Insights Into the Regulation of Aging DISSERTATION
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The Transcription Factor Hey and Nuclear Lamins Specify and Maintain
RESEARCH ARTICLE The transcription factor Hey and nuclear lamins specify and maintain cell identity Naama Flint Brodsly1†, Eliya Bitman-Lotan1†, Olga Boico1, Adi Shafat1, Maria Monastirioti2, Manfred Gessler3, Christos Delidakis2, Hector Rincon-Arano4, Amir Orian1* 1Rappaport Research Institute and Faculty of Medicine, Technion-Israel Institute of Technology, Haifa, Israel; 2Institute of Molecular Biology and Biotechnology (IMBB), Foundation for Research and Technology - Hellas (FORTH), Heraklion, Greece; 3Biocenter of Developmental Biochemistry, University of Wu¨ rzburg, Wu¨ rzburg, Germany; 4Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, United States Abstract The inability of differentiated cells to maintain their identity is a hallmark of age- related diseases. We found that the transcription factor Hey supervises the identity of differentiated enterocytes (ECs) in the adult Drosophila midgut. Lineage tracing established that Hey-deficient ECs are unable to maintain their unique nuclear organization and identity. To supervise cell identity, Hey determines the expression of nuclear lamins, switching from a stem-cell lamin configuration to a differentiated lamin configuration. Moreover, continued Hey expression is required to conserve large-scale nuclear organization. During aging, Hey levels decline, and EC identity and gut homeostasis are impaired, including pathological reprograming and compromised gut integrity. These phenotypes are highly similar to those observed upon acute targeting of Hey or perturbation of lamin expression in ECs in young adults. Indeed, aging phenotypes were suppressed by continued expression of Hey in ECs, suggesting that a Hey-lamin network *For correspondence: safeguards nuclear organization and differentiated cell identity. [email protected] DOI: https://doi.org/10.7554/eLife.44745.001 †These authors contributed equally to this work Competing interests: The authors declare that no Introduction competing interests exist. -
Article Evolutionary Dynamics of the OR Gene Repertoire in Teleost Fishes
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.09.434524; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Article Evolutionary dynamics of the OR gene repertoire in teleost fishes: evidence of an association with changes in olfactory epithelium shape Maxime Policarpo1, Katherine E Bemis2, James C Tyler3, Cushla J Metcalfe4, Patrick Laurenti5, Jean-Christophe Sandoz1, Sylvie Rétaux6 and Didier Casane*,1,7 1 Université Paris-Saclay, CNRS, IRD, UMR Évolution, Génomes, Comportement et Écologie, 91198, Gif-sur-Yvette, France. 2 NOAA National Systematics Laboratory, National Museum of Natural History, Smithsonian Institution, Washington, D.C. 20560, U.S.A. 3Department of Paleobiology, National Museum of Natural History, Smithsonian Institution, Washington, D.C., 20560, U.S.A. 4 Independent Researcher, PO Box 21, Nambour QLD 4560, Australia. 5 Université de Paris, Laboratoire Interdisciplinaire des Energies de Demain, Paris, France 6 Université Paris-Saclay, CNRS, Institut des Neurosciences Paris-Saclay, 91190, Gif-sur- Yvette, France. 7 Université de Paris, UFR Sciences du Vivant, F-75013 Paris, France. * Corresponding author: e-mail: [email protected]. !1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.09.434524; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Teleost fishes perceive their environment through a range of sensory modalities, among which olfaction often plays an important role. -
A New Genus of Miniature Cynolebiasine from the Atlantic
64 (1): 23 – 33 © Senckenberg Gesellschaft für Naturforschung, 2014. 16.5.2014 A new genus of miniature cynolebiasine from the Atlantic Forest and alternative biogeographical explanations for seasonal killifish distribution patterns in South America (Cyprinodontiformes: Rivulidae) Wilson J. E. M. Costa Laboratório de Sistemática e Evolução de Peixes Teleósteos, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Caixa Postal 68049, CEP 21944 – 970, Rio de Janeiro, Brasil; wcosta(at)acd.ufrj.br Accepted 21.ii.2014. Published online at www.senckenberg.de/vertebrate-zoology on 30.iv.2014. Abstract The analysis of 78 morphological characters for 16 species representing all the lineages of the tribe Cynopoecilini and three out-groups, indicates that the incertae sedis miniature species ‘Leptolebias’ leitaoi Cruz & Peixoto is the sister group of a clade comprising the genera Leptolebias, Campellolebias, and Cynopoecilus, consequently recognised as the only member of a new genus. Mucurilebias gen. nov. is diagnosed by seven autapomorphies: eye occupying great part of head side, low number of caudal-fin rays (21), distal portion of epural much broader than distal portion of parhypural, an oblique red bar through opercle in both sexes, isthmus bright red in males, a white stripe on the distal margin of the dorsal fin in males, and a red stripe on the distal margin of the anal fin in males.Mucurilebias leitaoi is an endangered seasonal species endemic to the Mucuri river basin. The biogeographical analysis of genera of the subfamily Cynolebiasinae using a dispersal-vicariance, event-based parsimony approach indicates that distribution of South American killifishes may be broadly shaped by dispersal events. -
Phosphorylation and Activation of Cell Division Cycle Associated 8 by Aurora Kinase B Plays a Significant Role in Human Lung Carcinogenesis
Research Article Phosphorylation and Activation of Cell Division Cycle Associated 8 by Aurora Kinase B Plays a Significant Role in Human Lung Carcinogenesis Satoshi Hayama,1,2 Yataro Daigo,1 Takumi Yamabuki,1 Daizaburo Hirata,1 Tatsuya Kato,1 Masaki Miyamoto,2 Tomoo Ito,3 Eiju Tsuchiya,4 Satoshi Kondo,2 andYusuke Nakamura 1 1Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, The University of Tokyo, Tokyo, Japan; Departments of 2Surgical Oncology and 3Surgical Pathology, Hokkaido University Graduate School of Medicine, Sapporo, Japan; and 4Kanagawa Cancer Center Research Institute, Kanagawa, Japan Abstract inhibitors for EGFR tyrosine kinase (i.e., gefitinib and erlotinib), Through genome-wide gene expression analysis of lung were developed and are applied in clinical practice (5). However, carcinomas, we detected in the great majority of lung cancer each of the new regimens can provide survival benefits to a small samples cotransactivation of cell division cycle associated subset of the patients (6, 7). Hence, new therapeutic strategies, such 8(CDCA8) and aurora kinase B (AURKB), which were as development of more effective molecular targeted agents considered to be components of the vertebrate chromosomal applicable to the great majority of patients with less toxicity, are passenger complex.Immunohistochemical analysis of lung eagerly awaited. cancer tissue microarrays showed that overexpression of Systematic analysis of expression levels of thousands of genes CDCA8 and AURKB was significantly associated with poor using cDNA microarrays is an effective approach for identification prognosis of lung cancer patients.AURKB directly phosphor- of unknown molecules involved in carcinogenic pathways and can ylated CDCA8 at Ser154, Ser219, Ser275, and Thr278 and seemed effectively screen candidate target molecules for development of to stabilize CDCA8 protein in cancer cells.Suppression of novel therapeutics and diagnostics. -
Evolution, Expression and Meiotic Behavior of Genes Involved in Chromosome Segregation of Monotremes
G C A T T A C G G C A T genes Article Evolution, Expression and Meiotic Behavior of Genes Involved in Chromosome Segregation of Monotremes Filip Pajpach , Linda Shearwin-Whyatt and Frank Grützner * School of Biological Sciences, The University of Adelaide, Adelaide, SA 5005, Australia; fi[email protected] (F.P.); [email protected] (L.S.-W.) * Correspondence: [email protected] Abstract: Chromosome segregation at mitosis and meiosis is a highly dynamic and tightly regulated process that involves a large number of components. Due to the fundamental nature of chromosome segregation, many genes involved in this process are evolutionarily highly conserved, but duplica- tions and functional diversification has occurred in various lineages. In order to better understand the evolution of genes involved in chromosome segregation in mammals, we analyzed some of the key components in the basal mammalian lineage of egg-laying mammals. The chromosome passenger complex is a multiprotein complex central to chromosome segregation during both mitosis and meio- sis. It consists of survivin, borealin, inner centromere protein, and Aurora kinase B or C. We confirm the absence of Aurora kinase C in marsupials and show its absence in both platypus and echidna, which supports the current model of the evolution of Aurora kinases. High expression of AURKBC, an ancestor of AURKB and AURKC present in monotremes, suggests that this gene is performing all necessary meiotic functions in monotremes. Other genes of the chromosome passenger complex complex are present and conserved in monotremes, suggesting that their function has been preserved Citation: Pajpach, F.; in mammals. -
Deterministic Shifts in Molecular Evolution Correlate with Convergence to Annualism in Killifishes
bioRxiv preprint doi: https://doi.org/10.1101/2021.08.09.455723; this version posted August 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Deterministic shifts in molecular evolution correlate with convergence to annualism in killifishes Andrew W. Thompson1,2, Amanda C. Black3, Yu Huang4,5,6 Qiong Shi4,5 Andrew I. Furness7, Ingo, Braasch1,2, Federico G. Hoffmann3, and Guillermo Ortí6 1Department of Integrative Biology, Michigan State University, East Lansing, Michigan 48823, USA. 2Ecology, Evolution & Behavior Program, Michigan State University, East Lansing, MI, USA. 3Department of Biochemistry, Molecular Biology, Entomology, & Plant Pathology, Mississippi State University, Starkville, MS 39759, USA. 4Shenzhen Key Lab of Marine Genomics, Guangdong Provincial Key Lab of Molecular Breeding in Marine Economic Animals, BGI Marine, Shenzhen 518083, China. 5BGI Education Center, University of Chinese Academy of Sciences, Shenzhen 518083, China. 6Department of Biological Sciences, The George Washington University, Washington, DC 20052, USA. 7Department of Biological and Marine Sciences, University of Hull, UK. Corresponding author: Andrew W. Thompson, [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.08.09.455723; this version posted August 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: The repeated evolution of novel life histories correlating with ecological variables offer opportunities to test scenarios of convergence and determinism in genetic, developmental, and metabolic features. Here we leverage the diversity of aplocheiloid killifishes, a clade of teleost fishes that contains over 750 species on three continents. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
2012 Annual Report
Memorial Sloan-Kettering Cancer Center 2012 ANNUAL REPORT A SHARED VISION A SINGULAR MISSION Nurse practitioner Naomi Cazeau, of the Adult Bone Marrow Transplant Service. PING CHI PHYSICIAN-SCIENTIST 10 STEPHEN SOLOMON ALEXANDER RUDENSKY INTERVENTIONAL IMMUNOLOGIST RADIOLOGIST 16 12 VIVIANE TABAR The clinicians and scientists of NEUROSURGEON Memorial Sloan-Kettering share a vision and 18 a singular mission — to conquer cancer. STEPHEN LONG STRUCTURAL BIOLOGIST They are experts united against a 20 SIMON POWELL complex disease. Each type of cancer R ADIATION ONCOLOGIST 24 ETHEL LAW is different, each tumor is unique. Set free NURSE PRACTITIONER in surroundings that invite the sharing of 26 ideas and resources, they attack the CHRISTINA LESLIE complexity of cancer from every angle COMPUTATIONAL BIOLOGIST and every discipline. 34 SCOTT ARMSTRONG PEDIATRIC ONCOLOGIST 30 TO JORGE REIS-FILHO EXPERIMENTAL PATHOLOGIST CONQUER 38 CANCER 04 Letter from the Chairman and the President A complete version of this report — 42 Statistical Profile which includes lists of our donors, 44 Financial Summary doctors, and scientists — 46 Boards of Overseers and Managers is available on our website at 49 The Campaign for Memorial Sloan-Kettering www.mskcc.org/annualreport. 4 5 Letter from the Chairman In 2012 the leadership of Memorial Sloan-Kettering endorsed Douglas A. Warner III These programmatic investments require leadership and and the President a $2.2 billion investment in a clinical expansion that will set vision. Our new Physician-in-Chief, José Baselga, joined the stage for a changing care paradigm into the next decade us on January 1, 2013. An internationally recognized and beyond. -
Fish, Various Invertebrates
Zambezi Basin Wetlands Volume II : Chapters 7 - 11 - Contents i Back to links page CONTENTS VOLUME II Technical Reviews Page CHAPTER 7 : FRESHWATER FISHES .............................. 393 7.1 Introduction .................................................................... 393 7.2 The origin and zoogeography of Zambezian fishes ....... 393 7.3 Ichthyological regions of the Zambezi .......................... 404 7.4 Threats to biodiversity ................................................... 416 7.5 Wetlands of special interest .......................................... 432 7.6 Conservation and future directions ............................... 440 7.7 References ..................................................................... 443 TABLE 7.2: The fishes of the Zambezi River system .............. 449 APPENDIX 7.1 : Zambezi Delta Survey .................................. 461 CHAPTER 8 : FRESHWATER MOLLUSCS ................... 487 8.1 Introduction ................................................................. 487 8.2 Literature review ......................................................... 488 8.3 The Zambezi River basin ............................................ 489 8.4 The Molluscan fauna .................................................. 491 8.5 Biogeography ............................................................... 508 8.6 Biomphalaria, Bulinis and Schistosomiasis ................ 515 8.7 Conservation ................................................................ 516 8.8 Further investigations ................................................. -
Nothobranchius As a Model for Aging Studies. a Review
Volume 5, Number 2; xxx-xx, April 2014 http://dx.doi.org/10.14336/AD Review Article Nothobranchius as a model for aging studies. A review Alejandro Lucas-Sánchez 1, *, Pedro Francisco Almaida-Pagán 2, Pilar Mendiola 1, Jorge de Costa 1 1 Department of Physiology. Faculty of Biology. University of Murcia. 30100 Murcia, Spain. 2 Institute of Aquaculture, School of Natural Sciences, University of Stirling, Stirling FK9 4LA, UK. [Received October 17, 2013; Revised December 4, 2013; Accepted December 4, 2013] ABSTRACT: In recent decades, the increase in human longevity has made it increasingly important to expand our knowledge on aging. To accomplish this, the use of animal models is essential, with the most common being mouse (phylogenetically similar to humans, and a model with a long life expectancy) and Caenorhabditis elegans (an invertebrate with a short life span, but quite removed from us in evolutionary terms). However, some sort of model is needed to bridge the differences between those mentioned above, achieving a balance between phylogenetic distance and life span. Fish of the genus Nothobranchius were suggested 10 years ago as a possible alternative for the study of the aging process. In the meantime, numerous studies have been conducted at different levels: behavioral (including the study of the rest-activity rhythm), populational, histochemical, biochemical and genetic, among others, with very positive results. This review compiles what we know about Nothobranchius to date, and examines its future prospects as a true alternative to the classic models for studies on aging. Key words: Aging, Fish, killifish, Nothobranchius Aging is a multifactorial process that involves numerous To be considered a model for aging, an animal must mechanisms that operate during the normal life cycle of have a number of features. -
Download Paper
M BoC | ARTICLE Chromosomal passenger complex hydrodynamics suggests chaperoning of the inactive state by nucleoplasmin/nucleophosmin Mariah L. Hanleya,b, Tae Yeon Yooc, Matthew Sonnetta, Daniel J. Needlemanc,d, and Timothy J. Mitchisona,* aDepartment of Systems Biology, Harvard Medical School, Boston, MA 02114–5701; bDepartment of Chemistry, cJohn A. Paulson School of Engineering and Applied Sciences, and dDepartment of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138-2902 ABSTRACT The chromosomal passenger complex (CPC) is a conserved, essential regulator of Monitoring Editor cell division. As such, significant anti–cancer drug development efforts have been focused on Yixian Zheng targeting it, most notably by inhibiting its AURKB kinase subunit. The CPC is activated by Carnegie Institution AURKB-catalyzed autophosphorylation on multiple subunits, but how this regulates CPC in- Received: Dec 20, 2016 teractions with other mitotic proteins remains unclear. We investigated the hydrodynamic Revised: Mar 27, 2017 behavior of the CPC in Xenopus laevis egg cytosol using sucrose gradient sedimentation and Accepted: Apr 4, 2017 in HeLa cells using fluorescence correlation spectroscopy. We found that autophosphoryla- tion of the CPC decreases its sedimentation coefficient in egg cytosol and increases its diffu- sion coefficient in live cells, indicating a decrease in mass. Using immunoprecipitation coupled with mass spectrometry and immunoblots, we discovered that inactive, unphosphorylated CPC interacts with nucleophosmin/nucleoplasmin proteins, which are known to oligomerize into pentamers and decamers. Autophosphorylation of the CPC causes it to dissociate from nucleophosmin/nucleoplasmin. We propose that nucleophosmin/nucleoplasmin complexes serve as chaperones that negatively regulate the CPC and/or stabilize its inactive form, pre- venting CPC autophosphorylation and recruitment to chromatin and microtubules in mitosis. -
Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG