© 2016 Nature America, Inc. All rights reserved. ment. Many teleost fish also exhibit human-like short telomeres develop embryonic of view clear a and manipulation for sibility Furthermore, their external provides fertilization increased acces which are unique of to vertebrates (such some as physiology,blood, bones and human spleen). with systems and organs key share exemplified by the success the of zebrafish model system ( years several of spans life with zebrafish), and (mouse models vertebrate and months, or weeks of spans life with flies), and worms (yeast, models nonvertebrate the aging: experimental for models genetic traditional between gap long-standing a bridge to killifish turquoise the allow istics lines stable of crucial generation are weeks rapid 3–4 the allow they because roughly manipulations, genetic for features of maturity sexual rapid cycle and life compressed naturally killifish’s turquoise treatments the drug Finally, and temperature restriction, dietary as such interventions environmental conserved by manipulated be can killifish turquoise the of span life the systems, model aging lesions neoplastic of incidences function mitochondrial in decline including aging, vertebrate of typical are that notypes killifish annual other with compared shortest-lived vertebrate that can be bred in captivity—even when the is 4–6 months, currently of span life a GRZ line, median with inbred the and (Zimbabwe), Park National Gonarezhou the in supply. constant in was 1968 first collected killifish The turquoise span and short generation time in the laboratory, when water is in ( Africa, Africa, where water is present only a rainy during season brief southeast in pools water habitat—ephemeral seasonal its to tion ( compressed of its life naturally span time and generation short because aging for experimental system model vertebrate exciting ( killifish turquoise African The I studying vertebrate aging and aging-related diseases. generated as rapidly as 2–3 months, which is much faster than other fish models. scale husbandry conditions that are critical for success. Because of the fast life cycle of the turquoise killifish, stable lines can be germ-line transmission and for minimizing off-target effects. We also provide strategies for via homology-directed repair (HD genome, this platform enables the generation of knockout alleles via end nonhomologous joining ( interspaced short palindromic repeats/ the shortest-lived vertebrate in captivity with a median life span of 4–6 months. By taking advantage of the clustered regularly a comprehensive protocol for efficient genome engineering in the A Published online 22 September 2016; or A.B. ( Cologne, Germany. 1 Itamar Harel short-lived African turquoise killifish Efficient genome engineering approaches for the 2010 Department of Genetics, of Department Stanford University, Stanford, California, USA. Fig. 1 Fig. Fig. 1 Fig. NTRO protocol central challenge in experimental aging research is the lack of short-lived vertebrate models for genetic studies. Here we present Teleost fish have substantial advantages as laboratory animals, laboratory as advantages substantial have Teleost fish phe of range comprehensive a exhibit killifish turquoise Old

| VOL.11 NO.10VOL.11 [email protected] a b D ). These features are likely to be an important adapta important an be to likely are features These ). ). The turquoise killifish maintains its compressed life life compressed its maintains killifish turquoise The ). UCT I ON 1 4 Glenn Laboratories for the Biology of Aging at Stanford, Stanford, California, USA. Correspondence should be addressed to I.H. ( , RiccardoDario Valenzano | 2016 8 ). | , cognitive impairment cognitive ,

2 natureprotocols . These unique life history character history life unique These . doi:10.1038 Fig. 1 Fig. 4,1 N. furzeri N. R 0 ). ). We include guidelines for guide . Moreover, similar to other other to similar Moreover, . 1,3– a ). CR /nprot.2016.10 7 . I SPR ) has emerged as an an as emerged has ) -associated -associated protein-9 nuclease ( 2 , 9 3 and increased increased and & Anne Brunet 3

13,1 2 Max Planck Institute for of Biology Ageing, Cologne, Germany. 9,11,1 4 . Fish 1,3, 1– 1 2 5 - - - - - 4 3 , .

A genome was reported in refs. refs. in reported was genome killifish the of turquoise analysis (detailed sequence bled genome turquoise the in editing kil genome precise allows that platform genome-to-phenotype comprehensive recently,a More manner. tissue-specific and temporal a in genes exogenous of expression killifish turquoise the in approaches engineering genome developing in step first the was random integration Tol2-based using Transgenesis entirely species. this been in until have lacking However, approaches experimental research. genetic recently, translational and discovery-based of goal long-standing a been have organisms model of genome traits,of including color, sex and life span different characteristics killifish. Finally, there exist several distinct wild-derived strains with point of reference among different laboratories using the turquoise erence genome assembly and genome engineering, and it provides a tion diapause as to referred drought during dormancy (developmental features system determination sexual XY-based an including zebrafish), as (such fish other with pared aging. The turquoise killifish has additional advantages when com life span that provides a unique opportunity for studying vertebratecompressed a yielded has environment extreme its to adaptation fish cave in degeneration eye logical questions, including adaptive evolution in sticklebacks habitats, havefish to successfully used been study interesting bio screens drug and genetic specifically approaches, high-throughput with capacity regenerative remarkable genes killifish and aging-related disease- multiple of turquoise targeting efficient enabled the in platform genome-to-phenotype The system Cas9 and CRISPR the using organism this in pipeline frican frican turquoise killifish ( 1 , RNA 4 Efficient and reliable ways to generate precise changes to the the to changes precise generate to ways reliable and Efficient l­ fish has been developed 2 3 2 ). In addition, the highly inbred GRZ strain (g . For example, this pipeline, combined with the turquoise turquoise the with combined pipeline, this example, .For 1 7 RNA 2 . their extreme of Because to adaptations a range of wide 2 and active migration of blastomeres before gastrula before blastomeres of migration active and CR ) ) target design, embryo injection and hatching, I SPR T his his protocol provides powerful genetic tools for / C as9) as9) system and the turquoise killifish 1 0 that have allowed for the genetic mapping T 2 ol2-based ol2-based transgenesis and large- . This platform includes the Nothobranchius Nothobranchius furzeri 20,2 1 9 6,2 . Similarly, the turquoise killifish’s turquoise Similarly, .the N 1 and fascinating developmental developmental fascinating and H 1 ) and a rapid genome-editing genome-editing rapid a and ) E 1 6 J) J) and knock-in alleles and they are compatible compatible are they and 28–3 3 CECAD, University Cologne,of 6,20,21,26,2 0 , thus allowing for the the for allowing thus , 1,24,2 [email protected] ), ), which is 7 5 . de novo facilitates ref assem 1 8 and 2 - - - - - ) .

© 2016 Nature America, Inc. All rights reserved. ase is guided by a gRNA molecule to a specific genomic locus, locus, genomic specific a to molecule gRNA a by guided is ase Hsu in reviewed (and edit the genomes of multiple model and non-model organisms pyogenes Streptococcus from Cas9 bacterial the on based tool A immunity. adaptive rial research. aging experimental for system model genetic promising a into killifish turquoise short-lived naturally and genome including transgenesis editing, have the transformed telomerase of subunit drome (e.g., congenita), dyskeratosis by out knocking the protein the generate fastest to vertebrate model for a us human age-associated telomere syn allowed has span, life compressed killifish’s panel mutant fish lines in the turquoise killifish, including a detailed timeline. Panel recirculating systems, middle). Right: an example of a young and an old turquoise killifish male. ( is 5–7 weeks. ( of 20–30 d post hatching (d.p.h.), the animals reach sexual maturity and are considered adults. The life cycle (from ‘egg to fish egg’) areof referredthe turquoiseto as ‘fry’killifish for the first few days, and shortly after they are referred to as ‘juvenile fish’ (until the animalstheir reachrespective sexualtimeline. maturity). FromAt fertilizationthe age to hatching (usually between 14 and 20 d post fertilization), animals are referred to as ‘embryos’.Figure 1 Freshly hatched where, similar to earlier genome-editing strategies such as as such strategies genome-editing earlier to similar where, CRISPR and and CRISPR b adapted with permission from ref.

| The turquoise killifish model for experimental aging research. ( b c a b ) The turquoise killifish’s natural habitat (ephemeral ponds in Zimbabwe and Mozambique, left) and lab environment (housing using water Natural habitat 1) Targetselectionand gRNAs Active domains ordering DNAoligos Cas Embryogenesis (Steps 1–3) 1–2 days ee ae seta cmoet i bacte in components essential are genes has provided a simple and efficient way to efficient and a simple provided has 9 months 14–20 days 1, t al. et 2 . Genome engineering approaches, approaches, engineering Genome . 3 Hatching 4 . n hs ol te a9 nucle Cas9 the tool, this In ). Birth 1 mRNA Synthesis 2) gRNA/Cas9 , Cold Spring Harbor Press. Panel (Steps 4–29) 1–2 days Childhood (1–3 days,Steps40–45) gRNA efficiency 3) Cas9mRNA gRNA injection Evaluation of (Steps 33–39) Lab environment 1–2 days 31–3 a ) Important landmarks in the life history of humans and the turquoise killifish, and - - - 3 Puberty c

adapted with permission from ref. + b 12–16 year (left and center images) photo credit: Itamar Harel. Right-hand images in 3–4 weeks lifish, in which it has allowed the generation of knockout and and knockout of generation the allowed has it which in lifish, the in including model kil organisms, turquoise editing multiple genome for efficient has system instrumental been CRISPR/Cas9 introduce new sequences into the genome (i.e., knock-in) DNA homologous a template for repairing the uses DSB, and hand, thus it can be other used to precisely the on knockout) HDR, (i.e., mutation. loss-of-function a and codon stop a to premature lead can this mutations, frameshift cause indels the which in cases In genome. the in insertions) or deletions (small indels Ran in (reviewed HDR or and NHEJ either by repaired be then Doudna can DSB in reviewed (TALENs; transcription-activator- Sontheimer nucleases and effector (ZFNs) like nucleases zinc-finger et al. et s F1 germ-line transmission 4) Sexuallymature 3 (Steps 46–52) Evaluation of 6 F0 Chimera (1–3 days) 30–40 days ). NHEJ is frequently imprecise, and it can introduce introduce can it and imprecise, frequently is ).NHEJ 3 5 c ), it generates a double-strand break (DSB). The The (DSB). break double-strand a generates it ), Old male Young male ) A genome-to-phenotype platform for generating stable Adulthood natureprotocols 2 , Cell Press. Optional: backcross 5) Sexuallymature (Steps 53–59) (2–3 months) 30–40 days stable lin Elderly

| VOL.11 NO.10VOL.11 4–6 months e 80 year s protocol | 2016 35,3 | 7

. The 2011 - © 2016 Nature America, Inc. All rights reserved. 2012 blue. Oligo, oligonucleotide; fs, frameshift; del, deletion. Panel (right). gRNA targets are in red, and PAM sequences are in bold. HhaI restriction site is highlighted with a yellow background, and mutated sequences are in genomic region encoding for a lysine residue (K836) in the turquoise killifish TERT protein (left), and the specific amino acid residues modified as a result in the ( CRISPR/Cas9-based genome editing (top), and a representative example for gRNAs (with targets sequences #6 and #7) resolved on an agarose gel (bottom). the variable oligonucleotide and oligonucleotides for PCR amplification used in this example (bottom). ( of the mDNA ( Figure 2 c protocol ) ) Examples for direct sequencing (top) and enzymatic digestion (bottom), as classical options for downstream analysis. (

| TERT VOL.11 NO.10VOL.11

| CRISPR/Cas9-based genome editing. ( gene (exon 11), for precise editing of new sequences into the genome (i.e., knock-in). The core sequence of the ssDNA template used to edit a d b a PolG ...GGTCT PolG-R PCRoligo: PolG-F PCRoligo: V V TER PolG 5 ariable oligo(PolGtarget#7): ariable oligo(PolGtarget#6): 4 3 2 1 7 6 5 Ranking Genomic sequence ′ ). ). An output from CHOPCHOP ( --> Co-injected ssDN (variable) 60 bp GGTCT T Targe Intron Exon Homology arm(~35bp) | 3 2016 ′ gRNA T7 promoter

GGTGGTCAACCCGCAGA GGTGGTCAACCCGCAGAAGG GGAGTACAGAGCGGCAGATG GGTTGTGCCGGAGTACAGAG GACAGCATCTGGATGTTAAG GGATGTTAAGGGGGTTGATG GTATCATTCGCTTCAGGTCG GAGAAAATGATCCTCTGGAG TGTTTCGCTGCCCTCTCCAG t T4 DNA genomictarget | natureprotocols Cleaning template,Step T7 RNA PolG gRNAs(target#) Exon A polymerase,Steps7– T arget sequence template containingK836Rpoint 2 polymerase,Step10 , Steps4–6

a https://chop ) ) NHEJ-based genome editing for an additional aging and a disease-related gene, the catalytic subunit G GG (constant) 80 bp 5′-TAATACGACTCACTAT 5′-TAATACGACTCACTAT 5′-ACCTCCCAGCTCCATTCCT 5′-GCCCTCTCCAGAGGATCATT 9 T TGG TG CG GGG CGG AGG AGG AGG C #6 8 Homology arm(~35bp) G G G exon TGGTGAACT.... TGGTGAACT GapFilledScaffold_660:57543 GapFilledScaffold_660:57534 GapFilledScaffold_660:57481 GapFilledScaffold_660:57471 GapFilledScaffold_660:57435 GapFilledScaffold_660:57373 GapFilledScaffold_660:57362 chop.rc.fas.harvard.ed #7 d adapted with permission from ref. 11 Genomic location mutations c Wild-type sequence: PolG target#6(6/10withmutations Mutate Wild-type sequence: PolG target#7(9/10withmutations Mutate TGCTTGATGCTGCGCT TGCTTGATGCTGCGC GATGCTGCGCTCCACATCTG GATGCTGCTCTCCTCATCTG GATGCTGCGCTCCACATCTG GATGCTGCGCTCCACATCTG TGCTTGATGCTGCGCT TGCTTGATGCTGCGCT TGCTTGATG gRN HhaI digestion A A A d d GGAGTACAGAGCGGCAGATG GGTTGTGCCGGAGTACAGAG u injection (target#)

sequences (examples): sequences (examples): ) ) providing a list of suggested gRNA targets (top). The sequences of ------YGLVVNPQ to preciseprotein HDR-based genomeengineeringtranslates YGLVVNPQ YGLVVNPQ YGLVVNPQ YGLV 2 2 2 2 2 2 2 Exon

T CCA ------CCA CCA 2 STRRGSW* , , Cell Press.

Strand + + + - - + - CATCTGCCGCTCTGTACTCC CAT CAT b CC CCG CCG CCG – – – ) ) A diagram for the synthesis of gRNAs used in K R R K VVVNF VVV VVVNF ------CTGCCGCTCTGTACTCCGGCACAACC GCTCC ------VVNF V837del CTCCG ------CTCTGTACTCCGGCACAACC ) ) + + + S mutations

GTTTTAGAGCTAGAAATAGCAAG GTTTTAGAGCTAGAAATAGCAAG CCGCTCTGTACTCCGGCACAACC G+C content(%) F GTACTCCGGCACAACCCCATG CTGCCGCTCTGTACTCCGGCA #6 WT Partial (10% fs Precise K836R(10% ------CTCCGGCACAACCCCATG 61 61 65 52 57 52 48 #7 d ) ) HDR-based genome editing GGACAACCCCGTGG ) 0 0 0 0 0 0 0 GGCACAACC 1 0 Of f-targets ) CCATG 0 0 0 0 0 0 0 2 © 2016 Nature America, Inc. All rights reserved. (2.5–10 pl) and to(2.5–10andpl) determine optimaltheconcentration for range most efficient. It was also necessary to the optimize that the injection variant found described in this volumeprotocol (nCas9n; see and ‘Reagents’) was the variants) nuclear-localized and optimized based genome editing reagents. Injection ‘Equipment in described are and Setup’ needle injection the for settings the in provided are mold injection the for dimensions postinjec up-to-date most and the survival; tion efficiency increase further to aspects key these easily more chorion the penetrate to it enable to injection needle injection during the optimizing by securely and egg the hold to dimensions specific of mold microinjections. injection an developing by zebrafish overcome was obstacle for This optimized needle injection using an inaccessible largely it makes which environment), harsh natural, its to adaptation of because (probably chorion tough a apparatus. Injection in described (first ref. systems recirculating water commercial in protocol were also developed here to enable large-scale husbandry (ref. protocol breeding the killifish for African described been have protocols husbandry Several fish. required protocols of described optimization previously for other microinjection and CRISPR/Cas9-based editing of genome implementation successful However, approaches, such as ZFNs and TALENs genome-editing recently, more and, Beauty) Sleeping and Tol2 microinjection protocols Genome engineering approaches in fish have greatly benefited from the Development protocolof transgenesis based months, genome editing both for CRISPR/Cas9-based as 2–3 in as quickly lines stable of generation the for allows time, which takes of the advantage turquoise killifish’s generation short in genes alleles multiple knock-in germ-line transmission. cassette can be used as a surrogate marker for detecting successful chain mCherry fluorescence reporter, under the zebrafish cardiac myosin light Figure 3 each component of the injection mix (see PROCEDURE Step 37). 2 , and see ,see and (cmlc)

| Tol2-based transgenesis. A new transgenic line harboring the promoter, is specifically expressed in the heart. This gene Tol2 Figure Figure Fig. 1 Fig. cmlc 2 2 , ( 4,1 2 5 To achieve the highest rate of CRISPR/Cas9- of rate highest Tothe achieve promoter 8 is 1 Figs. b 2,2 . 0 . 2 , ). The egg of the turquoise killifish possesses possesses killifish turquoise the of egg The 2 , we tested several Cas9 variants (e.g., codon- 8 0 ( , including a recent detailed laboratory laboratory detailed recent a including , 4 3 Figs. 4 4 Figs. 8 7 2,2 , transposase systems ). Adaptations to our initial housing housing initial our to Adaptations ). c Supplementary Methods Supplementary and and 8 . We continued to improve upon upon improve to continued We . and 2 . Overall, our protocol,current 2 , transgenesis ),

5 ) in the turquoise killifish killifish turquoise the in ) mCherry 4 2 , and CRISPR/Cas9 39–4 1 Tol2 28–3 (such as Tol1, 2 , and new new and , 0 and Tol2- (

Fig. Fig. 43–4

3 6 ) - .

arrows point to the single cell (left), and early eye formation (right). Bottom: the key steps in the hatching process described in Steps 46–52. Top: white in the injection process described in Steps 33–39. ( Figure 4 editing in the turquoise killifish genome CRISPR/Cas9-based for protocol detailed a We provide the procedureof Overview pellets. dry with feeding for we guidelines and provide feeds, available commercially many tested we tenance, main and growth of conditions standardized To food. facilitate freeze-dried on live, and frozen depended a have primarily studies to leads previous and diet, rich a killifish with feeding turquoise frequent for requirement of fecundity high and maturity maintenance. and growth Fish strains. of preservation the months several for diapause of state a in stay can embryos the and pause naturally can development °C, 20–23 at example, For proceeds. development the faster the 46–52, Steps and to hatch by 14–20 d (for more details see ‘Hatching’, PROCEDURE and skip diapause are embryos of the ready majority temperature this at and °C, 28 at manner synchronous more a in progresses development that found since Wehave months). or weeks (for in 14–20 time of d periods for and diapause variable others entering developing embryos some with nonsynchronous, largely be at 26 embryos bated °C, could but that development we observed survival hatching protocols optimal with thus of temperatures, development the and development, stereotypical incubation for allowing of identification the required diapause of phases nonaquatic and development. In during can addition, embryos enter a aquatic long phase requires it and synchronous, non largely is it models; fish other from differs killifish quoise incubation. Embryo c, chorion, containing surface projections; y, yolk. and Chi-Kuo Hu. RT, room temperature; sc, single cell; ld, lipid droplets; ready-to-hatch embryo (right); Scale bar, 0.5 mm. Photo credit: Itamar Harel white arrows point to the size of the eyes in a non-ready embryo (left) and a a Injection intosinglecell-1–3

Morning* spawning-4 | Egg collection-1–2 Injection and hatching. ( Night before 21, 4 8 (for months and even years). These adaptations adaptations These years). even and months (for Fig. Fig. 4 natureprotocols h The embryonic development of the tur the of development embryonic The h *No feeding b h ). In general, the higher the temperature, ). the temperature, In the higher general, a 2 ) A diagram visualizing the key steps , including generation of knockout The rapid growth, early sexual sexual early growth, rapid The b Incubation (wet,embryosolution) 21, Incubation (semi-drycoconutfiber) Hatching (coldhumicacid+oxygen Not ready c sc

4 | y 8 VOL.11 NO.10VOL.11 ld Add systemwaterandfeed , which can be useful for useful be can , which 2,2 8 b . We incu previously ) A diagram visualizing 3–4 days Ready protocol | 2016 1–2 week 1–2 week at 260 at 28 at RT 1 day

| )

° 2013 °

C

C s s - - - -

© 2016 Nature America, Inc. All rights reserved. tein domains, and for a knock-in approach gRNA target sequences target sequences should be selected to be upstream of procritical gRNA approach, Generally, for a approach. knockout desired the efficiency of evaluation ( the for designed be should sequences GN (when using the the T7 using promoter,or (when in protocol) to this as described 5 two first the synthesis, in the genome the 3 target sequence (and they are present in the gRNA molecule), and 5 gRNAs are according selected to the sequence following criterion: for Target sequences amplification). PCR for candidates cleotide predicted gRNAs, oligonu and sites of restriction possible ranking off-targets, genome-wide the (including selection target killifish the and contains sequence genome for gene models the turquoise ( v2 CHOPCHOP or ( CHOPCHOP via editing. genome for CRISPR/Cas9 and gRNA of synthesis and selection Target target stages: main three transmission. germ-line and of injections selection, consists lines killifish turquoise turquoise killifish colony. and it ref. can be easily adopted,7–90%; including by laboratories typically with a small is editing successful of frequency (e.g., and efficient highly is protocol feeding this experience, our From concerning hatching). (specifically approaches engineering conditionsbandry that are critical for the success these of genome ( transgenesis off-target effects. It also includes specific minimizing adaptationsand transmission for Tol2-basedgerm-line hatching, and injection col contains optimized guidelines for gRNA target design, embryo alleles via NHEJ and knock-in alleles via HDR ( Each needle should be calibrated for reproducible injection slidevolumes. (with injection droplets in different sizes) as seen throughInjections a stereoscope.are made into the cell, not the yolk. ( needles. The tip of the needle is broken by gently rubbingFigure 5 the tip on a Kimwipe. 2014 locus. knock-in desired the to overlap selected be should Fig. 1 Fig. protocol ′ -(N)20-NGG-3 The protocol for the generation of genome-engineered genome-engineered of generation the for protocol The

′ | ‘NGG’ represents the protospacer adjacent motif (PAM) site VOL.11 NO.10VOL.11 c

| ), and their position should be optimized depending on on depending optimized be should position their and ), 2 Preparation of injection needles. ( , and it provides essential information for successful successful for information essential provides it and , b a 500 pl Box 31–33,3 Target selection for a specific gene can be done done be can gene specific a for Target selection ′ . The first 20 base pairs are considered as the core 1 https://chopchop.rc | 2016 , and see see and , U6 5 . Depending on the promoter used for gRNA http://chopchop.cbu promoter). For each gene, 2–5 gRNA target | ′

nucleotides should be limited to GG GG to limited be should nucleotides natureprotocols Figs. 3 3 Figs. 65 pl a and ) Two main options for injection .fas.harvard.edu b ) A diagram of a micrometer

6 .uib.n ) and optimized hus optimized and ) 0.01 mm Fig. o 5 pl ; ref. 50), which ; ref.which 50), Option Option 6 ). The proto 1 2 / ; ref. 4 9), 2 ) - - - -

patible with high-throughput approaches. It is helpful to design design to helpful is It approaches. high-throughput with patible ( steps templates as oligonucleotides ( annealed two using tion transcrip T7-mediated by synthesized easily be can gRNAs The tem is established by synthesizing the gRNAs and the highlighting their specific advantages and potential applications. and differences between the genetic approaches detailed in this protocol, Figure 6 into into mating fish, pairs with wild-type and germ-line transmission up set be should they weeks), (3–4 mature sexually are founders backcross. and transmission Germ-line ( founders chimeric F0 generate to performed Once an optimal gRNA is selected, additional injections should be colonies). grown from single plasmids purified of (or sequencing target sequence, cloning and colonies of single direct sequencing of the amplification genomic DNA region the surrounding gRNA editing successful upon disrupted be could that site (i) the designing gRNA target to overlap with a unique restriction required: is region edited the of sequence exact the if or small, is ( approaches alternative cal, (HRM) melting high-resolution as such approaches, developed recently of individual (or pooled) gRNAs could be estimated using efficiency any of the genome-editing the established, is setup the After injection eggs). of number larger a yielding fish female (larger fish of size and age overall on the as well as feeding, of frequency supplemented pellets food with live/frozen food. Fecundity is dependent on food quality and high-quality using consumption food high require maturity killifish turquoise sexual the of mating rapid frequent and growth, accelerated The eggs. 50 and 0 between produce can fish up. to set be female need pairs A single that eggs are for mating required the injection, fertilized generate To model. killifish turquoise African the for adaptations specific overall are fish for setup developed protocols other to injection similar the for required components The Injectionandevaluation gRNA of efficiency forgenome editing. version nuclear-localized codon-optimized a of transcription mediated the of synthesis For control). positive (see site restriction a of disruption by example, editing—for genome target gRNA sequences that will facilitate verification of successful Fig. Fig. 2 Once gRNA target sequences are selected, the CRISPR/Cas9 sys Fig. Fig. b Fig. 2 Fig.

4 5 | ). This method does not require any cloning or digestion or digestion any cloning require not does ). method This 5 2 Genome engineering in the turquoise killifish. The main overlaps 2 (nCas9n) template. (nCas9n) or CRISPR-STAT or for an efficient example, which could also be used as a as used be also could which example, efficient an for b CRISPR/Cas9 (directed) Tol2 (random,multiple) ), and therefore it is extremely quick and is com is and quick extremely is it therefore and ), Plasmid Transposase protein gRNA Cas9 protein gRNA Cas9 protein Platform

+ (gene cassette) ssDNA DSBs DSBs 5 Fig. 2 Fig. 3 . We provide details for two classi two for details .We provide Tol2 Homology arms No templat c Templat Plasmid ssDNA ) that can be used if the indel indel the if used be can that ) X Cas9 e e Once the F0 chimeric chimeric F0 the Once Tol2 mRNA, we use SP6- use we mRNA, 3 8 Transgene (transposition) Fig. 1 Fig. Exogenous genecassette Tol2 , but they require require they but , Short sequence(e.g.Tag) Single basepair(variant Premature sto Indel Knock-out (NHEJ Knock-in (HDR) Result c Cas9 ). 2 ; (ii) PCR PCR (ii) ; p Tol2 mRNA. ) 2,46,5 ) - - - - 2 1

© 2016 Nature America, Inc. All rights reserved. be genotyped via fin clips. Fish that exhibit a specific desired desired specific a a of to be part be considered will exhibit stage at this (or knock-in) indel that Fish clips. fin via genotyped be should pair successful that from progeny F1 pair, adult breeding for a confirmed has been transmission Once germ-line chimeric. see homozygous, or possibly (heterozygous fish individual an in present be could in- frame) or (partial variants knock-in HDR-based or indels Multiple of types paragraph. previous the in described methods the of should be using evaluated their progeny by eggs) (fertilized either nate potential off-target effects generated by the Cas9 nuclease. nuclease. Cas9 the by generated effects off-target potential nate stable line, and they can be fish backcrossed to to wild-type elimi ? the construct isinherited inaMendelian manner.  or according toSteps53–59of the main Procedure using a setof oligonucleotides uniquefor the transgene. 6. Assess germ-line transmission visually using afluorescence stereoscope inthe F1(when fluorescence reporters are used), 5. Perform injections asdescribed inSteps33–39of the main PROCEDURE. Total Nuclease-free water Phenol-red (0.5%(wt/vol)) KCl (2M) flanked by Tol2 sites) (containing atransgene of choice DNA plasmid (0.75–1.5 Tol2 transposase mRNA(0.5–1 Component 4. Prepare aninjection mixture (35 chimeric for the transgene. preferably anendotoxin-free kit.Similar toCRISPR/Cas9 injections, expect ~50%survivalfor injectedembryo,and ~50%embryos  fluorescence marker asF0 founders, aswell for detecting germ-line transmission inF1. gamma-crystalin ( fluorescent protein gene under the control of the cardiac myosin light chain(  library endogenous regulatory elements from the turquoise killifish genome, recently availableasabacterial artificial chromosome (BAC) and the zebrafish heat-shock protein 70 (HSP70) are predicted toworkinthe turquoise killifish, aspreviously demonstrated withthe 3. Prepare aconstruct flanked byspecific Tol2DNAsequences. Many transgenic constructs (developed forzebrafish or transposase mRNA. 2. FollowSteps19–29of the main PROCEDUREtolinearize the PCS2FA withNotI enzyme, and tosynthesize and purifythe Tol2 and alternatives canbefound onthe Tol2Kit website: manufacturer’s instructions. The PCS2FA plasmid isavailablefrom Kawakami ( 1. For (iv) the detection of germ-line transmission is different, because of the fact that integrationplasmid containing is anexogenous random promoter and gene (described of interest (flanked bytwo below,Tol2 sequences) isco-injected(described below); and see nCasn9 synthesis (Steps19–29),withspecificdifferences highlighted below);(iii)an exogenous gene isintroduced, and therefore a (ii) instead of nCas9nmRNA,Tol2 transposase mRNAissynthesized (the overall protocol for Tol2 mRNAsynthesis resembles thatof However, there are four main differences ( Xenopus randomly integrate into the genome. Thissystemhasbeendemonstrated toworkinmany vertebrate cells, including zebrafish, (such asagene cassette)canbecloned betweenthese sequences, and inthe presence of the transposase protein the cassettewill transposase protein thatcancatalyzetransposition of aconstruct flanked byspecific DNA transposons are efficient tools for the generation of transgenic animals Box 1

Several stepsdescribed inthe current protocol for CRISPR/Cas9 genome editing canbefullyusedfor Tol2-based transgenesis. CR CR CR TROU

I I I T T T 2 in vitro 1 I I I , chicken, mice and humans : CAL CAL CAL B

h LES ttp://www.genome.clemson.ed

|

Tol2-based transgenesis STEP STEP STEP transcription of Tol2 transposase mRNA,usethe PCS2FA plasmid H OOT The transgene canrandomly integrate into several placesinthe genome, and backcrosses should beconducted until The purityof the co-injectedDNAplasmid (containing atransgene of choice) isimportant. Use Maxiprep (Qiagen), When trying anew promoter, itisrecommended touseasmall surrogate marker onthe same plasmid, such asa γ -cryst

I

N G µ ) promoter g/ Fig. 2 Fig.

µ l) µ

g/ c ), as their germ line could be be could line germ their as ),

µ 3 74,7 9 µ l) (expression inthe lens; W. Wei, personal communication). Selecthatched fish(fry) expressing the l recommended volume) astabulatedbelow:

5 . u Fig. . Up to35 6 ): (i)there isno gRNAtarget selection and synthesis (Steps1–18do not apply); Amount 1–2 1–2 3 35 7 0 7 promoters. New transgenic constructs couldbegenerated using the Tol2Kit µ µ µ µ µ l l

l

l l http://tol2kit.g

µ

●

l

T IMI - Final concentration 0.1% (wt/vol)

N G 30 ng/ 40 ng/ an HDR-based knock-in approach ( approach knock-in HDR-based an knockout approach, and for are 10–30 founders sufficient usually an NHEJ-based using line a stable generate to successfully ficient suf usually are founders 2–10 targets, gRNA efficient For allele. desired the for heterozygous be will progeny F1 the and indels, of set a unique exhibit will founder F0 individual each Note that life span, which allows one to quickly generate stable lines, to to lines, stable generate quickly to one allows which span, life compressed and time generation short its is approaches mental experi for killifish turquoise the using of advantage main The Advantages and limitations 400 mM enetics.utah.edu/index.php/Main_Pag 2–3months 7 µ µ 3 [email protected] cmlc . The medaka l l 7 5 , purifiedusing a Maxiprep kit,according the ) promoter β -actin promoter from Tol2 DNAsequences Tol2 natureprotocols 7 6 (expression inthe heart, see element encodes afunctional ). Additional details, tools 7 4 . Alarge DNAinsert Xenopus e Fig. Fig. .

| VOL.11 NO.10VOL.11 6 ). 2 8 and zebrafish Xenopus protocol Fig.

| 2016

7

) 5 Fig.

with

3

) or

2 | 6

9

, 2015 ). - - © 2016 Nature America, Inc. All rights reserved. for the killifish model system using this protocol. Finally, this this Finally, protocol. this using system model killifish the for adapted and implemented quickly be could advances these All sequences parameters selection editing successful detecting for methods by faster enhanced be could protocol CRISPR/Cas9 existing the of specificity and efficiency the endogenous Furthermore, genes. of activation or repression reversible allow which key example, For advances are possibilities. CRISPR interference new open also but approaches ing the as such systems, split these for required sequences short the of sys knock-in the tematic allow would template, (ssDNA) DNA a single-stranded with combination in system, CRISPR/Cas9 the example, For transgenesis. Tol2-based and editing genome CRISPR/Cas9 the both using model killifish turquoise the in introduced be could sequence (UAS) activating Gal4/upstream include zebrafish in used successfully been have that systems Split tracing. lineage for as well as genes, in vivo, regulation gene conditional for allow systems’ ‘Split approaches. we thus and genetic additional adapting for engineering, platform standardized a provide genome and husbandry to aspects related key optimized and developed further we protocol, this editing transgenesis Tol2-based the Extending protocolthe of applications phenotype. same the have several mutant alleles for the same gene and to assess whether they killifish. An turquoise additional way to test the for potential off-target effects is in to create fast relatively are which backcrosses, by part, in least at mitigated, be could effects Off-target effects. is for requirement and off-target the design target potential specific system CRISPR/Cas9 the of limitations the of one However, approaches high-throughput with compatible more a much faster design, and and simpler experimental it is therefore for allows aspect This nuclease. Cas9 the to guide RNA molecule provide targeting specificity, to the CRISPR/Cas9 system relies domains on an DNA-binding modified on rely which approaches, engineering genome other those Unlike killifish. turquoise the have in but approaches not those yet organisms, established been have been successfully used to generate targeted mutations in other hair. and glands mammary lungs, as such mammals, in present are that organs and features the all have not do fish Finally, killifish. turquoise the for available are the is challenge another and mutants tools so of (i.e., number limited on) antibodies, that mice, and zebrafish with Compared studies. life-span for particular in needed, be will optimization further engineering, genome for verified experimentally are that ments requirements, probably contributes to differences dietary in reported life-span that measure limitation a is quality) water and (including temperature of density, fish lack The husbandry phenotypes. adult standardized study to and them backcross 2016 protocol in could approaches be for adapted genome engineering protocol Advances in the CRISPR/Cas9 system are continuously emerg are system continuously Advances in the CRISPR/Cas9 (e.g., ZFNs and TALENs)technologies genome-editing Several 3 7

, which should not only improve the efficiency of existing existing of efficiency the improve only not should which , | VOL.11 NO.10VOL.11 6,10,2 such as precise temporal and tissue-specific expression of expression and tissue-specific such as temporal precise 2 have been successfully used in the turquoise killifish. In In killifish. turquoise the in used successfully been have 6 8 4 (which will increase the flexibility of target selection). . Although this protocol provides detailed guidelines guidelines detailed provides protocol this . Although 5 6 , Cre/ | 2016 loxP 31,65–6 loxP 28–3 and UAS and sequences. | natureprotocols 7 57–5 52,5 , as well as expansion of the PAMthe of , site as expansion as well 0 and CRISPR/Cas9-based genome genome CRISPR/Cas9-based and 9 3 and Tet-ON , improved gRNA specificity and and specificity gRNA , improved 61,6 2 and CRISPR activation 6 0 . These approaches 2,31,45,54,5 63,6 5 4 - - - . ,

of strain contamination, it is advised to tanks, as it adult use lidded is advised contamination, strain of demonstrate aggression, and they can should be separated. Tofemales) reduce (without the possibility density high at housed are that fish Male tank). 3-liter per fish (1–3 density high at housed be not should cm) 6.5–7 of length (maximum the killifish rate, turquoise growth optimal For day. per change water ~10% and systems lating recircu water available in commercially grown can be efficiently section, ‘Hatching’, PROCEDURE Steps 46–52 and compared with other fish models (see ‘Development of the Protocol’more ‘hands-on’forstageturquoisethis at needed iskillifish time and it requires both aquatic and nonaquatic phases, and therefore nonsynchronous,largely be can killifish turquoise the in opment ‘egg to egg’) of the turquoise killifish is 5–7 weeks. Embryonic adults devel(see ‘TIMING’ section and ing (d.p.h.), the animals reach sexual and maturity are considered the animals reach sexual maturity). At the age of 20–30 d tional),post and shortly afterhatch they are referred to as ‘juvenile fish’ (until opera fully is bladder swim and disappeared almost has sac yolk the days(until as referredfewtoare first hatchedfish ‘fry’the for post fertilization (d.p.f.), animals are referred to as ‘embryos’. Freshly optimized. have been yet not protocols recovery and freezing However, gametes. of sperm preservation long-term or tilization squeeze sperm and eggs, which could be for beneficial larger female fish a yielding larger number of eggs. It is possible to quency of feeding, as well as on the overall age and size of fish, with worms blood plemented with live/frozen food such as with compared zebrafish, higher and high-quality is food pellets (see ‘Reagents’) consumption can be food sup mating, frequent Resource (ZIRC): Center International Zebrafish the from in Facilities’ Zebrafish Research of ‘Diseases see facilities, research in diseases fish common of treatment and diagnosis the regarding information by (800–4,000 (subdued lighting salinity and higher flow slow (~5 water liters/h) lighting), dimmer ceiling prefers It fish. hardy makes relatively which a it salinity), and levels oxygen pH, temperature, of range a (including habitat its in naturally occur that parameters strain). and birth of date (specifically details required the all ( jump occasionally can fish Large-scale husbandry and maintenance. husbandry Large-scale guidelines. ethics institutional to, relevant adhere and by, approved be must killifish turquoise of use experimental and care organism, model vertebrate a is it as Furthermore, section. the and ‘PROCEDURE’ section in this are addressed aspects cific experiments animal of reporting the for guidelines ARRIVE the follows protocol This setup’). ‘Reagent (see colony a of killifish turquoise col,the breeding establishment specifically this have proto to aspects before initiating Several be considered design. Experimental cycles life similar sharing species strains killifish turquoise other From fertilization to hatching, which normally occurs 14–20 d 14–20 occurs normally which hatching,to fertilization From and maturity sexual rapid growth, accelerated the of Because water of range wide a withstand can killifish turquoise The Oodinium µ S). Higher salinity S). also velvet Higher inhibits salinity caused disease 4 , which is a parasitic dinoflagellate. For further further For dinoflagellate. parasitic a is which , 2 8 , with an optimal temperature range of 25–28 °C, 25–28 of range temperature optimal an , with . Fecundity is dependent on food quality and fre and quality food on dependent is .Fecundity http://w

ww.zebrafish.org/healt Fig. 1 Fig. 1 0 , as well as other annual killifish killifish , annual as as other well 5 Fig. . b ), and to label each tank with with tank each label to ), and 1 ). Thus, the life cycle (from Artemia The turquoise killifish (brine shrimp) or h . Fig. 4 6 in in vitro 9 , and spe and , b ). fer ------

© 2016 Nature America, Inc. All rights reserved. • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • REAGENTS M Please refer to (MSDS)for theMaterial DataSheets more Safety details. fish thathavebeen tricaine),exposed to protectivegloves be used. should chemical. When you powder are tricaine handling handling (or while Tricaine (Sigma-Aldrich, cat. no. A5040) NotI (NEB, cat. no. R0189S) Miniprep Kit (Qiagen, cat. no. 27104) QIAquick nucleotide removal kit(Qiagen, cat. no. 28304) Sodium Acetate (3M), pH5.5(Ambion, cat. no. AM9740) EDTA (0.5M; pH8.0; Ambion, cat. no. AM9260G) no. AM9516) cat. Invitrogen, mg/ml; (15 Coprecipitant GlycoBlue kit(Qiagen,PCR purification cat. no. 28104) dNTP solution (100mM; set NEB, cat. no. N0446S) T4 DNA (NEB, polymerase cat. no. M0203S) (NEB,BSA, grade biology molecular cat. no. B9000S) NEB buffer 2(NEB, cat. no. B7002S) EndoFree Maxiprep kit (Qiagen, cat. no. 12362) Agarose (Life Technologies, cat. no. 16500-500) cat. no. C4040) One ShotTOP10 competent cat. no. K2800-20) Zero Blunt TOPO PCRcloning kit(Life Technologies, TOPO TA cloning kit(Life Technologies, cat. no. K4600) cat. no. 37344) Methylene blue stock (2.3%(wt/vol) solution; Kordon, NaHCO CaCl KCl (Sigma-Aldrich, ACS grade) NaCl (Sigma-Aldrich, ACS grade) Yamamoto’s solution embryo Oxygen (Pemble-Halversion, tablets ‘Hatching’ sections). advance, atleastaday before itisrequired (see ‘Reagent Setup’ and fiber substrate) Coconut fiber(ZooMed Item #EE-8, quarts, loose 8dry coconut refrigerated (see ‘Reagent Setup’ section). Refrigerate thesolution at4°C. kept It for isgood several weeks if solution to needs prepared be inadvance, atleastaday before injections. Humic (Sigma-Aldrich, acid cat. no. 53680) Phenol red solution, 0.5%(wt/vol; Sigma-Aldrich, cat. no. P0290) PCR lysis buffer (Viagenbiotech, 102-T) GoTaq green master mix(Promega, cat. no. M712) PCR superMix (Invitrogen,High-fidelity cat. no. 12532-016) Proteinase Ksolution (20mg/ml; Ambion, cat. no. AM2546) cat. no. 15593) UltraPure phenol:chloroform:isoamyl alcohol (25:24:1; Life Technologies, Agarose (Life Technologies, cat. no. 16500500) Ethidium Scientific, bromide (Thermo cat. no. 15585011) 1-kb DNA ladder (Promega, cat. no. G5711) DNA100-bp ladder (Promega, cat. no. G2101) DNase/RNase-free dH T7kit(LifeMEGAscript Technologies, cat. no. AM1334) mMessage mMachine kit(Life Technologies, T7Ultra cat. no. AM1345) mMessage mMachine kit(Life Technologies, SP6Ultra cat. no. AM1340) standard desalted (Integrated DNA Technologies) template for the Custom DNA oligonucleotides (once annealed, asthegRNA serve itwill nCas9n mRNA instead used can be of (Procedure Steps 19–29) Optional: Cas9 protein NLS(1mg/ml, with PNA Bio). Cas9 The protein nCas9n expression plasmid salt(InstantSea Ocean, cat. no. SS15-10) Setup’ section). colony must establishedbefore be attempting thisprotocol (see ‘Reagent Research Animal Care and useinourlabwasapproved by theStanford Subcommittee on to, relevantguidelines. institutional ethics turquoiseAll care killifish turquoise care killifish andusehas be approvedto by, and adheremust authors uponrequest turquoiseAfrican ( killifish ATER 2 (Sigma-Aldrich, ACS grade) I 3 ALS (Sigma-Aldrich, ACS grade)  in vitro

CR I T ! 2 

I O (Invitrogen, #10977-015) CAUT transcription), 200 CAL

CR N. furzeri 4 I Coconut fiberneeds be to prepared in 5 T Escherichia coli Escherichia I (Addgene, cat. no. 47929) 7 ON I 0 CAL (10×; Reagent see Setup) As avertebrate organism, model A breeding turquoise killifish ) GRZstrain. It isavailable from http://otabs.com !

CAUT µ (Life Technologies,  M stock concentration and

CR I ON I T

I Tricaine isahazardous CAL / )

Humic acid

EQUIPMENT of NaHCO of NaHCO mM 0.2 Yamamoto’s embryo solution (10×: 170 mM NaCl, 27 mM KCl, 25 mM CaCl REAGENT SETUP • • • • • • • • • • • • • live blood worms pellets, supplemented with live with a single male with 4–5 females. Fish are fed twice a day with fooddry as pairs in a 2.8-liter tank. For spawning, fish are housed in a 9.8-liter tank with a 12-h light/dark cycle killifish are housed at 26 °C in a central filtration recirculating system, African turquoise killifish husbandry and maintenance for °C) several months. (20–25 temperature room at kept be could solution The infection. parasitic limit to solution) stock (wt/vol) (2.3% solution 1× the to added be sterilize the solution through a 0.22- • • • • • • • • • • • • • • • • Borosilicate microcapillaries with filament (Sutter, cat. no. cat. (Sutter, BF100-58-10) filament with microcapillaries Borosilicate 100 platesLB agar with 5Prime, (Eppendorf Phase locklight geltubes cat. no. 2302820) available providers. orderedshould be inadvance, locally depending on theshippingof time formats, ready to print) MethodsSupplementary Injection mold(welldepth: 1.1mm; 0.95mm, wellwidth: the See F123601G andF123602G) Gilson PIPETMAN (Fisher Scientific, cat. nos. F123600G, F144801G, Dumont tweezers #5(WPI, cat. no. 500342) Please refer to theMSDSfor more details. eyes are immediately. eyenotwashed damageand permanent canoccur if gloves handling. during Exposure to theskinandeyes may causeirritation, agent. Avoid eyes, contact with skinandclothing, andwear protective cat. no. 425044) hypochloriteSodium (NaClO; 10–15%available chlorine; Sigma-Aldrich, TE buffer (1×; pH8; Fisher, Thermo cat. no. AM9849) Isopropanol, ACS plus (Fisher Scientific, cat. no. A416-500) Ethanol (100%; 200proof; Chemical) GoldShield Rossville Direct) Shrimp (Brine eggs Premium shrimp brine grade Otohime (Reed fishdiet Mariculture) Potassium chloride (KCl; 2M; Affymetrix, cat. no. 75896) 30 Mesh sand(Homedepot, cat. no. 200000278) Compact incubator for (ThermoScientific, cat. embryos no. 50125590) America, cat. no. MA285) Stage micrometer, into 1mmdivided 0.01mmunits(Meiji Techno 8-Inch (OXO finemeshstrainer Good Grips, cat. no. 38991) this protocol. assembledbe according to themanufacturer’s guidelines before attempting Instrument) Scientific Instrumentation), assisted by aback-pressure(Warner unit micromanipulator andanM-PIP micropipette model holder (Applied switch to pulsetheinjectedsolution into theembryos, anMM3model stand, magnetic an MHCmodel anMMPI pressure model injector, afoot (AppliedInjection apparatus Scientific Instrumentation),which includes Nikon C-PSstereoscope andZeiss KL1500LCD opticfibers Sutter InstrumentP-87 60 ×15mmPetri dishes(Fisher, cat. no. 0875713a) Breeding (Pentair, tanksets SBTANK Tank-2) cyclerThermal (MJResearch PTC-200) before attempting thisprotocol (see ‘Reagent Setup’ section). to houseabreeding turquoise killifish colony, be established must andthey (Aquaneering) Commercially available water recirculating 2.8-liter systems tanks with cat. no. P7339-901) Pestle for a1.5-mltube, RNase andDNase free (Argos, 0.22- 1.7-ml Tubes (Genesee scientific, cat. no. 24-282) 24-412, 24-430) tips, pipet lowBarrier binding (Genesee scientific, cat. nos. 24-401, 24-404, Kimwipe (Kimtech Science) µ m Filter (Genesee scientific, cat. no. 25-227) 3 in 100 ml of H of ml 100 in 

 3 CR 4 ! ) 8

.

CR CAUT I Add 7.5 g of NaCl, 0.2 g of KCl, 0.2 g of CaCl KCl, of g of 0.2 NaCl, g 0.2 of g 7.5 Add T I I CAL T I I CAL natureprotocols µ  ON It isrecommended apparatus thattheinjection g/ml Ampicillin (Teknova, cat. no. L1004) for 3D printing design, for 3Dprinting inSTLor DWG file 2 2

, and conductivity 3,500 of CR O; adjust the pH to 7.3 with NaHCO with 7.3 to pH the adjust O; Sodium Hypochlorite Sodium isastrong oxidizing Water recirculating systems are anefficient way I Artemia T I CAL µ m filter. Methylene blue (100 The 3D-printed injection mold injection 3D-printed The (brine shrimp) or fed exclusively

| VOL.11 NO.10VOL.11 µ

S. Fish are housed

Turquoise protocol | 2016

3 2 µ ,filter- and and 0.02 g 0.02 and l/l) should

|

2017

2 ,

© 2016 Nature America, Inc. All rights reserved. be be limited to Gs, as follows: 5 in provided is example  detailed (a editing successful of identification the facilitate site can restriction unique a to proximity close in targets gRNA Selecting interest). of sequence the (flanking amplification PCR for oligonucleotides suggested and sites restriction possible with presented is sequence target each addition, In positions. genomic their at displayed are they and scores, quality to according color-coded are wide.Target sequences genome off-targets potential predict can it and sequences), pasted or regions genomic identifiers, (gene inputs of range 2| nothobr browsers: genome killifish turquoise recent two at available are models http://gen 1|  T required for adapting the Procedure for Tol2 transposon-based transgenesis are described in  PROCE have killifish turquoise the for designed needles injection The injections. needles injection of Preparation EQUIPMENT SETUP kept refrigerated. Refrigerate thismixture at4°C. It itis remains for good several weeks if (water from therecirculating system). Mix itwellandautoclave themixture. Humic acidpreparation Use afew weeks. itwithin keep itinclosed containers (such boxes) tip asused atroom temperature. Once cooled, squeeze out water (keeping itmoist, but not dripping), and Coconut preparation fiber standard procedures for used fish( widely system. or ’bleaching’ Disinfecting according isperformed embryos to of disinfected progeny caneventually moved be into themainrecirculating (see andmaintenance’).‘Large-scale husbandry fishare healthy, If their (preferably area), inaquarantined monitored andtheir healthshouldbe Steps 46–52). Hatchedbe fishshould separatelykept from the colony and hatch only thatare individuals ready fully (see ‘Hatching’, PROCEDURE coconut fiberand to incubate them at26°C. Monitor 3–4d,every them bleach, with the embryos to them to transfer anew Petri moist dishwith regular mail. via shipped canbe they Upon arrival,to disinfect itisimportant Parafilm with sealed and,when weather conditions arebelow not freezing, moist coconutwith eyeswhen visible fiber ( are strains, are embryos in60-mmPetri usually shipped of distribution dishes eggs Receiving or shipping fertilized 2018 arget selection protocol (vii) (vi) (v) (iv) (iii) (ii) (i)

Box 2

CR CR CR

Identify gRNA target sequences using CHOPCHOP ( CHOPCHOP using sequences target gRNA Identify using orthologs vertebrate between regions conserved compare and interest, of genes) (or gene a Select

|

I I I

VOL.11 NO.10VOL.11 Wash them twice with5–7mlof autoclavedsystemwaterfor 5mininthe same plate. Wash them once in5–7mlof autoclavedsystemwaterfor 5mininthe same plate. Incubate the embryosin5–7mlof bleachsolution for 5mininthe same plate. Transfer embryostoaclean10-cmPetri dish,and incubate them in5–7mlof bleachsolution for 5mininthe same plate. T T T from any remaining coconut fiber debris). Transfer embryosinto a10-cmPetri dish,and washthem with5–7mlof autoclavedsystemwater(inorder toseparate them Freshly prepare bleachsolution: 400 D Transfer the embryosinto anew 6-cmPetri dishwith5mlof 1×Yamamoto embryosolution. I I I anchius.info/NFINg URE CAL CAL CAL ome.ucsc.edu |

Steps 1–18 are omitted for Tol2-based transgenesis Genome editing using the CRISPR/Cas system is described in the main PROCEDURE. Modifications that are STEP Disinfectingembryos by bleaching ● In this protocol, T7 polymerase is used for gRNA synthesis; therefore, the first two 5 | 2016

T Dissolve 1g/lhumic insystem acid water IMI

Presoak coconutwith dH fiber |

https: / N natureprotocols (conserved regions are less likely to be alternatively spliced). The turquoise killifish gene killifish turquoise The spliced). alternatively be to likely less are regions (conserved G

1–2 d b A good needle is critical for successful successful for critical is needle good A (ref. (ref.

′ -GG-(N)18-NGG-3 //chopchop.rc.fas.ha For acolony initiating or for the Box 2 1 2 Fig. 4 ). ). µ l of NaOCl (stocksolution of 10–15%(vol/vol))in1literof autoclavedsystemwater. b ). Petri dishesare then 2 O andautoclave. ′ (as demonstrated for the selected gRNA targets in http:/ rvard.edu

/africanturquoisekil https://chopchop

/ (refs (refs harder to break, thechorion more canpenetrate easily. thisneedle Pulled brokencan be usingeither forceps or aKimwipe. itisslightly Although that tip sharper 2resultsOption aslightly inasimilar-shaped with needle breaking usingforceps thetip usually results inanopening thatistoo big. broken isbest tip The by gently on rubbingthetip aKimwipe, because for filamented microcapillaries both options. been optimized on a Sutter Instrument P-87 (with a trough filament),( designs and needle using different two for parameters The chorion. thicker the through penetration easier allows which injections, zebrafish for used needles the than tip flexible less and shorter a modeling claymodeling to holdthem. stored canbe needles (for years) inaclosed of Petri two strips dishwith Option Option 2 Option 1 design Needle Option 1producesOption point. astrong andisgreat asastarting needle ● 2,4

8 T ), and additional information is provided in in provided is information additional and ), IMI .rc.fas.harvard.edu lifishbrowser.org Line 2 1 N G Pressure 1h 500 500 450 Fig. 5 Fig. Ramp Ramp value: Ramp value: Ramp value: / Box Fig. 2 Fig. (ref. (ref. / ). CHOPCHOP accepts a wide a accepts CHOPCHOP ). 69 69 °C 14 °C 45 °C Heat a 1 ) are tabulated below, and they have they below,and tabulated are ) . a 6 Fig. Fig. 2 ). ) and and )

′ nucleotides should Pull 10 20 30 a http://www. ). Velocity

20 20 40

Time

200

0 0

© 2016 Nature America, Inc. All rights reserved. can be used to catalyze the gap-filling7| (synthesis of DNA in the 5 6| 5| oligonucleotide stock into aliquots, and freeze them at −20 °C to avoid freeze-thaw cycles.  and S4,and Table S1inHarel gRNA templatefor the 4| DNase-free reagents.  S when using other turquoise killifish strains). or even completely block it. Thus, the step of verifying the desired target sequence by sequencing is essential (specifically  by direct sequencing of the purifiedPCRproduct ( and generate anamplicon sizeinthe range 300–1,000bp.Order standard desalted oligonucleotides, and verifythe sequence amplify the genomic region containing the targeted sequence; the oligonucleotides should flankthe sequence of interest 3| O Total Nuclease-free water BSA (20 mg/ml) T4 DNA polymerase (3,000 units/ml) dNTP mix (25 mM) C 6 5 4 3 2 1 C Total Nuclease-free water NEB 2 buffer 10× Variable oligonucleotide (200 Universal reverse oligonucleotide (200 C Variable oligonucleotide oligonucleotide Universal reverse ynthesis ynthesis of g

omponent ycle number omponent

ligonucleotide

CR CR CR Use the following program onastandard thermocycler toanneal the oligonucleotides: Prepare the following annealing reaction inaPCRtube, and mixitbypipetting: Order the oligonucleotides (200 By using either CHOPCHOP orPrimer3 ( After annealing, 5 I I I T T T I I I CAL CAL CAL

All steps involving RNA synthesis and handling should be done in a clean environment, using RNase- and STEP STEP RNA

95 95 °C This universal reverse oligonucleotide will be used in all the gRNA template generations. Divide the Naturally occurring genetic variation (even in the inbred GRZ strain) could reduce the efficiency of editing, Denature s s ● ′ ssDNA overhangs will remain on both sides of the template (

in vitro T IMI 30 30 s AATAGCAAG TAATACGACTCACTATA GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACG µ N M) G transcription; seetablebelow(see et al. 1–2 d 12 12 °C 25 °C 72 °C 37 37 °C 2 µ ). A µ M) nneal M stockconcentration, standard desalted) that,once annealed, willserveasthe

S 2 2 min 2 2 min 2 min 2 min equence (5 http://bio [GG-( A mount 10 10 7 7 1 1 1 A Fig. 2 4 4 °C N 8.8 8.8 0.2 0.5 0.5 mount 10 10 µ µ µ µ )18] µ l l l l ′ l to3 µ info.ut.ee/primer3-0 Final µ µ µ µ

l l l l l GTTTTAGAGCTAGA a Forever ). ′ ) ′

→ Final concentration 3 ′ Fig. 2 ). Add the following to the reaction tube and mix by pipetting: Final concentration 20 20 20

1×

0.15 0.15 units/ µ µ a 0.4 0.4 mg/ml M M , additional examples canbefound inFigs. 6 1.25 1.25 mM .4.0/primer3 core target sequence in bold and unique for each gRNA Used for generation of all gRNA templates µ Fig. 2 l natureprotocols / ), design oligonucleotides to b , top panel), and T4 DNA polymerase P urpose

| VOL.11 NO.10VOL.11 protocol | 2016

|

2019

© 2016 Nature America, Inc. All rights reserved. using the supplied buffer(1×NEB 3.1). 20| manufacturer’s instructions. 19|   S  18| gel. Adiscrete band should beseen( 17| Measure the concentration using NanoDrop, and adjustittoaconcentration of 0.5–1 16|  15| 14|  13| ethanol: the 12| and incubate itfor anadditional 15minat37°C. 11| to the manufacturer’s instructions. 10|  synthesis. gRNA for 0.5 ofroughly concentration a expect and NanoDropinstrument, 30 in elute and protocol, 9| 8| 2020 Total Ethanol 100% (molecular biology grade) GlycoBlue Coprecipitant 3M Na Acetate Nuclease-free water Reaction mix C protocol ynthesis ynthesis of

omponent

PAUSE PAUSE CR CR CR CR Linearize 5 Purifythe nCas9nexpression plasmid DNAusing aMaxiprep kit,byresuspending the DNApelletaccording tothe Prepare 2-to3- Run2 Resuspend the pelletindH Remove the supernatant, respin the tubefor afewseconds and remove allthe residual fluid withafine-tipped pipette. Pellet the gRNAs for 15 mininachilledmicrocentrifuge (4°C)attopspeed(~11,000 Mixthe contents well(orvortex briefly), and chill the mixture at–20°C for atleast15min. Add 1 ForgRNAsynthesis, use1 Precipitate the RNA by adding the following components in the order listed, and mix well before adding adding before well mix and listed, order the in components following the adding by RNA the Precipitate

Clean the annealed and gap-filled oligonucleotides using a PCR purification kit according to the manufacturer’s manufacturer’s to the according kit purification PCR a oligonucleotides using gap-filled and annealed the Clean Use astandard thermocycler toincubate the reaction at12°Cfor 20min. | I I I I VOL.11 NO.10VOL.11 T T T T I I I I CAL CAL CAL CAL

PO PO µ µ

If Cas9 protein will be injected at Step 37 (instead of nCas9n mRNA), then Steps 19–29 can be omitted. l of TURBODNase (provided inthe T7MEGAscript kit)tothe reaction toremove the DNAtemplate, mixitgently l of the reaction using aformaldehyde loading dye (provided inthe T7MEGAscript kit)ina 1% (wt/vol)agarose For Tol2 transgenesis, transposase mRNA (rather than nCas9n mRNA) is synthesized as described in in described as synthesized is mRNA) nCas9n than (rather mRNA transposase Tol2 transgenesis, For I I STEP STEP NT NT Cas9 the template can be stored at −20 °C for several months. Aliquots can be stored at −80 °C for several months. µ g of the nCas9n expression plasmid DNAwith1–2 Do not let the pellet completely dry; otherwise, it will not dissolve. The reaction can be placed at –20 °C overnight with no decrease in yield. | m 2016 µ RNA l aliquots and store them at−80°C. | natureprotocols

µ ● l of Elution buffer (supplied in the kit). Measure the concentration using a standard a using concentration the Measure kit). the in (supplied buffer ofElution l

T IMI µ 2 l of the elutedtemplateina20- O or1×TEbuffer(~30 N G 1–2 d Fig. 2 b , bottompanel). A 451 451 300 115 mount 15 15 20 1 1 µ µ µ µ µ µ l l l l l l µ l), byletting the tubesitonice for 30minwithoccasional flicking. Final concentration µ 0.1 0.1 mM µ l T7MEGAscript transcription reaction, according g/ml. The resulting product is used as a template template a as used product is resulting The g/ml. µ l of NotI at 37 °Cfor 2h,inatotalvolume of 40 µ g/ µ g l. ).

Box Box

µ 1 l . © 2016 Nature America, Inc. All rights reserved.  Elute indH 31| locus edited the G right, the (on A left, the (on mutation first the edited, successfully is it Once protein. TERT killifish turquoise the in (K836) residue lysine a for encoding region genomic Harel in published (previously in shown example The PAMsite. the to possible as close as be mutations introduced the that recommended 30| introduced (or removed) from the genome. new sequences into the genome (i.e., knock-in). This optional section should be included only if a specific sequence is to be  O  during purification steps (Steps 24–29).  store them at−80°C. 29| 1% (wt/vol)agarose gel. Awell-defined band should beseen,similartothatobservedinStep17. 28| 27| 26|  mMessage mMachine SP6kit. 25| incubate the mixture for anadditional 15minat37°C. 24| reagents for poly(A) tailing. to verify that it includes a poly(A) site. Otherwise, the mMESSAGE mMACHINE ULTRA (SP6 or T7) kits include additional an SV40 polyadenylation (poly(A)) site. If an alternative Cas9 expression plasmid is chosen by the user, it is recommended  SP6 kitaccording tothe manufacturer’s instructions. 23| mRNA synthesis.  and elutein50 22| ? the incubation time or amount of enzyme. that should be ‘sharper’ and usually higher than the uncut plasmid. If digestion is incomplete, repeat Step 20 and increase used as a template), thus reducing the overall efficiency of mRNA synthesis. Complete digestion should yield a single band  gel toverifycompletedigestion of the plasmid. 21| this this kit rather than a PCR purification kit.

ptional: ptional: ssD TROU

PAUSE CR CR CR CR CR CR CR Measure the concentration using NanoDrop, and adjustthe concentration to~1 Run2 Incubate the resuspended nCas9nmRNAat65°Cfor 10mintocompletelydissolvethe mRNA. Resuspend the nCas9nmRNApelletindH Purifythe resulting mRNAusing lithiumchloride precipitation according tothe manufacturer’s instructions inthe Add 1 Transcribe cappedand polyadenylated nCas9nmRNAfrom the purifiedplasmid templateusing the mMessage mMachine Purifythe digested nCas9nexpression plasmid using aPCRpurification kit,according tothe manufacturer’s instructions, Run1 Order the ssDNA(standard desalted oligonucleotide) and purifyitusing the QIAquick Nucleotide Removal kit. Design ssDNA with homology arms (i.e., 30–50 bases, each side) flanking the gRNA target site. It is It site. target gRNA the flanking side) each bases, 30–50 (i.e., arms homology with ssDNA Design I I I I I I I T T T T T T T I I I I I I I B CAL CAL CAL CAL CAL CAL CAL LES

PO µ µ µ 2 O or1×elution buffer(provided inthe kit)atafinal concentration of 100–200

HDR uses a homologous DNA template for repairing the DSB, and thus it can be used to precisely introduce l of TURBODNase (provided inthe mMessage mMachine SP6kit)tothe reaction mixture, mixitwell and l of the reaction alongside acomparable amount of anuncut plasmid (~125ng) ona1.5%(wt/vol)agarose l of the reaction using a formaldehyde loading dye (provided inthe mMessage mMachine SP6kit)ona H I STEP STEP STEP STEP STEP STEP NT OOT NA µ Aliquots could be stored at −80 °C for several months. → 2 template for knock-in via HD l of 1×Elution buffer. . The QIAquick Nucleotide Removal kit is optimized for oligonucleotides; therefore, it is advised to use If the concentration of mRNA is too low, transcribe several reactions (Step 23) and pool them together Do not let the pellet fully dry; otherwise, it will not dissolve. The nCas9n expression plasmid used in this protocol is cloned into the pCS2 backbone, which includes DNA should be free of contaminating proteins and RNA, as these might affect the quality and yield of The remaining undigested plasmid DNA can lead to very long RNA molecules (the full plasmid would be I C) is silent, and it will change the PAM site. Changing the PAM site will prevent Cas9 from recutting recutting from Cas9 prevent will PAMsite the Changing PAMsite. the change will it and silent, is C) N G et al. et 2 ) displays the core sequence of the ssDNA template used to specifically edit a edit specifically to used template ssDNA the of sequence core the displays ) → G) will give rise to the K836R amino acid change. The second mutation mutation second The change. acid amino K836R the to rise give will G) 2 O orTEbufferataconcentration of 1–3 R

●

T IMI N G 1–2 d natureprotocols µ g/ µ µ g/ l. Prepare 2-to3- µ µ l. M.

| VOL.11 NO.10VOL.11 µ

l aliquots and protocol Figure 2 Figure |

2016

d |

2021

© 2016 Nature America, Inc. All rights reserved. (see ‘Equipment Setup’ and and Setup’ ‘Equipment (see chorion thicker the through penetration easier allows This needles. injection zebrafish with compared  mRNA and Cas9 protein. primarily use nCas9n mRNA, as it works with high efficiency, and we have not directly compared the efficiencies of nCas9n can be used at a final concentration of 200 ng/  mixture, and waitfor the mixture tomigrate tothe tip. 37| 36| ( provider; therefore it is advised to accurately measure the final product. From our experience, Hi-Def Acrylate and positioning of fertilized eggs fairly straightforward. Different materials might vary in quality depending on the mold with optimized dimensions (  (it willfloat).Thisproduce sixtroughs thatwill hold eggsinposition ( 35| grains should be ~600 mesh should be ~1 mm (see Materials). If sand trays are used, for good separation between eggs and sand, the size of sand  single-cell ortwo-cellstage. Yamamoto embryosolution atroom temperature. Injections should startwithin1–2h,inorder for embryostobeatthe using afine mesh strainer and astandard glass Pasteur pipette. Keep the eggsina6-cm Petri dishwith5ml of 1× 34| them between user. choice the on the and depends efficient, equally be can methods both tanks, breeding the to once However, uses. accustomed are fish subsequent for recycled is it before and time first the for it using before it autoclave to and sand wash thoroughly to important is it that Note beginning. the from of eggs clutches larger obtain to easier it  eggs. yield might fewer it and pair, mating the for period’ ‘training a be would events mating of couple first the that Note larger clutches of eggs for injection. Fish can be set up for mating weekly, and as frequently as every 3–4 d 3–4 every as frequently as and weekly, mating for up set be can Fish injection. for eggs of generate clutches helps larger which h), (4–5 time of period longer a for collected be could eggs Therefore, zebrafish. with h.p.f. ~3.5 at stage fertilization after two-cell division (reaching cell of rate slow relatively the of Because injections. for suitable are large a that eggs producing of for clutch sufficient usually is females 10–20 Crossing Setup’). ‘Reagent (see colony the in fecundity  approved by the Stanford Subcommittee on Research Animal Care. approved, and relevant institutional ethics guidelines must be followed. Care and use of turquoise killifish in our lab is ! fish. Alternatively, sand trays canbeusedaspreviously described fish the evening before injection, using abreeding tank( 33| described in  Injection  32| 2022 http://www.shapeways.com protocol

CAUT

PAUSE CR CR CR CR CR CR CR Prepare the injection mixture astabulatedbelow, and keep itonice. Back-fillthe needle with2–5 Break the needle (see‘Equipment Setup’section) bygently rubbing the tiponaKimwipe. Make a1.5%(wt/vol)agarose plate, and whilethe agarose isstillhot layaplastic injection mold onthe surface Onthe day of injection, remove the barrier and letthe fish mate for afew hours (usually 4–5h). Next, collecteggs Setupseveral breeding groups pertank(one male with2–3female fish) of sexually mature (1–2 months old)wild-type Prepare 2-

| I I I I I I I VOL.11 NO.10VOL.11 T T T T T T T I I I I I I I I ON CAL CAL CAL CAL CAL CAL CAL

PO ● As the turquoise killifish is a vertebrate model organism, care and use of the turquoise killifish has to be

For Tol2-based transgenesis, injection is performed as described in Steps 33–39, using the injection mix

I

Box STEP STEP STEP T STEP STEP STEP NT IMI µ Aliquots could be stored at −20 °C for several months, with no observed decline in efficiency. l aliquots and freeze them at−20°C. 1 N Alternatively, preliminary tests in our lab suggest that Cas9 protein (Cas9 protein with NLS, PNA Bio) Use the supplied 3D-printing design (in STL or DWG file formats, ready to print) for an injection The average size (diameter) of eggs is 1.3–1.35 mm. Therefore, for retaining the eggs, the holes of the | Mating using sand trays instead of a breeding tank ( tank of breeding a instead trays sand using Mating The needles designed for turquoise killifish injection have a shorter and less flexible tip tip flexible less and shorter a have injection killifish turquoise for designed needles The For injections, it is best to plan for a yield of 100–300 eggs according to the observed observed the to according eggs 100–300 of yield a for plan to best is it injections, For 2016 . G 1–2 d µ | m m (corresponding to ‘Mesh 30’; see ‘Equipment’ section). natureprotocols Fig. 5 Fig. / ) ) works well. S a upplementary upplementary Methods ). Thus, turquoise killifish injections might also require some practice. practice. some require also might injections killifish turquoise Thus, ). 7 1 ), there is less urgency for injection in turquoise killifish compared compared killifish turquoise in injection for urgency less is there ), µ l l instead of the nCas9n mRNA (I.H., data not shown). However, we Fig. 4 ). ). Using these optimized dimensions makes handling a ), which contains abarrier toseparate the male and female 28,2 9 . Fig. 4 Fig. Fig. 4 a ) is more natural for the fish, and makes makes and fish, the for natural more is ) a ). µ l of injection

48,7

2

.

© 2016 Nature America, Inc. All rights reserved. of Tol2-based transgenesis is evaluated as described in provide two additional alternative approaches: direct sequencing (Step 44A) and enzymatic digestion (Step 44B). Efficiency or identification of the exact modified sequence is required (specifically important in HDR-based knock-in experiments), we embryos) byadding the following toa1.7-mlEppendorf tube: 40| assessment of targeting efficiency, including HRM  E ?  39| mRNA. fg of nCas9n 200–300 and gRNA fg of ~30 deliver should picoliter injected each concentrations, suggested the With pl). 10 and 2.5 between (usually killifish turquoise and nl) 2 and 0.5 between (usually zebrafish in volume injection the between difference the Note can be calculated according to the following formula: Fig. 5 a reproducible injection volume, inject into mineral oil placed on top of a micrometer slide (see ‘Materials’ section and  injection. after cell slight ofleaking the from red solution the injection Makeneedle tip. sure a that small red dot (phenol red) is in seen the  volume. cell’s the of ~10% to corresponds which mixture, injection of pl pulses—~2.5–10 param 75-ms following the with using p.s.i. 30 eters: embryos stage two-cell or single- the of cytoplasm the into inject in apparatus, seen be injection can the cell single a with egg fertilized a of example (an needle injection the towards upward 38| injection mixture could be scaled up. However, in case the needles break frequently (or a larger number of injected eggs are required), the total volume of injection mixture is kept on ice. A total volume of 10 they can be kept at 4 °C for several weeks. Needles should be filled immediately before injections, whereas the remaining  penetration. needle facilitating relaxes, it temperature, room reaches 4 at stored be can embryos chorion, the through piercing To facilitate Total Nuclease-free water Optional: purified ssDNA template from Step 32 (for HDR experiments) Phenol red (0.5% (wt/vol)) nCas9n mRNA from Step 29 (1–3 Purified gRNA from Step 18 (150–300 ng/ C Total Proteinase K PCR Lysis buffer 10–15 Injected embryos C valuation of editing efficiency

TROU

omponent omponent CR CR CR CR CR 48hafterinjection, isolategenomic DNAfrom a‘testset’(10–15embryos)from the totalinjectedeggs(100–300 Afterinjection, monitor the embryosdaily and remove dead embryos(opaqueand blueincolor). By using a stereoscope, place the fertilized eggs into the agar troughs, and orient the single cell (or the two cells) cells) two the (or cell single the orient and troughs, agar the into eggs fertilized the place stereoscope, a using By I I I I I b T T T T T ), and measure the diameter of a droplet. Under the oil, the droplet is a sphere, and therefore the injection volume I I I I B I CAL CAL CAL CAL CAL LES

A detailed example is provided in

H STEP STEP STEP STEP OOT Expect ~50% survival of injected embryos, and ~50% chimeric embryos when using efficient gRNAs. Injection parameters may vary slightly between different needles. To adjust the parameters to achieve Agarose plates can be prepared several days in advance and kept at 4 °C. If plates are sealed with Parafilm, Back-pressure should be adjusted, so should be the adjusted, Back-pressure needle in the like liquid medium looks a with ‘smoking gun’, I N G µ g/ ● µ l)

T IMI µ A 205 205 200 l) mount 5 5 N µ G µ µ l 1–3 d l l Figure 5 2 and CRISPR-STAT Final concentration µ 2 l l of injection mixture should be enough for injecting 100–200 eggs. Box . . Several robust approaches were recently developed for downstream 0.5 0.5 mg/ml 1 4 3 . p r 3 5 3 . In cases in which the indel is very small (i.e., 1–2 bp), Up Up to 10 A ° 1–3 1–3 1–2 10 mount C for 10 min before injection. As the chorion chorion the As injection. before min 10 for C 2 2 µ µ µ µ l l l l µ l natureprotocols Final concentration 200–300 200–300 ng/ 0.1% 0.1% (wt/vol) 30 30 ng/ 20 20 µ M µ

| l VOL.11 NO.10VOL.11 µ l Fig. 4 Fig. protocol b ). By using using By ). | 2016

|

2023 -

© 2016 Nature America, Inc. All rights reserved. ? are ready to hatch.  ~50 embryosperplate. containing coconut fiber, closethe lid of the Petri dishand keep itat26°C. Keep the embryosspread apart,withupto 48| and compress ittoaflatsurface (~0.5cm deep) using apapertowel. 47| ? should be replaced more frequently. If increased (more then 1–5 eggs per week) death is observed, embryos should be monitored daily, and the embryo solution  Yamamoto embryosolution weekly, and remove dead embryos(stained bluebymethylene blue). per dish.Incubate the embryosat28°Ctoincrease synchronous embryonic development. Replacewith5mlof fresh 1× 46| of posthatching (d.p.h.) period, for the animals toreach sexual maturity ( However, italsoincludes aperiod of 14–20dfor the embryostodevelop (d.p.f.) and beready for hatching, and 3–4weeks  Hatching the efficiency isabove10%(see example in injected embryos. Efficiency can range between0 and 90%inthe testcase, and itisadvisedtocontinue toStep46when 45| (B) ( ? CRISPR-STAT Option Bworksverywell,it should bepursuedmostly ifnewly developed downstream approaches (including HRM be usedfor routine genotyping, onlyifthe editedregion resulted inaloss(orgain)of auniquerestriction site. Although is required (specificallyimportant for newly generated stablelines orinHDR-basedknock-in experiments). Option Bcan 44| 43| genomic DNA cleanup kit, or use a more robust (but less accurate) PCR mix (GoTaq Green Master Mix).  SuperMix, according tothe manufacturer 42| at 95°C.The genomic DNAisnow ready tousefor aPCR. 41| 2024 protocol A

TROU TROU TROU

(ii) ) Direct sequencing CR CR CR CR (i) (i) Byusing aglassPasteur pipette, transfer the embryosfrom the 1×Yamamoto embryosolution tothe Petri dish After1–2weeks, when eyesare visible( Keep the embryosin60-mmPetri dishes with5mlof 1×Yamamoto embryosolution, atadensity of upto50embryos When successful editing isconfirmed onthe ‘testset’ of embryos(10–15),continue toStep46hatch the remaining There are 2options for downstream analysis: option Ashould beusedwhen the precise sequence of the editedregion Cleanthe PCRproduct using aPCRpurification kit.Elutein30–40 Use oligonucleotides from Step3,and 0.5–1 Crushthe embryoswithapestle and incubate them overnight at55°C,followed byproteinase Kinactivation for 10min E

| I I I I nzymatic digestion VOL.11 NO.10VOL.11 noninjected embryosasanegative control. (purification) canbeomitted.  (see example in PCR products from Step42using the selectedrestriction enzyme according tothe manufacturer’s instructions Miniprep kitand sequence (seeexample in available through asequencing company; MCLab, for example). Alternatively, purifyDNAfrom single colonies using a was usedatStep42,clone PCRproducts using the TOPO-TA kit.Subject20colonies todirect sequencing (aservice T T T T Resolve the restriction enzyme digest from Step44B(i)ona1–1.5%(wt/vol)agarose gel. Use genomic DNAfrom If the PAM sitewasselectedonthe basisof itsproximity (5–10bp)to auniquerestriction site, digest the purified If high-fidelity PCRwasusedatStep42,clone PCRproducts using the TOPO-Blunt kit;ifGoTaq Green Master Mix I I I I B B B CAL CAL CAL

CAL LES LES LES CR ● I

5

These stepsare identical for Tol2-based transgenesis ( H H H T T STEP STEP STEP 3 I IMI OOT OOT OOT ) havenot beenestablished inthe lab. CAL N Retain undeveloped embryos in 1× Yamamoto embryo solution, and monitor their development until they Dead embryos can increase the chances of contamination and affect the survival of healthy embryos. Impurities in the genomic DNA can inhibit the reaction. Consider purifying the genomic DNA using a | I I I 2016

N N N G STEP 5–7 weeks G G G Fig. 2 | ● Some restriction enzymes canbeuseddirectly inthe PCRmix,which means thatStep42 natureprotocols

● T IMI

c T , bottompanel). IMI N G N 2–4d G 1–2d ′ s instructions, inatotalvolume of 50 Fig. Fig. 4

2 µ Fig. 2 ). b l of the genomic DNAfor PCRamplification withHigh Fidelity PCR ), add moist coconut fiber tothe bottom of the 60-mm Petri dishes, c , toppanel). Box µ 1 l of elution buffer. ). Thissteprequires only3–4dhands-on. Fig. 1 µ a l. ). 5

2 and

© 2016 Nature America, Inc. All rights reserved. Troubleshooting advice canbefound in ? the system. 59| 58| might require some practice). tail fin(most caudal fin) withasterile razorblade. Alternatively, remove 2–3scaleswith forceps (which islessinvasive, but 57|  minutes, fishwillstop moving. 56| off-target effects. Genotype eachgeneration asdescribed inSteps56–59. 55| every generation. Homozygous stablelines couldbegenotyped everyseveral generations. will beconsidered a‘stableline’ when the mutation isdetected inthe F1.Heterozygous stablelines should begenotyped transmission on10–15pooledembryos(F1),asdescribed inSteps40–45for the evaluation of editing efficiency. Afish 54| base of the dorsal finand ultimately bytheir distinct colors. 3–4 weeks, once male fishstartshowing tailcolor. Sexual maturity iseasilyvisiblein male fish,initially by the longer 53|  Germ-line transmission and backcross the desired mutation (or many couldbewildtype, depending onthe editing efficiency). (such asbrine shrimporbloodworms). These fishare F0chimeric ‘founders’ and couldbe heterozygous or homozygous for shrimp until 3weeksof age. After3weeks, feedadult fishtwice a day with dry food supplemented withlive/frozen food 52| 47–52) (Steps later a week again attempted be can fiber, hatching and coconut to back transferred be can embryos Unhatched food. available as serve  humic acid), and feedfrydaily withfreshly hatched brine shrimp( 51|  connected toatubewithan airstone. ture. Alternatively, aeration canbeusedinstead of oxygen tablets—for example, withastandard aquarium airpump the tablet,wescrape the surface toobtainsufficient quantities of powdered tablet).Leavethe container at room tempera 50| and many will die. prematurely, the majority could end up as ‘belly sliders’ (i.e., embryos that have not successfully inflated their gas bladder), should be hatched only when they are fully ready, using the size of the eye as a marker (  This allowsfor synchronized hatching. container withalid (for example, atipbox, filledtoa depth of ~1cm);ensure thatthe embryosare completelysubmerged. 49|

TROU

CR CR CR CR CR Gently putthe fishin1liter of fresh systemwaterat room temperature to recover for 10min,before returning to Placethe tissuein1.7-mlEppendorf tubesand process itasdescribed inSteps40–45. Use aplastic spoontogently placefishonasponge (moistened withsystemwater),and quickly trim2–3 mmfrom the Forgenotyping, anesthetize adult fishin200 mg of Tricaine in1liter of systemwaterat room temperature. Afterafew (Optional) Backcross heterozygous stablelines withwild-typeGRZfish for 2–3 generations toeliminate potential Collecteggsusing asand tray Setupmating pairsbetweensexually mature F0founders and wild-typefish.Fishare usually sexually mature after 2–4dafterthe addition of systemwater, transfer hatched frytothe systemand feedthem 1–2times perday withbrine Aday aftertransfer, fillthe lidded container withsystemwater(approximately anadditional 2-cm depth, ontop of the To improve oxygen supply, add approximately halfateaspoonof oxygen tablettothe humic acid (rather thancrushing Afteraweek,transfer allthe developed embryos( I I I I I T T T T T I I I I B I CAL CAL CAL CAL CAL LES

Tricaine solution should be freshly prepared before starting the experiment. These stepsare identical for Tol2-based transgenesis ( H

STEP STEP STEP OOT If embryos are hatched without sufficient oxygenation, the majority could end up as ‘belly sliders’. Synchronized hatching is achieved when embryos are wetted. To increase hatching survival, embryos I Using water with a salinity of ~1 g of sea salt per liter will allow brine shrimp to survive longer, and survive to shrimp brine allow will liter per salt g of ~1 sea a salinity with water Using N G 2 8 orbyusing abreeding tank,asdescribed instep33.After48h,evaluate germ-line T ● able

T IMI 1 . N G 1–3 d Fig. 4 b ) using aPasteur pipetteinto cold(4°C)humic acid ina Artemia salina Box 1 ). ). natureprotocols Fig. Fig. 4 b ). ). When embryos are hatched

| VOL.11 NO.10VOL.11 protocol | 2016

|

2025 - © 2016 Nature America, Inc. All rights reserved. Steps 40–45,evaluation of editing efficiency: 1–3 d. Evaluation of efficiency couldbeperformed onasubset ofinjected Steps 33–39,injection: 1–2d. Inexperienced userswillneed more time toincrease injection efficiency and survival. ssDNA templatecanbesetup inparallel. Steps 30–32(optional), ssDNA templatefor knock-in via HDR:1–2d. Synthesis of gRNAs, Steps 19–29,synthesis of Steps 4–18,synthesis of gRNAs: 1–2d Steps 1–3,target selection: 1–2d ● T 2026 eggs, whilethe remaining eggsare left todevelop. a Box 44 and and 39, 46, 48 Box 21 and S protocol

tep b T le le IMI

Box 1 1 | VOL.11 NO.10VOL.11 1 1 N

| G 1

Troubleshooting table.

of injected embryos abnormal development Low survival or degraded product mRNA synthesis or Poor nCas9n or P injected injected embryos (in Tol2) detected in Cas9) or expression editing (in CRISPR/ Little or no genome roblem | 2016 | natureprotocols Cas9 Tol2

mRNA:1–2d

mRNA mRNA integrity Decreased nCas9n/Tol2 injection mixture Inefficient delivery of Impure injection solution Too high injection volume RNA injected Too much DNA or RNase contamination the DNA plasmid Concentration and quality of DNA template Incomplete digestion of the synthesis kit Problem with the RNA P the yolk Accidental injection into ossible reason

trials, up to 100 ng/ toxic to the cell, and they lead to increased mortality. In our High concentrations of DNA (and RNA to a lesser extent) are to clean the working surface use RNase-free reagents and RNase decontamination solutions To prevent RNA degradation during and/or after RNA synthesis, the amount of DNA plasmid used as a template and follow the instructions in the mMESSAGE mMACHINE kit for of RNA synthesis. Purify the plasmid DNA before RNA synthesis, Lower amounts or impure DNA plasmid can result in lower yield cases, gel purification after digestion is recommended can reduce the overall efficiency of mRNA synthesis. In these molecules (using the full plasmid as a template), and thus it Remaining undigested plasmid DNA can lead to very long RNA date of expiration of RNA synthesis cycles. Consider making aliquots of the buffer. Verify the The synthesis buffer is sensitive to repeated freeze-thaw S visible visible single cell are probably unfertilized 10–30 min helps visualize the single cell. Eggs without a egg collection, incubation of the fertilized eggs at 28 °C for or lipid droplet. If the single cell is too difficult to see after or two cells at this stage; see Make sure that the injection occurs into the embryo (single cell injection solution by electrophoresis using agarose gel before making the nCas9n and Adjust DNA/RNA concentration and injection volume very low), injection efficiency decreases accordingly. volume is too small (or concentration of DNA and RNA is 11,000 To prevent clogging, centrifuge the injection mixture at after injection. Purify DNA and RNA before use Impure injection solution increases mortality of the embryos or decreasing the injection pulse of the injector the diameter of the needle opening; lowering the air pressure; solutions include lowering the injection volume; decreasing volume (~2.5–10 pl, measured by micrometer). Possible The injection solution must be lower than 1/10th of the cell’s Tol2 efficiently. If needed, adjust the concentration of DNA and olution RNA according to our guidelines g in a chilled centrifuge for 5 min. If the injection Tol2 mRNA may be degraded. Check mRNA integrity µ l l of DNA and 330 ng/ Cas9 Fig. Fig. 4b mRNAand preparation of ) ) and not into the yolk µ l l of Tol2 RNA work

© 2016 Nature America, Inc. All rights reserved. 7. 6. 5. 4. 3. 2. 1. c at online available is information permissions and Reprints financial interests. CO assistance from D.R.V. performed the experiments. I.H. and A.B. wrote the manuscript, with AUT Damon Runyon, Rothschild and HFSP fellowships (I.H.). and the Max Planck Institute for Biology of Ageing (D.R.V.) and by the Glenn Laboratories for the Biology of Aging (A.B.), by the Max Planck Society supported by US National Institutes of Health (NIH) DP1AG044848 and the M. Reichard and M.L. Powell for critical scientific discussions. This work was critical reading of the manuscript and important suggestions, and S. Thyme, A.S. McKay, C.-K. Hu, L. Booth, Y. Kim, W. Wei, P. Abitua and M. Concha for generating the files for 3D printing, C.-K. Hu for taking the photos for We are grateful to our coauthors on Harel B.A. Benayoun and P.P. Singh for all the work involving the genome project. A online version of the pape Note: Any Information Supplementary and Source Data files are available in the increasing the number of injectedeggsand number of F0founders. improve withpractice. Even ifinjection/targeting efficiency islow, these experiments canstillbesuccessful bysimply (e.g., 200–300)of fertilizedeggsfor propagation. Similarly, survivaland targeting efficiency aftermicroinjection will phases of colony setupand until the useriscomfortable withallthe husbandry steps, itisadvisedtocollecthigher numbers screening for germ-line transmission becomes easier, asvisual screening canreplace genotyping. Initially, during earlier only partial editing an in-frame insertion of ashort sequence; therefore, 10–30founders are usually required, asmany events willresult in skill 2–10founders are usually sufficient for obtaining astableline ( of NHEJ-basedknockout allelescanreach 90%efficiency, and depending mostly onthe specificgRNAtarget and injection 2–3 months, establishing the experimental setup(including abreeding colony) willtake ~6months ormore. The generation and translate tokey differences from protocols for other fish models. Although stablelines canbe generated asquickly as characteristics—a toughchorion, rapid growth and short lifespan—thatare probably adaptation toitsharshenvironment turquoise killifish.Although there are many similarities withother fish model systems, the turquoise killifishhasseveral This protocol provides detailed guidelines for the successful husbandry and efficient genome engineering inthe short-lived ANT Box 2 Box 1 ‘egg toegg’). Steps 53–59,germ-line transmission and backcrosses: 1–3dhands-on and 5–7weeksfor eachgeneration (lifecyclefrom sexual maturity ( embryos todevelop (d.p.f.) and beready for hatching, and 3–4weeksposthatching (d.p.h.) period, for the animals toreach Steps 46–52,hatching: 5–7 weeks. Thissteprequires 3–4dhands-on. However, italsoincludes aperiod of 14–20dfor the om/reprints/index.ht ckno

M H PET response to extrinsic mortality.extrinsic to response (2015). 1539–1554 lifespan. of architecturegenetic and evolution into insights research. aging for system biology. in system model new a as fishes Nothobranchiusannual the bench: vertebrate. short-lived naturally a Biol. Quant. lane. fast the in diseases and aging vertebrate Tozzini, E.T.Tozzini, D.R. Valenzano, J.J. Scheel, T.Genade, the to bush the From M. Reichard, & D.R. Valenzano, A., Cellerino, I. Harel, exploring for model a killifish: turquoise African The A. Brunet, & I. Harel, I OR C w , disinfecting embryosbybleaching: 1h , Tol2-based transgenesis: 2–3months I I

N le CONTR PATE G G FI dgm Biol. Rev. Camb. Philos. Soc. Philos. Camb.Rev. Biol. et al. et NANC D IB et al. et ents

Atlas of killifishes of the Old World Old the of killifishes of Atlas 80 et al. et UT RESULTS A platform for rapid exploration of aging and diseases in diseases and aging of explorationrapid for platform A , 275–279 (2015). 275–279 , I I

et al. et Annual fishes of the genus Nothobranchius as a model a as Nothobranchius genus the of fishes Annual AL We thank all members of the Brunet lab, specifically ONS m Fig. 1 Parallel evolution of senescence in annual fishes in fishes annual in senescence of evolution Parallel l I . r 2 NTERESTS .

I.H. I.H. and A.B. conceived the project, and I.H. The African turquoise killifish genome provides genome killifish turquoise African The ( Figs. 2d a ). Aging Cell Aging

The authors declare no competing BMC Evol. Biol. Evol. BMC Cell and et et al.

4

91 160 , 223–233 (2005). 223–233 ,

, 511–533 (2015). 511–533 , 6 (2015). We thank A.S. McKay for , 1013–1026 (2015). 1013–1026 , ). When the Tol2-based transgenic approach isusedwithafluorescence reporter, (T.F.H.1990). Publications,

13 Cold Spring Harb. Symp. Harb. Spring Cold , 77 (2013). 77 , http://www.nature. Cell

Figure 3b

163

,

,

12. 11. 10. 9. 8. 23. 22. 21. 20. 19. 18. 17. 16. 15. 14. 13.

onset of age-related markers in a short-lived vertebrate. short-lived a in markers age-related of onset 3 fish annual short-lived the of strains (2006). 275–278 fish short-lived the in decay cognitive and locomotor age-related and longevity Temperatureaffects (2011). 824–831 fish short-lived the in age with J. Exp. Zool. Exp. J. fishes. annual of eggs the in duration variable of diapause embryonic and (1999). 2567–2580 killifish, annual an fish. short-lived a of genome the from (2009). 1385–1395 fish short-lived the in determination cavefish. blind degenerationin eye sticklebacks. Invest. Clin. J. regeneration.tissue complex for model Lett. FEBS rerio) (Danio Zebrafish disease. Cell Aging fish short-lived the in phenotypes age-related (2006). 296–300 Terzibasi, E. Terzibasi, D.R. Valenzano, E. Terzibasi, A. Cellerino, & L. Domenici, A., Cattaneo, E., Terzibasi, D.R., Valenzano, N. Hartmann, Wourms, J.P. The developmental biology of annual fishes. 3. Pre-embryonic 3. fishes. annual of biology developmental J.P.TheWourms, in diapause embryonic bioenergeticsof The S.C. Hand, & Podrabsky,J.E. K. Reichwald, D.R. Valenzano, controlssignalling Jeffery,W.R.Hedgehog D.W.& Stock, Yamamoto,Y., F.C.Jones, zebrafish. in disease humanModeling Hooked! L.I. Zon, & C. Santoriello, a as zebrafish The K.D. Poss, & D.R. Hyde,T.J.,Bailey, M., Gemberling, metazoa. in W.E.Telomerebiology Wright, J.W.& Shay, N.M., Gomes, M. Westerfield, human modeling for species fish diverse zebrafish: the Beyond M. Schartl, Fig. , e3866 (2008). e3866 , 2 Dis. Mod. Mech. Mod. Dis. ). However, error-free HDR-basedknock-in requires

8 584 et al. et , 88–99 (2009). 88–99 ,

et al. et al. et 182 Nature et al. et et al. et

, 3741–3751 (2010). 3741–3751 , 122 The Zebrafish Book: A Guide for the Laboratory Use of Use Laboratory the for Guide A Book: Zebrafish The et al. et et al. et The genomic basis of adaptive evolution in threespine in evolution adaptive of basis genomic The , 389–414 (1972). 389–414 , Effects of dietary restriction on mortality and mortality on restriction dietary of Effects between phenotype aging in differences Large , 2337–2343 (2012). 2337–2343 , Mitochondrial DNA copy number and function decrease function and number copy DNA Mitochondrial Insights into sex chromosome evolution and aging and evolution chromosome sex into Insights Austrofundulus limnaeus Austrofundulus

484 natureprotocols Mapping loci associated with tail color and sex and color tail with associated loci Mapping the retards and lifespan prolongs Resveratrol (University of Oregon Press, 2000). Press, Oregon of (University

, 55–61 (2012). 55–61 , 7 , 181–192 (2014). 181–192 , Nothobranchius furzeri Nothobranchius Nothobranchius furzeri Nothobranchius Nature Nothobranchius furzeri Nothobranchius Nothobranchius furzeri Nothobranchius Cell Trends Genet. Trends

. 431 | 163 VOL.11 NO.10VOL.11 J. Exp. Biol. Exp. J. Nothobranchius furzeri Nothobranchius , 844–847 (2004). 844–847 , , 1527–1538 (2015). 1527–1538 , . Aging Cell Aging

29 . protocol Aging Cell Aging , 611–620 (2013). 611–620 ,

Curr. Biol. Curr. 202 . . | Genetics 2016 PloS One PloS (Part 19), (Part

5 ,

10

16 |

.

, 2027

183

,

, © 2016 Nature America, Inc. All rights reserved. 50. 49. 48. 47. 46. 45. 44. 43. 42. 41. 40. 39. 38. 37. 36. 35. 34. 33. 32. 31. 30. 29. 28. 27. 26. 25. 24. 2028 protocol

engineering. genome CRISPR ofgeneration next the for tool web a v2: CHOPCHOP Res. Acids Nucleic editing. genome for tool web TALENand CRISPR/Cas9 a CHOPCHOP: fishes. annual African in timegeneration short and (2016). 1396–1413 furzeri. Nothobranchius killifish annual short-lived system. CRISPR-Cas USA system. nuclease CRISPR a using editing genome repair.homology-independentDNA by zebrafish in knock-in CRISPR/Cas9-mediated efficient Highly embryos. zebrafish system. medaka. in transgenesis USA Sci. Acad. Natl. Proc. lineage. germ zebrafish the in transposition its and fish, medaka Japanese the from element Ac-like an element,Tol2 the of transposase (2003). 191–202 transposon. Beauty Sleeping the using zebrafish construct. reporter fluorescent a with by co-injection fish transgenic of selection efficient fish: neuroscience. Protoc. Nat. Preface.alterations. genome site-specific generating in TALENsand ZFNs, CRISPR/Cas9, engineering.genome for CRISPR-Cas9 immunity.bacterial adaptive 339 Science fish short-lived (2012). 1133–1141 (Species: killifish transgenicof aging. for model killifish African short-lived the in research. age fish short-lived the in research. aging fish annual short-lived (2016). 115–129 ageing. for model experimental emerging an killifish: furzeri Nothobranchius Labun, K., Montague, T.G., Gagnon, J.A., Thyme, S.B. & Valen, E. Valen, & S.B.Thyme, J.A., Gagnon,T.G., Montague, K., Labun, E. Valen, & G.M. Church, J.A., Gagnon, J.M., Cruz, T.G.,Montague, maturation early growth, Rapid M. Reichard, & M. Polacik, R., Blazek, Polacˇik, M., Blažek, R. & Reichard, M. Laboratory breeding of the of breeding Laboratory M. Reichard,Polacˇik, & R. Blažek, M., W.Y.Hwang, zebrafish biallelic multiplex W.Efficient Chen, & Wente,S.R. L.E., Jao, F.Bene, Del J.P.& Concordet, A., Cian, De Auer,T.O.,K., Duroure, N. Chang, V.M.Bedell, mediated transposon and Meganuclease J. Wittbrodt, & Grabher,C. functional a Identification of N. Kawakami, & A. Shima, K., Kawakami, A.E. Davidson, Transgenesisin J. Wittbrodt, & N.S. Foulkes, K., Lahiri, M., Rembold, in systems CRISPR-Cas of ApplicationsF. Zhang, & Heidenreich,M. F.A. Ran, of use enzymology.The in Methods Sontheimer,E.J. & J.A. Doudna, of applications and DevelopmentF. Zhang, & P.D.,Lander,E.S. Hsu, M. Jinek, P.Mali, L. Cong, the in expressiontransgenicInducible C. Duan, & H. Kamei, J.B., Allard, generationthe for protocol microinjection A C. Englert, & N. Hartmann, Transposon-mediatedtransgenesisA. Brunet, & S. Sharp, D.R., Valenzano, Kirschner,J. K. Reichwald, turquoise African short-lived The D.R. Valenzano, & H.G. Nam,Y., Kim, fish annual the in lifespan short Extremely A. Cellerino, & S. Valdesalici,

| VOL.11 NO.10VOL.11

, 823–826 (2013). 823–826 , 110

339 et al. et Nature , 13904–13909 (2013). 13904–13909 , et al. et et al. et et al. et et al. et

, 819–823 (2013). 819–823 , 8 et al. et et al. et Nucleic Acids Res. Acids Nucleic et al. et RNA-guided human genome engineering via Cas9. via engineeringgenome human RNA-guided , 2281–2308 (2013). 2281–2308 , Aging Cell Aging Nat. Rev. Neurosci. Rev. Nat. et al. et Multiplex genome engineering using CRISPR/Cas systems. CRISPR/Cas using engineeringgenome Multiplex

Genome engineering using the CRISPR-Cas9 system. CRISPR-Cas9 the using engineeringGenome et al. et A programmable dual-RNA-guided DNA endonuclease in endonuclease dual-RNA-guidedDNA programmable A 491 Nothobranchius furzeri Nothobranchius Genome editing with RNA-guided Cas9 nuclease in nuclease Cas9 RNA-guided with editing Genome Genome Biol. Genome

G3 (Bethesda) G3

42 Efficient genome editing in zebrafish using a using zebrafish in editing genome Efficient Mapping of quantitative trait loci controlling lifespan controlling loci trait quantitative of Mapping | In vivo In Cell Res. Cell High tandem repeat content in the genome of the of genome the in content repeat tandem High 2016 , 114–118 (2012). 114–118 , Nat. Biotechnol. Nat. Efficient gene delivery and gene expression in expression gene and delivery gene Efficient Methods Enzymol. Methods , W401–W407 (2014). W401–W407 , . Nothobranchius furzeri Nothobranchius Nothobranchius furzeri Nothobranchius Proc. Biol. Sci. Biol. Proc.

11 Genome Biol. Genome

genome editing using high-efficiency high-efficiency TALEN using editing genome 97 |

, 252–261 (2012). 252–261 , natureprotocols 23

, 11403–11408 (2000). 11403–11408 , Science 10

, 465–472 (2013). 465–472 , Nat. Protoc. Nat. 44

Nothobranchius furzeri Nothobranchius , R16 (2009). R16 , 1

17 , 531–538 (2011). 531–538 , , W272–W276 (2016). W272–W276 , Nothobranchius furzeri Nothobranchius Genome Res. Genome

, 36–44 (2016). 36–44 ,

31 337

.

Cell 8 270 546 J. Fish Biol. Fish J. , 227–229 (2013). 227–229 , (Suppl. 1), S10 (2007). S10 1), (Suppl. , 816–821 (2012). 816–821 ,

157

(Suppl. 2), S189–S191 (2003). S189–S191 2), (Suppl. , xix–xx (2014). xix–xx , 1 --a new vertebrate model for model vertebrate new --a , 1133–1139 (2006). 1133–1139 , : a new vertebrate model for model vertebrate new a : , 1262–1278 (2014). 1262–1278 ,

24 Dev. Biol. Dev. Proc. Natl. Acad. Sci. Acad. Natl. Proc.

Nat. Protoc. Nat. , 142–153 (2014). 142–153 , 82 EvoDevo ). Dis. Mod. Mech. Mod. Dis. , 1733–1738 (2013). 1733–1738 , Dev. Dyn. Dev. , a vertebrate a ,

263

4 , 24 (2013). 24 ,

, 11

Science

241 ,

,

9

,

54. 53. 52. 51. 61. 60. 59. 58. 57. 56. 55. 76. 75. 74. 73. 72. 71. 70. 69. 68. 67. 66. 65. 64. 63. 62.

multiple genes by CRISPR/Cas-mediated genome engineering.genome CRISPR/Cas-mediated by genes multiple activity. sgRNA target-specific evaluate to method PCR-based reliable and easy an analysis. curve melting resolution high by facilitated phenotyping and editing genome One PLoS RNAs.single-guide of assessment large-scale and oligonucleotideinsertion (2005). lines. transgenic zebrafish in transgene USA Sci. Acad. Natl. Proc. leukemia. lymphoblastic acute cell T myc-inducedconditional with system. Cre/loxP the using zebrafish transgenic in recombination site-directed recombinases. zebrafish. the in expressiongene targeted CRISPR-Cas9. using genomics (2013). 910–918 zebrafish. of promoter 2 chain light myosin cardiac the in elements regulatory critical transgene reveals GFP myocardium-specific a of transmission (2007). 3088–3099 constructs.transgenesis transposon Tol2 for kit Biol. elements.transposable using Fishes Biol. embryos. of rearing and collection the on emphasis special with killifish. annual of independentclades three in cleavage early during speed cycle cell in reduction with coincides fertilization. of time the at research. animal reporting for guidelines ARRIVE the reporting: researchbioscience Improving specificities. Biotechnol. Nat. Res. Genome Digenome-seq. multiplex by revealed nucleases CRISPR-Cas9 of specificities Methods Nat. approach. library-on-library a via parametersengineering genome Biol. Cell Mol. interrogation. and regulationgenome precision for CRISPR-Cas9 activation. and repression expression.gene of control (2013). expression. gene of control sequence-specific Wang, H. Wang, CRISPR-STAT:R. Sood, & S.M. Burgess,Varshney, G.K., B., Carrington, High-throughput J.M. Parant, Yoder,& B.K.S.M., Percival, H.R., Thomas, J.A. Gagnon, Qi, L.S. Qi, C.J. Huang, D.M. Langenau, ofDemonstration Z. Gong, & Y.W.,Tong, Chia, H., Wan, X., Pan, using by zebrafish in G.W.Transgenemanipulation Stuart, & J. Dong, for technique Gal4-UAS the of Use J.A. Campos-Ortega, & Scheer,N. functionalHigh-throughput F. Zhang, & N.E. Sanjana, O., Shalem, Huang, C.J., Tu, C.T., Hsiao, C.D., Hsieh, F.J. & Tsai, H.J. Germ-line H.J. Tsai, & F.J.Hsieh, C.D., Hsiao,C.T., Tu, C.J., Huang, K.M. Kwan, vertebrates. in vector transfer gene versatile a Tol2: K. Kawakami, Transgeniczebrafish Ekker,S.C. & K.J. Skuster, M.D., Urban, K.J., Clark, killifish annual the of HusbandryPodrabsky, J.E. history life annual to Transition A. Cellerino, & R. Ripa, L., Dolfi, of egg the of layer cortical the of ChangesYamamoto,T.-o. D.G. Altman, & M. Emerson, I.C., W.J.,Cuthill, Browne,Kilkenny, C., Kleinstiver,B.P. P.D.Hsu, targetGenome-wide J.S. Kim, & J. Park, S., Kim, S., Kim, D., Kim, CRISPR-Cas9 Unraveling G.M. Church, & P.,Moosburner,M. Mali, R., Chari, repurposing editing: Beyond L.S. Qi, W.A.& Lim, A.A., Dominguez, L.A. Gilbert, M.H. Larson,

8 (Suppl. 1), S7 (2007). S7 1), (Suppl. et al. et Transgenic Res. Transgenic

et al. et 9 et al. et Dev. Dyn. Dev.

, e98186 (2014). e98186 , 54 et al. et

et al. et

et al. et Nature 26 et al. et Repurposing CRISPR as an RNA-guided platform for platform RNA-guided an as CRISPR Repurposing

et al. et 12 17 Methods Cell Biol. Cell Methods , 421–431 (1999). 421–431 , One-step generation of mice carrying mutations in mutations carrying mice ofgeneration One-step DNA targeting specificity of RNA-guided Cas9 nucleases. Cas9 RNA-guided of specificity targeting DNA PLoS One PLoS

, 406–415 (2016). 406–415 , Nucleic Acids Res. Acids Nucleic et al. et et al. et , 823–826 (2015). 823–826 , 31 , 5–15 (2016). 5–15 , The Tol2kit: a multisite gateway-based construction gateway-based multisite a Tol2kit: The Conditional expression of a myocardium-specific a of expressionConditional Genome-scale CRISPR-mediated control of gene of controlCRISPR-mediated Genome-scale CRISPR interference (CRISPRi) for sequence-specific for (CRISPRi) interference CRISPR Efficient mutagenesis by Cas9 protein-mediated Cas9 by mutagenesis Efficient , 827–832 (2013). 827–832 ,

228 523 Cre/lox-regulated transgenic zebrafish model zebrafish transgenicCre/lox-regulated Engineered CRISPR-Cas9 nucleases with altered PAM altered with nucleases CRISPR-Cas9 Engineered

14 , 30–40 (2003). 30–40 , , 481–485 (2015). 481–485 ,

9

102 , 217–223 (2005). 217–223 , Cell , e114632 (2014). e114632 , PLoS Biol. PLoS Nat. Protoc. Nat. Proc. Imp. Acad. Tokyo Acad. Imp. Proc. Methods Cell Biol. Cell Methods Nat. Rev. Genet. Rev. Nat.

, 6068–6073 (2005). 6068–6073 , 159

77

43 , 647–661 (2014). 647–661 , , 363–379 (2004). 363–379 , , e157 (2015). e157 ,

8 EvoDevo , e1000412 (2010). e1000412 ,

Dev. Dyn. Dev. 8 , 2180–2196 (2013). 2180–2196 , Mech. Dev.Mech.

Cell 16

5 104 Dev. Dyn. Dev.

, 32 (2014). 32 , Austrofundulus limnaeus Austrofundulus , 299–311 (2015). 299–311 ,

233 152

15 , 137–149 (2011). 137–149 ,

80 , 1294–1303 , , 1173–1183 , , 269–271 (1939). 269–271 , , 153–158 (1999). 153–158 ,

236 Oryzias latipes Oryzias Cell ,

Nat. Rev. Nat.

Environ.

153 Genome

,