Vitamin D Biology and Heart Failure Meems, Laura

University of Groningen

Vitamin D biology and heart failure Meems, Laura

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record

Publication date: 2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA): Meems, L. (2015). Vitamin D biology and heart failure: Clinical and experimental studies.

Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment.

Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

Download date: 05-10-2021 Financial support by the Dutch Heart Foundation for the publication of this thesis is gratefully acknowledged.

Masterclass Groningen, Roche Diagnostics Nederland B.V., Servier Nederland Financial support by Graduate School of Medical Sciences, Junior Scientific Farma B.V. and University of Groningen for the publication of this thesis is gratefully acknowledged.

Meems, L.M.G. Vitamin D Biology and Heart Failure: Clinical and Experimental Studies

Cover & lay-out: W.E. Tomson

Printed by: Grafimedia Facilitair Bedrijf RUG No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, without permission of the author.

Proefschrift_final_zonder.indd 2 22-10-15 15:08 Vitamin D Biology and Heart Failure

Clinical and experimental studies

Proefschrift

ter verkrijging vanop gezag de graad van vande doctor aan de Rijksuniversiteit Groningen en volgens besluit van het College voor Promoties. rector magnificus prof. dr. E. Sterken De openbare verdediging zal plaatsvinden op

maandag 23 november 2015 om 16.15 uur

door

Laura Marieke Gezina Meems

te Coevorden geboren op 11 juni 1988

Proefschrift_final_zonder.indd 3 22-10-15 15:08 Promotores Prof. dr. R.A. de Boer Prof. dr. P. van der Harst

Beoordelingscommissie Prof. dr. I.A. Brouwer Prof. dr. G.J. Navis Prof. dr. S. Pilz

Proefschrift_final_zonder.indd 4 22-10-15 15:08 Paranimfen Drs. R.G.M. Lammerts Drs. J.K. Humalda

Proefschrift_final_zonder.indd 5 22-10-15 15:08 Proefschrift_final_zonder.indd 6 22-10-15 15:08 Contents chapter 1 9 Introduction chapter 2 19 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review Curr Drug Targ: 2011, 29-41 chapter 3 45 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study Submitted chapter 4 65 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study Ann Med 2015 Sept; 47(6):474-81. doi: 10.3109/07853890.2015.1073347. chapter 5 97 diastolic dysfunction in a murine model of pressure overload JThe Steroid vitamin Biochem D receptor Mol Biol. activator2012 Nov;132(3-5):282-9. paricalcitol prevents fibrosis and chapter 6 117 increased blood pressure in offspring via Panx1 hypermethylation SubmittedParental vitamin D deficiency during pregnancy is associated with chapter 7 139 Summary, discussion and future perspectives

155 Nederlandse samenvatting

164 Acknowledgements

169 Bibliography

Proefschrift_final_zonder.indd 7 22-10-15 15:08 Proefschrift_final_zonder.indd 8 22-10-15 15:08 Introduction

L.M.G. Meems

University of Groningen, University Medical Center Groningen, Departments of Cardiology, The Netherlands Chapter Proefschrift_final_zonder.indd 9 122-10-15 15:08 1 Chapter 1

Proefschrift_final_zonder.indd 10 22-10-15 15:08 Introduction

Heart failure Heart failure (HF) is one of the leading causes of morbidity and mortality in the Western

a clinical syndrome that is the result of abnormalities in cardiac function or structure (1). World. According to the European Society of Cardiology (ESC) Guidelines, HF is defined as

crackles) and symptoms (e.g. fatigue, peripheral oedema, shortness of breath), in HF may be diagnosed by typical signs (e.g. elevated jugular venous pressure, pulmonary

and/or diastolic dysfunction. The diagnosis of HF is not always easy, as the diagnostic value combination with more objective evidence such as elevated natriuretic peptides and systolic of these signs and symptoms is limited. To formulate a correct diagnosis, recognition of the

disease, such as loss of myocardium (e.g. due to myocardial infarction or myocarditis), or underlying disease is of major importance. In most cases, HF is the result of myocardial sustained pressure to the myocardium (e.g. long term hypertension or valvular stenosis), although HF can also be caused by disease of the valves, pericardium, endocardium, or the conduction system.

HF is characterized by a primary deficit in cardiac output to nourish the peripheral organs. compensatory mechanisms that affect both systemic and cellular processes. At a systemic In order to maintain sufficient perfusion of vital organs the human body employs several level, various neurohumoral adaptations take place, including activation of the sympathetic nervous system and the renin-angiotensin-alodsterone-system (RAAS). Although these

with progression of disease and worsening of ventricular function, and actually contribute mechanisms are beneficial in early stages of HF, these mechanisms become insufficient to the process of adverse progressive cardiac remodeling. Cardiac remodeling is a multi- cellular process and is characterized by pathologic hypertrophic growth, myocyte apoptosis, extracellular matrix alterations, re-expression of fetal gene programming, as well as changes

and activation in metabolism and inflammatory status (2). Most of the current pharmacological treatment focuses on the disturbed systemic and cellular processes, and interferes with one of the neurohumoral axes, such as the RAAS and the sympathetic nervous system (SNS). This is contrast to supportive treatment, such as diuretics and digitalis that mainly act to alleviate symptoms. Despite current treatment the 5-year survival remains poor (1,3) and a continuous quest for novel interventions and prognostic markers is ongoing.

Proefschrift_final_zonder.indd 11 22-10-15 15:08 1 Chapter 1

The vitamin D receptor

attracted to the concept of intervening in transcriptional regulation (4,5). One of the gene In the search for novel modifiers of HF pathophysiology, growing attention has been regulators that may be of particular importance in the development of cardiovascular disease is the vitamin D receptor (VDR) (6). The VDR belongs to the nuclear receptor superfamily of transcriptional regulators (4). This receptor is highly conserved among vertebrate species (7) and is expressed in mouse, rat, and human heart tissue (8,9). Liganded VDR forms a heterodimer with the retinoid X receptor (RXR) (10), a common partner for other nuclear receptors such as liver X receptor (LXR), peroxisome proliferator- activated receptor (PPAR) and thyroid hormone receptor (TR), and in this complex it acts as a promiscuous transcription factor (11). The transcriptional activity of VDR is regulated by several co-regulators that repress or transactivate gene transcription of several target genes by binding to positive or negative vitamin D responsive elements (VDREs and nVDREs, respectively)(12) (Figure 1).

Figure 1 - Mechanism of transcriptional regulation mediated by Vitamin-D Receptor (VDR). VDRs form a heterodimer complex with the retinoid X receptor (RXR) that binds to a VDR response element (VDRE). In the absence of the ligand vitamin D (vit-D), the complex is maintained in a repressed state by co-repressors. After binding of the ligand to the VDR, co-activators come in place of the co-repressors and this results in activation of gene transcription.

It is intriguing to realize that the VDR/RXR regulates about 3% of the entire genome (13), and the biological function of the genes that are regulated by the VDR/RXR complex is therefore extremely diverse. This involves very fundamental processes, such as cell cycle control, development of organs and calcium and phosphate homeostasis in bone

gland, adrenal gland, gut, lung, liver, and many more organs. Interestingly, this complex metabolism, inflammatory processes, and has effects in bone, kidney, parathyroid

Proefschrift_final_zonder.indd 12 22-10-15 15:08 Introduction

is also able to suppress renin transcription by binding the Ec, Eb, or DR3 elements in the renin promoter (5,14,15). Renin is a main component of the RAAS, that itself is an essential regulatory system in HF pathophysiology and an important target for treatment. Epidemiological data have consistently shown an inverse relationship between plasma

VDR-vitamin D complex may be a novel target in treatment and prevention of development renin levels and vitamin D levels (16,17) and it has been suggested that modification of the of hypertension, renal, and heart disease (18,19).

Vitamin D biology

3) or other analogues are needed. Calcitriol is the biologically active form of vitamin D, the In order to activate the VDR, first, the ligand calcitriol (1,25-dihydroxyvitamin D 4th discovered vitamin (after vitamin A, B, and C). Vitamin D is mainly produced by the skin in response to ultraviolet-B sunlight, although it can also be ingested from diet or supplements. Vitamin D is stored in fat, and has both vitamin and hormone-like

properties. The main components of the group of this fat-soluble vitamin are vitamin D3

(cholecalciferol) and vitamin D2 (ergocalciferol). Primary hydroxylation of cholecalciferol

in the liver results in calcidiol (25-hydroxyvitamin D3), and this metabolite is normally measured to determine a person’s “vitamin D status”. Calcidiol has to undergo a second hydroxylation step in the kidney before it becomes the biologically active variant calcitriol (Figure 2).

Figure 2 - Overview of vitamin D metabolism: from UV-B to calcitriol.

Vitamin D levels are tightly regulated by our body. The main feedback axis is with parathyroid hormone (PTH) that is produced by the parathyroid glands and responds to plasma calcitriol levels. Together, these hormones are responsible for regulation of bone homeostasis by maintenance of ionized calcium and phosphorus levels. More recently,

Proefschrift_final_zonder.indd 13 22-10-15 15:08 1 Chapter 1

vitamin D is also thought to exert effects that go beyond bone metabolism (Figure 2). The fact that the VDR is expressed by cardiomyocytes suggests that vitamin D biology may also be of importance in the heart (20). This is underscored by the observations that calcitriol

contractility via regulation of calcium ion uptake in ventricular cardiomyocytes (21). Mice itself is shown to be a negative endocrine regulator of the RAAS, and a modifier of cardiac that have a genetic disruption of the VDR (VDR-/--mice) develop cardiac hypertrophy, while treatment with a VDR-activator reduces left ventricular (LV)-mass in Dahl salt-senstive rats and improves diastolic function in hemodialysis patients (22). Furthermore, low levels of vitamin D are a well-known cause for secondary hyperparathyroidism, a condition that is characterized by chronic elevation of serum PTH levels. Not only VDR but also PTH- receptors are present by cardiomyocytes (23) and it may be that elevated levels of PTH are an important factor in the development of HF as well.

Figure 3. Overview of all vitamin-D-associated factors that could possibly modify HF development and/or progression. HF: heart failure, RAAS: renin-angiotensin-aldosterone-system

The potential beneficial effects of vitamin D may not all rely on direct effects of vitamin D HF-precursors, such as hypertension and diabetes mellitus type II (DM2). VDR-/--mice biology in HF pathophysiology. Vitamin D deficiency is associated with several so called have increased blood pressure levels, and an inverse relationship between vitamin D

Proefschrift_final_zonder.indd 14 22-10-15 15:08 Introduction

levels and blood pressure is observed (14). The prevalence of DM2 inversely relates with serum calcitriol levels, and this also accounts for serum glucose levels (24). It was further hypothesized that calcitriol levels may, at least partially, explain the observed differences in glucose tolerance between population groups (24). Therefore, vitamin D biology may also modify these HF-precursors, and via these indirect effects contribute to development and progression of HF.

Altogether these data suggest that vitamin D biology could be an important player in

maintaining cardiovascular health. Figure 3 illustrates that vitamin D biology reflects an development and progression via several pathways. This thesis assesses the importance of extensive and complex endocrine feedback system that has the potential to influence HF vitamin D biology in HF as a whole, and additionally considers the role single pathways may have in the development and progression of HF.

Outline of this thesis The general aim of this thesis is to investigate the role of vitamin D biology in HF. This thesis focuses on exploring the potential preventive and therapeutic role of vitamin D in HF, but also assesses the utility of vitamin D biology as preventive or therapeutic application besides HF. To this end a series of clinical and experimental studies were designed.

Chapter 2 provides an overview and systematic review of molecular mechanisms of vitamin D biology that may play a role in development of HF. In chapter 3 the association of vitamin

(data from the LifeLines Cohort Study Databank). Chapter 4 explores the relation between D deficiency and increased prevalence of morbidity in a general population is described vitamin D biology and new onset HF in a general population. It describes whether vitamin D metabolites and/or PTH have added value in identifying patients at risk for new onset HF (data from PREVEND). Chapter 5 studies the effect of the vitamin D analogue paricalcitol on

In chapter 6 LV hypertrophy and fibrosis in a murine model of pressure overload and HF development. offspring is investigated. The underlying mechanisms are studied, focusing on epigenetic the effect of parental vitamin D deficiency on cardiovascular health in the Chapter 7 provides a general summary and discussion of the presented

modifications. with providing the implications and recommendations for future research. findings in this thesis, and reflects on the main outcomes from chapter 2-6. It concludes

Proefschrift_final_zonder.indd 15 22-10-15 15:08 1 Chapter 1

References 8. of 1,25-dihydroxyvitamin D receptors and Simpson RU, Thomas GA, Arnold3 AJ. Identification 1. McMurray JJ, Adamopoulos S, Anker SD, Auricchio activities in muscle. J Biol Chem 1985 Jul A, Bohm M, Dickstein K, et al. ESC guidelines 25;260(15):8882-8891. for the diagnosis and treatment of acute and chronic heart failure 2012: The Task Force for the 9. O’Connell TD, Simpson RU. Immunochemical Diagnosis and Treatment of Acute and Chronic Heart Failure 2012 of the European Society of receptor protein in human heart. Cell Biol Int 1996 identification of the 1,25-dihydroxyvitamin D3 Cardiology. Developed in collaboration with the Sep;20(9):621-624. Heart Failure Association (HFA) of the ESC. Eur J RHeart Fail 2012 Aug;14(8):803-869. 10. Mangelsdorf DJ, Evans RM. The RXR heterodimers and orphan receptors. Cell 1995 Dec 15;83(6):841- 2. 850. ventricular remodeling: mechanisms: part 1 of 2. Burchfield JS, Xie M, Hill JA. Pathological Circulation 2013 Jul 23;128(4):388-400. 11. Haussler S, Germeroth D, Friedauer K, Akter SH, Danicke S, Sauerwein H. Characterization 3. van Jaarsveld CH, Ranchor AV, Kempen GI, Coyne of the dynamics of fat cell turnover in different JC, van Veldhuisen DJ, Sanderman R. Epidemiology bovine adipose tissue depots. Res Vet Sci 2013 of heart failure in a community-based study of Dec;95(3):1142-1150.

term survival. Eur J Heart Fail 2006 Jan;8(1):23- 12. Chen KS, DeLuca HF. Cloning of the human 1 subjects aged > or = 57 years: incidence and long- 30. alpha,25-dihydroxyvitamin D-3 24-hydroxylase

4. Kuipers I, van der Harst P, Kuipers F, van Genne D-responsive elements. Biochim Biophys Acta gene promoter and identification of two vitamin L, Goris M, Lehtonen JY, et al. Activation of liver X 1995 Jul 25;1263(1):1-9. receptor-alpha reduces activation of the renal and cardiac renin-angiotensin-aldosterone system. 13. Bouillon R, Carmeliet G, Verlinden L, van Etten E, Lab Invest 2010 Apr;90(4):630-636. Verstuyf A, Luderer HF, et al. Vitamin D and human health: lessons from vitamin D receptor null mice. 5. Kuipers I, van der Harst P, Navis G, van Genne L, Endocr Rev 2008 Oct;29(6):726-776. Morello F, van Gilst WH, et al. Nuclear hormone receptors as regulators of the renin-angiotensin- 14. Li YC, Kong J, Wei M, Chen ZF, Liu SQ, Cao LP. aldosterone system. Hypertension 2008 1,25-Dihydroxyvitamin D(3) is a negative Jun;51(6):1442-1448. endocrine regulator of the renin-angiotensin system. J Clin Invest 2002 Jul;110(2):229-238. 6. Gouni-Berthold I, Krone W, Berthold HK. Vitamin D and cardiovascular disease. Curr Vasc Pharmacol 15. Sigmund CD. Regulation of renin expression and 2009 Jul;7(3):414-422. blood pressure by vitamin D(3). J Clin Invest 2002 Jul;110(2):155-156. 7. Krasowski MD, Yasuda K, Hagey LR, Schuetz EG. Evolutionary selection across the nuclear 16. Burgess ED, Hawkins RG, Watanabe M. Interaction hormone receptor superfamily with a focus on of 1,25-dihydroxyvitamin D and plasma renin the NR1I subfamily (vitamin D, pregnane X, and activity in high renin essential hypertension. Am J constitutive androstane receptors). Nucl Recept Hypertens 1990 Dec;3(12 Pt 1):903-905. 2005 Sep 30;3:2.

Proefschrift_final_zonder.indd 16 22-10-15 15:08 Introduction

17. Resnick LM, Muller FB, Laragh JH. Calcium- regulating hormones in essential hypertension. Relation to plasma renin activity and sodium metabolism. Ann Intern Med 1986 Nov;105(5):649-654.

18. Doorenbos CR, van den Born J, Navis G, de Borst MH. Possible renoprotection by vitamin D in chronic renal disease: beyond mineral metabolism. Nat Rev Nephrol 2009 Dec;5(12):691-700.

19. Wu-Wong JR. Potential for vitamin D receptor agonists in the treatment of cardiovascular disease. Br J Pharmacol 2009 Sep;158(2):395-412.

20. Chen S, Glenn DJ, Ni W, Grigsby CL, Olsen K, Nishimoto M, et al. Expression of the vitamin d receptor is increased in the hypertrophic heart. Hypertension 2008 Dec;52(6):1106-1112.

21. Walters MR, Ilenchuk TT, Claycomb WC. 1,25-Dihydroxyvitamin D3 stimulates 45Ca2+ uptake by cultured adult rat ventricular cardiac muscle cells. J Biol Chem 1987 Feb 25;262(6):2536-2541.

22. Bodyak N, Ayus JC, Achinger S, Shivalingappa V, Ke Q, Chen YS, et al. Activated vitamin D attenuates left ventricular abnormalities induced by dietary sodium in Dahl salt-sensitive animals. Proc Natl Acad Sci U S A 2007 Oct 23;104(43):16810-16815.

23. Potthoff SA, Janus A, Hoch H, Frahnert M, Tossios P, Reber D, et al. PTH-receptors regulate norepinephrine release in human heart and kidney. Regul Pept 2011 Nov 10;171(1-3):35-42.

24. Zittermann A. Vitamin D and disease prevention with special reference to cardiovascular disease. Prog Biophys Mol Biol 2006 Sep;92(1):39-48.

Proefschrift_final_zonder.indd 17 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

Proefschrift_final_zonder.indd 18 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

L.M.G. Meems; P. van der Harst; W.H. van Gilst; R.A. de Boer

University of Groningen, University Medical Center Groningen, Department of Cardiology, The Netherlands Chapter Proefschrift_final_zonder.indd 19 222-10-15 15:08 2 Chapter 2

Abstract Vitamin D has recently been suggested as an important mediator of blood pressure and cardiovascular disease, including heart failure. In patient with heart failure, low vitamin D levels are associated with adverse outcome and correlate with established clinical correlates and biomarkers. Many precursor states of heart failure, such as

low vitamin D levels. Recent experimental data have provided clues how vitamin hypertension, atherosclerosis, and diabetes are more prevalent in subjects with D might exert cardioprotective effects. The steroid hormone vitamin D regulates gene expression of many genes that play a prominent role in the progression of

regulator of the hormone renin, the pivotal hormone of the renin-angiotensin system. heart failure, such as cytokines and hormones. Specifically, vitamin D is a negative

receptor, which develop hypertension and adverse cardiac remodeling mediated via Mechanistic insights were gained by studying mice deficient for the vitamin D the renin-angiotensin system. Furthermore, the vitamin D receptor is expressed in the heart and regulated under pro-hypertrophic stimuli and the vitamin D receptor has been associated with the expression of other hypertrophic genes such as natriuretic peptides.

So, epidemiological data and mechanistic studies have provided strong support for a potentially cardioprotective effect of vitamin D. It remains unclear if vitamin

therapeutic addendum in the treatment of heart failure. This review summarizes D supplementation is beneficial in preventing heart failure or if it could be a current knowledge on vitamin D and its biology in heart failure.

Proefschrift_final_zonder.indd 20 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

Introduction

incidence and prevalence (1). Once HF has ensued, patients have to be hospitalized often, Heart failure (HF) is a major medical problem in the Western world with an increasing thereby having a low quality of life score mainly due to worsening HF, arrhythmias or (recurrent) myocardial infarction. HF is a progressive condition involving activation of regulatory systems like the sympathetic nervous system (SNS) and the renin-angiotensin system (RAS). Initially activation of these systems is adaptive, but when activation becomes sustained, they contribute to pathological cardiac remodeling and progression of HF

morbidity and mortality considerably (1). However, despite optimal medical therapy, the (2). Treatment specifically targeting neurohumoral systems has reduced HF associated prognosis remains poor, with a 5 years mortality of approximately 50% (1). Novel targets and treatments are urgently needed and continuously sought after (3).

regulators of gene transcription (4,5). A gene regulator that may be of particular importance One of the novel concepts in intervening in the pathophysiology of HF includes influencing for cardiovascular disease and HF is the vitamin D receptor (VDR) (6). Insight was gained by studying VDR-/--mice that were shown to develop hypertension and cardiac remodeling. It has been suggested that treatment with vitamin D may attenuate experimental cardiac remodeling. Experimental data are supported by (older and recent) epidemiological data, consistently showing that vitamin D levels are substantially decreased in patients

vitamin D levels are associated with favorable outcome in patients with HF. However, with HF compared with healthy controls. In various cohorts it was confirmed that higher the exact mechanism of these associations is unclear. This review will describe the most

recently uncovered mechanistic clues. We will describe the metabolism of vitamin D and important findings from epidemiological studies and trials and discuss them in the light of the potential effects of vitamin D signaling in HF. We have reviewed published data on the

as a treatment in HF will be discussed. effects of vitamin D deficiency in HF. Finally, the potential role of vitamin D supplementation

Proefschrift_final_zonder.indd 21 22-10-15 15:08 2 Chapter 2

Vitamin D metabolism Vitamin D synthesis. understanding why vitamin D levels could be associated with development of HF. Vitamin D The basic metabolism of vitamin D is briefly discussed to allow better is an essential precursor of the active form of vitamin D: calcitriol, 1,25-hydroxivitamin-D3

(1,25(OH)2D3 D ) and cholecalciferol (vitamin D ). Dietary intake of vitamin D provides 10-20% of the 2 ). The two major forms3 of vitamin D are indicated as ergocalciferol (vitamin required supply (7), whereas most of the vitamin D is synthesized in the skin. Through the

from lesser active synthesized vitamin D to more biologically active forms takes place. absorbance of Ultraviolet-B (UVB) light by the skin the first step in the regulatory cascade

produces previtamin D , which turns to vitamin D by thermal isomerization. Primary Specifically, photolysis of3 7-dehydrocholesterol in 3the epidermis by solar UVB radiation hydroxylation of vitamin D3 in the liver results in 25-hydroxivitamin D (25(OH)D3),

which transforms into the highly biologically active calcitriol (1,25(OH)2D3) after second

enzymatic activity, e.g. vascular smooth muscle, monocytes and endothelial cells. Although hydroxylation in the kidney. Of note, there are several other cell types with 1α-hydroxylase these cells are thought to be of great relevance for local paracrine effects, they do not

2D3 levels.

significantly contribute to circulating 1,25(OH) Definition of vitamin D deficiency. No consensus on optimal levels of (serum) 25(OH)D3

3 level of less than 20 ng/mL (50 nmol/L) (8-11). A level of 25(OH)D of 21-29 ng/mL (52–72 nmol/L) may exists. Nevertheless, vitamin D deficiency is mostly3 defined as a 25(OH)D

calcium transport by 45 to 65% in women when 25(OH)D levels were increased from be regarded as relative insufficiency, considering data that3 shows an increased intestinal

average of 20-32 ng/mL (50–80 nmol/L) (12). A level of 30 ng/mL or greater ( >75 nmol/L) may be considered as sufficient vitamin D levels (13). Vitamin D and Calcium and PTH. Traditionally, the role of vitamin D has been considered as maintenance of normal ionized calcium and phosphorus concentrations and thereby

years strongly suggest that vitamin D exerts many effects in the body, regulation of bone as major regulator of the bone mineralization. Although experimental data of the last mineralization still remains its most important function. Without vitamin D, only 10 to 15% of dietary calcium and about 60% of phosphorus is absorbed (14-16).

Renal production of 1,25(OH)2D3 is tightly regulated by plasma parathyroid hormone (PTH) levels and serum calcium and phosphorus levels (7). Increased levels of PTH, serum calcium

en phosphorus lead to a decrease in 25(OH)D3, so an inverse relationship exists. Presence of

1,25(OH)2D3

increases efficiency of the absorption of renal calcium and of intestinal calcium 22

Proefschrift_final_zonder.indd 22 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

and phosphorus. 1,25(OH)2D3 also induces the expression of the enzyme 25-hydroxivitamin-

D-24-hydroxylase (CYP24). This enzyme catabolizes both 25(OH)D3 and 1,25(OH)2D3 into

biologically inactive, water-soluble calcitroic acid (7). Although 1,25(OH)2D3 is not the only modulator of PTH secretion, this inverse relationship is of importance for the cardiovascular system.

Vitamin D and its receptor in the heart

2D3 and interacts with target-cell nuclei to produce a variety of biologic effects (17). The VDR is an intracellular hormone receptor that specifically binds to 1,25(OH)

Expression. The VDR is expressed in rat (18) and human heart tissue (19). A more recent study showed that immunoreactivity was present for VDR in both neonatal rat

(NHR), nuclei and not the cytoplasm were positively stained for VDR. The VDR seems to cardiomyocytes and in fibroblasts (20). As expected for a nuclear hormone receptor

is under tight control (22), although cardiac transcriptional regulation hitherto remains be subcellular located, within or adjacent to the T-Tubulus (21). Expression of the VDR largely unknown. Chen et al. showed that in cardiac hypertrophic, expression of the VDR is increased (20).

Function of VDR. The traditional action of vitamin D is calcium and phosphate homeostasis, to ensure the deposition of bone mineral. Recently, the role of vitamin D as a steroid hormone belonging to the steroid hormone nuclear receptor family with important effects on gene transcription has been elucidated (23). Many novel targets of the VDR have been

of transcription factors as modulators of cardiac hypertrophy and failure has been identified which appear to be important players in heart disease. The potential importance appreciated recently (24) although initial enthusiasm has dampened (25).

Vitamin D: effects on pathophysiological pathways of heart failure

Renin-Angiotensin System (RAS) Background. The RAS is a key regulatory system in blood pressure (BP) and volume homeostasis and plays an essential role in the pathophysiology of HF. The RAS has been an important drug target for therapeutic intervention: angiotensin converting enzyme inhibitors (ACEi), Angiotensin II Receptor Blockers (ARBs), and aldosterone receptor

as risk factor for worse outcome (26,27). Interestingly, in the presence of treatments aimed antagonists (ARAs) reduce HF-related morbidity and mortality (1). PRA has been identified

Proefschrift_final_zonder.indd 23 22-10-15 15:08 2 Chapter 2

to inhibit the RAS, sustained elevations of PRA still exert malicious effects (27).

Epidemiological data. Epidemiological data showed that in both normotensive and

2D3 serum levels are inversely associated with BP (28-30) and also with PRA (30,31). This suggests a potentially causal relationship between vitamin hypertensive subjects, 1,25(OH) D and hypertension via renin regulation. Recent evidence showed that NHRs including VDR, liver X receptor (LXR) and peroxisome proliferator-activated receptor (PPAR) importantly

binds retinoid X receptor (RXR) and forms a heterodimer, which may bind the Ec, Eb, or DR3 mediate renin transcription regulation (5) via specific elements in the renin promoter. VDR elements in the renin promoter and suppresses renin transcription (5,32,33). Data from

Forman et al. 3 levels and Angiotensin II (Ang II) concentration. Patients with the lowest 25(OH)D levels had the highest levels (34) showed a significant trend between 25(OH)D3 of Ang II, furthermore supporting the notion that the RAS is overstimulated in absence of

25(OH)D3. In other small scale clinical studies, administration of 1,25(OH)2D3 also showed reductions in PRA, Ang II levels, BP and myocardial hypertrophy (35,36).

Although epidemiological data clearly indicate an association between vitamin D in hypertension, supplementation studies with vitamin D have yielded equivocal results. The

effect of long term supplementation with vitamin D (combined with calcium) on BP and Women’s Health Initiative Calcium/Vitamin D trial (37) could not establish a beneficial cardiovascular events. Possibly, this could be explained by the relative low dose (400 IU

intake and precise monitoring of BP are necessary to corroborate a potential relationship daily) of vitamin D in this study. Further studies with well-defined amounts of vitamin D between vitamin D status and BP.

Data from VDR-/--mice. Compelling experimental evidence for the interplay between vitamin D and renin has been provided by Li et al. (32), who employed mice with genetic total disruption of the gene encoding VDR (VDR-/--mice). In this model, the mRNA renin in the kidney is three-fold higher than in wild type mice and plasma Ang II is increased 2.5-fold. As the angiotensinogen levels show no difference between the VDR-/- and wild type mice, the increase of Ang II is attributed to increased renin activation. VDR-/--mice exhibit LV hypertrophy and increased cardiomyocyte size. Furthermore, VDR-/--mice have a two-fold increased water intake and urine output. Besides the cardiomyocytes, matricellular proteins are also regulated in VDR-/--mice (38). The development of hypertension in VDR-/--mice can

be corrected by administration of ACEi and ARBs but only as long as 1,25(OH)2D3 levels are

2D3 is not only crucial for calcium homeostasis, but also for maintaining BP homeostasis. at sufficient levels (39). So, from this model, it is strongly suggested that 1,25(OH)

Proefschrift_final_zonder.indd 24 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

1α-hydroxylase deficient mice. Interestingly, an increase in renin expression had also been seen in another mouse strain with genetic intervention in vitamin D homeostasis: the

abnormalities similar to those reported in VDR-/--mice. Administration of 1,25(OH) D to 1α-hydroxylase knockout mice. These mice lack the 1α-hydroxylase enzyme and develop2 3

neutralizes RAS activity (40). A rescue diet aimed at restoring the serum calcium D levels 1α-hydroxylase deficient mice results in normalization of the cardiac abnormalities and indeed showed normalized serum calcium and phosphorus levels, but the abnormalities in BP, cardiac structure and function and RAS activation persist. As the increase in renin is

not a result of hypocalcaemia, but disrupted VDR signaling, it was argued that 1,25(OH)2D3 suppresses renin in an exclusively VDR-dependent manner (40). More recent studies in the

2D3 not only regulates the renal RAS, but also the cardiac RAS in mice in a calcium-independent and 1,25(OH) D dependent manner same mouse model confirmed that 1,25(OH) 2 3 (41). This underscores the hypothesis that 1,25(OH)2D3 regulates cardiac function, at least partially, through the local (cardiac) RAS.

In experimental pharmacological studies, corroborative evidence was obtained in

suppresses in a dose-dependent manner renin expression (42). The potentially functional experimental studies using the specific VDR agonist paricalcitol. In mice, paricalcitol importance of this observation was shown by Zhang and colleagues (43). In a model of diabetic nephropathy, the ARB losartan decreased proteinuria, however, at the expense of an increased (compensatory) PRA. Inhibition of this PRA with the VDR agonist paricalcitol further decreased proteinuria. In another study from Bodyak et al. in hypertensive rats, paricalcitol partially reversed hypertension-induced LV remodeling (44).

Taken together, genetic and pharmacological perturbations of the VDR consistently show that vitamin D is a negative regulator of renin.

Other regulatory effects of the vitamin D receptor in heart failure Effects of vitamin D on PTH. Excess levels of parathyroid hormone (PTH) are known to increase BP and cardiac contractility, leading to cardiomyocyte hypertrophy and interstitial

An inverse association of 25(OH)D and 1,25(OH) D concentrations with PTH levels have fibrosis of the heart (45), factors which3 are directly2 contributing3 to cardiovascular disease. been reported in CHF patients, similar to the one in healthy adults (46). The rate of coronary

ml in men) versus artery disease increases 1.7-fold in subjects in the highest PTH quartile range (> 32pg/ PTH regulation may contribute to the association between abnormalities in vitamin D subjects in the lowest PTH quartile (<17.3 pg/ml in men). So, defective homeostasis and heart failure.

Proefschrift_final_zonder.indd 25 22-10-15 15:08 2 Chapter 2

Effects of vitamin D on ANP and BNP. Atrial and Brain Natriuretic Peptides (ANP, BNP) function as part of a counter-regulatory system of the RAS and are well-used biomarkers in HF. Their production is stimulated by stretch applied to the cell (47), which makes

them serve as surrogate markers of hypertrophy (47,48). 1,25(OH)2D3 lowers levels of immunoreactive ANP (irANP) and endogenous ANP gene expression (49). Furthermore,

1,25(OH)2D3 leads to reduction in human BNP (hBNP) promotor activity. A direct association between VDR with the hBNP promotor has been indicated by Chen and colleagues: when cardiac hypertrophy is induced by isoproterenol administration, not only an increase in hBNP promoter activity is found, but also in VDR expression (20). These data

indicate that some of the effects of 1,25(OH)2D3 are rather directly than indirectly operating at the level of the target gene expression in suppressing the hypertrophic phenotype.

Effects of vitamin D on myotrophin. Myotrophin acts in the pathogenesis of cardiac hypertrophy, but also in normal cardiomyocyte development and is considered as a

potential compensatory mechanism in HF (50). By treatment of cells with 1,25(OH)2D3 the level of myotrophin expression increases (51) but it is unclear whether this is cause or consequence of the phenotypic response of the cardiomyocytes.

Effects of vitamin D on (cardiac) muscle. Finally, as the VDR is also expressed in skeletal

muscle, several genomic VDR-mediated effects and rapid nongenomic effects of 1,25(OH)2D3 -/- have been described in vitro (52). Data from VDR -mice suggest that 1,25(OH)2D3 provides

analysis (52). So it could be hypothesized that a direct effect of the VDR system may also a late stage effect of muscle development, confirmed by gene and protein expression exist in the heart muscle or during heart development.

Effects of vitamin D on contractility. 1,25(OH)2D3 plays an important role in regulating

gene expression, growth and differentiation in cardiomyocytes (53). 1,25(OH)2D3 inhibits myocyte proliferation, induces myocyte hypertrophy and regulates expression of fetal

mRNA and protein levels, suggesting the presence of a 1,25(OH) D -dependent signaling myocyte specific genes (50). Induction of myocyte hypertrophy leads2 3 to an increase in VDR

antihypertrophic system (20). Thereby, 1,25(OH) D enhances cardiac myocyte contractility system within the heart, which is amplified in cardiac2 3 hypertrophy for his beneficial (21,55) and facilitates relaxation through both genomic and non-genomic pathways (21,23).

Involvement of 1,25(OH)2D3 in the genomic pathway leads to a direct regulation of gene transcription, whereas the activation of non-genomic pathways displays a wide variety of rapid (seconds to minutes) and transient changes in transmembrane transport of ions (such as calcium and chloride) or intracellular signaling pathways (such as cAMP, protein

Proefschrift_final_zonder.indd 26 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

kinase A, protein kinase C) (23). Whether these effects of vitamin D have consequences for cardiomyocyte function on the long term is unknown.

Vitamin D levels are associated with risk factors for development of HF

role of vitamin D and its receptor in HF from early states on. Several risk factors, that are Well over 30 years ago, the first observations were made that pointed towards a causal crucially involved in HF development are, at least in part, associated with changes vitamin D regulation.

Hypertension. Clinical and epidemiologic studies over the past decades have demonstrated

an inverse relationship between serum levels of 1,25(OH)2D3, BP (28,29) and PRA (31,30) in

of all patients (1,3), rendering hypertension as one of the main causes of HF. normotensive and hypertensive subjects. HF that is preceded by hypertension is about 70%

Atherosclerosis. Atherosclerosis with or without myocardial infarction is the leading cause of HF: about 70% of all patients have ischemic HF. As vitamin D regulates the levels of calcium in the blood, by increasing the absorption in the intestine, a role for vitamin D in atherosclerosis is expected. Indeed, low levels of vitamin D are predictive for increased

incidence of myocardial infarction (45). Low serum levels of 1,25(OH)2D3 are inversely

patients with low risk of developing HF (56). correlated with the extent of vascular calcification, not only in high risk patients, but also in

Diabetes. Diabetes is increasingly recognized as important cause of HF (3). As the VDR is

expressed by pancreatic β-cells and cells of the immune system, a role for vitamin D has to impaired secretion of insulin, in both animal and human models, and induces glucose been suggested in diabetes mellitus (DM). Previous data shows vitamin D deficiency leads

intolerance (57,58). And, indeed, vitamin D deficient individuals are at increased risk for supplementation with vitamin D (61,62). developing type 2 DM (59,60). Rectification of the glucose intolerance is observed after

Other risk factors. correlation between serum concentrations of 25(OH)D Several studies showed an independent3 and highly significant positive apolipoprotein A-1 and high density lipoprotein (HDL)-cholesterol (63,64). Accumulating and lipid profiles, such as epidemiological data are linking a low vitamin D status to the development of autoimmune diseases and chronic infections, like chronic obstructive pulmonary disease, allergy/asthma, multiple sclerosis, and rheumatoid arthritis (23). The VDR is required for the cellular and humoral immune response (65,66). In vitro studies suggest that vitamin D suppresses pro-

Proefschrift_final_zonder.indd 27 22-10-15 15:08 2 Chapter 2

to a possible inhibitory pathway in worsening of HF (69). inflammatory cytokines (66) and upregulates anti-inflammatory cytokines (66-68), leading

Inactive Vitamin D

• Ergocalciferol • 1α-hydroxyvitamin D • Cholecalciferol

• Alfacalcidol • 1,25-dihydroxyvitamin D • Docercalciferol 3

• Synthetic analogues 1,25-D • Calcitriol

• Paricalcitol • Maxacalcitol

Figure 1 - Effect of vitamin D on pathophysiological pathways of HF.

Vitamin D levels and the clinical heart failure syndrome: A systematic review Methodology of systematic review. We performed a search in Pubmed (April 2010), using MESH terms “heart failure”, “cardiomyopathy”, and “vitamin D”. This yielded 139 references. We excluded case reports, case series, review articles, articles in other languages than English and articles describing experiments in laboratory animals or cells. This left us with 27 articles, which are discussed in the text and categorized in Tables 1 and 2. In Table 1, articles are presented with data on vitamin D levels and development and/or outcome in HF. Table 2 shows articles that describe the effects of vitamin D supplementation on HF development or outcome.

The cause of Vitamin D deficiency in HF is multifactorial. with HF is likely to be multifactorial. First, in the general population, serum 1,25(OH) D Vitamin D deficiency in patients2 3

Proefschrift_final_zonder.indd 28 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

prone to low vitamin D levels. Secondly, limited mobility is a hallmark of HF (71,72). decreases with age (70). The average HF patient tends to be older (>70 years), so already

because of their sedentary life-style (73). Interesting recent data indicated that HF patients, Patients with HF have an increased risk of developing vitamin D insufficiency, simply compared to healthy controls, already had a lower vitamin D status in the period of their lives when they were still free from HF (74).

in environment; also genotype is a determinant factor in the development of vitamin D Thereby, this multifactorial character of vitamin D deficiency is not only due to variation

for bioactivation of 1,25OH D , and therefore involved in vitamin D metabolism (75). A SNP deficiency. As an example serves2 3 the gene CYP27B1 which decodes the rate limiting enzyme (Rs4646537) situated in the eight intron of the gene encoding CYP27B1 has been associated with hypertension and chronic HF. The homozygote rs4646537 carrier status is associated with increased risk for chronic HF in hypertensive patients, whereas the heterozygote carrier status demonstrates protective effects against development of hypertension (75).

In conclusion, vitamin D deficiency seems to depend on different factors, both environmental and genetic factors. Therefore, it is difficult to pinpoint the causes of widespread vitamin D deficiency in HF. Vitamin D deficiency and HF outcome (Table 1). Already in 1997, Shane and colleagues reported an observational study in 101 HF patients, (men and women) of multi-ethnical

origin. They linked low serum 25(OH)D3 levels to a diminished exercise tolerance, resulting

in lower peak VO2 in patients with low serum 25(OH)D3 and 1,25(OH)2D3 levels (76). It took

low 25(OH)D and 1,25(OH) D levels and HF characteristics. In a study of 88 Caucasian 16 years before3 another large2 study3 was reported that confirmed the relationship between patients from Zittermann et al., patients were divided into three groups: chronic HF patients

<50 years, chronic HF patients >50 years and a control group (patients >50 years). It was lower levels of 25(OH)D and 1,25(OH) D compared to the (elderly) healthy controls (46). shown that HF patients, 3regardless whether2 3 < 50 or >50 years of age, had significantly

natriuretic peptide) levels are associated with serum 25(OH)D (46), and by this the Thereby, this study also brought the first evidence that NT-proANP3 (N-terminal pro-artrial hypothesis was fueled that vitamin D levels might directly relate to HF outcome.

Subsequent studies demonstrated that 25(OH)D3 and 1,25(OH)2D3 have been associated

with LV dysfunction: patients with a poor LV function showed decreased 25(OH)D3 and

1,25(OH)2D3 levels (77). Myocardial markers like the NT-proANP and N-terminal pro-brain

natriuretic peptide (NT-proBNP) show significant and independent correlations with 29

Proefschrift_final_zonder.indd 29 22-10-15 15:08 2 Chapter 2

25(OH)D3 levels (77). A recent study even considered low serum 25(OH)D3 levels as a new risk factor above and beyond established cardiovascular risk factors, for cardiovascular events (78).

Vitamin D levels and mortality in chronic HF patients (Table 1). Epidemiological studies from

Pilz et al. (77) and Kim et al. 3 and 1,25(OH) D are found in chronic HF patients. The latter study showed that with reduce of 2 3 (79) showed that significant lower levels of 25(OH)D serum 25(OH)D3 levels the prevalence of HF patients increases. Fiscella and Franks reported

that 1,25(OH)2D3 levels function as independent predictor of mortality in HF patients (80). Zittermann et al. 25(OH)D and 1,25(OH) D ; the number of survivors increases with 12% when the lowest 3 showed2 that3 one-year-survival is significantly related to serum levels quintile of serum 25(OH)D3 levels is compared with the highest quintile of serum 25(OH)

D3 levels (81). The effect of 1,25(OH)2D3 levels on the survival-curve of HF patients even

(lowest serum levels) versus seemed to be of more importance: a one-year-survival rate of 66.2% in the first quintile serum levels) (81). Kilkinnen and his group demonstrated that an inverse association a one-year-survival rate of 96.1% in the fifth quintile (highest between serum 25(OH)D3 levels and cardiovascular disease is present when results are

adjusted for age and sex. On the 3other hand, the risk for coronary heart disease (CHD) is not (82). Nevertheless, low vitamin D statistically increased total cardiovascular disease significantly related to 25(OH)D levels when they are adjusted for potential confounders mortality in a multivariate model (82).

Vitamin D deficiency in African Americans and Hispanics. As vitamin D is absorbed by the skin and then converted in the liver and kidney, a dark skin with more pigmentation is a

disadvantage. Mean 25(OH)D3 decreases with older age, but also by black and Hispanic race (79). Arroyo and his group demonstrated that hypovitaminosis is present in African American (AA) patients independently if they were hospitalized with decompensated HF or were asymptomatic outpatients (83). A recent study from Forman and colleagues indicated

that plasma 25(OH)D3 levels are inversely related to Angiotensin II (Ang II) concentration (34), which may eventually lead to hypertension. As hypertension is a chief risk factor for development of chronic HF, AA and Hispanics may be at higher risk of developing HF due to their skin pigmentation and diminished synthesis of vitamin D.

In summary, low levels of vitamin D are associated with adverse outcome in HF. Published reports generally are small and comprise of maximum several hundred of patients with limited follow-up and low even rate. Clearly, larger cohort (multiple hundreds or thousands of patients), with meticulous characterization and systematic follow-up are warranted to

value the usefulness of vitamin D deficiency as a prognostic marker in HF. Furthermore, 30

Proefschrift_final_zonder.indd 30 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

we would like to point out that as with any novel biomarker of HF, (publication) bias may overestimate the actual importance of vitamin D in HF. Some negative reports are available: Bolland et al.

showed that neither the risk for myocardial infarction significantly increases when vitamin D deficiency is present, or the risk for HF (84). Intervention with Vitamin D and analogues in HF (Table 2). Daily Vitamin D3 supplementation in the general population did not change the risk for development of coronary heart disease (85). However, in dialysis patients, treatment with a VDR agonist led to decreased PRA, Ang II and ANP levels (36), although systolic blood pressure (SBP) and diastolic blood pressure

hypertrophy improve when vitamin D is supplemented, but this improvement does not (DBP) were not significantly altered. (36,86,87).3 Echocardiographic markers for cardiac

result in significant changes in cardiac contractility (36,87). Furthermore, inflammatory markers like IL-10 en TNF-α did show significant changes in favor of a less inflammatory profile in HF patients (86).

et al. included 123 patients and randomized To date, only a few publications specifically addressed if vitamin D supplementation could them to receive daily 2000 U cholecalciferol (plus calcium) or placebo, and followed the be of benefit in HF patients (86,88) Schleithoff patients for up to 9 months. Various surrogate parameters, such as BP, exercise capacity,

left ventricular ejection fraction and NT-proBNP did not differ between groups. Patients higher IL-10) (86). Witham et al. included 105 elderly patients with low vitamin D levels randomized to vitamin D had a lesser pro-inflammatory cytokine profile (lower TNF-α and and randomized them to 100,000 U vitamin D2 or placebo (given at baseline and after 10

to vitamin D treatment. Outcome parameters included exercise capacity and quality of life weeks). After 20 weeks, vitamin D levels significantly increased in the patients allocated measures and were not improved by vitamin D supplementation (88).

In conclusion, strong experimental and observational evidence suggests that vitamin D

have been conducted to prove this hypothesis. It is well known that experimental data and supplementation could be of benefit in HF patients. However, no adequately sized studies

renin in vitro (89), but in humans, no effects on renin levels were observed in a trial with a clinical data are not always in concert. For instance, PPAR-γ is a transcriptional regulator of

should be carefully designed and have adequate power. PPAR-γ agonist (90). This underscores that the mechanisms are complex and future trials

Proefschrift_final_zonder.indd 31 22-10-15 15:08 2 Chapter 2

Table 1 - Vitamin D levels and development and/or outcome in HF

HF and Vitamin D Study Age Average 25(OH)D % Key N Race 3 deficiency Population (years) and 1,25(OH)2D3 levels Deficient Findings

Bolland et al. (84) Post MPW 1581 C 50.0%

Risk for congestive HF, p=NS 736 74.5±4.4 serum 25(OH)D3 (p=0.97). Risk for MI, p=NS nmol/L (p=0.52). <50 735 73.6±4.0 - serum 25(OH)D3 nmol/L >50 Pilz et al. (77) CHF pt 3257 C - 89.7% Lowest quartile of serum 25(OH)

D3 is associated with a higher 789 66.0 number of deaths due to HF.

(58.3-72.9) NT-proBNP and 1,25(OH)2D3 are severe deficiency <25.00 nmol/L 1346 64.0 25.00-49.99 nmol/L (56.0-70.8) significantly associated (p<0.001). moderate deficiency 786 61.8 50.00-74.99 nmol/L (55.6-68.4) Insufficiency optimal range 336 61.0 (54.8-66.8)

≥75.00 nmol/L Zittermann et al. (46) CHF pt 88 C 61.3% 3 and 1,25(OH) D levels in chronic HF Significant2 reduced3 25(OH)D 20 38.9±7.9 9.5 ng/mL relationship between NT-proANP CHF patients < 50 years 34 64.1±6.4 11.5 ng/mL pt (p<0.001). Significant inverse and serum 25(OH)D3 34 68.9±5.2 17.0 ng/mL CHF patients ≥ 50 years (p<0.001). controls ≥ 50 years Alsafwah et al. (93) CHF pt, 86 AA - 84-96% Hypovitaminosis D is quite HD-NHF pt, prevalent in AA, irrespective of controls the season. As well in individuals mild hypovitaminosis D 51.1±1.2 with either decompensated or 20 - 30 ng/mL compensated HF, and those with mod. hypovitaminosis D 51.1±1.2 HD-NHF and healthy volunteers. 10 - 19 ng/mL Nevertheless, most and most severe hypovitaminosis D is seen severe hypo- 51.1±1.2 vitaminosis D in HF patients compared to the other groups.

<10 ng/mL Zittermann et al. (94) CHF pt 383 C Low circulating 1,25(OH)2D3 levels are more often found in electively listed patients 325 55.8±0.6 35.0±3.0 pmol/L 50.2% urgent/high urgent candidates for cardiac transplantation than urgent/high urgent 58 52.6±1.7 23.3±2.0 pmol/L 56.9% in elective candidates. 1-year sur- listed patients vival in those patients with lower

1,25(OH)2D3 levels vs. higher

between lower 1,25(OH)2D3 levels and(p <0.001). higher riskAn association of adverse events such as death and the need for cardiac transplantation was

observed (p<0.001).

Watson et al. (56) Healthy 113 C - Serum levels of 1,25(OH)2D3 levels volunteers are inversely correlated with the low risk group for 100 40.1±13.0 pg/mL developing CHD >45 years levelsextent of of 1,25(OH) vascular calcificationD levels are in high risk group for 13 34.5±9.9 pg/mL low risk group (p=2 0.24).3 Serum developing CHD inversely correlated with the >45 years extent of vascular calcification in

Wang et al. (78) HD pt 1739 C 19.7 ng/mL 28.0% highLow serumrisk group 25(OH)D (p= 0.05).3 levels are associated with increased cardio- 1258 59 ± 9 and beyond established vitamin D sufficient vascular events (p=0.01) above ≥15 ng/mL 32

Proefschrift_final_zonder.indd 32 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

481 59 ± 9 cardiovascular risk factors.

vitamin D deficient <15Forman ng/mL et al. (34) 184 C & - 79.9% Plasma 25(OH)D3 levels are AA optimal 37 42.2 (9.5) Dnot levels significantly are inversely related related to PRA to (p-trend=3 0.40). Plasma 25(OH) ≥30 ng/mL 108 40.0 (12.2) 15.0-29.9 ng/mL 0.03). Lower 25(OH)D3 levels are Ang II concentration (p-trend= insufficient associated with a blunted RPF 39 38.2 (13.5) response to exogenous Ang II deficient <15 ng/mL infusion (p-trend= 0.009). Abou-Raya et al. (92) CHF pt, 137 C 1,25(OH)2D3 - controls cantly lower in CHF patients than levels are signifi CHF patients 83 69.9±4.5 24.1±1.1 pg/mL An association between chronic controls 54 70.1±3.9 34.7±1.7 pg/mL HFin healthy severity controls (expressed (p= 0.005).by lower

class) and BMD measurements wasLVEF found. (p=0.001) or higher NYHA

Ameri et al. (91) CHF pt, 121 C 25(OH)D and 1,25(OH)2D3 concen- controls all CHF patients 90 78.41±7.74 17.25 (10.00-28.63) 93.3% nmol/L trations are significantly lower in- sociatedCHF patients with than LV dilation; in controls LV EDD (p= CHF patients with echo 52 76.85±8.33 14.13 (10.00-25.81) N.A.) . Vitamin D deficiency is as nmol/L 31 72.13±7.73 25.00 (17.38-45.13) and ESD were significantly longer nmol/L in vitamin D deficient patients - control subjects (p<0.05 for both). LV EDV and ESV tients with 25(OH)D3 were significantly higher in pa - cantly lower in severely <25 vitamin nmol/L (p<0.05 for both). FS was signifi

NT-proBNP and 1,25(OH)2D3 are negativelyD deficient associated. patients (p<0.05). Vitamin D supplementation is ineffective in reducing NT-proBNP levels in chronic HF patients.

Boxer et al. (99) CHF pt 60 - 77±10 26.7±12.5 ng/mL 30.0% Lower vitamin D levels were associated with poor aerobic capacity

and greater frailty (p=0.02). Arroyo et al. (83) CHF pt, 49 AA Hypovitaminosis is present in controls AA patients who were either compensated HF 10 52±3 37±7 ng/mL 80.0% hospitalized with decompensated patients HF or asymptomatic outpatients. long-term decompen- 15 56±3 14±1 ng/mL 100.0% sated HF patients mL are associated with elevations inSerum serum 25(OH)D PTH (HF levels patients of <30 vs. ng/ control group 9 36 (24-58) 18±4 ng/mL 0.0%

controls: p<0.01). Fiscella et al. (80) Healthy 15363 43.64 29.64 ng/mL - Low 25(OH)D3 levels inde- controls Multi pendently predict cardiovascular ethnic mortality, with an apparent Q1 25(OH)D3 levels 45.55 13.90 ng/mL threshold effect around the 25th

(<18Q2 25(OH)D ng/mL)3 levels 45.83 21.60 ng/mL (18-24.9 ng/mL) 25(OH)D3 levels substantially accountedpercentile (p<0.01).for the higher The lowage- and

Q3 25(OH)D3 levels 44.53 28.44 ng/mL (25-31.9 ng/mL) mortality among blacks. sex-adjusted cardiovascular Q4 25(OH)D3 levels 40.89 41.63 ng/mL

(>32 ng/mL) Kenny et al. (97) CHF pt, - - controls lower 25(OH)D The HF group showed3 significantly CHF 59 76.9±9.9 26.6±12.6 ng/mL Individuals with HF are levels (p=0.01).

Proefschrift_final_zonder.indd 33 22-10-15 15:08 2 Chapter 2

control 23 77.4±9.3 32.4±9.6 ng/mL at increased risk of bone loss;

patients met the criteria for frailty, whereasa significant none percentage of the control of HF

Kim et al. (79) Healthy 8351 24.3 ng/mL 74.0% subjectsMean 25(OH)D did (p=0.02).3 decreases with controls White 26.2 ng/mL 68.0% older age (p=0.001) and by black Black ≥20 14.9 ng/mL 97.0% Dand levels Hispanic of 20-29 race ng/mL(p<0.001), are but not3 by gender (p=0.115). 25(OH) Hispanic ≥20 21.2 ng/mL 88.0% increased prevalence of CVD. ≥20 not significantly associated with Shane et al. (76) CHF patients 101 Multi - Low serum 25(OH)D3 levels ethnic are associated with diminished

men: 8±1 ng/mL exercise tolerance: peak VO2 is low 25(OH)D3 9 ng/mL) 54 (25-70)

levels (≤ low serum 25(OH)D3. Low serum Pre MPW: 24±1 ng/mL lower (p=0.01) in patients with normal 25(OH)D3 levels 37 (33-39) 1,25(OH)2D3 is also associated

with a lower peak VO2 Post MPW: Higher serum PTH is associated (≥10 ng/mL) 54 (39-64) with better cardiovascular(p=0.09). function: LVEF was slightly, but sig-

nificantly, higher in patients with Kilkkinen et al. (82) Healthy 6219 C Men: 67.6% elevated serum PTH (p=0.05). controls 43.4±19.7 nmol/L between serum 25(OH)D level A significant inverse association3 Women: and total CVD mortality had been 41.5±18.9 nmol/L for age and sex (highest quintile Q1 25(OH)D3 levels 1258 53.9 (15.1) Men: seen when results were adjusted 23 (5-28) nmol/L vs. lowest quintile; P for trend

Women: was found between serum 25(OH) 21 (4-25) nmol/L <0.001). This inverse association D3 level and the risk of CVD death

Q2 25(OH)D3 levels 1202 48.9 (13.8) Men: (highest quintile vs. lowest; P for 33 (29-37) nmol/L Women: 30 (26-33) nmol/L trend = 0.0037). After adjustment- callyfor potential more total confounders, CVD death p= in NS Q3 25(OH)D3 levels 1284 48.4 (13.1) Men: (P for trend = 0.20). Statisti 42 (38-47) nmol/L multivariate model of low vitamin vs. high Women: 38 (34-43) nmol/L D category (<50 nmol/L) vitamin D category (>50 nmol/L); Q4 25(OH)D3 levels 1222 48.8 (12.8) Men: 54 (48-61) nmol/L (P for trend= 0.005). Women: 49 (44-55) nmol/L

Q5 25(OH)D3 levels 1253 47.0 (12.2) Men: 72 (62-180) nmol/L Women: 67 (56-151) nmol/L

Zittermann et al. (95) CHF pt, 300 C 23-89 - - 3 controls levels in CHF patients, compared Significant reduce of 25(OH)D CHF patients 150 style factors associated with low controls 150 to healthy controls (p<0.001). Life 25(OH)D3 levels (like low physical activity, residence in large towns and low frequency of summer holidays) are more common in HF patients than in healthy controls.

Zittermann et al. (81) Pt with CHF, 510 C - Circulating 1,25(OH)2D3 is related hypertension, to 25(OH)D CHD, DM, RD 3 1,25(OH)2D3 concentrations Q1 25(OH)D3 levels 120 54.7 (11.8) 12.8 (11.3) ng/mL should be regarded (p<0.001). as a Lownon Q1 1,25(OH)2D3 levels 9.9 (5.3) pg/L classic risk factor for total mor-

tality. 1,25(OH)2D3 concentration Q2 25(OH)D3 levels 120 54.7 (10.1) 17.3 (12.7) ng/mL

Q2 1,25(OH)2D3 levels 21.3 (2.4) pg/L midterm mortality. 1-year <25 ng/mL are linked to excess

Proefschrift_final_zonder.indd 34 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

Q3 25(OH)D3 levels 120 54.0 (9.9) 20.7 (34.8) ng/mL related to serum level 25(OH) Q3 1,25(OH)2D3 l levels 29.1 (2.3) pg/L survival curves are significantly D3 and 1,25(OH)2D3. 25(OH)

Q4 25(OH)D3 levels 120 52.3 (10.3) 22.1 (22.7) ng/mL D3 Q1: 79.8% vs. 25(OH)D3 Q5:

92.0%. 1,25(OH)2D3 Q1: 66.2% vs. Q4 1,25(OH)2D3 levels 37.9 (2.9) pg/L Q5: 96.1%. Serum 1,25(OH)2D3

Q5 25(OH)D3 levels 120 52.5 (10.8) 24.0 (18.7) ng/mL related to higher mortality risks Q5 1,25(OH)2D3 levels 56.2 (16.2) pg/L levels <25 pg/L are significantly

(p<0.001). Wilke et al. (75) Hyper- 617 Mostly - - The gene product for CYP27B1 tensive pt C Hyper- the rate-limiting enzyme for (25(OH)D 1α- hydroxylase is tensive + bio-activation of 1,25(OH)2D3. CHF pt, The homozygote rs4646537 controls carrier status (a SNP in the eight controls 206 58.5±20.5 intron of CYP27B1) is associated with increased risk for CHF in hypertensive patients 206 59.4±13.8 hypertension + CHF 205 60.2±13.0 The heterozygote carrier status of rs4646537hypertensive demonstrates patients (p<0.05). protec - tive effects against development of

Pilz et al. (98) Pt with CVD 614 C - hypertension (p<0.05).

25(OH)D3 levels with echocardio- graphicNo significant measures associations of LV geometry of and systolic function. Prevalence of diastolic dysfunction was sig- vs. the

quartile,nificantly but higher attenuated in the first towards a fourth season specific 25(OH)D - ment for age and cardiovascular risknon-significant factors. trend after adjust

Table 2 - Effects of vitamin D supplementation on HF development or outcome

HF and Vitamin D Average 25(OH) N Race Age D levels Treatment Outcome deficiency (years) (ng/ml)3 Witham et al. (88) 105 CHF pt C 100 000 U vitamin no improvement of physical

D2 at baseline and 10 treatment group 53 78.8 (5.6) 20.5 (8.9) weeks function (p=0.8). placebo Group 52 80.6 (5.7) 23.7 (10.0)

Schleithoff et al. (86) 123 CHF pt C 2000 IU vitamin D3 daily & 500 mg calcium (both groups) for unchangedIL-10 was significantly in treatment, reduced period of 9 months (p=0.042). TNF-α remained intervention groups (D+) 61 57 (53.63) 26.8 (9.2-35.1) Otherbut increased parameters significantly did not show control group (D-) 62 54 (50.62) 3.6 in placebo group (p=0.006). (-2.8-8.5) any significant changes: LVEF (p=0.643), SBP (p=0.865), DBP

Saadi et al. (96) 116 healthy UAE, Arab vitamin D2 2000 IU (p=0.375). women & Asian daily or 60 000 IU monthly Significant decline in NT- nulliparous women 63 24±0.6 19.0±1.4 proBNP levels (p<0.001) and PRA (p=0.06), no significant lactating women 53 29.8±0.9 26.6±1.9 didchanges lack ain placebo SBP (p=0.2) group). and DBP (p=0.2) (however, study Park et al. (36) 25 HD pt Asian 43.4 (27-59) - calcitriol 2x weekly treatment of 2 μg Significant decrease of IVST (p=0.01), PW thickness 35

Proefschrift_final_zonder.indd 35 22-10-15 15:08 2 Chapter 2

calcitriol supp. 15 intravenously for 15 weeks no calcitriol supp. 10 (p=<0.05), WMSI (p=0.01). - No significant changes in CO and BP (p=NS). Significant de crease in PRA (p<0.001), Ang II Bodyak et al. (44) 21 HD pt C - - Paricalcitol for 12 (p<0.001) and ANP (p<0.05). months. Level of paricalcitol was left up to Significant decrease of E/A paricalcitol treated 15 discretion of treating - group physician ratio (p<0.01), LV septal 6 thickness (p< 0.05), PW thick control group ness (p<0.05). No significant difference in LVEF (p=NS). Hsia et al. (85) 36282 C - Twice a day, 200 IU Calcium/vitamin D supplemen- healthy vitamin D3 calcium tation neither increased nor controls + calcium carbonate 500 mg decreased the risk for CHD in calcium/vitamin D 18176 62.4±7.0 supplemented Neither total calcium intake healthy post MPW (p=0.34). placebo 18106 62.4±6.9 nor total vitamin D intake at baseline affected cardiovascular risk with calcium/vitamin D supplementation in post

MPW (p=0.66).

HF = heart failure; vit. D = vitamin D; NS = non significant; C = Caucasian; AA = African Americans; MI = myocardial D infarction; CHF pt = chronic heart failure patients; NT-proBNP3 = N-terminal-pro brain natriuretic2 3 peptide; NT-proANP = N-terminal-pro brain natriuretic peptide; 25(OH)D = 25-hydroxyvitamin D; 1,25(OH) = 1,25-dihydroxyvitamin D; HD-NHF = Heart disease- Non Heart Failure; PRA = plasma renin activity; Ang II = angiotensin II; HD pt = hemodialysis patients; RPF = renal plasma flow; LVEF = left ventricular ejection fraction; NYHA = New York Heart Association; BMD = bone mass density; LV = left ventricle; EDD = end diastolic diameter; ESD = end systolic diameter; ESV= end systolic volume; EDV= end diastolic volume; FS = fractional shortening; PTH = parathyroid hormone; MPW = menopausal women; CVD = cardiovascular disease; DM = diabetes mellitus; CHD= coronary heart disease; RD = renal disease; IL-10 = interleukin-10; TNF-α = tumor necrosis factor-α; SBP = systolic blood pressure; DBP = diastolic blood pressure; UAE = united arab emirates; IVST = interventricular septum thickness; PW = posterior wall; WMSI = Unit wall motion score index; CO = cardiac output; BP = blood pressure; ANP = atrial natriuretic peptide; IU= International

Summary Vitamin D and its receptor, VDR, are increasingly recognized as mediators of HF. Low vitamin D status is associated with an increased prevalence of risk factors for HF and may also contribute to the development of the HF syndrome itself. Once HF has developed, a low vitamin D status is observed in patients with worse functional class and other clinical and biochemical correlates of

and immobility. From experimental data it has become clear that the VDR functions as a pivotal poor outcome. This has been connected to increased inflammatory status, more advanced age, transcriptional regulator, amongst others of several neurohumoral systems, most prominently the RAS, and other crucial systems involved in HF. Therefore, vitamin D and its receptor may represent a novel target for therapy in the devastating HF syndrome. Future studies with vitamin D or VDR agonists should elucidate if this is a feasible option for patients with HF.

Proefschrift_final_zonder.indd 36 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

Conflict of interest R.A.d.B. received an unrestricted research grant from Abbott for the study of the effects of paricalcitol in experimental heart failure.

Acknowledgements This work was supported by the Netherlands Heart Foundation (grant 2007T046 to R.A.d.B.) and

Research (NWO VENI, grant 016.106.117 to R.A.d.B.). the Innovational Research Incentives Scheme program of the Netherlands Organization for Scientific

Proefschrift_final_zonder.indd 37 22-10-15 15:08 2 Chapter 2

References vitamin D insufficiency. Lancet 1998; 351: 805-6. 1. Dickstein K et al. ESC guidelines for the diagnosis 11. Thomas MK et al. Hypovitaminosis D in medical treatment of acute, chronic heart failure 2008. The inpatients. N Engl J Med 1998; 338: 777-83. task force for the diagnosis and treatment of acute and chronic heart failure 2008 of the European 12. Heaney RP, Dowell MS, Hale CA, Bendich A. Society of Cardiology. Developed in collaboration Calcium absorption varies within the reference with the Heart Failure Association of the ESC range for serum 25-hydroxyvitamin D. J Am Coll (HFA) and endorsed by the European Society of Nutr 2003; 22: 142-6. Intensive Care Medicine (ESICM). Eur J Heart Fail R2008; 10: 933–89. 13. Dawson-Hughes B, Heaney RP, Holick MF, Lips P, Meunier PJ, Vieth R. Estimates of optimal vitamin 2. Dzau VJ. Tissue renin-angiotensin system in D status. Osteoporos Int 2005; 16: 713-6. myocardial hypertrophy and failure. Arch Intern Med 1993; 153: 937-42. 14. Holick MF, Garabedian M. Vitamin D: photobiology, metabolism, mechanism of action, and clinical 3. Krum H, Abraham WT. Heart failure. Lancet 2009; application. In: Favus MJ. Primer on the 373: 941-55. metabolic bone diseases and disorders of mineral metabolism. 6th ed. Washington, DC: Am Soc for 4. Kuipers I et al. Activation of liver X receptor-alpha Bone and Min Res, 2006; 129-37. reduces activation of the renal and cardiac renin- angiotensin-aldosterone system. Lab Invest 2010; 15. Bouillon R. Vitamin D: from photosynthesis, 90: 630-6. metabolism, and action to clinical applications. In: DeGroot LJ, Jameson JL, eds. Endocrinology. 5. Kuipers I et al. Nuclear hormone receptors as Philadelphia: W.B. Saunders, 2001; 1009-28. regulators of the renin-angiotensin-aldosterone system. Hypertension 2008; 51: 1442-8. 16. DeLuca HF. Overview of general physiologic features and functions of vitamin D. Am J Clin Nutr 6. Gouni-Berthold I, Krone W, Berthold HK. Vitamin D 2004; 80: Suppl: 1689-96. and cardiovascular disease. Curr Vasc Pharmacol 2009; 7: 414-22. 17. Baker AR et al. Cloning and expression of full- length cDNA encoding human vitamin D receptor. 7. Proc Natl Acad Sci USA 1988; 85: 3294-8. 2007; 357: 266-81. Holick MF. Vitamin D deficiency. N Engl J Med 18. 8. Holick MF. High prevalence of vitamin D of 1,25-dihydroxivitamin D receptors and Simpson RU, Thomas GA, Arnold3 AJ. Identification inadequacy and implications for activities in muscle. J Biol Chem 260; 1985: 8882- health. Mayo Clin Proc. 2006; 81: 353-73. 91.

9. Bischoff-Ferrari HA, Giovannucci E, Willett WC, 19. TD O’Connell and RU Simpson. Immunochemical

Dietrich T, Dawson-Hughes B. Estimation of optimal 3 serum concentrations of 25-hydroxyvitamin D for receptor protein in human heart. Cell Biol Inter 9; identification of the 1,25dihydroxivitamin D multiple health outcomes. Am J Clin Nutr 2006; 1996: 621-4. 84: 18-28. 20. Chen S et al. Expression of het Vitamin D is 10. increased in the hypertrophic heart. Hypertension

Malabanan A, Veronikis IE, Holick MF. Redefining 38

Proefschrift_final_zonder.indd 38 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

2008; 52: 1106-12. 30. Burgess ED, Hawkins RG, Watanabe M. Interaction of 1,25-dihydroxyvitamin D and plasma renin 21. Tishkoff DX, Nibbelink KA, Holmberg KH, Dandu L, activity in high renin essential hypertension. Am Simpson RU. Functional vitamin D receptor (VDR) J Hypertens 1990; 3: 903-5. in the T-tubules of cardiac myocytes: VDR knockout cardiomyocyte contractility. Endocrinolgy 2008; 31. Resnick LM, Muller FB, Laragh JH. Calcium- 149: 558-64. regulating hormones in essential hypertension. Relation to plasma renin activity and sodium 22. Zella LA, Meyer MB, Nerenz RD, Lee Sm, Martowicz metabolism. Ann Intern Med 1986; 105: 649-54. ML, Pike JW. Multifunctional enhancers regulate mouse and human vitamin D receptor gene 32. Li YC, Kong J, Wei M, Chen ZF, Liu SQ, Cao LP. transcription. Mol Endocrinol 2010; 24: 128-47. 1,25-Dihydroxyvitamin D(3) is a negative endocrine regulator of the renin-angiotensin 23. Bouillon et al. VDR null phenotype. Endocrine system. J Clin Invest 2002; 110: 229-238. Reviews 2008; 29: 726-76. 33. Sigmund CD. Regulation of renin expression and 24. McKinsey TA, Olson EN. Toward transcriptional blood pressure by vitamin D(3). J Clin Invest 2002; therapies for the failing heart: chemical screens to 110: 155-6. modulate genes. J Clin Invest 2005; 115: 538-46. 34. Forman JP, Williams JS, Fisher ND. Plasma 25. Brown JH, Del Re DP, Sussman MA. The Rac 25-hydroxyvitamin D and regulation and Rho hall of fame: a decade of hypertrophic of the renin-angiotensin system in humans. signaling hits. Circ Res 2006; 98: 730-42. Hypertension 2010; 55: 1283-8.

26. Alderman MH, Ooi WL, Cohen H, Madhavan S, 35. Kimura Y et al. Effectiveness of Sealey JE, Laragh JH. Plasma renin activity: a risk 1,25-dihydroxyvitamin D supplementation factor for myocardial infarction in hypertensive on blood pressure reduction in a patients. Am J Hypertens 1997; 10: 1-8. pseudohypoparathyroidism patient with high renin activity. Intern Med 1999; 38: 31-5. 27. Latini R, Masson S, Anand I, Salio M, Hester. The comparative prognostic value of plasma 36. Park CW et al. Intravenous calcitriol regresses neurohormones at baseline in patients with heart myocardial hypertrophy in hemodialysis patients failure enrolled in Val-HeFT. Eur Heart J 2004; 25: with secondary hyperparathyroidism. Am J 292-9. Kidney Dis 1999; 33: 73-81.

28. Kristal-Boneh E, Froom P, Harari G, Ribak J. 37. Margolis KL et al. Women’s Health Initiative Association of calcitriol and blood pressure in Investigators. Effect of calcium and vitamin D normotensive men. Hypertension 1997; 30: 1289- supplementation on blood pressure: the Women’s 94. Health Initiative Randomized Trial. Hypertension 2008; 52: 847-55. 29. Lind L, Hanni A, Lithell H, Hvarfner A, Sorensen 38. Rahman A, Hershey S, Ahmed S, Nibbelink K, pressure and other cardiovascular risk factors in Simpson RU. Heart extracellular matrix gene OH, Ljunghall S. Vitamin D is related to blood middle-aged men. Am J Hypertens 1995; 8: 894- 901. knockout mice. J Steroid Biochem Mol Biol 2007; expression profile in the vitamin D receptor 103: 416-9.

Proefschrift_final_zonder.indd 39 22-10-15 15:08 2 Chapter 2

39. Li YC. Vitamin D regulation of the renin-angiotensin peptides. N Engl J Med 1998; 339: 321-8. system. J Cell Biochem 2003; 88: 327-31. 49. Wu J, Garami M, Cao L, Li Q, Gardner DG. 40. 1,25(OH)2D3 suppresses expression and D, Dengshun M. Calcium-independent and secretion of atrial natriuretic peptide from cardiac Zhou C, Fengxiang L, Kejiang C, Di X, Goltzman 1,25(OH)2D3-dependent regulation of the rennin- myocytes. Am Physiol Society 1995; 268: 1108-13.

mice. Kidney Inter 2008; 74: 170-9. 50. McMurray J, Hiller C. The rise and fall of myotrophin angiotensin system in 1α-hydroxylase knockout in heart failure. J Am Coll Cardiol 2003; 42: 726-7. 41. Xiang W et al. Cardiac hypertrophy in vitamin D receptor knockout mice: role of the systemic and 51. Nibbelink KA, Tishkoff DX, Hershey SD, Rahman A,

cardiac rennin-angiotensin systems. Am J Physiol Simpson RU. 1,25(OH)2vitamin D3 actions on cell Endocrinol Metab 2005; 288: 125-32. proliferation, size, gene expression, and receptor localization, in the HL-1 cardiac myocyte. J Steroid 42. Fryer RM et al. Differential inhibition of renin Biochem Mol Biol 2007; 103: 533-7. mRNA expression by paricalcitol and calcitriol in C57/BL6 mice. Nephron Physiol 2007; 106: 76-81. 52. Endo I et al. Deletion of vitamin D receptor gene in mice results in abnormal skeletal muscle 43. Zhang Z, Zhang Y, Ning G, Deb DK, Kong J, Li YC. development with deregulated expression Combination therapy with AT1 blocker and of myoregulatory transcription factors. vitamin D analog markedly ameliorates diabetic Endocrinology 2003; 144: 5138-44. nephropathy: blockade of compensatory renin increase. Proc Natl Acad Sci U S A 2008; 105: 53. Park EA. The etiology of rickets. Physiol Rev 1923; 15896-901. 3: 106.

44. Bodyak N et al. Activated vitamin D attenuates 54. O’Connell TD, Berry JE, Jarus AK, Somerman MJ,

left ventricular abnormalities induced by dietary Simpson RU. 1,25-dihydroxyvitamin D3 regulation sodium in Dahl salt-sensitive animals. Proc Natl of cardiac myocyte proliferation and hypertrophy. Acad Sci USA 2007; 104: 16810-5. Am J Physiol 1997; 272: 1751-8.

45. Rostand SG, Drueke TB. Parathyroid hormone, 55. Green JJ, Robinson DA, Wilson GE, Simpson RU, vitamin D, and cardiovascular disease in chronic Westfall MV. Calcitriol modulation of cardiac renal failure. Kidney Int 1999; 56; 383-92. contractile performance via protein kinase C. J Mol Cell Cardiol 2006; 41: 350-9. 46. Zittermann A, Schleithoff SS, Tenderich G, Berthold HK, Körfer R, Stehle P. Low vitamin D 56. Watson KE et al. Active serum vitamin D levels are status: a contributing factor in the pathogenesis of congestive heart failure? J Am Coll Cardiol 2003; Circulation. 1997; 96: 1755-60. inversely correlated with coronary calcification. 41: 105-12. 57. Norman AW, Frankel JB, Heldt AM, Grodsky GM. 47. de Boer RA et al. Early expression of natriuretic peptides and SERCA in mild heart failure: of insulin. Science 1980; 209: 823-25. Vitamin D deficiency inhibits pancreatic secretion association with severity of the disease. Int J Cardiol 2001; 78: 5-12. 58. Chertow BS, Sivitz WI, Baranetsky NG, Clark SA, Waite A, Deluca HF. Cellular mechanisms of insulin 48. Levin ER, Gardner DG, Samson WK. Natriuretic

release: the effects of vitamin D deficiency and 40

Proefschrift_final_zonder.indd 40 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

repletion on rat insulin secretion. Endocrinology 10 receptor gene expression in human epidermal 1983; 113: 1511-18.

cells. Inflamm Res 1997; 46: 32-4. 59. Isaia G, Giorgino R, Adami S. High prevalence of 68. Canning MO, Grotenhuis K, de Wit H, Ruwhof hypovitaminosis D in female types 2 diabetic C, Drexhage HA. 1-alpha,25-dihydroxivitamin

population. Diabetes Care 2001; 24: 1496. D3 (1,25(OH)(2)D(3)) hampers the maturation of fully active immature dendritic cells from 60. Chiu KC, Chu A, Go VL, Saad MF. Hypovitaminosis D monocytes. Eur J Endocrinol 2001; 145: 351-7. is associated with insulin resistance and beta cell dysfunction. Am J Clin Nutr 2004; 79: 820-25. 69. Kell R, Haunstetter A, Dengler TJ, Zugck C, Kubler W,

61. Kadowaki S, Norman AW. Dietary vitamin D is be improved in NYHA functional class III patients? Haass M. Do cytokines enable risk stratification to essential for normal insulin secretion from the Comparison with other potential predictors of perfused rat pancreas. J Clin Invest 1984; 73: 759- prognosis. Eur Heart J 2002; 23: 70-8. 66. 70. McKenna M. Differences in vitamin D status 62. between countries in young adults and elderly. vitamin D status on insulin secretion and glucose Amer J Med 1992; 93: 69-77. Nyomba BL, Bouillon R, de Moor P. Influence of tolerance in the rabbit. Endocrinology 1984; 115: 191-7. 71. Boeke AJ. Do disease characteristics add to the Kriegsman DM, Deeg DJ, van Eijk JT, Penninx BW, 63. Auwerx J, Bouillon R, Kesteloot H. Relation explanation of mobility limitations in patients

between 25-hydroxyvitamin D3, apolipoprotein with different chronic diseases? A study in the A-I, and high density lipoprotein cholesterol. Netherlands. J Epidemiol Community Health Arterioscler Thromb 1992; 12: 671. 1997; 51: 676-85.

64. Heikkinen AM, Tuppurainen MT, Niskanen L, 72. Albanese MC, et al. Use of medical resources and Komulainen M, Penttila I, Saarikoski S: Long-term qualità of life of patients with chronic heart failure:

vitamin D3 supplementation may have adverse A prospective survey in a large Italian community effects on serum lipids during postmenopausal hospital. Eur J Heart Fail 1999; 1: 411-7. hormone replacement therapy. Eur J Endocrinol 1997; 137: 495. 73. Zittermann A, et al. Exercise-trained young men have higher calcium absorption rates and plasma 65. Yu S, Cantorna MT. The vitamin D receptor is calcitriol levels in comparison to age-matched required for iNKT cell development. Proc Natl sedentary controls. Calcif Tissue Int 2000; 67: Acad Sci USA 2008; 105: 5207-12. 215-9.

66. Zhu Y, Mahon BD, Froicu M, Cantorna MT. Calcium 74. Zittermann A, Schleithoff SS, Koerfer R. Vitamin D

and 1-alpha,25-hydroxyvitamin D3 target the TNF-alpha pathway to suppress experimental what to do about it? Heart Fail Rev 2006; 11:25-33. insufficiency in congestive heart failure: why and

35: 217-24. 75. Wilke RA et al. Genetic variation in CYP27B1 inflammatory bowel disease. Eur J Immunol 2005; is associated with congestive heart failure in 67. Michel G, Gailis A, Jarzebska-Deussen B, patients with hypertension. Pharmacogenomics Muschen A, Mirmohammadsadegh A, Ruzicka T. 2009; 10: 1789-97.

1,25-(OH)2-vitamin D3 and calcipotriol induce IL-

Proefschrift_final_zonder.indd 41 22-10-15 15:08 2 Chapter 2

76. Shane E et al. 86. Schleithoff SS, Zittermann A, Tenderich G, hyperparathyroidism in congestive heart failure. Berthold HK, Stehle P, Koerfer R. vitamin D Bone mass, vitamin D deficiency, and Am J Med 1997; 103: 197-207. patients with congestive heart failure: a double- supplementation improves cytokine profile in 77. Pilz S et al. blind, randomized, placebo-controlled trial. Am J with heart failure and sudden cardiac death in a Clin Nutr 2006; 83: 754-9 Association of vitamin D deficiency large cross-sectional study of patients referred for coronary angiography. J Clin Endocrinol Metab 87. Kim HW et al. Calcitriol regresses cardiac 2008; 93: 3927-35. hypertrophy and QT dispersion in secondary hyperparathyroidism on hemodialysis. Nephron 78. Wang AY et al. Serum 25-hydroxyvitamin D status Clin Pract 2006; 102: c21-9. and cardiovascular outcomes in chronic peritoneal dialysis patients: a 3-y prospective cohort study. 88. Witham MD, Crighton LJ, Gillespie ND, Struthers Am J Clin Nutr 2008; 87: 1631-8. AD, McMurdo ME. The effects of vitamin D supplementation on physical function and quality 79. Kim DH, Sabour S, Sagar UN, Adams S, Whellan DJ. of life in older patients with heart failure: a Prevalence of hypovitaminosis D in cardiovascular randomized controlled trial. Circ Heart Fail 2010; diseases (from the National Health and Nutrition 3: 195-201. Examination Survey 2001 to 2004). Am J Cardiol 2008; 102: 1540-4. 89. Todorov VT, Desch M, Schmitt-Nilson N, Todorova A, Kurtz A. Peroxisome proliferator-activated 80. Fiscella K, Franks P. Vitamin D, race, and receptor-gamma is involved in the control of renin gene expression. Hypertension 2007; 50: 939-44. US sample. Ann Fam Med 2010; 8: 11-8. cardiovascular mortality: findings from a national 90. de Boer RA, Martens FM, Kuipers I, Boomsma 81. Zittermann A et al. Circulating calcitriol F, Visseren FL: The effects of the PPAR-gamma concentrations and total mortality. Clin Chem agonist pioglitazone on plasma concentrations of 2009; 55: 1163-70. circulating vasoactive factors in type II diabetes mellitus. J Hum Hypertens 2010; 24: 74-6. 82. Kilkkinen A et al. Vitamin D status and the risk of cardiovascular disease death. Am J Epidemiol 91. Ameri P et al. High prevalence of vitamin D 2009; 170: 1032-9. dilation: An echocardiography study in elderly deficiency and its association with left ventricular 83. Arroyo M et al. Micronutrients in African- patients with chronic heart failure. Nutr Metab Americans with decompensated and compensated Cardiovasc Dis 2010. heart failure. Transl Res 2006; 148: 301-8. 92. Abou-Raya S, Abou-Raya A. Osteoporosis and 84. Bolland MJ et al. congestive heart failure (CHF) in the elderly health outcomes over 5 y in older women. Am J patient: double disease burden. Arch Gerontol Vitamin D insufficiency and Clin Nutr 2010; 91: 82-9. Geriatr 2009; 49: 250-4.

85. Hsia J et al. Women’s Health Initiative Investigators. 93. Alsafwah S et al. Hypovitaminosis D in African Calcium/vitamin D supplementation and Americans residing in Memphis, Tennessee with cardiovascular events. Circulation 2007; 115: and without heart failure. Am J Med Sci 2008; 335: 846-54. 292-7.

Proefschrift_final_zonder.indd 42 22-10-15 15:08 Vitamin D Biology in Heart Failure: Molecular Mechanisms and Systematic Review

94. Zittermann A et al. Poor outcome in end-stage heart failure patients with low circulating calcitriol levels. Eur J Heart Fail 2008; 10: 321-7.

95. Zittermann A, Fischer J, Schleithoff SS, Tenderich G, Fuchs U, Koerfer R. Patients with congestive heart failure and healthy controls differ in vitamin D-associated lifestyle factors. Int J Vitam Nutr Res 2007; 77: 280-8.

96. Saadi HF, Nicholls MG, Frampton CM, Benedict S, Yasin J. Serum 25-hydroxyvitamin D is not related to cardiac natriuretic peptide in nulliparous and lactating women. BMC Endocr Disord 2009; 9: 4.

97. Kenny AM, Boxer R, Walsh S, Hager WD, Raisz LG. Femoral bone mineral density in patients with heart failure. Osteoporos Int 2006; 17: 1420-7.

98. Pilz S et al. structure and function in older men and women: Vitamin D deficiency and myocardial The Hoorn Study. J Endocrinol Invest 2010 (e-pub ahead of print).

99. Boxer RS, Dauser DA, Walsh SJ, Hager WD, Kenny AM. The association between vitamin D and

in patients with heart failure. J Am Geriatr Soc inflammation with the 6-minute walk and frailty 2008; 56: 454-61.

Proefschrift_final_zonder.indd 43 22-10-15 15:08 Plasma Calcidiol, Calcitriol, And Parathyroid Hormone And Risk Of New Onset Heart Failure In A Population- Based Cohort Study

Proefschrift_final_zonder.indd 44 22-10-15 15:08 Plasma Calcidiol, Calcitriol, And Parathyroid Hormone And Risk Of New Onset Heart Failure In A Population- Based Cohort Study

Laura M.G. Meems1; Frank P. Brouwers1; Michel M. Joosten2; Hiddo J. Lambers Heerspink3; Dick de Zeeuw3; Stephan J.L. Bakker2; Ron T. Gansevoort2; Wiek H. van Gilst1; Pim van der Harst1; Rudolf A. de Boer1

University of Groningen, University Medical Center Groningen, Departments of Cardiology1, Nephrology2, and Clinical Pharmacy and Pharmacology3, The Netherlands Chapter Proefschrift_final_zonder.indd 45 322-10-15 15:08 3 Chapter 3

Abstract

prevalence and incidence. Since HF cannot be cured, prevention of HF is of utter Heart failure (HF) is a major problem in the Western World, with increasing

as risk factors for cardiovascular disease. However, their association with new onset importance. Calcidiol, calcitriol and parathyroid hormone (PTH) have been identified HF remains to be established. We investigated whether calcidiol, calcitriol, and PTH

additive predictive value over established risk predictors like N-terminal-pro Brain- could be used to identify those subjects at risk for new onset HF, and if they had type natriuretic peptide and highly sensitive Troponin-T.

We examined 7470 HF-free participants in PREVEND, a community-based cohort

male). During follow-up time of 12.6 years (InterQuartile Range [IQR]: 12.3-12.9), study in Groningen, the Netherlands (latitude 53⁰ N, mean age: 49 years, 48% 281 participants (4%) developed HF: 181 (66%) HF with reduced and 94 (34%)

respectively). Mean (± SD) of calcidiol was 58 (± 24) nmol/L, mean calcitriol 145 (± HF with preserved ejection fraction (HFrEF (LVEF ≥50%) and HFpEF (LVEF≤40%, 48) pmol/L, and median (IQR) PTH was 3.7 (3.0-4.6) pmol/L. Calcidiol levels were univariately associated with new onset HF (HR 0.82 [95% CI 0.69-0.96], but calcitriol levels were not (HR 0.85 [95% CI 0.71-1.03]). PTH levels kept their predictive value

1.53]). However, in our full model this association was lost (HR 1.10 [95% CI 0.92- after adjustment for age, sex and day of blood withdrawal (HR 1.26 [95% CI 1.04- 1.32]). Calcidiol, calcitriol, and PTH could not differentiate between new onset HFrEF or HFpEF.

calcitriol, or PTH was not associated with risk of developing HF. Screening for these After adjustment for confounding factors, a single measurement of plasma calcidiol,

markers to identify subjects at risk for new onset HF cannot be advocated.

Proefschrift_final_zonder.indd 46 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

Introduction Heart failure (HF) is one of the leading causes of morbidity and mortality in the Western World. Despite optimal treatment, the prognosis of HF remains poor, and approximately

strongly associated with age and due to the globally ageing population, HF is expected to 50% of the patients die within 5 years after first diagnosis (1). The incidence of HF is

prevent individuals from developing HF. Relatively simple and important strategies that become a major burden for society. HF cannot be cured yet, and a lot of effort is made to contribute to prevention of HF are control of hypertension, and prevention of myocardial infarction. However, another approach that may be useful in preventing new onset HF could

be the identification of subjects at risk for HF. Although several predication models have been established (2,3), their predictive value is modest, and it remains difficult to predict prediction models with novel markers is warranted. the risk for future HF events in individual subjects. Therefore, a continuous search for new

A role of vitamin D biology has been well established in bone homeostasis, but the last decades it has been suggested that vitamin D may as well be of importance for the development of cardiovascular (CV) disease, and in particular HF. Several observational studies reported an association between vitamin D and parathyroid hormone (PTH) in the development of CV disease and HF (4-6). In addition, it was already shown that elevated PTH levels were indeed associated with increased risk of HF in elderly, although vitamin D was not (7,8). Mechanistically, vitamin D and PTH exert roles in blood pressure

(11). However, it remains to be established whether PTH and vitamin D are independent (9), cardiomyocyte hypertrophy (10,11), myocardial fibrosis (12,13), and inflammation

predictors in the development of HF, or either HF with reduced ejection fraction (HFrEF) or HF with preserved ejection fraction (HFpEF). In a large, (mostly white) population-based cohort study, we analyze how calcidiol, calcitriol and PTH are related to each other, as well as to other baseline characteristics and laboratory values. We further investigate whether circulating calcidiol, calcitriol, and PTH are associated with risk for development of new onset HF, and if this association remains after correction for more established predictors like N-terminal-pro Brain-type natriuretic peptide (NT-proBNP) and highly sensitive Troponin-T (hs-TnT).

Proefschrift_final_zonder.indd 47 22-10-15 15:08 3 Chapter 3

Methods This study was performed using the data of the PREVEND (Prevention of Renal and Vascular

End-stage Disease) cohort study in Groningen, the Netherlands (latitude 53⁰ N) and has been described in more detail before (14,15). The flowchart for selection and inclusion of the final population is provided in Figure 1.

Figure 1 - Flowchart of selection and inclusion of final study population. DM: diabetes mellitus; HF: heart failure; PTH: parathyroid hormone; UAC: urinary albumin concentration.

Sample storage, biomarkers, and measurement of vitamin D. At baseline (1997-1998), EDTA

biomarker assessment. NT-proBNP, highly sensitive C-reactive protein (hs-CRP), hs-TnT and plasma samples were collected from all participants and stored at -80⁰C until used for urinary albumin concentration were determined as described before (2).

Baseline plasma calcidiol and calcitriol levels were measured by solid phase extraction isotope dilution that was followed by liquid chromatography-tandem mass spectrometry

Proefschrift_final_zonder.indd 48 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

of variations (CV) for calcidiol at physiological concentrations was from 5.0% up till 14.1%. (LC-MS/MS) (Spark-Holland Symbiosis system, Emmen, the Netherlands). The coefficient The detection limit for calcitriol was 1.2 nmol/L, with an intra-assay and inter-assay CV of 7.2% and 6.7% respectively. We used an automated two-site immunoassay (Roche, Diagnostics, Indianapolis, USA) to measure baseline plasma intact PTH levels, which had an intra-assay CV of 3.4-5.8% (9). Calcidiol levels were expressed in pmol/L (of note: 2.4 pmol/L is equivalent to 1 pg/mL) and calcitriol levels were expressed in nmol/L (2.5 nmol/L is equivalent to 1 ng/mL).

Ascertainment of new onset HF. between the baseline visit and the date of new onset HF or the date of the last follow-up In this study, follow-up time was defined as the time

et al. provided a (1 January 2010), whatever date came first. The diagnosis of each individual HF case was made using an extensive validation and identification process. Brouwers the participants of the PREVEND study were covered by the two main hospitals in the simplified overview of the validation and identification process of this study (15). Briefly, region. The local Ethics Committee of both hospitals granted access to hospital records

of PREVEND participants. Patient files were checked for the presence of HF at baseline or evidence of HF was reported, according to the criteria of the Heart Failure Guidelines of the during follow-up for new onset HF. HF was suspected when signs, symptoms, and objective European Society of Cardiology (ESC). All cases of suspected new onset HF (586 individual

cases) were adjudicated by two experts in the field of HF. Anonymized clinical charts, hospitalization, and physician office records were used to ascertain new onset HF. After this review-process patients were considered to have ‘definite new onset HF’, ‘definite no new onset HF’, or ‘definite HF prior to start date PREVEND’. In case consensus was not reached on individual case, the committee made a joint decision. At that time, ESC guidelines did not provide LVEF cut-offs for diagnosis of HFrEF or HFpEF, therefore HF was classified using the following cut-offs: HFrEF LVEF ≤40% and HFpEF LVEF ≥50%. To prevent blending of epidemiological profiles, patients with a LVEF between 41 & 49% (n=8) were excluded from final analysis. Aetiology and date of HF onset were also obtained from clinical charts. Definitions. Blood pressure was measured during two visits, using an automatic Dinamap

XL Model 9300 series device. Hypertension was defined as a systolic blood pressure reported to use antihypertensive medication. Body mass index (BMI) was calculated as (SBP) > 140 mm Hg, a diastolic blood pressure (DBP) > 90 mm Hg, or when an individual the ratio of weight to height squared (kg/m2 2 were considered obese. Hypercholesterolemia was present if lipid-lowering medication was used, ) and individuals with a BMI > 30 kg/m total serum cholesterol exceeded 6.5 mmol/L (251 mg/dL) without history of myocardial infarction (MI) or 5.0 mmol/L (193 mg/dL) when a history of MI was present. A history of

Proefschrift_final_zonder.indd 49 22-10-15 15:08 3 Chapter 3

MI was present in those individuals who reported that they had been hospitalized for at least 3 days as a result of this condition. Individuals had type 2 diabetes when the use of

anti-diabetic drugs was reported, and/or a fasting plasma glucose > 7.0 mmol/L (126 mg/ dL), or a non fasting plasma glucose > 11.1 mmol/L was measured. We calculated urinary albumin excretion (UAE) as the sum of two consecutive 24h urine collections. The simplified modification of diet in renal disease formula was used to calculate the estimated glomerular nicotine within the previous year. We used the Modular ECG Analysis System (16) to record filtration rate (eGFR). Smokers where those individuals who reported that they had used

Minnesota codes 8.3.1 and 8.3.3. standard 12-lead electrocardiograms. Presence of atrial fibrillation (AF) was defined using

Statistical analysis. Continuous data are represented as means ± standard deviation (SD) for normally distributed data and as medians with InterQuartile Ranges (IQR) for skewed distributions. Baseline differences were tested using Students-t-test or Kruskal-Wallis test, as appropriate. Discrete and categorical data are presented as frequencies (%), and differences between groups were tested using a standard Chi2

test. A p-value of <0.05 was designated as significant. We included covariates in our model as linear variables if appropriate or as categorical if discrete or non-linear. Calcidiol and calcitriol levels were normally distributed and included as continuous variables. PTH levels were distributed in a skewed manner, and transformed

in all models by using a statistical weighting method. This method enabled us to extrapolate to a log-scale. Due to the over selection of subjects with elevated UAE, we corrected for UAE and generalize our conclusions as if we were studying a general population (17).

Vitamin D levels are known to significantly fluctuate depending on the time of year of blood sampling. We computed Spearman’s Correlation coefficients to test the relationship between PTH, vitamin D and day of blood withdrawal in our subjects. In addition, we correct for the time of the year of blood sampling in all subsequent analyses unless stated included two variables (R= cos([2π/365.25]*day) and S= sin([2π/365.25]*day (18), to otherwise (18).

Cross-sectional univariable regression analyses were performed to study the univariate associations between calcidiol, calcitriol, PTH and baseline characteristics. We standardized

various predictors. the results and present outcomes as beta coefficients to compare relative strength of the

Linearity of the relationship between calcidiol, calcitriol, PTH and new onset HF was tested

Proefschrift_final_zonder.indd 50 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

and not violated. For the longitudinal analyses we built Cox proportional hazard regression models to study the associations between plasma vitamin D and PTH with risk of new

onset HF. Hazard ratios (HRs) are reported with respective 95% confidence interval [95% CI]. Cause-specific hazard analyses were performed to study the associations of calcidiol, for competing risk (P calcitriol, and PTH withcr risk of HFrEF (LVEF ≥50%) and HFpEF (LVEF≤40%). A P-value ) <0.10 between HFrEF and HFpEF was considered statistically significant (19,20). Proportional hazard assumptions were tested and satisfied. To describe the independent associations of calcidiol, calcitriol, and PTH with new onset

examined the univariate association between calcidiol, calcitriol, and PTH with risk of new HF, we built several models adjusting for possible confounders. In the first model, we

model, we added other covariates that are associated with new onset HF (type 2 diabetes, onset HF. In model 2, we adjusted for age, sex and season of blood withdrawal. In the third smoking, hypertension, hypercholesterolemia, history of myocardial infarction, obesity,

atrial fibrillation, serum cystatin C, UAE, hs-CRP, and eGFR (15)). Finally, we created a fourth model that additionally adjusted for NT-proBNP and hs-TnT (2). All analyses were performed using StataIC version 11.0 (StataCorp, Texas, USA).

Results A total of 7470 participants were evaluated in this study. Baseline characteristics are presented in Table 1. Mean (± SD) of calcidiol was 58 (± 24) nmol/L, mean calcitriol 145 (± 48) pmol/L, and median (IQR) PTH was 3.7 (3.0-4.6) pmol/L. 96% of the participants were

white, and 52% of the subjects were females with a mean age of 49 ± 12 years. Half of the subjects had their blood drawn in the winter. Cross-sectional associations of calcidiol, calcitriol, and PTH with demographics, laboratory values and co-morbidities. Univariate associations of changes in calcidiol, calcitriol, and PTH levels with baseline variables are presented in Table 2. Levels of calcidiol and calcitriol

correlated significantly with season of blood withdrawal (Spearman rho, calcidiol: 0.19, p<0.001; calcitriol: 0.20, p<0.001), but this was less outspoken for PTH (PTH: -0.08, p<0.001, Figure 2). We further observed that the levels of calcidiol and calcitriol were strongly associated with each other, whilst the association between PTH and calcidiol was less outspoken. Furthermore, we found no association between PTH and calcitriol levels. For PTH, the strongest association per 1-SD log-transformed increase was with age (Table 2).

Proefschrift_final_zonder.indd 51 22-10-15 15:08 3 Chapter 3

Figure 2 - A. Correlation of plasma calcidiol and season of blood withdrawal; B. correlation of plasma calcitriol and season of blood withdrawal; C. correlation of log transformed plasma PTH levels and season of blood withdrawal. as compared to previous season. Data is analyzed using one-way ANOVA (post hoc testing with Bonferroni). Data is presented in Tukey boxplot (median [IQR]). * p<0.05 and ***p<0.001 Outliers are not presented.

We also assessed the associations between levels of vitamin D metabolites, PTH and prevalence of several morbidities. Lower levels of calcidiol were associated with increased prevalence of type 2 diabetes, hypertension and a history of myocardial infarction, while lower levels of calcitriol were associated with a higher frequency of type 2 diabetes, but a lower frequency of hypercholesterolemia (Table 1). Higher PTH levels were associated with higher prevalence of multiple morbidities (hypertension, hypercholesterolemia, type

association with active smokers (Table 1). 2 diabetes, atrial fibrillation, and myocardial infarction), although we observed an inverse

Longitudinal associations of calcidiol, calcitriol, and PTH with risk of new onset HF. During a median follow-up time of 12.6 years (IQR: 12.3-12.9), 281 participants (4%) developed HF,

of whom 181 (66%) were classified with HFrEF and 94 (34%) with HFpEF. While levels of calcitriol were not different between groups, subjects that were diagnosed with HF were 52

Proefschrift_final_zonder.indd 52 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

more likely to have significantly lower calcidiol levels and higher PTH levels. The levels HFrEF (Table 1). of calcidiol, calcitriol, and PTH were not significantly different in subjects with HFpEF or

Figure 3 - Risk ratio for new onset HF (HR[95% CI]) per 1-SD increment in plasma calcidiol and calcitriol, or per 1-SD increment per log-transformed PTH levels. Model 1: univariate association. Model 2: age, sex, time of year of blood withdrawal (using the cosinor model). Model 3: model 2 + active smoking, type 2 diabetes, history of myocardial infarction or stroke, hypertension, hypercholesterolemia, obesity (body

mass index > 30 kg/m ), atrial fibrillation, triglycerides, glucose, urinary albumin excretion, highly sensitive type Natriuretic peptide and highly sensitive troponin-T. C-reactive protein, Cystatin C, and estimated glomerular filtration rate. Model 4: model 3 + N-terminal pro-Brain

Univariately, calcidiol levels were per 1-SD increase associated with new onset HF. However,

the association was no longer significant after adjustment for age, sex, and season of blood per 1-SD log-transformed increment, univariately associated with new onset HF (HR 1.79 withdrawal, and after further adjustment for other covariates (Figure 3). PTH levels were,

Proefschrift_final_zonder.indd 53 22-10-15 15:08 3 Chapter 3

season of blood withdrawal (Figure 3). However, after addition of other confounders that [95% CI 1.51-2.11]). This association remained present after adjustment for age, sex, and

1.17 [95% CI 0.97-1.41]). Addition of the biomarkers NT-proBNP and hs-TnT to this model are associated with risk of new onset HF this association was no longer significant (HR further attenuated this association (Figure 3).

importance in differentiating between new onset HFrEF or HFpEF. None of these markers We performed cause-specific analyses to analyze if calcidiol, calcitriol, and PTH could be of could differentiate between new onset HFrEF or new onset HFpEF (Figure 4).

Figure 4 - Risk ratio for new onset HFrEF or HFpEF (HR[95% CI]) per 1-SD increment in plasma calcidiol, calcitriol, or per log-transformed PTH levels, and their incremental power between HFrEF and HFpEF

(Pcr-value). 2), atrial In our full model, we adjusted for age, sex, active smoking, type 2 diabetes, history of myocardial infarction or stroke, hypertension, hypercholesterolemia, obesity (body mass index > 30 kg/m fibrillation, triglycerides, glucose, urinary albumin excretion , highly sensitive C-reactive protein , N-terminal and the cosinor model for time of the year of blood withdrawal. pro-Brain-type natriuretic peptide, highly sensitive troponin T , Cystatin C, estimated glomerular filtration rate,

Proefschrift_final_zonder.indd 54 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

Table 1 -

Baseline characteristics of all subjects participating in PREVEND without HF during follow up and of subjects with new onset HF during follow-up.No Heart All subjects Heart Failure HFrEF HFpEF Failure P-value (n=181) (n=94) P-value (n=7470) (n=7189) (n=281)

Age (years) 49 ± 12 48 ± 12 62 ± 9 62 ± 10 62 ± 9 0.73

Males (%) 48% 47% 61% <0.001 70% 44% Race (%) <0.001 <0.001 Caucasian 96% 96% 98% 98% 98% Negroid 1% 1% - - - Asian 2% 2% 1% 1 1 Other 1% 1% 1% 1 1

BMI (kg/m2) 26 ± 4 26 ± 4 28 ± 5 <0.001 28 ± 4 29 ± 6 0.04 SBP (mmHg) 128 ± 20 127 ± 19 145 ± 22 <0.001 143 ± 20 148 ± 26 0.08 DBP (mmHg) 74 ± 10 73 ± 10 80 ± 10 <0.001 80 ± 10 79 ± 10 0.50 Blood withdrawal in 50% 50% 48% 0.43 48% 49% 0.89 winter

38% 38% 38% 0.91 44% 28% 0.01

SmokingMyocardial or infarctionquit <1 yr (%) 6% 5% 25% <0.001 29% 17% 0.03 Hypertension (%) 30% 28% 68% <0.001 66% 72% 0.29 Hypercholesterolemia (%) 26% 25% 46% <0.001 48% 39% 0.15 Type 2 diabetes (%) 1% 1% 4% <0.001 4% 5% 0.58 1% 1% 4% <0.001 4% 4% 0.85

Atrial fibrillation (%) Glucose (mmol/L) 4.8 ± 1.1 4.8 ± 1.0 5.4 ± 1.7 <0.001 5.4 ± 1.6 5.6 ± 1.8 0.41 Total cholesterol (mmol/L) 5.6 ± 1.1 5.6 ± 1.1 6.0 ± 1.1 <0.001 6.0 ± 1.1 6.0 ± 1.0 0.87 HDL cholesterol(mmol/L) 1.3 ± 0.4 1.3 ± 0.4 1.2 ± 0.4 <0.001 1.2 ± 0.4 1.3 ± 0.4 0.29 Triglycerides (mmol/L) 1.4 ± 1.0 1.4 ± 1.0 1.6 ± 0.8 0.003 1.6 ± 0.8 1.5 ± 0.8 0.69

Serum creatinin (µmol/L) 83 ± 16 83 ± 16 87 ± 17 <0.001 90 ± 16 82 ± 16 <0.001 eGFR (ml/min/1.73 m2) 81 ± 14 81 ± 14 76 ± 16 <0.001 75 ± 14 78 ± 18 0.15 Cystatin C (mg/dL) 0.8 [0.7-0.9] 0.8 [0.7-0.9] 0.9 [0.8-1.0] <0.001 0.91 ± 0.2 0.9 [0.8-1.0] 0.29 hs-CRP (mg/L) 1.2 [0.5-2.8] 1.2 [0.5-2.8] 2.5 [1.1-4.8] <0.001 2.5 [1.2-4.5] 2.0 [0.8-4.5] 0.12 hs-TnT (ng/L) 2.5 [2.5-4.0] 2.5 [2.5-4.0] 6.0 [3.0-10.0] <0.001 7.0 [4.0-11.0] 5.0 [2.5-8.0] 0.001 NT-proBNP (ng/L) 37 [17-72] 36 [16-69] 102 [43-285] <0.001 140 [50-351] 80 [36-172] 0.01 Renin concentration 18 [11-29] 18 [11-29] 18 [10-31] 0.40 18 [10-34] 17 [8-26] 0.20 (µIU/mL)

UAE (mg/24 hrs) 9 [6-15] 9 [6-15] 15 [8-33] <0.001 15 [8-33] 15 [8-35] 0.29

calcidiol (nmol/L) 58 ± 24 58 ± 24 54 ± 21 0.003 56 ± 22 52 ± 20 0.19 calcitriol (pmol/L) 145 ± 48 145 ± 48 141 ± 45 0.10 143 ± 46 136 ± 41 0.24

PTH (pmol/L) 3.7 [3.0-4.6] 3.6 [3.0-4.5] 4.3 [3.5-5.4] <0.001 4.4 [3.4-5.4] 4.2 [3.7-5.4] 1.00

highly sensitive C-reactive protein, hs-TnT: highly sensitive troponin T, NT-proBNP: N-terminal pro-Brain-type DBP: diastolic blood pressure, eGFR: estimated glomerular filtration rate, HDL: high-density lipoprotein, hs-CRP: natriuretic peptide, PTH: parathyroid hormone, SBP: systolic blood pressure, UAE: urinary albumin excretion. Continuous normally distributed data are presented as mean ± SD and compared using Student’s t-test. Continuous non-normally distributed data are presented as median [IQR] and compared using the Kruskall-Wallis test. Categorical variables are presented as frequencies (%) and compared using standard chi-squared test.

Proefschrift_final_zonder.indd 55 22-10-15 15:08 3 Chapter 3

Table 2 - Cross-sectional analysis on the association between calcidiol, calcitriol, and PTH with demographics, baseline medical history and laboratory values.

PTH P-value calcidiol P-value calcitriol P-value Standardized Standardized Standardized beta-coefficient beta-coefficient beta-coefficient

Age (years) 0.30 <0.001 -0.02 0.09 -0.01 0.55 Males (%) -0.05 <0.001 0.01 0.36 0.08 <0.001

Race (%) Caucasian 1.00 ref 1.00 ref 1.00 ref

Negroid 0.05 <0.001 -0.11 <0.001 -0.01 0.52 Asian 0.05 <0.001 -0.13 <0.001 -0.03 0.02 Other 0.06 <0.001 -0.10 <0.001 -0.02 0.04 BMI (kg/m2) 0.24 <0.001 -0.08 <0.001 -0.02 0.04 SBP (mmHg) 0.25 <0.001 -0.04 0.001 0.02 0.05 DBP (mmHg) 0.21 <0.001 -0.02 0.15 0.02 0.03 Blood withdrawal in -0.04 0.72 0.33 <0.001 0.38 <0.001 winter

-0.22 <0.001 -0.04 -0.09 <0.001

SmokingMyocardial or infarctionquit <1 yr (%) 0.06 <0.001 -0.02 <0.0010.05 -0.02 0.12 Hypertension (%) 0.23 <0.001 -0.03 0.01 0.01 0.21 Hypercholesterolemia (%) 0.07 <0.001 0.00 0.69 0.04 <0.001 Type 2 diabetes (%) 0.04 0.001 -0.03 0.01 -0.03 0.01 0.04 0.002 -0.02 0.13 0.00 0.93

Atrial fibrillation (%) Glucose (mmol/L) 0.12 <0.001 -0.01 0.30 0.03 0.004 Total cholesterol (mmol/L) 0.07 <0.001 0.00 0.72 0.03 0.01 HDL cholesterol (mmol/L) -0.06 <0.001 0.09 <0.001 0.11 <0.001 Triglicerides (mmol/L) 0.08 <0.001 -0.04 0.001 -0.02 0.07 Serum creatinin (µmol/L) 0.09 <0.001 0.13 <0.001 -0.09 <0.001 eGFR (ml/min/1.73 m2) -0.12 <0.001 -0.17 <0.001 0.02 0.15 Cystatin-C (mg/dL) 0.09 <0.001 0.03 0.03 -0.09 <0.001 hs-CRP (mg/L) 0.06 <0.001 0.01 0.25 0.03 0.01 hs-TnT (ng/L) 0.18 <0.001 -0.02 0.05 -0.05 <0.001 NT-proBNP (ng/L) 0.14 <0.001 0.00 0.69 0.01 0.21 Renin concentration (µIU/ -0.08 <0.001 -0.05 <0.001 -0.12 mL) <0.001 UAE (mg/24 hrs) 0.12 <0.001 -0.03 0.01 -0.02 0.05

Calcidiol (nmol/L) -0.24 <0.001 0.54 <0.001 Calcitriol (pmol/L) 0.01 0.96 0.54 <0.001 PTH (pmol/L) -0.24 <0.001 0.00 0.96

Data are presented per each SD-increment of plasma calcidiol and calcitriol, and per SD log-transformed increase

CRP: highly sensitive C-reactive protein, hs-TnT: highly sensitive troponin T , NT-proBNP: N-terminal pro-Brain-type of PTH. DBP: diastolic blood pressure, eGFR: estimated glomerular filtration rate, HDL: high-density lipoprotein, hs- natriuretic peptide, PTH: parathyroid hormone, SBP: systolic blood pressure, UAE: urinary albumin excretion.

Proefschrift_final_zonder.indd 56 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

Discussion In this population-based study, neither plasma calcidiol, calcitriol nor PTH were independently associated with risk of new onset HF. Plasma calcidiol and PTH levels were

sex, and time of the year of blood withdrawal calcidiol was no longer associated, whilst univariately associated with risk of new onset HF. However, after adjustment for age, plasma PTH lost its predictive value after addition of other other covariates to our model. In addition, we observed that calcidiol and calcitriol levels strongly depended on season of blood withdrawal, and that PTH levels were more consistent during the year. Levels of calcidiol and calcitriol were strongly associated with each other, and although PTH is a well- known key regulator in vitamin D biology, we did not observe a cross-sectional association with plasma calcitriol and PTH. The association between plasma calcitriol and PTH was only

moderate in this cohort of healthy subjects. The observation that PTH is not associated with risk of new onset HF is in line with results from The Atherosclerosis Risk in Communities (ARIC) study (21), but contrasts with data from the Multi-Ethnic Study of Atherosclerosis (MESA), suggesting that PTH is a predictor for new onset HF (22). These discrepancies might be (indirectly) driven by differences in study-population. The average age of participants in the MESA (62 years) was markedly higher than in ARICs (range: 56-57 years) and PREVEND (49 years). In general, kidney function declines with age and changes in PTH levels are predominantly present in patients with advanced stages of chronic kidney disease (23). Independent from kidney function, increasing age itself is associated with increased plasma PTH concentrations (24,25) and it has even been suggested to take this effect into account when assessing calcium disorders

confounding variable, we hypothesize that the (indirect) effect of these baseline differences in elderly individuals(26). Even though ARIC, MESA and our study adjusted for age as a in age has driven the reported discrepancies. Although not directly within the scope of our

onset HF that was lost after we added sex, and time of year of blood withdrawal to this study, we observed a univariate signficant interaction between age, PTH, and risk for new model (data not shown). We suggest that future research should use accurately pre-set age categories to reveal if an interaction between age and PTH is of importance when assessing the association with new onset HF. Based on data from this and ARICs study, however, it

value. appears that screening for PTH to identify subjects at risk for new onset HF has limited

PTH is part of a complex endocrine system that regulates calcium and bone metabolism, and initiates integration of many factors, including the vitamin D metabolites calcidiol and calcitriol. Calcidiol is the storage form of vitamin D in the human body, and levels of this metabolite are used to determine vitamin D status. However, biological activity of vitamin

Proefschrift_final_zonder.indd 57 22-10-15 15:08 3 Chapter 3

D does not only rely on calcidiol and instead calcitriol is considered to be the primary and biologically most active metabolite in vitamin D biology (27). Previous studies mainly focused on the role of calcidiol as risk marker in HF and the value of measuring circulating calcitriol to predict new onset HF has not been studied before.

Experimental studies in mice lacking the vitamin-D receptor (VDR -/- - mice) demonstrated

that deficiency of the VDR results in cardiac hypertrophy and hypertension. So mechanistically, vitamin D is thought to directly influence HF pathology by regulating secretion of natriuretic hormones and activity of the renin-angiotensin-aldosteron system myocyte contractility, cardiac remodeling (regulation of inflammation and cytokines), (RAAS) (28). However, disappointing outcomes from experimental and epidemiological studies in humans have tempered the enthusiasm that this can be translated easily (29-31). In line with this, we now show that both plasma calcidiol and calcitriol have no predictive

value in identifying subjects at risk for new onset HF in the general population. Therefore, we consider the role for vitamin D as direct modifier in HF pathology a limited one. Although vitamin D may thus not have added value in predicting new onset HF in the general population, it may still be useful in reducing morbidity and mortality prevalence in patients with HF. The number of morbidities increases with age (32,33) and it is known that patients with HF often have multiple co-morbidities (34). Unfortunately, patients with co-morbid conditions are more likely to have an advanced stage of HF (34,35), with a concomitant increased risk for both HF hospitalization and overall mortality (35). It is, therefore, of relevance to establish screening tools that help identifying those patients at risk for increased co-morbidity prevalence (36). Interestingly, low levels of vitamin D are associated with abnormalities in laboratory values (e.g. increased serum LDL cholesterol, triglycerides and decreased serum HDL cholesterol) as well as increased prevalence of frequently reported co-morbidities in HF patients, such as hypertension and diabetes

mellitus (37). Moreover, vitamin D deficiency is also associated with increased morbidity an individual’s global health status. Possibly, low levels of vitamin D may be used to prevalence in a general population (33). We, therefore, hypothesize that vitamin D reflects

identify subjects with overall poor general health who are at risk for increased morbidity could be of added value in the reduction of morbidity and mortality burden in patients with prevalence. Further studies are needed to address if screening for vitamin D deficiency HF.

Strengths and limitations. PREVEND is a large, well-phenotyped, community-based cohort

study with a long follow-up. Within this study extensive information about study subjects is available that enabled us to adjust for several covariates, including sensitive cardiac 58

Proefschrift_final_zonder.indd 58 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

biomarkers, to minimize residual confounding. The validation of incident heart diagnosis has been thorough, while we used a sensitive method, LC-MS/MS to measure both calcidiol and calcitriol.

This study had several limitations. First, we used a retrospective approach to identify new

HF, this could have caused detection bias, especially resulting in the under detection of onset HF. Although all cases were evaluated by seven independent experts in the field of

subjects with HFpEF. Second, PREVEND study subjects were predominantly white. External readily extrapolated to other ethnicities. Third, due to the design of the study, there was a validity of our findings may be limited to white adults, and results may therefore not be

enrichment of subjects with mildly elevated urinary albumin concentrations. However, we and urinary albumin concentrations, we cannot fully ensure that this study design has not corrected for this in all analyses. Although we did not find a interaction between vitamin D affected our results.

Conclusion In this well-characterized community based cohort, we have shown that a single measurement of plasma calcidiol, calcitriol, or PTH does not predict new onset HF. Furthermore, we found that plasma calcidiol, calcitriol, and PTH were unable to distinguish between HFrEF and HFpEF. Based on these data, screening for these markers to identify

subjects at risk for new onset HF cannot be advocated.

Funding sources. This work was supported by the Netherlands Heart Foundation (grant 2007T046) and the Innovational Research Incentives Scheme program of the Netherlands Organization for

Scientific Research (NWO VENI, grant 916.10.117), and the Innovational Research Incentives Scheme program of the Netherlands Organization for Scientific Research (NWO VIDI, grant 917.13.350). Disclosures. H.J. Lambers-Heerspink has consultancy agreements with AbbVie, Astellas, Astra Zeneca, Johnson&Johnson, Reata, and Vitae. All honoraria are paid to his employer, the University Medical

Center Groningen, The Netherlands. The other authors report no conflicts

Proefschrift_final_zonder.indd 59 22-10-15 15:08 3 Chapter 3

References disease. Circ Heart Fail 2014 Sep;7(5):732-739.

1. van Jaarsveld CH, Ranchor AV, Kempen GI, Coyne 8. JC, van Veldhuisen DJ, Sanderman R. Epidemiology IA. Parathyroid hormone and cardiovascular van Ballegooijen AJ, Reinders I, Visser M, Brouwer of heart failure in a community-based study of disease events: A systematic review and meta- analysis of prospective studies. Am Heart J 2013 term survival. Eur J Heart Fail 2006 Jan;8(1):23- May;165(5):655-64, 664.e1-5. subjects aged > or = 57 years: incidence and long- 30. 9. 2. Brouwers FP, van Gilst WH, Damman K, van den Heerspink HJ, de Zeeuw D, Visser M, Brouwer IA, van Ballegooijen AJ, Gansevoort RT, Lambers- RBerg MP, Gansevoort RT, Bakker SJ, et al. Clinical et al. Plasma 1,25-dihydroxyvitamin D and the Risk of Developing Hypertension: the Prevention to predict new-onset heart failure in a community- of Renal and Vascular End-Stage Disease Study. risk stratification optimizes value of biomarkers based cohort. Circ Heart Fail 2014 Sep;7(5):723- Hypertension 2015(66):563-570. 731. 10. 3. Lloyd-Jones DM, Larson MG, Leip EP, Beiser A, van Ballegooijen AJ, Reinders I, Visser M, D’Agostino RB, Kannel WB, et al. Lifetime risk parathyroid hormone in relation to all-cause and Dekker JM, Nijpels G, Stehouwer CD, et al. Serum for developing congestive heart failure: the cardiovascular mortality: the Hoorn study. J Clin Framingham Heart Study. Circulation 2002 Dec Endocrinol Metab 2013 Apr;98(4):E638-45. 10;106(24):3068-3072. 11. Gupta GK, Agrawal T, DelCore MG, Mohiuddin SM, 4. Kritchevsky SB, Tooze JA, Neiberg RH, Schwartz GG, Hausman DB, Johnson MA, et al. Agrawal DK. Vitamin D deficiency induces cardiac 25-Hydroxyvitamin D, parathyroid hormone, and adipose tissue in hypercholesterolemic swine. Exp hypertrophy and inflammation in epicardial mortality in black and white older adults: the Mol Pathol 2012 Aug;93(1):82-90. health ABC study. J Clin Endocrinol Metab 2012 Nov;97(11):4156-4165. 12. Meems LM, Cannon MV, Mahmud H, Voors AA,

5. Duprez D, Bauwens F, De Buyzere M, De Backer van Gilst WH, Sillje HH, et al. The vitamin D T, Kaufman JM, Van Hoecke J, et al. Relationship and diastolic dysfunction in a murine model of receptor activator paricalcitol prevents fibrosis between parathyroid hormone and left ventricular pressure overload. J Steroid Biochem Mol Biol mass in moderate essential hypertension. J 2012 Nov;132(3-5):282-289. Hypertens Suppl 1991 Dec;9(6):S116-7. 13. Rahman A, Hershey S, Ahmed S, Nibbelink K, 6. Anderson JL, Vanwoerkom RC, Horne BD, Bair TL, Simpson RU. Heart extracellular matrix gene May HT, Lappe DL, et al. Parathyroid hormone, vitamin D, renal dysfunction, and cardiovascular knockout mice. J Steroid Biochem Mol Biol 2007 expression profile in the vitamin D receptor disease: dependent or independent risk factors? Mar;103(3-5):416-419. Am Heart J 2011 Aug;162(2):331-339.e2. 14. de Boer RA, van Veldhuisen DJ, Gansevoort RT, 7. Wannamethee SG, Welsh P, Papacosta O, Lennon Muller Kobold AC, van Gilst WH, Hillege HL, et L, Whincup PH, Sattar N. Elevated parathyroid in the general population. J Intern Med 2012 al. The fibrosis marker galectin-3 and outcome associated with increased risk of heart failure Jul;272(1):55-64. hormone, but not vitamin D deficiency, is in older men with and without cardiovascular

Proefschrift_final_zonder.indd 60 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

15. Brouwers FP, de Boer RA, van der Harst P, Voors and risk of incident heart failure: the multi-ethnic AA, Gansevoort RT, Bakker SJ, et al. Incidence study of atherosclerosis. J Am Heart Assoc 2014 and epidemiology of new onset heart failure Dec 2;3(6):e001278. with preserved vs. community-based cohort: 11-year follow-up of 23. Abdel-Gayoum AA. Serum vitamin D and reduced ejection fraction in a PREVEND. Eur Heart J 2013 May;34(19):1424- 1431. various stages of renal disease. Australas Med J parathyroid hormone profiles in patients with 2015 Feb 28;8(2):33-40. 16. van Bemmel JH, Kors JA, van Herpen G. Methodology of the modular ECG analysis system 24. Carrivick SJ, Walsh JP, Brown SJ, Wardrop R, MEANS. Methods Inf Med 1990 Sep;29(4):346- Hadlow NC. Brief report: Does PTH increase 353. with age, independent of 25-hydroxyvitamin D, phosphate, renal function, and ionized calcium? 17. Linssen GC, Bakker SJ, Voors AA, Gansevoort RT, J Clin Endocrinol Metab 2015 May;100(5):2131- Hillege HL, de Jong PE, et al. N-terminal pro-B-type 2134. natriuretic peptide is an independent predictor of cardiovascular morbidity and mortality 25. in the general population. Eur Heart J 2010 parathyroid hormone level is associated with Kamycheva E, Sundsfjord J, Jorde R. Serum Jan;31(1):120-127. body mass index. The 5th Tromso study. Eur J Endocrinol 2004 Aug;151(2):167-172. 18. Sachs MC, Shoben A, Levin GP, Robinson-Cohen C, Hoofnagle AN, Swords-Jenny N, et al. Estimating 26. Eastell R, Brandi ML, Costa AG, D’Amour P, Shoback mean annual 25-hydroxyvitamin D concentrations DM, Thakker RV. Diagnosis of asymptomatic from single measurements: the Multi-Ethnic primary hyperparathyroidism: proceedings of the Study of Atherosclerosis. Am J Clin Nutr 2013 Fourth International Workshop. J Clin Endocrinol Jun;97(6):1243-1251. Metab 2014 Oct;99(10):3570-3579.

19. Lu M, Lyden PD, Brott TG, Hamilton S, Broderick 27. Gallagher JC, Riggs BL, Eisman J, Hamstra JP, Grotta JC. Beyond subgroup analysis: improving A, Arnaud SB, DeLuca HF. Intestinal calcium the clinical interpretation of treatment effects in absorption and serum vitamin D metabolites in stroke research. J Neurosci Methods 2005 Apr 30;143(2):209-216. of age and dietary calcium. J Clin Invest 1979 normal subjects and osteoporotic patients: effect Sep;64(3):729-736. 20. Marshall SW. Power for tests of interaction: effect of raising the Type I error rate. Epidemiol Perspect 28. Dalbeni A, Delva P, Minuz P. Could vitamin D Innov 2007 Jun 19;4:4. supplements be a new therapy for heart failure? Possible pathogenic mechanisms from data of 21. Folsom AR, Alonso A, Misialek JR, Michos ED, intervention studies. Am J Cardiovasc Drugs 2014 Selvin E, Eckfeldt JH, et al. Parathyroid hormone Oct;14(5):357-366. concentration and risk of cardiovascular diseases: the Atherosclerosis Risk in Communities (ARIC) 29. Zittermann A. Vitamin D and cardiovascular study. Am Heart J 2014 Sep;168(3):296-302. disease. Anticancer Res 2014 Sep;34(9):4641- 4648. 22. Bansal N, Zelnick L, Robinson-Cohen C, Hoofnagle AN, Ix JH, Lima JA, et al. Serum parathyroid 30. Ford JA, MacLennan GS, Avenell A, Bolland M, hormone and 25-hydroxyvitamin D concentrations Grey A, Witham M, et al. Cardiovascular disease

Proefschrift_final_zonder.indd 61 22-10-15 15:08 3 Chapter 3

and vitamin D supplementation: trial analysis, systematic review, and meta-analysis. Am J Clin Nutr 2014 Sep;100(3):746-755.

31. Boxer RS, Kenny AM, Schmotzer BJ, Vest M, Fiutem JJ, Pina IL. A randomized controlled trial of high

dose vitamin D3 in patients with heart failure. JACC Heart Fail 2013 Feb;1(1):84-90.

32. Barnett K, Mercer SW, Norbury M, Watt G, Wyke S, Guthrie B. Epidemiology of multimorbidity and implications for health care, research, and medical education: a cross-sectional study. Lancet 2012 Jul 7;380(9836):37-43.

33. Meems L, de Borst M, Postma D, Vonk J, Kremer H, Schuttelaar M, et al. Low levels of vitamin D are associated with multimorbidity: Results from the LifeLines Cohort Study. Ann Med 2015, epub ahead of print.

34. Braunstein JB, Anderson GF, Gerstenblith G, Weller W, Niefeld M, Herbert R, et al. Noncardiac comorbidity increases preventable hospitalizations and mortality among Medicare

Cardiol 2003 Oct 1;42(7):1226-1233. beneficiaries with chronic heart failure. J Am Coll

35. van Deursen VM, Urso R, Laroche C, Damman K, Dahlstrom U, Tavazzi L, et al. Co-morbidities in patients with heart failure: an analysis of the European Heart Failure Pilot Survey. Eur J Heart Fail 2014 Jan;16(1):103-111.

36. Lee CS, Chien CV, Bidwell JT, Gelow JM, Denfeld QE,

and inpatient outcomes during hospitalization for Masterson Creber R, et al. Comorbidity profiles heart failure: an analysis of the U.S. Nationwide inpatient sample. BMC Cardiovasc Disord 2014 Jun 5;14:73-2261-14-73.

37. Skaaby T. The relationship of vitamin D status to risk of cardiovascular disease and mortality. Dan Med J 2015 Feb;61(2):B5008.

Proefschrift_final_zonder.indd 62 22-10-15 15:08 Plasma calcidiol, calcitriol, and parathyroid hormone and risk of new onset heart failure in a population-based cohort study

Proefschrift_final_zonder.indd 63 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

Proefschrift_final_zonder.indd 64 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

Laura M.G. Meems1; Martin H. de Borst2; Dirkje S. Postma3; Judith M. Vonk3; Hubertus P.H. Kremer4; Marie-Louise A. Schuttelaar5; Judith G.M. Rosmalen2,6; Rinse K. Weersma7; Bruce H.R. Wolffenbuttel8; Salome Scholtens9; Ronald P. Stolk9; Ido P. Kema10; Gerjan Navis2; Mohsin A.F. Khan1; Pim van der Harst1; Rudolf A. de Boer1

1 Department of Cardiology, 2 Department of Internal Medicine, 3 Department of Pulmonology; Groningen Research Institute for Asthma and COPD (GRIAC), 4 Department of Neurology, 5 Department of Dermatology, 6 Department of Psychiatry, department of Internal Medicine, 7 Department of Gastroenterology and Hepatology, 8 Department of Endocrinology, University of Groningen, 9 Department of LifeLines Cohort Study & Biobank, 10 Department of Laboratory Medicine, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands Chapter Proefschrift_final_zonder.indd 65 422-10-15 15:08 4 Chapter 4

Abstract

increasing. So far, studies on the relationship between vitamin D and morbidity are The prevalence of multimorbidity (≥1 disease within an individual) is rapidly mainly focusing on effects on single disease domains only, while vitamin D biology is associated with several diseases throughout the human body.

We studied 8726 participants from the LifeLines Cohort Study (a cross-sectional, population-based cohort study), and used the self-developed composite morbidity score to study the association between vitamin D levels and multimorbidity.

Study participants (mean age 45(13) years, 73% females) had a mean plasma vitamin D level of 59(22) nmol/L. In participants aged between 50-60 years, 58%

had ≥ 2 affected disease domains, while MS increased with age (70-80 years: 82% by 1 standard deviation (SD) of vitamin D level was associated with an 8% higher morbidity score>1, >80 years: 89% morbidity score>1). Each incremental reduction

morbidity score (full model OR 0.92 [95%CI 0.88-0.97], p=0.001). Participants with ( vitaminvs. D levels <25nmol/L were at highest risk for increasing morbidity prevalence >80nmol/L, OR 1.34 [95%CI 1.07-1.67, p=0.01]. Low levels of vitamin D are associated with higher prevalence of multimorbidity,

especially in participants with vitamin D levels<25 nmol/L. Collectively, our results favor a general, rather than an organ-specific approach when assessing the impact of vitamin D deficiency.

Proefschrift_final_zonder.indd 66 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

Introduction

single disease in an individual at a given point in time, is on a rapid increase. However, due The prevalence of multimorbidity, commonly defined as the manifestation of more than one

of multimorbidity in the general population remains unclear, with estimates ranging from to a lack of consensus as to how multimorbidity itself is defined (1), the true prevalence 17-90% (2). It is apparent that the presence of multimorbidity is associated with a higher mortality risk, impaired physical and mental functioning as well as a decreased quality

diseases whilst multimorbidity attracts relatively less attention. The increasing prevalence of life (3), yet resources continue to be directed towards addressing organ-specific single of multimorbidity in the ageing population thus urges health care professionals to address multiple medical problems in different disease domains in an orchestrated effort (4).

human body have been extensively studied and it is now a widely accepted fact that vitamin Over the last few decades, the pathophysiological effects of vitamin D deficiency on the

that low vitamin D levels are associated with a variety of acute and chronic diseases D deficiency is a global problem (5). Data from clinical and epidemiological studies suggest (6). Traditionally, vitamin D is considered to act on calcium and phosphate homeostasis, but recent research has shown that low vitamin D levels are associated with a wide range of non-skeletal impairments as well, including depression (7) , cardiovascular and cerebrovascular disease (8) , and several types of cancers (9). Despite this however, studies on the relationship between vitamin D and disease have mainly focused on patients with

vitamin D biology is associated with several diseases throughout the human body. These a single disease domain present even though there is sufficient evidence to suggest that observations in the literature provided a rationale for us to study the association between vitamin D and multimorbidity.

association of vitamin D levels and prevalence of multimorbidity using data from a large Since vitamin D may influence several organ systems simultaneously, we studied the population based study in the Netherlands (the LifeLines Cohort).

We hypothesized that low plasma concentrations of vitamin D are associated with increased prevalence of multimorbidity in the general population, especially in participants with vitamin D levels below 25 nmol/L.

Proefschrift_final_zonder.indd 67 22-10-15 15:08 4 Chapter 4

Material & Methods This manuscript was written in adherence to the guidelines of Strengthening The Reporting of Observational Studies in Epidemiology (STROBE) (10).

Study design. In this cross-sectional study, we collected data from participants of the

participants were asked to complete a self-administered questionnaire, requiring them to LifeLines Cohort Study. Prior to the first visit at the LifeLines outpatient clinic, all provide information pertaining to their medical history, current diseases, use of medication, and health behavior. Simultaneously, participants were instructed to bring in a detailed list with information about their latest medication used, which was then registered in

visit to the LifeLines outpatient clinic, all LifeLines participants underwent a clinical the LifeLines database (verification took place at a later time point). During the first examination, followed by blood and urine collection. In addition, current psychiatric disorders (depressive disorder, dysthemia, and anxiety disorders) were assessed with a brief standardized diagnostic interview: the Mini International Neuropsychiatric Interview (M.I.N.I.) 5.0.0 (11). Data from the questionnaires, medication list, clinical examination, and M.I.N.I interview were collectively used to determine point prevalence of disease in this population, with a simple morbidity score as the composite endpoint. More detailed information about the data collection can be found in appendix I.

Lifelines Cohort Study. LifeLines is a multi-disciplinary population-based cohort study that examines the health and the health-related behaviors of 167,729 persons living in the North East region of The Netherlands in a unique three-generation design (12). It employs a broad range of data collection including biomedical, socio-demographic, behavioral, physical and psychological factors that contribute to the health and disease of the general population, with a special focus on multimorbidity. All LifeLines participants completed a number of questionnaires containing questions on a broad spectrum of diseases, including obesity, cardiovascular and renal diseases, pulmonary diseases and allergy, cognitive function and depression, and musculoskeletal conditions. After completion of these questionnaires, LifeLines participants were invited for clinical examination and blood sampling at the LifeLines outpatient clinic.

Study population. LifeLines participants were invited through their general practitioner. A selection of general practitioners from the three northern provinces (situated at the 53rd parallel, Northern hemisphere) of the Netherlands, invited all of their listed patients between 25 and 50 years of age (index cohort). These probands were then asked to invite their family members (if present) to participate as well (parents, partners, parents-in- law, children). The inclusion phase was closed in December 2013 with a total of 167,729

Proefschrift_final_zonder.indd 68 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

participants. From this cohort, 9109 plasma samples were randomly selected in which we determined vitamin D levels (Figure 1). The study protocol was approved by the medical ethics review committee of the University Medical Center Groningen (UMCG) and conducted in accordance with the Declaration of Helsinki. All participants provided written informed consent upon enrollment.

Figure 1 - Relationship between season of blood sampling and vitamin D levels. Data are presented in

ANOVA (post hoc testing with Bonferroni). Outliers are not presented. Tukey boxplot (median [IQR]). ***p<0.001 as compared to previous season. Data is analyzed using one-way

Vitamin D assay. Plasma 25-Hydroxyvitamin D3 levels were measured by solid phase extraction isotope dilution followed by liquid chromatography–tandem mass spectrometry (Spark-Holland Symbiosis system, Emmen, The Netherlands) with a detection limit of 1.2

vitamin D levels were measured in nmol/L (2.5 nmol/L is equivalent to 1 ng/mL) and nmol/L, and intra-assay and inter-assay coefficient of variation from 5.0% up till 14.1%

categorized using the following cut-offs (13): sufficient (>80 nmol/L), hypovitaminosis D (50-80 nmol/L), insufficient (25-50 nmol/L) and deficient (<25 nmol/L). Defining single morbidities, disease domains, and morbidity score. Single morbidities were scored according to the 10th

edition of the International Statistical Classification of Diseases 69

Proefschrift_final_zonder.indd 69 22-10-15 15:08 4 Chapter 4

and Related Health Problems (ICD-10) (14) (for a detailed list of single morbidities see appendix II). Next, single morbidities were clustered into twelve different disease domains: genitourinary, renal, hematologic, dermatologic, musculoskeletal, ophthalmic & ear-nose- throat (ENT), psychiatric, endocrine, cardiovascular, respiratory, central nervous system (CNS) and gastrointestinal disease (for a detailed list of single morbidities within each disease domain see appendix II). Together, these twelve disease domains represent health and disease of the entire body. Scrutinizing relevant literature reveals that a standardized approach for measuring multimorbidity does not exist. Therefore, we calculated a simple morbidity score as a composite endpoint, in which a disease domain is considered as “affected” when at least one single disease is present within this disease domain shortly

represents point prevalence of twelve disease domains, with a maximum score of twelve. before and during the first visit at LifeLines outpatient clinic. The morbidity score thus Unfortunately, this method of registration has inherent uncertainties concerning sensitivity of disease-registration. Therefore, self-reported diseases were registered in this study when

the use of appropriate medication was verified. Statistical analyses. Baseline characteristics are presented according to vitamin D categories. Continuous data are represented as means ± standard deviation (SD) for normally distributed data and as medians with InterQuartile Ranges (IQR) for non-normal distributions. Discrete and categorical data are presented as frequencies (%).

Unless specified otherwise, outcomes were compared to participants who had vitamin D among the four vitamin D categories were tested using one-way ANOVA or Kruskal Wallis levels in the sufficient category (>80 nmol/L). For continuous data, baseline differences tests, as appropriate. Baseline differences between different vitamin D categories for discrete and categorical variables were compared using a standard Chi2-test.

It is known that vitamin D levels significant correlate with season of blood withdrawal withdrawal in our participants, we performed a Spearman’s rho test. Additionally, as (15). In order to confirm the relationship between vitamin D levels and season of blood

described previously (15), we added two variables (R= cos([2π/365.25]*day) and S= subsequent analyses. sin([2π/365.25]*day) to correct for plasma vitamin D levels and day of blood sampling in all

To study the association between vitamin D levels and a single disease domain we used logistic regression analyses. In addition, to study the association between vitamin D levels as well as vitamin D categories with morbidity score we used ordinal logistic regression analyses. The proportional odds assumption for the ordinal logistic models were checked

Proefschrift_final_zonder.indd 70 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

primary analyses, we studied the association between vitamin D levels and vitamin D and met. Odds ratios (ORs) were reported with 95% confidence interval [95% CI]. In the categories with single disease domains and morbidity score without assessment for co-

morbidity, and determinants of plasma vitamin D levels. This model controlled for several variates. In addition to these analyses, we created a model to adjust for risk-factors for determinants of both morbidity and plasma vitamin D levels (sex, age, BMI, smoking, kidney function (16)), lifestyle factors related to morbidity and vitamin D levels (education level, physical activity, alcohol consumption (17,18), and sole determinants of plasma vitamin D levels (albumin-corrected plasma calcium levels and dairy consumption (19)). The results generated from this model were considered the main results and are presented unless otherwise stated. In our model, age, kidney function and albumin-corrected plasma calcium levels were included as linear variables, whereas all other variables were included as categorical variables with dummy variables.

Since our method of data collection could potentially result in morbidities being under or over reported, we conducted a sensitivity analysis in which we randomly excluded 2 different disease domains for 3 consecutive times. Finally, as we did not score the presence of cancer as a separate disease domain, we also ran sensitivity analyses in both model 1 and

2, excluding participants who reported to have cancer (n=77). were performed using STATA v11SE (College Station, TX, USA). All p-values are two-tailed. A p-value <0.05 was considered statistically significant. Analyses

Results From January 2010 until October 2011 we collected and measured plasma vitamin D levels in 9091 samples. After exclusion of participants with vitamin D assay issues, pregnant women and non-Caucasian participants, a total of 8726 vitamin D samples from participants

with more females than males (73 vs. 27%). The mean plasma vitamin D level was 59 ± 22 were included in the final analysis (Supplemental Figure 1). Mean age was 45 ± 13 years, nmol/L, and 17% of the participants had plasma vitamin D levels above 80 nmol/L (Table 1).

Vitamin D levels and season of blood sampling. Plasma vitamin D levels were different among season of blood sampling (Figure 1). We observed that participants visiting LifeLines outpatient clinic during the winter were more likely to have lower vitamin D levels than

those visiting during the summer (Spearman’s rho=0.37, n=8726, p<0.000). Distribution of morbidity score. Table 2 displays the baseline characteristics of all individuals categorized by morbidity score. Participants with the lowest morbidity score (0) were more

Proefschrift_final_zonder.indd 71 22-10-15 15:08 4 Chapter 4

likely to be younger, less heavy, and non-smoking. Furthermore, we found that individuals who had a higher morbidity score, had an increased likelihood of having higher glucose levels, increased systolic and diastolic blood pressures, while they reported less physical activity, were less well educated and had lower vitamin D levels. The median sum of disease domains, as well as the distribution of participants with a higher morbidity score increased

62% of the population scored at least one disease domain while in the group of 50-60 years, substantially with age (figure 2A). In the group of participants aged between 20-30 years, 58% of the participants had at least two affected disease domains. Almost all participants

Figure 2B, the gastrointestinal (23%), central nervous system (17%), respiratory (16%), over 70 years had a morbidity score >1 (70-80 years: 82%, >80 years: 89%). As shown in cardiovascular (15%) and endocrine (12%) disease domain, were the disease domains that were most commonly reported as affected.

Figure 2A - Distribution of number of disease domains in different age-categories of subjects from the LifeLines Cohort Study.

Vitamin D categories and baseline characteristics. Table 1 also shows the baseline characteristics of the participating individuals according to their vitamin D category. Participants with lower plasma vitamin D levels were more likely to be male, had a higher BMI, systolic blood pressure, eGFR and, plasma glucose, but lower plasma calcium and HDL-

levels, and reported lower physical activity. In addition to these findings, we noticed some distinct differences in the baseline characteristics of the vitamin D deficient participants. As more likely to be current smokers and had a higher educational level. Furthermore, their compared to individuals with sufficient vitamin D levels, these participants were younger,

Proefschrift_final_zonder.indd 72 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

reported dairy intake was rather low, and so was their alcohol consumption.

Figure 2B. Distribution of affected disease domains in subjects from the LifeLines Cohort Study. Contribution per disease domain on total of reported disease domains (%).

Association of vitamin D levels and single disease domains. Analyzing the association between each standard deviation (SD)-reduction in vitamin D level and single disease domain, we

within the gastrointestinal, genitourinary and cardiovascular tract (Figure 3A). found a significant inverse relationship between vitamin D levels and prevalence of diseases

In contrast, none of the other domains were significantly inversely related to vitamin D renal disease domain. Furthermore, we found that for every 1 SD-decrease of plasma levels, although a borderline significant p-value of 0.061 was reported in the case of the

vitamin D level the morbidity score increased by 13% (p<0.001). In our full model, this effect was slightly attenuated, but still remained 8% (p=0.001).

Proefschrift_final_zonder.indd 73 22-10-15 15:08 4 Chapter 4

Figure 3A - Full model odds ratio with 95% CI of ordinal logistic regression on vitamin D levels and morbidity score, as well as odds ratio with 95% CI of logistic regression on vitamin D levels and single morbidities.

Association of vitamin D levels and vitamin D categories with morbidity score prevalence. Additionally, we studied the association between vitamin D category and morbidity score. Figure 3B displays the odds-ratios of the morbidity score and vitamin D category. Vitamin D

deficient individuals, as compared to vitamin D sufficient participants, were at the highest risk with regards to morbidity prevalence (full model : OR 1.34 [95% CI: 1.07-1.67], p=0.01). Albeit less pronounced, this association remained in subjects within the hypovitaminosis D category (full model: OR 1.16 [95% CI: 1.03-1.30], p=0.01) as well as the insufficient category (full model: OR 1.27 [95% CI: 1.13-1.45], p<0.001), respectively.

Proefschrift_final_zonder.indd 74 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

Figure 3B - Full model odds ratios with 95% CI of ordinal logistic regression on vitamin D category and morbidity score

Assessment of robustness of our results: sensitivity analysis. To assess the robustness of our

excluded 2 different disease domains for 3 consecutive times in both models 1 and 2. results we performed sensitivity analyses. In the first part of this analysis, we randomly However, this did not substantially change the OR of our ordinal and logistic regression. In the second part of the sensitivity analysis, we excluded participants who reported to have

cancer (n=77). Again, this did not change the overall findings (results not shown).

Proefschrift_final_zonder.indd 75 22-10-15 15:08 4 Chapter 4

Table 1 - Baseline characteristics of all participants in the LifeLines Cohort Study, as well as per vitamin D category

Baseline All participants Sufficient Hypovitaminosis D Insufficient Deficient characteristics (> 80 nmol/L) (50-80 nmol/L) (25-50 nmol/L) (<25 nmol/L) (n=8726) (n=1466) (n=4091) (n=2807) (n=362)

Age (years) 45 ± 13 46 ±13 46 ±13 45 ±12

Women (%) 73 79 43 ±12**

BMI (kg/m2) 74*** 69*** 66***

- normal (%) 46 55 ***47 ***41 ***42 - overweight (%) 38 35 40 38 33 - obese (%) 16 10 13 21 25

Smoking

- no (%) 49 47 50 48 ***49 - current (%) 19 19 18 21 29 - former (%) 32 34 33 31 22

Systolic BP (mmHg) 124 ±15 123 ±15 124 ±15

Diastolic BP (mmHg) 73 ±9 72 ±8 73 ±9 126 ±16*** 12573 ±10±16*

eGFR (ml/min/1.73m2) 94 ±15 90 ±15 73 ±9 ***

Plasma glucose levels 5.0 ±0.8 4.9 ±1 945.0 ±15*** ±1 96 ±14*** 100 ±15*** (mmol/L) 5.1 ±1*** 5.2 ±1*** Plasma AC calcium levels 2.2 ±0.07 2.3 ±0.1 (mmol/L) 2.3 ±0.1* 2.3 ±0.1*** 2.3 ±0.1*** Plasma HDL-levels 1.6 ±0.4 1.7 ±0.4 (mmol/L) 1.6 ±0.4*** 1.5 ±0.4*** 1.4 ±0.4*** Plasma LDL-levels 3.1 ±0.9 3.1 ±0.9 3.1 ±0.9 3.1 ±0.9 3.1 ±0.9 (mmol/L)

Education level

- low (%) 29 30 31 28 24* - moderate (%) 40 40 39 40 39 - high (%) 31 30 30 32 37

Frequent dairy intake (%) 90 91 90 91

Alcohol consumption 80***

- low (%) 82 79 81 ***84 86** - moderate (%) 17 20 18 15 12 - heavy (%) 1 1 1 1 2

Physical activity (%)

- none/low (%) 7 13 14 ***20 ***33

- moderate (%) 35 33 35 37 34 - high (%) 48 54 51 43 33

Plasma vitamin D levels 59 ±22 95 ±14 (nmol/L) 64 ±8*** 39 ±7*** 20 ±4*** Season of blood withdrawal

- Winter 45 26 ***34 ***63 ***84 - Spring 41 46 49 32 13 - Summer 11 22 13 4 2

Proefschrift_final_zonder.indd 76 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

- Fall 3 7 4 1 1

Morbidity score

- 0 (%) 24 28 24** ***22 22* - 1 (%) 32 32 33 30 32 44 40 43 48 46

- >1 (%)

All outcomes are compared to those from subjects within the sufficient category (>80 nmol/L). *p<0.05, **p<0.01 with Bonferroni), or with a Kruskal Wallis (post hoc Mann-Whitney-U) if appropriate. Discrete data are presented and *** p<0.001. Continuous data are presented as mean (SD) and analyzed using one-way ANOVA (post hoc testing as frequencies (%) and analyzed using Chi2

test. BP= blood pressure; eGFR= estimated glomerular filtration rate; 2), overweight (25-30 kg/m2 2 AC= albumin-corrected; HDL= high density lipoprotein; LDL= low density lipoprotein. BMI is subdivided in normal (<25 kg/m ), obese (>30 kg/m ); smoking is defined as no (no smoking last month, never is categorized in low (none, primary education up to intermediate vocational education), moderate (higher secondary smoked for >1 yr), current (smoking last month), former (no smoking last month and stopped > 1 yr); education level

education) and high (higher education and university); frequent dairy consumption is defined as regularly or daily intake of milk and butter products; alcohol consumption is defined as low (male <2 drinks/day, female <1 drink/ day), moderate (male 2-4 drinks/day, female 1-3 drinks/day) and heavy (male >4 drinks/day, female >3 drinks/day). Physical activity is categorized as none/low (≤1 day/wk 30 min activity), moderate (2-4 days/wk 30 min activity) and high (≥5 days/wk 30 min activity).

Table 2 - morbidity score Baseline characteristics of participating subjects in the LifeLine Cohort Study, according to their

Baseline MS 0 MS 1 MS 2 MS 3 MS 4 MS 5 MS 6 MS 7 characteristics (n=2092) (n=2768) (n=1977) (n=1118) (n=509) (n=176) (n=75) (n=11)

Age (years) 39 ± 11

Women (%) 73 43 ±72 12** 47 ±74 12** 52 ±72 13** 55 ±76 12** 58 ±70 11** 56 ±79 12** 60 ±73 11** BMI (kg/m2)

- normal (%) 73 ***51 ***36 ***26 ***16 ***9 ***3 ***9

-overweight (%) 27 38 44 45 45 44 41 46

- obese (%) 0 11 20 29 39 47 56 46

Smoking

- no (%) 58 ***50 ***45 ***41 ***42 ***40 ***32 55 - current (%) 17 20 20 20 18 24 22 9

- former (%) 25 30 3 39 40 36 46 36

Systolic BP (mmHg) 118 ± 10

Diastolic BP (mmHg) 70 ± 8 121 ± 13 *** 127 ± 16 *** 132 ± 17 *** 136 ± 18 *** 137 ± 18 *** 133 ± 17 *** 126 ± 19 **

eGFR (ml/min/1.73m2) 98 ± 13 72 ± 9 *** 74 ± 9 *** 76 ± 10 *** 77 ± 10 *** 77 ± 10 *** 76 ± 10 *** 72 ± 10 ***

Plasma glucose levels 4.8 ± 0.4 96 ± 14 *** 93 ± 14 *** 89 ± 15 *** 87 ± 16 *** 86 ± 16 *** 84 ± 21 *** 80 ± 20 *** (mmol/L) 4.9 ± 0.5 *** 5.0 ± 0.7 *** 5.3 ± 1.1 *** 5.5 ± 1.2 *** 5.9 ± 1.7 *** 6.3 ± 2.4 *** 6.0 ± 1.5 *** Plasma AC calcium levels 2.16 ± 0.1 2.17 ± 0.1 2.20 ± 0.1 2.22 ± 0.1 (mmol/L) 2.18 ± 0.1 *** 2.19 ± 0.1 *** 2.22 ± 0.1 *** 2.21 ± 0.1 ** Plasma HDL-levels 1.6 ± 0.4 *** *** *** 1.5 ± 0.5 (mmol/L) 1.6 ± 0.4 ** 1.5 ± 0.4 *** 1.5 ± 0.4 *** 1.5 ± 0.4 *** 1.4 ± 0.4*** 1.3 ± 0.4 ***

Proefschrift_final_zonder.indd 77 22-10-15 15:08 4 Chapter 4

Plasma LDL-levels 2.8 ± 0.7 3.2 ± 1.1 (mmol/L) 3.1 ± 0.8 *** 3.2 ± 0.9 *** 3.4 ± 1.0 *** 3.5 ± 1.0 *** 3.4 ± 1.2 *** 3.3 ± 1.2 *** Education level

- low (%) 19 ***25 ***32 ***42 ***48 ***53 ***48 55** - moderate (%) 41 40 41 36 35 31 36 45 - high (%) 40 35 27 22 17 16 16 0

Frequent dairy intake (%) 92 90 91 97 91

Alcohol consumption 90 * 89 *** 88 **

- low (%) 83 81 82* 82 84 80 85 82 - moderate (%) 16 18 17 16 16 18 13 18 - heavy (%) 1 1 1 2 1 2 1 0

Physical activity (%)

- none/low (%) 14 16 ***19 ***19 18 24** 23 18

- moderate (%) 36 37 36 32 31 31 29 36 - high (%) 50 47 45 49 51 45 48 46

Plasma vitamin D levels 61 ± 23 60 ± 22 57 ± 23 57 ± 24 (nmol/L) 58 ± 22 *** 58 ± 22*** 57 ± 22 *** 54 ± 23 *** Season of blood withdrawal - Winter 44 44 43 47 44 45 45 46 - Spring 42 42 42 40 40 44 36 36 - Summer 11 11 11 10 13 9 14 18 - Fall 3 3 4 3 3 2 5 0

Continuous data are presented as mean ± SD and analyzed using one-way ANOVA (post hoc testing with Bonferroni), All outcomes are compared to those from subjects with a morbidity score (MS) of 0. *p<0.05, **p<0.01, ***p<0.001. or with a Kruskal Wallis (post hoc Mann-Whitney-U) if appropriate. Discrete data are presented as frequencies (%) and analyzed using Chi2 2), overweight test. BP= blood pressure; eGFR= estimated glomerular filtration rate; AC= albumin-corrected; (25-30 kg/m2 2 HDL= high density lipoprotein; LDL= low density lipoprotein. BMI is subdivided in normal (<25 kg/m ), obese (>30 kg/m ); smoking is defined as no (no smoking last month, never smoked for >1 yr), low (none, primary education up to intermediate vocational education), moderate (higher secondary education) and current (smoking last month), former (no smoking last month and stopped > 1 yr); education level is categorized in

high (higher education and university); frequent dairy consumption is defined as regularly or daily intake of milk and butter products; alcohol consumption is defined as low (male <2 drinks/day, female <1 drink/day), moderate (male 2-4 drinks/day, female 1-3 drinks/day) and heavy (male >4 drinks/day, female >3 drinks/day). Physical activity is 30 min activity). categorized as none/low (≤1 day/wk 30 min activity), moderate (2-4 days/wk 30 min activity) and high (≥5 days/wk

Discussion

blood withdrawal and correction for several other confounders, low vitamin D levels are We demonstrate in this cross-sectional study that, after proper adjustment for season of associated with an increased prevalence of multimorbidity. We report an incremental

Proefschrift_final_zonder.indd 78 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

increase in multimorbidity prevalence according to a decrease in vitamin D levels, the

we show that the association between low vitamin D and multimorbidity is not restricted to association being strongest in participants with vitamin D levels <25nmol/L. Furthermore,

a specific disease or disease domain. Our findings are in line with the concept that vitamin within the human body (21). For that reason, we suggest that vitamin D has an overall D status influences physiological and pathophysiological processes in several organ systems association with disease. Further, our study underscores how common multimorbidity is.

Multimorbidity in the general population. study to show an association between vitamin D levels and prevalence of multimorbidity. To the best of our knowledge this is the first

although multimorbidity is a common feature in almost all individuals suffering from Traditionally, most biomedical research is focused on single, organ-specific morbidities chronic diseases (21), and as such it should be considered the norm, rather than the exception. It has been reported that people suffering from multimorbidity have impaired functional status, low quality of life, and worse health outcomes, as compared to those without multimorbidity (21,22). Participants who suffer from multimorbidity present

ambulatory and clinical care (23). Nevertheless, specialist medical care still mostly focuses a logistic and financial burden for health-care systems worldwide as they use more on the treatment of single morbidities and is organized in single disease or organ-centered clinics, despite the urge to improve continuity and coordination of care for people with multiple diseases (4). Treatment is based on single disease guidelines, and little effort has been investigated in proper treatment of patients with multimorbidity (24). In this study,

increases with age (25). we confirm that the number of disease domains, which we denote as morbidities, sharply

Recognition of the interplay between multimorbidity and vitamin D biology. Low levels of vitamin D have been associated with several single diseases from different disease domains (e.g.: age-related hypertension, multiple sclerosis, periodontal disease, tuberculosis and,

the gastrointestinal tract, although diseases within the central nervous (17%), respiratory inflammatory bowel disease (26)). Most of the reported diseases (23%) in our study are in (17%) and cardiovascular (15%) system are also frequently reported. Morbidities within

all of the latter domains have been associated with vitamin D deficiency. For example, vitamin D has been considered as a major player in pathogenesis of several gastrointestinal (27)), cardiovascular diseases and heart failure (28), while growing evidence suggests immune conditions (inflammatory bowel disease, Crohn’s disease and ulcerative colitis that low vitamin D levels are associated with the onset and severity of multiple sclerosis

(29). Vitamin D deficiency has also been linked to respiratory diseases like asthma and chronic obstructive pulmonary disease (COPD), although the role of vitamin D deficiency 79

Proefschrift_final_zonder.indd 79 22-10-15 15:08 4 Chapter 4

in development of COPD remains controversial (30). This suggests that low vitamin D levels, or in combination with a cluster of diseases, may contribute to the development of multiple diseases within different disease domains. However, results from observational and supplementation studies are non-consistent, and the role of vitamin D in disease (cause

or consequence) is still under debate. Nevertheless, we believe that vitamin D deficiency Autier et al., who suggested that that low levels of vitamin D are rather a marker of ill health should, at least, be regarded as marker of health. This is also in line with the findings from

than a cause risk factor for certain diseases (31). Based on these findings, we urge that multiple morbidities. And although the association between vitamin D supplementation and future studies of vitamin D biology and deficiency should take into account the context of

outcomes of large-scale clinical trials on vitamin D supplementation are eagerly awaited (beneficial) effects on both skeletal and non-skeletal outcomes is less clear (32)(33) (since (34), we thus, emphasize the need for evaluating a wide array of outcome measures.

This study has several strengths: (i) the use of a large cohort of a relatively homogeneous community based population, which allows extrapolation to similar populations, (ii) the

inclusion of 45 single morbidities, clustered into 12 disease domains, which represent organ use of standardized definitions of specific morbidities when possible (ICD-10); and (iii) the

and disease domains, we have explicitly reported the backbone our approach (appendix I), systems from the entire human body. In addition, with regard to the definitions of morbidity which promotes the reproducibility of this analysis.

relies on the data from the self-reported questionnaires. Although clinical examination was Our study shares the limitations of other studies in the field of multimorbidity, as it partly included, some of the diseases were self-reported and this may have caused under or over reporting of these morbidities. However, in the current framework of the LifeLines Cohort Study we considered this approach most feasible, although we acknowledge limitations

endpoint of morbidity score. Although we recognize that the effect of multimorbidity on inherent to this approach. Another restraint of this study may be the simplified composite individuals will vary with the combination and severity of morbidities, we chose to weight

This approach is different from other scores, like the Charlons-comorbidity score (36), that all morbidities equally, which resulted in a simplified count to define disease domains.

to use such an unweighted score: Boeckxstaens and colleagues recently reported about also takes into account the severity of the comorbidity. Of note, we are not the first ones a comparison of different multimorbidity measures (weighted versus unweighted), and found that there was no clear advantage in using a weighted score over an unweighted score (36). Furthermore, this strategy enabled us to include morbidities that have a low prevalence. Nevertheless, we believe this strategy to be the most feasible and reproducible

Proefschrift_final_zonder.indd 80 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

way to study multimorbidity since it takes into account the effects of multiple morbidities within disease domains rather than being restricted to single morbidities only. This study is a cross-sectional study: therefore these analyses do not provide information about

possible causality of vitamin D deficiency and morbidity prevalence. Another limitation of confounders, we cannot exclude a possible effect of any unmeasured factors on the observed this study is its observational nature: despite the fact that we adjusted for several potential association. In addition, residual confounding by variables that are measured by a higher degree of detail (such as education) is possible, although we do not consider them a likely explanation for the clear association between vitamin D levels and morbidity presence.

In this study we found that morbidity increases with age, and that multimorbidity is common. Furthermore, we showed that low levels of vitamin D are associated with an increased prevalence of morbidity, an association that is the strongest in participants with vitamin D levels below 25 nmol/L. However, this association is not disease, nor disease

domain specific. In light of this, our results favor a general, rather than an organ-specific approach when assessing the impact of vitamin D deficiency.

Conflict of interest. All authors have completed and submitted the ICMJE Form for Disclosure

of Potential Conflicts of Interest.; IPK has a patent related to vitamin D measurement (PCT/ NL2012/050849) pending; all other authors declare that they have no conflict of interest.

Proefschrift_final_zonder.indd 81 22-10-15 15:08 4 Chapter 4

References Gotzsche PC, Vandenbroucke JP, et al. The Strengthening the Reporting of Observational 1. de Groot V, Beckerman H, Lankhorst GJ, Bouter Studies in Epidemiology (STROBE) Statement: LM. How to measure comorbidity. a critical review Guidelines for reporting observational studies. Int of available methods. J Clin Epidemiol 2003 J Surg 2014 Jul 18. Mar;56(3):221-229. 11. Sheehan DV, Lecrubier Y, Sheehan KH, Amorim P, 2. Agborsangaya CB, Ngwakongnwi E, Lahtinen M, Janavs J, Weiller E, et al. The Mini-International Cooke T, Johnson JA. Multimorbidity prevalence Neuropsychiatric Interview (M.I.N.I.): the in the general population: the role of obesity in development and validation of a structured Rchronic disease clustering. BMC Public Health diagnostic psychiatric interview for DSM-IV and 2013 Dec 10;13:1161-2458-13-1161. ICD-10. J Clin Psychiatry 1998;59 Suppl 20:22- 33;quiz 34-57. 3. Diederichs C, Berger K, Bartels DB. The measurement of multiple chronic diseases--a 12. Stolk RP, Rosmalen JG, Postma DS, de Boer RA, systematic review on existing multimorbidity Navis G, Slaets JP, et al. Universal risk factors indices. J Gerontol A Biol Sci Med Sci 2011 for multifactorial diseases: LifeLines: a three- Mar;66(3):301-311. generation population-based study. Eur J Epidemiol 2008;23(1):67-74. 4. Sorensen HT. Multimorbidity and cancer outcomes: a for more research. Clin Epidemiol 13. Dawson-Hughes B, Heaney RP, Holick MF, Lips P, 2013 Nov 1;5(Suppl 1):1-2. Meunier PJ, Vieth R. Estimates of optimal vitamin D status. Osteoporos Int 2005 Jul;16(7):713-716. 5. Hilger J, Friedel A, Herr R, Rausch T, Roos F, Wahl DA, et al. A systematic review of vitamin D status 14. World Health Organization. International in populations worldwide. Br J Nutr 2014 Jan 14;111(1):23-45. Classification of Diseases. 2010; Available at: browse/2010/en. Accessed april, 2015. http://apps.who.int/classifications/icd10/ 6. Hossein-nezhad A, Holick MF. Vitamin D for health: a global perspective. Mayo Clin Proc 2013 15. Sachs MC, Shoben A, Levin GP, Robinson-Cohen C, Jul;88(7):720-755. Hoofnagle AN, Swords-Jenny N, et al. Estimating mean annual 25-hydroxyvitamin D concentrations 7. Pan A, Lucas M, Sun Q, van Dam RM, Franco OH, from single measurements: the Multi-Ethnic Manson JE, et al. Bidirectional association between Study of Atherosclerosis. Am J Clin Nutr 2013 depression and type 2 diabetes mellitus in women. Jun;97(6):1243-1251. Arch Intern Med 2010 Nov 22;170(21):1884- 1891. 16. Guessous I, McClellan W, Kleinbaum D, Vaccarino V, Zoller O, Theler JM, et al. Comparisons of serum 8. vitamin d levels, status, and determinants in Jul 19;357(3):266-281. populations with and without chronic kidney Holick MF. Vitamin D deficiency. N Engl J Med 2007 disease not requiring renal dialysis: a 24-hour 9. Giovannucci E. Epidemiology of vitamin D and urine collection population-based study. J Ren colorectal cancer. Anticancer Agents Med Chem Nutr 2014 Sep;24(5):303-312. 2013 Jan;13(1):11-19. 17. Annweiler C, Schott AM, Rolland Y, Beauchet O. 10. von Elm E, Altman DG, Egger M, Pocock SJ,

Vitamin D deficiency is associated with orthostatic 82

Proefschrift_final_zonder.indd 82 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

hypotension in oldest-old women. J Intern Med diseases: hype and reality. Food Funct 2012 2014 Sep;276(3):285-295. Aug;3(8):784-794.

18. Schottker B, Jorde R, Peasey A, Thorand B, Jansen 27. Ghaly S, Lawrance I. The role of vitamin D in EH, Groot L, et al. Vitamin D and mortality: meta- analysis of individual participant data from a large Gastroenterol Hepatol 2014 Jul 22:1-15. gastrointestinal inflammation. Expert Rev consortium of cohort studies from Europe and the United States. BMJ 2014 Jun 17;348:g3656. 28. Meems LM, van der Harst P, van Gilst WH, de Boer RA. Vitamin D biology in heart failure: molecular 19. Gonzalez-Rodriguez LG, Estaire P, Penas-Ruiz mechanisms and systematic review. Curr Drug C, Ortega RM, UCM Research Group VALORNUT Targets 2011 Jan;12(1):29-41. (920030). Vitamin D intake and dietary sources in a representative sample of Spanish adults. J Hum 29. Mandia D, Ferraro OE, Nosari G, Montomoli C, Nutr Diet 2013 Jul;26 Suppl 1:64-72. Zardini E, Bergamaschi R. Environmental factors and multiple sclerosis severity: a descriptive 20. Wang Y, Zhu J, DeLuca HF. Where is the vitamin study. Int J Environ Res Public Health 2014 Jun D receptor? Arch Biochem Biophys 2012 Jul 19;11(6):6417-6432. 1;523(1):123-133. 30. Zhang LL, Gong J, Liu CT. Vitamin D with asthma 21. Barnett K, Mercer SW, Norbury M, Watt G, Wyke and COPD: not a false hope? A systematic review S, Guthrie B. Epidemiology of multimorbidity and and meta-analysis. Genet Mol Res 2014 Feb implications for health care, research, and medical 13;13(3):7607-7616. education: a cross-sectional study. Lancet 2012 Jul 7;380(9836):37-43. 31. Autier P, Boniol M, Pizot C, Mullie P. Vitamin D status and ill health: a systematic review. Lancet 22. Diabetes Endocrinol 2014 Jan;2(1):76-89. D, Satariano WA, van den Bos GA. Causes and Gijsen R, Hoeymans N, Schellevis FG, Ruwaard consequences of comorbidity: a review. J Clin 32. Amrein K, Schnedl C, Holl A, Riedl R, Christopher Epidemiol 2001 Jul;54(7):661-674. KB, Pachler C, et al. Effect of high-dose vitamin

D3 on hospital length of stay in critically ill 23. expenditures, and complications of multiple ICU randomized clinical trial. JAMA 2014 Oct Wolff JL, Starfield B, Anderson G. Prevalence, patients with vitamin D deficiency: the VITdAL- chronic conditions in the elderly. Arch Intern Med 15;312(15):1520-1530. 2002 Nov 11;162(20):2269-2276. 33. Cauley JA, Chlebowski RT, Wactawski-Wende J, 24. Schoen C, Osborn R. 2010 Commonwealth Fund Robbins JA, Rodabough RJ, Chen Z, et al. Calcium International health policy survey. Available at: plus vitamin D supplementation and health www.commonwealthfund.org/surveys/2010/ Nov/2010-international-survey.aspx. Accessed ended: the Women’s Health Initiative. J Womens outcomes five years after active intervention April, 2015. Health (Larchmt) 2013 Nov;22(11):915-929.

25. Divo MJ, Martinez CH, Mannino DM. Ageing and 34. Manson JE, Bassuk SS, Lee IM, Cook NR, Albert the epidemiology of multimorbidity. Eur Respir J MA, Gordon D, et al. The VITamin D and OmegA-3 2014 Aug 19. TriaL (VITAL): rationale and design of a large randomized controlled trial of vitamin D and 26. marine omega-3 fatty acid supplements for the

Peterlik M. Vitamin D insufficiency and chronic 83

Proefschrift_final_zonder.indd 83 22-10-15 15:08 4 Chapter 4

primary prevention of cancer and cardiovascular disease. Contemp Clin Trials 2012 Jan;33(1):159- 171.

35. Charlson ME, Pompei P, Ales KL, MacKenzie CR. A new method of classifying prognostic comorbidity in longitudinal studies: development and validation. J Chronic Dis 1987;40(5):373-383.

36. Boeckxstaens P, Vaes B, Van Pottelbergh G, De Sutter A, Legrand D, Adriaensen W, et al. Multimorbidity measures were poor predictors

a prospective cohort study. J Clin Epidemiol 2015 of adverse events in patients aged >/=80 years: Feb;68(2):220-227.

37. KDIGO 2012 Clinical Practice Guideline for the Evaluation and Management of Chronic Kidney Disease. 2012; Available at: http://www.kdigo. org/clinical_practice_guidelines/pdf/CKD/ KDIGO_2012_CKD_GL.pdf. Accessed April, 2015.

Proefschrift_final_zonder.indd 84 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

Supplemental data and figures

Appendix I. Data collection in the LifeLines Cohort Study

Data collection. We obtained information from self-administered questionnaires (http://molgenis19. target.rug.nl/menu/main/protocolviewer) on smoking, alcohol consumption, education level, dairy consumption and physical activity. S a. Self-reported questionnaires (yes/no). Former smokers were those who reported no smoking in the previous month, but reported Participants were defined as current smokers if they reported any smoking in the previous month that they had smoked for longer than a year before they had stopped smoking. Participants were

longer than a year. defined as non-smokers if they reported no smoking in the previous month and never smoked for

Education was categorized into low (none, primary education up to those completing intermediate vocational education), moderate (higher secondary education) and high (higher vocational education and university).

We defined alcohol consumption as a function of drinks per day (light, moderate, and heavy). Male drinks, moderate drinkers if they reported 2-4 alcoholic consumptions per day and heavy drinkers participants were categorized as light drinkers if they reported a daily alcohol consumption of <2 if the daily intake exceeded 4 consumptions per day. Similarly, female participants were considered

light drinkers if they reported <1 alcoholic drink a day, moderate drinkers if they reported to drink 1-3 day. alcoholic consumptions a day and heavy drinkers if they reported an intake of >3 consumptions per

Participants were asked to report their milk and butter consumption during the previous month. Participants with low dairy consumption were those who reported no or rare dairy consumption during the last month. Participants who reported frequent or daily milk and butter intake during the previous month were considered to have a normal dairy consumption.

considered to have none/low physical activity if they reported being active during 30 minutes a day Physical activity of participants was classified as none/low, moderate or high. Participants were up to 1 day per week, moderate physical activity if they reported a daily activity of 30 minutes for 2-4 days a week, and high physical activity if they reported being active for 30 minutes a day, at least 5 days a week.

b. Clinical examination Following a standardized protocol, trained technicians measured each individual’s height and weight, as well as systolic and diastolic blood pressure. Body weight was measured without shoes with 0.1 kg precision. Height was measured to the nearest 0.5 cm. We calculated Body Mass Index (BMI) as weight (kg) divided by height squared (m2

). Participants were defined based on three categories of weight by 85

Proefschrift_final_zonder.indd 85 22-10-15 15:08 4 Chapter 4

30.0 kg/m2 2). Systolic and diastolic blood pressures were measured every World Health Organization BMI categories: normal (BMI<25.0 kg/m2), overweight (BMI ≥ 25.0 and < minute for a period of 10 minutes using an automated Dinamap Monitor (GE Healthcare, Freiburg, ) or obese (BMI ≥ 30.0 kg/m Germany). The size of the cuff was chosen according to the arm circumference. The average of the last three readings was recorded for each blood pressure parameter. The clinical examination was completed with prebronchodilator spirometry (FEV1, FEV1/FVC) performed in a standardized setting following ATS guidelines using Welch Allyn V.1.6.0.489, PC-based SpiroPerfect with CardioPerfect Workstation software and electrocardiography (ECG) (Welch Allyn V.1.6.0.489, MEANS algorithm).

c. Blood and urine analyses Blood sampling took place in the morning, after an overnight fast. Blood was collected in tubes containing heparin, EDTA or citrate, immediately followed by centrifugation. Next, blood was transported to the LifeLines central laboratory facility at room temperature or at 4°C, depending on the sample requirements. Hematology and chemistry analyses were performed at the clinical chemistry laboratory of the University Medical Center Groningen, unless reported differently. On the day of collection, serum levels of HDL and total cholesterol were measured using an enzymatic colorimetric method, triglycerides using a colorimetric UV method, and LDL using an enzymatic method, all on a Roche Modular P chemistry analyzer (Roche, Basel, Switzerland). Blood glucose was measured using a hexokinase method. Thyroid-stimulating hormone, thyroxine (T4) and triiodothyronine (T3) were measured using a Roche Modular A chemistry analyzer (Roche, Basel, Switzerland). Hemoglobin, as well as leukocyte and thrombocyte count was measured using a Sysmex XE 2100 analyzer (Sysmex, Kobe, Japan). Serum calcium, serum albumin, urine albumin and urine creatinine were measured using a Roche Modular P chemistry analyzer (Roche, Basel, Switzerland). Serum creatinine was measured using an enzymatic method on a Roche Modular P analyzer. Estimated

Collaboration equation (37). glomerular filtration rate (eGFR) was calculated using the Chronic Kidney Disease Epidemiology

Proefschrift_final_zonder.indd 86 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

Appendix II. An overview of diseases and disease domains in the Lifelines Cohort Study: a multidisciplinary, uniform approach to define multiple disease domains.

GENITOURINARY DISEASE Chronic bladder infection (XIV-N39) - Self-reported chronic bladder infection and use of anti microbial drugs

Male - Benign prostatic hypertrophy (BPH) (XIV-N40) o Use of BPH-related drugs

Female - Double ovary extirpation (XXI-Z90.7) o Self-reported surgical extirpation of 2 ovaries and use of female hormones

Anti microbial drugs= ATC-code G01, J01 BPH-related drugs= ATC-code G04C Female hormones= ATC-code G03C

Morbidity within the urogenital disease domain is present if one of the following diseases occur: - Chronic bladder infection - BPH - Double ovary extirpation

HEMATOLOGIC DISEASE Anemia (III-D50 until D64) - Self-reported anemia and use of iron supplementation or or

- Hb <6.0 if female - Hb<6.5 if male Thrombo-embolic disease - Self-reported thrombosis (IX-I82) and use of anti-thrombotic drugs - Self-reported lung emboli (IX-I26) and use of anti-thrombotic drugs - Self-reported bleeding disorder (III-D68.9) and use of anti-thrombotic drugs - Self-reported bleeding disorder (III-D68.9) and use of anti-hemorrhagic drugs

Optional - Thrombocytopenia (III-D69.3/D69.4/D69.4/D69.5/D69.6)

Proefschrift_final_zonder.indd 87 22-10-15 15:08 4 Chapter 4

- Thromobocytosis (III-D47.3) o Thromobocyte count <60*10E9/L

o Thrombocyte count >750*10E9/L Iron supplementation= ATC-code B03 Anti-thrombotic drugs= ATC-code B01AA, B01AB Anti-hemorrhagic drugs= ATC-code B02

Morbidity within the blood related disease domain is present if one of the following diseases occur: - Anemia - Thrombo-embolic disease

optional, inclusion of:

- Thrombocytopenia - Thrombocytosis

DERMATOLOGIC DISEASE Acne (XII-L70.9) - Self-reported severe acne and use of acne suppressor

Eczema (XII-L30.9) - Self-reported eczema and use of emollients and/or dermatological corticosteroids

Psoriasis (XII-L40.9) - Self-reported psoriasis and use of psoriasis suppressor

Acne suppressor= ATC-code D10 Emollients= ATC-code D02 Psoriasis suppressor= ATC-code D05

Morbidity within the dermatologic disease domain is present if one of the following diseases occur: - Acne - Eczema - Psoriasis

RENAL DISEASE Impaired renal function (XIV-N19) is present, if 2 2 - eGFR ≥ 60 ml/min/1.73m with albuminuria (24h albumin >30) - eGFR <60 ml/min/1.73m 88

Proefschrift_final_zonder.indd 88 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

Morbidity within the renal disease domain is present, if one of the following disease symptoms occurs: - Impaired renal function

MUSCULOSKELETAL DISEASE Arthrosis (XIII-M19.9) - Self-reported arthrosis and use of analgesics (paracetamol, NSAIDs, opiods) - Self-reported symptoms of pain in hands & feet and use of analgesics (NSAIDs, opiods) and use of analgesics (paracetamol, NSAIDs, opiods) - Self-reported symptoms of joint stiffness

Gout (XIII-M10) - Use of anti-gout medication

Osteoporosis (XIII-M81)

- Self-reported osteoporosis and use of calci chew D3 and bisphosponates

Rheumatoid Arthritis (XIII-M06.9) - Self-reported rheumatoid arthritis and use of NSAIDS/DMARDS/ TNF-alpha inhibitors/ IL inhibitors - Self-reported rheumatoid arthritis and use of B- and T-cell inhibitors and/or methothrexate and use of NSAIDS/DMARDS/ TNF-alpha inhibitor/ IL inhibitors - 2 or more self-reported symptoms of pain in hands & feet or joint stiffness and use of B- and T-cell inhibitors and/or methothrexate - 2 or more self-reported symptoms of pain in hands & feet or joint stiffness

Opiods= ATC-code N02A Paracetamol= ATC-code N02BE01 NSAIDs= M01AE, M01AB DMARDS = ATC- code M01

Biologicals: TNF-alpha inhibitor, IL inhibitors, B- and T-cell inhibitors: TNF-alpha inhibitor= ATC-code L04AB IL inhibitors= ATC-code L04AC B- and T-cell inhibitors= ATC-code LO4AA24, L01XC02 Methotrexate= ATC-code L01BA01 Anti-gout medication: ATC-code M04

Proefschrift_final_zonder.indd 89 22-10-15 15:08 4 Chapter 4

Morbidity within the musculoskeletal disease domain is present if one of the following diseases occur: - Rheumatoid arthritis - Arthrosis - Osteoporosis - Gout

OPHTALMOLOGIC AND EAR, NOSE AND, THROAT RELATED DISEASE Ophthalmic disease - Cataract (VII-H25/H26) or - Severe visual impairment (VII-H54.1)

ENT disease - Chronic sinusitis of throat and/or nose (X-J32) and use of local or systemic decongestive drugs - Severe hearing impairment (VIII-H90)

Decongestive drugs= ATC-code R01

Morbidity within the ophthalmologic and ENT-related disease domain is present if one of the following diseases occur: - Ophthalmic disease - ENT disease

PSYCHIATRIC DISEASE NB: The presence of (symptoms of) psychiatric diseases is based on outcomes from the MINI interview.

Depressive disorder (V-F32.0-33.0) and dysthymic disorder - Current depressive disorder or - Dysthemic disorder and use of antidepressants

Anxiety disorder (V-F40-F41) - Any anxiety disorder

Antidepressants= ATC-code N06A

Symptoms of morbidity within the psychiatric disease domain are present if one of the following diseases occur: - Current depressive disorder - Current anxiety disorder

Proefschrift_final_zonder.indd 90 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

ENDOCRINOLOGIC DISEASE Diabetes (IV-E10/E11/E12/E14) - Self-reported diabetes or - Use of oral anti-diabetics and/or insulin or or

- Fasting glucose levels >6.99 - Non-fasting glucose level >11.0 NB: we defined different types of diabetes and excluded diabetes related to pregnancy, but not to any (other) medical cause.

Thyroid disease (IV-E03/E05) - Use of thyroid hormones or or or - TSH>4 & FT4<11.0 (hypothyroidism)

- TSH>10 - TSH <0.5 & FT4>19.5 (hyperthyroidism) Hypercholesterolemia (IV-E78.0) or - Use of lipid lowering medication or - Self-reported myocardial infarction and cholesterol ≥5.0

- Cholesterol ≥6.5 mmol/L Oral anti-diabetics= ATC-code A10B Insulin= ATC-code A10A Thyroid hormones= ATC-code H03 Lipid lowering drugs= ATC-code C10A, C10B

Morbidity within the endocrinologic disease domain is present if one of the following diseases occur: - Diabetes - Thyroid disease - Hypercholesterolemia

CARDIOVASCULAR DISEASE Hypertension (IX-I10) is present, if or - Use of anti-hypertensive medication - BP> 140/90mmHG

Heart failure (IX-I50) is present, if - Self-reported disease, and - Use of (any) HF-related medication (diuretics, ACE-I, aldosteronantagonist, beta blocker, angiotensin receptor blocker)

Proefschrift_final_zonder.indd 91 22-10-15 15:08 4 Chapter 4

Vascular disease (IX-I21, IX-I25.2, IX-I64) is present, if - Self-reported MI, stroke, PCI & CABG, and - Use of vitamin K antagonists or ascal/acetylsalicylic acid or clopidogrel - Control: and use of (simva-)statin (however, 10% of this patient group does NOT use (simva-)statin)

Atrial fibrillation (IX-I48) is present, if - Self-reported, ‘diagnosed by MD’ and use of vitamin K antagonists, or - AF on ECG and use of vitamin K antagonists, or and AF on ECG

- CHADVASC<2 Pacemaker (XXI-Z95.0) - Self-reported

Heart transplant (XXI-Z94.1) - Self-reported

Anti-hypertensive medication= ATC-code C02, C03, C04, C07, C08, C09 Diuretics= ATC-code C03A, C03B, C03C, C03E, C03X Aldosteronantagonist= ATC-code C03D Beta blocker= ATC-code C07 Calcium antagonist= ATC-code C08 ACE-inhibitors and ANG II antagonists = ATC-code C09 Vitamin K antagonists = ATC-code B01AA Ascal = ATC-code B01AC06 Acetylsalicylic acid= ATC-code B01AC08 Clopidogrel= ATC-code B01AC04 Statin= ATC-code C10AA Simvastatin= ATC-code C10AA01

Cardiovascular disease is present, if one of the following diseases or disease symptoms occur: - Heart failure

- Pacemaker - Atrial fibrillation - Hypertension - Vascular disease - Heart transplant

PULMONARY DISEASE Asthma (X-J45) - doctors diagnosed asthma, or - 2 or more self-reported symptoms of: wheeze, attacks at rest, woken by an attack

Proefschrift_final_zonder.indd 92 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

and use of asthma/COPD medication, or - self-reported asthma and use of asthma/COPD medication

COPD (X-J44) NB: for diagnosis of we only included individuals with an age>40 years - If spirometry data is available, COPD is present if: or - if spirometry data is not available, COPD is present if: o GOLD classification: I-IV

o self-reported COPD & use of asthma/COPD medication & age>40 Chronic mucus hypersecretion (X-J42) - phlegm production during day or night, or immediately after waking up during at least 3 months/year

Chronic bronchitis (X-J40) - coughing/ phlegm production during the day or night, or immediately after waking up during at least 3 months/year

Asthma/COPD medication = ATC-code R03AC, R03CC, R03AK, R03BA, R03BB, R03BC01, R03BC03, R03DA04, R03DC

Morbidity within the respiratory disease domain is present if one of the following diseases or disease symptoms occur: - Asthma - COPD - Chronic mucus hypersecretion - Chronic bronchitis

CENTRAL NERVOUS SYSTEM DISEASE Dementia (V-F00/F01/F02/F03) - Self-reported dementia or or

- MMSE-score<24 if education level low/medium - MMSE-score<25 if education level high Migraine (VI-G43) - Self-reported migraine

Epilepsy (VI-G40) - Self-reported epilepsy and use of anti-epileptics

Back or neck hernia (XIII-51.2) - Self-reported back or neck hernia

Proefschrift_final_zonder.indd 93 22-10-15 15:08 4 Chapter 4

Parkinson’s disease (VI-G20) - Self-reported Parkinson’s disease and use of anti-Parkinson’s drugs

Multiple Sclerosis (VI-G35) - Self-reported multiple sclerosis

Anti-epileptics = ATC-code N03 Anti-parkinson’s drugs= ATC-code N04BC02, ATC-code N04BB01, ATC-code N04BC07, ATC-code N04BX02, ATC-code N04BA02, ATC-code N04BC05, ATC-code N04BD02, ATC-code N04BC04, ATC- code N04BC09, ATC-code N04BD01, ATC-code N04BX01

Morbidity within the central nerve system disease domain is present if one of the following diseases occur: - Dementia - Migraine - Epilepsy - Back or neck hernia - Parkinson’s disease - Multiple sclerosis

GASTRO INTESTINAL DISEASE History of liver disease - Non-alcoholic fatty liver disease (NAFLD) (XI-K75.8):

- Alcoholic fatty liver disease (AFLD) (XI-K70.0): o HSI>36 & no alcohol consumption

o HSI>36 & alcohol consumption NB: HSI= 8 * (ALT/AST) + BMI (+2 if female) (+2 if diabetes mellitus)

History of bowel disease - Ulcerative Colitis (XI-K51): o Self-reported, - Morbus Crohn (XI-K50): o Self-reported - Celiac Disease (XI-K90): o Self-reported celiac disease and o Gluten free diet - Optional, Irritable Bowel Syndrome (XI-K58): o Self-reported

Proefschrift_final_zonder.indd 94 22-10-15 15:08 Low levels of vitamin D are associated with multimorbidity: results from the LifeLines Cohort Study

History of gastric disease - Ulcus Pepticum (XI-K25): o Self-reported and

o Use of H2-antagonists, prostaglandins, protonpumpinhibitors (PPI) - Symptoms of gastric disease (XVIII-R10/R11/R12/R13): o Self-reported complaints: heart burn, stomach pain, nausea, vomiting, and o use of H -antagonists, prostaglandins, PPI 2 reflux

H2-antagonists, prostaglandins, PPI = ATC code A02B

Morbidity within the gastrointestinal disease domain is present if one of the following diseases symptoms occurs: - NAFLD or AFLD - Ulcerative Colitis - Morbus Crohn - Celiac disease - Ulcus pepticum - Symptoms of gastric disease

Supplemental Figure 1 - Flow-chart on inclusion and selection of the study population.

Proefschrift_final_zonder.indd 95 22-10-15 15:08 Proefschrift_final_zonder.indd 96 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

Laura M.G. Meems, MSc; Megan V. Cannon, MSc; Hasan Mahmud, PhD; Adriaan A. Voors, MD, PhD; Wiek H. van Gilst, PhD; Herman H.W. Silljé, PhD; Willem P.T. Ruifrok, MD, PhD; Rudolf A. de Boer, MD, PhD

University of Groningen, University Medical Center Groningen, Department of Cardiology, The Netherlands. Chapter Proefschrift_final_zonder.indd 97 522-10-15 15:08 5 Chapter 5

Abstract Activation of the vitamin D-vitamin D receptor (VDR) axis has been shown to reduce blood pressure and left ventricular (LV) hypertrophy. Besides cardiac hypertrophy,

cardiac fibrosis is a key element of adverse cardiac remodeling. We hypothesized dysfunction in an established murine model of cardiac remodeling. that activation of the VDR by paricalcitol would prevent fibrosis and LV diastolic

hypertrophy. Mice were treated with paricalcitol, losartan, or a combination of both Mice were subjected to transverse aortic constriction (TAC) to induce cardiac for a period of four consecutive weeks.

The fixed aortic constriction caused similar increase in blood pressure, both in weight compared to sham operated animals (10.2±0.7 untreated and paricalcitol- or losartan-treated mice. TACvs. significantly increased LV Administration of either paricalcitol (10.5±0.7), losartan (10.8±0.4), or a combination 6.9±0.3 mg/mm, p<0.05).

mice undergoing TAC (5.9±1.0 of both (9.2±0.6) did not reducevs. LV weight. Fibrosis was significantly increased in sham 2.4±0.8%, p<0.05). Treatment with losartan and paricalcitolvs. reduced fibrosis (paricalcitol 1.6±0.3% and losartan 2.9±0.6%, both with improved indices of LV contraction and relaxation, e.g. dPdtmax and dPdtmin p<0.05 TAC). This reduction in fibrosis in paricalcitol treated mice was associated and lower LV end diastolic pressure, and relaxation constant Tau. Also, treatment

III and TIMP-1. with paricalcitol and losartan reduced mRNA expression of ANP, fibronectin, collagen

and preserves diastolic LV function due to pressure overload in a mouse model. This Treatment with the selective VDR activator paricalcitol reduces myocardial fibrosis

ANP and several other tissue markers. is associated with a reduced percentage of fibrosis and a decreased expression of

Proefschrift_final_zonder.indd 98 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

Introduction Heart failure (HF) is a progressive condition involving activation of regulatory systems like the sympathetic nervous system (SNS) and the renin-angiotensin system (RAS) (1). It has become apparent that deregulated vitamin D homeostasis may be of considerable importance for the cardiovascular (CV) system. Patients with CV disease in general, and

with HF in particular, often have vitamin D deficiency (2,3). We and others have reported that vitamin D deficiency is associated with a poor prognosis in HF (2,4). The vitamin D receptor (VDR) is a nuclear hormone receptor that specifically binds to vitamin D and deletion of the VDR is associated with cardiac hypertrophy (7,8). Various mechanisms is expressed in (human, rat and murine) heart tissue (5,6). Systemic and cardiospecific have been proposed to explain the association between VDR signaling and myocardial hypertrophy. It has been shown that vitamin D is a negative transcriptional regulator of renin by binding the VDR (7,8,10). Furthermore, vitamin D has been linked to pro- hypertrophic pathways (9) and natriuretic peptide expression (11,12). So, the vitamin D-VDR axis may be a target for therapy in HF. Evidence for this hypothesis was obtained in experimental pharmacological studies, using paricalcitol, a selective vitamin D receptor activator, which was shown to exert anti-hypertrophic effects and to attenuate adverse cardiac remodeling in hypertensive rat models (13-15). Altogether, these data suggest a potentially important role of the vitamin D-VDR axis in cardiac remodeling and hypertrophy. It remains unclear if VDR activation may reduce LV hypertrophy independent of blood pressure. Furthermore, VDR activation has been best studied for its putative effects on

the matricellular matrix have also been observed (14). We therefore evaluated the effects of myocytic remodeling, however, besides the antihypertrophic effects, beneficial effects on paricalcitol in an established experimental model of cardiac hypertrophy, namely transverse

aortic constriction (TAC), and focused on the anti-fibrotic effects of paricalcitol. 99

Proefschrift_final_zonder.indd 99 22-10-15 15:08 5 Chapter 5

Materials and Methods Animals. We studied 10 week old male C57Bl/6J mice (Harlan, The Netherlands). Animals were housed under standard conditions. All animal studies were approved by the Animal Ethical Committee of the University of Groningen, The Netherlands, and conducted in accordance with existing guidelines for the care and use of laboratory animals.

Experimental procedures. ). After opening the thorax between Mice were subjected to transverse2 aortic constriction (TAC). In the second and third rib, the aorta was constricted at the aortic arch between both carotid brief, mice were anesthetized using isoflurane (2% in O arteries and sutured onto a 27-gauge needle with a 7.0 nylon suture. Immediately thereafter the needle was removed, creating a reproducible stenosis of the aorta about 50%. Control

of the aorta without ligation of the aorta; the suture was removed instead of knotted. All mice were subjected to a sham procedure. Sham operations were performed by isolation animals were treated with analgesia (carprofen) for 48 hours.

Design of the study. After TAC or sham surgery, a subset of the mice was treated with

paricalcitol, a selective vitamin D receptor activator (provided by Abbott, Deerfield, IL, USA), which activates the VDR, at a final dose of 300 ng/kg/day. Paricalcitol was dissolved in a with paricalcitol (or vehicle only) three times per week on Monday, Wednesday and Friday 95% propylene glycol and 5% ethyl alcohol solution. Mice were intraperitoneally injected

for five consecutive weeks. We also included an established anti-hypertrophic and anti- fibrotic treatment, namely the angiotensin II receptor blocker (ARB) losartan. Previous experiments have shown it is feasible and efficacious to dissolve losartan in the drinking water at a concentration of 30 mg/kg/day (15); mice were treated for five consecutive weeks. So, in total eight groups were studied. Sham (n=10), TAC (n=10), Sham+losartan (Sham-los, n=10), TAC+losartan (TAC-los, n=10), Sham+paricalcitol (Sham-pari, n=10), TAC+paricalcitol (TAC-pari, n=10), Sham+paricalcitol+losartan (Sham-combi, n=10) and TAC+paricalcitol+losartan (TAC-combi, n=10). Enzyme-linked immunosorbent assay (ELISA). Parathyroid hormone (PTH) was analyzed in plasma using a commercial Enzyme Linked Immunosorbent Assay according to manufacturer’s protocol (mouse intact PTH ELISA Kit, #60-2300, Immunotopics Inc, San Clemente, CA).

Plasma Aldosterone (pg/mL) was analyzed using a commercial Enzyme Linked Immunosorbent Assay according to manufacturer’s protocol (mouse intact Aldosterone ELISA Kit, ABIN367767, Antikoerper, Aachen, Germany).

100

Proefschrift_final_zonder.indd 100 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

Echocardiography and hemodynamic measurements. Two (data not shown) and four weeks

a transthoracic echocardiography with a 14 MHz transducer (Vivid 7, GE Healthcare, (before sacrifice) after TAC or sham surgery, echocardiography was performed using

and body temperature was maintained by placing the mouse on a heating pad. Short-axis Diegem, Belgium), as described previously (17). Mice were anaesthetized (2% isoflurane) view and M-mode tracings were used to measure cardiac hypertrophy and dimensions.

Echocardiographic data at sacrifice are shown in the supplemental data.

pressure tip catheter (Millar Instruments, Houston, TX, USA), that is introduced in the right Furthermore, prior to sacrifice, hemodynamic function was measured, using an indwelling carotid artery and advanced into the LV as described previously (18). First, blood pressure was recorded in the aortic arch, proximal to the aortic constriction. Then, once advanced into the LV, dPdtmax and dPdtmin, as indices of LV contraction and relaxation, were measured. Furthermore, intracardiac pressures including LV end diastolic (LVEDP) and end systolic (LVESP) were recorded. Tau, an isovolumetric relaxation constant, was measured according to the Glantz method.

After measuring invasive hemodynamics, blood was drawn via cardiac puncture and hearts were rapidly excised and weighed. Myocardial tissue was dissected transversally and processed for immunohistochemistry or snap frozen for molecular analyses.

Immunohistochemistry.

To measure fibrosis score, Masson’s trichrome staining was scanned by a scanning system, ScanScope (Aperio Technologies, Vista, CA, USA). Total performed on paraffin sections of all experimental animals. Whole stained sections were

section and expressed as percentage of total area. fibrosis was calculated automatically by the software under 20x magnifications for entire

To measure capillary density and cardiomyocyte size, endothelial cells were stained with

label, red, cell membranes green and nuclei blue. Tissuefaxs was used to photograph the CD31 (PECAM-1, BD-Pharm, #550274). CD31 positive cells stain, depending on fluorescent complete sections. Tissuefaxs software allows standardized counting of nuclei and the amount of capillaries by use of counting and measuring-macros in ImageJ. Number of capillaries was measured per mm2. Cardiomyocyte size is expressed as cross sectional area (CSA).

Quantitative real-time PCR. Total RNA from LV tissue was extracted using TRIzol reagent (Invitrogen Corporation, Carlsbad, CA, USA). cDNA synthesis and quantitative real time PCR (RT-qPCR) were performed as previously described with using 0.5 µg total RNA (19). mRNA

101

Proefschrift_final_zonder.indd 101 22-10-15 15:08 5 Chapter 5

levels were expressed in relative units based on a standard curve obtained with serial dilutions of a calibrator cDNA mixture. To normalize expression data, reference genes were used (GAPDH, 36B4). A list of primers is displayed in the supplemental data. We assayed

processes including tissue repair, collagens I and III, and atrial natriuretic peptide (ANP), an transcript abundance of fibronectin, a connective tissue marker involved in many cellular established marker of cardiac remodeling.

Statistical analysis. Results are reported as means±SEM. Statistical analysis among groups was performed by ANOVA with the Dunnett post hoc test if distributed normally or with the Kruskall-Wallis test followed by Mann-Whitney U test when skewed distributed. All p values are two-tailed and p using SPSS version 18.0 software (SPSS, Chicago, IL, USA). values <0.05 were considered significant. All analyses were performed

Results Paricalcitol and losartan did not exert any effects in the sham operated mice (Sham-los, Sham-pari and Sham-combi groups); data from these groups are not shown.

Paricalcitol effectively activates the VDR.

Administration of paricalcitol significantly reduced the PTH levels, both in the TAC-pari (34±10 mmol/l, p<0.05) and in the TAC-combi (25±7 Administration of losartan did not exert any effect on the PTH levels. Administration of mmol/l, p<0.05) groups compared to TAC only mice (246±45 mmol/l) (Figure 1A).

the TAC-los and TAC-combi groups compared to the sham group, (2.4±0.6 and 3.3±1.2 vs. losartan was associated with a non-significant increase in renal renin mRNA expression in

1.0±0.1 respectively, p=NS) (Figure 1D). Transverse aortic constriction results in left ventricular hypertrophy and hypertension. vs.

TAC significantly increased LV weight compared to sham operated animals (10.2±0.7 of either paricalcitol (10.5±0.7 mg/mm) or losartan (10.8±0.4 mg/mm) or a combination of 6.9±0.3 mg/mm, p<0.05, LV weight normalized to tibia length) (Figure 2). Administration

Mean arterial pressure (MAP) (Table 1), measured in the aortic arch before the constriction paricalcitol and losartan (9.2± 0.6 mg/mm) did not significantly reduce LV weight.

mice treated with the combination (paricalcitol+losartan) tended to have lower MAP was significantly increased by TAC. Neither treatment significantly lowered MAP, although

(p=0.08). Paricalcitol prevents LV dysfunction. Table 1 shows body weight, organ weights, and

hemodynamic data at sacrifice. TAC surgery causes typical changes of LV diastolic 102

Proefschrift_final_zonder.indd 102 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

dysfunction, as expressed by decreased dPdtmax and dPdtmin, increased LVEDP and increased Tau. Echocardiography (supplemental data) shows that systolic function is relatively preserved. Treatment with paricalcitol, losartan or the combination normalized

dPdtmax and dPdtmin. LVEDP was not significantly decreased by paricalcitol; however, decreased Tau, compared to TAC mice, and in the TAC combi group, Tau was decreased even the combination treatment normalized LVEDP. Treatment with paricalcitol significantly further.

Figure 1 - Downstream targets of paricalcitol and losartan treatment. A. levels of parathyroid hormone (PTH) in the different treatment groups. Treatment with the selective vitamin D receptor activator paricalcitol

mRNA levels of PTH receptor in the heart. D. mRNA levels of renin in the kidney. Treatment with losartan (los) (pari) significantly decreased PTH levels in blood. B. levels of aldosterone in the different treatment groups. C.

vs. sham, non-significantly increased the expression of renin mRNA in the kidney. TAC = transverse aortic constriction, vs. combi = treatment with both paricalcitol and losartan. All data are presented as mean±SEM. * p<0.05 # p<0.05 TAC, n=7-11 hearts per group.

103

Proefschrift_final_zonder.indd 103 22-10-15 15:08 5 Chapter 5

Table 1 -

Body weight, organSham weights, and hemodynamicTAC data at sacrificeTAC-los TAC-pari TAC-combi (n=8-16) (n=6-13) (n=8-15) (n=8-10) (n=8-12)

BW (g) 27.1±0.6 26.6±0.7 27.9±0.3 28.4±0.5 28.5±0.5

LV weight (mg) 120±4.7

HW (mg) 175±7.7 179±11.4 * 187±6.2 * 185±11.6 * 173±7.8 *

TL (mm) 17.3±0.3 220±12.617.2±0.4 * 248±10.117.3±0.2 * 243±15.517.7±0.1 * 222±11.417.8±0.1 *

HR (bpm) 489±17 513± 8 518± 6

SBP (mmHg) 98±2 576± 17 *# 551±18 *

DBP (mmHg) 65±2.4 136±9 * 137±564±4 * 130±763±4 * 125±961±6 *

MAP (mmHg) 76±2 72±3 * 85±5 81±3

LVEDP (mmHg) 4.7±1.6 94±4 * 8.8±1.888±4 * # 6.8±2.8 #

dPdtmax (mmHg/s) 7351±381 18.7±1.5 * 7333±190 # 7627±4849.8±2.3 * # 8448±528 #

dPdtmin (mmHg/s) -6331±537 5907±467 * -5694±226 # -6967±402 #

Tau (ms) 16.4±2.5 -4757±278 * 17.6±1.0 # 15.3±1.8 # -7984±50211.4±2.1 # *#

19.9±1.3 *

TAC = transverse aortic constriction, los = losartan, pari = paricalcitol, combi = treatment with both paricalcitol and losartan, BW = body weight, LV = left ventricle, HW = heart weight, TL = tibia length, HR = heart rate, bpm = beats per minute, SBP = systolic blood pressure, DBP = diastolic blood pressure, MAP = mean arterial pressure, relaxation of the left ventricle, Tau is an isovolumetric relaxation constant, measured according to the Glantz LVEDP = left ventricular end diastolic pressure, dPdtmax and dPdtmin are indices of maximal contraction and vs. vs. TAC-los or TAC-pari or TAC-comb method. All data are presented as means±SEM. * p<0.05 Sham TAC (any condition), # p<0.05 TAC

Non-myocytic effects of paricalcitol: effects on fibrosis and angiogenesis. TAC resulted in a 1.5-fold increase in number of capillaries in the myocardium (Figure 3A). Neither treatment

regimen significantly affected capillary density, however the increase of capillaries was increase in cardiomyocyte size is present in the TAC animals (1.01±0.2 vs. sham 0.65±0.1, lower in TAC groups treated with paricalcitol, losartan or both. Thereby, a significant

p<0.05).

increased in mice undergoing TAC (5.9±1.0 vs. Fibrosis was measured in the LV by Masson staining (Figure 3C). Fibrosis was significantly sham 2.4±0.8%, p<0.05). Treatment with vs. TAC). losartan, and especially paricalcitol, reduced the percentage of fibrosis (paricalcitol 1.6±0.3% and losartan 2.9±0.6%, both p<0.05

104

Proefschrift_final_zonder.indd 104 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

Figure 2 - Left ventricular weight (LV) normalized to tibia length.

TAC = transverse aortic constriction, vs. los = losartan, pari = paricalcitol, combi = treatment with both paricalcitol and losartan. Data are presented as mean±SEM. * p<0.05 sham, n=12-16 hearts per group.

Figure 3 - A. number of capillaries in the left ventricle measured per mm2. B: cardiomyocyte size in the left ventricle. C: percentage of fibrosis in the left ventricle.

TAC = transverse aortic constriction, los = vs. vs. losartan, pari = paricalcitol, combi = treatment with both paricalcitol and losartan. All data are presented as mean±SEM. * p<0.05 sham, # p<0.05 TAC, n=4-5 hearts per group. 105

Proefschrift_final_zonder.indd 105 22-10-15 15:08 5 Chapter 5

Figure 4 - mRNA expression of different genes. A. atrial natriuretic peptide (ANP). B. Fibronectin. C. collagen I.

D. collagen III. E. TIMP-1. mRNA expression is expressed as fold change. TAC = transverse aortic constriction, los vs. vs. = losartan, pari = paricalcitol, combi = treatment with both paricalcitol and losartan. All data are presented as mean±SEM. * p<0.05 sham, # p<0.05 TAC, n=4-8 hearts per group.

106

Proefschrift_final_zonder.indd 106 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

Paricalcitol reduces mRNA expression of ANP, fibronectin and collagen III. ANP mRNA

expression was significantly higher in TAC mice (7.6±2.3 fold, p<0.05) compared to sham group compared to the TAC mice (3.2±0.4 vs. mice. After treatment with paricalcitol, ANP was decreased significantly in the TAC-pari 7.6±2.3 fold, p<0.05).

mRNA expression of fibronectin was increased in TAC compared to sham (4.1±1.4 fold, (1.5±0.3 vs. p<0.05). Fibronectin was normalized in the TAC-pari group as compared to the TAC group 4.1±1.4 fold, p<0.05). Collagen III was also significantly increased in the TAC collagen mRNA expression in the TAC-pari group compared to the TAC group (1.9±0.2 mice, compared to sham mice (3.1±0.7 fold, p<0.05). Treatment with paricalcitol reduced vs.

3.1±0.7 fold, p<0.05). The mRNA expression of TIMP-1 (tissue inhibitor-1 of matrix vs. untreated TAC). metalloproteases) increased significantly in the TAC mice, compared to sham mice (9.4 fold p< 0.01) and this was reduced by paricalcitol, losartan or both (P<0.05 Again, treatment with paricalcitol reduced collagen mRNA expression in the TAC-pari group compared to the TAC group (9.4±3.9 vs.

3.7±1.1 fold, p< 0.05). Treatment with losartan showed similar results compared to treatment with paricalcitol, but a combination of both treatments did not further decrease the gene expression of matricellular proteins. Treatment with losartan showed similar results compared to treatment with paricalcitol, but a combination of both treatments did not further decrease the gene expression of matricellular proteins.

Discussion

The main findings of our study are that administration of paricalcitol is associated with Thereby, it effectively improves diastolic function in a well-established murine model a reduction in cardiac fibrosis and lower expression of pro-fibrotic genes in the heart. of pressure overload. These effects are comparable with the ARB losartan. Combined

treatment of paricalcitol and losartan did not further ameliorate fibrosis or LV dysfunction. without effects on systemic blood pressure. These beneficial effects were observed without clear effects on myocardial hypertrophy, and

Our results suggest that activation of the VDR axis may be particularly important in HF with

disease, with high prevalence and poor outcome, and without rational therapy (19). preserved ejection fraction (HFPEF). HFPEF is more and more recognized as an important

impaired LV relaxation. Although the precise pathophysiology of HFPEF remains unclear, HFPEF is characterized by preserved LV systolic function, increased filling pressures and

107

Proefschrift_final_zonder.indd 107 22-10-15 15:08 5 Chapter 5

it has become evident that markers of matrix turnover are increased in HFPEF patients

(20), and they may help in prognostication of patients (21,22) and that myocardial fibrosis adds to myocardial stiffness, common in HFPEF (23). In HFPEF, biomarkers of fibrosis are launched (24). increased, and a recently a trial in patients with HFPEF with an anti-fibrotic agent has been

Fibrosis is acknowledged as a key mediator in adverse cardiac remodeling and may be

a feasible target for therapy (25-27). Vitamin D inhibits renal myofibroblast activation, models, the use of paricalcitol was accompanied by reduced glomerulosclerosis and renal and reduces production of matricellular proteins (28). Likewise, in various renal injury

fibrosis (29-31). Also in the heart, it has been suggested that paricalcitol may reduce cardiac fibrogenesis (14) in a study presenting data of a gene array experiment, showing that a (MMPs) and tissue inhibitors of MMPs (TIMPs). It was previously suggested that VDR cluster of fibrotic genes was regulated by paricalcitol, including matrix metalloproteinases may be an important regulatory receptor for MMP gene expression (32). However, for

myocardial fibrosis, the data are less convincing. In a rat model of 5/6 nephrectomy, a cardiorenal model that provokes myocardial remodeling including fibrosis, it was shown et al. (13) also showed no effects on cardiac that that paricalcitol does not reduce but rather aggravates myocardial fibrosis and profibrotic gene expression (33,34). Bodyak fibrosis in their study in hypertensive rats. So, the precise role of paricalcitol in myocardial fibrogenesis remains to be proven. In our current study, we do show that paricalcitol reduces myocardial fibrosis. This was accompanied by decreases in fibrotic genes, such as fibronectin (previously reported in kidney injury (26,30)) and collagen type III (as reported in kidney injury models (28,30)). It may be clear that LV hypertrophy was not affected by treatment with paricalcitol; however other changes typically seen in adverse cardiac remodeling were affected by paricalcitol. First, ANP, a hallmark gene in adverse remodeling, was reduced by paricalcitol, despite neutral effects on LV hypertrophy and blood pressure. It has been shown that vitamin D through binding to the VDR is a negative regulator of the ANP gene (11,12,35), so

to cardiac stress. On the other hand, paricalcitol (or losartan) did not increase the numbers that this possibly reflects a direct transcriptional effect rather than regulation in response

of myocyte hypertrophy, has been shown to play a role in the transition from compensated of myocardial capillaries. Insufficient cardiac angiogenesis, not keeping pace with the rate to decompensated cardiac hypertrophy (36,37). Early, compensated hypertrophy, as in our model, is associated with compensatory angiogenesis (36,37).

Vitamin D homeostasis involves many more factors than vitamin D alone. Vitamin D

108

Proefschrift_final_zonder.indd 108 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

hyperparathyroidism are associated with CV pathology (39-43). Chronic PTH elevation deficiency leads to secondary hyperparathyroidism (38) and both primary and secondary is increasingly being viewed as maladaptive because of its direct hypertrophic effect on

vitamin D dependent is uncertain (45). cardiomyocytes and its pro-fibrotic effects (44). However, to what extent PTH-related risk is

(and the combination therapy losartan + paricalcitol). Treatment with losartan alone did In our study, serum PTH-levels were significantly reduced in mice treated with paricalcitol

not result in a significant decrease of serum PTH-levels. However, paricalcitol and losartan treatment exerted identical anti-fibrotic effects. Altogether, we suggest that in our study paricalcitol and not to PTH. Although we could not establish a clear relation between PTH of pressure overload the beneficial effects on myocardial structure are accountable to

be taken into account in the study of the vitamin D receptor analogues. and fibrosis, however, we suggest, in general, that the reciprocal suppression of PTH should

Mounting evidence points to a relevant relation between aldosterone and PTH in the pathogenesis of heart failure (46). It has been shown that PTH concentration dose- dependently increases aldosterone, suggesting a cause-effect relationship between hyperaldosteronism and hyperparathyroidism (47-50).

In our study, we did not detect a clear relationship between PTH and aldosterone. Clearly, the administration with (very high dose) paricalcitol strongly suppressed PTH. However, it could be argued that the PTH-vitamin D biology is no longer physiological in this extreme model, and hence the relationship between aldosterone and PTH has become perturbed. PTH could also exert direct effects on the heart and the cardiovascular system via its PTH receptor. PTH receptors are expressed in vascular smooth muscle cells, endothelial cells and cardiomyocytes (51) and cardiac PTH receptor signaling has been associated with sympathetic tone in the heart (52). However, given the observation that PTH receptor was not regulated in our model of cardiac remodeling nor by any intervention, we suggest that

PTH receptor signaling is unlikely a major factor in explaining our results. Our data may suggest dissociation between LV hypertrophy and LV relaxation, since paricalcitol improved LV relaxation while leaving LV hypertrophy unaffected. Nevertheless, our data clearly do not preclude a role of LVH on outcome and LV function. Such dissociation between LVH and LV function and outcome has been reported before. For instance, in the LIFE study (losartan vs. atenolol) dissociation between (modest) reduction in LVH and substantial reduction in event rate has been described (53). Likely, the small effects on reduction of LVH were accompanied by substantial reduction in cardiac remodeling and

109

Proefschrift_final_zonder.indd 109 22-10-15 15:08 5 Chapter 5

fibrosis. However, it is very difficult to measure fibrosis or reduction of fibrosis in human was paralleled by an improvement of LV indices of diastolic function. We hypothesize studies, as there are only few surrogate parameters. In our study, the reduced fibrosis

dysfunction, and possibly HFPEF. A recently presented PRIMO study, by Thadhani and that paricalcitol may be a useful agent in the treatment of myocardial fibrosis, diastolic colleagues (54), showed, in line with our observations, that in patients with stage 3-4 chronic kidney disease (CKD), treatment with paricalcitol does not affect LV hypertrophy assessed by paired cardiac MRI measurements. On the other hand, treatment with paricalcitol in this clinical setting tended to preserve diastolic function, which is related

with a better clinical outcome. We suggest that in future clinical trials markers of LV fibrosis should be included as secondary efficacy outcomes. So, although previous studies in several rat models showed that treatment with paricalcitol results in less LV hypertrophy (14,15), our results are in line with the PRIMO trial. We believe that the anti-hypertrophic effects of paricalcitol should be studied further.

Conclusion and Clinical Perspectives In a well established murine model of pressure overload that leads to cardiac hypertrophy and remodeling, we show that the selective vitamin D receptor activator paricalcitol

hypertrophy was not decreased by paricalcitol. These data suggest that vitamin D receptor attenuated myocardial fibrogenesis and protected from diastolic dysfunction. LV activation may affect the remodeling process, which comprises a complex of changes of

cardiomyocytes and non-cardiomyocyte cells, such as fibroblasts. Nevertheless, from our data, it may be argued that in future clinical trials measures of LV fibrosis should be incorporated as secondary efficacy outcomes. Further studies (in rodents and humans) fraction. should address if this approach might benefit in heart failure with preserved ejection

Acknowledgments. This study was supported by Abbott (grant number A08-424 to RAdB and AAV), the Netherlands Heart Foundation (grant 2007T046 to RAdB) and the Innovational Research

916.10.117 to RAdB). Incentives Scheme program of the Netherlands Organization for Scientific Research (NWO VENI, grant

Disclosure of interest. RAdB and AAV received a research grant from Abbott; RAdB and AAV received honoraria (consultancy, speaker fees) from Abbott.

110

Proefschrift_final_zonder.indd 110 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

References Hypertrophy. Circulation. 2011 Oct 25;124:1838- 47. 1. Dzau VJ. Tissue renin-angiotensin system in myocardial hypertrophy and failure. Arch Intern 10. Kuipers I, van der Harst P, Navis G, van Genne L, Med. 1993;153(8):937-42. Morello F, van Gilst WH et al. Nuclear hormone receptors as regulators of the renin-angiotensin- 2. Liu LC, Voors AA, van Veldhuisen DJ, van der Veer aldosterone system. Hypertension. 2008;51:1442- et al. Vitamin D 8. status and outcomes in heart failure patients. Eur J E, Belonje AM, Szymanski MK Heart Fail. 2011;13:619-25. 11. Li Q, Gardner DG. Negative regulation of R the human atrial natriuretic peptide gene 3. Meems LM, van der Harst P, van Gilst WH, de Boer by 1,25-dihydroxyvitamin D3. J Biol Chem. RA. Vitamin D biology in heart failure: molecular 1994;269:4934-9. mechanisms and systematic review. Curr Drug Targets. 2011;12(1):29-41. 12. Wu J, Garami M, Cao L, Li Q, Gardner DG.

1,25(OH)2D3 suppresses expression and secretion 4. Zittermann A, Schleithoff SS, Tenderich G, of atrial natriuretic peptide from cardiac myocytes. Berthold HK, Körfer R, Stehle P. Low vitamin D Am J Physiol. 1995;268(6 Pt 1):E1108-13. status: a contributing factor in the pathogenesis of congestive heart failure? J Am Coll Cardiol. 13. Bodyak N, Ayus JC, Achinger S, Shivalingappa V, Ke 2003;41(1):105-12. Q, Chen YS et al. Activated vitamin D attenuates left ventricular abnormalities induced by dietary 5. Wu J, Garami M, Cheng T, Gardner DG. 1,25(OH)2 sodium in Dahl salt-sensitive animals. Proc Natl

vitamin D3, and retinoic acid antagonize Acad Sci USA. 2007;104:16810-5. endothelin-stimulated hypertrophy of neonatal rat cardiac myocytes. J Clin Invest. 1996;97:1577- 14. Kong J, Kim GH, Wei M, Sun T, Li G, Liu SQ et al. 88. Therapeutic effects of vitamin D analogs on cardiac hypertrophy in spontaneously hypertensive rats. 6. Zanello SB, Collins ED, Marinissen MJ, Norman Am J Pathol. 2010;177:622-31. AW, Boland RL. Vitamin D receptor expression in chicken muscle tissue and cultured myoblasts. 15. Bae S, Yalamarti B, Ke Q, Choudhury S, Yu H, Horm Metab Res. 1997;29:231-6. Karumanchi SA et al. Preventing progression of cardiac hypertrophy and development of heart 7. Li YC, Kong J, Wei M, Chen ZF, Liu SQ, Cao LP. failure by paricalcitol therapy in rats. Cardiovasc 1,25-Dihydroxyvitamin D(3) is a negative Res. 2011;91:632-9. endocrine regulator of the renin-angiotensin system. J Clin Invest. 2002;110:229-38. 16. et al. de Boer RA, van Geel PP, Pinto YM, Suurmeijer AJ, 8. Li YC, Qiao G, Uskokovic M, Xiang W, Zheng W, Kong II type 1 receptor blockade on reperfusion-induced Crijns HJ, van Gilst WH Efficacy of angiotensin J. Vitamin D: a negative endocrine regulator of the arrhythmias and mortality early after myocardial rennin-angiotensin system and blood pressure. J infarction is increased in transgenic rats with Steroid Biochem Mol Biol. 2004;89-90:387-92. cardiac angiotensin II type 1 overexpression. J Cardiovasc Pharmacol. 2002;39:610-9. 9. Chen S, Law CS, Grigsby CL, Olsen K, Hong TT, Zhang Y et al. 17. the Vitamin D Receptor Gene Results in Cardiac et al. Activation of Cardiomyocyte-Specific Deletion of Kuipers I, Li J, Vreeswijk-Baudoin I, Koster J, van der Harst P, Silljé HH 111

Proefschrift_final_zonder.indd 111 22-10-15 15:08 5 Chapter 5

liver X receptors with T0901317 attenuates I, McKinlay S, O’Meara E, Shaburishvili T, Pitt B, cardiac hypertrophy in vivo. Eur J Heart Fail. Pfeffer MA. Rationale and design of the Treatment 2010;12:1042-50. of Preserved Cardiac Function Heart Failure with an Aldosterone Antagonist Trial: A randomized, 18. Pacher P, Nagayama T, Mukhopadhyay P, Bátkai S, controlled study of spironolactone in patients with Kass DA. Measurement of cardiac function using pressure-volume conductance catheter technique fraction. Am Heart J 2011;162(6):966-972. symptomatic heart failure and preserved ejection in mice and rats. Nat Protoc. 2008;3(9):1422-34. 25. Booz GW, Baker KM. Molecular signaling 19. Lam CS, Donal E, Kraigher-Krainer E, Vasan RS. mechanisms controlling growth and function of Epidemiology and clinical course of heart failure 43. cardiac fibroblasts. Cardiovasc Res. 1995;30:537- 2011;13:18-28. with preserved ejection fraction. Eur J Heart Fail. 26. MacKenna D, Summerour SR, Villarreal FJ. Role 20. Krum H, Elsik M, Schneider HG, Ptaszynska A, of mechanical factors in modulating cardiac

McKelvie RS, McMurray JJ, Zile MR, Anand IS. synthesis. Cardiovasc Res. 2000;46:257-63. Black M, Carson PE, Komajda M, Massie BM, fibroblast function and extracellular matrix Relation of peripheral collagen markers to death and hospitalization in patients with heart failure 27. heart of myocardial remodeling. Pharmacol Ther. Porter KE, Turner NA. Cardiac fibroblasts: at the I-PRESERVE collagen substudy. Circ Heart Fail. 2009;123:255-78. and preserved ejection fraction: results of the 2011;4:561-8. 28. Li Y, Spataro BC, Yang J, Dai C, Liu Y. 21. Martos R, Baugh J, Ledwidge M, O’Loughlin C, 1,25-dihydroxyvitamin D inhibits renal Murphy NF, Conlon C et al. Diagnosis of heart hepatocyte growth factor expression. Kidney Int. interstitial myofibroblast activation by inducing accuracy with the use of markers of collagen 2005;68:1500-10. failure with preserved ejection fraction: improved turnover. Eur J Heart Fail. 2009;11:191-7. 29. Tan X, Li Y, Liu Y. Paricalcitol attenuates renal 22. de Boer RA, Lok DJ, Jaarsma T, van der Meer P, Voors AA, Hillege HL et al. Predictive value of Am Soc Nephrol. 2006;17:3382-93. interstitial fibrosis in obstructive nephropathy. J plasma galectin-3 levels in heart failure with 30. Tan X, He W, Liu Y. Combination therapy with 2011;43:60-8. paricalcitol and trandolapril reduces renal reduced and preserved ejection fraction. Ann Med.

23. van Heerebeek L, Hamdani N, Handoko ML, Falcao- 2009;76:1248-57. fibrosis in obstructive nephropathy. Kidney Int.

31. Park JW, Bae EH, Kim IJ, Ma SK, Choi C, Lee J Pires I, Musters RJ, Kupreishvili K, Ijsselmuiden AJ, A, van der Velden J, Stienen GJ, Laarman GJ, Niessen et al. Renoprotective effects of paricalcitol on Schalkwijk CG, Bronzwaer JG, Diamant M, Borbély HW, Paulus WJ. Diastolic stiffness of the failing Physiol Renal Physiol. 2010;298:F301-13. gentamicin-induced kidney injury in rats. Am J glycation end products, and myocyte resting diabetic heart: importance of fibrosis,advanced tension. Circulation 2008;117:43-51. 32. Rahman A, Hershey S, Ahmed S, Nibbelink K, Simpson RU. Heart extracellular matrix gene 24. Desai AS, Lewis EF, Li R, Solomon SD, Assmann SF, Boineau R, Clausell N, Diaz R, Fleg JL, Gordeev knockout mice. J Steroid Biochem Mol Biol. expression profile in the vitamin D receptor

112

Proefschrift_final_zonder.indd 112 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

2007;103:416-9. Parathyroid hormone has a prosclerotic effect on vascular smooth muscle cells. Kidney Blood Press 33. Repo JM, Rantala IS, Honkanen TT, Mustonen Res. 2003;26:26–33. JT, Kööbi P, Tahvanainen AM et al. Paricalcitol 43. Khouzam RN, Dishmon DA, Farah V, Flax SD, Carbone LD, Weber KT. Secondary aggravates perivascular fibrosis in rats with 2007;72:977-84. hyperparathyroidism in patients with untreated renal insufficiency and low calcitriol. Kidney Int. and treated congestive heart failure. Am J Med Sci. 34. 2006;331:30-4. et al. Left ventricular periostin Pohjolainen V, Rysä J, Näpänkangas J, Kööbi P, 44. Schluter KD, Piper HM. Trophic effects of Eräranta A, Ilves M catecholamines and parathyroid hormone on gene expression is associated with fibrogenesis Transplant. 2012 Jan;27:115-22. adult ventricular cardiomyocytes. Am J Physiol. in experimental renal insufficiency. Nephrol Dial 1992; 263: H1739-46. 35. PW, Haussler MR et al. Suppression of ANP gene 45. Anderson JL, Vanwoerkom RC, Horne BD, Bair TL, Chen S, Wu J, Hsieh JC, Whitfield GK, Jurutka transcription by liganded vitamin D receptor: hormone, vitamin D, renal dysfunction, and May HT, Lappé DL, Muhlestein JB. Parathyroid Hypertension. 1998;31:1338-42. cardiovascular disease: dependent or independent involvement of specific receptor domains. risk factors? Am Heart J. 2011;162:331-339.e2. 36. WS, Walsh K. Vascular endothelial growth 46. Tomaschitz A, Ritz E, Pieske B, Fahrleitner- Izumiya Y, Shiojima I, Sato K, Sawyer DB, Colucci factor blockade promotes the transition from Pammer A, Kienreich K, Horina JH, Drechsler C, compensatory cardiac hypertrophy to failure in response to pressure overload. Hypertension. and parathyroidhormone: a precarious couple März W, Ofner M, Pieber TR, Pilz S. Aldosterone 2006;47:887-93. for cardiovascular disease. Cardiovasc Res. 2012;94:10-9. 37. M, Liao R, Colucci WS, Walsh K. Disruption of 47. Rosenberg J, Pines M, Hurwitz S. Response of Shiojima I, Sato K, Izumiya Y, Schiekofer S, Ito coordinated cardiac hypertrophy and angiogenesis adrenal cells to parathyroid hormone stimulation. contributes to the transition to heart failure. J Clin J Endocrinol. 1987;112:431–37. Invest. 2005;115:2108-18. 48. Mazzocchi G, Aragona F, Malendowicz LK, 38. Lee JH, O’Keefe JH, Bell D, et al. Vitamin D Nussdorfer GG. PTH and PTH-related peptide enhance steroid secretion from human treatable cardiovascular risk factor? J Am Coll adrenocortical cells. Am J Physiol Endocrinol deficiency: an important, common, and easily Cardiol. 2008;52:1949–56. Metab. 2001;280:E209–E13.

39. Rostland SG, Drueke TB. Parathyroid hormone, 49. Hanley NA, Wester RM, Carr BR, Rainey WE. vitamin D, and cardiovascular disease in chronic Parathyroid hormone and parathyroid hormone- renal failure. Kidney Int. 1999;56:383–92. related peptide stimulate aldosterone production in the human adrenocortical cell line, NCI-H295. 40. et al. Endocrine J. 1993;1:447–50. Parathyroid hormone and left ventricular Saleh FN, Schirmer H, Sundsfjord J, hypertrophy. Eur Heart J. 2003;24:2054–60. 50. Chhokar VS, Sun Y, Bhattacharya SK, Ahokas RA, 41. Perkovic V, Hewitson TD, Kelynack KJ, et al. Myers LK, Xing Z, et al. Hyperparathyroidism and

113

Proefschrift_final_zonder.indd 113 22-10-15 15:08 5 Chapter 5

the calcium paradox of aldosteronism. Circulation 2005;111:871–78.

51. Halapas A, Tenta R, Pantos C, Cokkinos DV, Koutsilieris M. Parathyroid hormone-related peptide and cardiovascular system. In Vivo 2003;17:425-32.

52, Potthoff SA, Janus A, Hoch H, Frahnert M, Tossios P, Reber D, Giessing M, Klein HM, Schwertfeger E, Quack I, Rump LC, Vonend O. PTH-receptors regulate norepinephrine release in human heart and kidney. Regul Pept. 2011;171:35-42.

53. Lindholm LH, Ibsen H, Dahlöf B, Devereux RB, Beevers G, de Faire U, Fyhrquist F, Julius S,

O, Nieminen MS, Omvik P, Oparil S, Wedel H, Kjeldsen SE, Kristiansson K, Lederballe-Pedersen Aurup P, Edelman J, Snapinn S; LIFE Study Group. Cardiovascular morbidity and mortality in patients with diabetes in the Losartan Intervention For Endpoint reduction in hypertension study (LIFE): a randomized trial against atenolol. Lancet. 2002;359:1004-10.

54. Thadhani R, Appelbaum E, Pritchett Y, Chang Y, Wenger J, Tamez H, Bhan I, Agarwal R, Zoccali C, Wanner C, Lloyd-Jones D, Cannata J, Thompson BT, Andress D, Zhang W, Packham D, Singh B, Zehnder D, Shah A, Pachika A, Manning WJ, Solomon SD. Vitamin D therapy and cardiac structure and function in patients with chronic kidney disease: the PRIMO randomized controlled trial. JAMA. 2012;307:674-84.

114

Proefschrift_final_zonder.indd 114 22-10-15 15:08 The vitamin D receptor activator paricalcitol prevents fibrosis and diastolic dysfunction in a murine model of pressure overload

115

Proefschrift_final_zonder.indd 115 22-10-15 15:08 Laura M.G. Meems1*, Hasan Mahmud1*, Hendrik Buikema2, Jörg Tost3, Sven Michel4, Janny Takens1, Rikst N. Verkaik-Schakel5, Inge Vreeswijk-Baudoin1, Irene V. Mateo-Leach1, Torsten Plösch5, Rudolf A. de Boer1

Proefschrift_final_zonder.indd 116 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

Laura M.G. Meems1*, Hasan Mahmud1*, Hendrik Buikema2, Jörg Tost3, Sven Michel4, Janny Takens1, Rikst N. Verkaik-Schakel5, Inge Vreeswijk-Baudoin1, Irene V. Mateo-Leach1, Torsten Plösch5, Rudolf A. de Boer1

University of Groningen, University Medical Center Groningen, 1Departments of Cardiology, 2 Clinical Pharmacy and Pharmacology, 5 Obstetrics and Gynaecology, The Netherlands; 3 Laboratory for Epigenetics and Environment, Centre National de Génotypage, CEA-Institut de Génomique,France; 4 Department of Pediatric Pneumology and Allergy, University Children’s Hospital Regensburg (KUNO), Medical University of Vienna, Austria. Chapter Proefschrift_final_zonder.indd 117 622-10-15 15:08 6 Chapter 6 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

Abstract

Vitamin D deficiency is the most common nutritional deficiency worldwide. Maternal in offspring but the reasons for this remain unknown. The aim of this study was vitamin D deficiency is associated with increased susceptibility of hypertension

offspring that may relate to hypertension. to determine if parental vitamin D deficiency leads to altered DNA methylation in

Male and female Sprague-Dawley rats were fed a standard or vitamin D depleted diet. After 10 weeks, non-sibling rats were mated the conceived pups received standard chow. We observed an increased systolic and diastolic blood pressure in the offspring from depleted parents (F1-depl). Genome-wide methylation analyses in offspring Panx1)-gene in F1-depl-rats. Panx1 encodes a hemi channel known to be involved in endothelial- identified hypermethylation of the promoter region of the Pannexin-1( dependent relaxation, and we demonstrated that in F1-depl-rats the increase in blood pressure was associated with impaired endothelial relaxation of the large vessels, suggesting an underlying biological mechanism of increased blood pressure

in children from parents with vitamin deficiency.

blood pressure levels in offspring. Parental vitamin D deficiency is associated with epigenetic changes and increased

118

Proefschrift_final_zonder.indd 118 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

Introduction

and premature death worldwide. The prevalence of hypertension is on the rise due to the Hypertension is a major risk factor in the development of cardiovascular (CV) disease increasing ageing population, and it is estimated that in 2025 1.56 billion adults will be affected by this condition (1).

The underlying mechanisms of hypertension are complex and multifactorial, but amongst many others, heritable factors play a role (2,3). This may include epigenetic DNA

increased susceptibility to develop hypertension (4-6) . modifications. Several groups have identified epigenetic markers that could contribute to

Recently, it became apparent that in humans maternal nutritional status during early pregnancy predictably affected DNA methylation in offspring (7). Previously, it had been demonstrated in mice that changes in maternal diet altered epigenetic development at genomic regions involved in DNA-methylation during embryonic phase (8-10). These

transcriptional activity and (indirectly) alter disease susceptibility (11). In light of this, one data suggest that nutritional deficiencies may induce epigenetic changes that modify gene of the nutritional components that may be of particular interest is vitamin D. Due to our

predominantly indoor lifestyles, vitamin D deficiency is in fact the most common nutritional associated with the development of short and long term disorders in the offspring, including deficiency worldwide (12,13). Interestingly, maternal vitamin D deficiency has been

increased susceptibility for hypertension in the offspring remains to be elucidated. We used hypertension (13). However, the mechanism linking parental vitamin D deficiency to

and epigenetic changes in offspring. a rat model to study the consequences of parental vitamin D deficiency on blood pressure

119

Proefschrift_final_zonder.indd 119 22-10-15 15:08 6 Chapter 6 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

Materials and Methods Animal Care and Experimental Design. All animal studies were approved by the Animal Ethical Committee of the University of Groningen, The Netherlands, and conducted in accordance with existing guidelines for the care and use of laboratory animals.

We studied 12-week old single-caged Sprague-Dawley male and female rats (Harlan, the

Netherlands), and supplied them with normal (n=7 males, 7 females) or vitamin D depleted cycles and ad lib access to tap water. After 10 weeks of dietary intervention, blood pressure diet (n= 8 males, 8 females) (Harlan [Teklad], diet code TD.87095) with 12:12 hr day-night was measured with a non-invasive method (tail-cuff method, rats were trained for 2 weeks beforehand). We collected blood (via venipuncture under anesthesia) from male and female animals to determine vitamin D status (25-hydroxyvitamin D (25(OH)D) and parathyroid hormone (PTH) levels).

Experimental procedures. After 10 weeks, a single female was mated with one non-sibling male from the same dietary group, and dietary treatment was continued. Following delivery,

maintained group-caged. From this point on, all animals were supplied with a standard diet males were removed from the cage and sacrificed, while females and offspring were for the entire duration of subsequent experiments (Figure 1). F1 pups were nursed freely and weaned at 3 weeks onto standard chow, provided ad libitum.

Figure 1. Global overview of the experimental set-up.

F0= parents, F1= offspring. 120

Proefschrift_final_zonder.indd 120 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

old F1-pups (10 male, 10 female). 10 other age-matched male pups per dietary arm received After 2 weeks of training, final blood pressure measurement was performed in 10 6-week telemeter implantation (Data Sciences International, St. Paul, MN, USA). Telemeters were used to continuously monitor blood pressure with a sampling frequency of 10s every 10 minutes for 72 hours.

Echocardiography and hemodynamic measurements.

Female rats and F1 pups were sacrificed performed using a transthoracic echocardiography with a 10 MHz transducer (Vivid 7, GE 10-12 weeks after delivery. Approximately 1 week prior to sacrifice, echocardiography was

Healthcare, Diegem, Belgium) as previously described (14). Briefly, rats were anaesthetized pad. Short-axis view and M-mode tracings were used to measure cardiac hypertrophy and (2.5% isoflurane) and body temperature was maintained by placing the rat on a heating heart dimensions.

catheter (Millar Instruments, Houston, TX, USA), that was introduced in the right carotid Prior to sacrifice, hemodynamic function was measured, using an indwelling pressure tip artery and advanced into the LV as previously described (14). After measuring invasive hemodynamics, blood was drawn via cardiac puncture and hearts together with other organs were rapidly excised and weighed. Myocardial and kidney tissue were dissected transversally and snap frozen for molecular analyses. Thoracic aortas were collected for vascular studies, while abdominal aortas were collected and snap frozen for molecular analyses.

Enzymeimmunoassy (EIA) of 25(OH)D. Plasma 25(OH)D levels were analyzed using a commercial Enzyme immunoassay according to the manufacturer’s protocol (25-Hydroxy Vitamin D EIA kit, AC-57F1, Immunodiagnostic Systems GmbH, Frankfurt am Main, Germany).

Enzyme-linked immunosorbent assay (ELISA) of PTH. Plasma PTH levels were analyzed using a commercial Enzyme Linked Immunosorbent Assay according to the manufacturer’s protocol (Rat Intact PTH ELISA Kit, #60-2500, Immunotopics Inc., San Clemente, CA).

Vascular studies with isolated aorta rings. The thoracic descending aorta was excised and

120.4; KCl, 5.9; CaCl , 2.5; MgCl , 1.2; NaH PO , 1.2; glucose, 11.5; NaHCO , 25.0; continuously placed in a Krebs bicarbonate2 solution2 of 2the 4following composition (mmol∙L-1):3 NaCl, aerated with 95% O2 and 5% CO2 at 37°C. The vessel was cleaned of adhering fat tissue and rings of 2 mm in width were cut with a sharp razor blade, whilst ensuring not to touch

the luminal surface. Rings were mounted between two stirrups in organ baths filled with 121

Proefschrift_final_zonder.indd 121 22-10-15 15:08 6 Chapter 6 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

15 ml of Krebs solution. One stirrup was anchored inside the organ bath while the other was connected to a displacement transducer to determine isotonic changes, as previously

before they were primed and checked for viability by evoking a contraction with 60 mmol/L described (15). Rings were then subjected to 14 mN and allowed to stabilize for 60 min KCl twice. Following washout and renewed stabilization, parallel rings were studied (in duplicate) either for contractile responses to KCl (10 to 80 mmol/L) or Phenylephrine (PE, 1 nmol/L to 10 µmol/L), or endothelium-dependent relaxation. For the latter, rings were

pre-constricted with 1 µmol∙L-1 PE followed by determination of the dilatory response to Subsequently, a single high concentration of sodium nitroprusside (SNP, 10 µmol/L) was the endothelium-dependent vasodilator acetylcholine (ACh: 10 nmol∙L-1 to 10 µmol∙L-1). administered to determine maximal endothelium-independent relaxation.

Quantitative real-time PCR. To measure mRNA gene expression levels, total RNA from left ventricle (LV) and kidney tissue was extracted using TRIzol reagent (Invitrogen Corporation, Carlsbad, CA, USA). cDNA synthesis and quantitative real time PCR (RT-qPCR) were performed as previously described with use of 0.5 µg total RNA (16). mRNA levels were expressed in relative units based on a standard curve obtained with serial dilutions of cDNA mixture. RNA expression data was normalized using the 36B4 as a reference. We assayed transcript abundance of genes listed in Table 1.

Genomic DNA isolation, genome-wide methylation status and data analysis. DNA was extracted from heart and kidney tissue, using the prepGEM Tissue 200 kit (ZyGem, New Zealand). The methylated DNA immunoprecipitation (MeDIP) was labeled with Cy5

samples were combined and hybridized to Rat 3x720K Multiplex CpG Island Plus RefSeq fluorophore and the input genomic DNA was labeled with Cy3 fluorophore. The labeled DNA Promoter Array (Nimblegen).

Genome-wide methylation status was determined using a multiplex Rat Nimblegen 3x720K CpG Island Plus RefSeq Promoter Array (Roche Nimblegen, Inc., Madison, USA). These arrays include 15,287 RefSeq gene promotors and 15,790 annotated CpG islands with 100 bp spacing through all tiled regions. Tiling of RefSeq promotors begins 3.9kb upstream, extends downstream 0.97kb and covers a total of 4.87kb of promoter per gene. The probe lengths were between 50–75 mer. Arrays were scanned using a MS200 scanner (Nimblegen). Data were extracted and exported to excel using NimbleScan. For MeDIP data the log2 et al. (17) using -ratios of fluorescence intensity obtained from the scanner were pre-processed the Bioconductor packages Ringo (18) and limma by median-centering and quantile normalization as proposed by Pälmke regions, a combination of three separate algorithms was applied, compromising of two (19). To define differentially methylated

122

Proefschrift_final_zonder.indd 122 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

publicly available methods BATMAN (20) and dmrFinder from the CHARM package (21) as well as a self-programmed R-script.

Assessment of DNA methylation status by pyrosequencing. According to the DNA methylation

status of the Pannexin-1 (Panx1 quantification-method of Tost and Gut, 2007, we analyzed the quantitative DNA methylation ) gene by pyrosequencing of bisulfite-treated DNA (22). the EZ DNA Methylation™ Kit (Zymo Research). Regions of interest selected for validation Briefly, 1 µg of DNA from heart or kidney tissue, respectively, was bisulfite-converted using

reverse primer, one of them being biotinylated (22). Information about PCR and sequencing were amplified using 2µL of bisulfite-treated genomic DNA and 10 µM of forward and

methylation status of the Panx1 was facilitated on a PyromarkQ24 system (Qiagen) as primers and the sequence-to-analyze is summarized in table 1. Quantification of the DNA described by Freitag et al. (23). Results were analyzed the results using the PyroMark CpG software (V.10.0.11.14, QIAGEN).

Table 1 -

Overview of primers used for rt-PCRPrimers and DNA used methylation for RT q-PCR status quantification.

36B4 (forward) GTTGCCTCAGTGCCTCACTC

36B4 (reverse) GCAGCCGCAAATGCAGATGG

Angiotensin 1 Receptor (forward) CTGGTTCACTGGCTGTTGAC

Angiotensin 1 Receptor (reverse) GGAAGATGGTGGCAACCAAG

Atrial natriuretic peptide (forward) ATGGGCTCCTTCTCCATCAC

Atrial natriuretic peptide (reverse) TCTACCGGCATCTTCTCCTC

Pannexin-1 (forward) AGACCAAGGGAGAGGACCA

Pannexin-1 (reverse) GCTGCTCAGGTFCCAAATCTT

Renin (forward) GTTGCTCTGGACCTCTTGTA

Renin (reverse) CACTGATCCTGGTCATGTCT

Vitamin-D Receptor (forward) GAGATTGCCGCATCACCAAG

Vitamin-D Receptor (reverse) ACGCTGTACCTCCTCATCTG

Primers used for pyrosequence

Pannexin-1 (forward) GGTTAGTAGGAGATAGGGTGGGGTTA

Pannexin-1 (reverse, biotinylated) ATCACACCCCCTACTCAACTCCC

Pannexin-1 (sequencing) TTTTAGGTAAGTTGTTGTTT

Sequence (CpG-island) to analyze of Panx1

TTGYGYGTTT AAGGYGGTYG GAGTTTTGGT GTYGYGYGYG TTGGGGATTY G

123

Proefschrift_final_zonder.indd 123 22-10-15 15:08 6 Chapter 6

Statistical analyses. Results were reported as means ± SEM, unless reported otherwise. Statistical analysis between groups was performed by using the Student’s-t-test if data was normally distributed or the Mann-Whitney U test if data was not normally distributed. Blood pressure-curves were analyzed using repeated measures ANOVA analysis. All p values were two-tailed and p

values <0.05 were considered statistically significant. Aorta contractile responses to KCl and PE were given in µm. Vasodilator responses to ACh were expressed as a percentage of PE-induced pre-contraction before contraction-tension response curves were generated (Graphpad Prism 5, Graphpad Software, San Diego, CA). N values represent the number of investigated rats. Full contraction-tension response curves were compared using repeated measurements ANOVA. Analyses were performed using STATA version 11.0 software (STATACorp, Texas, USA).

For BATMAN analysis, the difference in methylation between sets of windows of two different groups was assessed by a Wilcoxon-Mann-Whitney test for every step. As for the other approaches (dmrFinder and self-programmed R-script) the combined use of several arrays per phenotype led to an increased possibility to detect differences while the impact of potential artefacts was reduced. Whilst searching for differentially methylated regions

we selected only those regions that displayed significant differences for at least three consecutive sliding windows at a significance level of p=0.001. Results Vitamin D deficient diet resulted in a pronounced and prolonged vitamin D deficiency in F0- rats. F0-rats (parents) were fed with standard or vitamin D depleted diet for 10 weeks.

(Figure 2). Baseline characteristics and echocardiography data of F1-rats are presented in We dietary effect on plasma 25(OH)D and PTH levels was verified before rats were mated table 2. Offspring from parents fed a standard diet (F1-st) were compared with offspring from parents fed on a vitamin-D depleted diet (F1-depl). We observed no differences in body weight (BW), total heart weight (HW) or left ventricular weight (LVW) (Table 2). Furthermore, we calculated HW/BW-ratio and LVW/BW-ratio as a relative measure of cardiac hypertrophy. Again, outcomes were not different between groups (Table 2). Echocardiography was performed to assess the effects of a vitamin D depleted diet during pregnancy on cardiac performance in the offspring. Although global cardiac function was similar in all rats, we observed a minimally impaired cardiac function in F1-depl-rats,

as reflected by the increased LV internal diameter and decreased E-velocity, fractional shortening and ejection fraction (Table 2).

124

Proefschrift_final_zonder.indd 124 22-10-15 15:08 Table 2 - Baseline characteristics and echocardiography data of F1-rats (mean + SEM)

F1-st (N=10) F1-depl (N=10)

BW (g) 336 ± 8 325 ± 6

HW (mg) 1092 ± 17 1060 ± 17

LVW (mg) 825 ± 13 798 ± 13

HW/BW (g/mm) 3.3 ± 0.2 3.3 ± 0.2

LVW/BW (g/mm) 2.5 ± 0.2 2.5 ± 0.1

HR (bpm) 398 ± 7 397 ± 8

MV A (m/s) 0.68 ± 0.05 0.63 ± 0.05

MV E (m/s) 1.04 ± 0.02

MV E/A ratio 1.60 ± 0.11 0.891.50 ±± 0.05*0.06 IVSs (mm) 2.78 ± 0.05 2.64 ± 0.05

LVIDs (mm) 2.69 ± 0.18

LVPWs (mm) 2.82 ± 0.07 3.342.79 ± ± 0.10** 0.05 IVSd (mm) 1.62 ± 0.07 1.56 ± 0.03

LVIDd (mm) 5.86 ± 0.22

LVPWd (mm) 1.63 ± 0.05 6.341.56 ±± 0.09*0.04 LVOT diam (mm) 2.97 ± 0.04 2.92 ± 0.06

EF(%) 88 ± 1.6

%FS 54 ± 2.2 84 ± 0.7*

LV CO (ml/min) 147 ± 8 48135 ± 0.8± 8 *

Table 2 shows the baseline characteristics and echocardiographic data at sacrifice of the used rats. Data is expressed as mean ± SEM. st = standard chow, depl = vitamin D deficient chow, BW = body weight, HW= heart weight, LVW = left ventricular weight, TL = tibia length, SBP = systolic blood pressure, DBP = diastolic blood pressure, MAP = mean arterial pressure, HR = heart rate, bpm = beats per minute, A = late ventricular filling velocities, E= early ventricular filling velocities, E/A ratio= diastolic relaxation, IVSs = thickness of the interventricular septum in systole, LVIDs= left ventricular internal diameter in systole, LVPWs = thickness of the left ventricular posterior wall in systole, IVSd = thickness of the interventricular septum in diastole, LVIDd= left ventricular internal diameter in diastole, LVPWd = thickness of the left ventricular posterior wall in diastole, LVOT vs. vs. F1-depl. = left ventricular outflow tract, EF= ejection fraction, FS= fractional shortening, CO= cardiac output. * P<0.05 F1-st F1-depl, ** P< 0.01 F1-st

Figure 2 - The effect of the vitamin-D depleted diet on 25-hydroxyvitamin D (25(OH)D) levels (Fig. 2A) and parathyroid hormone (PTH) levels in female F0-animals (Fig. 2B). vs vs. F0-st

*p<0.05 . F0-st, **p<0.01 rats, n=3/group. 125

Proefschrift_final_zonder.indd 125 22-10-15 15:08 6 Chapter 6 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

F1-vitD-depl rats have elevated systolic and diastolic blood pressure and impaired endothelial relaxation (Supplemental Figure 1). Single blood pressure measurement revealed that F1-depl-rats . Vitamin D deficient diet had no effect on blood pressure levels in the parents

had a significant higher systolic and diastolic blood pressure than F1-st-rats (Figure 3A). systolic and diastolic blood pressure in F1-depl-rats (Figure 3B). Continuous blood pressure measurements for 3 days in F1-rats and confirmed elevated

Figure 3 - A. Single blood pressure measurement in F1-rats; B. Registration of continuous blood pressure measurement during 3 consecutive days. *P<0.05; ** p<0.01 vs. F1-st-rats, n=8-9/group; C. Dose-dependent thoracic aorta contractile response to Phenylephrine; D. Dose-dependent thoracic aorta relaxation response to Acetylcholine. ***p<0.001 vs. F1-st-rats, n=6/group. SBP: systolic blood pressure, DBP: diastolic blood pressure.

PE induced vasoconstrictor activity in isolated aorta rings was similar in all F1-rats (Figure

induced (endothelium dependent) relaxation of F1-depl-rats as compared to F1-st-rats 3C). In the aortas of F1-rats we observed a significant difference in Acetylcholine (Ach)- (Figure 3C). Endothelial-independent relaxation to sodium nitroprusside (SNP) did not differ between both groups (i.e. 3±2% vs. 7±4% of pre-constriction for F1-st and F1-depl-

depl-rats may be a consequence of impaired endothelial relaxation. rats respectively: p=ns). These results suggest that the increase in blood pressure in F1-

126

Proefschrift_final_zonder.indd 126 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

The increase of blood pressure in F1-depl-rats is not associated with increased expression of genes of the renin-angiotensin-aldosterone system. We performed RT q-PCR to study the

natriuretic peptide (Anp) a marker of cardiac stress was increased in F1-depl-rats as effect of parental vitamin D deficiency on gene expression levels of the offspring. Atrial compared to F1-St-rats (Figure 4A). Vitamin-D receptor (Vdr) expression was reduced in hearts and kidneys of F1-depl-rats (Figure 4B). We observed no changes in mRNA expression levels of renin and angiotensin-1-receptor (at1r). These results indicate that the increase in blood pressure is not associated with increased expression of genes of the renin- angiotensin-aldosterone system (RAAS) (Figure 4 C-D).

Figure 4 - mRNA expression levels in F1-rats of atrial natriuretic peptide (anp), vitamin-D receptor (vdr), renin and aldosteron-1 receptor (at1r) in heart and kidney. mRNA expression levels are presented as versus

fold change. *p<0.05 F1-st-rats, n=10/group.

Parental vitamin D depletion induces epigenetic changes in the offspring. We determined DNA-methylation status (Nimblegene Chip Array) in kidney samples from offspring (3 male animals per dietary arm). Although the F1-rats were genetically identical and all fed and raised under the same conditions, we observed changes in the methylation status. As

127

Proefschrift_final_zonder.indd 127 22-10-15 15:08 6 Chapter 6 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

illustrated in Figure 5, we only selected those genes with an obvious change in methylation

levels (n=10, p ≤ 0.001) (Figure 5).

Figure 5 - Overview of methylation gene expression profile in kidney samples from F1-st and F1-depl-rats.

We only selected genes with obvious differences in methylation expression (n=10) (p=0.001).

Subsequently, we checked NCBI Gene database to obtain more information on these 10 genes. First, we found that all genes were conserved in humans. For 2 genes, RefSeq status was predicted and the rest was provisional. Functional description of 6 genes (Dqx1, Gyltl1b, LOC499742, Otop2, RGD1562608, Zbtb7b) was not provided. The Capn2 and Bcl2 gene were associated with regulation of apoptosis, while the functional description of Adh7 gene was within alcohol dehydrogenase. Finally, the Pannexin-1 gene (Panx1) encodes for the plasma membrane protein called Pannexin-1, which is involved in various

128

Proefschrift_final_zonder.indd 128 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

physiological and pathophysiological processes (24). The hemichannel Pannexin-1 is abundantly present in different organs and tissues in mammals, including the heart, skeletal muscle and vasculature. Within the vasculature, Pannexin-1 is predominantly expressed in the endothelium of the larger vasculature and is associated with regulation of endothelial function (25). Therefore, we nominated Panx1 as the most plausible candidate gene to take forward for further analyses of epigenetic changes.

Role of Pannexin-1 in elevated blood pressure levels. To verify if altered DNA methylation status of Panx1 could potentially be associated with the observed endothelial relaxation in F1-depl-rats, we used pyrosequencing to perform a quantitative DNA methylation analysis on methylation status of Panx1. In this analysis we validated the microarray data using an extended set of samples (tissue of 10 kidneys/group) that included additional tissue from Panx1 in F1-depl-rats (vs. F1-st-rats, Figure 6A). In general, hypermethylation in the promoter region sibling and nonsibling rats. We observed a significant hypermethylation of the

expression levels of Panx1 were lower in F1-depl-rats versus causes gene silencing of genes and this we could confirm in the aortas of our rats: mRNA F1-st-rats , p<0.05, Figure 6B.

Figure 6 - A. quantitative (%) DNA methylation status of Panx1: kidney tissue of B. mRNA expression levels of Panx1 in aorta and heart F1-st (n=7) and F1-depl-rats (n=10; tissue of F1-st (n=10-13) and F1-depl (n=8- 11) rats. mRNA expression levels are presented versus F1-st-rats.

as fold change. * p<0.05

129

Proefschrift_final_zonder.indd 129 22-10-15 15:08 6 Chapter 6 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

Discussion

associated with elevated blood pressure levels in the offspring, which is accompanied by In this study, we show for the first time that a rat model of parental vitamin D deficiency is impaired endothelial relaxation in the large vessels. We propose that hypermethylation of the Panx1 promoter-region, resulting in lower gene expression, is an underlying potential mechanism. The observed upregulation of Anp in heart suggests increased cardiac stress, while the reduced expression levels of the Vdr in heart and kidney suggests reduced VDR-

of parents may translate into enhance susceptibility to several common multifactorial activity. Our findings add to the mounting literature suggesting that nutritional deficiencies diseases in their children.

A recent large multi-ethnic genome-wide association and replication study provided new insights regarding genetic predisposition of blood pressure regulation, and suggested DNA methylation to be an important player in this process (26). Previously, it has been shown that low levels of vitamin are associated with increased risk of hypertension (27-29), and

this has been confirmed recently (30). This suggests a direct relationship between vitamin D associated with changes in methylation status of the offspring as well (31). Therefore, it is biology and blood pressure regulation. Interestingly, maternal vitamin D deficiency has been conceivable that vitamin D may intervene with blood pressure levels in an indirect manner as well.

are expressed in an individual without altering the DNA. Especially during gametogenesis DNA methylation is part of the process of epigenetic modifications that control how genes

gene expression in various organs and tissues. This is thought to contribute to altered and early embryogenesis this process has a major impact on interindividual variation in

provoked by numerous factors, including environmental chemicals, drugs, but also nutrition susceptibility to certain diseases later on in life (32). Epigenetic modifications can be

(33,34). Nutritional factors, in particular maternal deficiencies, are therefore regarded as well-known modifiers of long-term disease outcomes in offspring. It has repetitively been induced increased cardiovascular disease prevalence, risk of metabolic disorders and breast reported that extreme maternal food deprivation during the first trimester of pregnancy

directly associated with blood pressure regulation in offspring: the offspring from rats and cancer in their children (35-37). Interestingly, maternal nutritional deficiencies are also mice fed on a low protein diet tend to develop increased blood pressure levels (38,39), and it has been shown that children from malnourished mothers had an increased susceptibility to develop hypertension later in their lives (36). However, no clear cause- and effect relationship explaining the development of hypertension has been established yet (40).

In our study, parental vitamin D deficiency is associated with increased blood pressure in 130

Proefschrift_final_zonder.indd 130 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

F1 animals, which was not in parallel and thus independent of the parental blood pressure. Since the increase in blood pressure, in this study, was not associated with changes in expression of genes of the RAAS, we hypothesize that this would be due to another in-utero programming effect, such as altered DNA-methylation status. We assessed DNA methylation

the promoter region and reduced gene expression in the aorta but not in the heart. status using quantitative and qualitative methods and identified Panx1 hypermethylation of

Figure 7 - Proposed mechanism by which parental vitamin-D deficiency is associated with increased blood pressure in offspring.

PANX-1= pannexin-1, Vit-D= vitamin D

The pannexin (Panx) family exists out of three isoforms (Panx1, Panx2, and Panx3) that are present throughout the entire body including the endothelial cells of the large vasculature. In the vessel wall, Panx1 is most abundantly expressed (41). Panx1 is thought to form ATP-permeable hexameric channels that release ATP. Binding of Ach to its receptor on the endothelial surface activates Panx1-hemichannels that induce endothelium-derived hyperpolarization (EDH) (24,41). Interestingly, mice that lack the Panx1 encounter endothelial dysfunction due to impaired Ach-induced relaxation (25), and functional Panx1-hemichannels seem to be essential in EDH-like relaxation (42). We hypothesize that the reduction in Panx1 expression may explain, at least in part, the observed differences in blood pressure levels in F1-rats. From our aggregate data, we suggest that parental

131

Proefschrift_final_zonder.indd 131 22-10-15 15:08 6 Chapter 6 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

Panx1. This results in less Panx1 transcription and gene expression, and inhibition of EDH. As a consequence, vitamin-D deficiency causes hypermethylation in the promoter region of Ach-induced relaxation is impaired: relaxation of the large vessels is hampered and blood pressure levels increase (Figure 7).

Vitamin D levels and VDR are thought to play an essential role in endothelial function as

improved endothelial function without alteration of blood pressure (43-46) . Given the well. Previously, it has been demonstrated that VDR activation of uremic rats significantly observation that we observed an increased blood pressure in F1-depl-rats, we suggest that the effect of reduced Vdr

is unlikely a major factor in explaining our results. This study has several limitations: (i) global methylation status is measured on kidney tissue and not on vascular segments or endothelial cells; (ii) because of the descriptive nature of this study, we are unable to prove a direct cause and effect relation of parental

(iii) in this study we show that the increase in blood pressure levels is associated with a vitamin D deficiency and the development of increased blood pressure in the offspring; decrease of mRNA expression levels of Panx1 in the thoracic aorta. Besides larger arteries, smaller resistance vessels (arterioles) also regulate blood pressure levels. Panx1 is present in both arteries and arterioles, and it has been hypothesized that Panx1-acitivity regulates vascular tone, peripheral resistance, and blood pressure levels in larger and smaller vessels (47). Future studies should address if altered Panx1-activity in smaller resistance vessels

influence blood pressure levels as well.

increased blood pressure in offspring. As a potential and plausible biological mechanism, In conclusion, we demonstrate that parental vitamin D deficiency is associated with we suggest Panx1 hypermethylation and a concomitant reduction in gene expression to be contributing to the observed disturbed endothelial relaxation. This phenomenon may not only directly result in higher blood pressure, but may eventually also contribute to adverse cardiovascular outcomes later in life.

Acknowledgements.

We would like to thank Silke Maass-Oberdorf, Michel Weij, Annemieke Smit-van Oosten, André Zandvoort and Bianca Schepers-Meijeringh for their help and support. Funding sources and disclosures. This work was support by a grant from the Ubbo Emmius

(grant 2007T046) and the Innovational Research Incentives Scheme program of the Netherlands Fonds-Junior Scientific Masterclass (UEF-JSM) (LMGM) and by the Netherlands Heart Foundation

Organization for Scientific Research (NWO VENI, grant 916.10.117, and NWO VIDI, grant 917.13.350) 132

Proefschrift_final_zonder.indd 132 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

(RadB). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The authors have nothing to declare.

133

Proefschrift_final_zonder.indd 133 22-10-15 15:08 References 9. Waterland RA, Jirtle RL. Transposable elements: targets for early nutritional effects on 1. World Heart Federation, Quick Facts on epigenetic gene regulation. Mol Cell Biol 2003 hypertension & high blood pressure. Available Aug;23(15):5293-5300. at: www.world-heart-federation.org/press/ fact-sheets/cardiovascular-disease-risk-factors/ 10. Dolinoy DC, Huang D, Jirtle RL. Maternal nutrient quick-facts-on-hypertension-high-blood- supplementation counteracts bisphenol A-induced pressure/. Accessed August, 2015. DNA hypomethylation in early development. Proc Natl Acad Sci U S A 2007 Aug 7;104(32):13056- 2. Joe B. Dr Lewis Kitchener Dahl, the Dahl rats, and 13061. Rthe “inconvenient truth” about the genetics of hypertension. Hypertension 2015 May;65(5):963- 11. Sutherland JE, Costa M. Epigenetics and the 969. environment. Ann N Y Acad Sci 2003 Mar;983:151- 160. 3. Vimaleswaran KS, Cavadino A, Berry DJ, LifeLines Cohort Study investigators, Jorde R, Dieffenbach 12. Hossein-nezhad A, Holick MF. Vitamin D for AK, et al. Association of vitamin D status with health: a global perspective. Mayo Clin Proc 2013 arterial blood pressure and hypertension risk: a Jul;88(7):720-755. mendelian randomisation study. Lancet Diabetes Endocrinol 2014 Sep;2(9):719-729. 13. Holick MF. High prevalence of vitamin D inadequacy and implications for health. Mayo Clin 4. Scherrer U, Rimoldi SF, Sartori C, Messerli FH, Proc 2006 Mar;81(3):353-373.

mechanisms in arterial hypertension. Curr Opin 14. Szymanski MK, Buikema JH, van Veldhuisen Rexhaj E. Fetal programming and epigenetic Cardiol 2015 Jul;30(4):393-397. DJ, Koster J, van der Velden J, Hamdani N, et al. Increased cardiovascular risk in rats with primary 5. Millis RM. Epigenetics and hypertension. Curr renal dysfunction; mediating role for vascular Hypertens Rep 2011 Feb;13(1):21-28. endothelial function. Basic Res Cardiol 2012 Mar;107(2):242-011-0242-4. Epub 2012 Jan 19. 6. International Consortium for Blood Pressure Genome-Wide Association Studies, Ehret GB, 15. Munroe PB, Rice KM, Bochud M, Johnson AD, et Zeeuw D, van Gilst WH. Comparison of zofenopril Buikema H, Monnink SH, Tio RA, Crijns HJ, de al. blood pressure and cardiovascular disease risk. group in improvement of endothelial dysfunction Genetic variants in novel pathways influence and lisinopril to study the role of the sulfhydryl- Nature 2011 Sep 11;478(7367):103-109. with ACE-inhibitors in experimental heart failure. Br J Pharmacol 2000 Aug;130(8):1999-2007. 7. Dominguez-Salas P, Moore SE, Baker MS, Bergen AW, Cox SE, Dyer RA, et al. Maternal nutrition at 16. Meems LM, Cannon MV, Mahmud H, Voors AA, conception modulates DNA methylation of human et al. The vitamin D metastable epialleles. Nat Commun 2014 Apr van Gilst WH, Sillje HH, 29;5:3746. and diastolic dysfunction in a murine model of receptor activator paricalcitol prevents fibrosis pressure overload. J Steroid Biochem Mol Biol 8. Waterland RA, Dolinoy DC, Lin JR, Smith CA, Shi 2012 Nov;132(3-5):282-289. X, Tahiliani KG. Maternal methyl supplements increase offspring DNA methylation at Axin Fused. 17. Palmke N, Santacruz D, Walter J. Comprehensive Genesis 2006 Sep;44(9):401-406. analysis of DNA-methylation in mammalian tissues

134

Proefschrift_final_zonder.indd 134 22-10-15 15:08 using MeDIP-chip. Methods 2011 Feb;53(2):175- 184. a role for DNA methylation: the International influencing blood pressure traits, and implicates Genetics of Blood Pressure (iGEN-BP) Study. Nat 18. Toedling J, Skylar O, Krueger T, Fischer JJ, Sperling Genet 2015 in press. S, Huber W. Ringo--an R/Bioconductor package for analyzing ChIP-chip readouts. BMC Bioinformatics 27. Burgess ED, Hawkins RG, Watanabe M. Interaction 2007 Jun 26;8:221. of 1,25-dihydroxyvitamin D and plasma renin activity in high renin essential hypertension. Am J 19. Ritchie ME, Silver J, Oshlack A, Holmes M, Diyagama Hypertens 1990 Dec;3(12 Pt 1):903-905. D, Holloway A, et al. A comparison of background correction methods for two-colour microarrays. Lind L, Hanni A, Lithell H, Hvarfner A, Sorensen Bioinformatics 2007 Oct 15;23(20):2700-2707. 28. pressure and other cardiovascular risk factors OH, Ljunghall S. Vitamin D is related to blood 20. Down TA, Rakyan VK, Turner DJ, Flicek P, Li H, in middle-aged men. Am J Hypertens 1995 Kulesha E, et al. A Bayesian deconvolution strategy Sep;8(9):894-901. for immunoprecipitation-based DNA methylome analysis. Nat Biotechnol 2008 Jul;26(7):779-785. 29. Kristal-Boneh E, Froom P, Harari G, Ribak J. Association of calcitriol and blood pressure 21. Irizarry RA, Ladd-Acosta C, Carvalho B, Wu H, in normotensive men. Hypertension 1997 Brandenburg SA, Jeddeloh JA, et al. Comprehensive Nov;30(5):1289-1294. high-throughput arrays for relative methylation (CHARM). Genome Res 2008 May;18(5):780-790. 30. Heerspink HJ, de Zeeuw D, Visser M, Brouwer IA, van Ballegooijen AJ, Gansevoort RT, Lambers- 22. Tost J, Gut IG. DNA methylation analysis by et al. Plasma 1,25-dihydroxyvitamin D and the pyrosequencing. Nat Protoc 2007;2(9):2265- Risk of Developing Hypertension: the 2275. Prevention of Renal and Vascular End-Stage Disease Study. Hypertension 2015(66). 23. Freitag N, Zwier MV, Barrientos G, Tirado-Gonzalez I, Conrad ML, Rose M, et al. 31. Zhang H, Chu X, Huang Y, Li G, Wang Y, Li Y, et al. NK-DC abundance on placentation and its relation Influence of relative to epigenetic programming in the offspring. Cell results in insulin resistance in rat offspring, which Maternal vitamin D deficiency during pregnancy Death Dis 2014 Aug 28;5:e1392. methylation. Diabetologia 2014 Oct;57(10):2165- is associated with inflammation and Ikappabalpha 24. Penuela S, Gehi R, Laird DW. The biochemistry and 2172. function of pannexin channels. Biochim Biophys Acta 2013 Jan;1828(1):15-22. 32. Jang H, Serra C. Nutrition, epigenetics, and diseases. Clin Nutr Res 2014 Jan;3(1):1-8. 25. Gaynullina D, Tarasova OS, Kiryukhina OO, Shestopalov VI, Panchin Y. Endothelial function 33. Jimenez-Chillaron JC, Diaz R, Martinez D, is impaired in conduit arteries of pannexin1 Pentinat T, Ramon-Krauel M, Ribo S, et al. The knockout mice. Biol Direct 2014 May 17;9:8-6150- 9-8. their implications on health. Biochimie 2012 role of nutrition on epigenetic modifications and Nov;94(11):2242-2263. 26. X, Zhang W, et al. Trans-ethnic genome-wide 34. Lillycrop KA, Burdge GC. Maternal diet as a Kato N, Loh M, Takeuchi F, Verweij N, Wang

association study identifies multiple genetic loci modifier of offspring epigenetics. J Dev Orig Health 135

Proefschrift_final_zonder.indd 135 22-10-15 15:08 6 Chapter 6 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation

Dis 2015 Apr;6(2):88-95. via an endothelium-derived hyperpolarization mechanism. FEBS Lett 2015 Apr 28;589(10):1164- 35. 1170. Osmond C, Barker DJ, et al. Early onset of coronary Painter RC, de Rooij SR, Bossuyt PM, Simmers TA, artery disease after prenatal exposure to the 43. Bodyak N, Ayus JC, Achinger S, Shivalingappa V, Ke Dutch famine. Am J Clin Nutr 2006 Aug;84(2):322- Q, Chen YS, et al. Activated vitamin D attenuates 7; quiz 466-7. left ventricular abnormalities induced by dietary sodium in Dahl salt-sensitive animals. Proc Natl 36. Acad Sci U S A 2007 Oct 23;104(43):16810-16815. Roseboom TJ. The metabolic syndrome in adults de Rooij SR, Painter RC, Holleman F, Bossuyt PM, prenatally exposed to the Dutch famine. Am J Clin 44. Karavalakis E, Eraranta A, Vehmas TI, Koskela JK, Nutr 2007 Oct;86(4):1219-1224. Koobi P, Mustonen J, et al. Paricalcitol treatment and

37. Nephron Exp Nephrol 2008;109(3):e84-93. arterial tone in experimental renal insufficiency. DI, Osmond C, Barker DJ, et al. Glucose tolerance de Rooij SR, Painter RC, Roseboom TJ, Phillips at age 58 and the decline of glucose tolerance 45. Mizobuchi M, Morrissey J, Finch JL, Martin DR, in comparison with age 50 in people prenatally Liapis H, Akizawa T, et al. Combination therapy exposed to the Dutch famine. Diabetologia 2006 with an angiotensin-converting enzyme inhibitor Apr;49(4):637-643. and a vitamin D analog suppresses the progression

38. Watkins AJ, Wilkins A, Cunningham C, Perry VH, Nephrol 2007 Jun;18(6):1796-1806. of renal insufficiency in uremic rats. J Am Soc Seet MJ, Osmond C, et al. Low protein diet fed exclusively during mouse oocyte maturation leads 46. Wu-Wong JR, Noonan W, Nakane M, Brooks KA, to behavioural and cardiovascular abnormalities Segreti JA, Polakowski JS, et al. Vitamin d receptor in offspring. J Physiol 2008 Apr 15;586(8):2231- activation mitigates the impact of uremia on 2244. endothelial function in the 5/6 nephrectomized rats. Int J Endocrinol 2010;2010:625852. 39. Kwong WY, Wild AE, Roberts P, Willis AC, Fleming TP. Maternal undernutrition during the 47. Billaud M, Sandilos JK, Isakson BE. Pannexin 1 in preimplantation period of rat development causes the regulation of vascular tone. Trends Cardiovasc blastocyst abnormalities and programming of Med. 2012;22:68-72. postnatal hypertension. Development 2000 Oct;127(19):4195-4202.

40. Natekar A, Olds RL, Lau MW, Min K, Imoto K, Slavin TP. Elevated blood pressure: Our family’s fault? The genetics of essential hypertension. World J Cardiol 2014 May 26;6(5):327-337.

41. Lohman AW, Billaud M, Straub AC, Johnstone SR, Best AK, Lee M, et al. Expression of pannexin isoforms in the systemic murine arterial network. J Vasc Res 2012;49(5):405-416.

42. Gaynullina D, Shestopalov VI, Panchin Y, Tarasova OS. Pannexin 1 facilitates arterial relaxation

136

Proefschrift_final_zonder.indd 136 22-10-15 15:08 Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation SSupplemental data and figures

Supplemental Figure 1 - Blood pressure levels in male and female F0-rats (n=6 per group).

137

Proefschrift_final_zonder.indd 137 22-10-15 15:08 Proefschrift_final_zonder.indd 138 22-10-15 15:08 Summary, discussion and future perspectives

L.M.G. Meems

University of Groningen, University Medical Center Groningen, Department of Cardiology, The Netherlands Chapter Proefschrift_final_zonder.indd 139 722-10-15 15:08 7 Chapter 7 Summary, discussion and future perspectives

140

Proefschrift_final_zonder.indd 140 22-10-15 15:08 Summary, discussion and future perspectives

Summary of this thesis Vitamin D biology is primarily known for its role in bone health. However, vitamin D is a pleiotropic vitamin and transcription factor with several effects on global health. The vitamin D receptor (VDR) is present in almost all organs and tissues (including the heart), and it has been appreciated that vitamin D exerts various effects that transcend bone metabolism. In fact, it has been postulated that up to 3% of the gene regulation may be regulated by vitamin D (1). In the human body, vitamin D forms a complex with the VDR (vitamin D-VDR). Via this complex, together with a nuclear hormone receptor partner such as Retinoid-X-Receptor (RXR) and several co-factors, the expression of downstream genes is regulated. For instance, the vitamin D-VDR complex is a negative endocrine regulator of the renin-angiotensin-aldosterone-system (RAAS) (2,3). RAAS is an established target in treatment and prevention of cardiovascular disease, including heart failure (HF). Further,

also crucial for HF. vitamin D regulates inflammatory (4-6) and proliferative pathways (7,8), pathways that are

prevalence (9). Despite current optimal therapies, the prognosis for HF remains poor, and HF is a major problem in the Western World, with an ever increasing incidence and the 5-year survival rate of HF is worse than several types of cancer. Therefore, a current search for novel and improved therapies is warranted and vitamin D may represent an

interesting modifiable factor in the pathophysiology of HF, as discussed by many (10-13). The overall aim of this thesis was to investigate the role of vitamin D biology in HF of vitamin D biology in HF, thereby contributing to better understanding of the therapeutic and preventive potential vitamin D has in patients with HF. The data presented in this thesis expand the current knowledge on the role of vitamin D biology in HF, using a clinical as well as an experimental setting. In addition, it provides several recommendations on how assessment of vitamin D levels as well as study of vitamin D biology might be used in daily

practice, and how specific values should be interpreted. 141

Proefschrift_final_zonder.indd 141 22-10-15 15:08 7 Chapter 7 Summary, discussion and future perspectives

Recognition of the interplay between vitamin D biology and cardiovascular disease.

with increased prevalence of several multifactorial diseases, including hypertension, COPD, Vitamin D deficiency is a global problem (14,15) and has been reported to be associated and diabetes mellitus. Within an individual, the number of diseases increases with age (16), and at advanced age many individuals suffer from more than one disease. Previous studies

However, the VDR is present throughout the entire body and it was hypothesized that mainly focused on the role of vitamin D deficiency and “single” morbidity prevalence. decreasing levels of vitamin D would be associated with increasing disease prevalence within several disease domains. To test this hypothesis we investigated if vitamin D status was associated with changes in multimorbidity prevalence. Chapter 4 illustrated that a low

prevalence of morbidities within an individual, being most outspoken in individuals with level of vitamin D, after adjustment for multiple confounders, is associated with increased

gastro-intestinal (22%), central nervous system (17%), respiratory (16%), cardiovascular vitamin D deficiency (<25 nmol/L). The most frequently reported diseases were in the (15%) and endocrine (12%) domain. Although the association between low vitamin D and

there was a clear inverse relationship between levels of vitamin D and cardiovascular a higher morbidity prevalence was not restricted to one specific disease or disease domain,

common phenomenon in patients with cardiovascular disease. disease prevalence. This observation supported the notion that vitamin D deficiency is a

prevalence of cardiovascular disease has been described: already in 2003, Zittermann This is not the first time that an association between low levels of vitamin D and increased

of vitamin D than their aged-matched healthy controls (10). Various other studies reported reported on the observation that patients with congestive HF had significantly lower levels similar observations and emphasized that higher levels of vitamin D are associated with better outcomes in patients with HF (17,18). However, the exact mechanisms underlying the association between low vitamin D and worse outcome in patients with HF remained unanswered. The aim of chapter 2 was to summarize the existing knowledge on vitamin D and its biology in HF. Using a systematic analysis, this chapter provided a comprehensive

overview how vitamin D signaling may influence pathophysiological pathways and effects in prevention and treatment of HF, via targeting renin and angiotensin II levels, and molecular changes in HF. The vitamin D-VDR complex could potentially exert beneficial (indirect) inhibition of the RAAS. Next to that, it was suggested that VDR-activation could have other, multivalent, effects that delay HF development and progression, as for instance

of natriuretic peptides secretion, as well as several other signaling intracellular pathways. by modification of inflammation (inhibition of macrophages and cytokines), and stimulation

The role for vitamin D biology in treatment of HF. In chapter 5 parts of the abovementioned

142

Proefschrift_final_zonder.indd 142 22-10-15 15:08 Summary, discussion and future perspectives

theories were addressed and it was investigated if activation of the vitamin D-VDR complex

(TAC), or a sham operation, to provoke HF based on left ventricular pressure overload. directly regulated HF pathophysiology. Mice were subjected to transaortic constriction The mice were treated with placebo, losartan (an angiotensin receptor blocker [ARB]), paricalcitol (a selective VDR-activator, VDRA), or a combination of losartan and paricalcitol

to induce left ventricular hypertrophy (LVH) and hypertension. Secondly, single or during five weeks. First, TAC demonstrated to be a reliable and reproducible technique combination-treatment with paricalcitol did not attenuate LVH. Nevertheless, treatment

vs. paricalcitol 1.6±0.3%). with paricalcitol prevented diastolic dysfunction and significantly reduced the amount of fibrosis in the left ventricle (TAC 5.9 ±1.0 Circulating levels of vitamin D are inversely associated with parathyroid hormone (PTH), and low levels of vitamin D are a well-known cause of secondary hyperparathyroidism (19). Patients suffering from this disease have extremely elevated PTH levels, and it has been observed that this is associated with increased cardiovascular disease risk and cardiovascular pathology (3,12,20,21). Mechanistically, high levels of PTH are known

chapter 5 to induce hypertrophy in cardiomyocytes, and to promote a pro-fibrotic state [44]. In also decreases serum PTH-levels. Although we could not establish if the reduced amount we demonstrated that paricalcitol not only reduces the amount of fibrosis, but

of fibrosis was a direct PTH-related effect, I hypothesize that the observed decrease in remodelling is a complex process, and future studies should address if PTH is culprit in this PTH levels, at least partly, explains the reduced formation of myocardial fibrosis. Cardiac process. Accumulating evidence suggests that modifying PTH may represent a promising novel target in prevention of cardiac remodelling and treatment of cardiovascular disease (22-24) .

The role for vitamin D biology in prevention of HF. Low levels of vitamin D are associated

and diastolic blood pressure, higher serum glucose and LDL levels, and lower HDL levels with an adverse cardiovascular risk profile that is characterized by increased systolic (chapter 3 & 4). In this thesis (chapter 3 & 4) it was demonstrated that individuals with

lower vitamin D (<50 nmol/L) levels were more likely to be of male sex, to have a higher BMI, and to perform less physical activity. Furthermore, individuals with deficient levels of (chapter 4). Interestingly, (most of) these abovementioned factors are regarded as risk vitamin D (<25 nmol/L) are more often active-smokers, and consume less dairy products factors for HF as well. To elucidate if vitamin D biology was associated with development and progression of HF, we tested the association between vitamin D biology and new onset HF in participants from the PREVEND database (for more information see Brouwers et al.(25)). Individuals in this database were well phenotyped and we had availability of an

143

Proefschrift_final_zonder.indd 143 22-10-15 15:08 7 Chapter 7 Summary, discussion and future perspectives

extensive set with information on demographics, laboratory values and other possible confounding factors. The primary analysis focused on the association of calcidiol, calcitriol, PTH and the risk for new onset HF. During a median follow-up of 12.6 (interquartile range 12.3-12.9) years, 283 individuals developed new onset HF. Development of HF, however was not independently associated with calcidiol, calcitriol or PTH levels. This suggests that

directly contribute to HF pathophysiology. Although low levels of vitamin D may thus be in subjects from the general population plasma levels of calcidiol, calcitriol or PTH do not

consider vitamin D biology causally associated with development and progression HF. associated with an unfavourable cardiovascular profile, from these data, it is unlikely to

children all over the world (15). Accumulating evidence suggests that environmental Vitamin D deficiency is the most common nutritional deficiency in men, women and

factors in adults, such as maternal nutritional deficiencies, may affect health-outcomes in of DNA methylation is a stochastically process that is responsible for interindividual offspring due to epigenetic modifications (26). In the early embryonic phase, establishment epigenetic variation (27). Recently, it has been shown that the process of DNA methylation

is predictably influenced by periconceptional levels of biomarkers and substrates (28). It was already discussed that during adult life, vitamin D deficiency is associated with contribute to altered disease susceptibility as well. This interesting issue was addressed increased disease prevalence. However, periconceptional (epi)genetic modifications may in chapter 6. Male and female Sprague-Dawley rats were fed with a standard, or a vitamin D depleted diet. After 10 weeks of diet, rats from each dietary arm were mated. Following

subsequent experiments all rats received the same standard diet. The offspring in this study delivery, the vitamin D deficient diet was replaced by the standard diet and during was considered genetically identical, and so were environmental conditions. Observed differences in the offspring were therefore most likely to be associated with in-uterine

modifications. At age of 10 weeks, we observed that offspring from vitamin D depleted and an impaired endothelial-dependent relaxation of the large vessels. Mechanistically, parents (F1-depl-rats) had a significantly elevated systolic and diastolic blood pressure, this was associated with increased hypermethylation of the pannexin-1 gene (Panx1), and a concomitant decrease in transcript abundance in aortas of F1-depl-rats. Panx1 encodes for the hemichannel Pannexin-1, which is thought to play a pivotal role in Acetylcholine- dependent endothelial relaxation in the vasculature (29,30). This suggested a plausible underlying biological mechanism of the observed elevated blood pressure. Because of these

changes that contribute to increased disease susceptibility in children later in life. However, results I hypothesize that parental vitamin D deficiency may be associated with epigenetic

future studies are needed to address the translational importance of this finding.

144

Proefschrift_final_zonder.indd 144 22-10-15 15:08 Summary, discussion and future perspectives

Discussion and future perspectives

potential roles outside bone metabolism have been studied more extensively than ever Vitamin D has received considerable attention during the last decades. Specifically, its before. The quest of unraveling the multivalent potencies of vitamin D in cardiovascular disease has excited researchers all over the world, but most recent data has dampened this enthusiasm: not all outcomes are as positive as the initial observations suggested they could have been. The outcomes of VITAL (31), a large scale supplementation study on the effect

of daily vitamin D3 supplementation (2000 IU) or omega-3 fatty acids (1 gram) in primary prevention of cancer, heart disease, and stroke in the general population are therefore eagerly awaited.

Vitamin D biology and HF. The high hopes on a central role for vitamin D in HF pathophysiology took a blow by the publication of the results from the PRIMO randomized control trial (RCT). This multicenter double-blind placebo-controlled trial evaluated the effect of forty-eight week treatment with paricalcitol on cardiac structure and function in 227 patients with chronic kidney disease and LVH. Disappointingly, neither left ventricular

results were considered negative, the general opinion about the possibilities for vitamin mass index nor diastolic function improved after paricalcitol-therapy. Although these first D-VDR complex as potential therapy in HF remained positive. This study has been followed by several more RCTs with paricalcitol and other VDR-activators, all with ambiguous outcomes (32-35). Nevertheless, based on some recent studies I believe that the initial enthusiasm that vitamin D biology was provided needs re-evaluation. A meta-analysis describing the overall effect of at least 1 year vitamin D supplementation on development

not effective in reducing HF (overall effect RR 0.83 [95% CI 0.60-1.13]). This was also of HF in individuals >50 years of age (36) concluded that vitamin D supplementation was suggested by the results from the Women’s Health Initiative (a double-blind RCT in which 35983 women were randomized 1:1 to receive 1000 mg/d of calcium plus 400 IU/d vitamin

D3 D supplementation was protective in women with baseline low-risk for HF (hazard ratio or placebo (37)). Their findings were, however, nuanced by the observation that vitamin 0.63 [95% CI 0.46-0.87]), but not in women in the high-subgroup (37). The effect of dietary

aged males did not observe an association between dietary vitamin D and incident HF (38). vitamin D (fortification) seems to be limited as well: a prospective study in 19,653 middle- I therefore support the recommendation that supplementation in patients with HF should not diverge from standard guidelines for vitamin D supplementation (34).

The abovementioned effects rely on the concept that vitamin D directly modifies HF pathophysiology via processes that modulate endothelial function, fibrosis, immunomodulation, and inflammation [Figure 1]. On the other hand, vitamin D deficiency 145

Proefschrift_final_zonder.indd 145 22-10-15 15:08 7 Chapter 7 Summary, discussion and future perspectives

is also associated with increased prevalence of several HF-precursors (e.g. elevated blood

HF precursors by activation of vitamin D biology could possibly (indirectly) modify HF pressure, BMI and unfavorable metabolic profile). This could mean that targeting of these pathophysiology. Disappointingly, the results from the recently published Styrian Vitamin D Hypertension Trial (a single-center, double-blind, placebo-controlled in which 200

gift of 2800 IU vitamin D or oily drops for 8 weeks) suggest that supplementation is not participants with arterial3 hypertension and calcidiol levels <30 ng/mL 1:1 received a daily effective in lowering blood pressure levels (39). This is in line with the outcomes of a recent meta-analysis on the effect of vitamin D supplementation in hypertension that concluded that vitamin D is most likely to be ineffective as blood pressure lowering agent (40). A Mendelian randomization study (108,173 individuals from 35 different studies) nonetheless concluded that increased plasma concentrations of vitamin D may have the potential to reduce the risk of hypertension: in instrumental variable analysis, each 10% increase of vitamin D was associated with a decrease of 0.29 mmHg in diastolic blood pressure and 0.37 in systolic blood pressure (41). Clearly, the observed effects in this study are small, much smaller than expected, and future studies with comparable sample sizes are warranted to

effect of vitamin D biology on other HF-precursors expressed a similar message (42,43). bolster and validate if these findings have clinical implications. Studies that focused on the Despite the availability of sizeable cohorts and a large amount of data, so far there has

disadvantageous in development and progression of HF (44). Altogether, I believe that the been no definite conclusion if activation of the vitamin D-VDR axis is in favor of, neutral or effect of vitamin D supplementation as direct and indirect modulator of HF pathophysiology is restricted. In general, even in these large cohorts, the observed effects are very small and this suggests that the expected number-to-treat has to be extremely high before any effect will be seen. Although the idea of worldwide vitamin D supplementation may theoretically

this seems no feasible suggestion in daily practice; not in the last place because of its likely be laudable (and may already be done by fortification of some dairy-products), I believe marginal or absent effect.

Vitamin D biology: the role of genetics and epigenetics. Despite the accumulating body of neutral, and at times even disappointing results, the role for vitamin D biology in HF cannot be effaced yet. Recently, it has been suggested that genetic variation is an important

importance in the association between low vitamin D and HF. Individuals with a genetic factor in interracial differences in vitamin D biology. This genetic diversity may be of major variation in a single allele were predisposed to have lower levels of vitamin D, and so was their risk for HF (45). Furthermore, the increased prevalence of obesity and diabetes mellitus type 2 in individuals with low vitamin D levels could, at least in part, be explained by genetic variants (42). Several studies have shown that vitamin D biology and VDR

146

Proefschrift_final_zonder.indd 146 22-10-15 15:08 Summary, discussion and future perspectives

regulation depends on several important factors: environment, genetics, epigenetics, and

to sunlight and dietary intake of vitamin D (47), VDR transcriptional activity and protein the interaction between them (46). Whereas levels of vitamin D mainly reflect exposure

expression is subjected to genetic and epigenetic modifications. These modifications (46). influence direct regulation of VDR, as well as the VDR-dependent-regulation of other genes

that modify transcript abundance of a gene without altering DNA sequence. Epigenetic The term epigenetic modification refers to a subset of changes in specific genomic regions

associated with interindividual variation in gene expression levels in multiple cell types modifications especially occur during early embryonic phase and these changes are later in life (27). I hypothesize that genetic and epigenetic diversity in vitamin D biology may have a role in HF pathology as well. As an example, in this thesis it was shown that

pressure of the offspring. Although the genotype and environment were the same, rats from periconceptional vitamin D deficiency in rats was associated with elevation in blood

reported about the observation that underlying VDR genotype modulated expression levels vitamin D deficient parents fed had a different phenotype. Furthermore, a previous study

These results suggest that epigenetic and genetic variation is associated with changes in of plasma microRNAs, and by this mechanism influenced plasma vitamin D levels (48). vitamin D biology and may affect health outcomes later in life. I therefore propose that in- utero programming of vitamin D biology contributes to altered disease susceptibility in an

individual. In my opinion, targeting vitamin D biology as modifier of genetic and epigenetic elucidate if targeting of vitamin D biology from early life on may prevent development and variation must be regarded as a novel and promising field. Future studies are requested to progression of (cardiovascular)disease at higher age.

Vitamin D: a marker of general health? The potency of vitamin D in HF is coming into a

clearer view. Although the results from some major studies are still awaited, the general 1 and provide an overview on how I foresee the role of vitamin D in HF. I consider the profile of vitamin D as potential target in HF has taken shape. I illustrated this in Figure potential of activation of the vitamin D-VDR axis as therapeutic target in HF likely to be limited, although I would like to stress that future studies are crucial to form a conclusive

message if vitamin D therapy is beneficial, neutral or harmful in HF. A novel and interesting studies should address if these variations provide novel targets in vitamin D biology as well topic in this field may be within modification of genetis and epigenetic diversity. Future as in prevention and treatment of HF.

147

Proefschrift_final_zonder.indd 147 22-10-15 15:08 7 Chapter 7 Summary, discussion and future perspectives

Figure 1 - Overview of the potency of vitamin D biology as modifier in HF

Although it may now appear that low levels of vitamin D are not a direct cause or risk factor in development and progression of HF, however, low levels of vitamin D are consistently

suggests that low levels of vitamin D are indicative for an individual’s general health status, associated with all-cause and cardiovascular-specific mortality (49,50). In my opinion, this and that low levels of vitamin D may indicate overall poor health. In addition, I propose that vitamin D should be regarded as a biomarker of health, and that it should be assessed as such. With the ageing population breathing down our necks, novel strategies are currently employed to identify and treat diseases as early as possible. I hope that future studies will focus on the question if assessing vitamin D could prove its usefulness in this.

Conclusion In the last decade, vitamin D biology has been studied more extensively than ever before. Although modifying vitamin D biology has been considered to have multivalent potency

148

Proefschrift_final_zonder.indd 148 22-10-15 15:08 Summary, discussion and future perspectives

in heart disease, the initial enthusiasm has dampened. This thesis contributes to the understanding of the role of vitamin D biology in HF. It further shows that interesting associations between vitamin D biology and HF exist, and that modulation of vitamin D in experimental models affects the condition of the heart and HF. However, the role for vitamin D as a novel target in HF biology is not straightforward and may be limited. Nevertheless, at this stage, a potential utility of vitamin D supplementation or VDR activation cannot be ruled out yet and large scale studies are underway addressing this issue. For sure, if low levels of vitamin D are not cause, but rather consequence of disease (51), monitoring vitamin D biology may be used as a novel and useful tool in the panoply of means to ascertain an individual’s general health status.

149

Proefschrift_final_zonder.indd 149 22-10-15 15:08 7 Chapter 7 Summary, discussion and future perspectives

References term survival. Eur J Heart Fail 2006 Jan;8(1):23- 30. 1. Bouillon R, Carmeliet G, Verlinden L, van Etten E, Verstuyf A, Luderer HF, et al. Vitamin D and human 10. Zittermann A, Schleithoff SS, Tenderich G, health: lessons from vitamin D receptor null mice. Berthold HK, Korfer R, Stehle P. Low vitamin D Endocr Rev 2008 Oct;29(6):726-776. status: a contributing factor in the pathogenesis of congestive heart failure? J Am Coll Cardiol 2003 2. Li YC, Kong J, Wei M, Chen ZF, Liu SQ, Cao LP. Jan 1;41(1):105-112. 1,25-Dihydroxyvitamin D(3) is a negative endocrine regulator of the renin-angiotensin 11. Wu-Wong JR. Potential for vitamin D receptor Rsystem. J Clin Invest 2002 Jul;110(2):229-238. agonists in the treatment of cardiovascular disease. Br J Pharmacol 2009 Sep;158(2):395-412. 3. Li YC. Vitamin D regulation of the renin-angiotensin system. J Cell Biochem 2003 Feb 1;88(2):327-331. 12. Xiang W, Kong J, Chen S, Cao LP, Qiao G, Zheng W, et al. Cardiac hypertrophy in vitamin D 4. Yu S, Cantorna MT. The vitamin D receptor is receptor knockout mice: role of the systemic and required for iNKT cell development. Proc Natl cardiac renin-angiotensin systems. Am J Physiol Acad Sci U S A 2008 Apr 1;105(13):5207-5212. Endocrinol Metab 2005 Jan;288(1):E125-32.

5. Zhu Y, Mahon BD, Froicu M, Cantorna MT. Calcium 13. and 1 alpha,25-dihydroxyvitamin D target the G, Stehouwer CD, et al. 3 Pilz S, Henry RM, Snijder MB, van Dam RM, Nijpels TNF-alpha pathway to suppress experimental myocardial structure and function in older men Vitamin D deficiency and and women: the Hoorn study. J Endocrinol Invest Jan;35(1):217-224. 2010 Oct;33(9):612-617. inflammatory bowel disease. Eur J Immunol 2005

6. Michel G, Gailis A, Jarzebska-Deussen B, 14. Muschen A, Mirmohammadsadegh A, Ruzicka T. Jul 19;357(3):266-281. Holick MF. Vitamin D deficiency. N Engl J Med 2007 1,25-(OH)2-vitamin D3 and calcipotriol induce IL- 10 receptor gene expression in human epidermal 15. Holick MF. High prevalence of vitamin D inadequacy and implications for health. Mayo Clin Proc 2006 Mar;81(3):353-373. cells. Inflamm Res 1997 Jan;46(1):32-34. 7. O’Connell TD, Simpson RU. Immunochemical

3 16. Barnett K, Mercer SW, Norbury M, Watt G, Wyke receptor protein in human heart. Cell Biol Int 1996 S, Guthrie B. Epidemiology of multimorbidity and identification of the 1,25-dihydroxyvitamin D Sep;20(9):621-624. implications for health care, research, and medical education: a cross-sectional study. Lancet 2012 Jul 8. Nibbelink KA, Tishkoff DX, Hershey SD, Rahman A, 7;380(9836):37-43.

Simpson RU. 1,25(OH)2-vitamin D3 actions on cell proliferation, size, gene expression, and receptor 17. Liu LC, Voors AA, van Veldhuisen DJ, van der Veer localization, in the HL-1 cardiac myocyte. J Steroid et al. Vitamin D Biochem Mol Biol 2007 Mar;103(3-5):533-537. status and outcomes in heart failure patients. Eur J E, Belonje AM, Szymanski MK, Heart Fail 2011 Jun;13(6):619-625. 9. van Jaarsveld CH, Ranchor AV, Kempen GI, Coyne JC, van Veldhuisen DJ, Sanderman R. Epidemiology 18. Schierbeck LL, Jensen TS, Bang U, Jensen G, Kober of heart failure in a community-based study of L, Jensen JE. Parathyroid hormone and vitamin D--markers for cardiovascular and all cause

subjects aged > or = 57 years: incidence and long- 150

Proefschrift_final_zonder.indd 150 22-10-15 15:08 Summary, discussion and future perspectives

mortality in heart failure. Eur J Heart Fail 2011 PREVEND. Eur Heart J 2013 May;34(19):1424- Jun;13(6):626-632. 1431.

19. Rahman A, Hershey S, Ahmed S, Nibbelink K, 26. Dominguez-Salas P, Cox SE, Prentice AM, Hennig Simpson RU. Heart extracellular matrix gene BJ, Moore SE. Maternal nutritional status, C(1) metabolism and offspring DNA methylation: a knockout mice. J Steroid Biochem Mol Biol 2007 expression profile in the vitamin D receptor Mar;103(3-5):416-419. Proc Nutr Soc 2012 Feb;71(1):154-165. review of current evidence in human subjects.

20. Zhou C, Lu F, Cao K, Xu D, Goltzman D, Miao 27. Rakyan VK, Blewitt ME, Druker R, Preis JI,

D. Calcium-independent and 1,25(OH)2D3- Whitelaw E. Metastable epialleles in mammals. dependent regulation of the renin-angiotensin Trends Genet 2002 Jul;18(7):348-351. system in 1alpha-hydroxylase knockout mice. Kidney Int 2008 Jul;74(2):170-179. 28. Dominguez-Salas P, Moore SE, Baker MS, Bergen AW, Cox SE, Dyer RA, et al. Maternal nutrition at 21. Fryer RM, Rakestraw PA, Nakane M, Dixon D, conception modulates DNA methylation of human Banfor PN, Koch KA, et al. Differential inhibition metastable epialleles. Nat Commun 2014 Apr of renin mRNA expression by paricalcitol and 29;5:3746. calcitriol in C57/BL6 mice. Nephron Physiol 2007;106(4):p76-81. 29. Gaynullina D, Shestopalov VI, Panchin Y, Tarasova OS. Pannexin 1 facilitates arterial relaxation 22. via an endothelium-derived hyperpolarization et al. Serum mechanism. FEBS Lett 2015 Apr 28;589(10):1164- van Ballegooijen AJ, Visser M, Snijder MB, 25-hydroxyvitamin D and parathyroid hormone in 1170. Dekker JM, Nijpels G, Stehouwer CD, relation to plasma B-type natriuretic peptide: the Hoorn Study. Endocr Connect 2012 Jul 21;1(1):48- 30. Gaynullina D, Tarasova OS, Kiryukhina OO, 57. Shestopalov VI, Panchin Y. Endothelial function is impaired in conduit arteries of pannexin1 23. knockout mice. Biol Direct 2014 May 17;9:8-6150- AE, Garcia M, Harris TB, et al. Serum vitamin D 9-8. van Ballegooijen AJ, Visser M, Cotch MF, Arai and parathyroid hormone in relation to cardiac structure and function: the ICELAND-MI substudy 31. Manson JE, Bassuk SS, Lee IM, Cook NR, Albert MA, Gordon D, et al. The VITamin D and OmegA-3 Jun;98(6):2544-2552. TriaL (VITAL): rationale and design of a large of AGES-Reykjavik. J Clin Endocrinol Metab 2013 randomized controlled trial of vitamin D and 24. marine omega-3 fatty acid supplements for the IA. Parathyroid hormone and cardiovascular primary prevention of cancer and cardiovascular van Ballegooijen AJ, Reinders I, Visser M, Brouwer disease events: A systematic review and meta- disease. Contemp Clin Trials 2012 Jan;33(1):159- analysis of prospective studies. Am Heart J 2013 171. May;165(5):655-64, 664.e1-5. 32. Dalbeni A, Delva P, Minuz P. Could vitamin D 25. Brouwers FP, de Boer RA, van der Harst P, Voors supplements be a new therapy for heart failure? AA, Gansevoort RT, Bakker SJ, et al. Incidence Possible pathogenic mechanisms from data of and epidemiology of new onset heart failure intervention studies. Am J Cardiovasc Drugs 2014 with preserved vs. Oct;14(5):357-366. community-based cohort: 11-year follow-up of reduced ejection fraction in a

151

Proefschrift_final_zonder.indd 151 22-10-15 15:08 7 Chapter 7 Summary, discussion and future perspectives

33. Amin A, Minaee S, Chitsazan M, Naderi N, Taghavi May;175(5):745-754. S, Ardeshiri M. Can vitamin D supplementation improve the severity of congestive heart failure? 41. Vimaleswaran KS, Cavadino A, Berry DJ, LifeLines Congest Heart Fail 2013 Jul-Aug;19(4):E22-8. Cohort Study investigators, Jorde R, Dieffenbach AK, et al. Association of vitamin D status with 34. Boxer RS, Kenny AM, Schmotzer BJ, Vest M, Fiutem arterial blood pressure and hypertension risk: a JJ, Pina IL. A randomized controlled trial of high mendelian randomisation study. Lancet Diabetes

dose vitamin D3 in patients with heart failure. JACC Endocrinol 2014 Sep;2(9):719-729. Heart Fail 2013 Feb;1(1):84-90. 42. Afzal S, Nordestgaard BG. Low vitamin D and 35. hypertension: a causal association? Lancet et al. Short- Diabetes Endocrinol 2014 Sep;2(9):682-684. Schroten NF, Ruifrok WP, Kleijn L, Dokter MM, term vitamin D supplementation lowers plasma Sillje HH, Lambers3 Heerspink HJ, renin activity in patients with stable chronic 43. Ooi EM, Afzal S, Nordestgaard BG. Elevated heart failure: an open-label, blinded end point, remnant cholesterol in 25-hydroxyvitamin D randomized prospective trial (VitD-CHF trial). Am Heart J 2013 Aug;166(2):357-364.e2. randomization study. Circ Cardiovasc Genet 2014 deficiency in the general population: Mendelian Oct;7(5):650-658. 36. Ford JA, MacLennan GS, Avenell A, Bolland M, Grey A, Witham M, et al. Cardiovascular disease 44. Pilz S, Gaksch M, O’Hartaigh B, Tomaschitz A, and vitamin D supplementation: trial analysis, systematic review, and meta-analysis. Am J Clin cardiovascular disease: where do we stand in Marz W. The role of vitamin D deficiency in Nutr 2014 Sep;100(3):746-755. 2013? Arch Toxicol 2013 Dec;87(12):2083-2103.

37. Donneyong MM, Hornung CA, Taylor KC, 45. Lutsey PL, Michos ED, Misialek JR, Pankow JS, Baumgartner RN, Myers JA, Eaton CB, et al. Risk Loehr L, Selvin E, et al. Race and Vitamin D of heart failure among postmenopausal women: Binding Protein Gene Polymorphisms Modify the a secondary analysis of the randomized trial of Association of 25-Hydroxyvitamin D and Incident vitamin D plus calcium of the women’s health Heart Failure: The ARIC (Atherosclerosis Risk initiative. Circ Heart Fail 2015 Jan;8(1):49-56. in Communities) Study. JACC Heart Fail 2015 May;3(5):347-356. 38. Dietary vitamin D and risk of heart failure in the 46. Saccone D, Asani F, Bornman L. Regulation of the Robbins J, Petrone AB, Gaziano JM, Djousse L. Physicians’ Health Study. Clin Nutr 2015 Apr 22. vitamin D receptor gene by environment, genetics and epigenetics. Gene 2015 May 1;561(2):171- 39. Pilz S, Gaksch M, Kienreich K, Grubler M, Verheyen 180. N, Fahrleitner-Pammer A, et al. Effects of vitamin D on blood pressure and cardiovascular risk factors: 47. Lamberg-Allardt C. Vitamin D in foods and a randomized controlled trial. Hypertension 2015 as supplements. Prog Biophys Mol Biol 2006 Jun;65(6):1195-1201. Sep;92(1):33-38.

40. Beveridge LA, Struthers AD, Khan F, Jorde R, 48. Pike JW, Meyer MB, St John HC, Benkusky NA. Scragg R, Macdonald HM, et al. Effect of Vitamin D Supplementation on Blood Pressure: A Systematic regulators as determinants of context dependent Epigenetic histone modifications and master Review and Meta-analysis Incorporating nuclear receptor activity in bone cells. Bone 2015 Individual Patient Data. JAMA Intern Med 2015 Mar 27.

152

Proefschrift_final_zonder.indd 152 22-10-15 15:08 Summary, discussion and future perspectives

49. Schottker B, Haug U, Schomburg L, Kohrle J, Perna L, Muller H, et al. Strong associations of 25-hydroxyvitamin D concentrations with all- cause, cardiovascular, cancer, and respiratory disease mortality in a large cohort study. Am J Clin Nutr 2013 Apr;97(4):782-793.

50. Schottker B, Jorde R, Peasey A, Thorand B, Jansen EH, Groot L, et al. Vitamin D and mortality: meta- analysis of individual participant data from a large consortium of cohort studies from Europe and the United States. BMJ 2014 Jun 17;348:g3656.

51. Reid D, Toole BJ, Knox S, Talwar D, Harten J, O’Reilly DS, et al. The relation between acute

and plasma 25-hydroxyvitamin D concentrations changes in the systemic inflammatory response after elective knee arthroplasty. Am J Clin Nutr 2011 May;93(5):1006-1011.

153

Proefschrift_final_zonder.indd 153 22-10-15 15:08 Proefschrift_final_zonder.indd 154 22-10-15 15:08 Nederlandse Samenvatting

Vitamine D biologie is primair bekend vanwege zijn rol in botgezondheid. Vitamine D blijkt echter een pleiotrope vitamine en transcriptiefactor te zijn met meerdere effecten op weefsels in het lichaam (inclusief het hart) en dit versterkt het vermoeden dat vitamine D algemene gezondheid. De vitamine D receptor (VDR) is aanwezig in bijna alle organen en

naast botregulatie ook betrokken is bij andere processen. Er wordt zelfs verondersteld dat vitamine D verantwoordelijk is voor 3% van de totale genregulatie in het lichaam. complex). In samenwerking met een nuclear hormone receptor partner In het menselijke lichaam vormt vitamine D een complex met de VDR (vitamine D-VDR (zoals retinoid-X-receptor [RXR]) en verschillende cofactoren reguleert dit complex

endocriene regulator van het renine-angiotensine-aldosteron-systeem (RAAS): een de genexpressie van downstream gelegen genen. Zo is het bijvoorbeeld een negatieve

inclusief hartfalen (HF). Daarnaast heeft vitamine D ook een regulerende werking op welbekend aangrijpingspunt in de behandeling en preventie van cardiovasculaire ziekte,

inflammatie en proliferatie, beiden belangrijk in de ontwikkeling van HF. HF is een groot probleem in de Westerse Wereld en heeft een nog steeds toenemende

incidentie en prevalentie. Ondanks huidige optimale therapieën blijft de prognose voor HF slecht, met een 5-jaarsoverleving die slechter is dan sommige soorten kanker. Er is hebben bediscussieerd dat vitamine D biologie de potentie bezit een interessante en daarom een continue zoektocht gaande naar nieuwe behandelingsmogelijkheden en al velen

modificeerbare factor in HF-pathofysiologie te kunnen zijn. Het doel van dit proefschrift is om de rol van vitamine D biologie in HF te onderzoeken,

preventieve toepassingen van vitamine D in patiënten met HF. De resultaten in dit om op deze manier bij te dragen aan begripvorming rondom de therapeutische en proefschrift vergroten de huidige kennis op zowel klinisch als experimenteel gebied. Bovendien voorziet dit proefschrift in enkele aanbevelingen hoe bepaling van vitamine D waardes alsook onderzoek naar vitamine D biologie gebruikt zou kunnen worden in de

worden. dagelijkse praktijk en hoe specifieke vitamine D waardes geïnterpreteerd zouden kunnen

155

Proefschrift_final_zonder.indd 155 22-10-15 15:08 Nederlands samenvatting Nederlandse samenvatting

Vitamine D biologie en cardiovasculaire ziekte: de rationale.

Vitamine D deficiëntie is verschillende multifactoriële ziekten zoals hypertensie, COPD en diabetes mellitus. Het een wereldwijd probleem en wordt in relatie gebracht met toegenomen prevalentie van

aantal ziektes per individu stijgt met de leeftijd en dat de meeste individuen op gevorderde leeftijd hebben dan ook meer dan één ziekte. In het verleden hield men zich voornamelijk is echter aanwezig in het gehele lichaam en er wordt daarom gedacht dat dalende vitamine bezig met de rol van vitamine D deficiëntie en het optreden van één enkele ziekte. De VDR D waardes verband kunnen houden met toegenomen ziekteprevalentie in meerdere

of er een relatie bestaat tussen de hoogte van circulerend vitamine D en het voorkomen van onafhankelijke ziektedomeinen. Om deze veronderstelling te testen hebben wij onderzocht

meerdere ziektes in één individu. In hoofdstuk 4 confounders, geassocieerd is met het aantal ziekten in een individu en dat deze relatie het laten wij zien dat lage vitamine D waardes, na correctie voor verschillende

gerapporteerd in het gastro-intestinale (22%), centrale zenuwstelsel (17%), respiratoire sterkst is in personen met vitamine D deficiëntie (<25 nmol/L). De meeste ziekten werden (16%), cardiovasculaire (15%) en endocriene (12%) domein. Hoewel de relatie tussen een

lage vitamine D waarde en toename in individuele ziekteprevalentie niet specifiek gold voor tussen circulerend vitamine D en aanwezigheid van cardiovasculaire ziekte. Deze observatie één bepaalde ziekte of ziektedomein, observeerden wij een duidelijke omgekeerde relatie

patiënten met cardiovasculaire ziekte. ondersteunt de gedachte dat vitamine D deficiëntie een veelvoorkomend fenomeen is in

Wij zijn niet de eersten die de relatie tussen lage vitamine D waardes en een verhoogde kans op cardiovasculaire ziekte beschrijven: al in 2003 beschreef Zitterman dat patiënten met congestief HF significant lagere vitamine D waarde hadden dan hun evenoude gezonde controles. Verscheidene andere studies rapporteerde daarna vergelijkbare resultaten uitkomst in patiënten met HF. Desalniettemin beantwoordden deze studies niet de vraag op en benadrukten keer op keer dat hogere vitamine D waardes gerelateerd zijn aan betere

welke wijze laag vitamine D uitkomsten in HF-patiënten beïnvloedt. In hoofdstuk 2 werkingsbiologie in HF samen te vatten. Dit hoofdstuk maakt gebruik van een hebben we gepoogd de huidige kennis over vitamine D en zijn systematische analyse en voorziet in een uitgebreide samenvatting hoe vitamine D signaling

pathofysiologische en moleculaire veranderingen in HF zou kunnen beïnvloeden. Vanwege aangrijping op renin en angiontensine II waardes en (indrecte) remming van het RAAS zou in preventie en behandeling van HF. Daarnaast zou activatie van de VDR ook een velerlei het vitamine D-VDR complex mogelijkerwijs een beschermende functie kunnen hebben

aan andere effecten teweeg kunnen brengen die HF pathofysiologie kunnen beïnvloeden, 156

Proefschrift_final_zonder.indd 156 22-10-15 15:08 Nederlandse samenvatting

en stimulatie van afgifte van natriuretische eiwitten en andere intracellulaire signaling zoals modulatie van inflammatoire processen (remming van macrofagen en cytokines) processen.

De rol van vitamine D biologie in de behandeling van HF. Een deel van bovengenoemde hoofdstuk 5, waarin we hebben onderzocht of activatie

veronderstellingen zijn getoetst in HF op basis van linker ventrikel pressure overload te creëren ondergingen muizen een van het vitamine D-VDR complex HF-pathofysiologie kan beïnvloeden. In een poging om transaortacale constrictie (TAC) of SHAM operatie. Na operatie werden muizen gedurende 5 weken behandeld met placebo, losartan (een angiotensine receptor blokker [ARB]), paricalcitol (een selectieve VDR-activator, VDRA) of een combinatie van losartan en paricalcitol. TAC-operatie in muizen bleek een betrouwbare en reproduceerbare techniek te

met paricalcitol, of een combinatie van paricalcitol en losartan, was echter niet in staat zijn om linkerventrikel hypertrofie (LVH) en hypertensie te bewerkstelligen. Behandeling LVH te verminderen. Daarentegen beschermde behandeling met paricalcitol wel tegen

linkerventrikel (TAC 5.9 ±1.0 vs. paricalcitol 1.6±0.3%). diastolische dysfunctie en verminderde het significant de hoeveelheid fibrose in het

Circulerende vitamine D waardes zijn omgekeerd evenredig aan circulerend parathyreoïdhormoon (PTH) waardes en verlaagde vitamine D is een welbekende oorzaak van secundaire hyperparathyreoïdie. Patiënten met deze ziekte hebben extreem verhoogde cardiovasculaire ziekten en cardiovasculaire pathologie. Verhoogde PTH waardes zouden PTH waardes en dit lijkt geassocieerd te zijn met een verhoogd risico op het ontstaan van

bewerkstelligen. zorgen voor cardiomyocyt hypertrofie en bovendien een profibrotische status In hoofdstuk 5

tonen wij aan dat paricalcitol niet alleen fibrose vermindert, maar ook circulerende PTH waardes verlaagt. Ondanks dat wij niet konden aantonen dat de vermindering van fibrose een direct PTH-afhankelijk effect was, hypothetiseer ik dat de het myocard kan verklaren. Remodeling in het hart is een complex proces en toekomstige afname in circulerend PTH, op zijn minst gedeeltelijk, de verminderde fibrosevorming in studies zullen moeten onderzoeken of PTH een bepalende factor is in dit proces. Een

toenemende hoeveelheid bewijs suggereert dat modificatie van PTH weleens een remodeling en behandeling van cardiovasculaire ziekten. veelbelovend nieuw aangrijpingspunt zou kunnen blijken in de preventie van cardiale

De rol voor vitamine D biologie in het voorkomen van HF. Lage waardes circulerend vitamine

door verhoogde systolische en diastolische bloeddruk met verhoogde serum glucose en LDL D zijn geassocieerd met een ongunstig cardiovasculair risicoprofiel dat wordt gekenmerkt

157

Proefschrift_final_zonder.indd 157 22-10-15 15:08 Nederlands samenvatting Nederlandse samenvatting

waardes en verlaagde HDL waardes (hoofdstuk 3 & 4). In dit proefschrift (hoofdstuk 3 & 4) wordt beschreven dat individuen met lagere vitamine

D waardes (<50 nmol/L) een grotere kans hebben om man te zijn, een hoger BMI te hebben en verminderde lichamelijke activiteit uit te oefenen. Daarnaast blijken individuen met minder zuivelproducten (hoofdstuk 4). Interessant genoeg worden (de meeste van) eerder deficiënte vitamine D waardes (<25 nmol/L) vaker actieve rokers te zijn en consumeren zij genoemde factoren ook wel beschouwd als risicofactoren voor het ontstaan van HF. Om uit

de relatie tussen vitamine D biologie en nieuw ontstaan HF in de PREVEND databank. te zoeken of vitamine D biologie een rol speelt in het ontstaan en beloop van HF testten wij

Individuen in de PREVEND databank zijn zeer goed gekarakteriseerd en wij beschikten daarnaast over een uitgebreide set aan variabelen met informatie over demografie, laboratoriumwaarden en mogelijk andere confounding factoren. In de primaire analyse in het ontstaan en het beloop van HF. Gedurende een mediane follow-up van 12.6 bestudeerden wij of calcidiol, calcitriol of PTH als risicofactoren kunnen worden beschouwd

(interquartile range 12.3-12.9) jaar ontwikkelden 283 individuen HF. Calcidiol, calcitriol en suggereert dat, in de algemene bevolking, circulerende waardes calcidiol, calcitriol en PTH PTH waardes bleken niet onafhankelijk geassocieerd te zijn met het ontstaan van HF. Dit

niet direct bijdragend zijn aan HF pathofysiologie. Ondanks dat lage vitamine D waardes wellicht geassocieerd zijn met een ongunstig cardiovasculair profiel, meen ik dat deze data heeft in het ontstaan en het beloop van HF. erop wijzen dat het zeer onwaarschijnlijk is dat vitamine D biologie een oorzakelijke rol

Vitamine D deficiëntie is de meest voorkomende voedingsdeficiëntie in mannen, omgevingsfactoren in volwassenen (zoals voedingstekorten in zwangere vrouwen) vrouwen en kinderen wereldwijd. Een toenemende hoeveelheid data suggereren dat

veranderingen. In de vroege embryonele fase is DNA methylatie een willekeurig proces gezondheidsuitkomsten in de volgende generatie(s) kan beïnvloeden via epigenetische

dat verantwoordelijk is voor epigenetische variatie tussen personen. Interessant genoeg blijkt dat periconceptionele waardes van biomarkers en substraten het proces van DNA methylatie op voorspelbare wijze kan beïnvloeden. Zoals eerder beschreven in hoeveelheid aandoeningen in een individu. Desalniettemin zou vitamine D via dit proefschrift blijkt vitamine D deficiëntie geassocieerd te zijn met een toegenomen

hoofdstuk 6 periconceptionele (epi)genetische veranderingen ook op indirecte wijze kunnen bijdragen fenomeen. aan ontvankelijkheid voor ziekte. In bespraken wij dit interessante

Mannelijke en vrouwelijke Sprague-Dawley ratten werden op een standaard of vitamine D deficiënt dieet gezet. Na 10 weken paarden ratten van elke dieetgroep. Direct na geboorte van de pups werd het vitamine D deficiënte dieet vervangen door het standaard dieet 158

Proefschrift_final_zonder.indd 158 22-10-15 15:08 Nederlandse samenvatting

en gedurende opvolgende experimenten werden alle ratten met hetzelfde standaard

dieet gevoerd. Wij beschouwden het nageslacht in deze studie als genetisch identiek, en dit gold evenzo voor de omgevingsfactoren waaraan zij blootgesteld waren. Dit maakt het aannemelijk dat mogelijke verschillen in het nageslacht zeer waarschijnlijk het resultaat zijn van veranderingen in de baarmoeder. Wij observeerden dat pups van 10 hogere systolische en diastolische bloeddruk hadden, met daarnaast verminderde weken oud, afkomstig van vitamine D deficiëntie ouders (F1-depl-ratten), een significant

met toegenomen hypermethylatie van het Pannexine-1 gen (Panx1 endotheelafhankelijke relaxatie van de grote vaten. Mechanistisch was dit geassocieerd afname in transcriptproduct van Panx1 in de aorta’s van F1-depl-ratten. Panx1 codeert ) en tegelijkertijd

voor het hemikanaal Pannexine-1 waarvan wordt gedacht dat het een belangrijke speelt in de Acetylcholineafhankelijke endotheel relaxatie in de vaten. Al met al suggereert dit een plausibel onderliggend biologisch mechanisme voor de geobserveerde stijging in bloeddruk. Naar aanleiding van deze studie concludeer ik dat vitamine D deficiëntie in ouders dragen aan toegenomen vatbaarheid voor ziekten later in het leven. Toekomstige studies geassocieerd kan zijn met epigenetische veranderingen in het nageslacht die bij kunnen zullen het translationele belang van deze bevinding aan moeten tonen.

Discussie en toekomst perspectief

Vitamine D heeft de afgelopen tientallen jaren een flinke hoeveelheid aandacht gekregen. Daarbij is vooral de rol van deze vitamine buiten het botmetabolisme meer bestudeerd dan D in cardiovasculaire ziekte heeft onderzoekers over de gehele wereld geënthousiasmeerd. ooit tevoren. De zoektocht naar het ontrafelen van alle mogelijke toepassingen van vitamine

positief als eerste observaties hebben doen suggereren. De resultaten van VITAL, een groots Helaas heeft meer recente data dit enthousiasme doen inperken: niet alle uitkomsten zijn zo

omega-3 vetzuren (1 gram) in primaire preventie van kanker, hartziekte en beroerte in de opgezette suppletie studie naar het effect van dagelijkse vitamine D3 suppletie (2000 IU) of algemene populatie, worden daarom vol verwachting afgewacht.

Vitamine D biologie en HF

. Data van de PRIMO randomized control trial (RCT) zijn de oorzaak van de eerste scheurtjes in de hoge verwachtingen die men had van vitamine placebogecontroleerde trial bestudeerde in 227 patiënten met chronische nierziekte en D als mogelijke centrale speler in HF-pathofysiologie. Deze multicenter dubbelblinde LVH het effect van 48 weken behandeling met paricalcitol op hartfunctie en hartstructuur. Helaas bleek dat zowel linkerventrikel massa als diastolische functie niet verbeterden na therapie met paricalcitol. Hoewel deze eerste resultaten als negatief kunnen worden

beschouwd, bleef het algemene gevoel over vitamine D-VDR complex activatie als mogelijke 159

Proefschrift_final_zonder.indd 159 22-10-15 15:08 Nederlands samenvatting Nederlandse samenvatting

therapie in HF positief. De PRIMO studie is dan ook opgevolgd door verscheidene andere RCTs met paricalcitol en andere VDR-activators, overigens zonder eenduidige uitkomsten. Gebaseerd op de resultaten van recente studies meen ik dat het initiële enthousiasme dat aan vitamine D biologie werd toebedeeld herevaluatie verdient. Een meta-analyse dat het

overall effect van tenminste 1 jaar vitamine D suppletie beschreef op de ontwikkeling van is in reductie van HF (overall effect RR 0.83 [95% CI 0.60-1.13]). Dit werd bovendien ook HF in individuen ouder dan 50 jaar concludeerde dat vitamine D suppletie niet effectief gesuggereerd door de resultaten van de Women’s Health Initiative (een dubbelblinde RCT waarin 35983 vrouwen 1:1 werden gerandomiseerd naar Calcium 1000 mg/d plus 400

IU/d Vitamine D3 observatie dat vitamine D suppletie een beschermende functie heeft in het ontstaan van HF of placebo). Enige nuance van deze conclusie blijft echter nodig gezien de in vrouwen met een laag baseline risico (Hazard Ratio 0.63 [95% CI 0.46-0.87]), maar niet

in vrouwen in de hoog risico subgroep. Het effect van vitamine D (fortificatie) in het dieet lijkt daarnaast ook beperkt: in een prospectieve studie in 19.653 mannen op middelbare HF. Ik ben dan ook voorstander van de aanbeveling om suppletie in patiënten met HF niet af leeftijd werd geen associatie gevonden tussen vitamine D consumptie en het optreden van

te laten wijken van de standaard richtlijnen voor vitamine D suppletie. De bovengenoemde effecten berusten zich op het concept dat vitamine D HF-

pathofysiologie direct beïnvloedt via processen die aangrijpen op endotheel functie, fibrose, geassocieerd met toegenomen prevalentie van verscheidene risicofactoren voor HF zoals immunomodulatie en inflammatie (Figuur 1). Echter, vitamine D deficiëntie is ook

dat modulatie van HF-risicofactoren middels activatie van vitamine D biologie wellicht ook verhoogde bloeddruk, BMI en een ongunstig metabool profiel. Dit zou kunnen betekenen

de resultaten van de recent gepubliceerde Styrian Vitamin D Hypertension Trial (een (indirect) HF-pathofysiologie beïnvloedt. Het is dan ook teleurstellend om te lezen dat singlecenter, dubbelblinde, placebogecontroleerde studie met 200 deelnemers met

of olieachtige druppels gedurende 8 arteriële hypertensie en calcidiol waardes <30 ng/mL3 die 1:1 gerandomiseerd werden weken) suggereren dat vitamine D suppletie bloeddruk niet verlaagt. Dit komt bovendien naar een dagelijkse gift van 2800 IU vitamine D overeen met de conclusie van een recente meta-analyse naar het effect van suppletie in

bloeddrukverlagend middel. Daarentegen concludeerde een Mendeliaanse randomnisatie hypertensie, waarin werd gerapporteerd dat vitamine D zeer waarschijnlijk ineffectief is als studie (108173 individuen uit 35 verschillende studies) dat hogere plasma concentraties

variabele analyse werd gevonden dat elke 10% toename in vitamine D was geassocieerd vitamine D mogelijkerwijs het risico op hypertensie verkleinen: middels een instrumentele met een 0,29 mmHg afname in diastolische en 0,37 mmHg afname in systolische bloeddruk.

Het mag duidelijk zijn dat de geobserveerde effecten in deze studie klein zijn, veel kleiner 160

Proefschrift_final_zonder.indd 160 22-10-15 15:08 Nederlandse samenvatting

dan verwacht, en toekomstige studies met vergelijkbare studiegrootte zullen noodzakelijk Ook studies die zich hebben gericht op het effect van vitamine D biologie in relatie zijn om deze bevindingen en hun klinische betekenis te bekrachtigen danwel te valideren. tot andere HF-risicofactoren dragen eenzelfde gemengde boodschap uit. Ondanks de beschikbaarheid van grote cohorten en een enorme hoeveelheid aan data ontbreekt een

ongunstige effecten heeft op het ontstaan en de ontwikkeling van HF. definitieve conclusie of activatie van het vitamine D-VDR complex gunstige, neutrale of

indirecte modulator in HF-pathofysiologie beperkt is. Gezien de marginale effecten in Dit alles doet mij geloven dat het effect van vitamine D suppletie als directe en grote cohortstudies verwacht ik een enorm hoog number-to-treat voordat effect te

verwachten valt. Alhoewel het idee van wereldwijde vitamine D suppletie theoretisch gezien prijzenswaardig mag zijn (en wellicht ook al deels wordt uitgevoerd middels fortificatie van bepaalde voedingsproducten) meen ik dat dit in alle redelijkheid geen wenselijke suggestie moet zijn voor de dagelijkse praktijk; al dan niet op de laatste hebben. plaats vanwege het zeer waarschijnlijke marginale of afwezige verwachte effect dat dit zal

Vitamin D biologie: de rol van genetica en epigenetica. Ondanks de toenemende hoeveelheid neutrale, en soms teleurstellende resultaten kan een rol voor vitamine D biologie in HF nog niet worden uitgesloten. Recente studies suggereren dat genetische diversiteit een

genetische diversiteit zou een grote rol kunnen spelen in de relatie tussen lage vitamine belangrijke factor is in de variatie in vitamine D biologie in verschillende etniciteiten. Deze D waardes en HF: individuen met een genetische variant in een enkel allel hebben zowel verhoogd risico op lagere plasma vitamine D waardes alsook op het ontstaan van HF.

van obesitas en diabetes mellitus 2 in personen met lagere vitamine D waardes kunnen Genetische variatie zou bovendien ook de (gedeeltelijk) toegenomen prevalentie verklaren. Verschillende studies hebben aangetoond dat vitamine D biologie en regulatie

en de interactie tussen deze factoren. Omgevingsfactoren zoals blootstelling aan zonlicht en van de VDR afhankelijk zijn van enkele belangrijke factoren: omgeving, genetica, epigenetica

genetische en epigenetische veranderingen transcriptionele activiteit en eiwitexpressie van vitamine D consumptie bepalen voornamelijk de hoeveelheid circulerend vitamine D, terwijl

VDR beïnvloeden. Deze veranderingen spelen niet alleen een directe rol in regulatie van de VDR maar beïnvloeden ook VDR-afhankelijke regulatie van andere genen. Het begrip het genoom die de eigenschap bezitten het transcriptproduct van een gen te veranderen epigenetische modificatie verwijst naar een aantal veranderingen in specifieke regio’s in

zonder de DNA sequentie te wijzigen. Epigenetische veranderingen treden voornamelijk op voor de individuele variatie in genexpressie in verschillende celtypes later in het leven. Ik in de vroege embryonale fase en deze veranderingen worden verantwoordelijk gehouden

161

Proefschrift_final_zonder.indd 161 22-10-15 15:08 Nederlands samenvatting Nederlandse samenvatting

hypothetiseer dat genetische en epigenetische diversiteit in vitamine D biologie wellicht

ook een belangrijke rol speelt in beïnvloeding van HF-pathologie. Als voorbeeld geldt de geassocieerd met verhoogde bloeddruk in het nageslacht. observatie in deze thesis dat periconceptionele vitamine D deficiëntie in ouderratten is Hoewel het genotype en omgevingsfactoren hetzelfde waren, bleken ratten van vitamine D

aangetoond dat een onderliggend VDR-genotype de expressie van plasma microRNA’s deficiënte ouders een ander fenotype te hebben. In ander eerder onderzoek is daarnaast

Beide bevindingen suggereren dat epigenetische en genetische variatie geassocieerd is beïnvloedde, en op deze manier (indirect) bepalend was voor plasma vitamine D waardes. met veranderingen in vitamine D biologie en dat deze variatie gezondheidsuitkomsten in-utero programming van

later in het leven kan beïnvloeden. Ik veronderstel dan ook dat vitamine D biologie een bijdragende factor is in individuele vatbaarheid voor ziekte. Naar epigenetische veranderingen een nieuw en veelbelovend veld. Toekomstige studies zullen mijn mening is de toepasbaarheid van vitamine D biologie als modulator van genetische en

fasen van het leven het ontstaan en het beloop van (cardiovasculaire) ziekten op hogere noodzakelijk zijn om uit te diepen of het aangrijpen op vitamine D biologie vanaf de eerste

leeftijd kan helpen beïnvloeden danwel voorkomen. Vitamine D: een marker van algemene gezondheid? De betekenis van vitamine D in HF

wordt steeds duidelijker. Hoewel we in afwachting zijn van de resultaten van enkele grote studies heeft er zich inmiddels een algemeen profiel van vitamine D als potentieel aangrijpingspunt in HF afgetekend. Dit profiel heb ik geprobeerd weer te geven in Figuur beschouw het effect van activatie van het vitamine D-VDR complex als medicamenteuze 1, waarbij ik schematisch presenteer hoe ik de rol van vitamine D voorzie in HF. Ik toepassing in HF beperkt, alhoewel ik wil benadrukken dat toekomstige studies essentieel

zullen zijn om een eenduidige boodschap af te geven of vitamine D therapie gunstig, Een potentieel nieuw en interessant veld kan worden gevonden in genetische neutraal of schadelijk is in patiënten met HF.

beantwoorden of genetische en/of epigenetische variatie nieuwe aanknopingspunten biedt en epigenetische modificatie. Toekomstige studies zullen de vraag moeten

in beïnvloeding van vitamine D biologie en preventie en behandeling van HF. verband vertonen met het ontstaan en de ontwikkeling van HF, en vitamine D biologie Alhoewel het er heden ten dage op lijkt dat lage vitamine D waardes geen direct causaal

dus geen officiële risicofactor is voor HF, worden lage vitamine D waardes wel consistent in relatie gebracht met algemene en cardiovasculaire-specifieke mortaliteit. Dit doet mij vermoeden dat lage vitamine D waardes een weerspiegeling zijn van algehele gezondheidsstatus van een individu en dat lage vitamine D waardes uiting zijn van een algemene slechte gezondheid. Ik stel voor dat vitamine D, op zijn minst, moet worden gezien 162

Proefschrift_final_zonder.indd 162 22-10-15 15:08 Nederlandse samenvatting

als biomarker van gezondheid en dat het op deze manier ook in de kliniek gebruikt zou moeten worden. Ten gevolge van de steeds ouder wordende bevolking wordt er continu

gewerkt aan nieuwe strategieën die nuttig zijn in de vroege opsporing en behandeling van vraag of evaluatie van vitamine D deze rol zou kunnen vervullen. ziekte. Met dit in mijn achterhoofd hoop ik dat toekomstige studies zich zullen richten op de

Conclusie

Nog nooit is vitamine D biologie uitgebreider bestudeerd dan de afgelopen jaren. Alhoewel in beginsel werd gedacht dat beïnvloeding van vitamine D biologie vele toepassingen kon hebben in hartziekte lijkt dit enthousiasme langzaamaan uit te doven. Deze thesis draagt interessante relatie bestaat tussen vitamine D biologie en HF en toont daarnaast aan dat bij aan het begrip rondom de rol van vitamine D biologie in HF. Het beschrijft dat er een modulatie van vitamine D biologie in experimentele modellen de conditie van het hart

en HF beïnvloedt. Desalniettemin leert het ons ook dat de rol voor vitamine D als nieuw aangrijpingspunt in HF biologie niet eenduidig is en wellicht zelfs beperkt. Op dit moment kan echter een mogelijke rol voor vitamine D suppletie of VDR activatie in HF nog niet worden uitgesloten en grootschalige studies zijn onderweg om dit vraagstuk definitief te beantwoorden. Het mag duidelijk zijn dat, mochten lage vitamine D waardes niet de veroorzaker zijn van ziekte maar juist het gevolg, monitoring van D biologie bepaling van algemene individuele gezondheidsstatus. een nieuwe en bruikbare toevoeging zou kunnen zijn aan het arsenaal van middelen in de

Figure 1 - Overzicht van de mogelijke manieren waarop vitamine D biologie HF kan beïnvloeden.

163

Proefschrift_final_zonder.indd 163 22-10-15 15:08 Acknowledgements Acknowledgements

dat wij ook in de toekomst nog veel projecten Acknow samen succesvol kunnen afronden. I would like to thank the members of the assessment committee for reading and approving ledge this thesis: Prof. dr. I.A. Brouwer, Prof. dr. G.J. Navis ments and Prof. dr. S. Pilz. De Junior Scientific Masterclass (JSM) wil ik Dit proefschrift zou hier vandaag niet hebben bedanken dat ze mij de mogelijkheid hebben gelegen zonder de hulp en begeleiding die ik de gegeven dit MD-PhD traject te mogen volgen. afgelopen jaren heb mogen ontvangen. Mijn dank Daarnaast wil ik het Ubbo Emmius fonds bedanken gaat uit naar eenieder die mij heeft bijgestaan voor de financiële bijdrage aan mijn onderzoek. tijdens mijn MD-PhD-traject. Enkelen van hen wil ik op de komende pagina’s in het bijzonder Beste professor W.H. van Gilst, beste Wiek. Ondanks bedanken. dat jij een stap terug hebt gedaan op de afdeling is jouw aanwezigheid nog altijd goed voelbaar. Allereerst wil ik beginnen met mijn dank te Als grondlegger van de afdeling Experimentele betuigen aan mijn beide promotores professor R. Cardiologie heb jij de juiste basis gelegd voor A. (Rudolf) de Boer en professor P. (Pim) van der het vele wetenschappelijke onderzoek dat er nu Harst. gebeurt. Ik wil je bedanken dat je mij ooit de kans hebt gegeven om als MD-PhD student op de Beste Rudolf, in 2009 begon ik onder jouw afdeling aan de slag te gaan. Het feit dat jij mij supervisie met mijn wetenschappelijke stage op hebt geholpen bij het realiseren van mijn ambitie de Experimentele‘‘ Cardiologie. Nu, 6 jaar later, om een Postdoctoral Fellowship in Amerika te doen heb ik mijn proefschrift afgerond en promoveer ik waardeer ik ten zeerste. bij jou als je allereerste MD-PhD student. Jij hebt mij geleerd te vertrouwen op mijn eigen kennis en Beste professor I.C. van Gelder, beste Isabelle. Dank kunde, zonder daarbij goede samenwerking met voor het luisterend oor en de adviezen tijdens onze anderen uit het oog te verliezen. Jouw opgewekte vrouw-tot-vrouw gesprekken. Uiteraard houd ik aard en doeltreffende aanpak van zaken maken je op de hoogte van mijn belevenissen in de Mayo je een prettig persoon om mee te werken en ik Clinic. hoop dat dit proefschrift het begin zal zijn van een langdurige en plezierige samenwerking. Ik ben During my PhD-trajectory I had the privilege benieuwd naar de komende 6 jaar! to work with several inspiring and enthusiastic researchers. I would like to thank all my co-authors Beste Pim, in eerste instantie was jij niet betrokken for their contribution to this thesis. bij dit project. In de loop der tijd veranderde dit en jouw positie als tweede promotor is dan ook Uiteraard mag en wil ik ook de medewerkers meer dan logisch. Ik bewonder je nooit aflatende van het CDP niet vergeten te bedanken. Bianca, enthousiasme en volhardendheid in het uitoefenen Michel, Annemieke en André zonder jullie hulp was van goed wetenschappelijk onderzoek. Jouw hoofdstuk 6 van dit proefschrift er niet geweest. scherpe geest en analytisch vermogen maken je Ondanks het feit dat een Parvovirus dreigde roet in uniek, zowel als mens als wetenschapper. Ik hoop het eten te gooien is dit project, mede dankzij jullie

164

Proefschrift_final_zonder.indd 164 22-10-15 15:08 Acknowledgements

flexibiliteit, met succes afgerond: dankjewel! heb je het niet altijd gemakkelijk gehad met Beste Marloes, ook jou wil ik bedanken voor je al mijn verhalen en belevenissen. Ik vind het hulp en geduld bij het hanteren van de ratten. Mijn bewonderenswaardig om te zien hoe jij in korte ‘vriendjes’ waren niet altijd even goedgehumeurd, tijd bent uitgegroeid tot stamcelspecialist van onze maar gelukkig voor mij bleef het bij één bezoekje afdeling en ik hoop dat je deze veelbelovende lijn aan de Spoed. Sander en Maurice, met jullie in doortrekt. de buurt gebeurde er altijd wat! Hoewel het de productiviteit niet altijd ten goede kwam was het De Galectine-3 boys, Rogier en Wouter M. wel gezellig. Mocht ik ooit nog een carrièreswitch Jullie bijdrage aan interessante discussies, overwegen, dan kom ik zeker solliciteren. ongemakkelijke situaties en (vrijdagmiddag) borrels valt niet in woorden te omvatten. Zonder goed management en secretariële Rogier, succes met de laatste loodjes van je ondersteuning is het voltooien van een proefschrift promotietraject. Denk ook nog eens aan ons als je een onmogelijke opgave: Daniëlle, jou wil ik in in Zwolle zit. Wouter, mijn vertrek naar Amerika het bijzonder bedanken voor alle praktische hulp, betekent een einde aan het dynamische duo Meems gezellige vrijdagmiddagborrels en andere uitjes & Meijers. Stel me niet teleur: ik vertrouw erop dat tijdens mijn promotietraject. Carla, bedankt voor jij ook zonder mijn aanwezigheid je promotie tot de hulp met alle administratieve rompslomp een succesvol einde zal brengen! die ik de afgelopen jaren bij je op het bordje hebt gelegd. Hopelijk verbeteren ze het Een belangrijk deel van wetenschap is het UMCGpasjessysteem ooit nog. Alma en Audrey presenteren van interessante en minder ontzettend bedankt voor alle organisatorische interessante wetenschappelijke resultaten op steun die ik de afgelopen jaren heb mogen vangen, congressen. Sociale ondersteuning speelt daarbij het maakte zaken vaak een stuk gemakkelijker. een belangrijke rol. Ik wil Anne, Daan (voortaan zal ik braaf de taxi nemen in plaats van de metro), Willem (toen nog Willem-Peter), DANKJEWEL! Haye, Herman (jouw voorliefde voor witte jurkjes Op onnavolgbare wijze ben jij de geheime is mij inmiddels duidelijk), Hilde (zat mijn pyjama succesformule geweest in veel van mijn eigenlijk lekker?), Ijsbrand, Marlies (succes als experimenten. Ik durf te stellen dat zonder jouw huisarts!), Niels, Rogier, Vincent, Wardit en Wouter hulp dit proefschrift hier nooit had gelegen. Je bent Wieringa bedanken voor alle gezelligheid op het een dierbare vriend en ik wens jou, Margreet en de ESC-2014 in Barcelona. Het ESC-HF 2015 in Sevilla kleine het allerbeste. kan ik maar in 1 woord omschrijven, onvergetelijk.. Biniyam (I knew you liked my shoes!), Eline, Jozine, Lieve (ex)-kamergenoten, dank voor alle Katya (I’ll never forget those Russian words), onvergetelijke momenten die wij de afgelopen Licette, Rogier, Thomas en Wouter M. dank jaren hebben meegemaakt: Harmen, wellicht kan voor het bijzondere congres, ik probeer er volgend de noise-canceling op je koptelefoon nu eindelijk jaar weer bij te zijn! uit…? Vincent, ik ben blij dat je het eindelijk aan hebt gedurfd je hart te volgen op zowel privé als Als afgestudeerd arts is het fijn zo nu en dan enige professioneel gebied. Mathilde, gelukkig ben jij nog ondersteuning te krijgen bij praktische steeds van mening dat het met die eigenwijsheid werkzaamheden. Silke, Janny, Linda, Martin, van jou wel meevalt: ik verwacht nog veel mooie Bibiche, Saskia en Theo dank voor al het werk dingen van je te zien! Martijn, Tinie of gewoon dat jullie voor mij hebben gedaan. Rikst-Nynke, Tiny, als mijn kamergenoot van het eerste uur bedankt voor alle hulp met de pyrosequence. Ik

165

Proefschrift_final_zonder.indd 165 22-10-15 15:08 Acknowledgements Acknowledgements

wens jullie allen het allerbeste! is uitgekomen. Oma, ons wekelijkse telefoontje Beste Inge, jouw hulp bij mijn projecten is op woensdag is al sinds het begin van mijn vanaf het begin af aan van onmisbare waarde studententijd vaste prik: Amerika ligt dan wel aan geweest. Met behulp van jouw expertise en de andere kant van de oceaan, maar sommige praktische vaardigheden was het mogelijke een tradities moet je niet gedegen experimentele basis te vormen voor dit veranderen! proefschrift. Ik zal dit nooit vergeten. Lieve Karin, als ‘het kleine zusje’ van heb jij het Ook alle andere collega’s waar ik de afgelopen niet altijd gemakkelijk gehad, maar wat doe je het jaren in meer of mindere mate mee heb ontzettend goed! In de afgelopen jaren ben je van samengewerkt wil ik bedanken: Alexander, mijn klein zusje uitgegroeid tot een zelfstandige Beatrijs, Peter, Irma (dank voor de hulp bij en volwassen vrouw die weet wat ze wil. Ondanks hoofdstuk 5) , Irene, Hasan, Bo, Meimei, Mariusz, dat ik soms nog moet wennen aan dit fenomeen Lili, Hongjuan, Jardi, Frank, Niek, Anne-Margreet, ben ik ontzettend trots op jou. Jij en Robbert lijken Lennaert, Leonie, Wardit, Atze, Jasper, Wouter te jullie plek gevonden te hebben in Stadtlohn (maar Rijdt, Weijie, Minke, Ruben Eppinga, Edgar, Mohsin stiekem hoop ik dat je snel weer in Nederland komt (thank you for all your help. I wish you the best!), wonen). Robbert, zonder jouw auto en mankracht Lysanne, Diederik, Guido, Bastiaan, Ernaldo, tijdens mijn vele verhuizingen had ik nu nog steeds Yanick, Yuya, Meelad, Ruben de With, Jennie, aan de Koeriersterweg gewoond. Mijn belofte Hanna en Johannah, Maarten, Mando, Just, Yldau, om voorlopig niet te verhuizen moet ik helaas al Qwint, Tim, Ayla en Patrick. Uiteraard geldt dit binnen anderhalf jaar verbreken: ‘gelukkig’ past in het bijzonder voor mijn studenten Inge van der het dit keer in koffers! Aar, Kalong en Arnold. Bedankt voor jullie inzet en frisse blik op zaken, ik Lieve papa en mama, ik wil jullie bedanken voor hoop ooit nog eens wat van jullie te horen. alle liefde, steun, kansen en relativering die jullie Ook de mensen van de CardioResearch wil ik mij al 27 jaar lang geven. Al als klein meisje bedanken: Anja, Nihaila, Carolien, Daan Buisman, beschikte ik Greetje, Trienke, Margriet, Karin, Geert en Bernard. over een grote dosis nieuwsgierigheid, met een wellicht nog grotere hoeveelheid energie. In Willemijn, dank voor het maken van de lay-out en plaats van deze eigenschappen af te remmen, cover. Ik ben erg blij met het eindresultaat. hebben jullie mij de handvatten aangereikt deze eigenschappen te gebruiken om mij zowel op Lieve vrienden, familie en schoonfamilie. Vanwege persoonlijk als professioneel gebied te blijven mijn volgeboekte agenda was het de afgelopen ontwikkelen. Ondanks dat ik inmiddels al bijna jaren niet altijd even gemakkelijk een afspraak 10 jaar op mezelf woon is onze band de afgelopen in te plannen. Ik had beloofd dat hier na mijn jaren alleen maar hechter geworden. Ik kijk nu al promotie verandering in zou komen, maar ik vrees uit naar onze gezamenlijke road-trip in Amerika! dat jullie nog 1 jaar langer geduld moeten hebben. Beste Jelmer, met jou als paranimf aan mijn zijde Lieve opa en oma. Ik ben er ontzettend trots op kan er niets meer mis gaan! Ik heb je leren kennen dat jullie hier vandaag kunnen zijn! Al bij mijn als voorzitter van ProMed, maar inmiddels ben je geboorte schatte opa mij op waarde in (‘dat is een die functie al lang ontgroeit en ben je een dierbare Sijbom, dat komt wel goed’) en ik geloof dat deze vriend. In alles wat we doen lijken onze wegen voorspelling tot op de dag van vandaag aardig elkaar te kruizen en het kan dan ook geen toeval

166

Proefschrift_final_zonder.indd 166 22-10-15 15:08 Acknowledgements

zijn dat zowel jouw promotor als co-promotor vandaag in mijn Corona zitten. Ik ben benieuwd wat de toekomst ons zal brengen.

Lieve Roos. Ik had hier vandaag niet zonder jou willen staan. Jij als geen ander weet dat de weg naar geluk niet altijd even vanzelfsprekend en gemakkelijk is. Ik ben enorm trots op alles wat je de afgelopen jaren al hebt bereikt en verwacht nog vele mooie dingen met jou (en Micha!) te zullen beleven.

Lieve Tom, al 4 jaar lang ben jij de allerliefste en leukste in mijn leven. Jouw onvoorwaardelijke steun, liefde en engelengeduld zijn tijdens dit proces van onschatbare waarde gebleken. Ik hoop dat wij samen nog vele avonturen gaan beleven. Op naar Amerika’’!

167

Proefschrift_final_zonder.indd 167 22-10-15 15:08 168

Proefschrift_final_zonder.indd 168 22-10-15 15:08 Bibliography Laura Marieke Gezina Meems was born on 11th of June 1988 in Coevorden (the cum laude)

Netherlands). After finishing high school (VWO diploma Natuur & Gezondheid, study Medicine. at de Nieuwe Veste in Coevorden in 2006, she moved to de Rijksuniversiteit Groningen to

In 2008 she became advisory student of the Dean of the University Medical Center Groningen (UMCG) and represented the student’s voice in the higher management of the UMCG. Because of this position she was involved in policy making of several Educational and Research related topics. Her interest in and desire to pursue an academic career were born during this period.

Experimental Cardiology under supervision of professor Rudolf de Boer. In January 2012 In 2009 Laura started her Master in Medicine with a 1-year scientific internship at the

failure while completing her internships in Deventer Ziekenhuis (Deventer) and UMCG she officially started her MD-PhD trajectory on the role of vitamin D biology in heart (Groningen). She obtained her MD-degree in June 2013 and restarted her research at the Experimental Cardiology in September 2013. In November 2014 she received a UEF-JSM Talent Grant. The completion of the MD/PhD-programme eventually led to the formation of this thesis in September 2015.

In 2015 Laura was awarded an ICIN Fellowship. This award enables her to continue

is dedicated to pursue a career as physician-scientist and to continue the translational research in the group of professor John C. Burnett jr, Mayo Clinic (Minnesota, USA). Laura research she has started so far.

169

Proefschrift_final_zonder.indd 169 22-10-15 15:08 Proefschrift_final_zonder.indd 170 22-10-15 15:08 ISBN 9789036783538

9 789036 783538

Proefschrift_final_zonder.indd 171 22-10-15 15:08