IGFBP7 Is Involved in Abalone Metamorphosis

Aquaculture 451 (2016) 377–384

Contents lists available at ScienceDirect

Aquaculture

journal homepage: www.elsevier.com/locate/aqua-online

IGFBP7 is involved in abalone metamorphosis

Guodong Wang a,NaLia,LiliZhanga, Longhui Zhang a, Ziping Zhang b, Yilei Wang a,⁎ a Key Laboratory of Healthy Mariculture for the East China Sea, Ministry of Agriculture, Fisheries College, Jimei University, Xiamen 361021, Fujian, China b Department of Natural Sciences and Mathematics, State University of New York at Cobleskill, NY 12043, USA article info abstract

Article history: Metamorphosis is the most critical life stage for abalone. There are morphogenetic transformations and habitat Received 26 June 2015 selection with metamorphosis. A large amount of larvae often die during this stage. Insulin/insulin-like growth Received in revised form 18 September 2015 factor signaling pathway (IIS) plays a role in the development. However, there is little knowledge of IIS function Accepted 29 September 2015 in metamorphosis. IGFBP7, a component of IIS, was found to be involved in metamorphosis of small abalone Available online xxxx Haliotis diversicolor. The expression of saIGFBP7 mRNA rapidly increased before metamorphosis, which were fi Keywords: mainly localized in the velum and foot. There was a signi cant decrease of metamorphosis rate after competent μ −10 Abalone larvae were exposed to 5 g/mL dsRNA of saIGFBP7 (p = 2.50 × 10 , F = 389.05). The expressions of three IGFBP7 downstream genes of IIS (PI3K, ERKα and AKT)aswellassaIGFBP7 were decreased in the dsRNA exposure Metamorphosis experiment. There was no significant difference of metamorphosis rate (p = 0.97, F = 0.071) after competent IIS larvae were induced in different concentrations of insulin. The expression of saIGFBP7, PI3K and ERKα also had no significant difference in insulin inducing assay. However, AKT expression level of 1 μmol/L insulin induced group was significantly higher than that of other concentrations (p = 3.41 × 10−7, F = 26.68). These results suggested that IGFBP7 is involved in metamorphosis of abalone larvae. Our study provides insight on developing new methods for increasing the metamorphosis rate in abalone aquaculture. However, it does not work as a negative regulator of IIS activity, or plays its role in an IGF- and insulin-independent manner during metamorphosis of abalone larvae. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Many chemical cues are able to induce abalone larvae settlement and metamorphosis, such as γ-aminobutyric acid (GABA) (Morse et al., Life histories of marine invertebrates are extremely diverse. Still, the 1979), thyroid hormones (THs) (Fukazawa et al., 2001), serotonin general theme of a pelago-benthic life cycle is metamorphosis, in which (Wang et al., 2010), and chemical substances in certain crustose red a free-swimming larval form feeds and/or disperses in the plankton algae (Morse and Morse, 1984). Small abalone (Haliotis diversicolor)is for a time, and then settles into the benthic habitat where it undergoes commercially important in the southeast coast of China as a primary a more or less dramatic transition both morphologically and physio- cultured species. The hatchery-produced seeds are very important for logically to its juvenile/adult habitat on the sea floor (Heyland and abalone culture. However, a major problem in seeding production is Moroz, 2006). poor larval metamorphosis resulting in low larvae survival rate. Higher Abalone is an ideal model for the study of marine invertebrate, metamorphosis rate of larval abalone is very essential in successful because its larva is lecithotrophic and larval metamorphosis is strongly culture industry (Li et al., 2006). Unfortunately, there are few methods induced by chemical cues (Morse et al., 1979; Roberts, 2001). to keep high metamorphosis rate, because the mechanism of abalone metamorphosis remains largely unknown. Apoptosis of larval tissues occurs in parallel with the differentiation Abbreviations: BC, blank control; Dilp, Drosophila insulin-like peptide; dsRNA, double- of adult tissues during the metamorphic transition. Metamorphosis is a stranded RNA; FSW, filtered seawater; GABA, γ-aminobutyric acid; GFP, green fluorescent process that removes larval tissues and builds up adult tissue. For exam- protein; hpf, hours post-fertilization; IB, insulin-like growth factors binding; IIS, insulin/ ple, the entire larval musculature is replaced in the adult. On the level of insulin-like growth factor signaling pathway; IGFBP7, insulin-like growth factor binding fi protein 7; IGFBPs, insulin-like growth factor binding proteins; IGFR, insulin-like growth the nervous system, adult-speci c neurons establish new connections factor receptor; ILPs, insulin-like peptides; Imp-L2, imaginal morphogenesis factor—late (reviewed by Heyland and Moroz, 2006). Therefore, signaling pathways 2; InR, insulin receptor; MAPK, mitogen-activated protein kinases; NC, negative control; involving in apoptosis/differentiation may play roles in metamorphosis. PBS, phosphate saline; PFA, paraformaldehyde; PI3K, phosphoinositide 3-kinase; PTTH, Insulin/insulin-like growth factor signaling pathway (IIS) is well prothoracicotropic hormone; qRT-PCR, quantitative real time PCR; THs, thyroid conserved from yeast to humans (Barbieri et al., 2003), and plays hormones; WISH, whole mount in situ hybridization. ⁎ Corresponding author. important roles in diverse biological processes, such as growth, E-mail address: [email protected] (Y. Wang). energy metabolism, and development. IIS contains secreted ligands

(insulin-like peptides [ILPs]), tyrosine kinase receptors (insulin 2. Materials and methods receptor [InR], insulin-like growth factor receptor [IGFR]), and ligands binding proteins (insulin-like growth factor binding proteins 2.1. Spawning and larval culture [IGFBPs]). IIS regulates neuronal proliferation, survival, and neurite outgrowth (Lau and Chalasani, 2014). In Drosophila, IIS regulates Spawning of adult H. diversicolor and larval culture were carried out metamorphosis by controlling ecdysone production (Sarraf-Zadeh at Hongyun Aquaculture Co. Limited. On the night of a predicted et al., 2013). These reports suggest that IIS may also play a role in spawning event, brood stock were placed into individual spawning abalone metamorphosis. aquaria with UV-irradiated seawater and allowed to spawn freely. These secreted ligands of IIS transmit intercellular signals through Eggs were collected by 100-μm wet screens, and were back washed the activation of InR or IGFR, leading to the activation of protein kinase into a 1 L beaker and fertilized for 5 min with sperm collected from signaling pathways, such as phosphoinositide 3-kinase (PI3K), mitogen- male spawning aquaria. Fertilized eggs were thoroughly washed with activated protein kinases (MAPK), and p53 (Zhu et al., 2014). IGFBPs sand-ﬁltered seawater (FSW), and put in a 50 L tub. The upper 2/3 modulate the activity of IIS by binding to ILPs with high afﬁnity. IGFBPs seawater in tub was poured out, fresh seawater was poured in, and are a group of cysteine-rich proteins, which are primarily characterized every 1 h until trochophore larvae were hatched. Larvae were poured by the presence of an N-terminal IGFs binding (IB) domain. They were into a 200 L aquarium until they were used in RNAi assays. A brood of grouped together, and named IGFBP-superfamily (Kim et al., 1997; larvae were derived from gamete contributions from at least three Baxter et al., 1998; Hwa et al., 1999; Rosenfeld et al., 1999). males and three females. There are six broods of larvae from different IGFBP7 is also known as IGFBP-related protein-1 (IGFBP-rP1), parents. The samples of each brood were collected at different MAC25, and tumor-derived cell adhesion factor (TAF). It belongs to development stages. The samples were put into liquid nitrogen, or into the IGFBP-superfamily, which is involved in the regulation of IIS. 4% paraformaldehyde (PFA). After trochophore stage, larvae were added

Unlike IGFBP1-6, IGFBP7 binds IGFs with low affinity, but recognizes dropwise with MgCl2 saturated solution to paralyze muscles, before insulin with a high affinity, and thereby modifies its metabolism, being put into 4% PFA with 1× phosphate saline (PBS: 0.8% NaCl, distribution, and ability to bind to the insulin receptor (Yamanaka 0.02% Na2HPO4, pH 7.4). After 24 h, the samples in PFA were transferred et al., 1997). In vertebrate, IGFBP7 exits in a wide range of normal to methanol by gradual dehydration (25%, 50%, 75%, 95% and 100% tissues, as well as in biological fluids (Degeorges et al., 2000; methanol; 5 min per step). The samples in methanol were maintained Lopez-Bermejo et al., 2003). Its biological functions have been at −20 °C until use for in situ hybridization. focused on various cancers, and may become as a tumor suppressor gene through the induction of apoptosis and senescence (reviewed 2.2. Double-stranded RNA (dsRNA) generations by Zhu et al., 2014). There are few reports of invertebrate IGFBP7. Those reports mainly The fragment of saIGFBP7 (136 bp–819 bp of AEE01360.1) was come from Drosophila, Bombyx and Caenorhabditis. There is only one amplified by PCR using ds-FT7 and ds-R primers or using ds-F and IGFBP in Drosophila, Imp-L2 (Imaginal morphogenesis factor-late 2), ds-RT7 primers. A 657 bp fragment of the green fluorescent protein which is the homolog of vertebrate IGFBP7 (Honegger et al., 2008). (GFP) gene from the pEGFP-N1 vector was also amplified by PCR In situ hybridizations and immunohistochemistry revealed Imp-L2 using ds-c-FT7 and ds-c-R or using ds-c-F and ds-c-RT7. The sequences expression in the corpora cardiaca and prothoracic portions of the ring of primers are shown in Table 1. The italics at 5′ ends are T7 promoter gland, in enteroendocrine cells in the anterior midgut, and in distinct sequences. neurons in both brain hemispheres and the subesophageal ganglion After being purified and sequenced, the expected PCR products (Honegger et al., 2008; Sarraf-Zadeh et al., 2013). Imp-L2 is involved were used as templates to transcribe single-stranded RNA (ssRNA) in differentiation of adult-specific tissues (Honegger et al., 2008). The by T7 phage RNA polymerases (Promega, USA). The DNA templates Imp-L2 production by prothoracicotropic hormone (PTTH) expressing were then degraded by addition of DNase I (Promega, USA) at a ratio neurons regulates Drosophila metamorphosis by adjusting ecdysone of 1 U/μg of template. The transcripts were then purified by organic production (Sarraf-Zadeh et al., 2013). solvent extraction using standard methods. The sense and antisense There are two kinds of IGFBP7 homologs in B. mori (Ma and Zhang, cRNA strands were mixed in 400 mM NaCl–10 mM Tris–Cl (pH 7.4) 2010, Gao et al., 2012).The role of IGFBP7 in metamorphosis of B. mori and annealed by incubation at 75 °C for 15 min, at 65 °C for 15 min, has never been illuminated. There are 3 homologs of IGFBP7 in and at room temperature for 15 min. The formation of dsRNA was Caenorhabditis elegans. One of them was involved in development monitored by determining the size shift in agarose gel electrophoresis, (Khatibzadeh et al., 2009). We found a homolog of IGFBP7, saIGFBP7, and the concentration of dsRNA was measured by Ultrospec™ 2100 in small abalone H. diversicolor.ThesaIGFBP7 mRNA and protein pro spectrophotometer (Amersham Biosciences, Sweden). The dsRNA could be detected in all examined tissues, with the highest expression of saIGFBP7 was used to silence saIGFBP7. GFP dsRNA was used as level in hemocytes, higher expression level in gills, and was up- control. regulated in hemocytes and gills after bacterial injection (Li et al., 2012). Moreover, we found that overexpression of saIGFBP7 increased 2.3. dsRNA exposure assay the hemocyte density, as well as, silencing saIGFBP7 decreased the hemocyte density. This means that saIGFBP7 was involved in hemo- Larvae were collected by 100 μm screens, and washed with 0.2 μm cyte proliferation of abalone (Wang et al., 2015). This suggests that FSW, then transferred into 10 mL test tubes, until 80% larvae developed saIGFBP7 may also play a role in proliferation of adult tissues during eyespots (competent larvae). The saIGFBP7 dsRNA/GFP dsRNA was metamorphosis. added in a test tube and adjusted to a final concentration of 5 μg/mL. In this study we showed that saIGFBP7 mRNA and protein were The FSW with saIGFBP7 dsRNA/GFP dsRNA was regarded as RNAi firstly detected in trochophore stage, increased during swimming larvae group/negative control (NC) group. The FSW without any addition stage, reached a vertex in metamorphosis, and kept in juvenile stage. was regarded as blank control (BC) group. After 2 h, larvae were trans- The expression pattern was similar to Hemp, a novel epidermal growth ferred into a 1 L beaker covered by benthic diatom. 10 h after being factor like protein, which plays a central role in ascidian metamorphosis transferred in a beaker, larvae were collected. Approximately 50 larvae (Eri et al., 1999). Down-regulation of saIGFBP7 mRNA by RNAi signifi- were used to count the number of metamorphosed and dead larvae. cantly decreased metamorphosis rate. The analysis of saIGFBP7 function Then these larvae were treated by PFA as 2.1 descriptions for in situ hy- will enhance our understanding of metamorphosis, and contribute to bridization. Metamorphosed larvae lost their cilia and began formation abalone seed production. of the juvenile shell. Dead larvae were indicated by deterioration of the G. Wang et al. / Aquaculture 451 (2016) 377–384 379

Table 1 Oligonucleotide primers used in qRT-PCR and dsRNA generation.

Primer name Nucleotide sequence (5′-3′) Gene name Accession no. Purpose

ds-FT7 TAATACGACTCACTATAGGGGGATGAATACTCTATGGTTGGTCGCC saIGFBP7 AEE01360.1 dsRNA generation ds-F GGATGAATACTCTATGGTTGGTCGCC saIGFBP7 AEE01360.1 dsRNA generation ds-RT7 TAATACGACTCACTATAGGGTGGCGTAGTCCTTGCTTTCGGT saIGFBP7 AEE01360.1 dsRNA generation ds-R TGGCGTAGTCCTTGCTTTCGGT saIGFBP7 AEE01360.1 dsRNA generation ds-c-FT7 TAATACGACTCACTATAGGGCGACGTAAACGGCCACAAGT GFP pEGFP-N1 dsRNA generation ds-c-F CGACGTAAACGGCCACAAGT GFP pEGFP-N1 dsRNA generation ds-c-RT7 TAATACGACTCACTATAGGGTTCTTGTACAGCTCGTCCATGC GFP pEGFP-N1 dsRNA generation ds-c-R TTCTTGTACAGCTCGTCCATGC GFP pEGFP-N1 dsRNA generation IGFBP7-F AAGAACAACGAAAGCAAGGACTAC saIGFBP7 AEE01360.1 Target gene IGFBP7-R GACAGACAAACATACAGACGGAAAA saIGFBP7 AEE01360.1 Target gene PI3K-F TGCTGATGCATGTCTGTCAA PI3K KT198719 Target gene PI3K-R CGGGAAACTCTCAAACCAGA PI3K KT198719 Target gene ERKα-F TGCAGAGTTGGCTAATGCAG ERKα JU073048.1 Target gene ERKα-R CTACCTGTTGCCATGTGGTG ERKα JU073048.1 Target gene AKT-F TCGACAAGATGGGTCCTTTC AKT JU066157.1 Target gene AKT-R ATCCATTCCTCCCTTTCACC AKT JU066157.1 Target gene YB1-F AAGTTCTAGCAACGAGGGTCA YB1 JN997407 Reference gene YB1-R GGTATTTCTTTGGGTTGTTCTTC YB1 JN997407 Reference gene outer cuticle and inactivity (Bryan and Qian, 1998). The rest of the blocked with 3% BSA at 37 °C for 30 min, and transferred in 1:5000 larvae were put into liquid nitrogen for quantitative real time dilution of anti-DIG alkaline phosphatase conjugated fab fragment PCR (qRT-PCR) assay. The expression level of saIGFBP7 and three at 4 °C overnight. The larvae were washed and visualized by NBT/BCIP. downstream genes of IIS (PI3K, ERKa and AKT) were detected by qRT-PCR. There were six replicate beakers of each treatment group 3. Results (dsRNA group, BC group and NC group). The metamorphosis rate and mortality rate were checked for normality and homogeneity 3.1. The temporal and spatial expressions of saIGFBP7 during development and then analyzed with a one-way ANOVA utilizing a post-hoc Fisher's LSD test to compare difference among various treatments. The temporal expression of IGFBP7 during development was analyzed using qRT-PCR. The relative expression level of saIGFBP7 to 2.4. Insulin inducing assay YB1 is showed in Fig. 1. There was almost no expression before trochophore larva. The expression of saIGFBP7 rapidly increased Competent larvae were tested for metamorphic responses to insulin. from trochophore larva stage to competent larva stage. There was A stock solution of insulin was prepared in FSW at a concentration of signiﬁcant difference between trochophore larva stage and veliger 100 μmol/L. Serial dilutions of insulin with FSW were prepared to larva (p b 0.0001, F = 50.48). The top expression level was at competent assay concentrations of 10, 1 and 0.1 μmol/L. The FSW without insulin larva stage, post-larva, and juvenile abalone. was regarded as blank control (0 μmol/L insulin). Larvae collected WISH of H. diversicolor larvae revealed that IGFBP7 transcripts were by screen were put into 1 L beaker covered by benthic diatom with localized in the velum and foot ( Fig. 2). The positive signal was ﬁrst different insulin concentration. After 12 h, larvae were collected for detected in a cluster of cells near apical tuft of cilia at early trochophore metamorphosis rate counting. There were six replicate beakers of each larva stage (Fig. 2 A). Then dense staining was observed in the whole insulin concentration (10, 1, 0.1 and 0 μmol/L). The sample collection velum, especially above the stomodeum, at later trochophore larva of qRT-PCR, whole mount in situ hybridization (WISH) and data analysis stage (Fig. 2 B). Despite extensive changes in the external character of were similar to dsRNA exposure assay. the larva, the expression location of saIGFBP7 appeared to have changed little between the trochophore stage and early veliger stage (Fig. 2 B 2.5. qRT-PCR and C). saIGFBP7 expression remained restricted to the region of the velum at the early veliger larva (Fig. 2 C). At middle veliger stage, The samples from liquid nitrogen were added 1 mL TRIZOL Reagent there appeared another positive signal in a cluster of cells in the foot (Invitrogen, USA). Total RNA was extracted from the samples, and cDNA (Fig. 2 D). Moreover, staining in the velum was concentrated to the was synthesized by M-MLV reverse transcriptase (Promega, USA). qRT- PCR was carried out with SYBR Green. The details of these processes were carried out according to our previous report (Li et al., 2012). The genes and primers used in qRT-PCR were listed in Table 1.

2.6. WISH

DIG-labeled RNA probe of IGFBP7 was synthesized as previously described (Li et al., 2012). The samples in methanol were gradually rehydrated to PBS in 2.0 mL tubes, and treated with 1 μg/mL of protein- ase K in PBST (0.3% TritonX-100 in PBS) for 30 min at 37 °C. After washed twice with PBS, the larvae of a sample were post-ﬁxed for 10 min in 4% PFA, and then pre-hybridized for 30 min at 65 °C. The larvae were halved to two 0.5 mL tubes. One of tubes was hybridized Fig. 1. The expression of saIGFBP7 in different development stages. YB1 (Y-box protein 1 overnight at 65 °C with antisense probes (1 mg/mL). The other tube gene, accession No. JN997407) served as reference gene. Each bar represents the mean value from six samples (n = 6) with the standard error (SE). Data (mean ± SE) with was done with sense probes (1 mg/mL). After hybridization, the larvae different lowercase signiﬁcantly differ (p b 0.05) during development stages. 2C, two were washed three times, once at with 4× SSC at 65 °C for 1 h and twice cells; MO, morula; GA, gastrula; TR, trochophore (15 hpf); VE, late veliger (48 hpf); with 2× SSC at room temperature for 15 min. Then the larvae were Competent larva (72 hpf); Post-larva (84 hpf); JU, juvenile abalone (3 dpm). 380 G. Wang et al. / Aquaculture 451 (2016) 377–384

Fig. 2. Spatial expression of saIGFBP7 gene in H. diversicolor swimming larvae. A–E, which were hybridized by antisense probes, are early trochophore larva (12 hpf), later trochophore larva (15 hpf), early veliger larva (18 hpf), middle veliger larva (21 hpf), later veliger larva (48 hpf), respectively. F–J are controls of A–E, which were hybridized by sense probes. v, velum (prototroch); s, shell; f, foot or foot anlage; st, stomodeum; vm, visceral mass. Scale bar, 50 μm. retral velum at the middle and later veliger stages (Fig. 2 DandE).The F = 389.05, Fig. 3 A). The metamorphosis rate of saIGFBP7 dsRNA staining in the foot was more intense and spread from middle veliger exposure group was significantly decreased as compared with stage to competent veliger stage (Figs. 2 D–EandFig. 5 A-BC). However, thatofNCgroup(p=4.4×10−10, F = 132.00) or BC group (p = the staining in the velum became thinner from later veliger stage to 4.8 × 10−10, F = 540.87, Fig. 3 A). There was no significant difference competent veliger stage (Fig. 2 EandFig. 5 A-BC), eventually completely of metamorphosis rate between NC and BC group (p = 0.07, F = disappeared at competent veliger stage (Fig. 5 A-BC). Hybridization 4.07, Fig. 3 A). Mortality rate of different treatment groups was also with a corresponding sense probe yielded no signals (Fig. 2 F–J). significantly different (p = 0.0075, F = 6.90, Fig. 3 B). The mortality of saIGFBP7 dsRNA exposure group was significantly higher than that 3.2. Effect of dsRNA exposure on metamorphosis rate, saIGFBP7 expression, of BC group (p = 0.097, F = 3.34, Fig. 3 B), but there was no signifi- and IIS cant difference of mortality rate between dsRNA group and NC group (p = 0.0006, F = 24.68, Fig. 3 B). There were significant difference of metamorphosis rate in differ- The results of qRT-PCR showed that saIGFBP7 mRNA level of ent treatment groups of dsRNA exposure assay (p = 2.50 × 10−10, dsRNA exposure group was significantly lower than that of BC (p = 1.44 × 10−7, F = 290.02) and NC group (p = 4.54 × 10−6, F = 118.12, Fig. 4). WISH showed that staining in the foot of dsRNA exposure larva was almost disappeared (Fig. 5 A-RNAi) at competent veliger larvae stage. The size/density of staining in dsRNA exposure group was smaller/lighter than that of NC and BC group (Fig. 5). In order to determine whether dsRNA exposure would influence IIS, three downstream genes expression of IIS (PI3K, ERKα and AKT)was detected by qRT-PCR. The results showed that the three genes expression levels of dsRNA group were significantly lower than that of BC and NC group (p b 0.05, Fig. 5).

Fig. 4. The relative expression of saIGFBP7, PI3K, ERKα and AKT. YB1 served as reference gene. Each bar represents the mean value from six samples (n = 6) with the standard Fig. 3. The metamorphosis rate (A) and mortality rate (B) of larvae after dsRNA exposure. error (SE). Data (mean ± SE) with different lowercase signiﬁcantly differ (p b 0.05) in Each bar represents the mean value from six samples (n = 6) with the standard error (SE). treatments. Blank control (BC), FSW without any addition; GFP dsRNA, negative control Data (mean ± SE) with different lowercase signiﬁcantly differ (p b 0.05) in treatments. (NC), FSW with 5 μg/mL GFP dsRNA; IGFBP7 dsRNA, FSW with 5 μg/mL saIGFBP7 dsRNA. G. Wang et al. / Aquaculture 451 (2016) 377–384 381

Fig. 5. Spatial expression of saIGFBP7 gene in H. diversicolor after exposure. A shows the expression of saIGFBP7 gene at 2 h post treatments (competent larva, 74 hpf). B shows the expression of saIGFBP7 gene at 12 h post treatments (post-larva, 84 hpf). The main expression location was the foot, but the expression level of BC and NC was higher than that of RNAi. NC, negative control, FSW with 5 μg/mL GFP dsRNA; RNAi, FSW with 5 μg/mL IGFBP-rP1 dsRNA. f, foot; vm, visceral mass; es, eyespot. Scale bar, 50 μm.

3.3. Effect of insulin inducing on metamorphosis rate, downstream genes expression level of saIGFBP7, PI3K and ERKα after different concentra- expression of IIS tions of insulin inducing (p N 0.05). However, the AKT expression of 0.1 μmol/L insulin induced group was significantly higher than that of Insulin had no significant effect on metamorphosis rate (p = 0.97, other concentrations (p = 3.41 × 10−7,F=26.68,Fig. 6 B). F=0.071,Fig. 6 A). PI3K, ERKα and AKT were also detected by qRT- PCR in insulin inducing assay. There were no significant difference in 4. Discussions

Although past studies have contributed to our understanding of the basic underpinnings of the morphological, ecological and behavioral patterns of larval settlement, the molecular mechanisms that regulate larval attachment and metamorphosis are still poorly understood (Chandramouli et al., 2014). Hence, high throughput ways (such as microarray, transcriptome and proteomics) have been used to discover gene or protein expression patterns in different larval stages of marine invertebrates (reviewed by Chandramouli et al., 2014). By comparing gene expression profiles from cDNA microarrays, 144 genes were iden- tified as candidates for a role in competence and/or metamorphosis of H. diversicolor (Williams et al., 2009). Metabolism was the most in func- tional distribution of all 144 differentially expressed genes (Williams et al., 2009), which were consistent with an increased metabolic cost associated with metamorphosis of H. rufescens (Shilling et al., 1996). The biochemical compositions of three species of abalone (H. fulgens, H. sorenseni and H. rufescens) are similar, with protein and lipid being the dominant macromolecules (Jaeckle and Manahan, 1989). Lipids are generally considered to be more important than protein and carbo- hydrates for fueling development in marine invertebrate larvae (Moran and Manahan, 2003). Lipids are a major source of endogenous energy during abalone larval development, which is consistent with the larval energetics of other marine molluscs (Moran and Manahan, 2003). IIS is involved in the regulation of lipid metabolism in both vertebrates and invertebrates (Saltiel and Kahn, 2001; Teleman, 2010). This is Fig. 6. Metamorphosis rate and genes' expression in the presence of different concentra- probably because multicellular organisms need to regulate their tion mammal insulin. Each bar represents the mean value from six samples (n = 6) with the standard error (SE). The bars with same lowercase have no significant difference response to varying nutrient conditions early in evolutionary history (p N 0.05). The bars with different lowercase significantly differ (p b 0.05). (Teleman, 2010). Metabolic regulation is inherently a complex system, 382 G. Wang et al. / Aquaculture 451 (2016) 377–384 designed to maintain homoeostasis in a robust way (Teleman, 2010).The saIGFBP7 appeared in the foot anlage at middle veliger larva stage, energy store in the form of lipids is probably similar in animals. and then the foot began to develop (Fig. 2 D). After metamorphosis, Most of the nutrient sensing in Drosophila takes place via IIS pathway the whole expression of saIGFBP7 was concentrated in the foot (Fig. 5 (Teleman, 2010). Imp-L2, a homolog of vertebrate IGFBP7, works B-BC). The spatial expression pattern of saIGFBP7 was related to cellular as a negative regulator of IIS activity by binding Dilp-2 (Drosophila proliferation and differentiation in the velum and food of larva. insulin-like peptide) and Dilp-5 (Alic et al., 2011; Honegger et al., According to temporal expression pattern, candidate genes in meta- 2008). Imp-L2 is an important component of IIS in Drosophila, and is morphosis of H. asinina were grouped into five clusters by Williams et al. involved in metabolic regulation of Drosophila. For example, Imp-L2 is (2009). The temporal expression pattern of saIGFBP7 is similar to cluster essential for the endurance of periods of starvation in Drosophila set A, which has a notably more rapid rise in expression at metamor- (Teleman, 2010). Imp-L2-expressing neurons sense the nutritional phosis, and includes the highest number of calcium ion binding prostate of Drosophila larvae and coordinate dietary information and teins, transcription factors and chymotrypsin (Williams et al., 2009). ecdysone production to adjust developmental timing under starvation Williams et al. (2009) predicted that genes of cluster set A were likely conditions (Sarraf-Zadeh et al., 2013). Imp-L2 mutant animals are not involved in the pre-emptive creation of juvenile structures in anticipa- able to reduce their insulin signaling in peripheral tissues such as tion of metamorphosis. The creation of juvenile structures needs cell body fat, leading to increased mortality (Teleman, 2010). Increased proliferation and differentiation. The temporal expression pattern of expression of Imp-L2 in adult Drosophila results in increase in storage saIGFBP7 also suggests that saIGFBP7 is related to cellular proliferation lipids, reduced fecundity, and enhances oxidative stress resistance and differentiation of the foot. and extension of lifespan (Sarraf-Zadeh et al., 2013). Imp-L2 prevents Previous studies have provided evidence that the foot of gastropod IIS-dependent nutrient utilization and prolongs the lifespan of lar- veliger larvae plays a significant role in the induction of metamorphosis, vae during starvation in Drosophila,aswellasinCaenorhabditis as it is a potential source of both chemo- and mechano-receptors (Ueda (Khatibzadeh et al., 2009). and Degnan, 2014). In H. asinina, the localization of Has-tft1 and HasNOS, Energy for larval development and metamorphosis of abalone is which is thought to be involved in the recognition of inductive cues, provided by maternally endowed yolk. After the completion of was detected in the anterior part of the larval foot in competent larvae metamorphosis, post-larvae of abalone commence particle feeding (Jackson et al., 2005; Ueda and Degnan, 2014). The development with radula. Within 2 days of the initiation of abalone metamorpho- of the foot as chemo- and mechano-receptors depends on cellular sis the mouth opens and feeding begins. If suitable diatoms are avail- proliferation and differentiation. saIGFBP7 might play a role in this able, they can be eaten from the second day after metamorphosis cellular process. induction (Roberts et al., 2001). During the first days of feeding, The studies on IGFBP7 modulating cellular proliferation are focused post-larvae still have a visible yolk, and initial growth is still supported on cancer cells. In some kinds of cancer, IGFBP7 works as a suppresser. by the yolk supply in addition to particle feeding. The critical period of In some kinds of cancer, IGFBP7 increases proliferation of cancer cells. mortality occurs in metamorphosis, coinciding with the transition The details were summarized by Zhu et al. (2014). The biological from lecithotrophy to particle feeding. After metamorphosis, the rapidly function and expression of IGFBP7 seems to be diversified and differ- increasing food consumption may begin to exceed supply, leading to ent in cell types or host environments (Jiang et al., 2008), because food shortages (Roberts et al., 2001). The higher expression of saIGFBP7 IGFBPs modulate cellular proliferation or apoptosis not only by an at competent larvae stage could more economically use energy store IGF-dependent mechanism but also by an IGF-independent mechanism and leave more energy to post-larvae. The yolk supply is very important (Hwa et al., 1999). Our results suggested that saIGFBP7 was involved in for post-larvae survival, because the energy source of post-larvae is cell proliferation and differentiation of the velum and foot. This is con- gradually transferred from yolk supply to particulate food after meta- sistent with our previous paper, which showed that IGFBP7 could pro- morphosis (Takami et al., 2000). It takes about ten days to perfect the mote hemocytes proliferation of H. diversicolor by exposure dsRNA digestive system of post-larvae (Takami et al., 2000). The decreases of and cap mRNA of saIGFBP7 (Wang et al., 2015). saIGFBP7, by exposing dsRNA, may increase unnecessary energy expen- IGFBP7 binds to insulin, IGF-1 and IGF-2; however, its affinity diture, such as more long time swimming and searching for appropriate for IGF-1 is more than 100-fold lower than that of IGFBP1 to IGFBP6 habitat for settlement. When we observed the larvae behavior of IGFBP7 (Hwa et al., 1998; Oh et al., 1996). Studies have suggested that it blocks dsRNA exposure group with microscope, we found that the larvae had insulin receptor activation by binding to insulin (Yamanaka et al., 1997) higher ciliary beating frequency, and swam more time than NC and BC or that it functions in an IGF- and insulin-independent manner (Sato group. The extra energy expenditure might lead to higher mortality et al., 2007). and lower metamorphosis rate. In Drosophila, decreased IIS delayed metamorphosis (Rulifson et al., During the metamorphosis, abalone larvae shed the velum, enlarged 2002), and increased IIS was sufficient to advance metamorphosis the gills and foot, and started peristomal shell formation. These differen- even in the absence of direct changes to other hormone systems tiations of juvenile/adult structures and the degeneration of larval (Walkiewicz and Stern, 2009). These results suggested that IIS is a structures are important components of metamorphosis (Heyland and rate-limiting step for metamorphosis (Walkiewicz and Stern, 2009). Moroz, 2006; Bishop et al., 2006). The two components are closely Increasing Imp-L2 expression at its endogenous sites delays pupariation related to cell differentiation and apoptosis. Many reports showed that (Sarraf-Zadeh et al., 2013). However our results showed that decreasing IGFBP7 had low expression in some cancers (Hwa et al., 1998; Ruan saIGFBP7 expression decreases metamorphosis rate of abalone larvae. et al., 2007) and could inhibit cell growth and induce apoptosis in This seems to be opposite to studies in Drosophila. However, the expres- colorectal adenocarcinoma cell lines (Ruan et al., 2007). However cell sion of downstream genes, PI3K, ERKα and AKT decreased in dsRNA ex- proliferation was suppressed after IGFBP7 overexpression was inhibited posure experiment as well. This suggested that saIGFBP7 does not work in glioma cell (Jiang et al., 2008). This means that the biological function as a negative regulator of IIS activity, or plays its role in an IGF- and of IGFBP7 seems to be diversified and to be different in cell types (Jiang insulin-independent manner during metamorphosis of abalone larvae. et al., 2008). In addition, the expression of PI3K, ERKα and AKT is not always equal The result of WISH revealed that the saIGFBP7 expression level was to the activity of their proteins. There needs more work to demonstrate related to the velum and foot development. When the velum was the relation between saIGFBP7 with PI3K, ERKα and AKT. newly formed at later trochophore and early veliger larva stage, Insulin-related peptides could work as general growth promoting saIGFBP7 expression level was high in the velum (Fig. 2 B and C). factors in molluscs. For example, porcine insulin increased the incorpo- There was almost no any saIGFBP7 expression in the velum, when the ration of amino acids in the mantle of Helisoma (Sevala et al., 1993)and velum degenerated at competent larvae stage (Fig. 5 A-BC). Meanwhile, Pecten maximus (Giard et al., 1998) in vitro. Primary hemocytes of G. Wang et al. / Aquaculture 451 (2016) 377–384 383 abalone H. tuberculata showed protein and DNA syntheses in response insulin signaling in Drosophila and is essential for starvation resistance. J. Biol. 7 (10), 179–192. to vertebrate insulin (Lebel et al., 1996). In addition, IGF-I elicited a Hwa, V., Tomasini-Sprenger, C., Bermejo, A.L., Rosenfeld, R.G., Plymate, S.R., 1998. significant stimulation of collagen synthesis in culture hemocytes of Characterization of insulin-like growth factor-binding protein-related protein-1 in abalone H. tuberculata (Serpentini et al., 2000). However, insulin has prostate cells. J. Clin. Endocrinol. Metab. 83, 4355–4362. α Hwa, V., Oh, Y., Rosenfeld, R.G., 1999. Insulin-like growth factor binding proteins: no effect on metamorphosis. Moreover, PI3K and ERK , two primary a proposed superfamily. Acta Paediatr. Suppl. 88, 37–45. downstream genes expression of IIS, were not different in expression Jackson, D.J., Ellemor, N., Degnan, B.M., 2005. Correlating gene expression with larval level after insulin inducing. These results suggested that mammal competence, and the effect of age and parent age on metamorphosis in the tropical – insulin might not be an important factor to abalone metamorphosis. abalone Haliotis asinina. Mar. Biol. 147, 681 697. Jaeckle, W.B., Manahan, D.T., 1989. Growth and energy imbalance during the Metamorphosis is a complicated process, in which many signal development of a lecithotrophic molluscan larva (Haliotis rufescens). Biol. pathways are involved. For example, Drosophila metamorphosis is Bull. 177, 237–246. directly induced by a pulse of the steroid hormone ecdysone (Marchal Jiang,W.,Xiang,C.,Cazacu,S.,Brodie,C.,Mikkelsen,T.,2008.Insulin-like growth factor binding protein 7 mediates glioma cell growth and migration. Neoplasia 10, et al., 2010). IIS, target of rapamycin and PTTH pathways, also play im- 1335–1342. portant roles in metamorphosis by controlling ecdysone production Khatibzadeh, S.M., Boisclair, Y., Lee, S.S., 2009. Investigating Insulin-Like Peptide (Walkiewicz and Stern, 2009; Sarraf-Zadeh et al., 2013). There are so Signaling-Dependent Stress Resistance in Caenorhabditis elegans: Possible Modulation Through an Imp-L2-Like Binding Protein. Honors Thesis Presented to the College of many kinds of chemical and biological materials as useful inducer for Agriculture and Life Sciences. metamorphosis of various abalone larvae, and their effects or effective Kim, H.S., Nagalla, S.R., Oh, Y., Wilson, E., Roberts, C.T., Rosenfeld, R.G., 1997. Identification concentrations are significantly controversial (Roberts, 2001). This sug- of a family of low-affinity insulin-like growth factor binding proteins (IGFBPs): characterization of connective tissue growth factor as a member of the IGFBP gests that there are other pathways involving abalone metamorphosis. superfamily. Proc. Natl. Acad. Sci. U. S. A. 94, 12981–12986. Researchers have been trying to promote high production of abalone Lau, H.E., Chalasani, S.H., 2014. Divergent and convergent roles for insulin-like peptides in in mass culture in many countries since the late 1970's due to the worm, fly and mammalian nervous systems. Invert. Neurosci. 1-8. fi Lebel, J., Giard, W., Favrel, P., Boucaud-Camou, E., 1996. Effects of different vertebrate over shing of natural stocks of abalone and the high demand for growth factors on primary cultures of hemocytes from the gastropod mollusc, Haliotis abalone. The critical step to success is the high metamorphosis tuberculata. Biol. Cell 86 (1), 67–72. rates at the initial stage, as a large amount of larvae often die in the Li, H., Lin, W., Zhang, G., Cai, Z., Cai, G., Chang, Y., Xing, K., 2006. Enhancement of larval mass culture (Zhang et al., 2008). We found that saIGFBP7 was involved settlement and metamorphosis through biological and chemical cues in the abalone Haliotis diversicolor supertexta.Aquaculture258(1),416–423. in abalone metamorphosis. Up-regulated expression of saIGFBP7 may Li, N., Zhang, Z.P., Zhang, L.L., Wang, S.H., Zou, Z.H., Wang, G.D., Wang, Y.L., 2012. increase metamorphosis rate. This will contribute to promoting high Insulin-like growth factor binding protein 7, a member of insulin-like growth factor production of abalone in mass culture. However the mechanism of signal pathway, involved in immune response of small abalone Haliotis diversicolor. Fish Shellfish Immunol. 33 (2), 229–242. saIGFBP7 in abalone metamorphosis needs more study. Lopez-Bermejo, A., Khosravi, J., Corless, C.L., Krishna, R.G., Diamandi, A., Bodani, U., Kofoed, E.M., Graham, D.L., Hwa, V., Rosenfeld, R.G., 2003. Generation of anti-insulin-like Acknowledgments growth factor-binding protein-related protein 1 (IGFBP-rP1/MAC25) monoclonal antibodies and immunoassay: quantification of IGFBP-rP1 in human serumand distribution in human fluids and tissues. J. Clin. Endocrinol. Metab. 88 (7), 3401–3408. The work was supported by the National Natural Science Foundation Ma, L., Zhang, Y.Z., 2010. Expression Analysis and Subcellular Localization of BmIBP From of China (No. 41006105, 41176152), the Natural Science Foundation of Silkworm Pupa, Bombyx mori. Zhejiang Sci-Tech University (master's thesis). Marchal, E., Vandersmissen, H.P., Badisco, L., Van de Velde, S., Verlinden, H., Iga, M., Van Fujian Province (No. 2015 J01142), the Program for Outstanding Young Wielendaele, P., Huybrechts, R., Simonet, G., Smagghe, G., Vanden Broeck, J., 2010. Scientists in Fujian Province University (No. JA12183), and the Innova- Control of ecdysteroidogenesis in prothoracic glands of insects: a review. Peptides tion Team Foundation of Jimei University (No. 2010A001). 31, 506–519. Moran, A.L., Manahan, D.T., 2003. Energy metabolism during larval development of green and white abalone, Haliotis fulgens and H. sorenseni. Biol. Bull. 204 (3), 270–277. References Morse, A.N.C., Morse, D.E., 1984. Recruitment and metamorphosis of Haliotis larvae induced by molecules uniquely available at the surfaces of crustose red algae. Alic, N., Hoddinott, M.P., Vinti, G., Partridge, L., 2011. Lifespan extension by increased J. Exp. Mar. Biol. Ecol. 75 (3), 191–215. expression of the drosophila homologue of the igfbp7 tumour suppressor. Aging Morse, D.E., Hooker, N., Duncan, H., Jensen, L., 1979. γ-Aminobutyric acid, a neurotrans- Cell 10 (1), 137–147. mitter, induces planktonic abalone larvae to settle and begin metamorphosis. Science Barbieri, M., Bonafè, M., Franceschi, C., Paolisso, G., 2003. Insulin/IGF-I-signaling pathway: 204 (4391), 407–410. an evolutionarily conserved mechanism of longevity from yeast to humans. Am. Oh, Y., Nagalla, S.R., Yamanaka, Y., 1996. Synthesis and characterization of insulin-like J. Physiol. Endocrinol. Metab. 285 (5), E1064–E1071. growth factor-binding protein (IGFBP)-7 recombinant human mac25 protein Baxter, R.C., Binoux, M., Clemmons, D.R., Conover, C., Drop, S.L., Holly, J.M., Oh, Y., specifically binds IGF-I and -II. J. Biol. Chem. 271, 30322–30325. Rosenfeld, R.G., 1998. Recommendations for nomenclature of the insulin-like growth Roberts, R., 2001. A review of settlement cues for larval abalone (Haliotis spp.). J. Shellfish factor binding protein (IGFBP) superfamily. Growth Horm. IGF Res. 8, 273–274. Res. 20 (2), 571–586. Bishop, C.D., Erezyilmaz, D.F., Flatt, T., Georgiou, C.D., Hadfield, M.G., Heyland, A., Hodin, J., Roberts, R.D., Lapworth, C., Barker, R.J., 2001. Effect of starvation on the growth and Jacobs, M.W., Maslakova, S.A., Pires, A., Reitzel, A.M., Santaqata, S., Tanaka, K., Youson, survival of post-larval abalone (Haliotis iris). Aquaculture 200 (3), 323–338. J.H., 2006. What is metamorphosis? Integr. Comp. Biol. 46 (6), 655–661. Rosenfeld, R.G., Hwa, V., Wilson, L., et al., 1999. The insulin-like growth factor binding Bryan, P.J., Qian, P.Y., 1998. Induction of larval attachment and metamorphosis in the protein superfamily: new perspectives. Pediatrics 104, 1018–1021. abalone Haliotis diversicolor (Reeve). J. Exp. Mar. Biol. Ecol. 223 (1), 39–51. Ruan, W., Xu, E., Xu, F., Ma, Y., Deng, H., Huang, Q., Lv, B., Hu, H., Lin, J., Cui, J., Di, M., Dong, Chandramouli, K.H., Qian, P.Y., Ravasi, T., 2014. Proteomics insights: proteins related to J., Lai, M., 2007. IGFBP7 plays a potential tumor suppressor role in colorectal larval attachment and metamorphosis of marine invertebrates. Front. Mar. Sci. carcinogenesis. Cancer Biol. Ther. 6, 354–359. http://dx.doi.org/10.3389/fmars.2014.00052. Rulifson, E.J., Kim, S.K., Nusse, R., 2002. Ablation of insulin-producing neurons in flies: Degeorges, A., Wang, F., Frierson, H.F., Seth, A., Sikes, R.A., 2000. Distribution of IGFBP-rP1 growth and diabetic phenotypes. Science 296 (5570), 1118–1120. in normal human tissues. J. Histochem. Cytochem. 48 (6), 747–754. Saltiel, A.R., Kahn, C.R., 2001. Insulin signaling and the regulation of glucose and lipid Eri, R., Arnold, J.M., Hinman, V.F., Green, K.M., Jones, M.K., Degnan, B.M., Lavin, M.F., 1999. metabolism. Nature 414, 799–806. Hemps, a novel EGF-like protein, plays a central role in ascidian metamorphosis. Sarraf-Zadeh, L., Christen, S., Sauer, U., Cognigni, P., Miguel-Aliaga, I., Stocker, H., Development 126 (24), 5809–5818. Köhler, K., Hafen, E., 2013. Local requirement of the Drosophila insulin binding Fukazawa, H., Hirai, H., Hori, H., Roberts, R.D., Nukaya, H., Ishida, H., Tsuji, K., 2001. proteinimp-L2incoordinating developmental progression with nutritional Induction of abalone larval metamorphosis by thyroid hormones. Fish. Sci. 67 conditions. Dev. Biol. 381 (1), 97–106. (5), 985–988. Sato, Y., Chen, Z., Miyazaki, K., 2007. Strong suppression of tumor growth by insulin-like Gao, K., Deng, X.Y., Qian, H.Y., Wu, P., Qin, G.X., Liu, T., Shen, Z.Y., Guo, X.J., 2012. Novel growth factor-binding protein-related protein 1/tumor-derived cell adhesion protein of IBP from silkworm, Bombyx mori, involved in cytoplasmic polyhedrosis factor/mac25. Cancer Sci. 98, 1055–1063. virus infection. J. Invertebr. Pathol. 110 (1), 83–91. Serpentini, A., Ghayor, C., Poncet, J.M., Hebert, V., Galera, P., Pujol, J.M., Boucaud-Camou, E., Giard, W., Lebel, J.M., Boucaud-Camou, E., Favrel, P., 1998. Effects of vertebrate growth Lebel, J.M., 2000. Collagen study and regulation of the de novo synthesis by IGF-I factors on digestive gland cells from the mollusc Pecten maximus L.:aninvitro in hemocytes from the gastropod mollusc, Haliotis tuberculata.J.Exp.Zool.287 study. J. Comp. Physiol. B 168 (2), 81–86. (4), 275–284. Heyland, A., Moroz, L.L., 2006. Signaling mechanisms underlying metamorphic transitions Sevala, V.M., Sevala, V.L., Saleuddin, A.S.M., 1993. Hemolymph insulin-like peptides in animals. Integr. Comp. Biol. 46 (6), 743–759. (ILP)titersandtheinfluence of ILP and mammalian insulin on the amino acid Honegger, B., Galic, M., Köhler, K., Wittwer, F., Brogiolo, W., Hafen, E., Hugo, S., 2008. incorporation in the mantle collar in vitro in Helisoma (Mollusca). Biol. Bull. Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts 185 (1), 140–148. 384 G. Wang et al. / Aquaculture 451 (2016) 377–384

Shilling, F.M., Hoegh-Guldberg, O., Manahan, D.T., 1996. Sources of energy for Wang, G.D., Li, N., Zhang, L.L., Zhang, L.H., Zhang, Z.P., Wang, Y.L., 2015. IGFBP7 promotes increased metabolic demand during metamorphosis of the abalone Haliotis hemocytes proliferation in small abalone Haliotis diversicolor,provedbydsRNAand rufescens (Mollusca). Biol. Bull. 191 (3), 402–412. cap mRNA exposure. Gene 571, 65–70. Takami, H., Kawamura, T., Yamashita, Y., 2000. Starvation tolerance of newly Williams, E.A., Degnan, B.M., Gunter, H., Jackson, D.J., Woodcroft, B.J., Degnan, S.M., 2009. metamorphosed abalone Haliotis discus hannai. Fish. Sci. 66 (6), 1180–1182. Widespread transcriptional changes pre-empt the critical pelagic–benthic transition Teleman, A., 2010. Molecular mechanisms of metabolic regulation by insulin in Drosophila. in the vetigastropod Haliotis asinina. Mol. Ecol. 18 (5), 1006–1025. Biochem. J. 425, 13–26. Yamanaka, Y., Wilson, E.M., Rosenfeld, R.G., Oh, Y., 1997. Inhibition of insulin receptor Ueda, N., Degnan, S.M., 2014. Nitric oxide is not a negative regulator of metamorphic activation by insulin-like growth factor binding proteins. J. Biol. Chem. 272, induction in the abalone Haliotis asinina. Front. Mar. Sci. http://dx.doi.org/10.3389/ 30729–30734. fmars.2014.00021. Zhang, X., Yang, Z., Cai, Z., 2008. Thehydrogenperoxideimpactonlarvalsettlementand Walkiewicz, M.A., Stern, M., 2009. Increased insulin/insulin growth factor signaling metamorphosis of abalone Haliotis diversicolor supertexta. Chinese J. Oceanol. Limnol. advances the onset of metamorphosis in Drosophila. PLoS One 4 (4), e5072. 26 (3), 238–241. Wang, X., Bai, Y., Huang, B., 2010. Effectsofchemicalcuesonlarvalsurvival,settlementand Zhu,S.,Xu,F.,Zhang,J.,Ruan,W.,Lai,M.,2014.Insulin-like growth factor binding metamorphosis of abalone Haliotis asinina. Chinese J. Oceanol. Limnol. 28, 1261–1265. protein-related protein 1 and cancer. Clin. Chim. Acta 431, 23–32.