Nuclear Receptors As Regulators of Pituitary Corticotroph Pro-Opiomelanocortin Transcription

Total Page:16

File Type:pdf, Size:1020Kb

Nuclear Receptors As Regulators of Pituitary Corticotroph Pro-Opiomelanocortin Transcription cells Review Nuclear Receptors as Regulators of Pituitary Corticotroph Pro-Opiomelanocortin Transcription Dongyun Zhang 1 and Anthony P. Heaney 1,2,* 1 Department of Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA 90095, USA; [email protected] 2 Department of Neurosurgery, David Geffen School of Medicine, University of California, Los Angeles, CA 90095, USA * Correspondence: [email protected]; Tel.: +1-310-267-4980; Fax: +1-310-267-1899 Received: 22 February 2020; Accepted: 1 April 2020; Published: 7 April 2020 Abstract: The hypothalamic–pituitary–adrenal (HPA) axis plays a critical role in adaptive stress responses and maintaining organism homeostasis. The pituitary corticotroph is the central player in the HPA axis and is regulated by a plethora of hormonal and stress related factors that synergistically interact to activate and temper pro-opiomelanocortin (POMC) transcription, to either increase or decrease adrenocorticotropic hormone (ACTH) production and secretion as needed. Nuclear receptors are a family of highly conserved transcription factors that can also be induced by various physiologic signals, and they mediate their responses via multiple targets to regulate metabolism and homeostasis. In this review, we summarize the modulatory roles of nuclear receptors on pituitary corticotroph cell POMC transcription, describe the unique and complex role these factors play in hypothalamic–pituitary–adrenal axis (HPA) regulation and discuss potential therapeutic targets in disease states. Keywords: adrenocorticotropic hormone; corticotroph; glucocorticoids; hypothalamic–pituitary–adrenal axis; nuclear receptor; pro-opiomelanocortin 1. Introduction The pituitary gland serves as a critical anatomical and functional connection between central and multiple peripheral endocrine organs (Figure1A). It comprises two embryonically distinct components, namely the anterior pituitary (AP) that originates from the non-neural oral ectoderm and makes up ~2/3 of the gland, and the posterior pituitary (PP) which develops from the anterior neural plate [1]. Communicating between the hypothalamus, and the adrenal, thyroid, liver, gonads and the anterior pituitary interprets fluctuating levels of neuropeptides and steroid hormones from the hypophyseal portal veins and the circulating bloodstream to coordinate production and release of six bioactive pituitary-derived peptide hormones, namely adrenocorticotropic hormone (ACTH), thyroid-stimulating hormone (TSH), follicle-stimulating hormone (FSH), luteinizing hormone (LH), growth hormone (GH), and prolactin (PRL). In contrast, the posterior pituitary is a direct extension of the hypothalamic magnocellular neurons (MN) of the paraventricular and supraoptic nuclei (PVN and SON) which travel downward along the pituitary stalk (Figure1B). It stores and releases arginine vasopressin hormone (AVP) and oxytocin (OXT) which maintain water balance and regulate parturition and breast milk release respectively. Arguably, the most critical component of this three-tier system is the hypothalamic–pituitary– adrenal (HPA) axis which plays a vital role in adaptive stress responses and maintaining organism homeostasis. The hypothalamic neurons in the medial parvocellular (MP) subdivision of the PVN synthesize and secrete corticotropin-releasing hormone (CRH), which travels through the hypophyseal Cells 2020, 9, 900; doi:10.3390/cells9040900 www.mdpi.com/journal/cells Cells 20202020, 9, 900x FOR PEER REVIEW 2 of 33 32 hypophyseal portal vessels to reach the anterior pituitary gland (Figure 1B). CRH then binds to portalcorticotropin vessels toreleasing reach the hormone anterior pituitaryreceptor- gland1 (CRH (Figure-R1) 1whichB). CRH is thenspecifically binds to expresse corticotropind on releasing anterior pituitaryhormone receptor-1corticotroph (CRH-R1) cells to which stimulate is specifically the release expressed of ACTH on anterior into the pituitary systemic corticotroph circulation. cells The to principalstimulate thetarget release for circulating of ACTH into ACTH the systemicis the adrenal circulation. cortex, The where principal on bind targetingfor its circulatingcognate receptor ACTH melanocortinis the adrenal cortex,2 receptor where (MC2R) on binding, ACTH its cognate primarily receptor induces melanocortin glucocorticoid 2 receptor (GC) (MC2R),synthesis ACTH and primarilysecretion from induces the glucocorticoidzona fasciculata (GC) of the synthesis adrenal and gland secretion [2]. GCs from are the pleiotropic zona fasciculata hormones, of the involved adrenal ingland almost [2]. GCsevery are cellular, pleiotropic molecular hormones, and involvedphysiologic in almost aspect every of the cellular, organism molecular and regulate and physiologic a broad spectrumaspect of theof essential organism physiologic and regulate functions. a broad spectrumGCs also of fine essential-tune HPA physiologic axis activity functions. by inhibiti GCs alsong hypothalamicfine-tune HPA CRH axis activity and anterior by inhibiting pituitary hypothalamic ACTH production CRH and and anterior secretion pituitary in a negative ACTH production feedback loopand secretionmanner ( inFigure a negative 1C). feedback loop manner (Figure1C). Hypothalamus B PVN SON 3V MPMP MN A MN VP PP AVP/OXT neuron CRH neuron AVP neuron Hypophyseal Portal Vessel ME CRH AP CRH-R1 Corticotroph Pituitary PP ACTH C Liver CRH/AVP release (+) (-) ACTH release (-) (+) Cortisol release Figure 1. SchematicSchematic diagram diagram of of the the hypothalamic hypothalamic-pituitary-adrenal-pituitary-adrenal (HPA) axis.axis. ( A) The major glands of the endocrine system include the hypothalamus and pituitary gland centrally and the thyroid, islet cells of of the the pancreas, pancreas, adrenal adrenal glands, glands, liver liver and and gonads gonads peripherally. peripherally. (B) ( BThe) The HPA HPA axis axis is regulated is regulated by hypothalamicby hypothalamic corticotropin corticotropin-releasing-releasing hormone hormone (CRH) (CRH) and and arginine arginine vasopressin vasopressin (AVP), (AVP), which which are produced in the paraventricular nucleus (PVN) of the hypothalamus and transported to the anterior pituitary, wherewhere they they drive drive synthesize synthesize and and secretion secretion of pituitary of pituitary adrenocorticotropic adrenocorticotropic hormone hormone (ACTH). (ACTH).In the adrenal In the cortex, adrenal ACTH cortex, stimulates ACTH the stimulates adrenal zonathe adrenal fasciculata zona cortex fasciculata to release cortex glucocorticoids to release (GCs),glucocorticoids which have (GCs), numerous which physiological have numerous effects. physiological (C) GCs also effects. exert negative (C) GCs feedback also exert at the negative level of feedbackthe hypothalamus at the level and of pituitary the hypothalamus to dampen excessiveand pituitary activation to dampen of the excessive HPA axis. activation 3V, the third of the ventricle; HPA AP,axis. anterior 3V, the pituitary;third ventricle; ME, median AP, anterior eminence; pituitary; MP, medialME, median parvocellular; eminence; MN, MP, magnocellular medial parvocellular; nucleus; MN,OXT, oxytocin;magnocellular PP, periventricular nucleus; OXT, parvocellular; oxytocin; PP, SON, periventricular supraoptic nucleus; parvocellular; VP, ventral SON, parvocellular. supraoptic nucleus; VP, ventral parvocellular. Cells 2020, 9, x; doi: FOR PEER REVIEW www.mdpi.com/journal/cells Cells 20202020,, 9,, 900x FOR PEER REVIEW 3 of 33 32 2. Pituitary Specific Regulators of Pro-Opiomelanocortin Transcription 2. Pituitary Specific Regulators of Pro-Opiomelanocortin Transcription Pro-opiomelanocortin (POMC) belongs to an ancestral opioid/orphanin gene family, and arose over Pro-opiomelanocortin500 million years ago by (POMC) insertion belongs of the to melanocortin an ancestral opioidsequence/orphanin into a preproendorphin gene family, and arosegene [over3–5] 500. The million human years POMC ago bygene insertion is located of the on melanocortin chromosome sequence 2p23.3, intospanning a preproendorphin 7,999bp on the gene reverse [3–5]. Thestrand. human It contains POMC three gene isexons located (354 onbp chromosome, 152bp, and 2p23.3,900bp spanningrespectively) 7999 separated bp on the by reverse two introns strand. (3It, contains705bp and three 2,888 exonsbp respectively (354 bp, 152, bp,Figure and 2A 900). bpThe respectively) 5′-untranslated separated region by (5′ two-UTR) introns of POMC (3705 mRNA bp and includes2888 bp respectively,the entire Exon Figure 1 2andA). Thethe 5first0-untranslated 20bp of the region proximal (50-UTR) region of of POMC Exon mRNA 2 (Figure includes 2B). The the remainingentire Exon sequence 1 and the of first Ex 20on bp2 encodes of the proximal a signal region peptide of Exonand the 2 (Figure first 18aa2B). Theof the remaining POMC precursor sequence (ofFigure Exon 2B) 2 encodes. A large a signalpart ofpeptide Exon 3 is and translated the first 18aato 223aa of the of POMCthe POMC precursor peptide (Figure and the2B). 3′ A-UTR large covers part aof 228bp Exon 3sequence is translated of the to 223aa3′ end of of the Exon POMC 3 (Figure peptide 2B) and. The the 3N0-UTR-terminal covers 26aa a 228-signal bp sequencepeptide of of the precursor30 end of ExonPOMC 3 (Figure protein2 B).is cleaved The N-terminal during maturation, 26aa-signal peptideand the ofremaining the precursor 241aa POMC region proteinis further is processedcleaved during into maturation,several peptides and the in remaininga tissue-specific
Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Functional Analysis of the Homeobox Gene Tur-2 During Mouse Embryogenesis
    Functional Analysis of The Homeobox Gene Tur-2 During Mouse Embryogenesis Shao Jun Tang A thesis submitted in conformity with the requirements for the Degree of Doctor of Philosophy Graduate Department of Molecular and Medical Genetics University of Toronto March, 1998 Copyright by Shao Jun Tang (1998) National Library Bibriothèque nationale du Canada Acquisitions and Acquisitions et Bibiiographic Services seMces bibliographiques 395 Wellington Street 395, rue Weifington OtbawaON K1AW OttawaON KYAON4 Canada Canada The author has granted a non- L'auteur a accordé une licence non exclusive licence alIowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distri%uteor sell reproduire, prêter' distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique. The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Functional Analysis of The Homeobox Gene TLr-2 During Mouse Embryogenesis Doctor of Philosophy (1998) Shao Jun Tang Graduate Department of Moiecular and Medicd Genetics University of Toronto Abstract This thesis describes the clonhg of the TLx-2 homeobox gene, the determination of its developmental expression, the characterization of its fiuiction in mouse mesodem and penpheral nervous system (PNS) developrnent, the regulation of nx-2 expression in the early mouse embryo by BMP signalling, and the modulation of the function of nX-2 protein by the 14-3-3 signalling protein during neural development.
    [Show full text]
  • Additional Methods
    Additional Methods Cell Expression Profiles The tissue-dependent gene expression dataset from the Genome Novartis Foundation contains 32 healthy major tissues, and 47 tumour samples and cell lines. The custom- designed whole-genome gene expression microarrays used on each sample targets 44775 human mRNA transcripts. Previous analysis of this dataset identified many chromo- somal regions of correlated transcription that are under the control of both tissue and parental allele-specific expression. The expression levels of TF genes across tissue sam- ples are observed to be lower than non-TF genes. This is coherent with the mechanistic explanation that the effect of a single TF molecule is amplified by transcribing many copies of mRNA from a target gene. Across all samples, the proportion of TFs rel- ative to all expressed genes is remarkably stable at ∼ 6%. In the bootstrap test for highly predictive CRMs, we resampled from this set of TFs to generate the bootstrap replicates. High variance in gene expression profiles are observed between replicates for samples with more heterogeneous composition. Therefore, we treat each replicate as an independent sample in our analysis. When analyzing expression variation in a single sample, we found that a Gaussian distributional assumption for gene expression is more suitable compared to other distributions. Smoothing and Model Fitting Since gene expression response by the target gene varies over different TF expression values in a smooth fashion, a curved function is needed to fit our gene expression data. For additive models, the partial response of the target gene to the expression of each TF is described by a smooth function.
    [Show full text]
  • Ptf1a/Rbpj Complex Inhibits Ganglion Cell Fate and Drives the Specification of All Horizontal Cell Subtypes in the Chick Retina
    Ptf1a/Rbpj complex inhibits ganglion cell fate and drives the specification of all horizontal cell subtypes in the chick retina. Elise Lelièvre, Monkol Lek, Henrik Boije, L. Houille-Vernes, Valérie Brajeul, A. Slembrouck, Jérôme Roger, José-Alain Sahel, Jean-Marc Matter, Florian Sennlaub, et al. To cite this version: Elise Lelièvre, Monkol Lek, Henrik Boije, L. Houille-Vernes, Valérie Brajeul, et al.. Ptf1a/Rbpj complex inhibits ganglion cell fate and drives the specification of all horizontal cell subtypes in the chick retina.: Ptf1a in chick retinal development. Developmental Biology, Elsevier, 2011, 358 (2), pp.296-308. 10.1016/j.ydbio.2011.07.033. inserm-00614775 HAL Id: inserm-00614775 https://www.hal.inserm.fr/inserm-00614775 Submitted on 16 Aug 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Ptf1a/Rbpj complex inhibits ganglion cell fate and drives the specification of all horizontal cell subtypes in the chick retina. 1,2,3,4,5 6 6 2,4,5 2,4,5 E.C. Lelièvre , M. Lek , H. Boije , L. Houille-Verne s , V. Brajeul , A. Slembrouck2,4,5, J.E. Roger4, J. Sahel2,4,5, J.M.
    [Show full text]
  • Mouse Anti-Human Testicular Receptor 4
    Catalog Clonality, clone Reactive Reg. Product Name Quantity Applications Number (isotype) species Status mAb clone H0107B WB, ELISA, 434700 Mouse anti-human TR4 100 µg Hu, Ms, Rt RUO (Ms IgG2a) IP, IHC Mouse Anti-Human Testicular Receptor 4 Description Testicular receptor 4 (TR4, TAK1; NR2C2) is a member of the orphan nuclear receptor family. TR4 was originally cloned from lymphoblastoma Raji cells or mouse brain cDNA library. No ligand has been reported. Northern blot shows TR4 is transcribed as a 9kb mRNA in many tissues and as a 2.8kb mRNA in testis, mainly in spermatocytes. TR4 has two isoforms called TR4α1 and TR4-α2, which differ in 19 amino acids coded by two separate exons. Both products translated from 9kb transcript are ubiquitously expressed. Since TR4 binds to the same elements for the RAR-RXR or TR-RXR heterodimers, TR4 may have an inhibitory affect for retinoic-acid mediated transactivation. Nomenclature NR2C2 Genbank L27586 Origin Produced in BALB/c mouse ascites after inoculation with hybridoma of mouse myeloma cells (NS-1) and spleen cells derived from a BALB/c mouse immunized with Baculovirus-expressed recombinant human TR4 (23-52 aa). Specificity This antibody specifically recognizes human TR4 and cross reacts with mouse and rat TR4. Purification Ammonium sulfate fractionation Formulation Concentration is 1 mg/mL in physiological saline with 0.1% sodium azide as a preservative. Application Recommended Concentration* Western Blot 2 μg/mL Non reducing Western Blot Not tested ELISA 0.1 μg/mL Immunoprecipitation Determine by use Electrophoretic Mobility Shift Assay Not tested Chromatin Immunoprecipitation Not tested Immunohistochemistry 10 μg/mL *In order to obtain the best results, optimal working dilutions should be determined by each individual user.
    [Show full text]
  • Modulation of the Activity of a Key Metabolic Regulator Small Heterodimer Partner by Post-Translational Modifications
    MODULATION OF THE ACTIVITY OF A KEY METABOLIC REGULATOR SMALL HETERODIMER PARTNER BY POST-TRANSLATIONAL MODIFICATIONS BY DEEPTHI KANAMALURU DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biochemistry in the Graduate College of the University of Illinois at Urbana-Champaign, 2011 Urbana, Illinois Doctoral Committee: Associate Professor Jongsook Kim Kemper, Chair Professor David J. Shapiro Professor Milan K. Bagchi Assistant Professor Lin-Feng Chen Abstract Small Heterodimer Partner (SHP, NR0B2), a member of the nuclear receptor superfamily, is an orphan receptor that lacks a DNA binding domain but contains a putative ligand binding domain. SHP forms non-functional heterodimers with DNA binding transcriptional factors and, thereby, functions as a transcriptional corepressor in diverse biological processes, including cellular metabolism, cell proliferation, apoptosis, and sexual maturation. Of these reported functions of SHP, maintaining cholesterol and bile acid levels by negative feedback regulation of hepatic conversion of cholesterol to bile acids is well established. Cholesterol is essential in many biological activities in mammalian cells. Conversion of hepatic cholesterol into bile acids is a major pathway to eliminate cholesterol from the body. However, excess amounts of cholesterol and bile acids are pathogenic. Therefore, the levels of cholesterol and bile acids need to be tightly regulated. Cholesterol 7α-hydroxylase (CYP7A1), a liver specific P450 enzyme, is the first and rate-limiting enzyme in this process. Increased levels of bile acids repress transcription of CYP7A1 in a feedback manner. In response to elevated bile acid levels, the nuclear bile acid receptor Farnesoid X Receptor (FXR) increases the transcription of SHP.
    [Show full text]
  • Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases
    Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Olivares, Ana Maria, Oscar Andrés Moreno-Ramos, and Neena B. Haider. 2015. “Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases.” Journal of Experimental Neuroscience 9 (Suppl 2): 93-121. doi:10.4137/JEN.S25480. http:// dx.doi.org/10.4137/JEN.S25480. Published Version doi:10.4137/JEN.S25480 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:27320246 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Journal name: Journal of Experimental Neuroscience Journal type: Review Year: 2015 Volume: 9(S2) Role of Nuclear Receptors in Central Nervous System Running head verso: Olivares et al Development and Associated Diseases Running head recto: Nuclear receptors development and associated diseases Supplementary Issue: Molecular and Cellular Mechanisms of Neurodegeneration Ana Maria Olivares1, Oscar Andrés Moreno-Ramos2 and Neena B. Haider1 1Department of Ophthalmology, Schepens Eye Research Institute, Massachusetts Eye and Ear, Harvard Medical School, Boston, MA, USA. 2Departamento de Ciencias Biológicas, Facultad de Ciencias, Universidad de los Andes, Bogotá, Colombia. ABSTRACT: The nuclear hormone receptor (NHR) superfamily is composed of a wide range of receptors involved in a myriad of important biological processes, including development, growth, metabolism, and maintenance.
    [Show full text]
  • Dynamic Transcriptomic Profiles of Zebrafish Gills in Response to Zinc
    Zheng et al. BMC Genomics 2010, 11:548 http://www.biomedcentral.com/1471-2164/11/548 RESEARCH ARTICLE Open Access Dynamic transcriptomic profiles of zebrafish gills in response to zinc depletion Dongling Zheng1,4, Peter Kille2, Graham P Feeney2, Phil Cunningham1, Richard D Handy3, Christer Hogstrand1* Abstract Background: Zinc deficiency is detrimental to organisms, highlighting its role as an essential micronutrient contributing to numerous biological processes. To investigate the underlying molecular events invoked by zinc depletion we performed a temporal analysis of transcriptome changes observed within the zebrafish gill. This tissue represents a model system for studying ion absorption across polarised epithelial cells as it provides a major pathway for fish to acquire zinc directly from water whilst sharing a conserved zinc transporting system with mammals. Results: Zebrafish were treated with either zinc-depleted (water = 2.61 μgL-1; diet = 26 mg kg-1) or zinc-adequate (water = 16.3 μgL-1; diet = 233 mg kg-1) conditions for two weeks. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array. Of the genes represented the expression of a total of 333 transcripts showed differential regulation by zinc depletion (having a fold-change greater than 1.8 and an adjusted P-value less than 0.1, controlling for a 10% False Discovery Rate). Down-regulation was dominant at most time points and distinct sets of genes were regulated at different stages. Annotation enrichment analysis revealed that ‘Developmental Process’ was the most significantly overrepresented Biological Process GO term (P = 0.0006), involving 26% of all regulated genes.
    [Show full text]
  • Discovering Mechanisms That Regulate Beta-Cell Neogenesis
    DISCOVERING MECHANISMS THAT REGULATE BETA-CELL NEOGENESIS AND PROLIFERATION by Hannah Elizabeth Edelman A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland November 2018 ABSTRACT In both Type I and Type II diabetes, a loss of functioning beta cells results in an inability to produce insulin effectively to regulate blood glucose. Current treatments have a variety of problems including insulin-dependence, donor scarcity, comorbidities, and cost. We are interested in inducing the body to produce its own beta cells endogenously by either neogenesis from progenitors or proliferation of existing beta cells. From previous work, we know that the transcription factor Sox9b plays an important role in the identity of endocrine progenitor cells in the zebrafish pancreas, known as centroacinar cells (CACs), that contribute to regeneration of beta cells. Since humans also have CACs but do not regenerate efficiently, we wanted to understand the downstream targets of Sox9b/SOX9 and their role in the biology of CACs. Using RNA-seq and ChIP-seq in PANC-1 cells we were able to find direct targets of SOX9, including the interesting candidate EPCAM, to follow up on. For assessing beta-cell proliferation, we knew from a previous screen that selective serotonin reuptake inhibitors (SSRIs) can induce beta-cell proliferation in the larval zebrafish. We hypothesized that innervation of the principal islet was responsible for this serotonergic signaling to the pancreas. Using imaging of a variety of transgenic lines, we established that innervation of the islet occurs by 4 days post fertilization and that the sox10 mutant zebrafish has a reduced amount of this innervation.
    [Show full text]
  • Dissertation
    Dissertation Submitted to the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany for the Degree of Doctor of Natural Sciences Presented by Ann-Cathrin Hofer (M.Sc.) Born in Heidelberg, Germany Oral Examination: 12th of September 2016 Regulatory T cells protect the neonatal liver and secure the hepatic circadian rhythm Referees 1st Referee: Prof. Dr. Peter Angel 2nd Referee: Dr. Markus Feuerer This dissertation was performed and written during the period from November 2012 to May 2016 in the German Cancer Research Center (DKFZ) under the supervision of Prof. Dr. Peter Angel and direct supervision of Dr. Markus Feuerer. The dissertation was submitted to the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany in June 2016. German Cancer Research Center (DKFZ) Immune Tolerance (D100) Im Neuenheimer Feld 280 69120 Heidelberg, Germany I II Confirmation Hereby, I confirm that I have written this thesis independently, using only the results of my investigation unless otherwise stated. Furthermore, I declare that I have not submitted this thesis for a degree to any other academic or similar institution. Parts of this dissertation have been submitted for publishing: Regulatory T cells protect the liver early in life and safeguard the hepatic circadian rhythm Ann-Cathrin Hofer, Thomas Hielscher, David M. Richards, Michael Delacher, Ulrike Träger, Sophia Föhr, Artyom Vlasov, Marvin Wäsch, Marieke Esser, Annette Kopp-Schneider, Achim Breiling, Frank Lyko, Ursula Klingmüller, Peter Angel, Jakub Abramson, Jeroen Krijgsveld & Markus Feuerer Parts of the experiments in this dissertation were performed in collaboration with other research groups as follows: CG methylation analysis with the 454 pyrosequencing technology: Division of Epigenetics, DKFZ, Heidelberg Dr.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Cell-Specific Alterations in Pitx1 Regulatory Landscape Activation Caused 2 by the Loss of a Single Enhancer
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434611; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Cell-specific alterations in Pitx1 regulatory landscape activation caused 2 by the loss of a single enhancer 3 4 5 Raquel Rouco1,2*, Olimpia Bompadre1,2*, Antonella Rauseo1,2, Olivier Fazio3, Fabrizio Thorel3, 6 Rodrigue Peraldi1,2, Guillaume Andrey1,2 7 8 9 1Department of Genetic Medicine and Development, Faculty of Medicine, University of 10 Geneva, Geneva, Switzerland 11 2Institute of Genetics and Genomics in Geneva (iGE3), University of Geneva, Geneva, 12 Switzerland 13 3 Transgenesis Core Facility, Faculty of Medicine, University of Geneva, Geneva, Switzerland 14 15 *Authors contributed equally 16 Correspondence: [email protected] 17 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434611; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 18 Abstract 19 20 Most developmental genes rely on multiple transcriptional enhancers for their accurate expression 21 during embryogenesis. Because enhancers may have partially redundant activities, the loss of one 22 of them often leads to a partial loss of gene expression and concurrent moderate phenotypic 23 outcome, if any.
    [Show full text]