.372, retention index = 0.623. Bootstrap values ≥ 50 presented above branches; jackknife ≥ 50 presented below branches; Bremer support presented intersecting branches.

Figure 16. Summary of results of maximum likelihood analysis of molecular partitions, Bayesian inference analysis of molecular partition, and total evidence analysis using Bayesian inference. Navajo rugs correspond to those analyses, respectively. Green represents good support (bootstrap ≥ 70 or posterior probability ≥ 0.95); red represents poor support (bootstrap < 70; posterior probability < 0.95); grey represents a clade not found in that analysis. Zygiellinae and some other ‘classically recognized core lineages’ (see text) are highlighted.

Figure 17. Results of rate-calibrated total evidence Bayesian inference analysis. Horizontal node bars represent 95% credibility intervals for node age estimates.

supported with bootstrap > 90 and posterior probability ≥ 0.95. As in the morphological

analysis, Phonognatha including A. melanopyga is paraphyletic. The main difference within Australasian zygiellines was the placement of Artifex as sister to both

Phonognatha and Deliochus in molecular partition only analyses, and Artifex placed as sister in Deliochus, which are both in turn sister to Phonogantha, in analyses including morphological and behavioral data. Zygiellinae is sister to all other araneids, followed by

Caerostris, Paraplectanoides crassipes, and Nephilinae. Most relationships with good

support were found to be similarly supported in the three analyses. Rate-calibrated analysis with 95% credibility intervals is presented in Figure 17. Character state changes in relevant clades in the total evidence topology are outlined in Table 6.

Biogeography

Model testing results for historical biogeography of zygiellines is found in Table

7. The DIVALIKE model without a jump parameter received the best AIC score, and is modeled in Figure 18. Reconstructions were largely the same across analyses, regardless

Table 6. Unambiguously optimized synapomorphies of relevant clades. ACCTRAN in bold. DELTRAN in italics. Clade Synapomorphies Araneidae 29: 0>1, 87: 0>1 Zygiellinae 15: 1>0, 25: 0>3, 122: 0>1, 216: 0>1; 233: 0>1 Australasian Zygiellinae 11: 0>1, 37: 0>1, 50: 0>1, 107: 1>0, 125: 1>0, 163: 1>0, 173: 0>1, 177: 0>1; 111: 0>1; 233: 1>2 Artifex + Deliochus 89: 0>1, 106: 0>1, 128: 0>1, 149: 1>0, 162: 0>1, 196: 0>1, 229: 0>1; 112: 0>1; 113: 0>2 Artifex 53: 0>2, 58: 0>1, 76: 0>1, 108: 1>0 Deliochus 93: 0>1, 186: 0>1, 233: 2>1 Phonognatha 76: 0>1, 104: 0>1, 133: 0>1, 183: 0>1, 207: 0>1

81 of biogeographic model implemented. There is a high likelihood of a Holarctic-

Indomalayan split from the Australasian regions, without any likelihood of crossing between those regions subsequently. Colonization of New Caledonia by Artifex was likely from Queensland north of the St. Lawrence Gap, while colonization by

Phonognatha was more likely from south of the St. Lawrence Gap. Both colonization events occurred after 37 myr. Deliochus species were all widespread prior to the appearance of the Nullarbor Plain (~24 myr) but after the St. Lawrence Gap (51–34 myr).

Phonognatha diverged around the time of the St. Lawrence Gap, but largely prior to the

Nullarbor Plain.

Figure 18. Results of ancestral range estimation of ingroup taxa using BioGeoBEARS under the most likely model (DIVALIKE). Scale is in millions of years. Abbreviations: P = Palearctic, N = Nearctic, I = Indomalayan, W = Western Australia, Q = Queensland (north of Gap of St. Lawrence), S = Eastern Australia (south of gap of St. Lawrence, mostly New South Wales), C = New Caledonia.

Table 7. BioGeoBEARS analysis results. Significant p-values in bold. Model LnL df D (LRT) p-value (LRT) AIC DEC -46.25 2 96.50 DEC+J -45.20 3 2.09 0.15 96.40 DIVALIKE -45.72 2 95.44 DIVALIKE+J -45.47 3 0.51 0.48 96.93 BAYAREALIKE -48.67 2 101.34 BAYAREALIKE+J -45.71 3 5.92 0.015 97.42

Figure 19. Results of ancestral state reconstruction of retreats, summarizing 1000 SIMMAP character maps based on dated total evidence analysis found in Figure 17. Colors represent retreat types; pie charts represent probabilities of those retreat types. Scale is in millions of years.

Retreat evolution

The symmetric model of character evolution (SYM) was selected based on its

AIC. This low parameter model was fitted to the phylogeny using make.simmap. The log

likelihood for ER, SYM, and ARD were -81.21, -83.97, and -93.42, respectively. The

AIC scores for those models were 202.41, 187.95, and 188.84, respectively. These results are presented in Figure 9. These results show Zygiellinae had an early likelihood of a retreat adjacent to the retreat, and subsequent evolution of integrated retreats in the genera Phonognatha and Artifex. Integrated retreats evolved in two other disparate groups: Araneus dimidiatus and Acusilas. Use of other material for an integrated retreat was used in Metepeira and Spilasma, which are not closely related to one another.

Discussion

Systematics

Molecular and total evidence analyses support the monophyly of Zygiellinae and paraphyly of Phonognatha. Based on the supports from the various analyses, we establish the genus Artifex. Moleular and total evidence analyses suggest Zygiellinae includes five genera: Phonognatha (Figs. 20A, 21-35), Deliochus (Figs. 20B, 36-47), Artifex (Figs.

20C, 48-54), Zygiella (Fig. 55), and Leviellus. Though we did not specifically set out to outline the morphological characters that delimit Zygiellinae, among examined species, zygiellines are characterized by unambiguous parsimony optimization on the total

84 evidence tree for the following characters: rugose patch in the piriform field of the ALS

(122), a divergent PLS triad with the flagelliform gland spigot being closer to the cylindrical than to the aggregate gland spigots (120), medially light sternum (25), and secondary split radii (216). Some of these characters are also found in Nephilinae, with the exception of more tightly arrangement (but not embracing) of the PLS triad. The

Australasian clade including Phonognatha, Deliochus, and Artifex is further characterized by females with anterior median eyes on a slight tubercle (11), femur I sigmoid in shape

(37), loss of sustentaculum (50) and median apophysis (163), epiandrous fusules not in pits (125), and by having the embolus coiled with the conductor (173). ACCTRAN optimizations suggest that the web adjacent retreat (233) evolved as a zygielline trait, was lost in the Australasian clade, and subsequently regained in Deliochus. Character optimization under DELTRAN suggests that an integrated leaf retreat evolved in the

Australasian clade and that the web adjacent retreat evolved independent in Zygiella and

Deliochus.

The optimal topologies under different tree inference methods and/or data matrices differ with respect to the three genera of interest. The parsimony analysis of morphology and behavior using TNT place Phonognatha as sister to Deliochus + Artifex, while the analyses including sequence data suggest that Artifex is sister to Phonognatha +

Deliochus. It is unclear whether the morphological similarity of the Deliochus + Artifex clade is a product of secondary changes in Phonognatha or synapomorphy. Unambiguous synapomorphies for Phonognatha after the total evidence analysis includes spot-like abdominal dorsal markings (76), coiled copulatory ducts within a capsule (104,105), cheliceral dimorphism with males’ being larger (133), curved tip of conductor (183), and

presence of a barrier web (207). The monophyly of Deliochus plus Artifex is supported

by an epigynal septum (89), sclerotization of the copulatory ducts (106), copulatory

openings sometimes plugged (112), sexual size dimorphism with smaller males (128),

loss of paracymbium (149), embolic hooks (196), subtegulum larger than tegulum in ectal

view (158), embolus with pars pendula associating sperm duct and sclerotized shaft

Figure 20. Schematic illustration of palps of species of Australasian zygielline genera. A, P. graeffei. B, D. humilis comb. nov. C. A. melanopyga comb. nov.

(162), and eunuchization including detached bulbus of the pedipalp (229). Deliochus is supported by the following synapomorphies: paired epigynal flaps near copulatory openings (93), and a thicker, moderately long embolus (186). Artifex is supported by the following synapomorphies: abdomen growing wider posteriorly (53) and extending beyond spinnerets in females (58), ring-like dorsal markings (76), and wide spermathecae separation (108).

The remainder of Zygiellinae remains largely unchanged from Gregorič et al.

(2015) save the placement of Zygiella sp. from Taiwan as sister to all other Zygiella rather than Z. atrica, Z. keyserlingi, and Z. atrica. Their placements, as well as the placement of Z. nearctica, lead those authors to synonymize Zygiella and Parazygiella

(in which Z. dispar and Z. montana were previously placed). Dondale et al. (2003) removed Z. nearctica from synonymy with Z. dispar, but the former was conspicuously absent from ‘Zygiellidae’ as explained by Wunderlich (2004). Given the description of Z. nearctica according to Wunderlich, Z. nearctica should have also been a member of

Parazygiella. Therefore, except for the weakly supported, unidentified zygielline from

Taiwan, Parazygiella and Zygiella would have been monophyletic, rendering their synonymy in Gregorič et al. (2015) superfluous but taxonomically coherent.

All analyses resulted in a monophyletic Araneidae (including both zygiellines and nephilines), but diagnosing Araneidae with morphological features remains elusive. The presence of a chilum is the only synapomorphy, which has been secondarily lost in

Clitaetra among the sampled taxa (see Table 6). Phonognatha, Deliochus, and Artifex lack the typical araneid radix and the sustentaculum, both thought to be araneid synapomorphies by Scharff and Coddington (1997), though both are present in Zygiella.

This suggests secondary loss of these characters in that clade. Kuntner et al. (2008) posited the sustentaculum of nephilines as convergent rather than homologous with that of araneids, which ran counter to previous studies (Dahl 1912; Hormiga et al. 1995;

Scharff and Coddington, 1997). Recent studies placing nephilines as sister to non- zygielline araneids (as presented here) or sister to zygiellines (Dimitrov et al. 2016) do not warrant a convergent sustentaculum and indeed provide support of its use as a

putative synapomorphy despite its loss in Phonognatha, Deliochus, Artifex, Micrathena,

and Chorizopes, among possible others.

Although an overarching examination of the relationships within Araneidae is not

part of the scope of this study given the sheer number of species therein, certain

observations can be made about the supported relationships. The bizarre Australian genus

Paraplectanoides is supported as the sister group of Nephilinae, as already pointed out by

Framenau et al. (2014, p. 154), based on the ongoing phylogenetic studies of Nikolaj

Scharff and collaborators. Paraplectanoides does not share many morphological features

with nephilines, as currently delimited by Kuntner et al. (2008), or any other araneid lineages for that matter. In the molecular and total evidence analyses, Caerostris,

Oarcinae, Verrucosa + Micrathena, and Spilasma diverge from the backbone successively prior to the rest of Araneidae. This has been observed to different degrees in

Gregorič et al. (2015) and Dimitrov et al. (2016), with the addition of Spilasma here.

With the exception of Caerostris and its sister araneids, all of these clades have high nodal support (both bootstrap and posterior probabilities). Further ‘major’ splits garner little support, but some intra- and intergeneric relationships are strong.

In the molecular and total evidence analyses, Mangora and Poltys are sisters (not supported in Gregorič et al. 2015), as are Neoscona and Metepeira (also supported in

Dimitrov et al. 2016). The subfamily Cyrtarachninae (Cyrtarachne + Pasilobus +

Paraplectana) is supported as sister to Mastophorinae (Mastophora + Ordgarius) in a reduced snare web clade, which is in turn supported as sister to Neoscona + Metepeira.

Araneus is polyphyletic, which is a previously described issue (e.g., Framenau, 2010).

For this reason, Araneinae remains elusive as its members (as morphologically and

behaviorally placed based on Scharff and Coddington 1997) are disparately placed in the

phylogeny. Araneus itself is one of the worst offenders and its revision will require

extensive study to parse. Nearctic Araneus are closely related to Hypsosinga, which is in

turn sister to the Asian sector web araneids analyzed by Gregorič et al. (2015), including

Milonia, Yaginumia, and Guizygiella, as well as Perilla.

Asian ‘Araneus’ and ‘Eriophora’ form a well-supported clade with Plebs,

Cyclosa, Dolophones, Chorizopes, and Gasteracantha. True Eriophora, represented by the type species E. ravilla, is closely related to Eustala and Acanthepeira; this pattern is not unlike the non-monophyly observed in Araneus. Cyrtophorinae (Cyrtophora +

Mecynogea) along with Argiope, Arachnura, and Acusilas form a well-supported clade, which corroborates previous studies on these groups (Cheng and Kuntner 2014; Gregorič et al. 2015).

Dated phylogeny and biogeography

The total evidence, time-calibrated analysis is presented in Figure 17. Araneidae is dated at 144.7 (111.9-178.9) mya, Zygiellinae is dated at 111.2 (76.3-147.7) myr, and the Australasian zygiellines are dated at 70.6 (45.4-100.0) myr. These dates are congruent with the fossil calibrated BEAST analysis of Dimitrov et al. (2016). The two New

Caledonian taxa examined, P. neocaledonica and A. joannae, colonized New Caledonia at approximately the same time: 20.2 (12.6-31.6) myr and 21.7 (13.7-32.7) myr, respectively. Neither is in conflict with appearance of New Caledonia as habitable at approximately 37 myr (Grandcolas et al. 2008). This is consistent with the dated

phylogeny and subsequent BioGeoBEARS analysis presented in Figure 7, which place

the colonization of the island by both A. joannae and P. neocaledonica at approximately

20 myr. The relatively recent colonization by the zygiellines of the island does not support or fail to support the results of Sharma and Giribet (2009) theorizing the island was habitable prior to 37 myr.

Interestingly, the biogeographic analysis supports colonization of New Caledonia from both the north and south of the geographic divide, the St. Lawrence Gap. This area is thought to be the zone where the tropical, northern Queensland forests meet the subtropical forests that extend into New South Wales, and has been important biogeographically in the distribution of taxa, including spiders (Webb and Tracey 1981;

Moussalli et al. 2005; Baker et al. 2008; Rix and Harvey 2013). A. melanopyga is found almost exclusively north of this zone, but P. tanydon – the putative sister of P. neocaledonica – is found south of that dry corridor. This suggests a degree of adaptability from both tropical and subtropical colonizers from the mainland to New Caledonia.

While Artifex can cross the 1,300 kilometers of open sea to New Caledonia, it does not seem it can survive in the subtropical and temperate climes south of the St.

Lawrence Gap, and is likey specialized to a tropical habitat. Phonognatha, likewise,

seems more dominant in subtropical and temperate habitats. Deliochus appears to be able

to adapt to tropical, subtropical, and temperate climates. Based on the total evidence

phylogeny, all three genera seem to have diverged prior to Australia rifting from

Antarctica and subsequent aridification occurring at approximately 32 mya. It also

suggests that traversing the Nullarbor Plain is regular enough to not cause speciation at

approximately 24 myr, as observed in other arachnids (e.g, Rix and Harvey, 2013).

However, the only species of Phonognatha or Artifex found west of the Nullarbor Plain is

P. melania, with suggests a degree of isolation by the Nullarbor. This desert area is a known barrier to dispersal between temperate southwestern and eastern Australia leading to endemicity in arachnids (Rix and Harvey 2013; Giribet et al. 2016; Rix et al. 2017;

Harvey et al, 2017) and other taxa (Barendse 1984; Cracraft 1986; Hopper and Gioia

2004; Morgan et al. 2007; Schultz et al. 2009; Heads 2013; Rix et al. 2015). Based on the models of historical biogeography tested in Rix et al. (2015), some species may be susceptible to a form of east-west vicariance, but others (the above taxa) are more able to reliably cross.

In particular, the presence of Deliochus east and west of the Nullarbor Plain as well as north and south of the St. Lawrence Gap, which formed during the Eocene, suggests neither the different in climates nor the dry corridor itself is a sufficient geologic boundary to limit its range or incur speciation. Therefore, Deliochus appears to be the hardiest survivor among the three genera, at least over land-based boundaries.

Anthropogenic effects may also be a culprit, given at least some zygiellines are common in human-modified habitats, and are pragmatic synanthropes (e.g., Phonognatha use man-made detritus for retreats). An analysis of populations of zygiellines with expansive and limited ranges may provide greater granularity on the structure of those distributions.

Retreat evolution

The use of a leaf retreat was not found in the non-araneid outgroups studied, and approximately half of the araneids sampled have a retreat of some kind. The retreat was

91 entirely lost in Oarcinae, though some other species without a typical intercept web (e.g.,

Cyrtarachne) make a retreat. The web adjacent retreat occurs in numerous places in the tree, and ranges in complexity from a weakly curled leaf near an acnchor thread to fairly elaborate silk tube. In the sampled taxa, using an integrated leaf retreat seems to have evolved independently at least three times: in the Australasian zygielline clade (and subsequently lost in Deliochus), in Acusilas, and Araneus dimidiatus. Within these clades, there are shades of difference in the integrated leaf curl. In Phonognatha and

Artifex, the leaf is normally coiled lengthwise into a helical shape, placed at the hub, and the orb above the hub is incomplete. The web is folded widthwise for the female’s eggsac. The webs of Acusilas is similar (Fig. 13B) as it has a leaf placed at the hub, though it seems to fold the leaf lengthwise and bond it with silk and complete more of the orb above the hub and leaf (Schmidt and Scharff 2008). Araneus dimidiatus is quite different from both as it places its leaf curl in the web just above the spiral of the completed orb. A. dimidiatus also has similar coloration as some Phonognatha and its relatives (reddish brown prosoma; tan abdomen with dark dorsal markings; see Fig. 13F), leading to numerous cases of mistaken identy. A specialization using detritus in an integrated retreat is found in Spilasma and Metepeira (Levi 1977; Levi 1995) as well as

Nemoscolus. Given the differences between their retreats and those of a leaf, we have opted to code them differently despite dissimilarities from each other. The use of detritus to form a stony, caddisfly pupae-like retreat of Spilasma duodecimguttata (Fig. 13D) seems a singular retreat modification, though even this unique structure may have evolved multiple times (unpubl. data). The web of Metepeira labyrinthea (Fig. 13C) features a dense confluence of silk that is decorated, supported, or otherwise integrated

92 with detritus that the spider will retreat to when disturbed. This reinforces the theory that constructing a relatively complex integrated retreat has evolved independently multiple times. Given its seemingly stochastic appearance in the sampled taxa, adding additional species to this analysis would be particularly interesting as differences in retreats are present within genera and between closely related genera.

Anatomical Abbreviations

A, accessory gland; AC, aciniform gland spigot; AG, aggregate gland spigot; ALS, anterior lateral spinneret; AME, anterior median eyes; BH, basal hematodocha, C, conductor; CO, copulatory opening; CY, cylindrical gland spigot; Cy, cymbium; E, embolus; EB, embolic base; EF, epigynal flap; FD, fertilization duct; FL, flagelliform gland spigot; MAP, major ampullate gland spigot; mAP, minor ampullate gland spigot;

MCP, mid-conductor process; P, paracymbium; PI, piriform gland spigot; PLS, posterior lateral spinnerets; PME, posterior median eyes; PMS, posterior median spinnerets; S, spermatheca; ST, subtegulum; T, tegulum.

Institutional Abbreviations

AM, Australian Museum, Sydney, Australia; CAS, California Academy of Sciences, San

Francisco, USA; MCZ, Museum of Comparative Zoology, Cambridge, USA; NHMUK,

Natural History Museum, London, United Kingdom; NMV, National Museum of

Victoria, Melbourne, Australia; QM , Queensland Museum, Brisbane, Australia; TMAG,

Tasmanian Museum and Art Gallery, Hobart, Australia; USNM, National Museum of

Natural History, Smithsonian Institution, Washington, DC, USA; WAM, Western

Australian Museum, Perth, Australia; ZMUH, Universität von Hamburg, Zoologisches

Institut und Zoologisches Museum, Hamburg, Germany.

Geolocations

Locations from labels are transcribed where possible. Coordinates estimated from non-

coordinate label data are marked with an asterisk (*).

Taxonomy

Araneidae Clerck, 1757

Phonognatha Simon, 1894

Type Species: Epeira graeffei Keyserling, 1865

Singotypa Simon, 1894. Dondale 1966

Diagnosis

Phonognatha can be distinguished from other araneids based on the following combination of characters: their typical abdominal color pattern (dark brown on paler

area including guanocytes) in both sexes; a rugose area on the posterior margin of the

ALS (Fig. 21A, arrow); one flagelliform spigot of triad closer to a cylindrical gland

spigot than aggregate gland spigots (Fig. 21C). Males with elongated conductor in which

the embolus lies in a groove, recalling a tetragnathid or nephiline palp rather than a

typical araneid, conductor with a process pointing apically near center of palp, and lack

of a median apophysis, as Deliochus and Artifex (Fig. 20). Females can be identified

based on the epigynum with two ventral copulatory openings without a scape, lobed

spermathecae, and a capsule containing a helically curved copulatory duct (Fig. 21D,

22E-G). Specifically, male Phonognatha can be diagnosed from Deliochus and Artifex

based on its longer cheliceral fangs (Fig. 22B, 35B vs. Figs. 39B, 51B), the absence of

epigynal flaps (present in Deliochus), and presence of an epigynal capsule bearing its coiled copulatory ducts (also absent in the latter two genera; Figs. 26F-G).

Description

Female: Total length 7.48-11.63. Carapace 3.25-4.28 long, 1.99-3.03 wide, 0.92-1.44

high, yellowish brown to reddish brown, sometimes with pars cephalica and carapace

margins slightly darker than pars thoracica. AMEs on small prominence; lateral eyes

juxtaposed, paired on a small prominences; AME diameter 0.14-0.29; AME interdistance

slightly wider than AME diameter; AME-PME distance ca. AME diameter. Clypeus ca.

1/2 -3/4 AME diameter. Paturon colored as pars cephalica, with 3 prolateral and 2-3

retrolateral teeth. Leg formula 1243, colored as cephalothorax, or slightly lighter; femur I

sigmoid. Abdomen 4.67-8.19 long, 3.16-5.54 wide, 3.03-5.54 high; light brown with pale

guanocytes; 1-5 round dark brown markings, often with dark brown posterior; ventral

side two longitudinal stripes from epigastric furrow to spinning field. Spinning field

typical of araneoids, with the following exceptions common to zygielline (and some

nephiline) araneids: a rugose area on posterior rim of ALS making a notch in the piriform

spigot field and one flagelliform spigot of triad closer to a cylindrical gland spigot than

aggregate gland spigots. Epigynum with small ventral-facing copulatory openings; each copulatory duct coiled within a capsule, forming a helix running anterior then twisting back on itself, before reaching a lobed spermatheca; fertilization ducts emerge dorsal and posterior from spermathecae. Copulatory ducts may be plugged with secretions or parts of pedipalp.

Male: Total length 2.85-8.21. Carapace 1.75-4.83 long, 1.15-3.17 wide, 0.59-1.52 high,

yellowish brown to reddish brown in color, sometimes with pars cephalica and carapace

margins darker than pars thoracica. Eye arrangement as in female; AME diameter 0.12-

0.22; AME interdistance slightly wider than AME diameter; AME-PME distance ca.

AME diameter. Clypeus ca. 1/2 AME diameter. Paturon colored as pars cephalica, with

3 prolateral and 2-3 retrolateral teeth. Legs formula 1243, colored as cephalothorax, or

slightly lighter; femur I sigmoid. Abdomen 1.62-4.71 long, 1.24-2.91wide, 0.80-3.03

high; light brown with pale guanocytes; 1-5 dark brown markings, often with dark brown

posterior; ventral side two longitudinal stripes from epigastric furrow to spinning field.

Spinning field with rugose patch and triad positioning as in females. Pedipalp tibia 1/2 -3

times length of cymbium; cymbium slightly elongated, with broad, integral

paracymbium; tegulum and subtegulum rotated dorsally; conductor with lightly rugose

texture, spiraling and emerging ventrally, twisting slightly, with a groove where the

embolus rests, terminating in an oblique point; center of conductor with process

somewhat parallel to elongated, twisted part of conductor.

Composition

Phonognatha is composed of four species: P. graeffei (Keyserling, 1865), P. melania (L.

Koch, 1871), P. neocaledonica new combination, and P. tanyodon new species.

Natural History

The natural history of Phonognatha is primarily informed by the observation of the most

commonly observed and collected species, P. graeffei. All Phonognatha share the leaf-

curling behavior, placing a leaf near the hub of an incomplete orb-web to use as retreat.

The temporary, non-sticky spiral remains in the finishe web. It is expected that all

Phonognatha also cohabitate in the leaf retreat, especially while the female is subadult,

and possible subsequent cannibalism (Fahey and Elgar, 1997), though this has primarily

been observed in P. graeffei and P. tanyodon.

Phylogenetics

Putative synapomorphies are spot-like abdominal dorsal markings, coiled copulatory

ducts within a capsule, cheliceral dimorphism (males’ are larger), curved tip of

conductor, and presence of a barrier web.

Distribution

Known from all states in Australia and from New Caledonia.

Phonognatha graeffei (Keyserling, 1865)

Figs. 20A, 21-24

Epeira graeffei Keyserling, 1865: 811, Plate 19, Figs. 12-13 (female). Australia, New

South Wales, Wollongong, E.H. Graeffe, syntypes (NHMUK, not examined); L. Koch,

1871: 98.

Phonognatha graeffei Simon, 1894: 748, Figs. 829-831 (female).

Epeira wagneri Rainbow, 1896: 325, Plate 19, Fig. 2 (female).

Phonognatha wagneri Dondale, 1966: 1171, Figs. 5A-G (male).

Phonognatha graeffei Davies, 1988: 288, Fig. 10 (female, male).

Phonognatha graeffei Hormiga, et al. 1995: 323, Figs 5K, 8A-G (male).

Phonognatha graeffei Kuntner, et al. 2008: 170, Figs. 11A-C, 11E-G (female, male).

Phonognatha graeffei Álvarez-Padilla & Hormiga 2011: 838, Figs. 125E-F, 136E (male).

NOTE: I have examined Levi’s illustration of the syntype.

Diagnosis

Males of P. graeffei can be distinguished from closely related species based on their palp, which has a pointed mid-conductor process approximately 1/3 the length of the conductor and cymbium approximately as long (or slightly longer) than palpal tibia. Other species in these genera have notably shorter (e.g. P. neocaledonica, Artifex, Deliochus) or longer

(e.g. P. melania, P. tanyodon) tibiae. Females of P. graeffei have a sclerotized epigynal

ridge anterior to copulatory openings, which other Phonognatha lack.

Description

Female (Figs. 21A-D, 22)(from Queensland, Lamington National Park, GH2536. Total length 8.61. Carapace 3.50 long, 2.32 wide, 1.15 high, yellowish brown to reddish brown; sternum 1.71 long, 1.19 wide, of similar color, with dark margins and pale longitudinal band. Eye rows slightly recurved, anterior row more so than the posterior. AMEs on small prominence; lateral eyes juxtaposed, paired on a small prominences; AME diameter

0.25; AMEs interdistance ca. 2/3 AME diameter; AME-PME distance ca. 2/3 AME

diameter. Clypeus ca. ½ AME diameter. Paturon yellowish brown to reddish brown, with

3 prolateral and 2 retrolateral teeth; cheliceral fang curves mesally about a third of the

way from the paturon. Legs colored as cephalothorax, or slightly lighter; femur I

sigmoid; formula 1243: femur I 3.80, patella I 1.61, tibia I 3.65, metatarsus I 4.25, tarsus

I 1.25; femur II 2.95m patella II 1.14, tibia II 2.56, metatarsus II, 2.98, tarsus II 1.07;

femur III 2.05, patella III 0.82, tibia III 1.16, metatarsus III 1.47, tarsus III 0.72; femur IV

2.60; patella IV 1.01; tibia IV 2.13; metatarsus IV 2.34; tarsus IV 0.76. Abdomen 4.75

long, 3.62 wide, 3.96 high; light brown with pale guanine crystals; four to five pairs of

brown markings on dorsum and longitudinal caudal stripe on; two longitudinal stripes of

guanocytes between epigastric furrow and spinning field. Epigynum with broad

sclerotized area, extending anteriorly; copulatory openings facing caudally, with

sclerotized ridges; copulatory duct continues anteriorly, then curves posteriorly to

spermathecae; fertilization ducts emerge from posterior region of spermathecae and

99 extend dorsally.

Male (Figs. 20A, 21E-I, 23)(from New South Wales, Brisbane Forest Park, KS 69633).

Total length 7.86. Carapace 3.88 long, 2.96 wide, 1.28 high, yellowish brown to reddish brown; sternum 1.91 long, 1.71 wide, colored of similar color as carapace, with darker edges. Eye arrangement as in female. AME diameter 0.17; AMEs interdistance ca. 1

AME diameter; AME-PME distance ca. 1 AME diameter. Clypeus ca. 1 AME diameter.

Paturon yellowish brown to reddish brown, with 3 prolateral and 2 retrolateral teeth; cheliceral fang bends mesally by almost 90°, then curving slightly again at approximately midpoint. Legs colored as cephalothorax, or slightly lighter; femur I sigmoid; formula

1243: femur I 5.15, patella I 1.99, tibia I 5.18, metatarsus I 6.14, tarsus I 1.34; femur II

3.97, patella II 1.71, tibia II 3.89, metatarsus II 4.21, tarsus II 1.21; femur III 2.40, patella

III 1.13, tibia III 1.54, metatarsus III 2.11, tarsus III 0.77; femur IV 3.20 patella IV 1.41, tibia IV 2.74, metatarsus IV 3.25, tarsus IV 0.90. Abdomen 4.49 long, 2.63 wide, 2.52 high; light brown with pale guanine crystals; 4-5 pairs of discrete dark brown markings on the dorsum, with a central stripe caudally; two longitudinal stripes of guanocytes between epigastric furrow and spinning field. Spinning field similar to female. Cymbium approximately as long as (or slightly longer than) palpal tibia; mid-conductor process pointed, broader at base, 1/3 to 1/2 the length of the elongate part of the conductor.

100

Figure 21. Phonognatha graeffei. Female: A, ALS; B, PMS; C, PLS; D, epigynum, ventral. Male pedipalp: E, apical; F, ectal; G, ventral; H, mesal; I, dorsal. Scale bars (μm): A,B: 10; C: 20; D-I: 100.

101

Figure 22. Phonognatha graeffei, female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

102

Figure 23. Phonognatha graeffei, male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A-D: 0.5; E-I: 0.1.

103

Variation

Females’ (n=6) total length 7.98–10.23; carapace length 3.45–4.28, width 2.42–3.03, height 1.08–1.35; abdomen length 4.75–6.39, width 3.51–4.53, height 3.69–4.94; sternum

length 1.65–2.01, width 1.19–1.52. Males’ (n=5) total length 2.86–8.21; carapace length

1.75–4.83, width 1.15–3.17, height 0.59–1.52; abdomen length 1.62–4.49, width 1.24–

2.63, height 0.80–3.03; sternum length 0.87–2.10, width 0.70–1.79.

Distribution

Known from the Australian Capital Territory, New South Wales, including Lord Howe

Island, Queensland, South Australia, Tasmania, and Victoria (Fig. 24).

Natural History

P. graeffei is one of the most common leaf-curling spiders in eastern Australia. This spider is apparently one of about three dozen that is capable of reversible color change

(Roberts, 1936), likely based on manipulating guanine crystals near the surface of its abdomen. This ability has been observed (Fig. 13) but it is unclear if this ability extends to congeners. Males vary greatly in size, with adults collected from the same locality being scarcely half the size of other adults. The webs of P. graeffei are sometimes

parasitized by Argyrodes, with multiple species having been collected (Grostal 1999).

Cohabitation has been observed in P. graeffei, with males sharing a leaf curl with an

immature female until she undergoes her final ecdysis into adulthood (Fahey and Elgar,

1997). P. graeffei has been observed to gather and consume pollen (Framenau et al. 2014,

104

Figure 24. Distribution of Phonognatha graeffei.

p. 42), but the extent and frequency of this behavior is unknown.

Additional material examined

New South Wales, Sydney, -33.866, 151.156*, W.J. Rainbow, 2FF (AM KS6642); New

South Wales, Yuraygir National Park, Iliaroo Campground, -29.759, 153.293, 31.i.2016,

35 m, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla, 3FF, 1M, 2Juv; New South Wales,

Yuraygir National Park, nr. water catchment, -29.783, 153.262, 31.i.2016, 35 m, G.

105

Hormiga, R.J. Kallal, F. Álvarez-Padilla, 1M, 1F; New South Wales, Hornsby, -33.714,

151.089*, 7.v.1933, A. Musgrave, 2FF (AM KS34245); New South Wales, Southwest

Rocks, -30.929, 153.089*, 20.iv.1993, J. Noble, 1F (AM KS45254); New South Wales,

Barren Grounds Nature Reserve, -34.679, 150.704*, 16.i.1966, leaf curlers (AM

KS77087); New South Wales, Sydney, Hyde Park, -33.866, 151.156*, 22.iii.1992, M.S.

Harvey, 1F (WAM 99/2805); New South Wales, Sydney, Taronga Zoo, -33.843,

151.242*, 30.iii.1979, H. Levi, on slope in shrubs (MCZ); New South Wales, Sydney,

Taronga Zoo, -33.843, 151.242*, 30.iii.1979, H. Levi, some epigyna plugged, 3FF, 1Juv

(USNM); New South Wales, Poverty Point, 20 mi E of Tenterfield, -29.069, 152.399*,

13.iv.1963, R. Boswell, 1F (MV ENTO2014-19L); New South Wales, Grafton, -29.683,

152.933*, 31.iii.1963, R. Boswell, 1F (MV ENTO2014-19L); New South Wales, Terrey

Hills, -35.300, 149.133, 27.xii.2007, M.L. Moir, K.E.C. Brennan, beating foliage, 1M

(WAM 99102); New South Wales, Wagga Wagga, Gregadoo Rd, -35.117, 147.367,

10.iv.1993, C.A. Carr, 1F (WAM 99/2810); New South Wales, Wagga Wagga,

Kooringal, -35.117, 147.367, 29.iii.1993, C.A. Car, webs in grass, 3FF, 1M (WAM

99/2806); New South Wales, 11 km E of Albury, -36.074, 146.914*, M.S. Harvey, under

bark of Eucalyptus sp., 1F (WAM 99/2804); New South Wales, Armidale, -30.500,

151.650*, H. Heathwole, 1F (QM); New South Wales, Moruya, nr. Bateman's Bay, -

35.911, 150.081*, i.1982, D. Wallace, 1M (QM); New South Wales, Richmond Range

State Forest, -28.690, 152.744*, 17-18.iv.1976, R.J. Raven, 1F (QM); New South Wales,

Richmond Range State Forest, -28.690, 152.744*, 17-18.iv.1976, R.J. Raven, 6FF (QM);

New South Wales, Crows Nest, -33.827, 151.201*, 27.i.1973, G. May, 1M (QM

S45609); New South Wales, Linden, Blue Mountains, -27.809, 146.360*, 28.ii.1971, M.

106

Gray, leaf curlers, 2FF (AM KS77088); New South Wales, Newcastle, Blackbutt

Reserve, site 1, -32.934, 151.697*, 2.viii.1988, M. Gray, C. Horseman, M. Zabka, in

curled leaf in orb web, 1M, 1F (AM KS18408); New South Wales, Bristol Point, Jervis

Bay, -35.085, 150.677*, 31.i.1931, W.A. Rainbow, 1M, 1Juv (AM KS77097); New

South Wales, Gosford, -33.428, 151.343*, 14.i.1930, K. Thompson, 2FF (AM KS33831);

New South Wales, Ermington, -33.815, 151.059*, 4.i.1959, R. Goodwin, R. Ford, 1F, 1M

(AM KS34252); New South Wales, Northbridge, nr. Sydney, -33.810, 151.218*,

20.iii.1928, A. Thompson, 4FF (AM KS33828); New South Wales, Wahroonga, -33.716,

151.115*, 2.iv.1928, N. Davidson, 1F (AM KS33835); New South Wales, Kempsey

Banks of Murray River, -31.050, 152.500, 27.i.1981, M.R. Gray, 2FF (AM KS57558);

New South Wales, 12 km S of Bowral Lemann Property, ii.1997, J. Lemann, C. Lemann,

1F (AM KS52101); New South Wales, Seven Mile Beach, -34.852, 150.743*, 26.ii.1980,

M.I. Nikitin, by sweeping M. communis, 1M (AM KS4639); New South Wales, Botany, -

33.949, 151.199*, 22.v.1965, R.E. Mascord, 2FF (AM KS77091); New South Wales,

Gordon, -33.756, 151.152*, 17.ii.1989, C. Horseman, M. McEvoy, on foliage, 1M (AM

KS20223); New South Wales, Pennant Hills, -33.733, 151.067, 25.ix.1998, J. Noble, 1F

(AM KS59082); New South Wales, Windsor’s Ranch, nr. Freeman’s Ranch, 1F (AM

KS9069); New South Wales, Urunga, -30.532, 152.997*, 7.iii.1981, M.R. Gray, 1F (AM

KS48850); New South Wales, 6 km S of Forster, 1M (AM KS10203); New South Wales,

Lord Howe Island, -31.530, 159.071*, 900-1300 m, leaf curler (AM KS33872); New

South Wales, Shoalhaven Heads, -34.852, 150.743*, 12.i.1953, N.J. Camps, 1F (AM

KS33830); New South Wales, Beecroft Reserve, -33.750, 151.067, 12.iii.1999, J. Noble,

1M (AM KS59077); New South Wales, Epping Station Strip, -33.767, 151.038,

107

15.ii.1995, J. Noble, 1M (AM KS59074); New South Wales, Narraweena, -33.750,

151.267, v.1996, M. Robinson, 1F (AM KS48707); New South Wales, Lord Howe

Island, -31.530, 159.017*, leaf curler, orb web on shrubs, 1F (AM KS33866); New South

Wales, Washpool State Forest, junction of Moogen and Coombadjan, 1M, 1Juv (AM

KS9319); New South Wales, Wollongongm -34.437, 150.834*, 3.iii.1966, R. Mascord,

1M (AM KS77092); New South Wales, North Ryde, -33.800, 151.117, 10.ii.1994, J.

Noble, 1M (AM KS59087); New South Wales, North Bondi, -33.884, 151.279*,

29.v.1962, 1F (AM KS34336); New South Wales, 6 m W of Kempsey on Sherwood

Road, -31.072, 152.711*, 24.iv.1974, M. Gray, webs on bank vegetation, leaf retreat, 2

FF, Juvs (AM KS77089); New South Wales, nr. Sydney, -33.866, 151.156*, iv.1928, R.

Cranfield, on Banksia, 2FF (AM KS33825); New South Wales, Beecroft Reserve, -

33.750, 151.067, 17.ii.1997, J. Noble, 1M (AM KS59079); New South Wales,

Crommelin Research Station, Pearl Beach, -33.547, 151.292*, 26.ii.1984, J. Clarke, 2FF

(AM KS50342); New South Wales, Crommelin Research Station, Pearl Beach, -33.547,

151.292*, 26.ii.1984, J. Clarke, 1F (AM KS50339); New South Wales, Frazer Reserve,

Wahroonga, -33.717, 151.133, 28.i.1994, J. Noble, 1F (AM KS59088); New South

Wales, Beecroft, -33.750, 151.067*, 15.iii.1997, J. Noble, 1F (AM KS52099); New

South Wales, South West Rocks, -30.922, 153.056*, 8.i.1993, J. Noble, 1F (AM

KS52455); New South Wales, Sydney District, -33.866, 151.156*, v.1928, C.R. Barlee,

2FF (AM KS33824); New South Wales, Lord Howe Island, 39, -31.530, 159.071*, 1M

(AM KS33870); New South Wales, Lord Howe Island, 38, -31.530, 159.071*, 1M, 1F,

1Juv (AM KS33865); New South Wales, Lord Howe Island, -31.530, 159.071*, 1M, 1F

(AM KS33872); New South Wales, South West Rocks, -30.922, 153.056*, 30.iv.1993, J.

108

Noble, 1F (AM KS54253); New South Wales, Bobbin Hill, 10.iii.1982, M. Gray, on

shrub, 1F (AM KS8958); New South Wales, La Kemba, -33.921, 151.077*, E.A. Brack,

3FF (AM KS34251); New South Wales, Sydney, Gladesville, -33.831, 151.126*,

12.iv.1928, J. Hoise, 1F (AM KS33829); New South Wales, Lord Howe Island, -31.530,

159.071*, 1F (AM KS33871); New South Wales, Lord Howe Island, -31.530, 159.071*,

247 m, 1F (AM KS33867); New South Wales, Carrow Brook, -32.283, 151.300,

21.iv.1999, J. Noble, 1F (AM KS59086); New South Wales, Beecroft, -33.750, 151.067,

10.ii.1998, J. Noble, 1F (AM KS57561); New South Wales, Beecroft, -33.750, 151.067,

10.ii.1998, J. Noble, 1F (AM KS59080); New South Wales, Lord Howe Island, -31.530,

159.071*, ii.1971, 381 m, M. Gray, 1Juv (AM KS33864); New South Wales, St.

George’s Basin, -35.085, 150.599*, i.1984, I. Biddle, 1M, 1F, 1Juv (AM KS22636); New

South Wales, Myall Lakes, -32.408, 152.402, D. Stevenson, 1F (AM KS2102); New

South Wales, Turramurra, -33.750, 151.117, i.1967, J. Child, living together in leaf, 1M

(AM KS70853); New South Wales, Mount Katapur, -30.274, 150.148*, 12.ii.1996, M.

Moulds, 1F (AM KS52103); New South Wales, Crommelin Research Station, Pearl

Beach, -33.547, 151.292*, ii.1994, R. Bradley, FF (AM KS50340); New South Wales,

Crommelin Research Station, Pearl Beach, -33.547, 151.292*, 26.ii.1984, J. Clarke, in rolled leaf, 1F (AM KS50341); New South Wales, Carrow Brook, -32.283, 151.300,

10.ii.1999, J. Noble, 1M (AM KS59085); New South Wales, Narrabeen Lake, -33.717,

151.282*, 17.i.1969, M. Gray, 1M, 1Juv (AM KS77096); New South Wales, Moruya, -

35.905, 150.086*, 27.i.1965, 1F (AM KS77086); New South Wales, Razorback, Camden,

-34.146, 150.656*, 1.v.1969, 1F (AM KS33839); New South Wales, Newcastle,

Blackbutt Reserve, site 1, -32.934, 151.967, 2.viii.1988, M. Gray, C. Horseman, M.

109

Zabka, in curled leaf, 1M, 1F (AM KS18409); New South Wales, Mount Gog, -31.836,

151.483*, 30.iii.1982, W. Bell, 1F (AM KS8852); New South Wales, Sydney Museum, -

33.866, 151.156*, 26.ii.1969, K. Kota, 1F (AM KS33836); New South Wales, Lane Cove

National Park, -33.749, 151.091*, vi.1988, M. Elgar, 1M, 1Juv (AM KS19927); New

South Wales, Sydney, Collaroy, -33.741, 151.307*, i.1930, A. Musgrave, 4MM, 3Juv

(AM KS34523); New South Wales, St. George’s Basin, -35.085, 150.599*, i.1984, I.

Buddle, 1F (AM KS22665); New South Wales, Crommelin Research Station, Pearl

Beach, -33.547, 151.292*, 4.iii.1984, R.A. Bradley, FF, Juv (AM KS50338); New South

Wales, Forster, -32.212, 152.540*, 14.ii.1997, M. Moulds, leaf and eggsac, 1F (AM

KS52096); New South Wales, Camden, -34.057, 150.701*, 15.vii.1968, M. Gray, in low gum with leaf, 1F (AM KS33838); New South Wales, Forster, -32.212, 152.540*,

12.ii.1997, M. Moulds, with leaf, 1F (AM KS52095); New South Wales, Minmi, -32.877,

151.617*, 2MM, 2FF (AM KS33827); New South Wales, Beecroft, -33.750, 151.067*,

5.iii.1994, J. Noble, 1M (AM KS53728); New South Wales, Upper Middle Harbor, nr.

Sydney, -33.768, 151.210*, 18.iii.1928, A. Musgrave, 1F (AM KS33826); New South

Wales, Killara, -33.764, 151.164*, 12.iv.1978, L. Bushell, 1F (AM KS1333); New South

Wales, Narrabeen Lake, -33.717, 151.282*, 17.i.1969, M. Gray, leaf curlers, 1M, 1Juv

(AM KS77095); New South Wales, Beecroft, -33.750, 151.067, 25.i.1999, J. Noble, 1M

(AM KS59078); New South Wales, Beecroft, -33.750, 151.067, 10.ii.1994, J. Noble, 1F

(AM KS59076); New South Wales, Beecroft, -33.750, 151.067, 10.ii.1994, J. Noble, 1M

(AM KS59075); New South Wales, ‘Springerlee’ gates S of Neville on Kentucky Road, -

33.737, 149.191*, 10.ii.1991, C. Horseman, J. Thompson, 1M (AM KS33868); New

South Wales, Wahroonga Frazer Reserve, -33.722, 151.113*, 10.ix.1993, J. Noble, 1F

110

(AM KS54240); New South Wales, Lord Howe Island, SG50, -31.530, 159.071*, M.

Gray, clubionid in dead leaf in web above Phonognatha leaf, 1F (AM KS33868); New

South Wales, Lord Howe Island, start of Transit Hill Track, off Bowker Avenue, -31.530,

159.071, 20.ii.2001, G. Milledge, 1F (AM KS70760); New South Wales, Bawley Point,

ca. 20 miles N of Bateman’s Bay, -35.516, 150.394*, 15.ii.1997, 5 m, E.S. Ross, 3FF

(CASENT); New South Wales, Beecroft, -33.750, 151.067, 2.iii.2004, J. Noble, 1M (AM

KS88881); New South Wales, Banyabba State Forest, -29.382, 153.007, ii.1998, A.

York, sweep, 1F (AM KS88597); New South Wales, Hornsby, Waitara Creek, -33.714,

151.089, 27.i.2008, g. Milledge, H. Smigh, beat, sweep, and hand collecting, 1M (AM

KS105045); New South Wales, Newnes State Forest, Birds Rock Flora Reserve, 0.6 km

from Sunnyside Ridge Road, -33.324, 150.193, 23.ii.2006, 1105 m, G. Milledge, J.

Tarnawski, M. Beatson, dry sclerophyll, beating and hand collecting, 5FF, 2MM (AM

KS94508); New South Wales, Newnes State Forest, track of Snow Gum Flora Reserve,

1.3 km from Blackfellows Hand Road, -33.324, 150.193, 21.ii.2006, 1144 m, G.

Milledge, J. Tarnawski, M. Beatson, dry sclerophyll, beating and hand collecting, 3FF

(AM KS94561); New South Wales, Newnes State Forest, track of Snow Gum Flora

Reserve, 2.5 km from Blackfellows Hand Road, -33.324, 150.193, 20.i.2006, 1172 m, G.

Milledge, J. Tarnawski, M. Beatson, dry sclerophyll, beating and hand collecting, 5FF,

2MM (AM KS94571); New South Wales, Newnes State Forest, Deep Pass Road South, -

33.324, 150.193, 22.ii.2006, 1100 m, G. Milledge, J. Tarnawski, M. Beatson, dry sclerophyll, beating and hand collecting, 1M (AM KS94615); New South Wales,

Arneliffe, -33.938, 151.146*, 6.i.1957, R.J. Weston, 1M (AM KS34344); New South

Wales, Devils Pulpit State Forest, -29.266, 153.204, ii.1997, A. York, sweep, eucalypt

111

forest, 1M (AM KS88619); New South Wales, St. Ives, Ku-Ring-Gai Wildflower

Garden, -33.705, 151.172, 17.i.2014, G. Milledge, H. Smith, night collecting, 1M (AM

KS122197); New South Wales, Lord Howe Island, -31.530, 159.071*, xii.19150i.1916,

A.M. Lea, 1F (AM KS6523); New South Wales, Turamurra, -33.750, 151.117, i.1967, J.

Child, 2FF (AM KS115365); New South Wales, Bundjalung National Park, Saltwater

Track, -29.376, 153.349, 20.ii.2011, G. Milledge, H. Smith, beat, sweep, and hand collecting, 1F (AM KS76434); New South Wales, Jamberoo Mountain, -34.667,

150.717*, 12.iv.1993, J. Noble, 1F (AM KS046007); New South Wales, 7 Mile Beach,

26.ii.1980, M.I. Nikitin, sweeping, 1F (AM KS4637); New South Wales, Hornsby,

Waitara Creek, -33.714, 151.089, 15.iii.2004, H. Smith, on line at night, 1M (AM

KS90093); New South Wales, Beecroft, -33.750, 151.067, 16.ix.2002, J. Noble, 1M (AM

KS79719); New South Wales, Beecroft, -33.750, 151.067, 16.ix.2002, J. Noble, 1M (AM

KS88873); New South Wales, Beecroft, -33.750, 151.067, 3.ii.2004, J. Noble, 1M (AM

KS87317); New South Wales, Spirabo State Forest, -29.300, 152.183, 4.ii-9.iv.1993, 920 m, M. Gray, G. Cassis, saddle along ride with steep drop to the south and a shallow basin to the north, 1F (AM KS038200); New South Wales, 3 km N of Landsdowne, -31.683,

152.483, 19.ii.1997, wet sclerophyll, 1M (AM KS97248); New South Wales, Beecroft, -

33.750, 151.067, i.ii.1992, J. Noble, 1F (AM KS046014); New South Wales, Beecroft, -

33.750, 151.067, 15.iv.1993, J. Noble, 1F (AM KS7105); New South Wales, Barrington

Tops Reserve, Gummi Road, Manning River Crossing, -31.862, 151.552, 19.iii.2008, G.

Milledge, A. Hegedus, beat/sweep, under bark, sclerophyll, 1M, 1F (AM KS103277);

New South Wales, Smiths Lake, -32.367, 152.500, 3.v.1997, spider exhibition, 1F (AM

KS97214); New South Wales, Mount Annan Botanical Gardens, -34.050, 150.767,

112

25.iii.2008, L. von Richter, in web, 1M (AM KS109240); New South Wales, Mount

Annan Botanical Gardens, -34.050, 150.767, 25.iii.2008, L. von Richter, in web, 1F (AM

KS109257); New South Wales, Beecroft, -33.750, 151.067, 4.iv.2004, J. Noble, 1F (AM

KS88845); New South Wales, Hornsby, Waitara Creek, -33.714, 151.089*, 22.i.2005, H.

Smith, 1M (AM KS91356); New South Wales, Wolgan State Forest, Newnes Road, -

33.282, 150.118, 21.ii.2006, 707 m, G. Milledge, J. Tarnawski, M. Beatson, dry

sclerophyll, beating and hand collecting, 1F (AM KS94547); New South Wales,

Doubleduke State Forest, -29.142, 153.194, ii.1997, A. York, sweep, eucalypt forest, 1F

(AM KS88061); New South Wales, Yerringbool, -34.367, 150.533, 1.iv.1990, S.J.

Fellenberg, 1F (AM KS86712); New South Wales, Beecroft, -33.750, 151.067, 1.iv.2002,

J. Noble, 1M (AM KS76894); New South Wales, Devils Pulpit State Forest, -29.263,

153.203, ii.1997, A. York, sweep, eucalypt forest, 1F (AM KS88060); New South Wales,

Hornsby, Waitara Creek, -33.714, 151.089, 11.iv.2004, G. Milledge, in web, 1F (AM

KS88826); New South Wales, Epping, -33.800, 151.117, 18.v.2011, R. Sadler, 1F (AM

KS115313); New South Wales, Royal Camp State Forest, -29.352, 152.873, ii.1998, A.

York, sweep eucalypt forest, 1F (AM KS88596); New South Wales, Mount Belmore

State Forest, -29.062, 152.776, ii.1997, A. York, sweep, eucalypt forest, 1M (AM

KS88057); New South Wales, Hornsby, Clovelly Road, -34.714, 151.089, 3.iii.2004, H.

Smith, in house, 1M (AM KS88818); New South Wales, Newnes State Forest, Waratah

Ridge Road, 3.2 km from Glowworm Tunnel Road, -33.324, 150.193, 1090 m, G.

Milledge, J. Tarnawski, M. Beatson, dry sclerophyll, beating and hand collecting, 3FF

(AM KS94598); New South Wales, Mount Annan Botanical Gardens, -34.050, 150.767,

25.iii.2008, L. von Richter, in eucalypt leaf, 1F (AM KS109241); New South Wales,

113

Hornsby, Waitara Creek, -33.714, 151.089, 12.ii.2004, G. Milledge, H. Smith, night, 1M

(AM KS87293); New South Wales, Spirabo State Forest, very end of Wattle Creek Road,

on ridge overlooking Wattle Creek Gorge to NE, -28.300, 152.183, 4.ii-9.iv.1993, 880 m,

M. Gray, G. Cassis, 1F (AM KS038285); New South Wales, 0.5 km W of Harrington, -

31.850, 153.683, 24.ii.1997, G. Williams, melaleuca swamp, for spiders exhibition, 1F

(AM KS97221); New South Wales, Nerong State Forest, 0.3 km S along Cox’s Fence, trail from Boundary Road, -31.633, 152.150, 4.ii-9.iv.1993, M. Gray, G. Cassis, 1F (AM

KS040834); New South Wales, Eurobdalla National Park, 1.5 km along track to

Honeysuckle, -36.279, 150.129, 20.v.2009, 30 m, G. Milledge, H. Smith, night collecting, 1F (AM KS108179); New South Wales, Wangi Ridge Reserve, -33.076,

151.608, 19.iii.2012, G. Milledge, H. Smith, night collecting, 1M (AM KS11848); New

South Wales, Ku-Ring-Gai Chase National Park, Bobbin Head, Mangrove Walk, -33.668,

151.156, 13.ii.2011, G. Milledge, hand collecting, 1M, 1F (AM KS115003); New South

Wales, Beecroft, -33.750, 151.067, 10.vi.2004, J. Noble, 1F (AM KS90881); New South

Wales, Mount Colah, -33.667, 151.117, 14.iv.2004, M.R. Gray, 5FF, 1M (AM KS8872);

New South Wales, Mount Colah, Pacific Highway, -33.667, 151.117, 8.iv.2014, M.R.

Gray, 1F (AM KS123089); New South Wales, Naremburn, -33.812, 151.200*, 29.i.1930,

Johnson, 1F (AM KS33406); New South Wales, Barrington Tops, Gloucester River

Campground, -32.067, 151.663*, 24.iii.2008, G. Milledge, H. Smith, night collecting

(AM KS122544); Queensland, Cainbable Cabin, nr. Lamington National Park, -28.135,

153.109, 1-3.ii.2016, 641 m, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla, 1M, 2FF, 2Juv;

Queensland, Brisbane, -27.510, 153.030*, 1950, J. Filmer, J. Wild, 3FF, 1M (QM

S45623); Queensland, Brisbane, Burbank Park, J.C. Trotter Memorial Park, -27.550,

114

153.183, 27.ii.2005, M. Rix, 2FF (QM); Queensland, Peregian Beach, -26.478, 153.086,

9.i.2005, M. Rix, 1F, 1M, 1Juv (QM); Queensland, Peregian Beach, -26.478, 153.086,

9.i.2005, M. Rix, 1F (QM); Queensland, Kroombit Tops National Park, -24.377,

151.041*, 17.xii.1983, K.M. Bennie (QM S45433); Queensland, Canungra, -28.017,

153.165*, vii.1992, W. Eberhard, 1F (MCZ); Queensland, Moreton Island, -27.102,

153.412*, R.J. Raven, with immature female in curled leaf, 2MM (QM S45619);

Queensland, Mt. Tambourine, -27.924, 153.171*, 18.vii.1992, G. Hormiga, J.

Coddington, 3FF (USNM); Queensland, Noosa National Park, -27.392, 153.111, M.

Kuntner, F. Álvarez, M. Rix, 1F (USNM); Queensland, Brisbane, Tingalpa dry forest,

J.C. Trotter Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F.

Álvarez, M. Rix, dry forest, 1F (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C.

Trotter Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez,

M. Rix, dry forest, 1M (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter

Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1M, 1Juv (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter

Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, some epigyna plugged, 4FF, 1Juv (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M.

Kuntner, F. Álvarez, M. Rix, dry forest, some epigyna plugged, 1M, 1F (USNM);

Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -27.556, 153.177,

6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, with 2 Arygrodes rainbowi, 1F (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial

Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest,

115

with 1 Arygrodes, 7FF (USNM); Queensland, Noosa National Park, -27.392, 153.111,

5.iv.2002, 50 m, M. Kuntner, F. Álvarez, M. Rix, 1M (USNM); Queensland, Noosa

National Park, -27.392, 153.111, 5.iv.2002, 50 m, M. Kuntner, F. Álvarez, M. Rix, 1M,

1F (USNM); Queensland, Noosa National Park, -27.392, 153.111, 5.iv.2002, 50 m, M.

Kuntner, F. Álvarez, M. Rix, dry forest, 1M (USNM); Queensland, Noosa National Park,

-27.392, 153.111, 5.iv.2002, 50 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1Juv

(USNM); Queensland, Noosa National Park, -27.392, 153.111, 5.iv.2002, 50 m, M.

Kuntner, F. Álvarez, M. Rix, dry forest, 2FF (USNM); Queensland, Noosa National Park,

Peregian Section, -26.508, 153.093, 11.i.2003, M. Kuntner, F. Álvarez, M. Rix, 3FF,

1Juv (USNM); Queensland, Whites Hill Reserve, -26.385, 153.100, 6.iv.2002, 30 m, M.

Kuntner, F. Álvarez, M. Rix, dry forest, 1M, 1F, 3Juvs (USNM); Queensland, Whites

Hill Reserve, -26.385, 153.100, 6.iv.2002, 30 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, epigynum plugged, 1F (USNM); Queensland, Whites Hill Reserve, -26.385,

153.100, 6.iv.2002, 30 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1M, 1F (USNM);

Queensland, Tambourine National Park, Witches Falls, -27.941, 153.180, 17.iv.2002, G.

Hormiga, M. Kuntner, F. Álvarez, rainforest, epigynum plugged, 1F (USNM);

Queensland, Tambourine National Park, Witches Falls, -27.941, 153.180, 17.iv.2002, G.

Hormiga, M. Kuntner, F. Álvarez, rainforest, 2FF (USNM); Queensland, Lamington

National Park, road to Canungra-O’Reilly’s, -28.140, 153.115, 5.iv.2002, 50 m, G.

Hormiga, M. Kuntner, F. Álvarez, 1M (USNM); Queensland, Lamington National Park, road to Canungra-O’Reilly’s, -28.140, 153.115, 15-17.iv.2002, 50 m, G. Hormiga, M.

Kuntner, F. Álvarez, 1M (USNM); Queensland, Lamington National Park, road to

Canungra-O’Reilly’s, -28.140, 153.115, 15-17.iv.2002, 50 m, G. Hormiga, M. Kuntner,

116

F. Álvarez, 1M (USNM); Queensland, Coolum, -26.531, 153.090*, ii-iii.1964, N.

Lambert, 1F (MV ENTO2014-19L); Queensland, Silver Valley via Herberton, -17.482,

145.312*, 24.ix.1950, J.S. Brooks, 1M, 1Juv (MV ENTO2014-19L); Queensland,

Yeronga, 23.vii.1992, J.M. Waldock, in curled leaf in orb web in garden, 1F (WAM

99/2339); Queensland, Blackdown Tableland via Dingo, -23.773. 149.329*, 1-6.ii.1981,

R.J. Raven, 5MM, 5FF (QM); Queensland, Boronto, G. Monteith, 1F (QM S39732);

Queensland, Bushlands Reserve, Chelsea Rd, -27.483, 153.188, 10.xi.2003, QM Party,

1Juv (QM S65410); Queensland, Camira, -27.635, 152.916*, 3.iii.1982, D. Sinclair, 1F

(QM); Queensland, Camira, -27.635, 152.916*, 3.iii.1982, D. Sinclair, 1M, 6FF (QM);

Queensland, Cooloola, -26.052, 152.974*, 6.iv.1987, K. Sadler, 1F (QM); Queensland,

Fraser Island, Orchid Beach, -24.915, 153.282*, 5-7.iii.1996, 200 m, R.J. Raven, heath,

3FF (QM S31059); Queensland, Fraser Island, Orchid Beach, -24.915, 153.282*, 5-

7.iii.1996, 200 m, R.J. Raven, heath, 3FF (QM S31071); Queensland, Freshwater NP, 34 km N of Brisbane, W of Redcliff, nr. Deception Bay, -27.174, 152.982, 14.iii.2009,

Entomological Society of Queensland, remnant open sclerophyll forest, eucalpyt and

Angophora trees, 1M (QM S90344); Queensland, Kroombit Tops National Park,

(northern escarpment), 45km SSW Calliope, -24.377, 151.041*, 9-19.xii.1983, V.E.

Davies, J. Gallon,(QM); Queensland, McLeod, nr. Windsor Tableland, -17.083,

145.267*, I. Fanning, 1F (QM); Queensland, Monday Creek / Severn River Camp,

4.iv.1988, R. Leggett, 1F (QM S13060); Queensland, Mount Tambourine garden, -

27.928, 153.194*, V.E. Davies, FF, 1M (QM S17275); Queensland, North Stradbroke

Island, Enterprise Mallee #1, -26.567, 153.433, 7.i.2002, 120 m, QM Party, 8FF, 1M

(QM S56282); Queensland, North Stradbroke Island, Enterprise Mallee #3, -27.600,

117

153.450, 7.i.2002, 80 m, QM Party, 3FF, 1M (QM S56265); Queensland, North

Stradbroke Island, Enterprise Scribbly Gum #3, 10.i.2002, 70 m, QM Party, 1F (QM);

Queensland, North Stradbroke Island, Enterprise Scribbly Gum #3, 10.i.2002, 70 m, QM

Party, 1F (QM S56283); Queensland, North Stradbroke Island, Enterprise Scribbly Gum

#3, 10.i.2002, 70 m, QM Party, 1M (QM S56166); Queensland, nr. Eurimbula, -24.183,

151.833*, xi.1978, J. Coraceirch, 1F (QM); Queensland, South Percy Island, lagoon area,

-38.425, 142.000*, Monteith, Thompson, Cooke, Janetzki, 1M (QM S27561);

Queensland, Camira, -27.635, 152.916*, R.J. Raven, 1M, 1F (QM S29650); Queensland,

Deepwater National Park, 65 km NW of Bundaberg, -24. 334, 151.923*, 20-26.ix.1992,

G.B. Monteith, S.R. Monteith, 5FF (QM S25939); Queensland, Kroombit Tops National

Park, northern escarpment, 45 km SSW of Calliope, 3-4.ii.1984, G. Monteith, Hagan,

Yeates, 1F (QM S45643); Queensland, Kroombit Tops, upper dry creek, 45km SSW of

Calliope, -24.377, 151.041*, 9-19.xii.1983, V.E. Davies, J. Gallon, JJ (QM S45469);

Queensland, Kroombit Tops, upper dry creek, 45km SSW of Calliope, -24.377,

151.041*, 9-19.xii.1983, V.E. Davies, J. Gallon, open forest (QM S45469); Queensland,

South Gatton, north junction view, -27.596, 152.274*, 30.xii.1984, A. Rodefelds, 2FF

(QM S45636); Queensland, Isla Gorge, -25.180, 149.943*, v.1973, G. May, 1F (QM

S45608); Queensland, 2km W of Sanford, 3.iv.1982, D. Sinclair, 3FF (QM S45605);

Queensland, Tambourine Mountain, -27.924, 153.171*, 25.iii.2000, V.E. Davies, 1F

(QM S52801); Queensland, Moreton, -27.127, 153.339*, 10.xi.1973, R. Raven, 1F (QM

S45664); Queensland, Bald Mountain Area via Emu Vale, -28.196, 152.373*, 22-

24.iv.1984, G.B. Monteith, 1F (QM S45596); Queensland, Chinchilla, -26.742, 150.628*, ii.1979, T. Adams, 4FF, 1M (QM S45659); Queensland, Moreton Island nr. Blue Lagoon,

118

-27.127, 153.339*, 16.iv.1981, G. Anderson, 1F (QM S45660); Queensland, Moreton

Island, -27.127, 153.339*, 11.ii.1982, G. Anderson, FF (QM S45606); Queensland,

Moreton Island, -27.127, 153.339*, 11.ii.1982, D. Sinclair, 4FF, 1M (QM

S45605);Queensland, Condamine Gorge, -28.339, 152.293*, 28.iii.1982, D. Sinclair, 2FF

(QM S45601); Queensland, Noosa, -26.389, 153.105*, iii.1938, H.A. Longman, 1F (QM

S45621); Queensland, Brisbane, -27.418, 152.830*, in curled leaf in orb web, 1M, 1F

(QM S45656); Queensland, Mount Flinders, -22.544, 150.769*, 14.iii.1982, D. Sinclair,

7FF, 1M (QM S45603); Queensland, Lower Wanga, Widgee Creek crossing, -26.124,

152.467*, 17.iv.1982, D. Sinclair, 10FF (QM S45615); Queensland, Eagle Heights nr.

Tambourine, -27.912, 153.199*, 15-23.iii.1955, S.J. Gunn, M.B. Wilson, 4FF, 1M (QM

S45620); Queensland, Cooloola, Camp Milo, -26.502, 152.974*, 3-7.ii.1976, R. Raven,

V.E. Davies, MM FF (QM S45662); Queensland, Boonah, Kooroomba, -27.996,

152.685*, 24.iii.1974, V.E. Davies, 12FF (QM S45613); Queensland, Double Island

Point, Little Freshwater Creek, -25.933, 153.189*, 14-15.vii.1985, J. Gallon, 1F (QM

S45637); Queensland, 10km N of Leyburn, -27.938, 151.586*, 28.iii.1982, D. Sinclair,

1F (QM S45602); Queensland, Brisbane, Griffith University study site, -27.418,

152.830*, 18.iii.1976, V.E. Davies, 2FF (QM S45610); Queensland, Coombabah Creek,

200 m upstream from Lakeside Caravan Park, -27.904, 153.366*, 10.iv.1982, D. Sinclair,

7FF (QM S45600); Queensland, Kroombit Tops National Park, -24.377, 151.041*,

25.ii.1982, R. Raven (QM S45634); Queensland, Kroombit Tops National Park, 45 km

SSW of Calliope, -24.377, 151.041*, 13-19.xii.1983, Monteith, Davies, Gallon,

Thompson, 1F (QM S45639); Queensland, West Burleigh, -28.106, 153.445*, 12.ii.1953, museum staff, 1F (QM S45630); Queensland, Brisbane, Weller’s Hill, -27.520, 153.050*,

119

8.iv.1996, D. Wolfgram, 1F (QM S30694); Queensland, Mount Barney National Park, 6 km from entrance, -28.273, 152.662*, 26.iv.1982, D. Sinclair, 1F (QM S45614);

Queensland, Kroombit Tops National Park, Ubobo Road, site 5 escarpment, -24.377,

151.041*, 15.xii.1984, M. Bennie, 6Juv (QM S45635); Queensland, Ravenshoe, -17.579,

145.493*, 13.xi.1971, N.C. Coleman, 1M (QM S45597); Queensland, Cooloola, -26.052,

152.974*, 31.xii.1973, R. Raven, 1M (QM S45618); Queensland, Kroombit Tops

National Park, Lower Kroombit Creek, 45 km SSW of Calliope, -24.377, 151.041*, 9-

19.xii.1983, V.E. Davies, J. Gallon, open forest, 4FF (QM S45646); Queensland, Crows

Nest, -33.827, 151.041*, 15.v.1974, B. Jahnke, curled leaf in orb web in open

sclerophyll, 1F (QM S45627); Queensland, South Ipswich, Flinder’s Peak, -27.632,

152.761*, 30.vi.1979, A. Rozefelds, 2FF, 1Juv (QM S45658); Queensland, nr. Mareeba, -

17.025, 145.501*, 27.xii.1976, 1F (QM S58362); Queensland, Blackduck Creek, -27.901,

152.205*, 24.i.1973, V.E. Davies, 1F (QM S45612); Queensland, Mount Glorious, -

27.333, 152.767*, iii.1973, R. Raven, 1F (QM S45661); Queensland, Mulgowie, Laidley,

-27.719, 152.767*, 10.iii.1981, M. Grant, sclerophyll, 1M (QM S45998); Queensland,

Mount Gravatt, -27.542, 153.076*, 17.v.1982, J. Gallon, 1F (QM S45595); Queensland,

Kroombit Tops National Park, Gladstone, -24.377, 151.041*, 23.ii.1989, D. Yeates, 30+

FF, MM (QM S45633); Queensland, Stanthorpe, -28.656, 151.935*, 6.iii.1982, D.

Sinclair, 30+ FF, MM (QM S45632); Queensland, 3 km W of Mount Flinders, in lantana

patch, -35.946, 148.966*, 14.iii.1982, D. Sinclair, 20FF (QM S45593); Queensland,

Mount Colliery, Southern Slopes Farm, valley, -28.248, 152.360*, 27.ii.1971, R. Monroe,

in orb + tangled web, sunny day, field no. 5, 1F (QM S45591); Queensland, Black

Fellows Creek, each branch, 14.iii.1973, R. Hobson, in curled leaves, 12FF (QM

120

S45631); Queensland, Kroombit Tops, Lower Kroombit Creek, 45 km SSW of Calliope,

-24.377, 151.041*, 9-19.xii.1983, G. Monteith, G. Thompson, open forest, Juvs (QM

S45642); Queensland, Herberton, Petford Road, -17.384, 145.327, 3.xii.2008, 912 m, G.

Milledge, H. Smith, general collecting, 1F (AM KS106570); Queensland, Kroombit

Tops, 65 km SSW of Gladstone, -24.377, 151.041*, 22-26.ii.1982, G. Monteith, G.

Thompson, Yeates, open forest, sweeping heath, 1F (QM S45640); Queensland,

Caloundra, Dickey’s Beach, -26.798, 153.125*, 10.ii.1974, V.E. Davies, in curled leaf in

orb web, 1F (QM S45611); Queensland, Ravensbourne, -27.338, 152.157*, 10.ii.1974, R.

Raven, 1F (QM S45616); Queensland, Glastonbury State Forest, -26.282, 152.525*,

17.iv.1982, D. Sinclair, 2FF (QM S45663); Queensland, N of Sydney, 1F (AM

KS33834); Queensland, Brisbane Forest Park, -27.418, 152.830, 11-16.i.1998, N. Power,

malaise trap 2, MM (AM KS69633); Queensland, Moffat Beach, -26.792, 153.140*,

29.xii.1966, 1F (AM KS77094); Queensland, Moffat Beach, -26.792, 153.140*,

29.xii.1966, 1F (AM KS77093); Queensland, Brisbane Forest Park, -27.418, 152.830, 1-

6.iii.1998, N. Power, malaise trap 3, 3MM (AM KS69505); Queensland, Condamine, -

26.904, 150.135*, 1F (AM KS33832); Queensland, Brisbane Forest Park, -27.418,

152.830, 18-23.i.1998, N. Power, malaise trap 5, MM (AM KS69424); Queensland,

Brisbane Forest Park, -27.418, 152.830, 29.xii.1997-2.i.1998, N. Power, malaise trap 3,

3MM (AM KS69454); Queensland, Brisbane Forest Park, -27.418, 152.830, 25.ii-

2.iii.1998, N. Power, malaise trap 2, 1M (AM KS69511); Queensland, Brisbane Forest

Park, -27.418, 152.830, 11-16.i.1998, N. Power, malaise trap, 5M (AM KS69417);

Queensland, Brisbane Forest Park, -27.418, 152.830, 8-13.ii.1998, N. Power, malaise trap 3, 3MM (AM KS69683); Queensland, Brisbane Forest Park, -27.418, 152.830, 15-

121

20.iii.998, N. Power, malaise trap 2, 5MM (AM KS69500); Queensland, Brisbane Forest

Park, -27.418, 152.830, 22-27.iii.1998, N. Power, malaise trap 3, 4FF, 3MM (AM

KS69491); Queensland, Brisbane Forest Park, -27.418, 152.830, 18.iv.1997, F.

MacKillop, for spiders exhibition, 1F, eggsac (AM KS95952); Queensland, Eurimbolla, -

24.183, 151.833*, 3FF (AM KS12786); Queensland, Bribie Island, -27.058, 153.192, 23-

28.ix.1997, N. Power, malaise trap, heathland/acacia regrowth, 1M (AM KS69590);

Queensland, Fungella, road to Fungella Dam at junction of Freegarden Road, 21.iv.1998,

G. Milledge, 1F (AM KS52415); Queensland, Brisbane, Mount Coot-Tha, along summit track, -27.480, 152.962, 24.iii.2010, 164 m, G. Hormiga, N. Scharff; Queensland,

Mudgerabah, west on road to Springbrook, -28.090, 153.360*, 21.i.1986, R. Raven (QM

S45460); Queensland, West Burleigh, -28.111, 153.441*, 12.ii.1953, Museum Staff, 1F,

1M (QM S45617); Queensland, Lota Creek, Manley West, -27.479, 153.186, 19.iii.2006,

5 m, C. Griswold, D. Silva, R. Raven, B. Baehr, eucalypt casuarina woodland, general collecting, 3FF (CASENT9022943); Queensland, Burnett Highway, rest stop 20 km NW of Monto, -24.800, 150.984, 7.iii.2008, G. Milledge, H. Smith, beat/sweep, under bark, sclerophyll forest, 1M (AM KS103175); Queensland, Daisy Hill, -27.633, 153.150,

1.iv.1997, S. Cowan, for spider exhibition, 1F (AM KS95949); Queensland, Lane Cove, -

33.814, 151.167, 18.vii.1998, W. Wain, 1F (AM KS97279); Queensland, Brisbane Forest

Park, -27.418, 152.830, 23.i.1998, trap 2, 3MM (AM KS118949); Queensland, Brisbane

Forest Park, -27.418, 152.830, 23.i.1998, trap 2, 4MM (AM KS118932); Victoria, Crib

Point, -38.358, 145.219*, 14.v.1978, R. Easton, 2FF (WAM 99/2834-5); Victoria, nr.

Albury, -36.074, 146.914*, i.1974, A.R. Haller, with leaf (MCZ); Victoria, South

Gippsland, Stoney Creek, -38.268, 146.742*, i.1978, K.N. Bell, 1F (MV ENTO2014-

122

19L); Victoria, South Gippsland, Stoney Creek, -38.268, 146.742*, i.1978, K.N. Bell, 1M

(MV ENTO2014-19L); Victoria, South Gippsland, Stoney Creek, -38.268, 146.742*, i.1978, K.N. Bell, 1M (MV ENTO2014-19L); Victoria, South Gippsland, Stoney Creek, -

38.268, 146.742*, i.1978, K.N. Bell, 1Juv (MV ENTO2014-19L); Victoria, South

Gippsland, Stoney Creek, -38.268, 146.742*, i.1978, K.N. Bell, 1Juv (MV ENTO2014-

19L); Victoria, South Gippsland, Stoney Creek, -38.268, 146.742*, i.1978, K.N. Bell,

1Juv (MV ENTO2014-19L); Victoria, Nunawading, -37.817, 145.185*, 18.ii.1995,

Neboiss, 1F (MV ENTO2014-19L); Victoria, Nunawading, -37.817, 145.185*,

18.ii.1995, Neboiss, 1M (MV ENTO2014-19L); Victoria, Mitta Mitta Reserve, -36.642,

147.406*, 9.ii.1973, Dartmouth Survey, 2FF (MV ENTO2014-19L); Victoria, Mitta

Mitta Reserve, -36.642, 147.406*, 9.ii.1973, Dartmouth Survey, 1Juv (MV ENTO2014-

19L); Victoria, Melbourne, -37.738, 144.956*, 23.iv.1992, E. Stafford, 1F (MV

ENTO2014-19L); Victoria, Melbourne, -37.738, 144.956*, v.1956, 1F (MV ENTO2014-

19L); Victoria, Melbourne, Eltham, -37.715, 145.158*, iii.1996, D. Hope, ex mud wasp

nest, 7FF (MV ENTO2014-19L); Victoria, Melbourne, Shire of Diamond Valley, -

37.650, 145.117*, iii.1989, L. Raywood, 1F (MV ENTO2014-19L); Victoria, Carnegie, -

37.895, 145.045*, 23.ii.1955, R.A. Dunn, 1M, 1F (MV ENTO2014-19L); Victoria,

Brunswick, -37.767, 144.963*, 18.ii.1991, 1F (MV ENTO2014-19L); Victoria, 5 km S of

Swifts Creek, -37.250, 147.712*, 2.iii.1993, G. Milledge, 1F (MV ENTO2014-19L);

Victoria, Sunday Island, -38.711, 146.628*, 4FF, 1M (MV ENTO2014-19L); Victoria,

Bruthen, -37.707, 147.832*, 12.iii.1917, D. Leach, 1F (MV ENTO2014-19L); Victoria,

Balwyn, -37.809, 145.079*, 4.iii.1991, 2FF (MV ENTO2014-19L); Victoria, Kallista, -

37.897, 145.387*, 10.iv.1954, 1F (MV ENTO2014-19L); Victoria, Avon River State

123

Forest, Dermodys Camp, -37.805, 146.917, 15.i.2006, V.W. Framenau, M.L. Thomas,

night collection, dry sclerophyll forest, 1M, 1F (WAM 68046); Victoria, Clayton,

Monash University, -37.933, 149.217, 2.iv.1991, M.S. Harvey, M.E. Blosfelds, 10+FF

(WAM 99/21814-30); Victoria, Healesville, Coranderrk Reserve, -37.684, 145.524,

24.ii.1981, M.S. Harvey, 1F (WAM 99/2833); Victoria, Healesville, Coranderrk Reserve,

-37.684, 145.524, 24.ii.1981, M.S. Harvey, 1M (WAM 99/2832); Victoria, Healesville,

Coranderrk Reserve, -37.684, 145.524, 4.iii.1980, M.S. Harvey, inside curled leaf in orb

web, 1F (WAM 99/2833); Victoria, Airey’s Inlet, -38.467, 114.083, 13-14.v.1992, M.S.

Harvey, M.E. Blosfelds, 1F (WAM 99/23811); Victoria, Balwyn, Yandilla St, -37.809,

145.081*, 16.ii.1982, M.S. Harvey, inside house at night, 1M (WAM 99/2183); Victoria,

Balwyn, Yandilla St, -37.809, 145.081*, 31.i.1982, M.S. Harvey, ex web inside house,

1M (WAM 99/2812); Victoria, 5 km S of East-West Rd on Wong Rd, 7 km SW of

Kawarren, -38.500, 143.517, 7.iii.1986, M.S Harvey, B.J. Scott, 1M (WAM 99/2837);

Victoria, P. French, 1F (QM); Victoria, P. French, 2FF (QM); Victoria, P. French, 1F

(QM); Victoria, 2.iv.1896, P. French, 1F (QM); Victoria, 5 km N of Cape Schanck, -

38.461, 144.905*, 14.v.1972, P. Christy, 8FF (QM); Victoria, Bacchus Marsh, -37.675,

144.439*, 22.iv.1974, V. Salanitri, 2FF (QM); Victoria, Bundoora, LTU Campus, -

37.695, 145.064*, 19.ix.1981, 2F (QM); Victoria, Latrobe University, -37.721, 145.048*,

T.R. New, N. Hives, old eucalypt leaves, suspended on Grevilla, 5MM, 1F (QM);

Victoria, Monash University, Snake Gully, -37.933, 145.117*, 10.iv.1975, 1F (QM);

Victoria, Warby Range State Park, 10 km W of Wangaratta, -38.300, 146.110, 2000, M.

Scholes, 1F (QM S54170); Victoria, Lind National Park, 19 km W of Cann River, -

37.576, 148.961, 24.iii.1978, M.R. Gray, 1F (AM KS045205); Victoria, Taggerty, -

124

37.340, 145.716*, 21.iii.1970, M. Gray, eucalypt forest, 3FF (AM KS109372); Victoria,

South Gippsland, Stanley Creek, -38.269, 146.742*, i.1978, K.N. Bell, 1F (QMV);

Victoria, South Gippsland, Stanley Creek, -38.269, 146.742*, i.1978, K.N. Bell, 1M

(QMV); Victoria, South Gippsland, Stanley Creek, -38.269, 146.742*, i.1978, K.N. Bell,

1M (QMV); Victoria, South Gippsland, Stanley Creek, -38.269, 146.742*, i.1978, K.N.

Bell, 1Juv (QMV); Victoria, Nunawading, -37.817, 147.406*, 18.ii.1955, Neiboss, 1F

(QVM); Victoria, Nunawading, -37.817, 147.406*, 18.ii.1955, Neiboss, 1M (QVM);

Victoria, Mitta Mitta, -36.642, 147.406*, 9.ii.1973, Dartmouth Survey, with

Cheirecanthium, 2FF (QVM); Victoria, Mitta Mitta, -36.642, 147.406*, 9.ii.1973,

Dartmouth Survey, with Cheirecanthium, 1Juv (QVM); Victoria, Melbourne, -37.738,

144.956*, 23.iv.1992, E. Stafford, 1F (QVM); Victoria, Melbourne, Shire of Diamond

Valley, -37.738, 144.956*, iii.1989, L. Raywood, 1F (QVM); Victoria, Melbourne, -

37.738, 144.956*, v.1956, 1F (QVM); Victoria, Melbourne, Etham, -37.713, 145.149*,

iii.1996, D. Hope, ex mud wasp nest, 7FF (QVM); Victoria, Arenal, 1988-1989, H.

Manson, 1F (QVM); Victoria, Carnegie, 28.ii.1955, R.A. Dunn, 1F (QVM); Southern

Australia, Port Lincoln, -34.717, 135.850, 12.v.1980, B.Y. Main, 1F (WAM 87415);

Southern Australia, Mallee Scrub, -34.173, 139.084*, 1984, 1F (MV ENTO2014-19L);

Southern Australia, Kangaroo Island, -35.833, 137.250*, v.1951, J. Bechervaise, 2F (MV

ENTO2014-19L); Southern Australia, Bridgewater, Towers Rd, -35.000, 138.767,

12.ii.1990, B.Y. Main, 1F (WAM 87423); Southern Australia, Mount Bold Reservoir

Reserve, -35.113, 138.703*, 5.ii.1976, P. Walker, with leaf, 1F (AM KS32101); Southern

Australia, Onkaparinga Gorge, -35.164, 138.665*, 21.v.1976, P. Walker, with leaf, 1F

(AM KS32116); Southern Australia, Cleland Conservation Park, -34.978, 138.700,

125

18.iii.2002, G. Milledge, H Smith, 1M (AM KS76381); Southern Australia, Coffin Bay

National Park, nr. turnoff to Point Avoid, -34.650, 135.357, 23.iii.2002, G. Milledge, H.

Smith, 1F (AM KS76449); Southern Australia, Belair National Park, Saddle Hill Road, -

35.012, 138.675, 19.iii.2002, G. Milledge, H. Smith, 1F (AM KS76388); Southern

Australia, Mallee Scrub, 1984, 1F (QVM); Australian Capital Territory, Canberra, -

33.283, 149.217, 1963, Kerr (CSIRO) by B.Y. Main, 1F (WAM 99/2792); Australian

Capital Territory, Canberra, Gianinderra, -35.329, 149.072*, 9.iv.1963, C.R. MacLellan, on Acacia, 1M, 1F (MCZ); Australian Capital Territory, Canberra, Najor Orchard, -

35.281, 149.129*, 15.v.1963, C.R. MacLellan, in Pyracantha, 1M, 1F (USNM);

Australian Capital Territory, Canberra, -35.281, 149.129*, 24.v.1992, G. Milledge, 1F

(MV ENTO2014-19L); Australian Capital Territory, Black Mountain, -35.300, 149.133,

14.ii.1962, M.A. Shearer, 1F (WAM 101112); Australian Capital Territory, Canberra, -

35.300, 149.133, 1963, Kerr, with eggsac, 1F (WAM 101113); Australian Capital

Territory, Canberra, -35.300, 149.133, 1963, Kerr, 4FF (WAM 101114); Australian

Capital Territory, Canberra, -35.238, 149.217, Kerr (CSIRO) by B.Y. Main, 10+FF

(WAM 99/2772-91); Australian Capital Territory, Red Hill, 14 Pera Pera Place, -38.366,

145.524*, 15.vi.1982, M.S. Harvey, ex curled leaves in partial or complete orb webs, 8FF

(WAM 99/2793-800); Australian Capital Territory, Red Hill, 14 Pera Pera Place, -38.366,

145.524*, 16.iv.1993, M.S. Harvey, sitting on ceiling inside house, 1M (WAM 99/2801);

Australian Capital Territory, Red Hill, 14 Pera Pera Place, -38.366, 145.524*, 24.v.1981,

M.S. Harvey, ex curled leaves, 2FF (WAM 99/2802-3); Australian Capital Territory,

Canberra, -35.281, 149.129*, E. McCallan, prey of Pison spinolae, 3MM, 2FF (QM);

Australian Capital Territory, Canberra, -35.281, 149.129*, 12.v.1982, D.C.F. Rentz,

126

10+FF (QM); Australian Capital Territory, Canberra, -35.281, 149.129*, 28.ii.1982, E.

McCallan, prey of Pison spinolae, 1F (QM); Australian Capital Territory, Canberra, -

35.281, 149.129*, i.1980, E. McCallan, prey of Pison spinolae, 10+FF (QM); Australian

Capital Territory, Canberra, Red Hill, -38.366, 145.524*, 9.v.1982, M.S. Harvey, 1F

(QM); Australian Capital Territory, -35.281, 149.129*, 10.i.1981, E. McCallan, spiders in

leaf roll, 1F (QM S45654); Queensland, Dalby, Mt. Pleasant, -27.191, 151.261*, N.

Geary, 1F (QM S45626); Australian Capital Territory, Canberra, Gianinderra, -35.329,

149.072*, 9.iv.1963, C.R. MacLellan, in Acacia, 1M, 1F (AM KS77090); Tasmania,

George Town, -41.100, 146.817, vi.1978, R. Easton, 1F (WAM 85278); Tasmania,

Trevallyn, -41.443, 147.101*, 1.ii.1928, V.V. Hickman, orb-web in irregular network,

1F, 1M (AM KS28575); Tasmania, Eaglehawk Neck, Penzance, -43.009, 147.921*,

6.iii.1996, M. Moulds, 1F (AM KS28675); Tasmania, East Risdon, -42.822, 147.325*, iv.1965, 1F (AM KS28673); Tasmania, St. Helens, nr. caravan park, -41.333, 148.253,

8.iii.2006, 33 m, G. Hormiga, L. Lopardo, disturbed eucalypt woodland, 5FF; Tasmania,

St. Helens, nr. caravan park, -41.333, 148.253, 8.iii.2006, 33 m, G. Hormiga, L. Lopardo, disturbed eucalypt woodland, 5FF; Tasmania, St. Helens, nr. caravan park, -41.333,

148.253, 8.iii.2006, 33 m, G. Hormiga, L. Lopardo, disturbed eucalypt woodland, 1F,

1M; Tasmania, St. Helens, nr. caravan park, -41.333, 148.253, 8.iii.2006, 33 m, G.

Hormiga, L. Lopardo, disturbed eucalypt woodland, 1M, 1F; Tasmania, East Coast,

Bicheno lookouts, -41.867, 148.300, 24-26.v.1996, 60 m, L.J. Boutin, dry eucalypt forest on granite, ex rolled eucalypt leaf in orb web, 5 FF (TMAG J4748); Tasmania, East

Coast, Bicheno lookouts, -41.867, 148.300, 31.i.1998, L.J. Boutin, dry eucalypt forest on granite, ex sweeping #25 grass/shrubs, 1M, 1F (TMAG J3579); Tasmania, Freycinet

127

National Park, -42.150, 148.300, 27.v.1996, L.J. Boutin, eucalypt forest on granite, ex under rocks and bark, 1F (TMAG J4751); Tasmania, St. Helens, nr. caravan park, -

41.333, 148.253, 8.iii.2006, 30 m, disturbed eucalypt woodland, general collecting, 3FF

(CASENT9022674); Tasmania, St. Helens, nr. caravan park, -41.333, 148.253, 8.iii.2006,

30 m, disturbed eucalypt woodland, general collecting, 3FF (CASENT9022674);

Tasmania, St. Helens, nr. caravan park, -41.333, 148.253, 8.iii.2006, 30 m, disturbed eucalypt woodland, general collecting, 3FF (CASENT9022674); Tasmania, St. Helens, nr. caravan park, -41.333, 148.253, 8.iii.2006, 30 m, disturbed eucalypt woodland, general collecting, 3FF (CASENT9022674); Tasmania, Brooks Creek, West Coast,

7.iii.1981, Earthwatch, 2FF (NMV 13:44514); Tasmania, Launceston, 17 Wentworth

Street, -41.446, 147.161*, 24.ii.1971, R. Upson, 1M, 1F (NMV 13:43173); Tasmania,

Launceston, 17 Wentworth Street, -41.446, 147.161*, 24.ii.1971, R. Upson, 1M, 1F

(NMV 13:43163); Tasmania, Launceston, 17 Wentworth Street, -41.446, 147.161*,

24.ii.1971, R. Upson, 1M, 1F (NMV 13:43171); Tasmania, Launceston, -41.446,

147.161*, R.T. Green, 2FF (NMV 13:44513); Tasmania, Exeter, -41.299, 146.952,

6.ii.1963, R.H. Green, 4FF, 1M (NMV 13:11187).

128

Figure 25. Phonognatha melania. Female: A, ALS; B, PMS; C, PLS; D, epigynum, ventral. Male pedipalp: E, apical; F, ectal; G, ventral; H, mesal; I, dorsal. Scale bars (μm): A-C: 10; D-I: 100.

Phonognatha melania (L. Koch, 1871)

Figs. 25-28

Epeira melania L. Koch, 1871: 100, Plate 8, Fig. 3 (female). Australia, Queensland,

129

between Port Denison and Bowen, syntypes (ZMUH, examined).

Meta melania Keyserling, 1887a: 207, Plate 18, Fig. 7 (male).

Singotypa melania Simon, 1894a: 749.

Phonognatha melania Dondale, 1966: 1172, Fig. 5H-O (female, male); Hickman, 1967:

56, Figs. 99-102 (female, male).

Singotypa pallida Dalmas, 1917: 435 (female; type depository unknown, not examined).

New synonymy.

NOTE: P. pallida is described as similar to P. melania except for being smaller and paler.

Given the variation within P. melania (including reversible color change in other

Phonognatha), it is not clear to us why this taxon is unique from P. melania.

Furthermore, the type status and depository are unknown.

Diagnosis

Males of P. melania can be distinguished from congeners based on their palpal tibiae,

which are slightly longer than (up to 1.5 times, Fig. 27B) the length of the palpal

cymbium, and broader mid-conductor process (Fig. 27E). Other Phonognatha have

palpal tibiae shorter than the cymbium except for P. tanyodon n. sp., which has a tibia

many times longer than the cymbium (Fig. 35B). The females have an elongated

abdomen of relatively equal width for the length of it, with two dark markings on the

dorsal area and spinnerets positioned centrally on the venter. The abdomen of Artifex

species are somewhat elongated but with a crescent- or ring-shaped dorsal pattern and wide, solidly dark posterior.

130

Description

Female (Figs. 25A-D, 26)(from Western Australia, Walpole-Nornalup National Park,

GH0113). Total length 9.62. Carapace 3.71 long, 2.73 wide, 1.05 high, yellowish brown to reddish brown; sternum 1.879 long, 1.39 wide, of similar color, with dark margins and pale longitudinal band. Eye rows slightly recurved, anterior row more so than posterior.

AMEs on small prominence; lateral eyes juxtaposed, paired on a small prominences;

AME diameter 0.18; AMEs interdistance ca. 1 ½ AME diameter; AME-PME distance ca.

1 AME diameter. Clypeus ca. 1 AME diameter. Paturon yellowish brown to reddish

brown, with 3 prolateral and 2-3 retrolateral teeth; cheliceral fang curves mesally about a

third of the way from the chelicera. Legs colored as cephalothorax; femur I sigmoid;

formula 1243: femur I 3.44, patella I 1.22, tibia I 3.47, metatarsus I 3.69, tarsus I 1.18;

femur II 2.74, patella II 1.03, tibia II 2.53, metatarsus II 2.66, tarsus II 0.94; femur III

1.70, patella III 0.65, tibia III 1.04, metatarsus III 1.28, tarsus III 0.63; femur IV 2.54,

patella IV 1.05, tibia IV 1.90, metatarsus IV 1.72, tarsus IV 0.62. Abdomen 6.54 long,

3.78 wide, 3.89 high; very elongate, light brown with pale guanine crystals; anterior

dorsum with pair of ovate brown markings; posterior dorsum brown; two longitudinal

stripes of guanocytes between epigastric furrow and spinning field, which is centrally

positioned; one stripe of guanocytes extends caudally from spinning field. Epigynum

131

Figure 26. Phonognatha melania, female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

132

Figure 27. Phonognatha melania, male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A-D: 0.5; E-I: 0.1.

133 with ventral-facing, sclerotized copulatory openings, with sclerotized point caudal to opening; setae on outer side of copulatory openings crossing over openings; copulatory ducts include multiple spiral convolutions extending anteriorly then turning back to spermathecae; fertilization ducts emerge from posterior region of spermathecae and extend dorsally.

Male (Figs. 25E-I, 27)(from Western Australia, Lane Poole Reserve, WAM 99/2892-4).

Total length 4.51. Carapace 2.51 long, 1.69 wide, 0.91 high, yellowish brown to reddish brown; sternum 1.26 long, 0.92 wide, yellowish brown. Eye rows slightly recurved, anterior row more so than the posterior. Eye rows slightly recurved, anterior row more so than the posterior. AMEs on small prominence; lateral eyes juxtaposed, on small prominences. AME diameter 0.17; AMEs interdistance ca. 1 AME diameter; AME-PME distance ca. 1 AME diameter. Clypeus ca. ½ AME diameter. Chelicerae yellowish brown to reddish brown, with 3 prolateral and 2 retrolateral teeth; cheliceral fang bends mesally by almost 90°, then curving slightly again at approximately the midpoint. Legs colored as cephalothorax; femur I sigmoid; formula 1243: femur I 3.54, patella I 1.26, tibia I 3.71, metatarsus I 3.76, tarsus I 1.06; femur II 2.52, patella II 1.03, tibia II 2.72, metatarsus II

2.45, tarsus II 0.89; femur III 1.36, patella III 0.61, tibia III 0.91, metatarsus III 1.05, tarsus III 0.58; femur IV 1.89, patella IV 0.82, tibia IV 1.62, metatarsus IV 1.52, tarsus

IV 0.61. Abdomen 2.35 long, 1.67 wide, 1.07 high; dorsal face light brown with pale guanine crystals; 4-5 pairs of discrete dark brown markings on dorsum, with a central longitudinal stripe; ventral face with two longitudinal stripes of guanocytes between epigastric furrow and spinning field. Pedipalpal tibia approximately 1.5 times length of

134

cymbium; mid-conductor process broad, with flattened rather than pointed tip,

approximately half length of conductor’s elongate part.

Variation

Females’ (n=5) total length 8.78–11.63; carapace length 3.25–3.65, width 1.99–2.73, height 0.93–1.44; abdomen length 6.04–8.19, width 3.21–4.56, height 3.48–4.41; sternum

length 1.51–1.88, width 1.07–1.39. Males’ (n=5) total length 4.51–6.96; carapace length

2.51–3.26, width 1.50–2.23, height 0.78–0.91; abdomen length 2.35–4.01, width 1.67–

2.43 height 1.07–2.30; sternum length 1.17–1.49, width 0.92–1.31.

Distribution

P. melania is perhaps the most widespread species of Phonognatha. Described from

Queensland, but is most common in Western Australia. This species has been collected in

all states except the Northern Territory (Fig. 28).

Natural History

This species exhibits a degree of sexual size dimorphism, with males sometimes as little

as half the size of the female. Collecting records suggest cohabitation of adult males and

immature females as described in P. graeffei (Fahey and Elgar 1997).

Additional material examined

Western Australia, Langford, -32.044, 115.942*, 17.x.1992, Scheer, Keen, 1F (QM

S51219); Western Australia, Spearwood, -32.100, 115.738*, 10.ii.1952, B.Y. Main, in

dead bush wattle, 1F (WAM); Western Australia, Yanchap National Park, nr. ranger’s

office, -31.517, 115.767, 20.iv.1993, J.M. Waldock, A. Sampey, 1F (WAM 99/2983);

135

Figure 28. Distribution of Phonognatha melania.

Western Australia, Booanya, -32.654, 123.508*, ii.1982, A.E. Baesjou, 4FF, 1M (MV

ENTO2014-19L); Western Australia, Canning Well, -22.366, 121.308*, vi.1988, B.

Harvey, 1F (MV ENTO2014-19L); Western Australia, Mason Bay, -33.955, 120.480,

14.iii.2007, G. Byrne, inside curled leaf, low heathland, 3FF (WAM 85348); Western

Australia, Jarrahdale, Alcoa mine area, -32.267, 116.100, 12.i.1997, K.E.C. Brennan, suction sample, 1M (WAM 54848); Western Australia, Jarrahdale, Alcoa mine area, -

43.640, 116.240, ii.2001, M.L. Moir, suction sample, from Lomandra sonderi (WAM

136

133381); Western Australia, Jarrahdale, Alcoa mine area, -43.640, 116.240, ii.2001, M.L.

Moir, suction sample, from Bossiaea aquifolium (WAM 133381); Western Australia,

Jarrahdale, Alcoa mine area, -43.640, 116.240, ii.2001, M.L. Moir, suction sample, from

Bossiaea aquifolium (WAM 133381); Western Australia, Jarrahdale, Alcoa mine area, -

43.640, 116.240, v.2001, M.L. Moir, suction sample, from Microzamia riedlei (WAM

133381); Western Australia, Alcoa mine site, N and NW of Jarrahdale, -32.267, 116.100,

iii.1993, S.J. Simmonds, 1F (WAM 33875); Western Australia, Walpole-Nornalup

National Park, Anderson Rd, -34.995, 116.871, 5.iii.2008, M.G. Rix, M.S. Harvey,

sifting/beating, 1F (WAM94787); Western Australia, Goongarrie Station, site GG2, -

29.976, 121.056, 1.v.1996, P.L.J. West et al., by hand, 1F (WAM 41767); Western

Australia, Goongarrie Station, site GG12, -30.019, 121.028, 1.v.1996, P.L.J. West et al., dry pitfall trap, 1F (WAM 41768); Western Australia, Stirling Range Retreat, caravan park, -34.315, 118.187, M.S. Harvey, J.M. Waldock, K. Edward, C. Poustie, 1F (WAM

85271); Western Australia, Stirling Range National Park, Wedge Hill, -34.421, 118.183,

2.v.1996, M.S. Harvey, J.M. Waldock, B.Y. Main, 1F (WAM 85273); Western Australia,

Stirling Range National Park, S of Bluff Knoll, on flat south of track, -34.383, 118.250,

1.v.1996, 1F (WAM 85274); Western Australia, Stirling Range National Park, south side of Mt. Magog, sand flat, -34.417, 117.917, 24.iv.1996, J.M. Waldock, orb-web with curled leaf, 1F (WAM 85276); Western Australia, Stirling Range caravan park, -34.317,

118.200, 30.iii.1993, M.S. Harvey, J.M. Waldock, at night, 2FF (WAM 99/2971-2);

Western Australia, Wyalkatchem Nature Reserve, -31.171, 117.408, M.S. Harvey,

J.M.Waldock, at night, 1F (WAM 40682); Western Australia, Mount Cooke, -32.417,

116.300, 16.vi.1991, M.S. Harvey, J.M. Waldock, 1F (WAM 85275); Western Australia,

137

Mount Cooke, -32.417, 116.300, 18.vi.1991, M.S. Harvey, J.M. Waldock, 6FF (WAM

99/2896-901); Western Australia, Tutanning Nature Reserve, western end, site WK8, -

32.541, 117.281, 15.x.1997, P. van Heurck, et al., wet pitfall trap, 1M (WAM85279);

Western Australia, Pedro’s Farm, Dingo Flat Rd, northern boundary of Walpole-

Nornalup National Park, -34.950, 116.850, 13.v.1989, B.Y. Main et al., foliage at night,

1F (WAM 111808); Western Australia, Jarrahdale, Alcoa mine area, -32.267, 116.100, iv.1998, K.E.C. Brennan, suction sample, 1F (WAM 54859); Western Australia, Cape

Range area, outside Cave C-64, #3576, -22.050, 114.017, 27.vi.1989, B. Vine, 2FF

(WAM 88566); Western Australia, Charles Darwin Reserve, near dam, -29.468, 117.060,

7.v.2009, M.S. Harvey, 1F (WAM 97770); Western Australia, Charles Darwin Reserve, near dam, -29.468, 117.060, 7.v.2009, M.S. Harvey, 1F (WAM 97771); Western

Australia, Fraser Range Station, New Bore Paddock, -32.067, 122.800, 23.iv.1995, A.F.

Longbottom, curled leaf retreat orb web on fence, 1F (WAM 99/2886); Western

Australia, Hoffman’s Mill, -33.067, 122.800, 29.iii.1959, B.Y. Main, 1F (WAM

99/2891); Western Australia, Shannon Range at Nelson, -34.717, 116.350, 16-18.ii.1990,

M.S. Harvey, M.E. Blosfelds, 20+FF, 10+MM (WAM 99/2910-65); Western Australia,

Shannon National Park, -34.250, 116.400, 24.iii.1993, M.S. Harvey, J.M. Waldock, in

orb web, 1F (WAM 99/2909); Western Australia, Shannon National Park, Dog Pool, -

34.767, 116.367, 22.iii.1993, M.S. Harvey, J.M. Waldock, at night, 1F (WAM 99/2872);

Western Australia, Nugadog Forest Reserve, south border, -30.183, 116.917, 22.v.1996,

M.S. Harvey et al., 1F (WAM 99/2867); Western Australia, Mount Barker, 16 Osborne

Rd, -34.633, 117.667, xii.1992, P.J. Mann, 1M (WAM 99/2866); Western Australia,

Mount Barker, 16 Osborne Rd, -34.633, 117.667, 28.iii.1990, A.F. Longbottom, 1F

138

(WAM 99/2895); Western Australia, Banganup Lake, -32.167, 115.817, 30.iii.1990, M.S.

Harvey, J.M. Waldock, 5FF (WAM 99/2875-9); Western Australia, Denmark, -34.950,

117.350, 12.iv.1992, R.P. McMillan, 1F (WAM 99/2862); Western Australia, Darlington,

-31.920, 116.079*, v.1975-iii.1975, C.H. Lowe, 1F (WAM 99/2882); Western Australia,

Cranbrook, -34.247, 117.518, 13.iv.1952, B.Y. Main, 1F (WAM 99/2861); Western

Australia, Torndirrup National Park, North Frenchman’s Bay Rd, -35.100, 117.900,

25.iv.1990, M.S. Harvey, J.M. Waldock, 2FF (99/2973-4); Western Australia, Wilson

Inlet, -34.983, 117.350, 21.ii.1990, M.S. Harvey, M.E. Blosfelds, 7FF, 1M (WAM

99/2975-82); Western Australia, between Chittering and Pearce, -31.500, 116.000, G.H.

Lowe, 1F (WAM 99/2881); Western Australia, between Chittering and Pearce, -31.500,

116.000, G.H. Lowe, 1M (WAM 99/2860); Western Australia, John Forrest National

Park, -31.885, 116.094*, 4.vi.1989, V.E.Davies, 2FF (WAM 99/2863-4); Western

Australia, 40 mi W of Ravensthorpe, Camp Creek, nr. Sussetta River, -33.600, 119.368*,

13.i.1952, B.Y. Main, 2FF (WAM 99/2869-70); Western Australia, Porongurups, north end, -34.700, 117.850, 16.ii.1993, A.F. Longbottom, stunted jarrah area, 1F (WAM

99/2868); Western Australia, 5 km SW of Gidgeegannup, -31.333, 116.150, 6.v.1969,

6.v.1969, WA Arachnology Group, 4FF (WAM 99/2887-90); Western Australia,

Blackboy Picnic Site, 2.5 km along Honeymoon Rd, jut N of Harvey, -33.067, 115.900,

18.iv.1995, M.S. Harvey, M.E. Blosfelds, in rolled leaf, 1F (WAM 99/2859); Western

Australia, Blackboy Picnic Site, 2.5 km along Honeymoon Rd, jut N of Harvey, -33.067,

115.900, 18.iv.1995, M.S. Harvey, M.E. Blosfelds, in rolled leaf, 1F (WAM 99/2880);

Western Australia, Fitzgerald River National Park, -33.888, 199.885*, 11.ii.1985, R.P.

McMillan, 3FF (WAM 99/2883-5); Western Australia, Pemberton Youth Hostel, -34.400,

139

115.967, 1-2.v.1990, M.S. Harvey, J.M. Waldock, 1F (WAM 99/2905); Western

Australia, Lane Poole Reserve, 15 km S of Dwellingup, -32.723, 116.076*, 2.iii.1987, O.

Mueller, in open jarrah, mostly in Macrogamia, 2MM, 1Juv (WAM 99/2892-4); Western

Australia, Melaleuca Park, NE of Wanneroo, 7.iv.1990, M.S. Harvey, 1F (WAM 99/905);

Western Australia, Mundaring Weir, wall, -31.967, 116.167, 7.ii.1990, M.S. Harvey,

M.E. Blosfelds, 2FF (WAM 99/2903-4); Western Australia, Jog Pool on Shannon River,

-34. 767, 116.367, 1990, M.S. Harvey, J.M. Waldock, 1F (WAM 99/2908); Western

Australia, gorge bisecting lateritic ridge, ca. 5-6 km of Mt. Dale, 24.iv.1994, J.M.

Waldock, K. Brimmell, inside curled leaf in orb web, 1F (WAM 99/2902); Western

Australia, Geraldton, Spalding Park, -28.750, 114.617, 13.iv.1992, M.S. Harvey, 1F

(WAM 99/2970); Western Australia, 7 km N of South Coast Highway, -34.933, 117.367,

26.iv.1990, M.S. Harvey, J.M. Waldock, 4FF (WAM 99/2966-9); Western Australia,

Ballidu, -30.600, 116.767, 24.v.1996, J.M. Waldock, in curled leaf in orb web, 1F (WAM

99/2858); Western Australia, Stirling Range National Park, Toolbrunup Track, -34.400,

118.067, 31.iii.1993, M.S. Harvey, J.M. Waldock, night, 1F (WAM 99/2873); Western

Australia, Jarrah, 35 km NW of Kojonup, -33.611, 116.873, 9.v.1982, B.Y. Main, V.E.

Davies, 9FF (QM); Western Australia, North Kojunup, -33.833, 117.159*, 4.iv.1982,

B.Y. Main, V.E. Davies, 2FF (QM); Western Australia, Torbay, Dingo Beach track, -

35.017, 117.633*, 10.v.1982, B.Y. Main, V.E. Davies, 1F (QM); Western Australia,

Wilga, gravel ridge, -33.669, 116.272*, 23.ii.1986, L. Broadwater, V.E. Davies, G.B.

May, night collecting, 1F (QM S45435); Western Australia, Stirling Range National

Park, Gold Holes, -34.400, 118.067*, in leaf (AM KS14508); Western Australia,

Walpole-Nornalup National Park, Two Road, 11.1 km 282W Walpole, -34.965, 16.607,

140

26.ii.2006, 30 m, G. Hormiga, L. Lopardo, eucalypt forest and open heathland, many FF;

Western Australia, Walpole-Nornalup National Park, Two Road, 11.1 km 282W

Walpole, -34.965, 116.607, 26.ii.2006, 30 m, G. Hormiga, L. Lopardo, eucalypt forest and open heathland, many FF; Western Australia, Walpole-Nornalup National Park, Two

Road, 11.1 km 282W Walpole, -34.965, 116.607, 26.ii.2006, 30 m, G. Hormiga, L.

Lopardo, eucalypt forest and open heathland, many FF; Western Australia, Walpole-

Nornalup National Park, Two Road, 11.1 km 282W Walpole, -34.965, 116.607,

26.ii.2006, 30 m, G. Hormiga, L. Lopardo, eucalypt forest and open heathland, 12FF;

Western Australia, Walpole-Nornalup National Park, Two Road, 11.1 km 282W

Walpole, -34.965, 116.607, 26.ii.2006, 30 m, G. Hormiga, L. Lopardo, eucalypt forest and open heathland, 10FF; Western Australia, Walpole-Nornalup National Park, Two

Road, 11.1 km 282W Walpole, -34.965, 116.607, 26.ii.2006, 30 m, G. Hormiga, L.

Lopardo, eucalypt forest and open heathland, 1M, 1F; Western Australia, Walpole-

Nornalup National Park, Two Road, 11.1 km 282W Walpole, -34.965, 116.607,

26.ii.2006, 30 m, G. Hormiga, L. Lopardo, eucalypt forest and open heathland, 1F;

Western Australia, Walpole-Nornalup National Park, Two Road, 11.1 km 282W

Walpole, -34.965, 116.607, 26.ii.2006, 30 m, G. Hormiga, L. Lopardo, eucalypt forest and open heathland, 3FF; Western Australia, Tinglewood, nr. cabins, 6.98 km N of

Walpole, -34.914, 116.731, 24.ii.2006, 185 m, G. Hormiga, L. Lopardo, 1M, 1F; Western

Australia, Tinglewood, nr. cabins, 6.98 km N of Walpole, -34.914, 116.731, 24.ii.2006,

185 m, G. Hormiga, L. Lopardo, 1F, 1M; Western Australia, D’Entrecasteux National

Park, Mandalay Beach, 13.8 km W Walpole, -34.986, 116.589, 25.ii.2006, 70 m, G.

Hormiga, L. Lopardo, heathland on white sand, with Proeaceae and Xanthakeaceae,

141

13FF; Western Australia, Jarrahdale, -32.267, 116.100*, asummetrical web, curled leaf,

1F (AM KS109401); Western Australia, Witchcliffe, nr. Golgotha Cave, -34.013,

115.106, 23.i.1974, M. Gray, sweeping understory in karri forest, 1M (AM KS32886);

Western Australia, Hovea, 545 Hedges Road, -31.892, 116.116, 10.iv.2016, K.

Framenau, T. Melissa, mixed Jarrah/Marri forest, 2MM, 5FF (PES 28866); Queensland,

Broadwater Lake Conservation Area, 20 km SE of Dalby, SW Track, -27.378, 151.277*,

28.iv.2002, 3FF (USNM); Queensland, Birdsville to Mt. Isa, vii.1987, B. Harvey, 1F

(MV ENTO2014-19L); Queensland, 15 miles S of Greymare, -36.428, 148.297*,

29.xii.1973, sweeping long grass under dry sclerophyll, 4MM (QM S45657);

Queensland, Crater Rewan, iv.1984, A. Rozefelds, 3FF (QM S39776); Queensland,

Braemar State Forest, via Kogan, -29.054, 152.997*, GBM, ex Callitrus, 1F (QM

S39743); Queensland, Kroombit Park, nr. Biloela, -24.377, 151.041*, 15.viii.1997, H.

Beare, 1F (AM KS50787); Queensland, Eurimbola, SE of Gladstone, rainforest site 4, -

24.183, 151.833, iii.1975, 0 m, C. Horseman, 1M, 1F (AM KS0252); Queensland,

Taunton National Park, NE corner just off road, -23.493, 149.278, 9.v.2000, G. Milledge,

H. Smith, 1F (AM KS66499); Queensland, Conway National Park, site 34, -20.412,

148.795*, 8.xi.1991, R. Raven, swamp at start of Mount Rooper walk, 1M (QM S33973);

Tasmania, Risdon, -42.822, 147.327*, 27.ii.1964, V.V. Hickman, 2MM, 1F, 1Juv

(MCZ); Tasmania, East Risdon, -42.822, 147.325*, V.V. Hickman, 10+FF (USNM);

Tasmania, 2.i.1928, V.V. Hickman, 2MM, 1F (WAM); Tasmania, Risdon, -42.822,

147.327*, 27.iii.1952, V.V. Hickman, FF (AM KS28661); Tasmania, East Risdon, -

42.822, 147.325*, 10.vi.1957, V.V. Hickman, in curled leaf web, 6FF (AM KS28674);

Tasmania, Punchbowl, -41.457, 147.167*, 2.ii.1928, V.V. Hickman, 2FF (AM

142

KS28582); Tasmania, Domain, -42.865, 147329*, 19.iii.1964, V.V. Hickman, among

grass, 1M (AM KS28676); Tasmania, Risdon, -42.822, 147.327*, 20.vii.1960, J.L.

Hickman, V.V. Hickman, in curled leaf suspended in orb web, FF (AM KS28660);

Tasmania, Domain, -42.865, 147329*, 27.iv.1973, V.V. Hickman, in curled leaf, 1F (AM

KS28677); Victoria, Dimboola, -36.387, 142.054*, 1988-1989, H. Manson, 2FF (MV

ENTO2014-19L); Victoria, 18 km N of Healesville, -37.583, 145.517, 5.iv.1991, M.S.

Harvey, M.E. Blosfelds, 1F (WAM 99/2836); New South Wales, Wagga Wagga, nr.

Collorboralli, -35.250, 147.333, 18.iv.1993, C.A. Car, 1F (WAM 99/2986); New South

Wales, nr. Dubbo, -32.250, 148.616*, 28-29.i.1983, V.C. Levitt, 1F (AM KS34250);

New South Wales, Warderry State Forest, -33.699, 148.203, 15.iii.2002, G. Milledge, H.

Smith, in curled leaf, 1F (AM KS76354); New South Wales, Euabalong, Round Hill, -

33.036, 146.386*, 15.v.1969, M. Gray, 1F (AM KS109274); New South Wales,

Cocoparra National Park, Woolshed Flat campsite, -34.079, 146.223, 15.iii.2002, G.

Milledge, H. Smith, head torch, 1F (AM KS76357); New South Wales, Broken Hill, The

Pinnacles, -31.994, 141.470* (AM KS32881); New South Wales, Kosciuszko National

Park, Waste Point, 8.3 km N Jindabyne, -36.350, 148.606, 1.iii.2008, 930 m, A. Hegedus,

nigh collection 1F (AM KS104530); Southern Australia, Kangaroo Island, -35.833,

137.250*, v.1951, J. Bechervaise, 2F (MV ENTO2014-19L); Southern Australia,

Mambray Creek National Park, Flinders Range, -32.808, 137.983*, 8.iv.1973, M. Gray,

rolled leaf in orb web, 1F (AM KS10245); Southern Australia, 23 km N of Warrow, -

34.172, 135.387, 22.iii.2002, G. Milledge, H. Smith, 1F (AM KS76434); Southern

Australia, Pinkawillinie Conservation Park, track SW of Paney High School, 2 km from

N border of par, -32.789, 135.509, 22.iii.2002, G. Milledge, H. Smith, curled leaf, 2MM

143

(AM KS86117); Australian Capital Territory, Canberra, -35.282, 149.129*, 15.v.1963,

C.R. MacLellan, on Pyracantha, 1F (WAM); Australian Capital Territory, Canberra, -

35.281, 149.129*, 4.iii.1972, E. McCallan, prey of Pison spinolae, 3FF (QM); Australian

Capital Territory, Canberra, -35.281, 149.129*, i.1980, E. McCallan, prey of Pison spinolae (QM); Australian Capital Territory, Canberra, Najor Orchard, -35.281,

149.129*, 15.v.1963, C.R. MacLellan, on Pyracantha, 1F (MKS33817).

Phonognatha neocaledonica Berland, 1924, new combination

Figs. 29-32.

Phonognatha graeffei neocaledonica Berland, 1924: 213, Fig. 113-117. New Caledonia,

Ouéna, between Oubatche and Tao, 23.vi.1911, Sarasin and Roux (type depository unknown, not examined).

Diagnosis

This species is one of two zygielline species known from New Caledonia. The very short palpal tibia (approximately half the length of the cymbium, Fig. 31B,E-I) is similar to A. melanopyga, but the mid-conductor process is more pointed than A. melanopyga and lacks the mesal membrane present in Artifex. Their epigyna are similar to those of P. tanyodon, though this species’s copulatory opening is more sclerotized (Fig. 30E).

Description

Female (Figs. 29-30)(from Mandjélia, QM S17777). Total length 9.11. Cephalothorax

144

Figure 29. Phonognatha neocaledonica comb. nov. Female: A, ALS; B, PLS; C, PMS; D, epigynum, ventral. Scale bars (μm): A-C: 10; D: 100.

3.65 long, 2.14 wide, 1.25 high. Carapace yellowish brown, with pars cephalica darker

than pars thoracica; sternum 1.60 long, 1.34 wide, with dark margins and pale median

band. Eye rows slightly recurved, anterior row more so than the posterior. AMEs on

small prominence; lateral eyes juxtaposed, paired on a small prominences; AME diameter

0.21; AMEs interdistance slightly less than ca. 1 AME diameter; AME-PME distance ca.

1 AME diameter. Clypeus ca. ½ AME diameter. Paturon reddish brown, with three prolateral and three retrolateral teeth; cheliceral fang curves mesally about a third of the way from paturon. Legs colored as carapace; femur I sigmoid; formula 1243: femur I

4.00, patella I 1.31, tibia I 3.51, metatarsus I 3.75, tarsus I 1.27; femur II 3.19, patella II

145

Figure 30. Phonognatha neocaledonica comb. nov., female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

146

1.09, tibia II 2.54, metatarsus II 3.06, tarsus II 1.07; femur III 2.31, patella III 0.58, tibia

III 1.45, metatarsus III 1.52, tarsus III 0.86; femur IV 3.17, patella IV 1.05, tibia IV 2.30, metatarsus IV 2.58, tarsus IV 1.00. Abdomen 6.15 long, 4.67 wide, 4.85 high, light brown with pale guanine crystals; three to four pairs of brown markings on dorsum, with a central brown longitudinal stripe caudally; ventral face with area with guanocytes posterior to epigastric furrow, decreasing closer to spinning field. Epigynum with broad sclerotized area, extending anteriorly; copulatory openings ventrally facing, with sclerotized ridges; copulatory ducts turn with multiple looping convolutions in an anterior lobe before turning on itself before reaching spermathecae; fertilization ducts emerge from posterior region of spermathecae and extend dorsally.

Male (Fig. 31)(from near Canala, WAM T85283). Total length 4.47. Carapace 2.57 long,

1.86 wide, 1.09 high. Carapace reddish brown; sternum 1.19 long, 1.10 wide, orange- yelwith darker, brownish edge. Eye arrangement as in female. AME diameter 0.14;

AMEs interdistance ca. 1 AME diameter; AME-PME distance ca. 1 AME diameter.

Clypeus ca. 1 AME diameter. Paturon reddish brown, with three prolateral and three retrolateral teeth; cheliceral fang curves mesally about a third of the way from paturon.

Legs colored as cephalothorax; femur I sigmoid; formula 1243: femur I 3.20, patella I

1.08, tibia I 3.51, metatarsus I 3.87, tarsus I 1.03; femur II 2.47, patella II 0.95, tibia II

2.45, metatarsus II 2.58, tarsus II 0.86; femur III 1.48, patella III 0.59, tibia III 1.01, metatarsus III 1.21, tarsus III 0.56; femur IV 1.90, patella IV 0.75, tibia IV 1.63, metatarsus IV 2.10, tarsus IV 0.76. Abdomen 2.44 long, 1.33 wide, 1.40 high, dorsal face

147

Figure 31. Phonognatha neocaledonica comb. nov., male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A-D: 0.5; E-I: 0.1.

148

light brown with pale guanine crystals; indistinct light brown markings positioned

dorsolaterally; ventral face of abdomen with guanocytes posterior to epigastric furrow;

desiccation of the abdomen conceals some of the pattern, though I suspect it is the same

as the female. Cymbium approximately twice as long as palpal tibia; mid-conductor process pointed, curved dorsally slightly, approximately half the length of conductor’s elongate part.

Variation

Females’ (n=4) total length 9.11–10.19; carapace length 3.65–4.1, width 2.14–3.10, height 1.03–1.41; abdomen length 5.24–8.44, width 4.23–5.54, height 4.84–5.54; sternum length 1.60–1.99, width 1.34–1.63.

Natural History

Unknown.

Distribution

Known from New Caledonia (Fig. 32).

Additional material examined

Mount Ouin, -22.017, 166.450*, 1100 m, rainforest, 2Juv (WAM 99/2770-1); 7 mi SE of

La Foa, -21.711, 165.827*, 1-7.iii.1945, C.L. Remington, 1M; Mt. Panié, east slope

(descent), -20.583, 164.767, 4.xi.1988, 1300-1700 m, R.B. Churchill, rainforest, 3FF

(QM S41252); Mount Koghis, -22.183, 166.533, 10.ii.1993, M.S. Harvey, N.I. Platnick,

149

Figure 32. Distribution of Phonognatha neocaledonica comb. nov.

R.J. Raven, 1F (WAM 85281); Mount Panié, -20.583, 164.750, 16.ii.1993, M.S. Harvey,

N.I. Platnick, R.J. Raven, 1F (WAM 85282); 7.4 km S of Canala, -22.583, 165.967,

6.ii.1993, M.S. Harvey, N.I. Platnick, R.J. Raven, 1M (WAM85283); 7 mi E of La Foa, -

21.774, 165.917*, 7.iv.1945, C.L. Remington, 1F, 1Juv (WAM); Auopinie, 20 km NE of

Poya, 18-28.v.1984, 650 m, G. Monteith, D. Cook, 1F (QM S45461); Mount Panié, -

20.600 164.750, 11.xii.1990, 1300 m, R. Raven, Agatha montana rainforest, 2FF (QM);

Mount Panié, -20.583, 164.750*, 4.ii.1977, B. Jamieson, in curled leaf, 1F (QM S45463);

Mount Panié, -20.583, 164.750*, 7.vi.1996, M.S. Moulds, 1F (AM KS52432); Col d’Amieu Forest Station, -21.620, 165.804*, 8-9.v.1984, 400 m, G. Monteith, D. Cook, 1F

(QM S45466); Table Union, -21.550, 165.767*, 10.v.1984, 700-1000 m, G. Monteith, D.

150

Cook, 3FF (QM S45462); Mandjélia, above Puébo, -20.401, 164.533*, 11-13.v.1984, 6-

750 m, G. Monteith D. Cook, 4FF (QM S45464); Mount Dzumac, -22.052, 166.467*,

800-1000 m, G. Monteith, D. Cook, 1F (QM S45469); Mount Rembai, -21.599,

165.853*, 9.v.1984, 700-900 m, G. Monteith, D. Cook, 5FF (QM S45468); Mandjélia, -

20.400, 164.533*, 12.ii.1990, R. Raven, in curled leaf, 1F (QM S17777).

Phonognatha tanyodon new species Kallal & Hormiga

Figs. 33-36.

New South Wales, Budderoo National Park, Minnamurra Rainforest, board walk, -

34.635, 150.728, 15.iii.2010, 134 m, G. Hormiga, N. Scharff, day and night, 1F (MCZ).

Diagnosis

Males of Phonognatha tanyodon have a very long palpal tibia, approximately three times the length of the cymbium, and long, robust chelicerae with a long apical tooth on the anterior margin (Fig. 35B); both features are unique within the genus. Females have an epigynum with a pair of ventrally-facing copulatory openings similar to P. neocaledonica, but can be separated by the lack of sclerotization found around the copulatory openings of P. neocaledonica and fewer twists of the copulatory duct within

the capsule (Fig. 34E-G).

Description

Female (Figs. 33A-D, 34)(from New South Wales, Budderoo National Park, GH2533).

151

Figure 33. Phonognatha tanyodon sp. nov. Female: A, ALS; B, PMS; C, PLS; D, epigynum, ventral. Male pedipalp: E, apical; F, ectal; G, ventral; H, mesal; I, dorsal. Scale bars (μm): A,B: 10; C: 20; D-I: 100.

Total length 8.52. Carapace 3.30 long, 2.28 wide, 1.16 high, yellowish brown; sternum

1.42 long, 1.24 wide, of similar color, with darker margins; green in color as immatures.

Eye rows slightly recurved, anterior row more so than posterior. AMEs on small

152

Figure 34. Phonognatha tanyodon sp. nov., female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

153 prominence; lateral eyes juxtaposed, paired on a small prominences; AME diameter 0.20;

AMEs interdistance ca. ¾ AME diameter; AME-PME distance ca. 1 AME diameter.

Clypeus ca. ½ AME diameter. Paturon reddish brown, with three prolateral and three retrolateral teeth; cheliceral fang curves mesally about a third of the way from paturon.

Legs colored as cephalothorax; femur I weakly sigmoid; formula 1243: femur I 3.83, patella I 1.19, tibia I 4.05, metatarsus I 4.75, tarsus I 1.18; femur II 2.98, patella II 0.80, tibia II 2.68, metatarsus II 3.23, tarsus II 1.01; femur III 1.91, patella III 0.46, tibia III

1.32, metatarsus III 1.46, tarsus III 0.67; femur VI 2.92, patella VI 0.80, tibia VI 2.34, metatarsus VI 2.76, tarsus VI 0.75. Abdomen 6.16 long, 4.35 wide, 4.51 high, light brown with pale guanine crystals; dorsum with triangular dorsolateral brown markings with lighter areas with guanoctye crystals between them; ventral face with area with guanocytes posterior to epigastric furrow, and three lines of guanocyes extending toward spinning field, two laterally and one centrally. Epigynum with relatively simple, ventral- facing, sclerotized copulatory openings; setae on outer side of copulatory openings crossing over openings; copulatory ducts relatively short with few twists before reaching spermathecae; fertilization ducts emerge from posterior region of spermathecae and extend dorsally.

Male (Figs. 33E-I, 35)(from Queensland, Bulburin, KS0081). Total length 5.03. Carapace

2.89 long, 1.87 wide, 0.99 high, reddish brown, slightly darker on pars cephalica than pars thoracica, but green in color as immatures; sternum 1.24 long, 1.16 wide, yellowish brown, with darker brown at edges. Eyes arranged as in female. AME diameter 0.18;

AMEs interdistance ca. 1 AME diameter; AME-PME distance ca. 1 AME diameter.

154

Figure 35. Phonognatha tanyodon sp. nov., male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A-D: 0.5; E-I: 0.1.

155

Clypeus ca. ½ AME diameter. Chelicerae particularly long (often at least half the length

of the carapace), yellowish brown to reddish brown, with three prolateral (including very

long aprical tooth) and three retrolateral teeth; cheliceral fang bends mesally by almost

90°, then curving slightly again at approximately midpoint. Legs colored as

cephalothorax; femur I weakly sigmoid; formula 1243: femur I 4.43, patella I 1.32, tibia I

5.08, metatarsus I 5.60, tarsus I 1.24; femur II 3.03, patella II 1.04, tibia II 3.10,

metatarsus II 3.15, tarsus II 0.81; femur III 1.91, patella III 0.65, tibia III 1.29, metatarsus

III 1.59, tarsus III 0.60; femur IV 2.60, patella IV 0.91, tibia IV 2.26, metatarsus IV 2.74,

tarsus IV 0.54. Abdomen 2.77 long, 1.91 wide, 1.80 high, with relatively numerous setae;

light brown with few pale guanine crystals; 4-5 indistinct tan-brown markings on the dorsum, with stripes of guanine crystals on sides and rear; venter of abdomen relatively free of guanocytes. Pedipalp with tibia 2–3 times the length of the cymbium; mid- conductor process pointed, approximately half the length of the elongate part of cymbium.

Variation

Females’ (n=4) total length 7.48–9.56; carapace length 3.30–3.84, width 2.26–2.46, height 1.08–1.21; abdomen length 4.67–6.48, width 3.16–4.47, height 3.10–4.61; sternum length 1.42–1.61, width 1.24–1.31. Males’ (n=4) total length 4.16–6.10; carapace length

2.13–3.32, width 1.46–2.11, height 0.70–1.12; abdomen length 2.20–3.23, width 1.62–

1.98, height 1.64–1.87; sternum length 1.00–1.44, width 0.96–1.38.

156

Natural History

This species exhibits several behaviors found in other Phonognatha. It builds a leaf

retreat at the hub of the web. Juveniles build a leaf retreat from a leaf still attached to the

twig at its hub. Cheiracanthium sp. were observed preying on juveniles. Adult males

were found cohabitating with immature females in January and February, suggesting a

similar behavior as found in P. graeffei (Fahey and Elgar 1997).

Distribution

Known from the eastern regions of Queensland and New South Wales (Fig. 36).

Figure 36. Distribution of Phonognatha tanyodon sp. nov.

157

Etymology

The species epithet, from Greek tany- (long) and –odon (tooth), refers to this species’

extremely long paturon, cheliceral fangs, and apical cheliceral teeth.

Additional material examined

New South Wales, Budderoo National Park, Minnamurra Rainforest, -34.634, 150.724,

25-26.i.2016, 510 m, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla, 5MM, 17Juvs; New

South Wales, Barrington Tops National Park, Jerusalem Creek Track, -32.246, 151.729,

29.i.2016, 388 m, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla, 1M, 1Juv; New South

Wales, Tooloom Scrub, -28.557, 152.469*, 4.ii.1983, J. Gallon, 1M (QM S56820); New

South Wales, Port Macquarie, Sea Acres, -31.462, 152.912*, 14-26.ii.1999, 10 m, G.

Williams, malaise trap, subtropical rainforest, 1M (AM KS59072); New South Wales,

Scalloway, Willowvale, nr. Gerringong, -34.746, 150.811*, 3.v.1988, M. Gray, low

remnant forest, fine orb web with central hole, no leaf retreat, 1M, 1F (AM KS18476);

New South Wales, Budderoo National Park, Minnamurra Rainforest, board walk, -

34.635, 150.728, 15.iii.2010, 134 m, G. Hormiga, N. Scharff, day and night, FF; New

South Wales, Budderoo National Park, Minnamurra Rainforest, board walk, -34.635,

150.728, 15.iii.2010, 134 m, G. Hormiga, N. Scharff, day and night, FF; New South

Wales, Jamberoo Mountain, -34.650, 150.767, 20.iv.2002, J. Noble, 1F, eggsac (AM

KS79776); New South Wales, Bundjalung National Park, Woody Head, NPWS

accommodation area, -29.368, 153.37, 17.ii.2011, G. Milledge, H. Smith, night

collecting, 2FF, 1M (AM KS114645); Queensland, Noosa National Park, -27.392,

153.111, 7.iv.2002, 30 m, M. Kuntner, F. Álvarez, M. Rix, 1M (USNM); Queensland,

158

Noosa National Park, -27.392, 153.111, 7.iv.2002, 30 m, M. Kuntner, F. Álvarez, M. Rix,

1M (USNM);Queensland, Noosa National Park, -27.392, 153.111, 7.iv.2002, 30 m, M.

Kuntner, F. Álvarez, M. Rix, 1M (USNM); Queensland, Noosa National Park, -27.392,

153.111, 7.iv.2002, 30 m, M. Kuntner, F. Álvarez, M. Rix, 1M, 1F (USNM);

Queensland, Noosa National Park, -27.392, 153.111, 7.iv.2002, 30 m, M. Kuntner, F.

Álvarez, M. Rix, 1M (USNM); Queensland, Cooloola National Park, -25.045, 153.210*,

1.v.1982, D. Sinclair, in rainforest, 4FF (QM S51232); Queensland, Cooloola, -26.052,

152.974*, 7.iv.1987, K. Sadler, 2FF (QM S33443); Queensland, Brisbane Forest Park, -

27.418, 152.830, 1-6.iii.1998, N. Power, malaise trap 1, 1M (AM KS69485); Queensland,

Brisbane Forest Park, -27.418, 152.830, 8-13.ii.1998, N. Power, malaise trap 1, 1M (AM

KS69693); Queensland, Bulburin, NW of Bundaberg, -24.517, 151.350*, iii.1975, M.

Gray, C. Horseman, 1M (AM KS12766); Queensland, Brisbane Forest Park, -27.418,

152.830, 15-20.iii.1998, N. Power, malaise trap 3, 1M (AM KS69458); Queensland,

Bulburin forestry nursery, NW of Bundaberg, -24.517, 151.350, iii.1975, 580 m, M.

Gray, C. Horseman, rainforest site 3A, 3FF, 3MM (AM KS0081); Queensland, Mount

Glorious, -27.333, 152.767, 12.iii.1998, trap 3, 1M (AM KS119461).

Deliochus Simon, 1894

Type species: Meta zelivira Keyserling, 1887

Diagnosis: Females of Deliochus can be diagnosed from other araneids based on the combination of the presence of epigynal flaps near the copulatory openings (Figs. 37D,

38E-G) and the rugose area on the posterior margin of the ALS (Fig. 37A). Males lack

159

the median apophysis, and have the embolus with a sclerotized shaft separated from the

sperm duct by pars pendula, which meet distally; the sperm duct sclerotizes distally.

Both the sperm duct and sclerotized shaft frequently have recurved barbs (Fig. 20B).

Deliochus can be diagnosed from Phonognatha and Artifex based on its stouter, complex

conductor in males and epigynal flaps in females.

Description

Female: Total length 5.67-10.83. Carapace 2.56-4.63 long, 1.82-3.40 wide, 0.64-1.46

high, dark brown to greenish yellow in color, sometimes with dark marking where pars

cephalica and pars thoracica meet. AMEs on small prominence; lateral eyes juxtaposed, paired on a small prominences; AME diameter 0.18-0.29; AME interdistance slightly wider than AME diameter; AME-PME distance ca. AME diameter. Clypeus ca. 1/2 -3/4

AME diameter. Paturon colored as pars cephalica, with 3 prolateral and 3-4 retrolateral teeth. Leg formula 1243, colored as cephalothorax, or slightly lighter; femur I sigmoid.

Abdomen 2.92-7.83 long, 2.64-5.84 wide, 2.32-6.67 high; green to white in color, sometimes with longitudinal stripes on the dorsum and mottled to striped lateral pattern; venter dark. Spinning field typical of araneoids, but with rugose area on posterior rim of

ALS and one flagelliform spigot of triad closer to a cylindrical gland spigot than aggregate gland spigots. Epigynum with ventral-facing copulatory openings separated by

a septum and flanked by flaps; copulatory duct sclerotized, twisting ventrally before

meeting weakly lobed spermathecae; copulatory duct may be plugged with part of

pedipalp.

160

Male: Total length 1.29-5.32. Carapace 1.19-2.98 long, 0.99-1.88 wide, 0.44-1.44 high, dark brown to greenish yellow in color, sometimes with dark marking where pars cephalica and pars thoracica meet. Eye arrangement as in female; AME diameter 0.13-

0.19; AME interdistance slightly wider than AME diameter; AME-PME distance ca.

AME diameter. Clypeus ca. 1/2 AME diameter. Chelicerae colored as pars cephalica, with 3 prolateral and 3 retrolateral teeth. Legs formula 1243, colored as cephalothorax, or slightly lighter; femur I sigmoid. Abdomen 1.30-3.15 long, 0.99-2.27 wide, 0.92-2.54 high; dorsal and ventral coloration variable, with brown, white, green, yeland/or red stripes of variable widths; venter dark. Spinning field similar to females. Pedipalp tibia

1/4 to equal the length of the cymbium; cymbium somewhat short, not more than twice as long as it is wide; paracymbium absent; subtegulum much larger than tegulum, rotated dorsally; embolic division associated with tegulum at membrane near embolic base; embolus with sclerotized embolic shaft and sperm duct connected by a membranous pars pendula, with the two ends meeting at the tip; ends of embolus and sperm duct often with hooks; conductor large and complex, with inner, terminally translucent sclerite associated with the outer, ring-like sclerite inside the dorsal end of the latter.

Composition

Deliochus includes three species: D. zelivira (Keyserling, 1887), D. humilis (L. Koch,

1867), and D. idoneus (Keyserling, 1887).

161

Natural History

Little is catalogued on the natural history of Deliochus as observations are often

attributed to Araneus or Phonognatha. Unlike Phonognatha, their retreat is adjacent to

the web, and the web itself is complete. Females and males cohabitate in the leaf retreat.

Deliochus is sexually size dimorphic, with males being a fraction of the size of female.

Males often use their pedipalp to plug the copulatory opening, and observing males

without one (or both) pedipalps is frequent.

Phylogenetics

Deliochus is supported by the putative synapomorphies of paired epigynal flaps near

copulatory openings and a thicker, moderately long embolus.

Distribution

Known from all states of Australia and Papua New Guinea.

Deliochus zelivira (Keyserling, 1887)

Figs. 37-40.

Meta zelivira Keyserling, 1887: 210, Plate 19, Figs. 1-2 (female, male). Australia,

Queensland, Peak Downs, (ZMUH, examined, syntypes: 1M, 1F, 3Juv).

Deliochus zelivira Simon, 1894: 749; Kuntner et al. 2008: 171, Fig. C-D (female);

Kuntner et al., 2009: 1453, Fig. 2C-D (female).

162

Figure 37. Deliochus zelivira. Female: A, ALS; B, PMS; C, PLS; D, epigynum, ventral. Male pedipalp: E, apical; F, ectal; G, ventral; H, mesal; I, dorsal. Scale bars (μm): A-C: 10; D-I: 100.

Diagnosis

Males can be distinguished by their slightly longer palpal tibia and longer hooks on embolus; the latter can be compared to D. humilis, which has shorter, serrated hooks and

D. idoneus which apparently lacks them. Females have epigynal flaps posterior and

163 lateral to the copulatory openings; D. humilis has flaps which are more directly posterior to the copulatory openings and D. idoneus has flaps that are lateral to the copulatory openings. Both have dark markings where the pars cephalica meets the pars thoracica

(Figs. 38A, 39A), which is absent in other Deliochus.

Description

Female (Figs. 37A-D, 38)(from Queensland, Mount Flinders, QM S45266). Total length

7.57. Carapace 3.41 long, 2.45 wide, 3.41 high, yellowish brown, with fovea separating cephalic and thoracic areas darker; sternum 1.64 long, 1.28 wide, colored as carapace with darker margins. Eye rows slightly recurved, anterior row more so than the posterior.

AMEs on small prominence; lateral eyes juxtaposed, paired on a small prominences;

AME diameter 0.20; AMEs interdistance ca. 1 AME diameter; AME-PME distance ca.

2/3. Clypeus ca. ½ AME diameter. Paturon yellowish brown, with three prolateral and three retrolateral teeth; cheliceral fang curves mesally about a third of the way from paturon. Legs colored as carapace; femur I sigmoid; formula 1243: femur I 3.84, patella I

1.09, tarsus I 3.64, metatarsus I 4.33, tarsus I 1.12; femur II 3.20, patella II 1.00, tarsus II

2.77, metatarsus II 3.03, tarsus II 0.93; femur III 2.13, patella III 0.77, tarsus III 1.34, metatarsus III 1.60, tarsus III 0.62; femur IV 3.01, patella IV 0.97, tarsus IV 2.16, metatarsus IV 2.91, tarsus IV 0.74. Abdomen 4.52 long, 3.70 wide, 3.17 high, with two dorsal longitudinal light stripes of guanocytes with dark brown between and on either side; abdomen laterally with 4-5 pairs of brown and white stripes, the anteriormost of which continues around the front of the abdomen; ventral side of abdomen brownish yelwith a brown marking between the epigastric furrow and spinnerets. Epigynum with

164

Figure 38. Deliochus zelivira, female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

165

sclerotized copulatory openings anterior and inset to epigynal flaps, flanked by tufts of

setae. Copulatory ducts run anteriorly, turning three times before running posteriorly,

ventral to region of copulatory duct proximal to copulatory openings, widening until it

meets the two-lobed spermathecae in area where lobes join; fertilization ducts emerge

posteriorly on dorsal area of spermathecae.

Male (Figs. 37E-I, 39)(from Queensland, nr. Lamington National Park, GH2516). Total

length 3.30. Carapace 1.84 long, 1.23 wide, 0.60 high, yellowish brown to greenish

brown in color (becoming more yellow in preservative), with fovea separating cephalic

and thoracic areas darker; sternum 0.85 long, 0.72 wide, colored as carapace, with darker

margin. Eye rows slightly recurved, anterior row more so than the posterior. AMEs on

small prominence; lateral eyes juxtaposed, on small prominences. AME diameter 0.15;

AMEs interdistance ca. 1 AME diameter; AME-PME distance ca. 1 AME diameter.

Clypeus ca. ½ AME diameter. Chelicerae yellowish brown, with three prolateral and

three retrolateral teeth; cheliceral fang curves mesally about a third of the way from

paturon. Legs colored as carapace; femur I sigmoid; formula 1243: femur I 2.19, patella I

0.75, tarsus I 2.03, metatarsus I 2.42, tarsus I 0.77; femur II 1.57, patella II 0.54, tarsus II

1.50, metatarsus II 1.67, tarsus II 0.61; femur III 0.98, patella III 0.36, tarsus III 0.67,

metatarsus III 0.80, tarsus III 0.38; femur IV 1.40, patella IV 0.49, tarsus IV 1.06,

metatarsus IV 1.41, tarsus IV 0.43. Abdomen 1.94 long, 1.27 wide, 1.17 high, light

brown with two dorsal longitudinal light stripes of guanocytes with red on either side

(becoming dark brown in preservative); sides of abdomen with 4-5 pairs of brown and

white stripes, the anteriormost of which continues around the front of the abdomen;

166

Figure 39. Deliochus zelivira, male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A,C-D: 0.5; B,E-I: 0.1.

167

Figure 40. Distribution of Deliochus zelivira.

abdomen light brown ventrally, with darker marking on posterior half. Palp (Figs. 37E-I,

39E-I) typical for Deliochus, with short tibiae (half the cymbium length), slightly narrow cymbium, and longer embolic barbs separated by nearly the barbs’ length from each other.

168

Variation

Females’ (n=3) total length 5.67–9.28; carapace length 2.65–3.80, width 2.05–2.55, height 0.94–1.76; abdomen length 2.92–5.35, width 2.64–4.35, height 2.31–4.70; sternum

length 1.45–1.69, width 1.08–1.28. Males’ (n=3) total length 3.30–4.41; carapace length

1.84–2.43, width 1.23–1.65, height 0.59–0.76; abdomen length 1.91–2.42, width 1.27–

1.75, height 1.17–1.56; sternum length 0.85–1.02, width 0.72–0.92.

Natural History

Unknown.

Distribution

This species occurs in Queensland, New South Wales, Western Australia, Victoria, and the Australia Capital Territory (Fig. 40).

Additional material examined

New South Wales, Mystery Bay, -36.3, 150.117, 26.xii.2004, G. Milledge, beating

foliage, 1M (AM, KS90893); New South Wales, Beecroft, -33.750, 151.067, 1.xii.2001,

J. Noble, 1M (AM KS76788); New South Wales, Jenolan Caves, -33.819, 150.023*,

1902, V. Wilbord, 1F (AM KS123622); New South Wales, Hornsby, Waitara Creek, -

33.714, 151.089, 12.ii.2004, G. Milledge, H. Smith, at night, 1F (AM KS97297);

Queensland, Cairns, -16.917, 145.767, vii.1967, J. Child, 1F, 1M (AM KS104238);

Queensland, Cairns, -16.917, 145.767*, 13.iv.1969, C. Coleman, R. Mascord, 1F (AM

KS120632); New South Wales, Camira State Forest, -29.296, 152.904, ii.1997, A. York,

169 sweep, eucaplypt forest, 1M (AM KS88063); New South Wales, Kuringai Chase

National Park, -33.622, 151.245*, 27.i.1999, M.R. Gray, 1F (AM KS77085); New South

Wales, Jamberoo Mountain, -34.667, 150.717*, 38.ii.1996, J. Noble, 1M (AM KS49925);

New South Wales, Scheyville, -33.601, 150.892*, 2-5.ii.1987, H. Recher, pyretheum knockdown, MM, FF (AM KS52540); Queensland, Cainbable Cabin, nr. Lamington

National Park, -28.135, 153.109, 1-3.ii.2016, 641 m, G. Hormiga, R.J. Kallal, F. Álvarez-

Padilla, 1M; Queensland, nr. Giraween National Park, -28.851, 151.983*, 7.iv.1974, R.J.

Raven, 1F (AM KS45264); Queensland, Mt. Flinders, -22.544, 150.769*, 14.iii.1982, D.

Sinclair, in green woven together silken leaves, 5FF (AM KS45266); Queensland, Fraser

Island, Sandy Cape, 24.750, 153.214*, 28.v-11.vi.1981, C. Fearnley, 1F (QM S45282);

Queensland, Kroombit Tops National Park, Dawes Range, 45 km SSW of Calliope, -

24.377, 151.041*, 9-19.xii.1983, V.E. Davies, J. Gallon, rainforest, 4Juvs (QM S45451);

Queensland, Boondall Wetlands, site 1, -27.340, 153.075, 2.ix.2003, 5-10 m, QM Party, day hand collecting in Melaleuca woodland, 1F (QM S65409); Queensland, Bushlands

Reserve, Chelsea Rd, -27.483, 153.183, 10.xi.2003, QM Party, 1F (QM S65410);

Queensland, Bushlands Reserve, Chelsea Rd, -27.483, 153.183, 10.xi.2003, QM Party,

1M (QM S65827); Queensland, Bushlands Reserve, Chelsea Rd, -27.483, 153.183,

10.xi.2003, QM Party, 1M (QM S65826); Queensland, Drewvale, Illaweena St, -27.642,

153.063, 5.xi.2003, QM Party, 1M (QM S67067); Queensland, Landsborough, -26.800,

152.967*, 28.vi.1991, M. Glover, 1F (QM S48298); Victoria, Yarra Glen, -37.659,

154.377*, 10.i.1975, V. Salanitri, in mud daubers nest, 4MM (QM S45247); Victoria,

Lower Tarwin, -38.760, 145.915*, 12.iii.1925, G.F. Hill, 1F (MV ENTO2014-19L);

Victoria, Frankston, -38.150, 145.144*, 11.ii.1961, R. Bell, 1F (MV ENTO2014-19L);

170

Victoria, 2.iv.1896, P. French, 1F (QM S39723); Australian Capital Territory, Canberra, -

35.281, 149.129*, 4.iii.1972, E. McCallan, food of Pison spinolae, 1F (QM S45271);

Australian Capital Territory, Canberra, -35.281, 149.129*, 4.iii.1972, E. McCallan, 2FF

(QM S56815); Tasmania, Strahan, -42.126, 145.328*, xi.1923, K. Collins, 1F (AM

KS10748); Western Australia, Stirling Range National Park, Toolbrunup Track, -34.400,

118.040*, 31.iii.1993, M.S. Harvey, J.M. Waldock, night (WAM 99/2874); Western

Australia, Sabina River, -33.650, 115.400, ii.1987, A. Stewart, ex mud wasp nest, Pleon sp., 7FF. 2Juv (WAM 77278); Western Australia, Sabina River, -33.650, 115.400, ii.1987, A. Stewart, ex mud wasp nest, Pleon sp., 1F (WAM 77286); Western Australia,

Sabina River, -33.650, 115.400, ii.1987, 27.i.1984, A. Stewart, J.M. Waldock, ex mud wasp nest, Pleon sp., 3FF (WAM 77281); Western Australia, Sabina River, -33.650,

115.400, ii.1987, 27.i.1984, A. Stewart, J.M. Waldock, ex mud wasp nest, Pleon sp., 1F

(WAM 77276); Western Australia, Sabina River, -33.650, 115.400, ii.1987, 27.i.1984, A.

Stewart, J.M. Waldock, ex mud wasp nest, Pleon sp., 3FF, 1Juv (WAM 77289); Western

Australia, Sabina River, -33.650, 115.400, ii.1987, 27.i.1984, A. Stewart, J.M. Waldock, ex mud wasp nest, Pleon sp., 3FF, 1Juv (WAM 77293); Western Australia, Bornholm, -

35.050, 117.567, ii.1988, R.T. Wolf and co., under potplant, 2FF (WAM 77235);

Western Australia, Stirling Range National Park, carpark at base of Toolbrunup Peak, -

34.392, 118.063, 23.ii.2012, F. Bokhari, 1F (WAM 120899); Western Australia,

Pemberton Youth Hostel, -34.400, 115.967, 14.vii.1957, B.Y. Main, 1F (WAM 7233);

Western Australia, Hovea, -31.883, 116.100, 22.vii.1996, A. Sampey, 1F (WAM

99/2865).

171

Deliochus humilis (Koch, 1867) new combination

Figs. 20B, 41-44.

Theridion humile L. Koch, 1867: 192 (female). Australia, Queensland, Brisbane,

syntypes: 1F, 1Juv (MG22569) (ZMUH, examined).

Araneus humilis L. Koch, 1872a: 107, Plate 9, Fig. 1 (female).

Araneus favorabilis Rainbow, 1916a: 103, Plate 22, Fig. 18-19 (female). Australia,

Queensland, Gordonvale, -17.081, 145.791*, 9.ix.1912, W.J. Rainbow, holotype (AM

KS6518, examined). New synonymy.

Diagnosis

Males can be distinguished by their shorter embolic serrations; D. zelivira has longer,

more separated hooks and D. idoneus seems to lack them. Females have epigynal flaps directly posterior to the copulatory opening rather than lateral or posterior-lateral (Fig.

41D, 42E-G). Both males and females lack the dark marking where the pars cephalica

and pars thoracica meet.

Description

Female (Figs. 41A-D, 42)(from New South Wales, Budderoo National Park, GH2534).

Total length 5.74. Carapace 2.58 long, 1.81 wide, 0.64 high, yellowish brown; sternum

1.23 long, 1.01 wide, of similar color. Eye rows slightly recurved, anterior row more so

than the posterior. AMEs on small prominence; lateral eyes juxtaposed, paired on a small

prominences; AME diameter 0.17; AMEs interdistance ca. 1 AME diameter; AME-PME

172

Figure 41. Deliochus humilis comb. nov. Female: A, ALS; B, PMS; C, PLS; D, epigynum, ventral. Male pedipalp: E, apical; F, ectal; G, ventral; H, mesal; I, dorsal. Scale bars (μm): A-C: 10; D-I: 100.

distance ca. 2/3 AME diameter. Clypeus ca. ½ AME diameter. Chelicerae yellowish brown to reddish brown, with three prolateral and three retrolateral teeth; cheliceral fang curves mesally about a third of the way from paturon. Legs colored as carapace; femur I sigmoid; formula 1243: femur I 3.04, patella I 0.83, tibia I 2.87, metatarsus I 2.12, tarsus

173

Figure 42. Deliochus humilis comb. nov., female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

174

I 0.67; femur II 2.46, patella II 0.71, tibia II 2.12, metatarsus II 2.64, tarsus II 0.69; femur

III 1.70, patella III 0.58 ,tibia III 1.14, metatarsus III 1.37, tarsus III 0.50; femur IV 2.32,

patella IV 0.68, tibia IV 1.72, metatarsus IV 2.35, tarsus IV 0.59. Abdomen 3.42 long,

2.64 wide, 2.78 high, with two dorsal longitudinal light stripes of guanocytes; ventral side

of abdomen brownish yellow. Epigynum with sclerotized copulatory openings anterior to

epigynal flaps. Copulatory ducts run anteriorly, turning three times before running

posteriorly, ventral to the region of copulatory duct proximal to the copulatory opening,

meeting weakly lobed spermathecae in area where lobes join; fertilization ducts emerge

posteriorly on dorsal area of spermathecae.

Male (Figs. 41E-I, 43)(from New South Wales, Barrington Tops National Park,

GH2535). Total length 3.16. Carapace 1.57 long, 1.04 wide, 0.44 high, greenish brown,

yellowing with preservation; sternum 0.71 long, 0.66 wide, colored as carapace. Eye

rows slightly recurved, anterior row more so than the posterior. AMEs on small

prominence; lateral eyes juxtaposed, on small prominences. AME diameter 0.11; AMEs

interdistance ca. 1 AME diameter; AME-PME distance ca. 1 AME diameter. Clypeus ca.

½ AME diameter. Paturon yellowish brown, with three prolateral and three retrolateral

teeth; cheliceral fang curves mesally about a third of the way from paturon. Legs colored

as carapace; femur I sigmoid; formula 1243: femur I 2.48, patella I 0.70, tibia I 2.43,

metatarsus I 2.20, tarsus I 0.70; femur II 1.49, patella II 0.34, tibia II 1.33, metatarsus II

1.45, tarsus II 0.63; femur III 0.93, patella III 0.36, tibia III 0.59, metatarsus III 0.71,

tarsus III 0.37; femur IV 1.19, patella IV 0.37, tibia IV 0.94, metatarsus IV 1.28, tarsus

IV 0.46. Abdomen 1.80 long, 1.34 wide, 1.30 high, light brown with two longitudinal

175

Figure 43. Deliochus humilis comb. nov., male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A,C-D: 0.5; B,E-I: 0.1.

176

Figure 44. Distribution of Deliochus humilis comb. nov.

yellowish white stripes of guanocytes; venter light brown. Palp (Figs. 41E-I, 43E-I) typical for Deliochus, with short tibiae (<1/2 length of cymbium) and numerous short embolic barbs-like serration on both sclerotized embolic shaft and sperm duct distally.

Variation

Females’ (n=4) total length 6.96–7.59; carapace length 2.56–3.62, width 1.81–2.41,

177

height 0.64–1.26; abdomen length 3.42–4.49, width 2.64–3.81, height 2.78–3.91; sternum

length 1.23–1.69, width 1.01–1.32. Males’ (n=3) total length 1.29–3.05; carapace length

1.19–1.61, width 0.99–1.09, height 0.44–0.58; abdomen length 1.30–1.80, width 0.99–

1.34, height 0.92–1.30; sternum length 0.71–1.16, width 0.66–0.95.

Natural History

Half and full eunuchs and copulatory plugs formed from broken emboli are common.

Cohabitation of males and females in web-adjacent leaf nest observed.

Distribution

This species occurs mainly in Queensland, New South Wales, and Tasmania (Fig. 44).

Additional material examined

New South Wales, Budderoo National Park, Minnamurra Rainforest, -34.634, 150.724,

25-26.i.2016, 510 m, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla, 1F; New South Wales,

Barrington Tops National Park, Jerusalem Creek Track, -32.246, 151.729, 29.i.2016, 388 m, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla, 1M, 2FF, 1 Juv; New South Wales,

Chichester State Forest, nr. logging museum, -32.325, 151.730, 27.i.2016, 502 m, G.

Hormiga, R.J. Kallal, F. Álvarez-Padilla, 1F; New South Wales, Mystery Bay, -36.3,

150.117, 26.xii.2004, G. Milledge, beating foliage, 1 M (AM KS90893); New South

Wales, Jamberoo Mountain, -34.647, 150.776*, 1-4.i.1999, J. Noble, 1M (AM

KS59062); New South Wales, Jamberoo Mountain, -34.647, 150.776*, 27.xii.1981, C.

Bark, 1M (AM KS51616); New South Wales, Sydney, Royal National Park, -34.079,

178

151.047*, 8.xii.1981, C. Bark (AM KS8645); New South Wales, Cheltenham, Byles

Creek, -33.750, 151.083, 16.i.1998, J. Noble, 1F (AM KS57564); New South Wales,

Cheltenham, Byles Creek, -33.750, 151.083, 16.i.1998, J. Noble, 1F (AM KS57565);

New South Wales, Cheltenham, Byles Creek, -33.750, 151.083, 16.i.1998, J. Noble, 1F

(AM KS57566); New South Wales, Scalloway, Willowvale, nr. Gerringong, -34.746,

150.811*, 3.v.1988, M. Gray, low remnant forest, fine orb web with central hole, no leaf

retreat, 1M, 1F (AM KS18476); Queensland, Gordonvale, -17.081, 145.791*, 9.ix.1912,

W.J. Rainbow 1F (AM KS6518); Queensland, Mount Garnet, -17.676, 145.114*,

23.ii.1972, N.C. Coleman, 1M (AM KS87645); Queensland, Edmonton, -17.017,

145.746*, 29.ix.1969, N.C. Coleman, 3FF (AM KS5888); Queensland, Jamberoo

Mountain, -34.650, 150.783, 24.xii.1998, J. Noble, 1F (AM KS59063); Queensland,

Cairns, Trinity Park, -16.811, 145.704*, 9.x.1995, J. Thompson, J. Olive, in park, 1F

(AM KS044795); Queensland, Cairns, Trinity Park, -16.811, 145.704*, 9.x.1995, J.

Thompson, J. Olive, in park, 1F (AM KS044796); Queensland, Cairns, Trinity Park, track to Earl Hill via Reed Rd, -16.800, 145.709, 21.v.2000, G. Milledge, H. Smith, 1F

(AM KS 66404); Queensland, Cairns, Trinity Park, -16.803, 145.701, 14.v.2000, G.

Milledge, H. Smith, J. Thompson, night collecting in Melaleuca swamp, 1F (AM

KS66712); Queensland, Bulburin Forest Nursery, NW of Bundaberg, rainforest site

3A580, -24.517, 151.483, iii.1975, M. Gray, C. Horseman, 1F (AM KS0800);

Queensland, North Stradbroke Island, Enterprise Blackbutt #2, -27.567, 153.450,

8.i.2002, 60 m, QM Party, night hand collection 50918, 1M (QM S56277); Queensland,

North Stradbroke Island, Enterprise Blackbutt #2, -27.567, 153.450, 8.i.2002, 60 m, QM

Party, night hand collection 50918, 1F (QM S56196); Queensland, North Stradbroke

179

Island, Enterprise Mallee #2, -27.567, 153.450, 7.i.2002, 80 m, QM Party, night hand

collecting, 2FF (QM S56202); Queensland, North Stradbroke Island, Enterprise Mallee

#2, -27.567, 153.450, 7.i.2002, 100 m, QM Party, hand collecting, 1F (QM S56344);

Queensland, North Stradbroke Island, Enterprise Scribbly Gum #1, -27.617, 153.433*,

10.i.2002, 70 m, QM Party, night hand collection, 2FF; Quensland, North Stradbroke

Island, Enterprise, Scribbly Gum #2, -27.600, 153.450*, 10.i.2002, 120 m, QM Party,

night hand collecting, 1F (QM S56278); Queensland, North Stradbroke Island, Enterprise

Scribbly Gum #3, -27.600, 153.450, 10.i.2002, 70 m, QM Party, night hand collection,

1M, 1F (QM S56345);Queensland, Daintree National Park, -16.170, 145.418*, 3.iii.1972,

N.C. Coleman, 1M (QM S45250); Queensland, Cooktown, -15.436, 145.216*,

12.vi.1973, V.E. Davies, C. Tanner, 2FF (QM S45249); Queensland, Coothraba, Teewah,

-26.286, 152.938*, 14.ix.1973, R.Raven, large orb web with very close spiral and large

number of radii, 1F (QM S45259); Queensland, Brisbane, Gold Creek Reservoir, -

27.457, 152.877*, 2.vi.1981, V.E. Davies, R.J. Raven, beating, 1F (QM S45284);

Queensland, Trinity Beach, -16.798, 145.699*, xii.1971, N.C. Coleman, 2FF (QM

S45255); Queensland, Mt. Nebo, -27.380, 152.781*, 22.ii.1979, QM PTO, water

catchment reserve, orb web with very close spiral and nested center, 2FF (QM S45363);

Queensland, Furch Hatton campsite, 7-14.iv.1975R.J. Raven, V.E. Davies, 1M (QM

S45454); Queensland, Upper Brookfield, -27.458, 152.857*, 22.xii.1980, R.Raven, V.E.

Davies, 1F (QM S45270); Queensland, Upper Brookfield, -27.458, 152.857*, D. Sinclair,

1F (QM S45261); Queensland, Upper Brookfield, -27.458, 152.857*, 22.xii.1980, V.E.

Davies, R.Raven, complex notophyll vine forest with Araucaria (QM S45270);

Queensland, Eureka, -25.272, 152.162*, 11.ii.1972, N.C. Coleman, 1M (QM S45253);

180

Queensland, Yule Point, -16.530, 145.479*, 15.i.1972, N.C. Coleman, 1M (QM S45256);

Queensland, Cairns, Botanical Gardens, -16.900, 145.748*, xii.1982, R.R. Jackson,

cohabitating in rolled-up leaf, 1F, 1M eunuch (QM S56196); Queensland, Cairns,

Botanical Gardens, -16.900, 145.748*, xii.1982, R.R. Jackson, cohabitating in rolled-up

leaf, 1M, 1F (QM S45453); Queensland, Oakley, -27.439, 115.714*, 13.iii.1973, G. May,

between two sealed gum leaves, 1F (QM S45262); Queensland, Townsville, -19.260,

146.812*, 30.iii.1985, 2FF, 2MM eunuchs (QM S58364); Queensland, Moreton Island, -

27.127, 153.399*, 2.ii.1982, D. Sinclair, 1F (QM S45261); Queensland, nr. Herberton, -

17.386, 145.382, 13.xi.1971, N.C. Coleman, 1F (QM S45254); Queensland, Cooloolah,

Teewah Creek, -26.052, 152.974*, 31.xii.1973, R.J. Raven, 1F (QM S45257);

Queensland, Gordonvale, -17.081, 145.791*, N.C. Coleman, 1F (QM S45252);

Queensland, SW Mount Garnet, 40 Mile Scrub, -17.658, 145.090*, 10-14.ix.1978, R.J.

Raven, V.E. Davies, 3FF (QM S45248); Queensland, Stott’s Island, Tweed Rd, -28.270,

153.498*, 17-19.ix.1978, JC GC RR, 1F (QM S45448); Queensland, Bulburin State

Forest, roadway, -24.598, 151.530*, 18.iii.1975, TC VED RK, 1F (QM S45431);

Queensland, Beecroft Reserve, -33.750, 151.067, 30.i.1998, J. Noble, 1F (AM KS57562);

Queensland, Brisbane Forest Park, -27.418, 152.830, 11-15.i.1997, N. Power, malaise trap 3, 1m (AM KS69423); Queensland, Bribie Island, -27.058, 153.192, 25-30.xii.1997,

N. Power, malaise trap 2, heathland/acacia regrowth, 1M (AM KS69398); Queensland,

Sarina Beach, 30km SSE of Mackay, -21.387, 149.309*, 20.iv.1991, G. Milledge, 1F

(MV ENTO2014-19L); Queensland, Cape Tribulation, -16,072, 145.444*, vii.1992, 10 m, W. Eberhard, 1M (MCZ); Queensland, Atherton Tablelands, Rose Gums, -17.312,

145.714, 20.iv.2002, 750 m, G. Hormiga, M. Kuntner, F. Álvarez, rainforest, 1F

181

(USNM); Queensland, Atherton Tablelands, Rose Gums, -17.312, 145.714, 20.iv.2002,

750 m, G. Hormiga, M. Kuntner, F. Álvarez, rainforest, 1F (USNM); Queensland,

Atherton Tablelands, Rose Gums, -17.312, 145.714, 20.iv.2002, 750 m, G. Hormiga, M.

Kuntner, F. Álvarez, rainforest, 1F,1M (USNM); Queensland, Atherton Tablelands, Rose

Gums, -17.312, 145.714, 20.iv.2002, 750 m, G. Hormiga, M. Kuntner, F. Álvarez, rainforest, 1Juv (USNM); Queensland, Buhot Creek, Burbank, -27.584, 153.170,

26.xi.2003, 50 m, QM Party, night hand collecting in riparian forest, 1M (QM S67555);

Queensland, Buhot Creek, Burbank, -27.584, 153.170, 26.xi.2003, 50 m, QM Party, night hand collecting in riparian forest, 1F, 3Juvs (QM S67546); Queensland, Bunya

Mountains National Park, Marlaybrook, -26.799, 151.537*, 6.iii.1976, R.J. Raven, V.E.

Davies, sweeping, 1F (QM S39722); Queensland, North Stradbroke Island, Enterprise

Blackbutt 3, -27.578, 153.467, 8.i.2002, 80 m, QM Party, 2FF (QM); Queensland,

Townsville, -19.260, 146.812*, 30.iii.1985, 1F,1M (QM S58363); Queensland, SW of

Malanda, Lot 2 of Merragallan Road, -17.419, 145.544, 22.ix.2003, G. Milledge, H.

Smith, headtorch, 1M, 1F (AM KS86083); Queensland, Forty Mile Scrub, -18.109,

144.569, 5.iii.2008, G. Milledge, H. Smith, beat/sweep, under bark, vine scrub, 1M

(AM); Queensland, nr. Malanda, Merragallan Road, -17.417, 145.543, 2.xii.2008, 847 m,

G. Milledge, H. Smith, night collecting, 1F (AM KS106581); Queensland, nr. Malanda,

Merragallan Road, -17.417, 145.543, 2.xii.2008, 847 m, G. Milledge, H. Smith, night collecting, 1M (AM KS106612); Northern Territory, East Port Darwin, -12.470,

130.918*, 18.xii.1980, R.R. Jackson, cohabitating with subadault, 1M (AM KS45246);

Northern Territory, Darwin, East PE, -12.561, 131.019*, 9.xi.1979, R. Raven, night, 4FF

(QM S45245); Tasmania, Domain, -42.865, 147329*, 13.ii.1976, V.V. Hickman, 1F (AM

182

KS28649);Victoria, Hawthorn, Riversdale Rd, -37.822, 145.034*, 13.iv.1918, L. Turner,

1F ((MV ENTO2014-19L); PAPUA NEW GUINEA: Milne Bay Province, Louisiade

Archipelago, Misima Island, north slopes of Mount Misima, camp 7, -10.674, 152.719*,

16-30.vii.1956, 350 m, Fifth Archbold Expedition to New Guinea, L.I. Brass, 1F

(AMNH); Morobe Province, Wau Ecology Institute, -7.277, 146.598*, 15.xi.1980, W.A.

Shear, ground collecting in coffee, 1F (AMNH); Morobe Province, Wau Ecology

Institute, -7.277, 146.598*, 15.xi.1980, W.A. Shear, ground collecting in coffee, 2FF

(AMNH); Central Province, Port Moresby, -9.480, 147.149*, 12.x.1949, G.F. Wilson,

1M (MV ENTO2014-19L).

Deliochus idoneus (Keyserling, 1887) new combination

Figs. 45-48.

Epeira idonea Keyserling, 1887a: 177, Plate 15, Fig. 5 (female). Australia, Queensland,

Peak Downs; holotype, 1F, (ZMUH, examined).

Diagnosis

Adults of both sexes of D. idoneus have a solid brown colored cephalothorax as opposed to the yellowish or greenish browns found in D. zelivira and D. humilis. Males have wide brown and white longitudinal markings on its abdomen absent in other Deliochus, and palps with a relatively short tibia and embolus without serrated hooks. Females have pale whitish abdomens, often with anterior dark areas on the abdomen which is completely unlike the striping of congenerics, and epigynal flaps lateral to the copulatory openings

183

Figure 45. Deliochus idoneus comb. nov. Female: A, ALS; B, PMS; C, PLS; D, epigynum, ventral. Male pedipalp: E, apical; F, ectal; G, ventral; H, mesal; I, dorsal. Scale bars (μm): A-C: 10; D-I: 100.

rather than posterior in both D. zelivira and D. humilis.

Description

Female (Figs. 45A-D, 46)(from New South Wales, Berowra Valley Regional Park, KS

184

115760). Total length 9.67. Carapace 4.32 long, 2.96 wide, 1.25 high. Carapace

yellowish brown; sternum 1.96 long, 1.58 wide, colored as carapace with darker edges.

Eye rows slightly recurved, anterior row more so than the posterior. AMEs on small prominence; lateral eyes juxtaposed, paired on a small prominences; AME diameter 0.26;

AMEs interdistance ca. 1 AME diameter; AME-PME distance ca. 2/3 AME diameter.

Clypeus ca. 2/3 AME diameter. Paturon yellowish brown, with three prolateral and three to four retrolateral teeth; cheliceral fang mesally about a third of the way from the paturon. Legs colored as carapace; femur I sigmoid; formula 1243: femur I 4.64, patella I

1.67, tibia I 4.06, metatarsus I 4.94, tarsus I 1.42; femur II 3.98, patella II 1.35, tibia II

3.14, metatarsus II 3.74, tarsus II 1.18; femur III 2.52, patella III 0.97, tibia III 1.71, metatarsus III 2.02, tarsus III 0.78; femur IV 3.48, patella IV 1.18, tibia IV 2.52, metatarsus IV 3.25, tarsus IV 0.98. Abdomen 6.32 long, 4.92 wide, 4.88 high, pale whitish, covered in white guanocytes, ventral side of abdomen brownish yellow, slightly darker between the epigastric furrow and spinnerets, with sporadic guanocytes.

Epigynum with sclerotized copulatory openings, with epigynal flaps positioned just outside the openings, flanked by tufts of setae. Copulatory ducts run anteriorly, then switch back ventrally to meeting two-lobed spermathecae in area where lobes broadly join; fertilization ducts emerge posteriorly on dorsal area of spermathecae.

Male (Figs. 45E-I, 47)(from New South Wales, Pomingalarma Park, KS93951). Total

length 5.32. Carapace 2.98 long, 1.88 wide, 0.67 high, brown; sternum 1.22 long, 1.02

wide, mottled brown with yellowish brown longitudinal stripe approximately 2/3 the

length of the sternum. Eye rows slightly recurved, anterior row more so than the

185

Figure 46. Deliochus idoneus comb. nov., female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

186

Figure 47. Deliochus idoneus comb. nov., male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A,C-D: 0.5; B,E-I: 0.1.

187 posterior. AMEs on small prominence; lateral eyes juxtaposed, on small prominences.

AME diameter 0.20; AMEs interdistance ca. 1 AME diameter; AME-PME distance ca. 1

AME diameter. Clypeus ca. ½ AME diameter. Paturon brown, with three prolateral and three retrolateral teeth; cheliceral fang curves mesally about a third of the way from the chelicera. Legs colored as carapace; femur I sigmoid; formula 1243: femur I 2.59, patella

I 0.81, tibia I 2.20, metatarsus I 2.53, tarsus I 0.88; femur II 2.02, patella II 0.72, tibia II

1.59, metatarsus II 1.92, tarsus II 0.71; femur III 1.20, patella III 0.50, tibia III 0.76, metatarsus III 0.95, tarsus III 0.47; femur IV 1.65, patella IV 0.60, tibia IV 1.21, metatarsus IV 1.55, tarsus IV 0.54. Abdomen 3.15 long, 2.27 wide, 2.54 high, mostly white with guanocytes, with two dark longitudinal bands; dark lateral band terminates anterior to spinning field and coalescence with other stripes; in color with two dark brown stripes on the dorsum and one on each side; venter of abdomen brown. Palp (Figs.

45E-I, 47E-I) typical for Deliochus, with tibiae 1/2 to 3/4 length of cymbium, and no apparent embolic barbs.

Variation

Females’ (n=4) total length 7.94–10.54; carapace length 3.58–4.31, width 2.90–3.30, height 1.22–1.46; abdomen length 5.41–6.34, width 4.92–5.24, height 3.74–6.67; sternum length 1.68–2.21, width 1.48–1.76. Males’ (n=4) total length 3.77–5.32; carapace length

2.04–2.98, width 1.42–1.88, height 0.67–1.44; abdomen length 2.13–3.15, width 1.56–

2.27, height 1.68–2.54; sternum length 1.02–1.22, width 0.86–1.02.

188

Natural History

Males of this species are often half or full eunuchs.

Distribution

This species occurs in Queensland, New South Wales, Tasmania, and Western Australia

(Fig. 48).

Figure 48. Distribution of Deliochus idoneus comb. nov.

189

Additional material examined

New South Wales, Berowra Valley Regional Park, -33.657, 151.114, 1.v.2011, G.

Milledge, H.M. Smith, beat, sweep, and hand collecting, 1F (AM KS115760); New South

Wales, Kosciuszko National Park, Waste Point, 8.3 km N of Jindabyne, -36.350,

148.606, elev. 930 m, 1.iii.2008, A. Hegedus, night, 2F (AM KS104534); New South

Wales, Lane Cove River, -33.814, 151.167*, 4.iv.1911, J. Edgecombe, 1F (AM

KS118829); New South Wales, Minmi, -32.877, 151.617*, 1F (AM KS32855); New

South Wales, Banyabba State Forest, start of Ogilivie Track, -29.382, 153.007, 9.iii.2008,

G. Milledge, H. Smith, beat, sweep, and under bark, sclerophyll forest, 1F (AM

KS103201); New South Wales, Glen Davis Road, 33.135, 150.047*, 23.iv.1966, R.

Mascord, 3FF (AM KS34081); New South Wales, Glen Davis Road, 33.135, 150.047*,

23.iv.1966, R. Mascord, 1M (AM KS32854); New South Wales, Pomingalarma Park, 8 km W of Wagga Wagga, -35.067, 147.367, 24.i.2001, C. Car, sweep/beat understory of

Bracteantha viscosa, 1M (AM KS93951); New South Wales, Hornsby, Waitara Creek, -

33.714, 151.089, 15.iii.2004, H. Smith, in web at night, 1M (AM KS88813); New South

Wales, Camden, -34.056, 150.694*, 15.vii.1968, M. Gray, purse retreat on blackthorn, 1F

(AM KS34345); New South Wales, Epping Strip, -33.767, 151.083, 20.iii.1999, J. Noble,

1F (AM KS59066); New South Wales, Munmorah Recreation Reserve, Geeburg

Camping Area, -33.193, 151.606*, M.R. Gray, 1F (AM KS17133); New South Wales,

Beecroft, -33.750, 151.067, 10.iii.1999, J. Noble, 1F (AM KS59061); New South Wales,

Beecroft, -33.750, 151.047*, 20.iv.1998, J. Noble, 1F (AM KS52451); New South Wales,

South Granville, -33.867, 151.000, 31.v.1995, 31.v.1995, J. Noble, 1F (AM KS59065);

New South Wales, Kirrawee, -34.032, 151.073*, 1F (AM KS52456); New South Wales,

190

Epping Strip, -33.767, 151.083, 15.ii.1995, J. Noble, malaise trap, 1Juv (AM KS54253);

Queensland, Cainbable Cabin, nr. Lamington National Park, -28.135, 153.109, 1-

3.ii.2016, 641 m, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla, 1Juv; Queensland,

Rochedale, Malloy Rd, -25.572, 153.121*, 18.ii.1972, R.J. Raven, V.E. Davies, with coarse silk sac with egg sac, 1F (QM S4575); Queensland, Rochedale, Malloy Rd, -

25.572, 153.121*, 18.ii.1972, N.C. Coleman, 1F (QM S45286); Queensland, Brisbane,

Rochedale State Forest, -25.572, 153.121*, 20.iii.1980, sweeping, 1F (QM S45273);

Queensland, Rochedale State Forest, -25.572, 153.121*, 17.iv.1980, V.E. Davies, R.J.

Raven, night collecting, 1F (QM S45274); Queensland, Mt. Malloy, Little Farm, -16.696,

145.402*, 28.vi.1973, F. Little, 2FF (AM KS45283); Queensland, Rundle Shale, A.

Rozefelds, 4-5.xii.1980, 1F (QM S45278); Queensland, Amiens, nr. Stanthorpe, -28.645,

151.942*, 14.iv.1974, G. May, 1F (QM S45284); Queensland, Black Mountain, -26.417,

152.857, N.C. Coleman, 1971-1972, 1M (QM S45445); Queensland, Clear Mountain, -

27.315, 152.890*, 30.vi.1985, G. Anderson (QM S45260); Queensland, Dulacca, nr.

Miles, -26.315, 152.890*, 1.v.1928, J.C. Doherty, 1F (QM S45279); Queensland, Gin

Gin, -24.979, 151.947*, 8.viii.1987, N.C. Coleman, 1F (QM S45277); Queensland,

Caloundra, Bells Creek, -26.798, 153.125, 9.vii.1970, R. Monroe, 1F (QM S45285);

Queensland, Caloundra, Bells Creek, -26.798, 153.125, 9.vii.1970, R. Monroe, 1F, 1M

(QM S45628); Queensland, Rockhampton, Emu Park, -23.280, 150.537*, 29.xi.1973,

V.E. Davies, 2F (QM S45276); Queensland, Redland Bay, -27.628, 153.297*, 4.iii.1950,

I.G. Filmer, 1F (QM S45280); Queensland, Lake Broadwater, -27.363, 151.099*,

11.iv.1987, M. Beunie, tussock on ridge, 1F (QM S45436); Queensland, Kroombit Tops

National Park, Lower Dry Creek, 45 km SW of Calliope, -24.377, 151.041*, 9-

191

19.xii.1983, V.E. Davies, J. Gallon, open forest, beating, JJ (QM S45645); Queensland,

Cairns, Trinity Park, track to Earl Hill via Reed Rd, -16.800, 145.709, 21.v.2000, G.

Milledge, H. Smith, 1F (AM KS57879); Queensland, Brisbane, Burbank Park, J.C.

Trotter Memorial Park, -27.550, 153.183, 9.vi.2005, M. Rix, 1F (QM); Queensland,

Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -27.556, 153.177, 6-

11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1F, 1M eunuch (USNM);

Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -27.556, 153.177,

-27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1F

(USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -

27.556, 153.177, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, consuming male eunuch, 1F (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F.

Álvarez, M. Rix, dry forest, consumed male eunuch, 1M (USNM); Queensland,

Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -27.556, 153.177, 6-

11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, consumed male eunuch,

1M (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -

27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1M, 1F

(USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park, -

27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1M eunuch (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter Memorial Park,

-27.556, 153.177, 27.xii.2002 (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C.

Trotter Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez,

M. Rix, dry forest, 1M eunuch (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C.

192

Trotter Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez,

M. Rix, dry forest, 1F (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter

Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1F, 1M (USNM); Queensland, Brisbane, Tingalpa dry forest, J.C. Trotter

Memorial Park, -27.556, 153.177, 6-11.iv.2002, 40 m, M. Kuntner, F. Álvarez, M. Rix, dry forest, 1M (USNM); Queensland, Eumundi, Gheerulla Creek rest area, -26.565,

152.767, 13.i.2003 (USNM); Queensland, Belmont Hills Bushlands, site 1, -27.513,

153.118, 3.xi.2003, 80 m, QM Party, 1F (QM S65466); Queensland, Boondall

Wetlands, site 1, -27.340, 153.075, 2.ix.2003, 5-10 m, QM Party, day hand collecting in

Meleleuca woodland, 2FF (QM S67328); Queensland, Bundaberg, Baldwin's Swamp, -

24.850, 153.350*, 1993, E.E. Zillman, 1F (QM S25379); Queensland, Bushlands

Reserve, Chelsea Rd, -27.483, 153.183, 10.xi.2003, QM Party, 2FF (QM S67527);

Queensland, Bushlands Reserve, Chelsea Rd, -27.483, 153.183, 10.xi.2003, QM Party,

1M (QM S56825); Queensland, Cooloola, Teewah Creek, -26.052, 152.974*,

31.xii.1973, R.J. Raven, 1F (QM); Queensland, Drewvale, Illaweena St, -27.643,

153.063, 5.xi.1003, QM Party, 2FF (QM S65823); Queensland, Glasshouse, 4.vi.1991,

M. Glover, 1F (QM S48957); Queensland, Murphys Creek, base of Toowoomba River, nr. Springbluff Reservoir, -27.467, 152.033*, 3.iv.2004, J. Warden, 1F (QM S73642);

Queensland, Noosa National Park, -27.392, 153.111*, ix.1973, G. May, 1F (QM);

Queensland, Rollingstone, -19.033, 146.382*, 17.vi.1979, 1F with spiderlings (QM

S58375); Queensland, Cairns, Crystal Cascades, -16.927, 145.697*, 25.v.1969, N.C.

Coleman, 2FF (AM KS95968); Tasmania, East Risdon, -42.822, 147.325*, 13.ii.1934,

V.V. Hickman, 1F, 1M (AM KS328554); Tasmania, East Risdon, -42.822, 147.325*,

193

17.iv.1957, V.V. Hickman, 1F, in cocoon-like nest with eggsac in shrub (AM KS28862);

Tasmania, Domain, -42.865, 147329*, 27.iv.1973, V.V. Hickman, 1F (AM KS28678);

Tasmania, Domain, -42.865, 147329*, 7.iii.1968, V.V. Hickman, 2FF (QM S45443);

Tasmania, Domain, -42.865, 147329*, 7.iii.1968, V.V. Hickman, 4MM (QM S45444);

Tasmania, Domain, -42.865, 147329*, 13.vii.1968, V.V. Hickman, from cocoon-like nests (MCZ); Tasmania, Domain, -42.865, 147329*, 27.ii.1982, JLH, taken together, 1F,

1M (QM S45442); Tasmania, Swansea Area, -42.104, 148.017*, 8.iv.1990, M.R. Gray,

3FF (AM KS53098); Tasmania, Risdon, -42.822, 147.327*, 27.ii.1964, V.V. Hickman, in cocoon-like nest among leaves on shrub, 1F (AM KS28679); Tasmania, East Risdon, -

42.822, 147.325*, 27.ii.1964, V.V. Hickman, in curled leaves, 2FF (AM KS28580);

Victoria, Anglesea, -38.406, 144.017*, 17.iii.1953, McEvery, 1F (MV ENTO2014-19L);

Victoria, Maryborough, -30.050, 143.735*, 21.ii.1972, 2Juv (MV ENTO2014-19L);

Victoria, 2.iv.1896, P. French, 4FF (QM); Australian Capital Territory, Canberra, -

35.281, 149.129*, 24.v.1992, G. Milledge, 1F (MV ENTO2014-19L); Western Australia,

Red Hill Road, top of Darling Scarp, FN1, -31.833, 116.067, 14.vii.1957, B.Y. Main, 1F

(WAM 101109).

NOTE: Multiple vials of Deliochus idoneus collected by V.V. Hickman identify those specimens as Collina glabicira Urquhart, 1891, or as Phonognatha glabicira.

Unfortunately, the plates accompanying the description of the genus and species are lost, as is the type specimen (Mike Fitzgerald, pers. comm.). The description of the epigynum in particular is broadly reminiscent of that of Deliochus, but the height of the clypeus and distally enlarged, convergent endites in the description of C. glabicira suggest it may be a

194 theridiid. Without the type specimen or figures, however, we cannot conclusively say if this monotypic genus should be moved from Araneidae or synonymized with Deliochus.

Artifex Kallal & Hormiga new genus

Type Species: Epeira melanopyga L. Koch, 1871

Diagnosis: Artifex can be distinguished from other araneids based on the following combination of characters: a brown ring and crescent shapes on the dorsum of the abdomen (Fig. 50A), wider posterior abdment (Fig. 50A, 54A) usually surrounding apodemes, on a pale guanocyte field in both sexes and a rugose area on the posterior margin of the ALS. Males have a somewhat elongated conductor with a process pointing apically near center of palp, a translucent membrane wrapping the conductor mesally

(Figs. 51B, E-I), embolus with sclerotized shaft and sperm duct separated by pars pendula (Fig. 51B), convering about midway, with minute hooks on both, and the absence of median apophysis (Fig. 20C). Females can be identified based on the epigynum with two ventral copulatory openings without a scape separated by a sclerotized carina or septum and broad, somewhat sclerotized copulatory duct. Females can be distinguished from Phonognatha and Deliochus by the wider posterior abdomen and broad copulatory openings (Fig. 49D, 53D). Males have a membranous layers of the conductor (Fig. 50E) absent in related genera.

Description

Female: Total length 9.45-14.11. Carapace 4.87-6.01 long, 3.12-4.30 wide, 1.41-2.16

195 high, yellowish brown to reddish brown in color, with pars cephalica and carapace margins darker than pars thoracica. AMEs on small prominence; lateral eyes juxtaposed, paired on a small prominences; AME diameter 0.25-0.44; AME interdistance slightly wider than AME diameter; AME-PME distance ca. AME diameter. Clypeus ca. 1/2 -3/4

AME diameter. Paturon colored as pars cephalica, with 3 prolateral and 3 retrolateral teeth. Leg formula 1243, colored as cephalothorax, or slightly lighter; femur I sigmoid.

Abdomen 5.94-9.62 long, 4.18-7.15 wide, 3.03-7.02 high; light brown with pale guanocytes; 1-5 dark brown markings, often with dark brown posterior; ventral side two longitudinal stripes from epigastric furrow to spinning field. Spinning field typical of araneoids, with the following exceptions common to zygielline (and some nephiline) araneids: a rugose area on posterior rim of ALS making a notch in the piriform spigot field and one flagelliform spigot of triad closer to a cylindrical gland spigot than aggregate gland spigots. Epigynum with large ventral-facing copulatory openings separated by a sclerotized septum; copulatory duct broad and somewhat sclerotized, curling ventrally to reach spermathecae; fertilization ducts emerging dorsal and posterior from spermathecae. Copulatory duct frequently plugged with minutely hooked emboli.

Male: Total length 4.46-6.91. Carapace 2.28-3.90 long, 1.45-2.39 wide, 0.77-1.12 high, yellowish brown to reddish brown in color, with pars cephalica and lateral edges of carapace darker than pars thoracica. AMEs on small prominence; eye arrangement as in female; AME diameter 0.16-0.26; AME interdistance slightly wider than AME diameter;

AME-PME distance ca. AME diameter. Clypeus ca. 1/2 AME diameter. Chelicerae colored as pars cephalica, with 3 prolateral and 2 retrolateral teeth. Legs formula 1243,

196 colored as cephalothorax, or slightly lighter; femur I sigmoid. Abdomen 2.72-3.50 long,

1.68-2.40 wide, 1.71-2.41 high; 1-5 dark brown markings, often with dark brown posterior; ventral side two longitudinal stripes from epigastric furrow to spinning field.

Spinning field similar to female. Pedipalp tibia approximately half the length of cymbium; cymbium slightly elongated, with broad, integral paracymbium; tegulum and subtegulum rotated dorsally; membrane connecting embolic division with tegulum near embolic base; embolus with sclerotized shaft and sperm duct separated by pars pendula, then converging at about midway, with small barbs near point of convergence; conductor coiled with an embolic groove, covered ectally with translucent membrane covering mid- conductor process.

Composition

Artifex is composed of two species: A. melanopyga (L. Koch, 1871) new combination, and A. joannae (Berland, 1924) new combination.

Natural history

Artifex is confined to tropical regions. Like Deliochus, it is characterized by female- biased sexual size dimorphism. Pedipalps with missing bulbs and plugged copulatory ducts are common.

Phylogenetics

Artifex is supported by the putative synapomorphies of a wide posterior abdomen extending past spinnerets, wide spermathecae separation, and ring-like zygielline dorsal

197

markings.

Distribution

Known from Queensland and New South Wales, Australia, and New Caledonia (Fig. 52).

Etymology

The name Artifex is derived from the Latin word ars and the suffix –fex, meaning a skilled crafter. The name refers to the use of a leaf as a retreat by the members of this genus.

Artifex melanopyga (L. Koch, 1871) new combination

Figs. 20C, 49-52.

Epeira melanopyga L. Koch, 1871: 9, Plate 8 Fig. 2. Type: Australia, Queensland, Port

Mackay, 1F holotype (ZMUH, examined).

Singotypa melanopyga Rainbow, 1916: 87, Plate 21, Fig. 9 (male).

Phonognatha melanopyga Kuntner et al., 2008: 170, Figs. 11D, H-I (female, male);

Kuntner et al., 2009: 1452, Fig. 1C (male).

Araneus mastersi Bradley, 1876a: 146, Plate 1, Fig. 1 (female, male). New synonymy.

Diagnosis

Males of A. melanopyga are distinguishable from closely related species by the

198

membranous area on its conductor (Fig. 51E). Females can be distinguished from A.

joannae by its more or less straight median septum (Fig. 49D vs 52D) and crescent (Fig.

50A) rather than ring-shaped (Fig. 54A) dorsal abdominal markings.

Figure 49. Artifex melanopyga comb. nov. Female: A, ALS; B, PMS; C, PLS; D, epigynum, ventral. Male pedipalp: E, apical; F, ectal; G, ventral; H, mesal; I, dorsal. Scale bars (μm): A,C: 20; B: 20; D-I: 100.

199

Description

Female (Figs. 49, 50A-D)(from Queensland, Yam Island, S 12466). Total length 12.29.

Carapace 5.36 long, 3.63 wide, 1.96 high, yellowish brown to reddish brown, with

cephalic area and fovea darker; sternum 2.48 long, 1.76 wide, reddish brown, with dark

margins and pale central area. Eye rows slightly recurved, anterior row more so than the

posterior. AMEs on small prominence; lateral eyes juxtaposed, paired on a small

prominences; AME diameter 0.19; AMEs interdistance ca. 1 ½ AME diameter; AME-

PME distance ca. 1 AME diameter. Clypeus ca. 1 AME diameter. Paturon reddish brown, with three prolateral and three retrolateral teeth; cheliceral fang curves mesally about a third to half of the way from the chelicera. Legs colored as cephalothorax; femur I sigmoid; formula 1243: femur I 4.29, patella I 1.92, tibia I 4.06, metatarsus I 4.72, tarsus

I 1.50; femur II 3.48, patella II 1.60, tibia II 3.31, metatarsus II 3.70, tarsus II 1.40; femur

III 2.61, patella III 1.21, tibia III 1.67, metatarsus III 2.24, tarsus III 1.06; femur IV 3.48, patella IV 1.49, tibia IV 2.72, metatarsus IV 2.55, tarsus IV 0.97. Abdomen 8.03 long,

5.39 wide, 5.04 high, elongate, slightly wider posteriorly; dorsal face light brown with pale guanine crystals; dorsum with 3-4 pairs of curved brown markings, with brown posterior area; venter with two indistinct longitudinal stripes of guanocytes between epigastric furrow and spinning field, which is relatively centrally positioned. Epigynum with two large ventral-facing, sclerotized copulatory openings, separate by a median septum of a relatively uniform width; copulatory ducts turn with multiple looping convolutions in an anterior lobe before turning on itself before reaching spermathecae; fertilization ducts emerge from posterior region of spermathecae and extend dorsally.

200

Figure 50. Artifex melanopyga comb. nov., female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

201

Male (Figs. 49E-I, 51)(from Queensland, Fitzroy Island, KS33822). Total length 6.20.

Carapace 3.43 long, 2.09 wide, 1.08 high, yellowish brown, with cephalic region slightly darker, and division between cephalic and thoracic regions and fovea darker still; sternum

1.26 long, 0.94 wide, colored as cephalothorax. Eye arrangement as in female. AME diameter 0.21; AMEs interdistance ca. 1 AME diameter; AME-PME distance slightly less than ca. 1 AME diameter. Clypeus ca. ½ AME diameter. Paturon yellowish brown to reddish brown, with three prolateral and two retrolateral teeth; cheliceral fang bends mesally at approximately the midway point. Legs colored as cephalothorax; femur I sigmoid; formula 1243: femur I 3.02, patella I 1.29, tibia I 2.89, metatarsus I 3.07, tarsus

I 0.98; femur II 2.42, patella II 1.19, tibia II 2.49, metatarsus II 2.50, tarsus II 0.95; femur

III 1.47, patella III 0.72, tibia III 1.00, metatarsus III 1.10, tarsus III 0.60; femur IV 2.05, patella IV 0.92, tibia IV 1.73, metatarsus IV 1.65, tarsus IV 0.70. Abdomen 3.35 long,

2.04 wide, 2.00 high, dorsal face light brown with pale guanine crystals; 4-5 pairs of indistinct dark brown markings on the dorsum, with brown posterior area; ventral face lacking guanocytes. Pedipalp typical of Artifex, with tibia approximately 1.5 times the length of the cymbium.

Variation

Females’ (n=5) total length 9.45–13.59, carapace length 4.88–5.36, width 3.11–3.63, height 1.41–1.60, abdomen length 5.94–9.66, abdomen width 4.18–6.08, abdomen height

3.03–6.05, sternum length 2.21–2.50, and sternum width 1.59–1.96. Males’ (n=5) total length 4.46–6.91, carapace length 2.28–3.90, width 1.45–2.36, height 0.77–1.12,

202

Figure 51. Artifex melanopyga comb. nov., male. A, dorsal; B, frontal; C, lateral; D, ventral. Pedipalp: E, ectal, illustrated; F, dorsal; G, mesal; H, ventral; I, ectal. Scale bars (mm): A-D: 0.5; E-I: 0.1.

203

abdomen length 2.72–3.45, abdomen width 1.68–2.40, abdomen height 1.71–2.41,

sternum length 1.13–1.82, and sternum width 0.83–1.30.

Natural History

This species exhibits sexual size dimorphism, with females reaching approximately three

times the length of males. Multiple male specimens are missing their palps and females

often have epigynal plugs formed from those palps. This has been described as genital

emasculation and is discussed further in Kuntner et al. (2015).

Distribution

Known from the eastern region of Queensland, including islands of the Torres Strait (Fig.

52).

Figure 52. Distribution of Artifex melanopyga comb. nov. and A. joannae comb. nov. Circles correspond to A. melanopyga; diamonds correspond to A. joannae.

204

Additional material examined

Queensland, Mossman, -16.45, 145.37*, 22.ix.1969, R. Mascord, 1F (AM KS33823);

Queensland, Cape Kimberley, Neal, Noah Creek Area, -16.283, 145.467, 26.x.1994, R.

Elick, B.Y. Main, rainforest, from a Crinum, nest in cone-shaped dry leaf, 1F, 1M eunuch

(WAM 99/2984); Queensland, Cooktown, -15.436, 145.216*, 3-10.iv.1991, G. Milledge,

1F (MV ENTO2014-19L); Queensland, Sarina Beach, 30 km SSE of Mackay, 21.387,

149.309*, 20.iv.1991, G. Milledge, 1Juv (MV ENTO2014-19L); Queensland,

Gordonvale, -17.097, 145.779*, 18.iv.1916, W.J. Rainbow, 1M, 3Juv (MV ENTO2014-

19L); Queensland, Townsville, -19.260, 146.812*, 5.ii.1945, B. Malkin, 7FF (WAM);

Queensland, Paluma, -19.000, 146.200, 22.i.1981, M.S. Harvey, 1F (WAM 99/2985);

Queensland, Gordonvale, -17.018, 145.791*, vi.1916, A.A. Girault, 3FF (WAM

1916/421); Queensland, Townsville, -19.260, 146.812*, 2.v.1945, B. Malkin, 1F

(WAM); Queensland, South Malle Island, Lamond Hill, -20.270, 148.837*, 30.xi.1981,

M.S. Harvey, ex curled leaves in web, 1F (WAM 99/2838); Queensland, Cooloola, Camp

Milo, -25.045, 153.210*, 3-7.ii.1976, R.J. Raven, V.E.Davies, curled leaf in web, 10+FF

(QM); Queensland, Enfield site, nr Westmar, -27.951, 149.712*, 9.i.1979, R.J. Raven,

V.E. Davies, 3FF (QM); Queensland, Enfield site, nr.Westmar, -27.951, 149.712*,

10.i.1979, R.J. Raven, V.E. Davies, 10+FF (QM); Queensland, Lake Broadwater, -

27.363, 151.099*, 12.ii.1984, M. Bennie, 1F (QM); Queensland, Mt. Colliery, Warwick,

-28.217, 152.017*, 1.iii.1971, R. Monrow, swept in roadside vegetation, 1F (QM);

Queensland, Yandaburra, 125 km SW of Springsure, -24.339, 147.623*, 7-16.v.1976, C.

Fearnley, 3FF (QM); Queensland, Mabuiag Island, -9.952, 142.180*, 3.viii.1975, H.

Heatwole, 1F (QM S39738); Queensland, Normanby Station, 30 km NW of Cooktown, -

205

15.334, 145.019*, 13-17.ix.1984, C. Fearnley, 1M, 1F (QM S39741); Queensland, Torres

Strait, Yam Island, 28.xi-2.xii.1986, J. Gallon, 1M (QM S12465); Queenland, Torres

Strait, Sabba Island, 31.vii.1975, H. Heatwole, 1F (QM S39739); Queensland, Torres

Strait, Friday Island, -10.598, 142.166*, 7.xii.1986, J. Gallon, 1F (QM S12302);

Queensland, Cape Hillsborough National Park, McBrides Point Eucalyptus Forest, -

20.912, 152.373*, 12.ii.1975, D.A. Schulz, 1F (QM S45594); Queensland, Airlie Beach,

-20.268, 148.719*, 16.ii.1986, R.J. Raven, J. Gallon, 1F (QM S8050); Queensland, Airlie

Beach, -20.268, 148.719*, 15-17.ii.1986, J. Gallon, R.J. Raven, general and night

collecting, 3FF, 1M (QM S8020); Queensland, Shute Harbor, -20.288, 148.786*,

16.ii.1986, R.J. Raven, J. Gallon, night collecting, 10FF (QM S9959); Queensland, Shute

Harbor, -20.288, 148.786*, 15.ii.1986, R.J. Raven, J. Gallon, night collecting, 7FF (QM

S9956); Queensland, Shute Harbor, -20.288, 148.786*, 16.ii.1986, R.J. Raven, J. Gallon, vine shrub on rock, beating, 2FF (QM S9962); Queensland, Yeppon, Congalee Beach, -

23.135, 150.744, 1.xii.1992-iii.1993, 20 m, A. Walford, intercept and pitfall, 1F (QM

S27487); Queensland, Carlisle Island, camp area, -20.786, 149.286*, 12-19.xii.1986, M.

Bennie, FF, 2MM eunuchs (QM S39744); Queensland, Torres Strait, Yam Island, SW of

Yorke Island, -9.901, 142.775*, 28.xi-2.xii.1986, J. Gallon, under bark, 4FF (QM

S12466); Queensland, South Percy Island, lagoon area, -21.767, 150.300, 25-26.xi.1992,

Monteith, Thompson, Cook, Janetzki, 8FF (QM S40785); Queensland, Girraween

National Park, -28.775, 151.912*, 7.iii.1974, 5FF (QM S45629); Queensland, 5 km

upriver Mooloolaba, -26.651, 153.101*, 2.iv.1982, D. Sinclair, found at edge of river in

paperbark area at fringe, 1F (QM S45599); Queensland, Rockhampton, nr. Mount

Archer, -23.363, 150.529*, 5-6.x.1982, A. Rozefelds, rainforest, 1M, 1Juv (QM S56819);

206

Queensland, Torres Strait, Horn Island, -10.607, 142.282*, 23.vii.1975, H. Heatwole,

E.C., 2FF (QM S39736); Queensland, Torres Strait, Moa Island, Kubin Village, -10.177,

142.258*, 14.viii.1975, H. Heatwole, 1F (QM S39737); Queensland, Undara, -18.225,

144.577, 2.x.1989, M. Godwin, in rolled leaf, 1F (QM S35306); Queensland, 40 Mile

Scrub, SW of Mount Garnet, -18089, 144862*, 3-10.iv.1978, V.E. Davies, R. Raven, 1F,

Juvs (QM S39777); Queensland, Salvator Rosa National Park, Spyglass, -24.817,

146.424*, 16.ix.1984, M. Bennie, 10+ Juvs (QM S45459); Queensland, Gordonvale, -

17.081, 145.791*, AA. Girault, 1 M, 2Juvs (QM); Queensland, Torres Strait, Yorke

Island, -9.752, 143.407*, 13.viii.1974, S. Ingram, 3FF, 1M (QM S39734); Queensland,

Proserpine, Lethe Brook Creek Crossing, site XY20, -20.414, 148.527, 6.xi.2007, 13 m,

R. Raven, rainforest, 1F (QM S86719); Queensland, Proserpine, Thompson Creek, site

XY14, -20.511, 148.565, 12.xi.2007, 44 m, R. Raven, closed forest, 1F (QM S86802);

Queensland, Proserpine, Deadman Creek, site XY17, -20.505, 148.556, 10.xi.2007, 21 m,

R. Raven, open forest, 1F (QM S86827); Queensland, Proserpine, nr. Kelsey Substation, site XY19, -20.390, 148.541, 6.xi.2007, 21 m, R. Raven, closed forest, 1F (QM S86701);

Queensland, Proserpine, Thompson Creek, site XY16, -20.554, 148.505, 9.xi.2007, 48 m,

R. Raven, rainforest, 1F (QM S86593); Queensland, Proserpine, nr. Kelsey Substation, site XY19, -20.390, 148.541, 6.xi.2007, 21 m, R. Raven, closed forest, 2FF (QM

S86612); Queensland, Proserpine, Thompson Creek, site XY16, -20.554, 148.505,

9.xi.2007, 48 m, C.J. Burwell, rainforest, night hand collection, 15123, 1F (QM S86593);

Queensland, Proserpine, Thompson Creek, site XY15, -20.519, 148.557, 11.xi.2007, 30 m, R. Raven, closed forest, 1F (QM S86784); Queensland, Fitzroy Island, -16.935,

145.993*, 22.ix.1971, R.E. Mascord, 2FF, 1M (AM KS33822); Queensland, Fitzroy

207

Island, -16.935, 145.993*, 1951, J.G. Brooks, 1F (AM KS33821); Queensland, Prince of

Wales Island, Terry Beach, -10.687, 142.175*, E. Cameron, 1M (AM KS51624);

Queensland, Whitsunday Island, -20.267, 148.979*, i.1934, F. Amenhill, spider in leaf nest, 1F, 1M eunuch (AM KS34320); Queensland, 40 mi SW of Mount Garnet,

5.xi.1962, 750 m, E.S. Ross, D.Q. Cavagnaro, 2FF (CASENT); Queensland, Herveys

Range, -19.367, 146.433, 21.vii.2009, 380 m, G. Cocks, under leaf, 1M (AM KS109949);

Queensland, Townsville, -19.260, 146.812*, 1F (AM KS036939); Queensland, Davies

Creek Falls, -17.010, 145.582, 28.ii.2008, G. Milledge, H. Smith, beat and sweep, under bark, sclerophyll, 1F (AM KS103105); Queensland, Tumoulin Road, SE of Herberton, -

17.468, 145.372, 4.xii.2008, G. Milledge, H. Smith, general collecting, 1F (AM

KS106625); Queensland, Cape Kimberley, track to lookout W of caravan park, -16.274,

145.468, 21.ix.2003, G. Milledge, H. Smith, headtorch, 1M (AM KS86169); Queensland,

Cape York Peninsula, -15.433, 144.450, 9.viii.2002, G. Wishart, 1F (AM KS79682);

Queensland, Herveys Range, -19.367, 146.333, 21.vii.2009, 380 m, G. Cocks, under leaf,

1Juv (AM KS109944); Queensland, Cape York Peninsula, Elliot Falls, -11.350, 142.400,

7.viii.2002, G. Wishart, 2FF, 1M (AM KS79680); Queensland, Edmonton, rainforest block at end of Barr Street, -17.025, 145.747, 18-19.ix.2003, G. Milledge, H. Smith, curled leaf, 1F (AM KS86149); Queensland, Herberton, Petford Road, 0.9 km W of

Herberton, -17.386, 145.378, 23.ix.2003, G. Milledge, H. Smith, curled leaf, 2MM (AM

KS86117).

208

Artifex joannae (Berland, 1924) new combination

Figs. 52-54.

Phonognatha joannae Berland, 1924: 213, Fig. 118-120 (female, male). Type: New

Caledonia, Loyalty Islands, Maré, 18.xi.1911, 1 male, 10 females (Paris, not examined).

Diagnosis

This species is known exclusively from New Caledonia. Epigynum is similar to that of A. melanopyga, but the median septum is thinner in the middle while in A. melanopyga is

uniformly wide across its entire length (Fig. 52D vs. 49D), and has ring-like markings on

the dorsum of the abdomen (Fig. 54A). The epigynum of P. neocaledonica (the other

New Caledonian zygielline) lacks large copulatory openings separated by a septum. Male

is known only from original description (see note below).

Description

Female (Figs. 53-54)(from Mandjélia, WAM85308). Total length 12.43. Carapace 6.01

long, 4.30 wide, 1.91 high. Carapace with reddish brown cephalic area and yellowish

brown thoracic area; sternum 2.41 long, 1.98 wide, reddish brown with pale median

region. Eye rows slightly recurved, anterior row more so than the posterior. AMEs on

small prominence; lateral eyes juxtaposed, paired on a small prominences; AME diameter

0.31; AMEs interdistance slightly more than ca. 1 AME diameter; AME-PME distance

slightly more than ca. 1 AME diameter. Clypeus ca. 3/4 AME diameter. Paturon reddish

brown, with three prolateral and three retrolateral teeth; cheliceral fang curves mesally

209

Figure 53. Artifex joannae comb. nov. Female: A, ALS; B, PLS; C, PMS; D, epigynum, ventral. Scale bars (μm): A-C: 10; D: 100.

about a third of the way from the chelicera. Legs colored as cephalothorax; femur I

sigmoid; formula 1243: femur I 4.98, patella I 1.72, tibia I 4.36, metatarsus I 5.66, tarsus

I 1.60; femur II 4.22, patella II 1.59, tibia II 3.72, metatarsus II 4.37, tarsus II 1.42; femur

III 2.94, patella III 1.25, tibia III 2.14, metatarsus III 2.71, tarsus III 1.14; femur IV 3.97,

patella IV 1.32, tibia IV 2.95, metatarsus IV 3.50, tarsus IV 1.12. Abdomen 9.63 long,

6.98 wide, 6.12 high, light brown with pale guanine crystals; pair of dark brown markings

located anteriorly, with two to three ring-shaped brown markings, and dark brown caudally; two longitudinal stripes of guanocytes between epigastric furrow and spinning field. Epigynum with two large ventral-facing, sclerotized copulatory openings, separate by a median septum more constricted in the center; copulatory ducts turn ventrally before reaching spermathecae; fertilization ducts emerge from the posterior region of the

210

spermathecae and extend dorsally.

Variation

Females’ (n=6) total length 11.35–14.11; carapace length 4.87–6.01, width 3.32–4.30, height 1.53–2.16; abdomen length 7.34–9.63, width 4.94–6.98, height 4.83–6.40; sternum

length 2.01–2.49, width 1.90–2.01.

Natural History

Multiple specimens have embolus plugging the epigynum, similar to A. melanopyga. This

is paired with a trait that seems to be codistributed with epigynal plugs in this lineage: a

distally serrated embolus. Furthermore, the male size reported by Berland (1924)

suggests sexual size dimorphism, which it would also share with its congeneric and

Deliochus.

Distribution

Known exclusively from New Caledonia (Fig. 52).

NOTE: The male is illustrated in Berland (1924), but we were not able to obtain the

specimens. Based on the illustration, the pedipalps of A. melanopyga and A. joannae are

similar but we cannot elaborate on details.

211

Figure 54. Artifex joannae comb. nov., female. Habitus: A, dorsal; B, frontal; C, lateral; D, ventral. Epigynum: E, ventral; F, dorsal, illustrated; G, ventral, illustrated. Scale bars (mm): A-D: 0.5; E-G: 0.1.

212

Additional material examined

Rivière Bleue, -22.083, 166.650, 9.ii.1993, 240 m, M.S. Harvey, N.I. Platnick, R.J.

Raven, rainforest, 1F (WAM 87838); Mount Mandjélia, -22.583, 164.533, 17.ii.1993,

600 m, M.S. Harvey, N.I. Platnick, R.J. Raven, rainforest, 1F (WAM 85308); Col de

Rousselles, -21.450, 165.467, M.S. Harvey, N.I. Platnick, R.J. Raven, rainforest, 1F

(WAM 85309); Ile des Pins, near Grotte de la 3eme, -22.617, 167.433, M.S. Harvey, N.I.

Platnick, R.J. Raven, rainforest, 1F (WAM 85310); 7 mi E of La Foa, -21.774, 165.917*,

1.ii.1945, C.L. Remington, 1F (WAM); Loyalty Islands, Lifu Island, -20.966, 167.258*,

5.ix.1938, L. MacMillan, 1F (WAM); Forêt Thy Reserve, -22.167, 166.917*, 21.v.1984,

150 m, G. Monteith, D. Cook, 1F (QM S45465); Mount Koghis, -22.168, 166.534*,

26.v.1984, 400 m, G. Monteith, D. Cook, 1F (QM S45467).

213

Figure 55. Zygiella x-notata. Female: A, ALS; B, PMS; C, PLS; D, epigynum, ventral. Male pedipalp: E, apical; F, ectal; G, ventral; H, mesal; I, dorsal. Scale bars (μm): A-C: 10; D: 20; E-I: 100.

214

MISPLACED TAXA

Family Araneidae

Acusilas vicitra (Rainbow, 1916) new combination

Phonognatha vicitra Sherriffs, 1928

India: South Coorg, Sidapur, Charlotte Estate, xii.1928, 3000 ft, W.R. Sherriffs, 4

females, 3 juveniles (collection unknown, not examined).

This spider is described from far beyond the known distribution of Phonognatha and its

close relatives (known only from Australia, New Caledonia, and Papua New Guinea),

and seems to have been allocated to that genus based on its color pattern and leaf curl.

However, examination of similar specimens (S. Kulkarni) and photos (M. Siliwal)

suggest this species is an Acusilas. Both are araneids that make leaf-curl retreats, and

confusing the two is not difficult (see Fig. 13B).

Family Linyphiidae

Neriene guanga (Barrion and Litsinger, 1995) New combination

Phonognatha guanga Barrion and Litsinger, 1995. Philippines: Luzon Island, Laguna

Province, Los Baños, IRRI Farm, 4.iv.1984, AT Barrion, female holotype (IRRI, not

examined); Liliw, Tuybaana Village, 14.iii.1979, TJ Perfect, subadult female paratype

(IRRI, not examined).

This species from the Philippines is described as a Phonognatha. However, unlike

215

Phonognatha or closely related taxa, this species has a high clypeus, abdomen without

dark-on-white markings, truncate abdomen with a posterior tubercle, V-shaped epigynum, lack of copulatory ducts inside a capsule, and non-lobed spermathecae.

Furthermore, there is no note about an orb-web with leaf retreat; this specimen was collected under leaves. This species is a member of Linyphiidae, in the genus Neriene, as pointed out by Hormiga (1997).

Family Tetragnathidae

Deliochus pulchra Rainbow, 1916. Australia: Queensland, Gordonvale, 30.vi.1912, WJ

Rainbow, holotype (KS 6475) (AM, examined)

Deliochus pulchra melania Rainbow, 1916. Australia: Queensland, Gordonvale,

15.vi.1912, WJ Rainbow, holotype (KS 8841) (AM, examined)

These two species were described based on specimens were collected in Gordonvale,

Queensland, Australia. Both are erroneously named D. pulcher in the WSC (2017), and

the label for the subspecies is misidentified as D. pulchra melania. Based on their eye

arrangement, endites, and simple epigyna, we suggest that these are tetragnathids.

However, the tetragnathids of Australia are relatively little known with numerous

undescribed genera and species (Álvarez-Padilla and Hormiga, in prep).

Key to zygielline genera

216

1. Males with median apophysis and projecting, sclerotized paracymbium (Figs. 55E-I); females with sustentaculum and spherical spermathecae…2

- Males without median apophysis; paracymbium absent or broadly integrated to cymbium; females without sustentaculum; spermathecae lobed…3

2. Males with cylindrical embolus tip; females with epigynal scape…Leviellus

- Males with flat embolus tip; females without scape…Zygiella

3. Males with short, compact, sclerotized conductor (Fig. 20C); females with epigynal flaps near copulatory openings (Fig. 37D)…Deliochus

4. Abdomen with dark spots, rings, or crescents; males with elongate conductor; females without epigynal flaps…5

5. Pars cephalica darker than pars thoracica (Fig. 50A); male conductor less sclerotized

(Fig. 51E); embolic hooks present (Fig. 51E); male with chelicerae morphology similar to

female (Fig. 50B, 51B); female epigynum heavily sclerotized with large copulatory

openings (Fig. 50E); copulatory duct not coiled in capsule…Artifex

6. Pars cephalica colored as pars thoracica; male conductor well sclerotized (Fig. 23F-I); embolic hooks absent; male cheliceral fang angular, longer than female (Fig. 22B, 23B); female epigynum with less sclerotized epigynum (typically only edges of copulatory

217

openings), with copulatory duct housed in a capsule (Fig. 26F-G)…Phonognatha

Key to females

1. Epigynum with hooked ‘flaps’ emerging posterior or lateral to copulatory openings

(Fig. 38E)…2

- Epigynum without hooked ‘flaps’ (Fig. 22E)…4

2. Epigynal flap lateral and adjacent to copulatory opening (Fig. 46E); abdomen white

(Fig. 45A), or with brown markings near anterior that may appear as stripes…D. idoneus

- Epigynal flap posterior to copulatory opening; sides abdomen with variegated brown

and white (or green, in life) markings, with thin, white, longitudinal markings

dorsally…3

3. Epigynal flap directly posterior to copulatory opening (Fig. 42E); carapace without markings near where pars thoracica and pars cephalica meet …D. humilis

- Epigynal flap posterior and lateral to copulatory opening (Fig. 38E); carapace with

markings near where pars thoracica and pars cephalica meet (Fig. 38A)…D. zelivira

4. Epigynum with wide copulatory openings separated by a sclerotized septum (Fig.

50D); copulatory duct not enveloped in capsule…5

- Epigynum without wide copulatory opening separated by a sclerotized septum (Fig.

22D); copulatory duct coiled within a capsule (Fig. 26F-G)…6

218

5. Sclerotized septum separating copulatory openings wide, without any constriction (Fig.

49D, 50E); copulatory duct forming knot-like structure (Fig. 50F-G); dark marking on abdomen with curved shape (Fig. 50A); Australia (Fig. 52)…A. melanopyga

- Sclerotized septum separating copulatory openings with slight constriction (Fig. 54E); copulatory duct without knot-like structure (Fig. 54F-G); dark marking on abdomen ring-

shaped (Fig. 54A); New Caledonia (Fig. 52)…A. joannae

6. Abdomen elongate, with spinnerets positioned near the center of the venter of the abdomen (Fig. 26D); dorsum of abdomen with two dark marking anteriorly and dark posterior (Fig. 26A); copulatory ducts coiled ten or more times (Fig. 26F-G)…P. melania

- Abdomen not elongate, with spinnerets positioned caudally; dorsum with multiple dark markings; copulatory ducts coiled less than ten times…7

7. Epigynum with sclerotized ridge anterior to copulatory openings (Fig. 21D, 22E), with openings slightly recessed; copulatory ducts coiled 1-2 times (Fig. 22F-G)…P. graeffei

- Epigynum without sclerotized ridge anterior to copulatory openings; copulatory ducts coiled 3 or more times…8

8. Copulatory openings well sclerotized, tear-drop shaped (Fig. 29D, 30E); long lobe with copulatory duct, with five to eight twists (Fig. 30F-G); New Caledonia (Fig. 31)…P. neocaledonica

- Copulatory openings not well sclerotized, circular (Fig. 33D, 34E); short lobe with

219

copulatory duct, with less than five twists (Fig. 34F-G); Australia (Fig. 36)…P. tanyodon

Key to males

1. Pedipalp with mid-conductor process (Fig. 20A)…2

- Pedipalp without mid-conductor process (Fig. 20B-C)…6

2. Tibia of pedipalp no longer than cymbium (Fig. 31B, 51B)…3

- Tibia of pedipalp longer than cymbium (Fig. 27B, 35B)…5

3. Conductor with translucent membrane wrapping mid-conductor process; mid- conductor process with relatively broad, anvil-shaped; pars pendula separating sclerotized embolic shaft and sperm duct (Fig. 20C, 51E-I); pars cephalica darker than pars thoracica (Fig. 51A)…A. melanopyga

- Conductor without translucent membrane and pars pendula; mid-conductor process pointed (Fig. 23E); pars cephalica colored as pars thoracica…4

4. Tibia 3/4 to equal in length of the cymbium (Fig. 23B); Australia…P. graeffei

- Tibia less than 1/2 length of cymbium (Fig. 21B); New Caledonia…P. neocaledonica

5. Palpal tibia 1-2 times length of cymbium (Fig. 27B); chelicerae with largely monomorphic teeth…P. melania

- Palpal tibia exceeding 3 times length of cymbium (Fig. 35B); chelicerae with extremely

220 long apical tooth (Fig. 35B)…P. tanyodon

6. Abdomen white, with two dorsal brown stripes and one on each side (Fig. 47A); embolus without hooks (Fig. 47E)...D. idoneus

- Abdomen with two thin longitudinal white stripes with a darker color on either side and stripes on sides (Figs. 39A, 43A); embolus with hooks (Fig. 39E, 43E)…7

7. Carapace with dark markings where pars cephalica and pars thoracica meet (Fig.

39A); embolic hooks relatively long and spaced by approximately one hook length (Fig.

39E)…D. zelivira

- Carapace without dark markings with pars cephalica and pars thoracica meet (Fig.

43A); embolic hooks short and close together as serration (Fig. 43A)…D. humilis

221

Chapter 4: Phylogenetic relationships within the orb-weaving spider family Araneidae, and the effects of orthology assessment and gene occupancy on phylogenomic analyses

Abstract

Orb-weaving spiders of the family Araneidae are an extremely diverse and charismatic terrestrial arthropod group, with many of them recognizable by their iconic circular snare web. In general, morphological, behavior, target loci, and total evidence analyses have made great strides toward understanding the relationships with Araneidae, but several recalcitrant nodes remain and no overarching phylogeny of araneids is available. In this study, we analyze 33 taxa, including 19 araneids, representing most of the main araneid lineages. Six matrices were constructed to test the effects of ortholog assessment based on the methods BUSCO and UPhO and gene occupancy ranging from 45-85% representation, with tree inference based on multi-species coalescent, maximum likelihood, and Bayesian methods. We found consistent congruence between most of the 17 completed treatments, with minimal effects of occupancy, missing data, or orthology assessment. Low numbers of genes associated with combinations of orthology assessment and occupancy produced trees with low node support or anomalous topologies, whereas high node support was generally associated with more genes, lower occupancy, and more missing data. The two orthology methods shared few transcripts and arrived at broadly similar topologies, suggesting strong signal in the sequences. Araneidae is monophyletic with congruence with target gene analyses, but work remains in parsing the relationships of Cyclosa and close relatives.

Introduction

The spider family Araneidae is composed of approximately 3,200 species in 169 genera,

222

making it the third most speciose spider family after Salticidae and Linyphiidae (World Spider

Catalog 2017). Araneids have been the subject of research on topics ranging from sexual size

dimorphism (Hormiga et al. 2000; Kuntner and Coddington 2009; Cheng and Kuntner 2015),

web evolution (Craig 1987; Blackledge et al. 2009; Gregorič et al. 2015), stabilimenta (silk

patterns found in some orb-webs) (Lubin 1974; Blackledge and Wenzel 1999; Seah and Li 2001),

and mating behavior (Christenson et al. 1985; Robinson and Robinson 1980; Robinson 1982).

However, much of this work, especially comparative studies requiring broad sampling, requires a

phylogenetic tree as a foundation. Over the course of the last several decades, there has been little

consensus on the phylogeny of Araneidae, which has hampered further study on this family as well as our understanding and interpreting of araneid diversity.

No discussion of araneid phylogeny can escape the influence of the late Herbert W. Levi

(1921–2014), whose revisions of the Neotropical orb-weavers in particular are an invaluable resource. The field has benefited greatly from his work and its importance cannot be understated.

There is less rigorous knowledge of araneid taxonomy elsewhere in the world, making the wider problem difficult, particularly for the tropical faunas. While there are a number of genus-level revisions in place, there was no explicit, widely sampled phylogenetic study of Araneidae until relatively recently.

The landmark study by Scharff and Coddington (1997) represents the first effort to analyze the relationships among the major araneid lineages in a cladistic framework using morphological and behavioral characters (Fig. 56A). With 100 species across 70 genera, that work was pivotal in our understanding of Araneidae phylogeny. Major results of Scharff and

Coddington (1997) included finding Araneidae as sister to the remaining araneoids, non- monophyly of Micratheninae and Gasteracanthinae, Zygiella as an araneid but not Nephila, and many other relationships and patterns of trait evolution.

Shortly thereafter, the increasingly popular use of molecular systematics by

arachnologists led to a number of conflicts between works based on the types of characters used

223

(see review in Hormiga and Griswold 2014). For instance, the first family level molecular

analysis on araneoids placed Araneidae sister to Linyphiidae rather than sister to both

Linyphiidae and Tetragnathidae (Hausdorf 1999). With increasing numbers of taxa and

characters, as well as combinations of molecular and morphological datasets, it became more and

more apparent that the foundational morphological work does not reflect our modern

interpretation of Araneidae (Figs. 56B-E). For instance, despite its nested placement in Scharff

and Coddington’s analysis (1997), Arkys is more closely related to Tetragnathidae and

Mimetidae, resulting in its placement in a new family, Arkyidae (Fig. 56C,D,F) (Dimitrov et al.

2016). Similarly, the nested placement of Zygiella with Araneidae would be replaced by a more

basally diverging position, sister to Phonognatha and Deliochus, which were long thought to be

tetragnathids (Fig. 56B-D,F) (Blackledge et al. 2009; Álvarez-Padilla et al. 2009; Dimitrov et al.

2012; Gregorič et al. 2015; Dimitrov et al. 2016). However, many results found in Scharff and

Coddington’s work was corroborated by subsequent analyses; Zygiella would remain an araneid;

Mastophorinae would remain closely related to Cyrtarachninae; Gasteracantha and Micrathena

were not closely related (Blackledge et al. 2009; Dimitrov et al. 2012; Tanikawa et al. 2014;

Gregorič et al. 2015; Dimitrov et al. 2016).

Just as purely morphological and behavioral analyses were incongruent with molecular and total evidence results, so were molecular and total evidence results with each other. For instance, nephiline araneids were placed at family-level in Nephilidae based on morphological, behavioral, and molecular characters (Kuntner et al. 2008; Álvarez-Padilla et al. 2009; Kuntner et

al. 2013) before subsequent synonymy with Araneidae (Dimitrov et al. 2016). This in turn

affected the status of Zygiellinae (Zygiella, Phonognatha, and close relatives), which would have

also required family-level status to preserve the family Nephilidae. Other differences in the

phylogenies of different methods and studies may be at a deeper level (branching of subfamily-

level clades from the araneid backbone) or at a more shallow level between genera or species.

224

Figure 56. Hypotheses of the topology of Araneidae and close relatives. Previous analyses using morphology, target gene, total evidence, and transcriptomes are presented. Taxa shown are limited to those in this study for purposes of comparison; non-araneid terminals, if present, shown at superfamily or family level. All tree branch lengths are transformed. Grey highlighting represents Araneidae.

225

Major backbone level inconsistencies include Micrathena diverging prior to Oarcinae in Gregorič et al. (2015) but after in Dimitrov et al. (2016). The position of Mangora is weakly supported in most analyses. Scharff and Coddington (1997), Dimitrov et al. (2016), and Kallal and Hormiga

(in prep) found it sister or near sister to Araneus and Neoscona (Fig. 56A, C), while other analyses find it more basally diverging from the araneid backbone. Confusion also abounds from taxonomic revision lacking at the genus level. For instance, preliminary molecular analyses point to different genera for New World and Old World representatives of the genera Araneus and

Eriophora (Framenau et al. 2010; Gregorič et al. 2015; Kallal and Hormiga in prep.).

Issues related to limited utility of common genes used in spider phylogenetics has given way to the use of next generation sequencing methods to attempt to resolve incongruent, weakly supported, and recalcitrant nodes (Fernández et al. 2014; Bond et al. 2014; Garrison et al. 2015).

That is, the typical markers used for target gene spider phylogenetics – 12S, 16S, 18S, 28S, cytochrome c oxidase I, and histone 3 – may be too few to provide sufficient resolution for some questions in spider phylogenetics (Blackledge et al. 2009; Dimitrov et al. 2012, 2016). By comparison, use of transcriptomes has provided orders of magnitude more bases of molecular sequence data for comparison, alleviating limited data as a source of error or lack of resolution in spider phylogenetics. Specific to araneids, Garrison et al. (2016) include six taxa – Nephila clavipes, Verrucosa arenata, Micrathena gracilis, Neoscona arabesca, Gasteracantha hasselti, and Macracantha arcuata (Fig. 56E) – and their results are congruent with molecular and total evidence analyses. The limited sample of araneids makes this result likely, and testing the monophyly of Araneidae explicitly was not within their scope of their study. As the topology of

Araneidae evolves, so too does our understanding of the evolution of their traits, ranging from the morphology of the pedipalp (e.g., presence of the median apophysis) to web architecture (e.g., web shape or presence of stabilimenta).

226

While ‘big data’ may not be a panacea, size of the datasets that can be analyzed and the breadth of manipulations of those datasets make them flexible and powerful, but also with a number of pitfalls (see Delsuc et al., 2005). Relatively minute changes in the processing pipeline can produce topological artifacts, and incongruence between highly (and often absolutely) supported results of phylogenomic analyses is beginning to be explored in new ways (Salichos et al. 2014; Arcila et al. 2017; Shen et al. 2017). Some well-known examples of potential issues in processing transcriptomic and genomic data are rooting issues, stationarity, heterotachy, and taxon sampling (Wheeler 1990; Graham et al. 2002; Philippe et al. 2011); here, we will focus on orthology assessment and gene occupancy.

Comparison of orthologous genes (which are shared by common ancestry rather than other process such as duplication) is an underlying assumption of phylogenetic analyses. Despite theoretical clarity on differences between types of homologs (e.g, Fitch 1970), determining which are orthologs and therefore fit for comparison is an ongoing exploration. Strict similarity can be used as a proxy for orthology (Kristensen et al. 2011), but this orthology is assumed rather than tested by the data. Single copy orthologs for comparison, similar in theory to comparison of typical markers, is one way to confront the expansive sequence data gathered by next generation methods. Simão et al. (2015) developed BUSCO as a method for benchmarking completeness of transcriptomes or genomes based on a collection of single copy genes found in the majority of sampled genomes. In this case, nearly 2,700 arthropod genes compose the database for comparison. A hidden Markov model for comparison of genomic or transcriptomic data to genes in that database resulting in data being binned as a specific marker (sometimes called BUSCOs).

While this method is explicitly for benchmarking, the authors note single copy genes found in this way are useful for phylogenetics. Comparison to a database of possible orthologs draws its strength from relative simplicity (Salichos and Rokas 2011), but can be intrinsically limited by a finite number of targets for orders of magnitude more sequence data. Other, tree-based methods use the phylogeny of individual genes culled from the transcriptomes or genomes themselves to

227

infer orthology and paralogy (Hejnol et al. 2009; Dunn et al. 2013; Kocot et al. 2013; Yang and

Smith 2014; Ballesteros and Hormiga 2016). UPhO (Ballesteros and Hormiga 2016) is a modular

system of tree-based orthology assessment which is based only on the data input for the analysis

instead of a database. Homologs are clustered from input assemblies via MCL (van Dongen

2000), which are then subjected to a phylogenetic pipeline similar to target gene analysis. UPhO

then uses an unrooted method to parse orthologs from paralogs; the orthologs can subsequently be

evaluated phylogenetically using coalescent or concatenation based methods. Given assumptions

of orthology are fundamental to any phylogenetic study, this is a crucial step to examine.

Gene occupancy and missing data is another potentially problematic aspect of

phylogenomic analyses (Maddison et al. 1993; Wiens 2003; Lemmon et al. 2009; Simmons

2012). Including missing data, whether gaps in alignments or entirely absent genes, obviously

disallow comparison from present data but its exclusion can also be detrimental (Wiens and

Morrill 2011). Wiens and Morrill (2011) posit it is not missing data itself that is necessarily

intrinsically problematic (as stated by Lemmon et al. 2009), but instead its distribution with respect to informative data. Missing data has been explored on the basis of taxon presence, gene presence, and tree inference method (Rubin et al. 2012; Streicher et al. 2014; Hosner et al. 2015;

Huang and Knowles 2016; Streicher et al. 2016). This can be an especially important topic for transcriptome-based studies; only genes that are expressed at a given time can be examined. Gene occupancy is defined here as a measure of whether a gene can be found in a ratio of the terminals.

A matrix with a gene occupancy of 50% is characterized by the genes included being present in at least 50% of the taxa. Genes with 50% of taxa could result in comparison of taxa without overlap in a given gene, in turn making a correlation with missing data likely. By the same token,

a higher gene occupancy, for example 90%, would result in a much smaller pool of genes for comparison compared to the 50% gene occupancy matrix, which implies less missing data and potentially lesser computational burden. While a more complete matrix with higher occupancy and less missing data might seem like a preferable situation, Fernández et al. (2016) demonstrate

228

this can lead to biases that conflict with both other analyses of the dataset and previous analysis

based on target loci, morphological, behavior, and total evidence analyses.

We present the first family-level transcriptomics-based study of an orb-weaving spider

family in an attempt to bring the study of araneid phylogeny into the genomic era. Based on

specimens collected from a number of additional araneids, we seek to resolve backbone

relationships (e.g., the placement of Mangora and Nephilinae) as well as shallower, genus-level

relationships where possible. This will be conducted by tree inference method using

concatenation and coalescent methods to test for incongruences that could be attributable to

incomplete lineage sorting, two orthology assessment methods to see if orthologs selected have

any effect on the resulting topologies, and three gene occupancy thresholds to see the effect of

missing data and number of genes. Finally, we will examine some previous character

reconstructions in light of new topologies and how to proceed in understanding the phylogeny of

Araneidae.

Methods and Materials

Taxon sampling

New transcriptomic data was generated for 12 specimens not present in previous

transcriptomic studies, for a total of 33 terminals (Fig. 57; Table 8). Fourteen outgroup taxa were selected with at least one representative of major related families. Within Araneidae, we selected

19 taxa, aiming to maximize coverage of many of the ‘core’ subfamily lineages from Scharff and

Coddington (1997) – including ‘Araneinae,’ Cyrtophorinae, Argiopinae, Gasteracanthinae,

Micratheninae –as well as other taxa from both new and problematic lineages. Other sequences were culled from the NCBI SRA (Sharma et al. 2014; Zhao et al. 2014; Bond et al. 2014).

229

Extraction, library construction, and sequencing

The extraction protocol largely follows Fernández et al. (2014b). Samples were sacrificed

and subsequently fixed in RNAlater (Life Technologies). mRNA was extracted using TRIzol

(Life Technologies), and purified, intact mRNA was isolated using Dynabeads mRNA

Purification Kit (Invitrogen). cDNA libraries were generated using the Apollo 324 system and

PrepX mRNA kit (Wafergen). An Agilent 2100 Bioanalyzer (Agilent Technologies) was used to

check quality and size of mRNA and DNA before and after library construction. Diluted, pooled

samples were run using the Illumina HiSeq 2500 platform (paired end, 150 bp) at the FAS Center

for Systems Biology at Harvard University.

Sanitation, assembly, and identification of coding regions

Low quality read and adapter trimming were conducted with Trim Galore! 0.2.6 (Wu et

al. 2011) with the quality parameter set to 30 and phred cut-off set to 33; reads shorter than 25 bp were discarded. Ribosomal rRNA filtering was conducted using the default settings in Bowtie

2.9.9 (Langmead and Salzberg 2012). De novo assemblies were generated using Trinity 2.0.6

(Grabherr et al. 2011; Haas et al. 2013) with path reinforcement set to 75. Redundancy reduction was done using CD-HIT-EST (Fu et al. 2012) with 95% global similarity. Open reading frames

(ORFs) were identified using TransDecoder 3.0.0 (Haas et al. 2013). Resulting ORFs were then considered prepared for orthology assessment.

230

Figure 57. Araneidae. Spiders imaged here represent the taxa sampled unless otherwise noted with asterisks. A, Phonognatha graeffei, Yuraygir National Park, New South Wales, Australia (RJK); B, Nephila clavipes, Big Shoals State Park, Florida, USA (Jesus Ballesteros); C, Micrathena gracilis, Theodore Roosevelt Island, DC, USA (RJK); D, Argiope aurantia, Archbold Biological Station, Florida, USA (RJK)*; E, Eriophora transmarina, Yuraygir National Park, New South Wales, Australia (RJK); F, Metepeira

231 labyrinthea, Chippokes Plantation State Park, Virginia, USA (RJK); G, Poltys sp., Chichester State Forest, New South Wales, Australia (RJK); H, Mangora maculata, Great Falls Park, Virginia, USA (RJK)*; I, Araneus dimidiatus, Yuraygir State Park, New South Wales, Australia (RJK); J, Macracantha arcuata, GH031014_R09_11_THA (GH); K, Dolophones sp., Chichester State Forest, New South Wales, Australia (RJK).

Table 8. Newly sequenced material for this study.

Species Locality Voucher code(s) Araneus dimidiatus Australia: New South Wales, Budderoo National Park, Minnamurra IZ-141269, GH2174 rainforest, -34.6339, 150.7244, elev. 196 m, 25-26.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-01) Araneus marmoreus USA: Virginia, Jefferson National Forest, Rt. 613, elev. 1140 m, IZ-71263 23.ix.2015, 37.41326, G. Hormiga, M.A. Arnedo, R.J. Kallal, G. Giribet (GG 1163) Argiope sp. Australia: New South Wales, Yuraygir National Park, Wilsons IZ-141205, GH2226 Headland, -29.8299, 153.2868, elev. 15 m, 3.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-12) Cyclosa sp. Australia: New South Wales, Budderoo National Park, Minnamurra IZ-1412016, GH2157 rainforest, -34.6339, 150.7244, elev. 196 m, 25-26.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-01) Deliochus humilis Australia: New South Wales, Barrington Tops National Park, nr. IZ-141208, GH2165 Sharpes Creek Track, -32.0607, 151.6726, elev. 560 m, 28.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-05) Dolophones sp. Australia: New South Wales, Budderoo National Park, Minnamurra IZ-141209, GH2181 rainforest, -34.6339, 150.7244, elev. 196 m, 25-26.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-01) Eriophora transmarina Australia: New South Wales, Budderoo National Park, Minnamurra IZ-141270, GH2166 rainforest, -34.6339, 150.7244, elev. 196 m, 25-26.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-01) Mangora sp. Costa Rica: Heredia Prov., Estación Biológica La Selva, nr. Puerto IZ-141271. GH2388 Viejo de Sarapiquí, 10.43453302, -84.00825603, elev. 34 m, Sendero Tres Rios (STR) 23.v.2016, G. Hormiga, G. Giribet, C. Víquez (CR03) Metepeira labyrinthea USA: Virginia, Bluemont Park, 38.868, -77.130, 23.vii.2016, R.J. & GH2413 L.M. Kallal Phonognatha graeffei Australia: New South Wales, The Barringtons Country Retreat, - IZ-141210, GH2199 32.2466, 151.6890, elev. 185 m, G. Hormiga, R.J. Kallal, F. Álvarez- Padilla (AUS2016-GW-03) Plebs eburnus Australia: New South Wales, Budderoo National Park, Minnamurra IZ-141211, GH2171 rainforest, -34.6339, 150.7244, elev. 196 m, 25-26.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-01) Poltys sp. Australia: Chichester State Forest, nr. Logging Museum, -32.2349, IZ-141212, GH2184 151.7296, elev. 501 m, 27.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez- Padilla (AUS2016-GW-02)

232

Orthology assessment and gene occupancy

Orthology was assessed using BUSCO 1.1b1 (Simão et al. 2015) and UPhO (Ballesteros

and Hormiga 2016). BUSCO-based orthology assessment was based on complete single-copy and fragmented BUSCOs determined using default settings for gene set assessment benchmarking (-

OGS). The resulting orthologs from BUSCO were refined for gene occupancy trials with 15, 22, and 28 of the 33 taxa to construct occupancy-based treatments (e.g., an ortholog must be present in 15 of 33 taxa). In the UPhO pipeline, proteins were clustered using all-versus-all BLAST

searches with an expectation value of 1x1010 followed by MCL (van Dongen 2000) with an

inflation value of 2 and set to include all taxa. Homologous clusters were then subjected to

MAFFT v7.017 (Katoh and Standley 2013), trimAl v1.2 (Capella-Gutierrez et al. 2009) and

FastTree (Price et al. 2010) as well as Al2Phylo as part of the paMATRAX+ module of UPhO.

Orthology assessment was conducted on resulting gene family trees with a minimum taxa threshold of 15, 22, and 28 (as gene occupancy thresholds for BUSCO) for nodes with 75% bootstrap support or higher, and including in-paralogs. Duplicates were removed using distOrth.

Resulting orthologs for both orthology assessment methods were processed using MAFFT, trimAl and FastTree, then concatenated using geneStitcher following Ballesteros and Hormiga

(2016). Overlap between genes was examined using Venny (Oliveros 2015).

Tree inference

Each of these orthology assessment and gene occupancy treatments resulted in six matrices for tree inference on which three tree inference methods are conducted: using ASTRAL-II 4.10.12

(Mirarab et al. 2014), ExaML 3.0 (Aberer and Stamatakis 2013), and ExaBayes 1.4.1 (Aberer et al. 2014). ASTRAL was run with input trees from FastTree, with the UPhO trees generated as part of the UPhO pipeline, on default settings. ASTRAL tree supports are local posterior

233 probabilities, with node support of 95 or higher considered strong (Sayyari and Mirarab, 2016), and overall support evaluated using normalized quartet score. ExaML was partitioned by gene and run on the CAT model (Roure et al. 2012). Bootstrap support for ExaML was conducted using RAxML 8.2.9 (Stamatakis 2014); nodes are considered well-supported if equal to at least

90 (e.g., Philippe et al. 2003; Fernández and Giribet 2015; Streicher et al. 2016). ExaBayes analyses was conducted using the JTT model, with two runs of two chains, checkpoint intervals of 1,000 generations, for default convergence settings (≤ 1% average standard deviation of split frequencies and at least 1,000,000 generations). High support is considered at bootstrap ≥ 95. All topologies are rooted with the deinopid Menneus. All analyses were conducted using the Colonial

One High Performance Computing Cluster at the George Washington University.

Results

Matrix composition

The six matrices, composed based on orthology method (BUSCO or UPhO) and occupancy threshold (45%, 65%, 85%) are presented in Table 9. Specifically, these are matrix I

(BUSCO low occupancy [15/33 taxa], 1,404 genes, 591,554 amino acids), matrix II (BUSCO moderate occupancy [22/33 taxa], 548 genes, 222,340 amino acids, matrix III (BUSCO high occupancy [28/33 taxa], 64 genes, 25,308 taxa), matrix IV (UPhO low occupancy matrix [15/33 taxa], 1,780 genes, 457,080 amino acids), matrix V (UPhO moderate occupancy [22/33 taxa], 641 genes, 130,520 amino acids), and matrix VI (UPhO high occupancy matrix [28/33 taxa], 299 genes, 55,780 amino acids). The number of genes per matrix ranged from 64 (matrix III) to 1,780

(matrix IV), and number of amino acids per matrix ranged from 25,035 (matrix III) to 591,554

(matrix IV). Missing data ranged from 18.58% (matrix VI) to 53.74% (matrix IV), calculated as gaps in the concatenated alignment.

234

Table 9. Matrices analyzed in this study.

Matrix Occupancy Genes Amino Missing Average Median Nodes Nodes Nodes Normalized Acids Data gene gene with ≥ 95 with ≥ with quartet (%) length length local 90 ≥ 95 score posterior bootstrap posterior probability support probability I 45% 1404 591,554 50.43 421 358 26 23 27 0.718 15 taxa II 65% 548 222,340 41.45 406 356 26 25 28 0.715 22 taxa III 85% 64 25,035 30.67 391 327 18 16 - 0.685 28 taxa IV 45% 1780 457,080 53.74 257 187 27 26 28 0.781 15 taxa V 65% 641 130,520 31.69 204 166 26 24 28 0.790 22 taxa VI 85% 299 55,780 18.58 187 165 26 24 28 0.793 28 taxa

Phylogenetics

The results of the various analyses are presented in Figure 58. The two topologies shown are the topologies with the most highly supported nodes based on tree inference method and gene occupancy for BUSCO (Fig. 58A) and UPhO (Fig. 58B). This convention follows Streicher et al.

(2016), which is suggested for empirical datasets. The UPhO topology shown (Fig. 58B) is treated as the preferred topology for this reason. The topology was largely consistent across 16 treatments; one failed to converge after 13 million generations, and another was anomalous (see

Discussion). Nicodamoidea (Nicodamidae plus Megadictynidae) is sister to the Araneoidea clade.

The relatively new family Arkyidae is sister to Tetragnathidae, which are in turn sister to

Mimetidae (henceforth referred to as ‘tetragnathoids,’ following Hormiga, submitted.).

Malkaridae is sister to the tetragnathoids. The only repeated conflict in outgroup topology involved the placement of Runga (Physoglenidae), with most placing it sister to Theridiosoma

(Theridiosomatidae) + Araneidae, and a minority of analyses placing it sister to Tekelloides

(Cyatholipidae) + Frontinella (Linyphiidae).

All 17 completed analyses recovered Araneidae as monophyletic. Most place Zygiellinae

235

Figure 58. The phylogenetic trees with highest support for BUSCO and UPhO analyses. Boxes at nodes signify results from analyses conducted with that orthology method. Green: ≥ 95 local posterior probability or posterior probability, ≥ 90 bootstrap support; yellow: ≥ 70 of all support types; red: <70 of all support types; white: clade not present in analysis. Subfamilies are noted in shaded boxes.

236

(Phonognatha + Deliochus) as sister to all remaining araneids, followed by Nephila and

Micrathena + Verrucosa. Most analyses place Mangora as the sister to the rest of the araneids, which fall into two main clades. The first of these includes Argiope + Cyrtophora sister to a clade including Poltys, Metepeira, Neoscona, and Araneus marmoreus. The second clade includes

Gasteracanthinae (Gasteracantha + Macracantha) and Cylcosa, Dolophones, Plebs, Eriophora, and Araneus dimidiatus.

Discussion

Systematics of Araneidae and close relatives

The topologies of the various phylogenomic datasets are largely congruent with each other (Fig. 59). Outside Araneidae, only very minor differences disrupt the nearly identical topology regardless of orthology method or missing data and occupancy. Theridiidae is the earliest diverging araneoid clade, a result supported by both phylogenomic and target locus studies (Dimitrov et al. 2016; Wheeler et al. 2016). Linyphiidae and Cyatholipidae are always sister families with high support, sometimes with the addition of Physoglenidae. It should be noted that the latter three families have species that build sheet webs (e.g., Dimitrov et al. 2016).

Theridiosomatidae is consistently supported as sister to Araneidae. The main difference between the topology of outgroup taxa lies in the placement of Runga sp. (Physoglenidae), with low occupancy concatenation analyses and high occupancy BUSCO analyses placing it sister to

Linyphiidae + Cyatholipidae rather than Theridiosomatidae + Araneidae. The latter is consistent with analyses with some but not all larger taxon sampling of target gene analyses; Dimitrov et al.

(2016) find Theridiosomatidae sister to Araneidae, whereas Wheeler et al. (2016) find a clade including tetragnathoids and linyphioids (Linyphiidae, Pimoidae, and Cyatholipidae) (Figs. 56C,

D).

237

Figure 59. Distribution of topologies with incongruences. Each pair of rows represents the two main topologies for a given clade. Each column represents a treatment (combination of orthology method, occupancy threshold, and tree inference method). A: ASTRAL; EM: ExaML; EB: ExaBayes. Green: ≥ 95 local posterior probability or posterior probability, ≥ 90 bootstrap support; yellow: ≥ 70 of all support types; red: <70 of all support types; black: other topology; white: other relationship in the given pair.

Considering the backbone of araneid relationships, or major early splits in the tree, we

find high support, especially in the UPhO based analyses. The majority found Zygiellinae

(Phonognatha + Deliochus) as sister to all other araneids; BUSCO-based analysis of matrix III placed Nephila as sister to all other araneids. This is consistent with some (Fig. 56D, F) but not all (Fig. 56B, C) previous studies. The monophyly of Araneidae is undisputed from the results following the taxonomic actions of Dimitrov et al. (2016). Micrathena + Verrucosa branches next from the araneid backbone, which was also supported in nearly all analyses. This is consistent with previous transcriptomic work (Garrison et al. 2016) and most previous generation studies for

Micrathena only (Fig. 56B-D), except for Kallal and Hormiga (in prep.), who also find a strong sister relationship between Micrathena and Verrucosa. In contrast, Scharff and Coddington

(1997) found Micrathena nested within Araneidae sister to the non-araneid Arkys.

238

Mangora emerges from the araneid backbone next. The placement of Mangora is inconsistent;

most analyses find it as sister to all araneids not previously mentioned (14/17 analyses), but some

analyses (namely BUSCO-based coalescent analyses and ExaML analysis of matrix III) place it

otherwise. This is largely consistent with previous analyses except for Kallal and Hormiga, who

find it sister to Poltys. Target gene analyses have historically included only a single Mangora species, and additional, species-level phylogenetic work on this genus may corroborate this placement recovered by transcriptomic work with increased taxon sampling.

The remaining araneid taxa are split into two clades. The first invariably includes

Cyrtophora + Argiope, which are in turn sister to a clade including Poltys, Metepeira, Araneus, and Neoscona. The second includes Gasteracanthinae and the Cyclosa clade. A close relationship between cyrtophorines and argiopines is put forth by virtually all molecular and morphological data, with Scharff and Coddington (1997) finding the hirsute carapace of these subfamilies to be a synapomorphy. Molecular sequence data for Poltys has been included in two analyses, which are broadly congruent with each other than this analysis. The analyses of Agnarsson and Blackledge

(2009), Gregorič et al. (2015), Dimitrov et al. (2016), Wheeler et al. (2016), and Kallal and

Hormiga (in prep.) all include Metepeira, Neoscona, and Araneus and group them together (Fig.

56B-D, F), as in this analysis. Scharff and Coddington (1997) place Metepeira in a more basally diverging position, but Araneus and Neoscona are sisters. In BUSCO-based analyses, the topology of Metepeira, Poltys, Neoscona, and Araneus is unstable. In ExaML analyses,

Metepeira is sister to the other three rather than Poltys; in ExaBayes analyses, Metepeira is sister to Araneus, which is in turn sister to Neoscona and Poltys; finally, in coalescent methods, the high occupancy matrix found Metepeira sister to Neoscona. The UPhO analyses were consistent in their placement of the four taxa. As with Mangora, only a single Metepeira is included in target gene analyses (typically the taxon included here, M. labyrinthea), and more expansive taxon sampling using target gene or transcriptome levels could be useful.

239

The relationships among the remaining taxa are not consistent except for

Gasteracanthinae (Gasteracantha + Macracantha). In some analysis, Dolophones, which has not

been analyzed with molecular sequence data except by Kallal and Hormiga (in prep), is sister to

Gasteracanthinae, while in other analyses it is more closely related to Plebs, Araneus dimidiatus,

and Eriophora transmarina. The former topology is congruent with the total evidence analysis of

Kallal and Hormiga (in prep), but it is weakly supported therein. Further collection of

Dolophones could be invaluable in placement of this taxon. Comment on the remaining species –

Plebs, Cyclosa, Araneus dimidiatus, and Eriophora transmarina – must be somewhat superficial

as the relationships shift in nearly every analysis. Nonetheless, phylogenomic analyses support

prior studies’ conclusion that Araneus is not monophyletic (Kallal and Hormiga, in prep.), and,

interestingly, of these taxa only Cyclosa is known outside Asia, Australia, and Oceania. Given

taxonomic issues with Eriophora transmarina and Araneus dimidiatus, which group nearby,

special attention to the cosmopolitan Cyclosa could be enlightening.

Implications on comparative biology

This new transcriptome-based framework, preliminary as it may be, allows

reinterpretation of comparative biology and character reconstructions from previous works. For

instance, Scharff and Coddington (1997) included several notable character reconstructions in

their work. Naturally, the mapping of characters is predicated on completeness of taxon sampling,

and while the sampling presented here is admittedly fewer than the over 3,100 described araneid

species, this new topology allows us to examine certain characters in a new light. Evolution of

elements of the male pedipalp (a leg co-opted into a complex intromittent secondary sexual organ), would require reevaluation. For instance, the radix, or enlarged base of the sperm- delivering embolus in the male pedipalp, was gained early in the evolution in araneids but

240 subsequently lost in Arkys, Archemorus, Aspidolasius, and Caerostris. Based on subsequent analysis including this one, we know the basally emerging lineages from the araneid backbone are Nephila, Phonognatha, and Caerostris, and that Arkys is not an araneid. This suggests the evolution of the radix, rather than being lost a number of subsequent times within Araneidae, was lost perhaps once in Aspidolasius, which has not been reassessed beyond the analysis of Scharff and Coddington (1997).

Evolution of extreme sexual size dimorphism in orb-weavers has been studied for years

(e.g., Hormiga et al. 2000; Kuntner and Coddington 2009) and especially Araneidae since

Nephila and close relatives are now included. The phylogenetic reconstruction of orb-weaver dimorphism in Hormiga et al. (2000) found several origins of dimorphism by several means (e.g., gigantism or dwarfism of the sexes separated or in concert). Dimorphism associated with female gigantism in their ‘argiopoid clade’ is lost in Arkys and close relatives (no longer araneids) and

Micrathena, which is situated as more basally diverging than the clade including Argiope here.

However, the dimorphism associated with Gasteracanthinae would now be sister to non- dimorphic taxa in the Cyclosa clade rather than in the argiopoids. Dimorphism in the early diverging araneids, namely Nephilinae, Zygiellinae, and Caerostris, will require more in-depth study to parse given genus-by-genus variations. Only some of them are sexually size dimorphic

(e.g., Nephila, Herennia, Nephilengys, Nephilingis in Nephilinae; Deliochus and Artifex in

Zygiellinae), making taxon sampling a key component for their study which is beyond the scope of this study.

Web architectures are largely conserved among the taxa sampled here; ideally cyrtarachnines and mastophorines should be included in future works. Following Scharff and

Coddington (1997), eight araneid taxa sampled build stabilimenta in their orb-webs: Argiope,

Cyclosa, Cyrtophora, Gasteracantha, Micrathena, Neoscona, Nephila, and Plebs. The close association between Cyclosa, Plebs, and Gasteracantha as well as the well supported Cyrtophora

+ Argiope clade may minimize the number of gains of this trait, but the relatively independent

241 appearance of stabilimenta in Nephila, Neoscona, and Micrathena remain outliers that speak to convergence of useful web character, though studies disagree on what they use might be.

Coalescent, species tree methods are thought to alleviate incomplete lineage sorting associated with concatenation (e.g., Degnan and Rosenberg 2009; Liu et al. 2015). That is, the signal of incomplete lineage sorting involves weakly support or atypical topologies with concatenation that do not appear when using coalescent methods (Edwards 2016). We observed congruent topologies in both coalescent and concatenation methods along the backbone, and when limited to a single orthology assessment method, inconsistencies were limited mostly to shallow relationships (e.g., the Cyclosa clade). This suggests this araneid dataset does not contain the signature of incomplete lineage sorting. Furthermore, in the case of coalescent UPhO analyses, normalized quartet score from the ASTRAL analysis increases with gene occupancy and fewer genes whereas it decreased in BUSCO analyses (though the range never exceeded 0.1).

Orthology

The two methods of orthology assessment, BUSCO and UPhO, resulted in largely congruent topologies. When comparing across the same degree of occupancy (matrix I vs. IV, II vs. V, and III vs. VI), UPhO typically recovered more orthologs, more amino acids, and less missing data; the exception is matrix I with approximately 4% less missing data than matrix IV

(Table 9). The average and median gene lengths were longer with BUSCO than UPhO. Using well-supported nodes as a measure of support for a dataset, in all but one case, UPhO had more highly supported nodes. Specifically in the case of ASTRAL, for instance, the normalized quartet scores at their lowest with UPhO (0.781 in matrix IV) were greater than that achieved with the highest with BUSCO (0.718 with matrix I). Furthermore, the only analysis that was very different from the rest, to the degree of a non-monophyletic Theridiidae and breaking the tetragnathoid clade from Malkaridae occurred in the high occupancy BUSCO analysis (matrix III), though this

242 is likely more of an effect of occupancy than the matrix as the occupancy at 85% (28 taxa of 33) resulted in 64 genes – relatively low by phylogenomic standards.

The degree of overlap between the transcripts used by the UPhO and BUSCO-based analyses was very limited (Fig. 60). Only 4.3% of transcripts were shared between the two orthology methods. In other words, despite the same transcriptomes from which the orthologs are culled, the orthologs themselves are very different. Given BUSCO is based on comparison to a collection of reference orthologs and UPhO orthologs are based entirely on shared sequences between members of sampled taxa, it is not altogether unsurprising that UPhO would generate more orthologs. The genes are longer in BUSCO analyses but more numerous in UPhO (Table 9).

Given the congruence between the two trees despite differences in orthologous transcripts, this suggests strong signal in the data that is robust to differences in tree inference methods and orthology assessment.

Figure 60. Comparison of transcripts used for UPhO and BUSCO orthology methods. UPhO analyses used approximately 10,000 more transcripts. Less than 5% transcripts were shared between the orthologs of two methods.

243

Occupancy, missing data, and number of genes

Three occupancy thresholds based on number of taxa present for a specific gene, were

tested in this analysis: low (45%, 15 of 33 taxa), moderate (65%, 22 of 33 taxa), and high (85%,

28 of 33 taxa). As occupancy increases, missing data decreases. As occupancy increases and

missing data decreases, gene length and number of highly supported nodes also decrease except

in the case of concatenation analyses with BUSCO, where moderate occupancy was best

supported. Despite the cosmetic appeal of low degrees of missing data, our results are consistent

with those of Fernández et al. (2016) and Streicher et al. (2016), wherein matrices with more

missing data were resolved with better supported nodes. The only markedly poor topology

resulted from the BUSCO analysis with high occupancy (III), though this is likely an incidental

effect from the fewer number of genes associated with that level of occupancy (Table 9).

Analyses on matrix VI with the same level of occupancy had almost 5 times as many genes and

twice the amino acids.

While high supports are not necessarily indicative of a ‘true’ tree given topological

conflicts with absolute node supports in genomic-scale analyses (e.g., Philippe et al. 2011;

Salichos and Rokas 2013; Arcila et al. 2017; Shen et al. 2017), the consistently higher supports at certain nodes and their congruence with target gene analyses allow a degree of confidence in their findings. The increase in missing data as occupancy drops and their association with highly supported nodes could be a result of genes found in fewer taxa that are useful for resolving certain clades but are missing or otherwise removed in matrices with less missing data. It is unclear what the inflection point of missing data versus node support is with this dataset based on these analyses, though it does appear to be between 64 and 299 genes (~25-50,000 amino acids).

This is broadly consistent with analysis on mammals (Song et al. 2012; Springer and Gatesy

2016; Edwards 2016), which show high, consistent support from 100-150 genes for concatenation

244

and coalescent methods but 300-400 genes is better. However, larger matrices with more missing

data are more computationally intensive; matrices with 65% versus 45% took 2–3 times the CPU

hours for concatenation-based methods.

Conclusion

Though the importance of data exploration of phylogenomic dataset cannot be

understated, this study suggests both orthology assessment and missing data - and, by extension,

number of genes compared – can have a marked effect on the resulting topologies. UPhO based assessments generally produce more genes and less missing data than BUSCO analyses of the same occupancy level. Including too few genes (and typically less missing data) produces atypical topologies, resulting in non-monophyly of groups undisputed by other data sources. A maximum number of genes is limited by computing resources but more than 100-500 genes

(Edwards 2016) and/or occupancy values of 50% (Fernández et al., 2016; Streicher et al., 2016) seem to produce well-supported phylogenies here as in other studies. The majority of analyses presented here support a monophyletic Araneidae with good support for some of its lineages, given the caveats of limited taxon sampling. This work highlights room for additional work on the clade using next generation or target gene approaches on the Cyclosa clade in particular.

Furthermore, contentious relationships and notable missing lineages from non-phylogenomic analyses remain and would benefit from more complete taxon sampling, a perennial issue in phylogenetics, and one that is ever decreasing as phylogenomic resources grow.

245

References

Aberer, A.J., Kobert, K., and Stamatakis, A. (2014). ExaBayes: massively parallel Bayesian tree inference for whole-genome era. Molecular Biology and Evolution, 31 2553–2556. DOI: https://doi.org/10.1093/molbev/msu236

Aberer A.J., and Stamatakis A. (2013). ExaML: Exascale Maximum Likelihood. Program and documentation available from: http://sco.h- its.org/exelixis/web/software/examl/index.html.

Agnarsson, I., and Blackledge, T.A. (2009). Can a spider web be too sticky? Tensile mechanics constrains the evolution of capture spiral stickiness in orb-weaving spiders. Journal of Zoology 279, 134–140.

Álvarez-Padilla, F. (2007). Systematics of the spider genus Metabus O. P.-Cambridge, 1899 (Araneoidea: Tetragnathidae) with additions to the tetragnathid fauna of Chile and comments on the phylogeny of Tetragnathidae. Zoological Journal of the Linnean Society 151, 285–335. doi:10.1111/j.1096-3642.2007.00304.x

Álvarez-Padilla, F., Dimitrov, D., Giribet, G., and Hormiga, G. (2009). Phylogenetic relationships of the spider family Tetragnathidae (Araneae, Araneoidea) based on morphological and DNA sequence data. Cladistics 25, 109–146. doi:10.1111/j.1096- 0031.2008.00242.x

Álvarez-Padilla, F., and Hormiga, G. (2008). A protocol for digesting internal soft tissues and mounting spiders for scanning electron microscopy. Journal of Arachnology 35, 538– 542.

Álvarez-Padilla, F., and Hormiga, G. (2011). Case 3541- Metinae Simon, 1894 (Arachnida, Araneae, Tetragnathidae): proposed emendation of the current spelling to Metainae to remove homonymy with Metidae Boeck, 1872 (Crustacea, Copepoda). Bulletin of Zoological Nomenclature 68, 262–266.

Álvarez-Padilla, F., and Hormiga, G. (2011). Morphological and phylogenetic atlas of the orb-weaving spider family Tetragnathidae (Araneae: Araneoidea). Zoological Journal of the Linnean Society 162, 713–879. doi:10.1111/j.1096-3642.2011.00692.x

ARBS (Australian Biological Resources Study). (2014). Australian faunal directory, available at https://biodiversity.org.au/afd/taxa/ARANEAE. Accessed 9 May 2017.

Arcila, D., Ortí, G., Vari, R., Armbruster, J.W., Stiassny, M.L.J., Ko, K.D., Sabaj, M.H., Lundberg, J., Revell, L.J., and Betancur-R., R. (2017). Genome-wide interrogation advances resolution of recalcitrant groups in the tree of life. Nature Ecology and Evolution. DOI: 10.1038/s41559-016-0020.

246

Arnedo, M.A., Coddington, J.A., Agnarsson, I., and Gillespie, R.G. (2004). From a comb to a tree: phylogenetic relationships of the comb-footed spiders (Araneae, Theridiidae) inferred from nuclear and mitochondrial genes. Molecular Phylogenetics and Evolution 31, 225–245.

Baker, C.H., Graham, G.C., Scott, K.D., Cameron, S.L., Yeates, D.K., and Merritt, D.J. (2008). Distribution and phylogenetic relationships of Australian glow-worms Arachnocampa (Diptera, Keroplatidae). Molecular Phylogenetics and Evolution 48, 506– 514.

Ballesteros, J.A., and Hormiga, G. (2016). A new orthology assessment method for phylogenomic data: unrooted phylogenetic orthology. Molecular Biology and Evolution, 33, 2117–2134. DOI:10.1093/molbev/msw069.

Barendse, W. (1984). Speciation in the Genus Crinia (Anura: Myobatrachidae) in Southern Australia: A Phylogenetic Analysis of Allozyme Data Supporting Endemic Speciation in Southwestern Australia. Evolution 38, 1238–1250.

Barrion, A.T., and Litsinger, J.A. 1981. Riceland Spiders of the South and Southeast Asia. Wallingford UK , CAB International.

Benoit, P.G. 1962. Les Araneidae-Nephilinae africains. Revue de Zoologie et de Botanique Africaines 65, 217–231.

Berland, L. 1924. Araignées de la Nouvelle Calédonie et des iles Loyalty. In: Sarasin F., In: Roux J, eds. Nova Caledonia.159–255.

Bidegaray-Batista, L., and Arnedo, M.A. (2011). Gone with the plate: the opening of the Western Mediterranean basin drove the diversification of ground-dweller spiders. BMC Evolutionary Biology 11, 317.

Blackledge, T.A., Scharff, N., Coddington, J.A., Szüts, T., Wenzeld, J.W., Hayashi, C.Y., and Agnarssona I. (2009). Reconstructing web evolution and spider diversification in the molecular era. Proceedings of the National Academy of Sciences USA 106, 5229–5234.

Blackledge, T.A., and Wenzel, J.W. (1999). Do stabilimenta in orb webs attract prey or defend spiders? Behavioral Ecology 10, 372–376.

Blackwall, J. (1869). Description of a new species of Epeira. Annals and Magazine of Natural History 4, 398–400.

Bond, J.E., Garrison, N.L., Hamilton, C.A., Godwin, R.L., Hedin, M., and Agnarsson, I. (2014). Phylogenomics resolves a spider backbone phylogeny and rejects a prevailing paradigm for orb web evolution. Current Biology 24, 1765–1771. DOI:10.1016/j.cub.2014.06.034.

247

Bradley, H.B. (1876). The araneids of the Chevert Expedition. Part I. Proceedings of the Linnean Society of New South Wales 1, 137–150. Brignoli, P.M. (1983). A catalogue of the Araneae described between 1940 and 1981. Manchester University Press.

Cabra-García, J. J., and Brescovit, A. D. (2016). Revision and phylogenetic analysis of the orb-weaving spider genus Glenognatha Simon, 1887 (Araneae, Tetragnathidae). Zootaxa 4069, 1–183. doi:10.11646/zootaxa.4069.1.1

Capella-Gutierrez, S., Silla-Martinez, J.M., and Gabaldon, T. (2009). trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25, 1972–1973.

Carpenter, J.M, and Wheeler, W.C. (1999). Towards simultaneous analysis of morphological and molecular data in Hymenoptera. Zoologica Scripta 28: 251–260.

Chamberlin, R. V, and Ivie, W. (1941). Spiders collected by L. M. Saylor and others mostly in California. Bulletin of the University of Utah 31, 3–49.

Cheng, R.C., and Kuntner, M. (2014). Phylogeny suggests nondirectional and isometric evolution of sexual size dimorphism in argiopine spiders. Evolution 68, 2861–2872.

Cheng, R.-C., and Kuntner, M., (2015). Disentangling the size and shape components of sexual dimorphism. Evolutionary Biology 42, 223–234. DOI:10.1007/s11692-015-9313- z.

Chikuni, Y. (1955). Five interesting spiders from Japan highlands. Acta Arachnologica 14, 29–40.

Christenson, T.E., Brown, S.G., Wenzl, P.A., Hill, E.M., and Goist, K.C. (1985). Mating behavior of the golden-orb-weaving spider, Nephila clavipes: I. Female receptivity and male courtship. Journal of Comparative Psychology 99, 160–166.

Clerck, C. (1757). Svenska spindlar, uti sina hufvud-slågter indelte samt under några och sextio särskildte arter beskrefne och med illuminerade figurer uplyste. (Stockholm).

Coddington, J.A. 1986. The monophyletic origin of the orbweb. In: Spiders: Webs, Behavior, and Evolution. Stanford University Press, California.

Coddington, J.A. (1990). Ontogeny and homology in the male palpus of orb-weaving spiders and their relatives, with comments on phylogeny (Araneoclada: Araneoidea, Deinopoidea). Smithsonian Contributions to Zoology 496, 1–52.

Colgan, D.J., McLauchlan, A., Wilson, G.D.F., Livingston, S.P., Edgecombe, G.D., Macaranas, J., Cassis, G., and Gray, M.R. (1998). Histone H3 and U2 snRNA DNA

248

sequences and arthropod molecular evolution. Australian Journal of Zoology 46, 419– 437.

Cracraft, J. (2009). Origin and Evolution of Continental Biotas: Speciation and Historical Congruence within the Australian Avifauna. Evolution 40, 977–996.

Craig, C.L. (1987). The significance of spider size to the diversification of spider-web architectures and spider reproductive modes. American Naturalist 129, 47–68.

Crandall, K.A., Harris, D.J., and Fetzner Jr., J.W. (2000). The monophyletic origin of freshwater crayfish estimated from nuclear and mitochondrial DNA sequences. Proceedings of the Royal Society of London B 267, 1679–1686. Crisp, M., Cook, L., and Steane, D. (2004). Radiation of the Australian flora: what can comparisons of molecular phylogenies across multiple taxa tell us about the evolution of diversity in present-day communities? Philosophical Transactions of the Royal Society of B 359, 1551–11571.

Dahl, F. (1912). Seidenspinne und Spinneseide. Mitteilungen aus dem Zoologischen Museum in Berlin 6, 1–90.

Dalmas, R de. (1917). Trois araignees nouvelles de’australie. Annales de la Société Entomologique de France 86, 431–436.

Davies, V.T. (1988). An illustrated guide to the genera of orb-weaving spiders in Australia. Memoirs of the Queensland Museum 25, 273–332.

Degnan, J.H., and Rosenberg, N.A. (2009). Gene tree discordance, phylogenetic interference and the multispecies coalescent. Trends in Ecology and Evolution 24, 762– 768.

Delsuc, F., Brinkmann, H., and Philippe, H., 2005. Phylogenomics and the reconstruction of the tree of life. Nature Reviews Genetics 6, 361–375. DOI:10.1038/nrg1603

Dimitrov, D., Álvarez-Padilla, F., and Hormiga, G. (2010). On the Phylogenetic Placement of the Spider Genus Atimiosa Simon, 1895, and the Circumscription of Dolichognatha O.P.-Cambridge, 1869 (Tetragnathidae, Araneae). American Museum Novitates 3683, 1–19. doi:10.1206/669.1

Dimitrov, D., Benavides, L. R., Arnedo, M. A., Giribet, G., Griswold, C. E., Scharff, N., and Hormiga, G. (2016). Rounding up the usual suspects: a standard target-gene approach for resolving the interfamilial phylogenetic relationships of ecribellate orb-weaving spiders with a new family-rank classification (Araneae, Araneoidea). Cladistics, 1–30. doi:10.1111/cla.12165

Dimitrov, D., and Hormiga, G. (2009). Revision and Cladistic Analysis of the Orbweaving Spider Genus Cyrtognatha Keyserling, 1881 (Araneae, Tetragnathidae).

249

Bulletin of the American Museum of Natural History 317, 1–140. doi:10.1206/317.1

Dimitrov, D., and Hormiga, G. (2011). An extraordinary new genus of spiders from Western Australia with an expanded hypothesis on the phylogeny of Tetragnathidae (Araneae). Zoological Journal of the Linnean Society 161, 735–768. doi:10.1111/j.1096- 3642.2010.00662.x

Dondale, C. (1966). The spider fauna (Araneida) of deciduous orchards in the Australian Capital Territory. Australian Journal of Zoology 14, 1157.

Dondale, C.D., Redner, J.H., Paquin, P., and Levi, H.W. (2003). The insects and arachnids of Canada. Part 23. The orb-weaving spiders of Canada and Alaska (Araneae: Uloboridae, Tetragnathidae, Araneidae, Theridiosomatidae). Ottawa, NRC Research Press.

Downen, M.R. (2011). The taxonomy and taphonomy of the fossil spiders from the Crato Formation of Brazil. Master’s thesis, Kentucky Western University.

Dunn, C.W., Hejnol, A., Matus, D.Q., Pang, K., Browne, W.E., Smith, S.A., Seaver, E., Rouse, G.W., Obst, M., Edgecombe, G.D., Sorensen, M.V., Haddock, S.H.D., Schmidt- Rhaesa, A., Okusu, A., Kristensen, R.M., Wheeler, W.C., Martindale, M.Q., and Giribet, G. (2008). Broad phylogenomic sampling improves resolution of the animal tree of life. Nature 452, 745–749.

Eberhard, W.G., Agnarsson, I., and Levi, H.W. (2008). The Natural History Museum Web forms and the phylogeny of theridiid spiders (Araneae: Theridiidae): chaos from order. Systematics and Biodiversity 6, 1–61.

Edwards, S.V. 2016. Phylogenomic subsampling: a brief review. Zoologica Scripta 45, 63–74. DOI:10.1111/zsc.12210.

Fahey, B.F., and Elgar, M.A. (1997). Sexual cohabitation as mate-guarding in the leaf- curling spider Phonognatha graeffei Keyserling (Araneoidea, Araneae). Behavioral Ecology and Sociobiology 40: 127–133.

Fernández, R., Edgecombe, G.D., and Giribet, G. (2016). Exploring phylogenetic relationships within Myriapoda and the effects of matrix composition and occupancy on phylogenomic reconstruction. Systematic Biology 65, 871–889. DOI:10.1093/sysbio/syw041.

Fernández, R., Hormiga, G., and Giribet, G. (2014a). Phylogenomic analysis of spiders reveals nonmonophyly of orb weavers. Current Biology 24, 1772–1777. DOI:10.1016/j.cub.2014.06.035.

Fernández, R., Laumer, C.L., Vahtera, V., Libro, S., Kaluziak, S., Sharma, P.P., Pérez- Porro, A.R., Edgecombe, G.D., and Giribet, G. (2014b). Evaluating topological conflict

250

in centipede phylogeny using transcriptomic data sets. Molecular Biology and Evolution 31, 1500–1513. DOI:10.1093/molbev/msu108

Fitch, W.M. (1970). Distinguishing homologous from analogous proteins. Systematic Biology 19, 99–113. DOI: https://doi.org/10.2307/2412448.

Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3, 294–299.

Framenau, V.W., Baehr, B.C., and Zborowski, P. (2014). A guide to the spiders of Australia. Chatswood, Australia: New Holland Publishers.

Framenau, V.W., Dupérré, N., Blackledge, T.A., and Vink, C.J. (2010a). Systematics of the new Australasian orb-weaving spider genus Backobourkia (Araneae: Araneidae: Araneinae). Arthropod Systematics and Phylogeny 68, 79–111.

Framenau, V.W., Scharff, N., and Harvey, M.S. (2010b). Systematics of the Australian orb-weaving spider genus Demadiana with comments on the generic classification of the Arkyinae (Araneae: Araneidae). Invertebrate Systematics 24, 139–171.

Fu, L.M., Niu, B.F., Zhu, Z.W., Wu, S.T., and Li, W.Z. 2012. CD-HIT: accelerated for clustering the next-generation sequencing data. Bioinformatics 28, 3150–3152.

Garrison, N.L., Rodriguez, J., Agnarsson, I., Coddington, J.A., Griswold, C.E., Hamilton, C.A., Hedin, M., Kocot, K.M., Ledford, J.M., and Bond, J.E. (2016). Spider phylogenomics: untangling the spider tree of life. PeerJ 4, e1719. DOI:10.7717/peerj.1719.

Giribet, G., Boyer, S.L., Baker, C.M., Fernández, R., Sharma, P.P., de Bivort, B.L., Daniels, S.R., Harvey, M.S., and Griswold, C.E. (2016). A molecular phylogeny of the temperate Gondwanan family Pettalidae (Arachnida, Opiliones, Cyphophthalmi) and the limits of taxonomic sampling. Zoological Journal of the Linnean Society 178, 523–545.

Giribet, G., Carranza, S., Baguña, J., Riutort, J., and Ribera, C. (1996). First molecular evidence for the existence of a Tardigrada + Arthropoda clade. Molecular Biology and Evolution 13, 76–84.

Goloboff, P.A. (2004). TNT. Cladistics 20, 84.

Goloboff, P.A., Farris, J., and Nixon, K.C. (2008). TNT, a free program for phylogenetic analyses. Cladistics 24, 774–786.

Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q.D., et al. (2011). Full-length

251

transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29, 644–652.

Graham, S.W., Olmstead, R.G., and Barrett, S.C.H. (1998). Rooting phylogenetic trees with distant outgroups: a case study from the commelinoid monocots. Molecular Biology and Evolution 19, 1769–1781.

Grandcolas, P., Murienne, J., Robillard, T., Desutter-Grandcolas, L., Jourdan, H., Guilbert, E., and Deharveng, L. (2008). New Caledonia: a very old Darwinian island? Philosophical Transactions of the Royal Society B: Biological Sciences 363, 3309–3317.

Gregorič, M., Agnarsson, I., Blackledge, T.A., and Kuntner, M. (2015). Phylogenetic position and composition of Zygiellinae and Caerostris, with new insight into orb-web evolution and gigantism. Zoological Journal of the Linnean Society 175, 225–243.

Haas, B.J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P.D., Bowden, J., Couger, M.B., Eccles, D., Li, B., Lieber, M., et al. (2013). De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature Protocols 8, 1494–1512.

Hausdorf, B. (1999). Molecular phylogeny of araneomorph spiders. Journal of Evolutionary Biology 12, 980–985. DOI:10.1046/j.1420-9101.1999.00104.x.

Heads, M. (2013). Biogeography of Australasia: a molecular analysis. New York: Cambridge University Press.

Hejnol, A., Obst, M., Stamatakis, A., Ott, M., Rouse, G.W., Edgecombe, G.D., Martinez, P., Baguñà, J., Bailly, X., Jondelius, U., Wiens, M., Müller, W.E.G., Seaver, E., Wheeler, W.C., Martindale, M.Q., Giribet, G., and Dunn, C.W. (2009). Assessing the root of bilaterian animals with scalable phylogenomic methods. Proceedings of the Royal Society B 276, 4261–4270.

Hentz, N. M. (1850). Descriptions and figures of the araneides of the United States. Boston Journal of Natural History 6, 18–35, 271–295.

Hickman, V.V. (1967). Some common spiders of Tasmania. Tasmanian Museum and Art Gallery.

Holm, A. (1979). A taxonomic study of European and East African species of the genera Pelecopsis and Trichopterna (Araneae, Linyphiidae), with descriptions of a new genus and two new species of Pelecopsis from Kenya. Zoologica Scripta 8, 255–278.

Hopper, S.D., and Gioia, P. (2016). The Southwest Australian Floristic Region : Evolution and Conservation of a Global Hot Spot of Biodiversity. Annual Review of Ecology, Evolution, and Systematics 35, 623–650.

252

Hormiga, G., Eberhard, W.G., and Coddington, J.A. (1995). Web-Construction behavior in Australian Phonognatha and the phylogeny of nephiline and tetragnathid spiders (Araneae: Tetragnathidae). Australian Journal of Zoology 43, 313–364.

Hormiga, G., and Griswold, C.E. (2014). Systematics, Phylogeny, and Evolution of Orb- Weaving Spiders. Annual Review of Entomology 59, 487–512.

Hormiga, G., Scharff, N., and Coddington, J.A. (2000). The phylogenetic basis of sexual size dimorphism in orb-weaving spiders (Araneae, Orbiculariae). Systematic Biology 49, 435–462.

Hosner, P.A., Faircloth, B.C., Glenn, T.C., Braun, E.L., and Kimball, R.T. (2015). Avoiding missing data biases in phylogenomic inference: an empirical study in the landfowl (Aves: Galliformes). Molecular Biology and Evolution 33, 1110–1125. DOI: 10.1093/molbev/msv347.

Huang, H., and Knowles, L.L. (2016). Unforeseen consequences of excluding missing data from next-generation sequencing: simulation study of RAD sequences. Systematic Biology 65, 357–365. DOI:10.1093/sysbio/syu046

Jang, K.H., and Hwang, U.W. (2011). Molecular phylogeny and new classification system of spiders (Arachnida, Araneae). Unpublished work, Kyungpook National University, South Korea.

Joseph, M.M., and Framenau, V.W. (2012). Systematic review of a new orb-weaving spider genus (Araneae: Araneidae), with special reference to the Australasian-Pacific and South-East Asian fauna. Zoological Journal of the Linnean Society 166, 279–341.

Katoh, K., and Standley, D.M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30, 772–780.

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., and Drummond, A. (2012). Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647– 1649.

Keyserling, E. (1865). Beitrage zur Kenntniss der Orbitelae Latrl. Verhandlungen der Kaiserlich-Königlichen Zoologisch-Botanischen Gesellschaft in Wien 15, 799-856.

Keyserling, E. (1879). Neue Spinnen aus Amerika. Verhandlungen der Kaiserlich- Königlichen Zoologisch-Botanischen Gesellschaft in Wien 29, 293-349.

Kim, S. T., and Lee, S. Y. (2013). Arthropoda: Arachnida: Araneae: Mimetidae, Uloboridae, Theridiosomatidae, Tetragnathidae, Nephilidae, Pisauridae, Gnaphosidae.

253

Spiders. Invertebrate Fauna of Korea 21, 1–183.

Koch, C. L. (1836). Die Arachniden. (Dritter Band : Nürnberg).

Köcher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo, S., Villablana, A., and Wilson, A.C. (1989). Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences USA 86, 6196– 6200.

Kocot K, Citarella M, Moroz L, and Halanych K. (2013). PhyloTreePruner: a phylogenetic tree-based approach for selection of orthologous sequences for phylogenomics. Evolutionary Bioinformatics 9, 429–435.

Kralj-Fišer, S., Gregorič, M., Lokovšek, T., Elik, T.Č., and Kuntner, M. (2013). A glimpse into the sexual biology of the “zygiellids” spider genus Leviellus. The Journal of Arachnology 41, 387–391.

Kristensen, D.M., Wolf, Y.I., Mushegian, A.R., and Koonin, E. V. (2011). Computational methods for gene orthology inference. Briefings in Bioinformatics 12, 379–391. DOI:10.1093/bib/bbr030.

Kropf, C. 2013. Hydraulic system of locomotion. In: Spider Ecophysiology. Springer Berlin Heidelberg, Berlin, 43–56.

Kulczyński, W. (1911). Spinnen aus Nord-Neu-Guinea. In: ‘Nova Guinea. Resultats de l'expedition Scientifiqe neerlandaise a la Nouvelle Guinee en 1903 sous les auspices d'Arthur Wichmann.’ Leiden Zool. 3, 423–518.

Kuntner, M. 2005. A revision of Herennia (Araneae: Nephilidae: Nephilinae), the Australasian ‘coin spiders.’ Invertebrate Systematics 19, 391–436.

Kuntner, M., Agnarsson, .I, and Li, D. (2015). The eunuch phenomenon: adaptive evolution of genital emasculation in sexually dimorphic spiders. Biological Reviews 90, 279–296.

Kuntner, M., Arnedo, M.A., Trontelj, P., Lokovšek, T., and Agnarsson, I. (2013). A molecular phylogeny of nephilid spiders: Evolutionary history of a model lineage. Molecular Phylogenetics and Evolution 69, 961–979.

Kuntner, M., Coddington, J.A., and Hormiga, G. (2008). Phylogeny of extant nephilid orb-weaving spiders (Araneae, Nephilidae): Testing morphological and ethological homologies. Cladistics 24,147–217.

Kuntner, M., Coddington, J.A., and Schneider, J.M. (2009). Intersexual arms race?

254

Genital coevolution in nephilid spiders (Araneae, Nephilidae). Evolution 63, 1451–1463.

Kuntner, M., and Hormiga, G. (2002). The African spider genus Singafrotypa (Araneae, Araneidae). The Journal of Arachnology 30, 129–139.

Lanfear, R., Calcott, B., Ho, S.Y.W., and Guindon, S. (2012). PartitionFinder: Combined Selection of Partitioning Schemes and Substitution Models for Phylogenetic Analyses. Molecular Biology and Evolution 29, 1695–1701.

Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Naure Methods 9, 357–359.

Lemmon, A.R., Brown, J.M., Stanger-Hall, K., and Moriarty-Lemmon, E. (2009). The effect of ambiguous data on phylogenetic estimates obtained by maximum likelihood and Bayesian inference. Systematic Biology 58:130–145.

Levi, H.W. (1977). The orb-weaver genera Metepeira, Kaira, and Aculepeira in America north of Mexico (Araneae, Araneidae). Bulletin of the Museum of Comparative Zoology at Harvard College 148, 185–238.

Levi, H.W. (1980). The orb-weaver genus Mecynogea, the subfamily Metinae and the genera Pachygnatha, Glenognatha, and Azilia of the subfamily Tetragnathinae north of Mexico (Araneae: Araneidae). Bulletin of the Museum of Comparative Zoology at Harvard College 149, 1–74.

Levi, H. W. (1986). The Neotropical orb-weaver genera Chrysometa and Homalometa (Araneae: Tetragnathidae). Bulletin of the Museum of Comparative Zoology at Harvard College 151, 91–215.

Levi, H.W. (1992). Spiders of the orb-weaver genus Parawixia in America (Araneae: Araneidae). Bulletin of the Museum of Comparative Zoology at Harvard College 153, 1– 30.

Levi, H.W. (1995). Orb-weaving Actinosoma, Spilasma, Micrepeira, Pronous, and four new genera (Araneae, Araneidae). Bulletin of the Museum of Comparative Zoology at Harvard College 154, 153–213.

Levi, H.W, and von Eickstedt, V.R.D. (1989). The nephiline spiders of the neotropics (Araneae: Tetragnathidae). Memoirs of the Institute Butantan 51, 43–56.

Lewis, P.O. (2001). A likelihood approach to estimating phylogeny from discrete morphological character data. Systematic Biology 50, 913–925.

Liu, L., Yu, L., Kubatko, L., Pearl, D.K., and Edwards, S.V. (2015). Coalescent methods for estimating phylogenetic trees. Molecular Phylogenetics and Evolution 53, 320–328.

255

Lubin, Y.D. 1974. Stabilimenta and barrier webs in the orb webs of Argiope argentata (Araneae, Araneidae) on Daphne and Santa Cruz Islands, Galapagos. Journal of Arachnology 2, 119–126.

Maddison, W.P. 1993. Missing data versus missing characters in phylogenetic analysis. Systematic Biology 42, 576–581.

Marchese, C. (2015). Biodiversity hotspots: a shortcut for a more complicated concept. Global Ecology and Conservation 3, 297–309.

Marusik, Y. M., Omelko, M. M., Simonov, P. S., and Koponen, S. (2015). New data about orb-weaving spiders (Aranei: Araneidae and Tetragnathidae) from the Russian Far East. Arthropoda Selecta 24, 207–214.

Matzke, N.J. (2013). Probabilistic historical biogeography: new models for founder-event speciation, imperfect detection, and fossils allow improved accuracy and model-testing. Frontiers of Biogeography 5, 242–248.

Matzke, N.J. (2014). Model selection in historical biogeography reveals that founder- effect speciation is a crucial process in island clades. Systematic Biology 63, 951–970.

Miller, M.A., Pfeiffer, W., and Schwartz. T. (2011). Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, 1–8.

Mirarab, S., Reaz, R., Bayzid, M.S, Zimmerman, T., Swenson, M., and Warnow, T. (2014). ASTRAL: genome-scale coalescent-based species tree estimation. Bioinformatics 30, i541–i548.

Morgan, M.J., Roberts, J.D., and Keogh, J.S. ( 2007). Molecular phylogenetic dating supports an ancient endemic speciation model in Australia’s biodiversity hotspot. Molecular Phylogenetics and Evolution 44, 371–385.

Moussalli A, Hugall AF, Moritz C. (2005). A mitochondrial phylogeny of the rainforest skink genus Saproscincus, Wells and Wellington (1984). Molecular Phylogenetics and Evolution 34: 190–202.

Myers, N., Mittermeier, R.A., Mittermeier, C.G., da Fonseca, G.A.B., and Kent, J. (2000). Biodiveristy hotspots for conservation priorities. Nature 403, 853–858.

Namkung, J. (2002). ‘The spiders of Korea.’ (Kyo-Hak Publishing Co.: Seoul, South Korea.)

Nicolet, A. C. (1849). Aracnidos. In: Gay, C. (ed.) ‘Historia física y política de Chile.’ Zoología 3, 319–54. doi:10.5962/bhl.title.16172.

256

Nixon, K.C. (1999). Winclada. Version 1.00.08. Available at: http://www.cladistics.com/

Oliveros, J.C. (2015). Venny. An interactive tool for comparing lists with Venn’s diagrams. http://bioinfogp.cnb.csic.es/tools/venny/index.html. Last accessed April 2017.

Oxford, G.S. (1997). Guanine as a colorant in spiders: development, genetics, phylogenetics and ecology. Proceedings of the 17th European Colloquium of Arachnology, 121–131.

Oxford, G.S., and Gillespie, R.G. (1998). Evolution and ecology of spider coloration. Annual Review of Entomology 43, 619–43.

Palumbi, S.R., Martin, A., Romano, S., McMillan ,W.O., Stice, L., and Grabowski, G. (1991). The simple fool’s guide to PCR, Version 2.0. University of Hawaii, Honolulu. Paradis, E., Claude, J., and Strimmer, K. (2004). APE: analyses of phylogenetics and evolution in R language. Bioinformatics 20, 289–290.

Penney, D., and Ortuño, V.M. (2006). Oldest true orb-weaving spider (Araneae: Araneidae). Biology Letters 2, 447–450.

Philippe, H., Brinkmann, H., Lavrov, D. V., Littlewood, D.T.J., Manuel, M., Wörheide, G., and Baurain, D. (2011). Resolving difficult phylogenetic questions: why more sequences are not enough. PLoS Biology 9. DOI:10.1371/journal.pbio.1000602.

Pickard-Cambridge, O. (1869). Catalogue of a collection of Ceylon Araneida lately received from Mr J. Nietner, with descriptions of new species and characters of a new genus. I. Journal of the Linnean Society of London, Zoology 10, 373–397.

Pickard-Cambridge, O. (1889). Arachnida. Araneida. In ‘Biologia Centrali-Americana, Zoology.’ (London).

Pickard-Cambridge, F.O. (1902). A revision of the genera of Araneae or spiders with reference to their type species. Annals and Magazine of Natural History 9, 5–20.

Price, M., Dehal, P., and Arkin, A. (2010). FastTree 2 – approximately maximum likelihood trees for large alignments. PLos One 5, e9490.

Pyron, R.A. (2017). Novel Approaches for phylogenetic inference from morphological data and total-evidence dating in squamate reptiles (lizards, snakes, and amphisbaenians). Systematic Biology 66, 38–56.

R Core Team. (2015). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Available at http://www.R- project.org/.

Rainbow, W.J. (1896). Descriptions of some new Araneidae of New South Wales. No. 6.

257

Proceedings of the Linnean Society of New South Wales 21, 320–344.

Rainbow, W.J. (1916). Arachnida from northern Queensland. Part II. Records of the Australian Museum 11, 79–119.

Ramage, T., Martins-Simoes, P., Mialdea, G., Allemand, R., Duplouy, A., Rousse, P., Davies, N., Roderick, G.K., Charlat, S. (2017) A DNA barcode-based survey of terrestrial arthropods in the Society Islands of French Polynesia: host diversity within the SymbioCode Project. European Journal of Taxonomy 272, 1–13.

Rambaut, A., Suchard, M.A., Xie, D., and Drummond, A.J. ( 2014). Tracer v1.6. Available from http://beast.bio.ed.ac.uk/Tracer

Ranwez, V., Harispe, S., Delsuc, F., and Douzery, E.J.P. (2011). MACSE: multiple alignment of coding sequences accounting for frameshifts and stop codons. PLoS One 6, doi: 10.1371/journal.pone.0022594.

Ree, R.H., and Smith, S.A. (2008). Maximum Likelihood Inference of Geographic Range Evolution by Dispersal, Local Extinction, and Cladogenesis. Systematic Biology 57, 4– 14.

Revell, L.J. (2012). phytools: an R package for phylogenetic comparative biology (and other things). Methods in Ecology and Evolution 3, 217–223.

Rix, M.G., Cooper, S.J.B., Meusemann, K., Klopfstein, S., Harrison, S.E., Harvey, M.S., and Austin, A.D. 2017. Post-Eocene climate change across continental Australia and the diversification of Australasian spiny trapdoor spiders (Idiopidae: Arbanitinae). Molecular Phylogenetics and Evolution 109, 302–320.

Rix, M.G., Edwards, D.L., Byrne, M., Harvey, M.S., Joseph, L., and Roberts, J.D. (2015). Biogeography and speciation of terrestrial fauna in the south-western Australian biodiversity hotspot. Biological Reviews 90, 762–793.

Rix, M.G., and Harvey, M.S. (2012). Phylogeny and historical biogeography of ancient assassin spiders (Araneae: Archaeidae) in the Australian mesic zone: Evidence for Miocene speciation within Tertiary refugia. Molecular Phylogenetics and Evolution 62, 375–396.

Roberts, N.L. (1936). Colour change in the leaf-curling spider (Araneus wagneri). Journal and Proceedings of the Royal Society of New South Wales 1936, 28–29.

Robinson, M.H. (1982). Courtship and mating behavior in spiders. Annual Review of Entomology 27, 1–20.

Robinson, M.H., and Robinson, B.C. (1978). Thermoregulation in orb-web spiders: new descriptions of thermoregulatory postures and experiments on the effects of posture and

258

coloration. Zoological Journal of the Linnean Society 64, 87–102.

Robinson, M.H., and Robinson, B. (1980). Comparative studies of the courtship and mating behavior of tropical araneid spiders. Pacific Insects 36, Dept. Entomology, Bishop Museum, Hawaii, USA.

Roewer, V.C.F. (1942). Katalog der Araneae. Bremen.

Ronquist, F. (1997). Dispersal-vicariance analysis: a new approach to the quantification of historical biogeography. Systematic Biology 46, 195–203.

Ronquist, F., and Huelsenbeck, J.P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1752–1754.

Rubin, B.E.R., Ree, R.H., and Moreau, C.S. (2012). Inferring phylogenies from RAD sequence data. Plos One 7, e33394. DOI: 10.1371/journal.pone.0033394

Salichos, L., and Rokas, A. (2011). Evaluating ortholog prediction algorithms in a yeast model clade. Plos One 6, e18755.

Salichos, L., and Rokas, A. (2013). Inferring ancient divergences requires genes with strong phylogenetic signals. Nature 497, DOI: 10.1038/nature12130.

Salichos, L., Stamatakis, A., and Rokas, A. (2014). Novel information theory-based measures for quantifying incongruence among phylogenetic trees. Molecular Biology and Evolution 31, 1261–1271. DOI: 10.1093/molbev/msu061.

Sayyari, E., and Mirarab, S. (2016). Fast coalescent-based computation of local branch support from quartet frequencies. Molecular Biology and Evolution 33, 1654–1668. https://doi.org/10.1093/molbev/msw079

Scharff, N., and Coddington, J.A. (1997). A phylogenetic analysis of the orb-weaving spider family Araneidae (Arachnida, Araneae). Zoological Journal of the Linnean Society 120, 355–434.

Schmidt, J.B., and Scharff, N. (2008). A taxonomic revision of the orb-weaving genus Acusilas Simon, 1895 (Araneae, Araneidae). Insect Systematics & Evolution 39, 1–38.

Schultz, M.B., Smith, S.A., Horowitz, P., Richardson, A.M.M., Crandall, K.A., and Austin, C.M. (2009). Evolution underground: a molecular phylogenetic investigation of Australian burrowing freshwater crayfish (Decapoda: Parastacidae) with particular focus on Engaeus Erichson. Molecular Phylogenetics and Evolution 50, 580–598.

Scopoli, J.A. (1763). Araneae. In ‘Entomologia carniolica, exhibens insecta carniolae indigena et distributa in ordines, genera, species, varietates. Methodo Linnaeana.’ pp. 392–404. (Vindobonae).

259

Seah, W.K, and Li, D. (2001). Stabilimenta attract unwelcome predators to orb-webs. Proceedings of the Royal Society of London B 268, 1553–1558.

Selden, P. A. (1990). Lower Cretaceous spiders from the Sierra de Montsech, north-east Spain. Palaeontology 33, 257–285.

Sharma, P., and Giribet, G. (2009). A relict in New Caledonia: phylogenetic relationships of the family Troglosironidae (Opiliones: Cyphophthalmi). Cladistics 25, 279–294.

Sharma, P.P., Kaluziak, S.T., Perez-Porro, A.R., Gonzalez, V.L., Hormiga, G., Wheeler, W.C., and Giribet, G. (2014). Phylogenomic interrogation of Arachnida reveals systemic conflicts in phylogenetic signal. Molecular Biology and Evolution 31, 2963–2984. doi:10.1093/molbev/msu235

Shen, X.-X., Hittinger, C.T., and Rokas, A. (2017). Contentious relationships in phylogenomic students can be driven by a handful of genes. Nature Ecology and Evolution. DOI: 10.1038/s41559-017-0126

Sherriffs, W. (1928). South Indian Arachnology. Part III. Annals and Magazine of Natural History 2, 177–192.

Simão, F.A., Waterhouse, R.M., Ioannidis, P., Kriventseva, E.V., and Zdobnov , E.M.. (2015). BUSCO: assessing genome assembly and annotation completeness with single- copy orthologs. Bioinformatics, 31, 3210–3212. https://doi.org/10.1093/bioinformatics/btv351.

Simó, M., Álvarez, L., and Laborda, Á. (2016). The orb-weaving spider genus Chrysometa in Uruguay: distribution and description of a new species (Araneae, Tetragnathidae). Zootaxa 4067, 589–593. doi:10.11646/zootaxa.4067.5.7

Simmons, M.P. (2012). Misleading results of likelihood-based phylogenetic analyses in the presence of missing data. Cladistics 28, 208–222.

Simon, E. (1887). Observation sur divers arachnides: synonymies et descriptions. Annales de la Société Entomologique de France 6, 158–159, 167, 175–176, 186–187, 193–195.

Simon, E. (1894). Histoire naturelle des araignées. (Paris).

Simon, E. (1895). Histoire naturelle des araignées. (Paris).

Simon E. (1907). Arachnides recueillis par L. Fea sur la côte occidentale d’Afrique. 1re partie. Annali del Museo civico di storia naturale di Genova 3, 218–323.

Smith, H. M. (2008). Synonymy of Homalopoltys (Araneae: Araneidae) with the genus

260

Dolichognatha (Araneae: Tetragnathidae) and descriptions of two new species. Zootaxa 24, 1–24.

Sodhi, N.S., Koh, L.P., Brook, B.W., and Ng, P.K.L. (2004). Southeast Asian biodiversity: an impending disaster. Trends in Ecology and Evolution 19, 654–660.

Song, D. X. and Zhu, M. S. (1994). On some species of cave arachnids of China. In ‘Sixtieth Anniversary of the Founding of China Zoological Society: Memorial Volume Dedicated to the Hundredth Anniversary of the Birthday of the Late Prof. Sisan Chen (Z. Chen)’. (Ed Y.Y. Chen.) pp. 35–46. (China Science and Technology Press: Beijing).

Song, S., Liu, L., Edwards, S.V., and Wu, S. (2012). Resolving conflict in eutherian mammal phylogeny using phylogenomics and the multispecies coalescent model. Proceedings of the National Academy of Sciences USA 109, 14942–14947.

Springer, M.S., and Gatesy, J. (2016). The gene tree delusion. Molecular Phylogenetics and Evolution 94, 1–33.

Stamatakis, A. (2014). RAxML version 8: a tool for phylogenetic analysis and post- analysis of large phylogenies. Bioinformatics 30, 1312–1313.

Streicher, J.W., Devitt, T.J., Goldberg, C.S., Malone, J.H., Blakmon, H., and Fujita, M.K. (2014). Diversification and asymmetrical gene flow across time and space: lineage sorting and hybridization in polytypic barking frogs. Molecular Ecology 23, 3273 – 3291.

Streicher, J.W., Schulte, J.A., and Wiens, J.J. (2016). How should genes and taxa be sampled for phylogenomic analyses with missing data? An empirical study in iguanian lizards. Systematic Biology 65, 128–145. DOI: https://doi.org/10.1093/sysbio/syv058

Tanikawa, A. (1991). A new species of the genus Dolichognatha (Araneae: Tetragnathidae) from Iriomotejima Island, southwest Japan. Acta Archnologica 40, 37– 41.

Tanikawa, A. (2001). Okileucauge sasakii, a new genus and species of spider from Okinawajima Island, southwest Japan (Araneae, Tetragnathidae). The Journal of Arachnology 29, 16–20.

Tanikawa, A., Shinkai, A., and Miyashita, T. (2014). Molecular Phylogeny of Moth- Specialized Spider Sub-Family Cyrtarachninae, which Includes Bolas Spiders. Zoological Science 31, 716–720.

Thirunavukarasu, P., Nicolson, M., and Elgar, M.A. (1996). Leaf selection by the leaf- curling spider Phonognatha graeffei (Keyserling) (Araneoidea: Araneae). Bulletin of the British Arachnology Society 10, 187–189.

Thorell, T. (1890). Studi sui ragni Malesi e Papuani. IV, 1. Annali del Museo Civico di

261

Storia Naturale di Genova 28, 1–419.

Thorell, T. (1895). ‘Descriptive catalogue of the spiders of Burma.’ (London).

Urquhart, A.T. (1891). On new species of Tasmanian Araniedae [sic]. Papers and Proceedings of the Royal Society of Tasmania 1890, 236–253. van Dongen, S. (2000). Graphs Clustering by flow simulation. Ph.D. Thesis. University of Utrecht. Utrecht, Netherlands.

Walckenaer, C.A. (1837). Histoire naturelle des insectes. Aptères. (Paris).

Webb, L.J., and Tracey, J.G. (1981). Australian rainforests: patterns and change. In: Ecological biogeography of Australia. (W. Junk, The Hague).

Wheeler, W.C., Coddington, J.A., Crowley, L.M., Dimitrov, D., Goloboff, P.A., Griswold, C.E., Hormiga, G., Prendini, L., Ramírez, M.J., Sierwald, P., Almeida-Silva, L., Álvarez-Padilla F., Arnedo M.A,. Benavides Silva, L.R., Benjamin, S.P., Bond, J.E., Grismado, C.J., Hasan, E., Hedin, M., Izquierdo, M.A., Labarque, F.M., Ledford, J., Lopardo, L., Maddison, W.P., Miller, J.A., Piacentini, L.N., Platnick, N.I., Polotow, D., Silva-Dávila, D., Scharff, N., Szűts, T., Ubick, D., Vink, C.J., Wood, H.M., and Zhang, J.X. (2016). The spider tree of life: phylogeny of Araneae based on target-gene analyses from an extensive taxon sampling. Cladistics (online version), 1–43, https://doi.org/10.1111/cla.12182

White, A. (1841). Description of new or little known Arachnida. Annals and Magazine of Natural History 7, 471–477.

Whiting, M.F., Carpenter, J.C., Wheeler, Q.D., and Wheeler, W.C. (1997). The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Systematic Biology 46, 1–68. Wiens, J.T. 2003. Missing data, incomplete taxa, and phylogenetic accuracy. Systematic Biology 52, 528–538.

Wiens, J.T. and Morrill, M.C. 2011. Missing data in phylogenetic analysis: reconciling results from simulations and empirical data. Systematic Biology 60, 1–13.

Wood, H.M., Matzke, N.J., Gillespie, R.G., and Griswold, C.E. (2013). Treating fossils as terminal taxa in divergence time estimation reveals ancient vicariance patterns in the palpimanoid spiders. Systematic Biology 62: 264–284.

World Spider Catalog (2017). World Spider Catalog. Natural History Museum Bern, online at http://wsc.nmbe.ch, version 18.0, accessed on 2 February 2017.

Wu, Z.P., Wang, X., and Zhang, X.G. (2011). Using non-uniform read distribution models to improve isoform expression inference in RNASeq. Bioinformatics 27, 502–

262

508.

Wunderlich, J. 1986. Spinnenfauna Gestern und Heute. Fossile Spinnen in Bernstein und ihre heute lebenden Verwandten. (Weisbaden: Erich Bauer Verlag bei Quelle und Meyer).

Wunderlich, J. (2004). The fossil spiders (Araneae) of the families Tetragnathidae and Zygiellidae n. stat. in Baltic and Dominican amber, with notes on higher extant and fossil taxa. Beiträge zur Araneologie 3, 899–955.

Wunderlich, J. (2008). Descriptions of fossil spider (Araneae) taxa mainly in Baltic amber, as well as certain related extant taxa. Beiträge zur Araneologie 5, 44–139.

Wunderlich, J. (2015). On the evolution and the classification of spiders, the Mesozoic spider faunas, and descriptions of new Cretaceous taxa mainly in amber from Myanmar (Burma) (Arachnida: Araneae). In: Wunderlich, J. (ed.) Beiträge zur Araneologie, 9, 21– 408.

Wunderlin, J., and Kropf, C. (2013). Rapid Colour Change in Spiders. In: Spider Ecophysiology. Springer Berlin Heidelberg, Berlin, 361–370.

Yaginuma, T. (1958). Revision of Japanese spiders of the family Argiopidae. I. Genus Meta and a new species. Acta Arachnologica 15, 24–30.

Yang, Y., and Smith, S.A. (2014). Orthology inference in non-model organisms using transcriptomes and low-coverage genomes: improving accuracy and matrix occupancy for phylogenomics. Molecular Biology and Evolution 31, 3081–3092.

Zdobnov, E.M., Tegenfeldt, F., Kuznetsov, D., Waterhouse, R.M., Simão, F.A., Ioannidis, P., Seppey, M., Loetscher, A., and Kriventseva, E.V. (2016). OrthoDB v9.1: cataloging evolutionary and functional annotations for animal, fungal, plant, archaeal, bacterial and viral orthologs. Nucleic Acids Research 45, D744–D749. DOI: 10.1093/nar/gkw1119.

Zhang, C., Stadler, T., Klopfstein S., Heath, T.A., and Ronquist, F. (2015). Total evidence dating under the fossilized birth-death process. Systematic Biology 65, 228–249.

Zhao, Y., Zheng, Y., Chen, L., Dong, Y., and Wang, W. (2014). Analysis of transcriptomes of three orb-web spider species reveals gene profiles involved in silk and toxin. Insect Science 21, 687–698.

263

Appendices

Appendix 1. New material used for DNA extraction for metaine phylogeny.

Species Locality Voucher code(s) Chrysometa alboguttata Mexico: Chiapas, Salto de Agua, Centro Turistico GH2015, Poza Azul, 17.55779, -92.35368, 22.xii.2012, J.A. RJKDNA010 Ballesteros, E.B. Chavez Chrysometa poas Costa Rica: Heredia, Barva, Sendero Laguna Barva GH2011, P.N. Braulio Carrillo, Sector Volcán Barva, elev. 2854 RJKDNA006 m, 10.13371, -84.10528, T. da Silva-Moreira, J.A. Ballesteros Chrysometa zelotypa Costa Rica: Heredia, Barva, Sendero Laguna Barva GH2013, P.N. Braulio Carrillo, Sector Volcán Barva, elev. 2854 RJKDNA008 m, 10.13371, -84.10528, T. da Silva-Moreira, J.A. Ballesteros Dolichognatha incanescens Vietnam: Ha Tinh Province, Cat Ba National Park, GH2107, Tyuen Duung Giao Duc Moi Truung - Du Lich Sinh RJKDNA024 Thai [Forest Education Trail], 20.797179, 107.006982, elev. 50 m, 18-12.x.2009, J. Miller, D.S. Pham, D.N. Hieu Dolichognatha longiceps Philippines: Luzon Island, Laguna Prov., UP Los GH2126, Baños campus, 2.5 km ESE Los Baños, 14.1525, RJKDNA012 121.2344, elev. 138m, tall forest, general collecting in day time, 26-27.v.2011, H. Wood, M. Yngente, N. Chousou Polydouri, C. Griswold, V. San Juan, V. Knutson, PH0050 Dolichognatha pentagona USA: Florida, Highlands Co., Highlands Hammock GH2529, State Park, Ancient Hammock Trail, 27.468, -81.549, RJKDNA033 55 m, 21.vii.2016 marsh, G. Hormiga, R.J. Kallal (FL2016-GW-05) Dolichognatha umbrophila Vietnam: Ha Tinh Province, Vu Quang National Park, GH2106, forest nr. Don Bien Phong [border station] 567, RJKDNA023 18.331306, 105.439111, elev. 50 m, 27.xi-04.x.2009, J. Miller, D.S. Pham Metellina mengei Denmark: Bornholm, Hammeren Fyr, nr. Opalsøen, GH2521, 3.vii.2004, elev. 80 m, G. & D. Hormiga RJKDNA028 Zhinu manmiaoyangi Taiwan, Taichung City Co., Heping District, GH1404, Dasyueshan National Forest Recreation Area, RJKDNA001 24.25735, 121.00696, elev. 2205 m, 10-11.vii.2013, G. Hormiga, F. Labarque

Appendix 2. RAxML results of Metainae.

264

Appendix 3. MrBayes results of Metainae.

265

Appendix 4. New material sequenced for zygielline study.

266

Species Locality Voucher code(s) Acusilas dahoneus Philippines: Luzon Island, Laguna Prov., UP Los CASENT9042191, Baños campus, 2.5 km ESE Los Baños, 14.1525, GH2127, 121.2344, elev. 138m, tall forest, general collecting RJKDNA013 in day time, 26-27.v.2011, H. Wood, M. Yngente, N. Chousou Polydouri, C. Griswold, V. San Juan, V. Knutson, PH0001 Artifex melanopyga Australia: Queensland, Proserpine, nr. Kelsey QM S86612, Substation, site XY19, -20.390, 148.541, 6.xi.2007, GH2518, 21 m, R. Raven, closed forest RJKDNA025 Artifex melanopyga Australia: Queensland, Proserpine, Thompson Creek, QM S86802, site XY14, -20.511, 148.565, 12.xi.2007, 44 m, R. GH2519, Raven, closed forest RJKDNA026 Deliochus humilis Australia: New South Wales, Budderoo National GH2515, Park, Minnamurra Rainforest, -34.63390798, RJKDNA016 150.724441, elev. 196.328751 m, 25-26.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016- GW-01) Deliochus zelivira Australia: Queensland, Cainbable Cabin, nr. GH2516, Lamington National Park, -28.13518, 153.10944, RJKDNA017 elev. 641 m, 1-3.ii.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-16) Deliochus idoneus Australia: Queensland, Cainbable Cabin, nr. GH2517, Lamington National Park, -28.13518, 153.10944, RJKDNA018 elev. 641 m, 1-3.ii.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016-GW-16) Dolophones sp. Australia: Queensland, Lamington National Park, GH2525, Green Mtn. Section, Lahey Memorial, -28.18829703, RJKDNA032 153.119387, 799 m., 2.ii.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla Eriophora ravilla Mexico: Chiapas, Salto de Agua, Centro Turistico GH2522, Poza Azul, 17.55779, -92.35368, 22.xii.2012, elev. RJKDNA029 68 m, JA Ballesteros, EB Chavez Eriophora transmarina Australia: New South Wales, Budderoo National GH2167, Park, Minnamurra Rainforest, -34.63390798, RJKDNA019 150.724441, elev. 196.328751 m, 25-26.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016- GW-01) Paraplectanoides crassipes Australia: Victoria, Biamanga National Park, off GH1810 Field Buckets Road, elev. 161 m, -36.46652, 149.89529, 16.iv.2014, base of tussocks, G. Hormiga, N. Scharff Phonognatha graeffei Australia: Queensland, Tamborine National Park, GH0093, USNM Witches Falls, rainforest, -27.9048, 153.1800, 04044, 17.iv.2002, G. Hormiga, M. Kuntner, F. Álvarez- ARAGH000044 Padilla Phonognatha melania Australia: Western Australia, Charles Darwin WAM T97771, Reserve, near dam, -29.467778, 117.060000, GH2016, 7.v.2009, MS Harvey, Orbweb with rolled leaf at RJKDNA002 night Phonognatha melania Australia: Western Australia, Blackboy Ridge Park, WAM T115548,

267

Chittering Road, -31.488889, 116.112778, JM GH2017, Waldock et al, beating vegetation, juvenile RJKDNA003 Phonognatha tanyodon Australia: New South Wales, Budderoo National GH2514, Park, Minnamurra Rainforest, -34.63390798, RJKDNA015 150.724441, elev. 196.328751 m, 25-26.i.2016, G. Hormiga, R.J. Kallal, F. Álvarez-Padilla (AUS2016- GW-01) Spilasma duodecimguttata Brazil: Amazonas, Manaus, Reserva Florestal GH2530, Alberto Ducke, -2.932163151, -59.97491173, 79 m, RJKDNA034 17.v.2012, G Hormiga, J Ballesteros, L Benavides, T Moreira

268

Appendix 5. RAxML results of Zygiellinae.

269

Appendix 6. Molecular only MrBayes analysis of Zygiellinae.

270

Appendix 7. Total evidence MrBayes analysis of Zygiellinae.

271

Appendix 8. Morphological character coding.

Morphological character matrix.

Characters culled from other data sets (namely Kuntner et al. (2008) and Álvarez-Padilla et al. (2009)) are presented with the abbreviation MK08 or FAP09, respectively, followed by the character number in that matrix. These two references provide discussions and the original sources that were used to delineate the characters used in their matrices. We have denoted with an asterisk the new or revised characters and/or states that we have used in our matrix.

Female Somatic Morphology

1.Cephalic region: (0) low; (1) high. Corresponds to MK08 1.

2. Carapace: (0) piriform, with pars cephalica conspicuously narrower than pars thoracica; (1) oviform, with pars cephalica conspicuously narrower than pars thoracica. Corresponds to MK08 2.

3. Carapace edge structure: (0) smooth; (1) ridged. Corresponds to MK08 3.

4. Carapace edge setation: (0) smooth (or with few hairs); (1) hairy. Corresponds to MK08 4.

5. Carapace surface: (0) smooth; (1) with tubercles. Corresponds to MK08 5.

6. Fovea: (0) inconspicuous; (1) conspicuous. Corresponds to MK08 6 and FAP09 101.

7. Carapace macrosetae: (0) typical; (1) thicker, as in Nephilingis and Nephilengys. Corresponds to MK08 7.

8. Carapace setal bases: (0) typical; (1) enlarged and raised, as in Herennia. Corresponds to MK08 8.

9. Carapace V-mark: (0) absent; (1) present, as in Herennia. Corresponds to MK08 9.

10. Carapace hirsuteness: (0) covering <10%; (1) covering 10-50%; (2) covering more than 50%. Corresponds to FAP09 98.

11. Median eye region: (0) rounded, mounted on mass of pars cephalica without tubercle; (1) mounted on slight tubercle. Corresponds to MK08 11.

12. Lateral eye region: (0) lateral eyes on separate tubercles; (1) lateral eyes on single tubercle; (2) lateral eyes not on tubercle. Corresponds to MK08 12 and FAP09 96.

13. Separation between PME and PLE: (0) lesser than one PME interdistance; (1) wider than PME interdistance. Corresponds to MK08 13 and FAP09 90.

14. Posterior eye row curvature: (0) straight or recurved; (1) procurved. Corresponds to MK08 14

272 and FAP09 97.

15. Relative PME separation: (0) PME interdistance < PME diameter; (1) PME interdistance ≥ 1 PME diameter. Corresponds to MK08 15 and FAP09 91.

16. PLE size: (0) PLE diameter ≤ PME diameter; (1) PLE diameter> PME diameter. Corresponds to MK08 16 and FAP09 95.

17. PME tapetum: (0) absent; (1) present. Corresponds to MK09 17 and FAP09 92.

18. PLE tapetum: (0) absent; (1) present. Corresponds to MK08 18 and FAP09 94.

19. Clypeus height: (0) <3 AME diameters; (1) ≥ 3 AME diameters. Corresponds to MK08 19 and FAP09 89.

20. Endites: (0) >2x width; (1) <2x width. Corresponds to MK08 20.

21. Labium-sternum fusion: (0) separate; (1) fused. Corresponds to MK08 21.

22. Sternum-pleura fusion: (0) separate; (1) fused. Corresponds to MK08 22.

23. Sternum dimensions: (0) longer than wide; (1) as wide or wider than long. Corresponds to MK08 23 and FAP09 106.

24. Sternal slit sensilla: (0) prominent; (1) inconspicuous. Corresponds to MK08 24.

25. Sternum color pattern: (0) uniform dull coloration; (1) uniform red or orange; (2) medially dark, laterally light; (3) lighter medially, darker laterally; (4) with yellow spots. Corresponds to MK08 25.

26. Sternum white pigment: (0) absent; (1) present. Corresponds to MK08 26.

27. Frontal sternal tubercle: (0) absent; (1) present. Corresponds to MK08 32 and FAP09 109.

28. Frontal sternal tubercle aspect: (0) small; (1) large. Corresponds to MK08 33.

29. Female chilum: (0) absent; (1) present. Corresponds to MK08 34 and FAP09 85.

30. Female chelicerae: (0) width > ½ length; (1) width < ½ length. Corresponds to MK08 35.

31. Cheliceral ectal margins: (0) smooth; (1) with stridulatory striae. Corresponds to MK08 36 and FAP09 81.

32. Cheliceral boss: (0) present; (1) absent. Corresponds to MK08 37 and FAP09 80.

33. Cherliceral boss cuticle: (0) smooth; (1) striated. Corresponds to MK08 38.

34. Prosoma supracheliceral loble (PSL): (0) present; (1) absent. Corresponds to MK08 39 and FAP09 87.

35. Cheliceral furrow: (0) denticulated; (1) smooth. Corresponds to MK08 40 and FAP09 84.

273

36. Coxae III and IV humps: (0) absent; (1) present. Corresponds to MK08 41.

37. Femur I shape: (0) basically straight; (1) sigmoid, curved outward. Corresponds to MK08 42. 38. Femoral spines: (0) present; (1) absent. Corresponds to MK08 43.

39. Femur I and II macrosetae morphology: (0) long; (1) short and stout. Corresponds to MK08 44.

40. Femur I prolateral spines: (0) absent; (1) present. Corresponds to MK08 45.

41. Spine socket color: (0) as legs; (1) dark. Corresponds to MK08 46.

42. Femur IV trichobothria: (0) absent; (1) present. Corresponds to MK08 47 and FAP09 169.

43. Femur IV trichobothria pattern: (0) scattered; (1) ordered in rows. Corresponds to MK08 48 and FAP09 171.

44. Nephiline tibia I tufts: (0) absent; (1) present. Corresponds to MK08 49.

45. Nephiline tibia II tufts: (0) absent; (1) present. Corresponds to MK08 50.

46. Nephiline tibia IV tufts: (0) absent; (1) present. Corresponds to MK08 51.

47. Patella-tibia autospasy: (0) absent; (1) present. Corresponds to MK08 52.

48. Theridiid comb: (0) absent; (1) present. Corresponds to MK08 53 and FAP09 173.

49. Tarsus IV median claw: (0) as long or longer than paired claws; (1) shorter than paired claws. Corresponds to MK08 54.

50. Sustentaculum: (0) present; (1) absent. Corresponds to MK08 55 and FAP09 176.

51. Sustentaculum angle: (0) widely diverging from other setae; (1) parallel to other setae. Corresponds to MK08 56.

52. Female abdomen length: (0) length > 2x width; (1) length = 1-2x width; (2) length < width. Corresponds to MK08 57.

53. Abdomen width: (0) elliptical to uniform; (1) widest proximally; (2) widest distally; (3) pentagonal. Corresponds to MK08 58.

54. Female lateral abdominal margin: (0) smooth; (1) not smooth, lobed. Corresponds to MK08 59.

55. Female anterior abdominal humps/tubercles: (0) present; (1) absent. Corresponds to MK08 60.

56. Female mid-abdomen humps: (0) present; (1) absent. Corresponds to MK08 61.

57. Female abdominal tip: (0) rounded; (1) truncated. Corresponds to MK08 62.

274

58. Female abdomen beyond spinnerets: (0) typical (<20% length beyond spinnerets); (1) considerable (more than 20%). Corresponds to MK08 63.

59. Spiracle position: (0) near spinnerets; (1) advanced toward epigastric furrow. Corresponds to MK08 64.

60. Female abdominal ventro-median apodemes: (0) absent; (1) present. Corresponds to MK08 65.

61. Female abdominal ventro-median apodeme number: (0) 1-5; (1) 6-11. Corresponds to MK08 66.

62. Female abdominal ventro-lateral sclerotizations: (0) present; (1) absent. Corresponds to MK08 67.

63. Female abdominal ventro-lateral sclerotizations: (0) one paired line; (1) several lines. Corresponds to MK08 68.

64. Female abdominal dorso-median apodemes: (0) absent; (1) present. Corresponds to MK08 69.

65. Female abdominal dorso-lateral sclerotizations: (0) present; (1) absent. Corresponds to MK08 70.

66. Female abdominal dorso-central sclerotizations: (0) absent; (1) present. Corresponds to MK08 71.

67. Female dorsal sigillae: (0) absent; (1) present. Corresponds to MK08 72.

68. Female anterior abdomen light-pigmented band: (0) absent; (1) present. Corresponds to MK08 73.

69. Nephiline abdominal coloration: (0) uniform; (1) patterned. Corresponds to MK08 74. Note this character and 70-75 are nephiline-specific characters from MK08; removing them does not seriously affect the overall topology.

70. Female dorsal dark spots: (0) absent; (1) present, esp. Herennia. Corresponds to MK08 75.

71. Female dorsal longitudinal light lines: (0) absent; (1) present, esp. Nephila. Corresponds to MK08 76.

72. Female dorsal paired light spots: (0) absent; (1) present, esp. Nephila. Corresponds to MK08 77.

73. Female dorsal wide notched band: (0) absent; (1) present, esp. Nephila. Corresponds to MK08 78.

74. Female dorsal ‘butterfly’ pattern: (0) absent; (1) present, esp. Clitaetra. Corresponds to MK08 79.

75. Female dorsum ‘grid’ pattern: (0) absent; (1) present, esp. Clitaetra. Corresponds to MK08

275

80.

76*. Zygielline abdominal dorsal markings: (0) longitudinal stripes; (1) dark crescents or rings around apodemes with solidly dark posterior; (2) dark oval markings near apodemes with striped posterior. Zygielline taxa have conspicuous patterns on the dorsum of their abdomens that are consistent with generic placement (Deliochus, Artifex, and Phonognatha, respectively).

77. Abdomen tip color: (0) without paired white spots; (1) with paired white spots. Corresponds to MK08 81 and FAP09 159.

78. Female silver abdomen coloration: (0) absent; (1) present. Corresponds to MK08 82.

79. Female ventral light pigmented area: (0) absent; (1) present. Corresponds to MK08 83.

80. Female ventral pattern: (0) central light area; (1) transverse lines; (2) four large spots; (3) numerous spots; (4) longitudinal lines. Corresponds to MK08 84.

81. Booklung cover: (0) grooved; (1) smooth. Corresponds to MK08 85 and FAP09 158.

82. Area around female book lunch spiracle: (0) weakly sclerotized; (1) heavily sclerotized. Corresponds to MK08 86.

Female Genitalia

83. Epigynum: (0) present; (1) absent. Corresponds to MK08 87 and FAP09 123.

84. Posterior epigynum: (0) round; (1) grooved. Corresponds to MK08 88.

85. Epigynal ventral area: (0) low; (1) swollen. Corresponds to MK08 89.

86. Epigynal posterior area: (0) round; (1) lingulate. Corresponds to MK08 90.

87. Epigynal openings: (0) superficial; (1) in larger chambers. Corresponds to MK08 91.

88. Epigynal chamber opening position: (0) medial; (1) lateral. Corresponds to MK08 92.

89. Epigynal septum: (0) absent; (1) present. Corresponds to MK08 93.

90. Epigynal septum shape: (0) narrow between chambers; (1) extensive, broader posteriorly. Corresponds to MK08 94.

91. Epigynal paired sclerotized pocket with inset copulatory openings: (0) absent; (1) present. Corresponds to MK08 95.

92. Epigynal scape: (0) absent; (1) present. Corresponds to MK08 96 and FAP09 127.

93. Epigynal flap : (0) absent; (1) present. Corresponds to MK08 97.

94. Epigynal flap position: (0) posterior to copulatory openings; (1) lateral to copulatory openings.

276

95. Epigynum posterior membrane: (0) absent; (1) present, as Meta.

96. Anterior epigynal area: (0) with paired apodemes; (1) round. Corresponds to MK08 99.

97. Cuticle anterior to epigynal area: (0) rounded; (1) depressed. Corresponds to MK08 100 and FAP09 126.

98. Epigynal anterior area: (0) round; (1) depressed, as Clitaetra and Opadometa. Corresponds to MK08 101.

99. Epigynal lateral area: (0) round; (1) curved, as Clitaetra and Opadometa. Corresponds to MK08 102.

100. Copulatory opening: (0) opens caudally; (1) opens ventrally. Corresponds to MK08 103 and FAP09 131.

101. Caudal copulatory opening orientation: (0) on posterior sclerotized epigynal margin; (1) anterior to sclerotized margin. Corresponds to MK08 104.

102. Copulatory opening: (0) slit; (1) round. Corresponds to MK08 105.

103. Copulatory duct morphology: (0) flattened, longer than wide; (1) tube; (2) broadly attached, wider than long. Corresponds to MK08 106 and FAP09 145.

104*. Copulatory ducts coiled within a capsule: (0) absent; (1) present. The copulatory duct of Phonognatha is coiled between 2 and 12 times, away from the spermathecae then back to them. While the lumen is coiled, the entire coil it enclosed in a capsule (Fig. XXX). This structure appears to be unique to Phonognatha.

105*. Copulatory duct coils within capsule: (0) ≤ 2; (1) 3-8; (2) ≥ 9. Refer to figs for each state.

106. Copulatory duct sclerotization: (0) unsclerotized; (1) sclerotized. Corresponds to FAP09 147.

107. Spermathecae shape: (0) lobed; (1) spherical. Corresponds to MK08 107 and FAP09 139.

108. Spermathecae separation: (0) separated by >2 spermatheca widths; (1) separated by <2 widths. Corresponds to MK08 108 and FAP09 138.

109. Spermathecae sclerotization: (0) sclerotized; (1) unsclerotized. Corresponds to MK08 109 and FAP09 137.

110. Fertilization ducts: (0) present; (1) absent, as in tetragnathines. Corresponds to MK08 110.

111. Epigynal anterior sclerotized arch: (0) absent; (1) present. Corresponds to MK08 111.

112. Female copulatory opening: (0) never plugged; (1) sometimes plugged. Corresponds to MK08 112.

113. Copulatory plug composition: (0) secretion; (1) embolus; (2) male palp sclerites in addition to the embolus. Corresponds to MK08 113 and FAP09 132.

277

Spinnerets

114. Cribellum: (0) present; (1) absent. Corresponds to MK08 114.

115. ALS piriform bases: (0) normal; (1) reduced. Corresponds to MK08 115 and FAP09 1.

116. PMS nubbin: (0) absent; (1) present. Corresponds to MK08 116 and FAP09 7.

117. PMS aciniform field: (0) extensive; (1) sparse. Corresponds to MK08 117 and FAP09 5.

118. PLS mesal cylindrical spigot bases: (0) subequal to other PLS cylindrical spigot; (1) larger. Corresponds to MK08 118.

119. PLS mesal cylindrical spigot position: (0) central; (1) peripheral. Corresponds to MK08 119.

120. PLS triad: (0) spread, with flagelliform spigot closer to cylindrical spigots than aggregate spigots; (1) closed, with flagelliform spigot closer to aggregate spigots and cylindrical spigots, but not embracing; (2) embracing, with aggregate spigots adjacent to cylindrical spigots. Corresponds to MK08 120 and FAP09 14.

121. PLS aggregate spigot: (0) normal; (1) enlarged. Corresponds to MK08 121 and FAP09 10.

122. ALS rugose patch: (0) absent; (1) present. Corresponds to FAP09 3.

Male Somatic Morphology

123. Epiandrous fusules arrangement: (0) one transverse line; (1) two main clusters. Corresponds to FAP09 18.

124. Epiandrous fusules line: (0) level with surrounding cuticle; (1) within a groove. Corresponds to FAP09 19.

125. Epiandrous fusules pits: (0) absent; (1) present. Corresponds to FAP09 20.

126. Epiandrous fusule base distal margin: (0) sharp; (1) rounded. Corresponds to FAP09 21.

127. Epiandrous plate posterior edge: (0) as upper edge; (1) swollen. Corresponds to FAP09 22.

128. Overall sexual size dimorphism: (0) total length of male at least half the total length of the female; (1) total length of male less than half the total length of the female. Corresponds to MK08 122 and FAP09 122.

129. Dorsal abdomen scutum: (0) absent; (1) present. Corresponds to MK08 123 and FAP09 166.

130. Male lateral eye position: (0) separate; (1) adjacent. Corresponds to MK08 124.

131. Cephalic region dimorphism: (0) narrower than in female; (1) proportional to females. Corresponds to MK08 125 and FAP09 119.

132. Male AME region: (0) as in female; (1) projected beyond clypeal margin. Corresponds to

278

MK08 126.

133. Chelicerae dimorphism: (0) male chelicerae as female; (1) male chelicerae larger than females’; (2) male chelicerae smaller than females’. Corresponds to MK08 127 and FAP09 118.

134. Cheliceral clasping spurs: (0) absent; (1) present, as in tetragnathines. Corresponds to MK08 128.

135. Paturon posterior surface: (0) smooth; (1) with tubercle. Corresponds to MK08 129.

136. Coxa I hook (and female femur II groove): (0) absent; (1) present. Corresponds to MK08 130 and FAP09 184.

137. Male tibia II macrosetae: (0) as tibia I; (1) more robust than tibia I; (2) absent. Corresponds to MK08 131 and FAP09 179.

138. Male endite tooth: (0) absent; (1) present. Corresponds to MK08 132.

Male Genitalia

139. Male palpal trochanter: (0) twice the width or less; (1) more than twice the width. Corresponds to MK08 134 and FAP09 183.

140. Male palpal femoral tubercle: (0) absent; (1) present. Corresponds to MK08 135.

141. Male palp patella macrosetae number: (0) none; (1) one; (2) two. Corresponds to MK08 136 and FAP09 180.

142. Male palpal tibia length: (0) ≤ 1.5 x width; (1) > 1.5 x width. Corresponds to MK08 137 and FAP09 181.

143. Cymbium shape: (0) entire; (1) constricted. Corresponds to MK08 138 and FAP09 25.

144. Cymbium length: (0) < 2 x cymbium width; (1) > 2 x cymbium width. Corresponds to MK08 139 and FAP09 35.

145. Cymbium orientation: (0) dorsal; (1) mesal. Corresponds to MK08 140 and FAP09 23.

146. Cymbial ectal margin: (0) sclerotized as cymbium; (1) transparent. Corresponds to MK08 141 and FAP09 36.

147. Tarsal organ diameter: (0) as macrosetal base diameter; (1) wider than macrosetal base diameter. Corresponds to FAP09 24.

148. Cymbial processes: (0) absent; (1) present. Corresponds to MK08 142.

149. Paracymbium: (0) absent; (1) present. Corresponds to MK08 144 and FAP09 37.

150. Paracymbium attachment: (0) integral; (1) intersegmental (2) articulated. Corresponds to MK08 145 and FAP09 40.

279

151. Paracymbial base sclerotization: (0) as cymbium; (1) less sclerotized. Corresponds to MK08 146.

152. Paracymbium shape: (0) short, hook-shaped; (1) longer than wide, finger-shaped; (2) flat, rectangular; (3) u-shaped; (4) flat, triangular; (5) broadly articular at Phonognatha. Corresponds to MK08 147 and FAP09 38.

153. Paracymbium edge: (0) glabrous; (1) with setae. Corresponds to MK08 148 and FAP09 44.

154. Anterior paracymbial apophysis: (0) absent; (1) present. Corresponds to MK08 149 and FAP09 42.

155. Paracymbium fold: (0) absent; (1) present. Corresponds to MK08 150 and FAP09 43.

156. Paracymbium end: (0) rounded; (1) pronged. Corresponds to MK08 151.

157. Paracymbium prong: (0) < 1/3 paracymbium length; (1) > 1/3 paracymbium length. Corresponds to MK08 152.

158. Tegulum in ectal view: (0) at least as large as subtegulum; (1) smaller than subtegulum. Corresponds to MK08 153 and FAP09 49.

159. Sperm reservoir: (0) normal; (1) enlarged. Corresponds to MK08 154 and FAP09 76.

160. Reservoir course: (0) spiral; (1) with switchbacks. Corresponds to MK08 156 and FAP09 77.

161. Ventral tegular switchback: (0) single; (1) double. Corresponds to MK08 156 and FAP09 78.

162. Ejaculatory duct: (0) within sclerotized portion of embolus; (1) contained in pars pendula, as in Deliochus and Artifex (Fig. 20). Corresponds to MK08 157 and FAP09 79.

163. Median apophysis: (0) absent; (1) present. Corresponds to MK08 158 and FAP09 51.

164. Median apophysis-sperm duct association: (0) no sperm duct; (1) with sperm duct loop. Corresponds to MK08 159 and FAP09 52.

165. Median apophysis thread-like spur: (0) absent; (1) present. Corresponds to MK08 160.

166. Apical tegular apophysis: (0) absent; (1) present, as in Herennia. Corresponds to MK08 161.

167. Ventral tegular apophysis: (0) absent; (1) present, as in Clitaetra. Corresponds to MK08 162.

168. Mesal tegular apophysis: (0) absent; (1) present. Corresponds to MK08 163.

169. Theridiid tegular apophysis: (0) absent; (1) present. Corresponds to MK08 164 and FAP09 61.

170. Conductor: (0) present; (1) absent. Corresponds to MK08 165 and FAP09 53.

171. Conductor size: (0) less than half bulb volume; (1) at less the bulb volume. Corresponds to MK08 166 and FAP09 60.

280

172. Conductor form: (0) rounded; (1) with embolic groove. Corresponds to MK08 167.

173. Conductor-embolus association: (0) coiled with or within conductor; (1) separate from conductor. Corresponds to MK08 168 and FAP09 54.

174. Conductor secondary apophysis: (0) absent; (1) present. Corresponds to MK08 169.

175. Conductor lobe: (0) absent; (1) present. Corresponds to MK08 170.

176. Conductor membrane: (0) absent; (1) present. Corresponds to MK08 172.

177. Conductor shape: (0) complex; (1) simple, finger-like. Corresponds to MK08 173.

178. Finger-like conductor shape: (0) relatively short; (1) relatively long. Corresponds to MK08 174.

179. Conductor composition: (0) undivided; (1) divided into sclerites. Corresponds to MK08 175.

180. Conductor distal flap: (0) absent; (1) present, as in Herennia. Corresponds to MK08 176.

181. Conductor edge: (0) smooth; (1) ridged. Corresponds to MK08 177.

182. Conductor curvature: (0) straight, or nearly so; (1) sigmoid or bent. Corresponds to MK08 178.

183. Conductor tip: (0) straight; (1) hooked, as in Phonognatha. Corresponds to MK08 179.

184. Conductor subdistal protuberance: (0) absent; (1) present, as in some Nephila. Corresponds to MK08 180.

185. Embolus length: (0) >2 times cymbium length; (1) 0.5-1.5 times cymbium length; (2) <0.5 cymbium length. Corresponds to MK08 181 and FAP09 68.

186. Embolus form: (0) thin; (1) thick; (2) filiform. Corresponds to MK08 182.

187. Embolus sclerotization: (0) sclerotized; (1) unsclerotized, as Opadometa. Corresponds to MK08 183.

188. Embolus-tegulum orientation: (0) parallel; (1) perpendicular. Corresponds to MK08 184 and FAP09 62.

189. Embolus-tegulum membrane: (0) absent; (1) present. Corresponds to MK08 185 and FAP09 63.

190. Embolic base: (0) thin; (1) enlarged into radix. Corresponds to MK08 186 and FAP09 71.

191. Embolic base, distal part: (0) smooth; (1) denticulated, as in some Clitaetra. Corresponds to MK08 187.

192. Embolic apophysis: (0) absent; (1) present, as in some nephilines and metaines. Corresponds

281 to MK08 188 and FAP09 64.

193. Radical membrane: (0) absent; (1) present, as in some araneids. Corresponds to MK08 189.

194. Stipes: (0) absent; (1) present, as in some araneids. Corresponds to MK08 190 and FAP09 72.

195. Embolic constriction: (0) absent; (1) present. Corresponds to MK08 191.

196. Embolic hooks: (0) absent; (1) present, as in Deliochus and Artifex. Corresponds to MK08 192.

197. Embolic distal apophysis: (0) absent; (1) present. Corresponds to MK08 193.

198. Embolus tip: (0) flat; (1) cylindrical. Corresponds to MK08 194.

199. Distal hematodocha: (0) absent; (1) present. Corresponds to MK08 195 and FAP09 73.

200. Subterminal apophysis: (0) absent; (1) present. Corresponds to MK08 196 and FAP09 75.

201. Terminal apophysis: (0) absent; (1) present. Corresponds to MK08 197 and FAP09 74.

Web Architecture

202. Web architecture: (0) orb; (1) sheet; (2) cob. Corresponds to MK08 198 and FAP09 187.

203. Web angle: (0) horizontal to 45° diagonal; (1) greater than 45° diagonal. Corresponds to MK08 199 and FAP09 191.

204. Orb shape: (0) round; (1) vertically elongate. Corresponds to MK08 200.

205. Silk color: (0) white; (1) golden. Corresponds to MK08 201.

206. Silk stabilimentum: (0) absent; (1) present. Corresponds to MK08 202 and FAP09 190.

207. Barrier web: (0) absent; (1) present. Corresponds to MK08 203 and FAP09 192.

208. Hub position: (0) not against substrate; (1) against substrate. Corresponds to MK08 204 and FAP09 199.

209. Hub placement: (0) central; (1) displaced up; (2) displaced down. Corresponds to MK08 205 and FAP09 199.

210. Hub bite-out: (0) absent; (1) present. Corresponds to FAP09 195 and MK08 206.

211. Hub open/closed: (0) closed; (1) open. Corresponds to MK08 207 and FAP09 194.

212. Hub cup: (0) absent; (1) present. Corresponds to MK08 208 and FAP09 198.

213. Hub to temporary spiral shift: (0) gradual; (1) abrupt. Corresponds to MK08 209 and FAP09 197.

282

214. Radii construction: (0) not cut and reeled; (1) cut and reeled. Corresponds to FAP09 201 and MK08 210.

215. Radii attachment on frame: (0) attached once; (1) attached twice. Corresponds to MK08 211 and FAP09 200.

216. Secondary radii: (0) absent; (1) present. Corresponds to MK08 212 and FAP09 202.

217. Tertiary radii: (0) absent; (1) present. Corresponds to MK08 213 and FAP09 203.

218. Pseudoradii: (0) absent; (1) present. Corresponds to MK08 214.

219. Sticky spiral: (0) spiral; (1) parallel. Corresponds to MK08 215.

220. Non-sticky spiral: (0) removed; (1) persists in final web. Corresponds to MK08 216 and FAP09 205.

221. Non-sticky spiral form: (0) linear; (1) zig-zag. Corresponds to MK08 217.

222. Non-sticky spiral contact with first sticky spiral construction: (0) absent; (1) present. Corresponds to FAP09 206 and MK08 218.

223. Sticky spiral localization: (0) oL1; (1) iL1; (2) oL4. Corresponds to MK08 219 and FAP09 204.

224. Web posture: (0) legs I and II extended; (1) legs I and II flexed. Corresponds to FAP09 189 and MK08 220.

225. Argiope posture: (0) absent; (1) present. Corresponds to MK08 221.

226. Attack behavior: (0) wrap-bite; (1) bite-wrap. Corresponds to FAP09 209 and MK08 222.

227. Wrap-bite-silk: (0) dry; (1) sticky. Corresponds to MK08 223.

228. Cheliceral clasp: (0) absent; (1) present. Corresponds to MK08 224 and FAP09 213.

229. Emasculation: (0) absent; (1) present. Corresponds to MK08 225 and FAP09 212.

230. Body shake: (0) absent; (1) present. Corresponds to MK08 226 and FAP09 221.

231. Side change: (0) absent; (1) present. Corresponds to MK08 227.

232. Partial web renewal: (0) absent; (1) present. Corresponds to MK08 228 and FAP09 193.

233. Retreat: (0) absent or simple; (1) present, dominated by silk tube or integrated leaf. Largely corresponds to MK08 229 and FAP09 207.

234. Retreat form: (0) silk tube, possible without leaf substrate; (1) leaf is a major component of the retreat; (2) other detritus is a major component of the retreat. Largely corresponds to MK08 230.

283

235. Detritus web decoration: (0) no decoration; (1) decoration. Corresponds to MK08 231.

Appendix 9. Dispersal matrix for biogeography.

Localities of zygielline species for biogeographic analyses. Zones are: Palearctic (P), Nearctic (N), Indomalayan (I) New Caledonia (C), Queensland north of St. Lawrence Gap (Q), eastern Australia south of St. Lawrence Gap (S), and Western Australia (W). An ‘x’ denotes presence in that zone. Note Z. atrica and Z. x-notata is limited to the Palearctic as they were likely brought to the New World recently by man.

taxa P N I C Q S W Artifex joannae x Artifex melanopyga x Deliochus humilis x x x Deliochus idoneus x x x Deliochus zelivira x x x Leviellus inconveniens x Leviellus poriensis x Leviellus stroemi x Leviellus thorelli x Phonognatha graeffei x x Phonognatha melania x x x Phonognatha neocaledonica x Phonognatha tanyodon x Zygiella atrica x Zygiella dispar x x Zygiella keyserlingi x Zygiella montana x Zygiella nearctica x Zygiella sp. x Zygiella x-notata x

284

Appendix 10. ASTRAL analysis of matrix I.

Appendix 11. ASTRAL analysis of matrix II.

285

Appendix 12. ASTRAL analysis of matrix III.

Appendix 13. ExaML analysis of matrix I.

286

Appendix 14. ExaML analysis of matrix II.

287

Appendix 15. ExaML analysis of matrix III.

Appendix 16. ExaBayes analysis of matrix I.

288

Appendix 17. ExaBayes analysis of matrix II.

Appendix 18. ASTRAL analysis of matrix IV.

289

Appendix 19. ASTRAL analysis of matrix V.

Appendix 20. ASTRAL analysis of matrix VI.

290

Appendix 21. ExaML analysis of matrix IV.

Appendix 22. ExaML analysis of matrix V.

291

Appendix 23. ExaML analysis of matrix VI.

Appendix 24. ExaBayes analysis of matrix IV.

292

Appendix 25. ExaBayes analysis of matrix V.

Appendix 26. ExaBayes analysis of matrix VI.

293