CELLULAR UPTAKE OF DNA NANOPARTICLES AND
REGULATION OF CELL SURFACE NUCLEOLIN
by
XUGUANG CHEN
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Dissertation adviser: Dr. Pamela B. Davis, M.D., Ph.D.
Department of Biochemistry
CASE WESTERN RESERVE UNIVERSITY
August, 2009 CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
______
candidate for the ______degree *.
(signed)______(chair of the committee)
______
______
______
______
______
(date) ______
*We also certify that written approval has been obtained for any proprietary material contained therein.
Copyright © 2009 by Xuguang Chen All rights reserved TABLE OF CONTENTS
Chapter 1. Introduction……………………………………………………………….....I
Chapter 2. Cell surface nucleolin serves as receptor for DNA nanoparticles
composed of PEGylated polylysine and DNA……………………………………..II
Chapter 3. Regulation of cell surface expression of nucleolin by cell cycle dependent
kinase Cdk1…………………………………………………………………………III
Chapter 4. Gene delivery by DNA nanoparticles via lipid-raft mediated, dynamin-
independent endocytosis…………………………………………………………...IV
Chapter 5. Discussion and future directions……………………………………….....VI
Bibliography………………………………………………………………………….....VI
List of Tables……………………………………………………………………………VI
List of Figures………………………………………………………………………….VII
Abstract………………………………………………………………………………...XII
Chapter 1. Introduction…………………………………………………………………1
Cystic fibrosis and CFTR……………………………………………………………..1
CFTR function and its regulation……………………………………………………..2
CFTR mutations and therapeutic strategies to correct CFTR defect………………….4
CF gene therapy and viral vectors………………….………………….……………...6
Nonviral gene therapy for CF………………….………………….…………………..9
Composition and stability of compacted DNA nanoparticles………………………..11
In vivo expression and immunogenicity of DNA nanoparticles……………………..13
Intracelluar trafficking of DNA nanoparticles………………….……………………17
i Nucleolin and its structure………………….………………….…………………….18
Phosphorylation and intracellular localization of nucleolin…………………………20
Intracellular function of nucleolin………………….………………….…………….22
Functions of cell surface nucleolin………………….………………….……………24
Association of nucleolin with cytoskeleton………………….………………………31
Cell cycle and cyclin dependent kinase (Cdk)….……………….…………………...33
Endocytosis and its regulation………………….………………….………………...34
Lipid raft and clathrin-independent endocytosis………………….………………….37
Means to study different forms of endocytosis………………….…………………...40
Summary………………….………………….………………….…………………...41
Chapter 2. Cell surface nucleolin serves as receptor for DNA nanoparticles
composed of PEGylated polylysine and DNA………………….…………………43
Summary………………….………………….………………….………………….…...44
Introduction………………….………………….………………….…………………...45
Results………………….………………….………………….…………………………48
DNA nanoparticles localize to nucleolus after internalization………………………48
Nucleolin binds to DNA nanoparticles directly………………….…………………..49
Binding of nucleolin to unPEGylated and TFA nanoparticles………………………53
Binding of nucleolin to CK30 peptides………………….……………………………53
Nucleolin exists at the cell surface………………….………………….……………55
Uptake of DNA nanoparticles by HeLa and 16HBEo- cells………………………...57
Manipulating surface nucleolin affects expression from DNA nanoparticles………61
ii Purified nucleolin inhibits internalization of DNA nanoparticles…………………...64
Discussion………………….………………….………………….……………………..65
Materials and Methods………………….………………….…………………………..69
Reagents………………….………………….………………….……………………69
siRNA and Real-Time PCR………………….………………….…………………...69
Cell Cultures………………….………………….………………….……………….70
Purification of nucleolin………………….………………….………………………70
Surface Plasmon Resonance (SPR) ………………….………………….…………..70
Cell surface biotinylation and Western blot………………….………………………71
Fluorescence microscopy………………….………………….……………………...72
Labeling of DNA nanoparticles with rhodamine………………….…………………72
Luciferase reporter assay………………….………………….……………………...73
Calculation of surface areas of DNA nanoparticles and nucleolin…………………..73
Chapter 3. Regulation of cell surface expression of nucleolin by cell cycle dependent
kinase Cdk1………………….………………….………………….……………….75
Summary………………….………………….………………….………………………76
Introduction………………….………………….………………….…………………...77
Results………………….………………….………………….………………….……...80
The N-terminus of nucleolin is required for its expression on the cell surface……...80
Intracellular localization of truncated nucleolin constructs………………………….82
Surface nucleolin is upregulated at the G2/M phase transition……………………...85
iii RO-3306 inhibits cell surface expression and threonine phoshphorylation of
nucleolin………………….………………….……………………………………….89
Threonine to glutamate mutations of Cdk sites increase surface expression of
nucleolin………………….………………….………………….……………………92
CK2 phosphorylation has little impact on the cell surface expression of nucleolin…94
Effect of extracellular pH, EDTA and K+ on the association of nucleolin to the cell
membrane….……………….……………….……………….……………….………96
Discussion….……………….……………….……………….……………….………..100
Materials and Methods….……………….……………….……………….…………..104
Reagents….……………….……………….……………….……………………….104
Cell culture and transfection….……………….……………….……………….…..104
Construction of truncated nucleolin-GFP fusion proteins….………………………105
Site-directed mutagenesis of nucleolin….……………….…………………………106
Detection of cell surface proteins by biotinylation….……………….……………..107
Fluorescent microscopy….……………….……………….……………….……….107
Cell cycle synchronization by double thymidine block….……………….………...107
Subcellular fractionation of HeLa cells….……………….……………….………..108
Immunoprecipitation of endogenous and GFP-tagged nucleolin….……………….108
Transfection of DNA nanoparticles….……………….……………….……………109
Release of cell surface nucleolin….……………….……………….……………….109
Chapter 4. Gene delivery by DNA nanoparticles via lipid-raft mediated, dynamin-
independent endocytosis….……………….……………….……………………...110
iv Summary….……………….……………….……………….……………….…………111
Introduction….……………….……………….……………….………………………112
Results….……………….……………….……………….……………….……………116
Transfection of DNA nanoparticles is saturable….……………….………………..116
DNA nanoparticles enter polarized 16HBEo- cells from the apical surface….……117
Cell surface nucleolin is found only on the apical surface of 16HBEo- cells….…..118
Transfection of DNA nanoparticles depends on the integrity of lipid rafts….……..119
Surface nucleolin appears in clusters on the plasma membrane….………………...121
Nucleolin exists in lipid rafts….……………….……………….…………………..122
DNA nanoparticles are also found in lipid raft fractions….……………….……….126
Transfection of DNA nanoparticles does not require dynamin….…………………129
Transfection of DNA nanoparticles depends on microtubules but not actin
filaments….……………….……………….……………….……………….………130
Discussion….……………….……………….……………….……………….………..132
Materials and Methods….……………….……………….……………….………….136
Reagents and plasmids….……………….……………….……………….………..136
Cell culture….……………….……………….……………….……………………136
Transfection of DNA nanoparticles and reporter luciferase assay….……………...136
Fitting of the suturation curve of nanoparticle transfection….……………………..137
Cell surface biotinylation….……………….……………….……………….……...137
Immunoprecipitation and Western blot….……………….………………………...138
Immunocytochemistry and electron microscopy….……………….……………….138
Fluorescence microscopy….……………….……………….……………….……...139
v Isolation of lipid rafts by sucrose density gradient….……………….……………..140
Amplification and visualization of plasmid DNA from gradient fractions….……..140
Chapter 5. Discussion and future directions….……………….…………………….142
Non-viral gene therapy for CF….……………….……………….…………………142
Application of DNA nanoparticles in CF….……………….………………………145
Interaction of DNA nanoparticles and nucleolin….……………….……………….147
Dissecting the interaction of nanoparticles with nucleolin using SPR……...……...149
Diverse use of SPR technology….……………….……………….………………...152
Detecting cell surface nucleolin in vivo….……………….……………….………..156
Targeting cell surface nucleolin using DNA nanoparticles….……………………..159
Endocytic pathway(s) employed by DNA nanoparticles….……………….……….162
Fluorescent labeling of DNA nanoparticles for real-time tracking….……………..164
Molecular partners of nucleolin and DNA nanoparticles….……………….………169
Phosphorylation and regulation of cell surface nucleolin….……………………….174
Summary….……………….……………….……………….……………….……...176
Bibliography….……………….……………….……………….……………….……..178
List of Tables
Chapter 1. Introduction
1.1 Extracellular ligands for cell surface nucleolin….……………….……………...30
1.2 Examples of different endocytic pathways and their inhibitors….………………42
vi Chapter 3. Regulation of cell surface expression of nucleolin by cell cycle dependent
kinase Cdk1
3.1 DNA oligos for generating truncated nucleolins….……………….…………...105
3.2 DNA oligos for mutating Cdk sites to glutamate (E)…..………………………106
3.3 DNA oligos for mutating Cdk sites to alanine (A)…..…………………………106
3.4 DNA oligos for mutating CK2 sites to alanine….……………….……………..107
List of Figures
Chapter 1. Introduction
1.1 Hypothesized structure of CFTR….……………….……………….……………..2
1.2 Cellular barriers for in vivo gene transfer….……………….……………………..9
1.3 Transmission electron micrographs of compacted DNA nanoparticles in saline..12
1.4 Gene expression following in vivo gene transfer by DNA nanoparticles in mice.14
1.5 Intracellular trafficking of DNA nanoparticles in well differentiated airway
epithelial cells….……………….……………….……………….…………………..18
1.6 Primary structure of nucleolin from different species….……………….……….19
1.7 Antibodies against nucleolin and purified nucleolin protein inhibit infection of
human parainfluenza virus type 3….……………….……………….……………….26
1.8 Pathways of entry into cells….……..………….……………….………………..35
Chapter 2. Cell surface nucleolin serves as receptor for DNA nanoparticles
composed of PEGylated polylysine and DNA
2.1 Intracellular trafficking of DNA nanoparticles in primary human airway epithelial
cells….……………….……………….……………….……………….…………….48
vii 2.2 DNA nanoparticles do not colocalize with endosomal-lysosomal markers….….49
2.3 Direct binding of nucleolin to DNA nanoparticles assayed by SPR….…………50
2.4 Direct binding of nucleolin to DNA nanoparticles in reversed SPR….…………51
2.5 Nucleolin binds to unPEGylated and TFA nanoparticles with different kinetics..53
2.6 Nucleolin binds to CK30 and CK30PEG peptides at much lower affinities….…...54
2.7 Nucleolin is expressed at the cell surface in HeLa and 16HBEo- cells….………56
2.8 Uptake of rhodamine labeled DNA nanoparticles by HeLa and 16HBEo- cells...57
2.9 Uptake of rhodamine labeled DNA nanoparticles in HeLa cells requires energy
but not via clathrin-mediated endocytosis….……………….……………………….59
2.10 DNA nanoparticles follow the same route into HeLa cells as MS-3 antibody
against nucleolin….……………….……………….……………….………………..60
2.11 Serum starvation reduces cell surface nucleolin and transfection by DNA
nanoparticles….……………….……………….……………….……………….…...61
2.12 Knockdown of nucleolin by siRNA inhibits transfection of DNA
nanoparticles….……………….……………….……………….……………….…...62
2.13 Overexpression of nucleolin on the cell surface enhances gene transfer by DNA
nanoparticles….……………….……………….……………….……………………63
2.14 Purified nucleolin inhibits transfection by DNA nanoparticles….……………..64
Chapter 3. Regulation of cell surface expression of nucleolin by cell cycle dependent
kinase Cdk1
3.1 The primary structure and expression of truncated nucleolins….……………….80
3.2 Cell surface expression of the truncated nucleolin constructs….………………..81
3.3 Intracellular localization of truncated nucleolin-GFP fusion proteins….………..82
viii 3.4 Intracellular localization of full-length (FL) nucleolin and NCLD 6 – 8….…….84
3.5 Fluctuation of cell surface nucleolin by surface biotinylation….………………..86
3.6 Fluctuation of cell surface nucleolin by subcellular fractionation….……………88
3.7 Inhibition of Cdk1 by RO-3306 prevents the increase of cell surface nucleolin at
G2/M transition….……………….……………….……………….…………………89
3.8 Effect of RO-3306 on cell surface nucleolin and transfection of DNA
nanoparticles in asynchronous HeLa and 16HBEo-cells….………….……………...91
3.9 Mutations on Cdk sites affect cell surface expression of full-length nucleolin….93
3.10 Mutations in CK2 sites have little effect on cell surface expression of nucleolin,
but influence serine phosphorylation….……………….……………….……………95
3.11 Nucleolin is secreted into the medium under conditions of acidic pHs, high
extracellular EDTA, or high K+….……………….……………….………………...97
Chapter 4. Gene delivery by DNA nanoparticles via lipid-raft mediated, dynamin-
independent endocytosis
4.1 Transfection of DNA nanoparticles is saturable….……………….……………116
4.2 DNA nanoparticles transfect polarized 16HBEo- cells only from the apical
membrane….……………….……………….……………….……………….……..117
4.3 Surface nucleolin is only expressed on the apical membrane of polarized
16HBEo- cells….……………….……………….……………….…………………118
4.4 Drugs that interfere with lipid rafts block the uptake of DNA nanoparticles…..120
4.5 Nucleolin clusters on the cell surface….……………….……………….……...122
4.6 Nucleolin exists in the lipid rafts in multiple cell lines….……………………..123
4.7 Colocalization of surface nucleolin with flotillin….……………….…………..124
ix 4.8 Nucleolin coimmunoprecipitates with flotillin-1….……………….…………...125
4.9 DNA nanoparticles migrate to the density-buoyant lipid raft fractions….……..127
4.10 DNA nanoparticles enter lipid rafts following uptake….……………………..128
4.11 Inhibition of dynamin does not block transfection of DNA nanoparticles……129
4.12 Disruption of microtubules inhibits transfection of DNA nanoparticles….…..130
Chapter 5. Discussion and future directions
5.1 Transfection of DNA nanoparticles in the non-CF phenotype 16HBEo-S and the
CF phenotype 16HBEo-AS cells in culture….……………….…………………….148
5.2 Types of sensor chips carried by BIAcore….……………….………………….152
5.3 Binding of DNA nanoparticles to nucleolin immobilized on a CM3 chip….….153
5.4 Binding of nucleolin to DNA nanoparticles immobilized on CM3 and CM4
chips….……………….……………….……………….……………….…………..154
5.5 Expression of nucleolin in mouse airway and neuronal cells….……………….156
5.6 CdSe quantum dot samples obtained at different reaction times exhibiting size-
tunable emission across the visible spectral range….……………….……………...163
5.7 Viability of HeLa cells after 1- or 24-hour treatment with QD or QD-PEG-CK30 at
different concentrations….……………….……………….………………………..164
5.8 Cellular uptake of QD or QD-PEG-CK30….……………….…………………..165
5.9 Expression of QD labeled or unlabeld nanoparticles in HeLa cells….………...166
5.10 Intracellular trafficking of QD-labeled DNA nanoparticles in HeLa cells……167
5.11 Cytotoxicity and cellular uptake of fluorescent gold cluster (AuPEG) ….…...168
5.12 Immunoprecipitation of nucleolin or NCL123 pulls down cellular partners of
nucleolin….……………….……………….……………….……………….………170
x 5.13 His tagged but not the unlabeled nanoparticles pull down nucleolin and other cell
surface proteins….……………….……………….……………….………………..171
xi Cellular Uptake of DNA Nanoparticles and Regulation of Cell Surface Nucleolin
Abstract
by
XUGUANG CHEN
DNA nanoparticles are in vivo gene transfer vectors in development for treating cystic
fibrosis. We previously discovered that they deliver transgenes efficiently to the mouse
airway without inducing significant inflammatory cells and cytokines. Using rhodamine-
labeled DNA nanoparticle, we found that they accumulate in the nucleoli in well-
differentiated airway epithelial cells, colocalizing with nucleolin. We employed surface
plasmon resonance (SPR) technology to demonstrate direct binding of nucleolin to DNA
nanoparticles with KD = 25.9 nM. Nucleolin is expressed on the surface of HeLa cells
and human tracheal 16HBEo- cells. Cell surface nucleolin shares a similar intracellular
trafficking pattern with rhodamine-nanoparticles. Manipulations of nucleolin indicate that
it is essential for the transfection of the nanoparticles. Moreover, purified nucleolin
significantly blocks transfection, supporting the hypothesis that nucleolin is a critical
receptor for the nanoparticles. We then studied the regulation of surface expression of
nucleolin and found that cyclin dependent kinase 1 (Cdk1), rather than casein kinase 2
(CK2) phosphorylation, promotes its surface appearance. The N-terminus of nucleolin
including the 8 consecutive Cdk sites is required for efficient surface expression.
Inhibition of Cdk1 blocks the increase of surface nucleolin at G2/M phase transition.
Mutations of the Cdk sites to glutamate increase its surface expression. We also found
that nucleolin exists in lipid rafts on the membrane, and DNA nanoparticles can be recovered from lipid raft fractions following cellular uptake. Moreover, transfection of
xii the nanoparticles is blocked by cholesterol depletion using drugs such as filipin and methyl--cyclodextrin. Nucleolin directly associates with flotillin-1, an integral lipid raft
protein regulating raft-mediated endocytosis; and the association is not disrupted by
cholesterol depletion. Taken together, DNA nanoparticles enter cells via lipid rafts and
cell surface nucleolin, which is positively regulated by cyclin dependent kinase Cdk1.
xiii Chapter 1. Introduction
Cystic fibrosis and CFTR
Cystic fibrosis (CF) is among the most prevalent genetic disorders among Caucasian population. It is an autosomal recessive inherited condition, and occurs in about 1 in 2500 newborns. The current median survival age of CF patients is about 37 years with comprehensive care. Clinically the disease is characterized by high sweat chloride concentration, and obstruction of exocrine glands with thick mucus. Disease in the distal airways and submucosal glands is the main cause of mortality in CF patients, for desiccation of airway secretions leads to infection which is difficult or impossible to treat, which contributes to thickened mucus and pus in the airways. CF patients also have exaggerated and prolonged inflammatory response to Pseudomonas compared to normal people, and the neutrophils recruited in response to inflammation help destroy the lung.
CF pathology also includes pancreatic insufficiency, which often causes malnutrition, and male infertility. Most states in US have now implemented newborn screening programs for CF, so CF can now be treated in the early stages (Davis, 2006; Davies et al., 2008;
Rowe et al., 2005).
The CF disease is caused by mutations in a single gene, which encodes the CF transmembrane conductance regulator (CFTR), a chloride secretion channel situated on the apical membrane of the airway epithelia. In 1989 the CFTR gene was cloned and sequenced, allowing more in-depth analysis of its function and malfunction using modern molecular biology approaches. The human CFTR gene contains about 180,000 base pairs
(bp), locates on the long arm of chromosome 7, and encodes a 1480 amino acid protein.
The CFTR protein is a member of the ATP-binding cassette (ABC) transporter
1 superfamily, which bind to ATP and use the energy of its hydrolysis to drive translocation of molecules across lipid membrane. CFTR is a cyclic AMP (cAMP) activated chloride channel expressed in several tissues including kidney, pancreas, intestines, vas deferens, sweat duct and lung (Rowe et al., 2005; Guggino and Stanton,
2006). Mature CFTR protein has two transmembrane domains (TM), each with 6 membrane-spanning helices (Figure 1.1). The N-terminus of CFTR is relatively short, while the cytoplasmic loop (CL) between the two TMs and the C-terminus contain several regulatory elements essential to its function. The CL and C-terminus contains one nucleotide-binding domain (NBD) each, both of which bind to ATP but only one of which hydrolyzes it for energy. The CL also contains an important regulatory domain called R domain, which is phosphorylated by protein kinase A (PKA) and protein kinase C (PKC) (Guggino and
Stanton, 2006; Riordan,
2008).
CFTR function and its regulation
The primary function of CFTR is as an important ion channel maintaining osmotic homeostasis by secreting Cl- and regulating other membrane ion channels (Ratjen, 2006).
Loss of CFTR function leads to Na+ hyperabsorption, dehydration of airway surface liquid (ASL), and thickening of the airway mucus (Boucher, 2004). This effect is recapitulated in the epithelial Na+ channel (ENaC) overexpressing mouse model, which underscores the importance of CFTR as a Cl- channel (Mall, 2008; Ratjen, 2006). The
2 presence of CFTR messenger RNA (mRNA) and proteins in non-polarized cell types especially immune cells, gives rise to the question of whether it has any function in regulating immune or inflammatory responses. It’s not clear yet whether or not the hyper- inflammatory phenotype of CF patients is the direct consequence of the loss of CFTR function (Riordan, 2008).
The activity of CFTR as an ion channel is regulated on several levels, such as phosphorylation by receptor for activated C-kinase 1 (RACK1), protein kinase A (PKA) and protein kinase C (PKC), protein-protein interaction of the Asp-Thr-Arg-Leu motif at
C-terminus and PDZ-domain protein such as the Na+/H+ exchanger regulatory factors
(NHERF) and dimerization through the C-terminal tail. PKA regulates CFTR activity by phosphorylating the R domain and activating the channel in response to signaling through the 2-adrenergic receptor ( 2-AR) and adenosine 2b receptor (A2b-R). However, PKA may also inhibit CFTR as phosphorylation on the R domain inhibits its binding to
NHERF1 thereby reducing dimerization, which is suggested to be necessary for channel activation (Guggino and Stanton, 2006).
Proper function of CFTR also requires correct protein synthesis, endoplasmic reticulum (ER) maturation, trafficking through ER-Golgi to the plasma membrane and recycling in the endosome and lysosome. CFTR is synthesized and integrated into the ER membrane, glycosylated on the amine groups co-translationally, and a fraction of CFTR with proper modifications and conformation evades the ER quality control system and is exported to the Golgi complex for further glycosylation and folding (Riordan, 2008).
CFTR without proper modification and conformation are eliminated by ubiquitination and proteosomal degradation. Molecular chaperones such as Hsp70 and Hsp90 and
3 interactions with PKA and NHERF1 facilitate this folding process of nascent CFTR on both sides of the ER membrane (Guggino and Stanton, 2006). The plasma membrane
CFTR pool is constantly internalized in clathrin-coated vesicles termed early endosomes.
Most of the internalized CFTR in early endosomes is recycled back to the plasma membrane in recycling endosomes, while a portion of it is degraded in lysosomes
(Guggino and Stanton, 2006; Riordan, 2008).
CFTR mutations and therapeutic strategies to correct CFTR defect
It is therefore evident from the description above that it takes great effort and a number of steps of the cell to produce properly functional CFTR. Consequently, disturbance in any of the above synthesis, trafficking and activation steps will have significant impact in CFTR function. More than 1600 CFTR mutations have been identified clinically. The most common mutation in CF patients is the deletion of a phenylalanine residue at a.a. 508 (F508). About 50% CF patients are F508 homozygous, and 90% patients have at least one such allele. CFTR mutations are categorized into six classes based on the effect of these mutations on the cellular processes described above. Class I mutations produce premature and unstable CFTR transcripts and truncated CFTR protein at very low level. Class II missense mutations, including F508, lead to misfolding of CFTR protein, retention in the ER and degradation by the quality control system. Class III mutations result in defective activation of the channel by preventing it from binding to and hydrolyzing ATP, while class IV mutations reduces Cl- conductance and channel gating. Class V mutations have decreased transcript and protein level due to defects in promoter or splicing. As an example, a polymorphism in the polythymidine tract of intron 8 (IVS8) comprises 5T, 7T
4 and 9T alleles. The 5T allele is associated with poor usage of splicing acceptor and skipping of exon 9, and 5T/5T homozygous patients express only about 5-10% of normal
CFTR mRNA in the lung. However, the intriguing aspect of this mutation is that despite the low expression level of full-length CFTR, these patients has relatively late onset of lung diseases and milder symptoms, suggesting that low level of functional CFTR is sufficient for normal lung function (Noone et al., 2000; Cottin et al., 2005). CFTR with class VI mutations is retrieved and degraded from the plasma membrane at a higher rate
(Guggino and Stanton, 2006; Riordan, 2008). All of these mutations result in reduced Cl- secretion by CFTR, which leads to other downstream pathologies.
Specific therapeutic strategies have been designed to address each of the molecular defects mentioned above. There are 3 drugs in clinical trials or available to treat the malnutrition condition, 6 to restore ion balance of the airway and 1 to treat the thickened mucus of CF patients in the CF Foundation drug development pipeline. In addition, 9 anti-inflammatory drugs are in development or available to patients. To attack more fundamental problems of CF disease on the molecular level, PTC-124 has been designed to suppress the premature stop codon in class I mutations such as W1282X. Other drugs such as VRT-325, VX-770 and VX-809, are developed to facilitate the maturation and trafficking of class II mutations such as F508 and to enhance channel activation of class
III and IV mutations such as G551D (Rowe et al., 2005; Riordan, 2008). Although some of these small-molecule drugs are designed to target a specific type of mutation, their effects are unlikely to be restricted to CFTR alone, and may interfere with transcription, translation and regulation of many genes. It is not clear what effects these drugs will have on a developing airway of a child. Therefore, instead of targeting normal cellular
5 processes to correct a single gene mutation, the most direct and intuitive way to restore
CFTR function is to deliver a normal copy of the CFTR gene into patients with any type of mutation, where it will achieve therapeutic expression and channel function. Gene therapy for CF has been extensively studied.
CF gene therapy and viral vectors
In vivo gene transfer, or gene therapy, appears to be a logical concept to treat CF disease for the following reasons. Firstly, CF is a monogenic disease, and the defective gene has been cloned and sequenced. Secondly, the lung, which is the major organ affected by the disease, is readily accessible to the external environment. Thirdly, CF is recessive, so a relatively low level of functional CFTR is needed to maintain normal cellular physiology. In fact, it is estimated that only 5-10% of all airway epithelial cells will need to be transduced by the CFTR transgene to restore normal ion transport and balance. Moreover, the 5T/5T patients only express about 10% normal CFTR mRNA and have only mild lung disease, so this level of gene expression might be sufficient to provide therapeutic effect in patients with severe mutations (Noone et al., 2000). Lastly,
CF is a slowly progressive disease, leaving a considerable time window for early intervention. There have been CF gene therapy clinical trials using both viral and nonviral vectors. Issues like immunogenecity, toxicity, in vivo gene delivery efficiency and regulation of transgene expression were assessed (Davis and Cooper, 2007; Ziady and Davis, 2006).
Viral vectors for CF gene therapy have the advantages of high delivery efficiency.
Furthermore, integrating viral vectors that insert the transgene into host genome will allow steady expression for a relatively long period. However, they have inherent
6 problems when used in humans due to their immunogenecity and other potential risks.
The human immune system tends to respond to viral vectors, developing acute and often serious inflammatory responses, circulating antibodies or complement- and macrophage- mediated host defense. Cytotoxic T-lymphocytes may also be induced against viral protein antigens. These responses not only harm the recipient, but also prevent re- administration of the same vector, which is critical for CF, as the airway epithelium constantly replenishes itself. Another concern with recombinant virus is that it may share genetic information with wildtype viruses in the environment, potentially accelerating their evolution. Integrating viral vectors carry the risk of insertional mutagenesis. A real- life lesson learned in a retroviral vector trial is that two patients developed leukemia following treatment with bone marrow cells transduced with the vector, which in at least one cell inserted into and activated a protooncogene. Despite the potential risks using recombinant virus, several platforms have been built on DNA viruses such as adenovirus and adeno-associated virus (AAV), and RNA viruses such as lentivirus (White and
Ponnazhagan, 2006; Ziady et al., 2003a).
Adenoviruses occur in nature and infect humans with minor symptoms. The structure and genome of adenoviruses is thoroughly understood, and it’s able to transduce non- dividing cells, which made it the first choice of viral vector. However, due to its natural prevalence, many potential recipients have circulating antibodies against the virus, and cytotoxic T cells tend to eradicate cells infected by the virus, thus limiting long-term expression of the transgene. Another problem for adenoviral vector to transduce airway epithelia is that the receptors needed for the infection process are expressed on the basolateral membrane, which is largely inaccessible to the airway lumen unless the
7 epithelium is damaged. Finally, significant and dangerous inflammatory response was observed following adenoviral vector administration (Klink et al., 2004; Verma and
Weitzman, 2005).
Adeno-associated viruses are not pathogens and transduce non-dividing cells.
However, the available cloning capacity (~ 4-5 kb) of the AAV genome makes it difficult to accommodate the entire CFTR expression cassette, as the open reading frame (ORF) alone contains 4443 bp. In the efforts to minimize the CFTR expression cassette, the promoter/enhancer region has been shortened, and even the coding sequence has been truncated. Another heatedly debated topic in the field of AAV development is the selection of serotypes. AAV serotypes have different specificity for different cell types.
AAV5, 2 and 6 transfect airway epithelium, and are considered most suitable for CF gene therapy. Unfortunately, most people already harbor antibodies against several AAV serotypes, which may block the transfection (Klink et al., 2004; Verma and Weitzman,
2005; Riordan, 2008).
Lentiviral vector is derived from human immunodeficiency virus type 1 (HIV-1) or its counterparts in other species, although the HIV-1 derived vector is most studied. It has larger cloning capacity (~ 8-9 kb) than AAV and can integrate into host genome. The disadvantage for CF gene therapy is that the original lentiviral vector only transduces cells that express CD4, which is a receptor for its envelope protein. Although vesicular stomatitis virus (VSV)-G envelope protein pseudotyped lentiviral vector was developed, it still lacks the ability to transduce polarized airway epithelial cells in vivo. Lentivrial vectors with other tropisms are being developed (Klink et al., 2004; Verma and
Weitzman, 2005).
8 Nonviral gene therapy for CF
Nonviral gene transfer vectors may be safer than viral vector in vivo, but they are less efficient in delivering transgenes. The main reason for low efficiency is that the vector must overcome a series of barriers to deliver the transgene to nucleus effectively in vivo. CF airway being an example, the vector has to cross thick mucus and evade the clearance by cilia and host defense before it even reaches the epithelial cells.
The vector has to protect the DNA payload from degradation by extracellular nucleases during this process. Once in contact with the cells, it has to bind to the cell surface via surface expressed receptors if the vector is targeted, or via electrostatic interactions with the plasma membrane. The vector then has to be internalized into the cell, escape degradation in the endosome-lysosome system in most cases, travel intact through the cytosol, cross the nuclear envelope presumably through the nuclear pore complex (NPC), unpack inside the nucleus and allow the transcription machinery to access the expression cassette of the transgene (Figure 1.2) (Davis and Cooper, 2007; Ziady and Davis 2006;
Medina-Kauwe et al., 2005). Current nonviral strategies include polyplexes, most of which contain poly-amines such as poly lysine, lipoplexes, mainly cationic lipids, and
9 molecular conjugates, including synthetic peptides and recombinant proteins (Ziady and
Davis, 2006; Medina-Kauwe et al., 2005).
Lipoplexes are the most studied nonviral vectors. Cationic lipids complex with negatively charged DNA into particles 100 – 500 nm in diameter. This approach allows efficient membrane fusion and cytoplasmic entry, therefore is ideal for transducing actively dividing cells, because the breakdown of the nuclear envelope grants the transgene access to the transcription machinery in the nucleus. However, it is very inefficient when applied to airway epithelia, as those cells are not actively dividing. In addition, it has little specificity toward epithelial cells and will transfect other cell types as well. Lipoplex vectors also elicit host immune response related to the unmethylated
CpG elements in the bacterial DNA. To minimize the immune response, investigators have tried to minimize the CpG content of the plasmid DNA, choose lipids that promote a lesser CpG response, and suppress the host immune response pharmacologically (Ziady and Davis, 2006; Klink et al., 2004).
Polyplexes such as polyethyleneimine (PEI) and poly-lysine (polyK) with different compositions and conformations have been tested in vitro with good transduction. When administered in vivo, both achieve considerable efficiency of transduction and both readily reach the nucleus of non-dividing cells. However, PEI presents high cytotoxicity in vivo and induces remarkable inflammatory cytokine response, which has prevented it from progressing into the clinic. On the other hand, polyK, when conjugated to polyethylenelycol (PEG), fails to induce any significant toxicity or inflammation (Ziady et al., 2003c). Therefore our lab has focused on the development and characterization of
PEG conjugated polyK vector. First generation of DNA nanoparticles formulated with
10 long-chain polyK without PEG and plasmid DNA deliver transgene in the airway epithelia of CF mice and maintain transgene expression up to 12 days (Ziady et al.,
1999). However, these nanoparticles are only stable in 1 M NaCl solution, which limits their human application. Subsequently, second-generation DNA nanoparticles were developed with a shorter polyK chain in addition to PEG, which stabilizes the particles under ambient conditions (Davis and Cooper, 2007; Ziady and Davis, 2006). All DNA nanoparticles referred to in following discussion are these second-generation nanoparticles.
Composition and stability of compacted DNA nanoparticles
The compacted DNA nanoparticles are one of the two non-viral gene therapy vectors in clinical trials for CF patients (Davis and Cooper, 2007). The DNA nanoparticles are composed of plasmid DNA and polyethylene glycol (PEG)-substituted cysteine- polylysine peptides (PEG-CK30). In a phase I clinical trial, nanoparticles containing the
CF transmembrane conductance regulator (CFTR) gene induced cAMP stimulated chloride transport activity in the nasal epithelium in 8 out of 12 study participants, and no drug-associated adverse events were observed (Konstan et al., 2004). These nanoparticles have minimal toxicity, are non-immunogenic, and transfect non-dividing cells in vivo at high efficiencies (Ziady et al., 2003b; Ziady et al., 2003c; Farjo et al.,
2006). The DNA nanoparticles have been used to deliver reporter genes efficiently to the airways of mouse, ferret, sheep and rabbit (Ziady et al., 2003b; unpublished data), midbrain and striatum of rat and mouse brain (Yurek et al., 2005), and mouse retina
(Farjo et al., 2005; Cai et al., 2008). Therefore, DNA nanoparticles have great therapeutic potential in targeting multiple organs in human.
11 The DNA nanoparticles are composed of plasmid DNA and polyethylene glycol
(PEG) substituted polylysine. The polyK peptide consists of 30 lysine residues and a cysteine residue at the N-terminus. The sulfhydral group on the cysteine residue is linked to a 10 kDa PEG chain, which stabilizes the compacted nanoparticles and protect them from tissue interaction in vivo. The polyK peptide binds to the circular DNA in a non- specific fashion by electrostatic interactions. It is calculated that one DNA molecule binds 300-400 polyK peptides in one nanoparticle on average (Liu et al., 2001). The
DNA nanoparticles take different shapes in solution depending on the counterion for polyK. Generally, for a plasmid DNA of 8 kb (like CFTR plasmid), when the counterion is acetate, the compacted nanoparticle is rod-like in shape, about 200 nm in length and 10 nm in width. Nanoparticles compacted in trifluoroacetate are ovoid with minor diameter of 25 nm (Figure 1.3). The gene delivery efficiency of both nanoparticles is similar (Liu et al., 2003; Ziady et al., 2003b; Fink et al., 2006).
12 These PEGylated nanoparticles are much more stable than the first-generation unPEGylated DNA nanoparticles. The PEG side chains extend outwards from the center of the nanoparticles, and protect them from interacting with each other or from destruction by tissue fluids. The stable DNA nanoparticles can be stored for at least 3 years at 4ºC, for months at room temperature and weeks at 37ºC. The physical properties of these stored nanoparticles are identical to those of freshly prepared nanoparticles. The in vivo transfection efficiency of the nanoparticles is not impaired after storage (Ziady et al., 2003b). Another concern of gene delivery agents is the in vivo stability. The stable
DNA nanoparticles are protected from degradation by mouse serum and have a half life of 2-4 hours compared to 10 minutes for naked DNA (Ziady et al., 2003a). Moreover, these nanoparticles can be concentrated up to 12 mg DNA per mL, and at least 8 mg
DNA per mL solution can be nebulized without affecting the physical properties and gene delivery efficacy. Therefore, the nanoparticles are favorable for pharmaceutical application. Therefore, the stabilized DNA nanoparticles are superior to naked DNA and non-PEGylated nanoparticles with respect to stability.
In vivo expression and immunogenicity of DNA nanoparticles
In vivo gene delivery into mouse airway epithelial cells has been confirmed by luciferase and -galactosidase expression from the DNA nanoparticles. Mice were given nanoparticles containing 100 g plasmid DNA in 25 L saline or the same amount of naked DNA or saline alone intranasally. Reporter gene expression is dose dependent. The expression of -galactosidase is uneven in five out of 8 mice as tested by immuno- staining of airway sections. About 30-50% of epithelial cells express the transgene while some cells have undetectable staining. In the other three out of the total eight mice that
13 were treated , the
expression level is very
high in over 80% of
airway epithelial cells
(Figure 1.4). The delivery
of CFTR gene was also
tested in a CF mouse
model. In the nose of CF
mice, 1/3 of the test mice
had sufficient transfer of
CFTR to fully correct the chloride transport defect, and the rest had partial correction by nasal potential difference
(NPD) measurements. In CF mice, NOS-2 gene expression is downregulated by the defect in CFTR; while in the nanoparticle-treated animals this reduction was reversed, indicating that the secondary consequences of the CF defect was corrected by the expression of the transgene (Ziady et al., 2003b).
DNA nanoparticles have minimal toxicity in vivo, and no immune response has been observed. At the highest dose tested in mice with intranasal injection, the animal developed asymptomatic, transient accumulation of mononuclear cells near the pulmonary veins. There were no alveolar or peribronchial infiltrates, and no evidence of
CpG type toxicity in the lungs of mice. Therefore, the DNA nanoparticles can take advantage of high expression plasmids without provoking inflammation with their CpG content (Ziady et al., 2003c). Since the DNA from nanoparticles will not be integrated
14 into the chromosome, repeated dosing will be necessary to achieve long-term correction of CFTR dysfunction. Copernicus Therapeutics Inc. tested the immunogenecity of the
DNA nanoparticles, and detected no immune response against the nanoparticles after four repeated doses (unpublished data). The transfection efficiency of the fourth dose is the same as the first.
Another concern for clinical application is whether concurrent infection, as often occurs in CF patients, will impair the efficacy of transgene delivery. To address this issue, animal experiments acutely infected mice with Pseudomonas, and then treated them with DNA nanoparticles. One day following dosing, the expression of reporter gene is not decreased comparing to control, uninfected mice, which indicates that the compacted DNA nanoparticles are effective even in the presence of acute Pseudomonas infection (unpublished data).
In the phase I dose escalation clinical trial, no adverse events attributable to DNA nanoparticles were observed following intranasal administration. Measures of inflammation and toxicity, including IL-6, complement and C-reactive protein in serum, cell counts, protein, IL-6 and IL-8 in nasal washings, were monitored, but there was no association of serum or nasal washing inflammatory mediators with administration of compacted DNA. At day 14, vector polymerase chain reaction (PCR) analysis showed
0.58 copy of transgene DNA per cell in the nasal scraping samples of the high dose level group. The most encouraging result is that partial to complete restoration of the isoproterenol responses of nasal potential difference, which indicates a rescue of CFTR function, was observed in 8 out of the total 12 subjects. These corrections persisted for as long as 6 days after gene transfer (Konstan et al., 2004). Therefore, this study not only
15 confirms the safety of DNA nanoparticles at up to 8 mg per subject, but also provides an evidential basis to further pursue and improve the clinical application of DNA nanoparticles in CF patients.
Besides airways, DNA nanoparticles have also been tested successfully in delivering transgenes into brain and retina. DNA nanoparticles carrying a green fluorescent protein
(GFP) reporter gene has been shown to transfect both neurons and glial cells immediately around the injection site in the midbrain and striatum of rats and mice (Yurek et al.,
2005). DNA nanoparticles carrying a therapeutic transgene have been shown to rescue a rat model of Parkinson’s disease by targeting the dopaminergic neurons of the midbrain
(Yurek, unpublished data). In studies conducted in mouse retina, DNA nanoparticles transfect almost all cell types at any sites of injection. Most impressively, subretinal injection of the nanoparticles resulted in transduction of nearly all of the photoreceptor population, and the expression of the transgene was similar to that of rhodopsin, which is the highest expressed gene in the retina. In addition, no deleterious effects on retinal function were observed after the injection (Farjo et al., 2006; Cai et al., 2008). In summary, DNA nanoparticles appear to be a clinically viable solution to deliver and express therapeutic transgenes in various tissues, organisms and disease settings.
In summary, DNA nanoparticles are powerful nonviral gene transfer agents, which might prove clinically useful in treating genetic disorders such as cystic fibrosis.
Although it has been shown that DNA nanoparticles deliver transgene to the nucleus when microinjected into the cytoplasm of non-dividing cells (Liu et al., 2003), it was still not clear how the nanoparticles were internalized into the cytoplasm in the first place, or what molecules mediate its nuclear targeting. In the course of studies on intracellular
16 trafficking of DNA nanoparticles, we found a close association of uptake with the presence of substantial amounts of nucleolin in the cytoplasm (unpublished data, see below). Most interestingly, the DNA nanoparticles do not seem to enter the endosome- lysosome pathway following the uptake. Since understanding the mechanism of how
DNA nanoparticles bind to the cell surface, enter and progress through the cell into the nucleus may help us improve the vector or design other therapeutic strategies to facilitate the delivery, we further investigated the trafficking of DNA nanoparticles in primary human tracheal epithelial cells.
Intracelluar trafficking of DNA nanoparticles
It is critical for a transgene to reach the nucleus to be expressed. Moreover, it has to evade the various “clearance” machineries inside the cytoplasm to stay intact. Previous studies evaluated the hypothesis that DNA nanoparticles enter the nucleus via the nuclear pore complex (NPC). DNA nanoparticles microinjected into the cytoplasm produced 10 fold more reporter gene product than naked DNA. An inhibitor of nuclear pore function, wheat germ agglutinin, blocks this enhancement. When nanoparticles compacted with
DNA of different size were microinjected into the cytoplasm, reporter gene expression showed a critical size dependency. Ellipsoidal nanoparticles with minor diameter larger than 25 nm (usually corresponding to about 8 kb plasmid), which is the average diameter of nuclear pores, did not express well (Liu et al, 2003).
Previous studies in our lab followed the uptake of DNA nanoparticles labeled with rhodamine by a protein-DNA clamp in well-differentiated human airway epithelial cells
(WD AEC) grown at the air-liquid interface. Primary cultures of airway epithelial cells internalize particles into the cytoplasm as soon as 15 minutes after application. By 60
17
minutes, most of the DNA nanoparticles concentrate in nucleolus-like structures in the nucleus. By costaining cells treated with rhodamine labeled nanoparticles and FITC- conjugated nucleolin antibody, we found that DNA nanoparticles actually colocalize with nucleolin in both cytoplasm and nucleus, most profoundly in the nucleolus. Further statistical analysis of distribution of nucleolin and uptake of DNA nanoparticles showed a critical positive correlation between cytoplasmic nucleolin and rhodamine stain in the nucleus (Figure 1.5, see also Figure 2.1). Thus, nucleolin seems to be a potential receptor, or at least a partner, for DNA nanoparticles.
We also tested the possibility of the involvement of any conventional endocytotic pathway. DNA nanoparticles show no colocalization with Rab5 or EEA1 (early endosomal markers), only minor colocalization with Cathepsin D or LAMP-1 (lysosome markers), and no colocalization with caveolin. Therefore, DNA nanoparticles appear to employ a novel internalization mechanism, independent of conventional clathrin mediated- and caveolin- mediated endocytoses.
Nucleolin and its structure
18 Nucleolin has been discovered and cloned in various eukaryotic organisms ranging from yeast to plant to mammals. It is conserved through almost all eukaryotes and has essential functions in various cellular processes. Human nucleolin is a protein of 709 amino acids, with a calculated molecular weight of 77 kDa, but full-length nucleolin runs at about 105 kDa on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-
PAGE) due to the long stretches of acid residues at the N-terminus and high level of post- translational modification. It has three characteristic domains: the N-terminal acidic
region, four RNA recognition motifs (RRM) in the middle and the C-terminal glycine/arginine rich (GAR) domain (Figure 1.6; Tuteja and Tuteja, 1998). The N- terminal domain contains highly acidic regions interspersed with basic sequences and contains multiple phosphorylation sites. This region is reported to bind to H1 histone and mediate chromosomal rearrangement during ribosomal DNA (rDNA) transcription
(Tuteja and Tuteja, 1998). The N-terminal domain also binds to certain ribosomal proteins and ribosomal RNA (rRNA) processing proteins such as U3 snoRNP (Ginisty et
19 al., 1999), and might have function in the final assembly of ribosome. The second feature of this domain is that it is rich in phosphorylation sites for multiple kinases including 4 sites for casein kinase II (CK2) and 8 consecutive sites for cyclin dependent kinase cdc2/Cdk1 (Srivastava and Pollard, 1999). This region undergoes extensive phosphorylation and dephosphorylation during cell growth and proliferation. These phosphorylations have been shown to regulate its subcellular localization and function and will be discussed in detail in a separate section (Srivastava and Pollard, 1999; Galati and Bocchino, 2007). The central globular domain of nucleolin contains four RNA binding domains (RBDs), also known as RNA recognition motifs (RRMs). This region mediates the association of nucleolin to the 5’ external transcribed spacer (ETS) of nascent rRNAs. It has been proposed that nucleolin recruits other rRNA processing machinery following binding to the nascent rRNA (Ginisty et al., 1999). A bipartite nuclear localization signal (NLS) resides between the N-terminal acidic domain and the
RBDs, which has been reported to be responsible for its nuclear localization. The C- terminal GAR domain is interspersed by dimethyl-arginine and phenylalanine. The function of the dimethyl modification on the arginines is not clear to date, but it is suggested that it’s related to the localization of nucleolin in the nucleolus (Srivastava and
Pollard, 1999). The GAR domain can function as an ATP dependent DNA/RNA helicase and DNA dependent ATPase, which might be important for facilitating the correct folding of RNA. This domain also interacts specifically with a subset of ribosomal proteins and nonspecifically with RNAs (Ginisty et al., 1999; Srivastava and Pollard,
1999).
Phosphorylation and intracellular localization of nucleolin
20 Nucleolin shuttles between cytoplasm and nucleus, and also to the cell surface in certain cell types, despite lack of a transmembrane domain or glycosylphosphatidyl- inositol (GPI) anchor (Srivastava and Pollard, 1999). This section will focus on the intracellular shuttling of nucleolin, while the localization and function of cell surface nucleolin will be discussed in a separate section below. The bipartite NLS between the N- terminal acidic region and the central RBDs is suggested to be responsible for its nuclear targeting. However, nucleolin has no actively functioning nuclear export signal. The localization of nucleolin as well as other functions is regulated by post-translational modifications, especially phosphorylation. Nucleolin from nucleus has higher isoelectric point (pI) than nucleolin in the cytoplasm and cell surface (Hovanessian et al., 2000), which indicates different post-translational modifications occur in different compartments. Nucleolin contains phosphorylation sites for various kinases, including
CK2, cdc2/Cdk1, PKC-, cAMP dependent kinases and an ecto-kinase on cell surface.
CK2 is a major regulatory kinase during cell growth. At interphase, it phosphorylates serines in the N-terminal region of nucleolin, as well as topoisomerase I and RNA polymerase I, followed by localization of these three proteins to rDNA containing chromosomes and rRNA transcription, which suggests that the phosphorylation of nucleolin may be a prerequisite for the structural organization of the nucleolus during G1 phase. Upon phosphorylation, nucleolin produces two auto-proteolytic fragments, which localize to the nucleolus and activate transcription of rDNA. Therefore, nuclear localization of nucleolin is enhanced by CK2 phosphorylation on serine residues
(Schneider et al., 1989). This process is regulated mostly by growth stimuli, including
21 hormones such as insulin, androgen and dexamethasone, and growth factors such as epidermal growth factor (EGF) and fibroblast growth factor 2.
Another important regulator of nucleolin is Cdk1 during mitosis (Belenguer et al.,
1990; Peter et al., 1990). The N-terminus of nucleolin contains 8 tandem TPXK motifs
(X is a small a.a. with hydrophobic side chain) recognized by Cdk1. Cdk1 phosphorylates threonine residues during mitosis and thereby inhibits nuclear localization of nucleolin.
On the other hand, the de-phosphorylated state of threonines promotes nuclear localization of nucleolin (Srivastava and Pollard, 1999). Therefore, CK2 and Cdk1 work in coordination during interphase and mitosis to regulate the localization and function of nucleolin. Cyclic AMP dependent kinase also phosphorylates nucleolin during G1 phase to S phase transition following isoprenaline stimulation in rat parotid gland.
Phosphorylation of nucleolin by PKC- was shown to be required for nerve growth factor induced differentiation of PC12 cells (Srivastava and Pollard, 1999). In summary, the localization and function of nucleolin is regulated by specific phosphorylation by multiple kinases.
Intracellular function of nucleolin
Nucleolin is a ubiquitous eukaryotic protein conserved through yeast to human, which suggests an essential role in eukaryotes (Srivastava and Pollard, 1999). It has well characterized functions in the ribosomal biogenesis, and participates in multiple steps of regulating rDNA transcription, trafficking and maturation of pre-ribosomal RNA and proteins, assembling ribosomal subunits and their intracellular transport (Ginisty et al.,
1999; Srivastava and Pollard, 1999). It is also suggested to control the accumulation of pre-rRNA thereby regulate the homeostasis of ribosome (Ugrinova et al., 2007). Since
22 nucleolin is one of the major components of the nucleolus in interphase cells, it has also been implicated in the maintenance of nucleolar structure during cell cycle. When inactivated by small interfering RNA (siRNA), cells manifest a series defect during mitosis, including abnormal chromosome aggregation, centrosome duplication and spindle malformation (Ugrinova et al., 2007; Ma et al., 2008). Therefore, nucleolin appears to be a key regulator of ribosome synthesis and assembly, and influences cell cycle progression.
Nucleolin regulates gene expression in a post-transcriptional fashion by binding to mRNAs at their 5’ or 3’ UTRs and stabilizing them (Ginisty et al., 1999). Targets of nucleolin include mRNAs of the fragile X mental retardation protein (FMRP), amyloid precursor protein (APP) and interleukin-2 (IL-2) (Cemens et al., 1999; Rajagopalan et al.,
1998; Chen et al., 2000). Other mRNAs including the internal ribosome entry site (IRES) of hepatitis C virus, human preprorenin (hREN), CD154 (CD40L), human -globin, matrix metalloproteinase 9 (MMP-9) and collagen prolyl 4-hydroxylase (C-P4H) were also reported to be regulated by nucleolin (Izumi et al., 2001; Persson et al., 2003; Singh et al., 2004; Jiang et al., 2006; Fahling et al., 2006a; Fahling et al., 2006b). Nucleolin binds and stabilizes these mRNAs, prolongs their halflives, thereby increases their translation and the expression. This stabilizing effect is often found to be in response to environmental stimulus such as hypoxia or arsenic (Fahling et al., 2006a; Fahling et al.,
2006b; Zhang et al., 2006).
Recently an increasing amount of research suggests that nucleolin is implicated in the apoptosis of several cell types by binding to apoptotic proteins and regulating their expression. Nucleolin binds to and stabilizes the mRNAs of anti-apoptotic bcl-2 and Bcl-
23 XL following induction of apoptosis by drugs or UV irradiation (Otake et al., 2007;
Zhang et al., 2008; Kalousek et al., 2007). The mRNA of growth arrest and DNA damage inducible gene 45 (GADD45) is stabilized by nucleolin in mouse embryonic fibroblast upon NF B inhibition (Zheng et al., 2005) or in human bronchial epithelial cells upon arsenic chloride treatment (Zhang et al., 2006). Nucleolin also binds to the 5’-UTR of p53 mRNA, and suppresses its translation upon DNA damage (Takagi et al., 2005).
Therefore, nucleolin appears to be a pro-survival/anti-apoptotic protein functioning through modulating translation of apoptotic regulators. Consistent with this view, expression of nucleolin has been reported to be induced by genotoxic stress along with nucleophosmin following UV irradiation (Yang et al., 2002).
Nucleolin also regulates gene expression at the transcriptional level either by enhancing chromatin remodeling or by direct binding to promoters. In the nucleus, nucleolin acts as a histone chaperone and enhances the activity of chromatin remodeling complex SWI/SNF and ACF (Angelov et al., 2006; Storck et al., 2007). Transcription of
CD34 in human hematopoietic cells is activated by nucleolin through its sequence specific binding to the promoter region (Grinstein et al., 2007). The expression of cPLA2 in A549 cells was activated by phorbol 12-myristate 13-acetate (PMA) through the direct binding of c-Jun/nucleolin and c-Jun/Sp1 to the Sp1-binding sites of cPLA2 promoter (Tsou et al., 2008). In cancer cells, nucleolin binds and activates the transcription of human papillomavirus 18 (HPV18) enhancer thereby promoting proliferation. This binding is inhibited by retinoblastoma (Rb) at G1 phases and regulated in a cell cycle dependent fashion (Grinstein et al., 2006).
Functions of cell surface nucleolin
24 A most intriguing finding about nucleolin is that despite lack of a transmembrane domain or signal sequence, nucleolin is nevertheless found to be present on the surface of various cell types and serves as a receptor for a variety of extracellular ligands. As already mentioned, nucleolin is a substrate of an ecto-kinase, and it resides on cell surface in a phosphorylated form (Srivastava and Pollard, 1999). In HEp2 cells, antibodies against nucleolin are taken up in an energy dependent fashion, which is inhibited at 4°C
(Deng et al., 1996). However, this study incubated the cells with the antibody for a relatively long period of time, and it is not clear whether this uptake and inhibition by cold is specific to nucleolin antibody. Nucleolin also serves as a default receptor for apoB and apoE-containing lipoprotein. By binding to LDL, it may sense the abundance of exogenous lipid to support cell growth and adjust the synthesis of ribosomes
(Semenkovich et al., 1990). The neurite-promoting IKVAV motif on basement membrane protein laminin-1 in the extracellular matrix is another ligand for nucleolin, which has been shown to promote differentiation of neurons and several neural cell lines.
The high abundance of nucleolin in mature brain suggests a role for nucleolin in differentiation and maintenance of neural tissues (Kibbey et al., 1995). It was later discovered that laminin-1 induces early differentiation of cells and concomitantly mobilizes nucleolin from nucleus to the cell surface in human intestinal epithelial cells
(Turck et al., 2004).
Another class of extracellular ligands for nucleolin comprises viruses and several anti-viral molecules. Coxsackie B virus, but not poliovirus or Sendai virus, binds to nucleolin on the cell surface (De Verdugo et al., 1995). A polyclonal antibody against nucleolin considerably reduces the transduction of baculovirus in HepG2 cells,
25 suggesting the involvement of cell surface nucleolin in its infection process (Makela et al., 2008). In human airway epithelial cells, human parainfluenza virus type 3 (HPIV-3) was found to interact directly with cell surface nucleolin during viral infection. HPIV-3 is an airborne pathogen that infects human lung epithelial cells from the apical (luminal) membrane, and nucleolin is required for the internalization, but not attachment, of HPIV-
3 to the airway epithelial cells. Both a monoclonal antibody against nucleolin and purified nucleolin protein markedly reduces HPIV-3 infection and replication in A549 cell culture (Figure 1.7 A and B). Interestingly, cell surface nucleolin was found only on the apical surface of A549 cells grown on filters (Bose et al, 2004). However, A549 is an alveolar carcinoma cell line, and does not form tight junctions as normal airway epithelial cells. Therefore, it does not polarize into strict apical and basolateral sides on filters, and the differential nucleolin expression data needs to be interpreted with caution.
Nucleolin also serves as a co-receptor for HIV-1 virus by binding to the V3 loop of gp120 protein in CD4+ T cells. The affinity of the binding is comparable to the binding of gp120 to soluble CD4, and purified nucleolin inhibits HIV-1 infection by blocking this
26 binding (Callebaut et al, 1998). A group of anti-HIV agents is able to block HIV-1 transmission by binding to nucleolin and preventing the attachment of HIV-I virus onto the surface of CD4+ T cells. This class of molecules includes a cytokine named
“midkine” (Said et al., 2002; Hovanessian, 2006), an artificially synthesized pseudo- peptide HB-19 (Nisole et al., 2002), a growth factor pleiotrophin (Said et al., 2005) and a serum factor lactoferrin (Legrand et al., 2004). The growth factor midkine is a cytokine that inhibits HIV infection in cell cultures in an autocrine and paracrine manner. Midkine mRNA is systematically expressed in adult peripheral blood lymphocytes from healthy donors, and its expression may be markedly but transiently induced upon in vitro treatment of lymphocytes with IL-2 or interferon- (IFN-) and activation of T lymphocytes by phytohemagglutinin (PHA) or through the engagement of the CD28 antigen. Both midkine and HB-19 bind to nucleolin at its C-terminal GAR domain and compete with each other. Both molecules bind to surface nucleolin and enter cells independent of heparan sulfate and chondroitin sulfate proteoglycans (Hovanessian,
2006; Nisole et al., 2002). Lactoferrin in mammalian secretions and blood, which has potent anti-viral and anti-cancer activity, was also found to be a partner of cell surface nucleolin. It inhibits HIV-1 infection by similar mechanism to midkine, and binds to nucleolin at an affinity of about 240 nM by BIAcore (Legrand et al., 2004).
Glycoproteins, growth factors and even inorganic renal crystals are also among the molecules that bind to cell surface nucleolin. In a monocyte cell line U937, nucleolin binds to fructosyllysine specifically (Srivastava and Pollard, 1999). Nucleolin co-purifies with L-selectin by affinity chromatography from human hematopoietic cell line KG1a
(Harms et al., 2001). Nucleolin also interacts with acharan sulfate (AS) at high affinity in
27 Lewis lung carcinoma cells (Joo et al., 2005). Nucleolin was also purified via hepatocyte growth factor (HGF) affinity chromatography from the LNCaP prostate cancer cell line.
HGF was shown to mediate the increased adhesion in these cells in response to prostate stromal-conditioned media (Tate et al., 2006). Using similar affinity chromatography followed by mass spectrometry (MS) identification technique, nucleolin was identified in skeletal muscle tissue as a binding partner for receptor protein tyrosine phosphatase- .
Cell surface nucleolin was found present in developing myotubes in this study (Alete et al., 2006). Calcium oxalate (CaOx) crystals formed in tubular fluids grow to kidney stones if they are retained by surface receptors of the tubular cells. Nucleolin, especially the N-terminal acidic stretches, has been reported to bind to Ca2+ (Sorokina and
Kleinman, 1999; Sorokina et al., 2004) and CaOx crystals on the cell surface in renal tubules in vivo (Kumar et al., 2003; Sorokina et al., 2004; Verkoelen and Verhulst,
2007). Nucleolin resides on the apical membrane and is associated with cytoskeleton in a
Ca2+ dependent fashion in cultured renal tubular cells (Sorokina and Kleinman, 1999).
The acidic region of N-terminal nucleolin selectively mediates this attachment of CaOx crystals to inner medullary collecting duct (IMCD) cells in culture. Overexpression of nucleolin in IMCD cells increases CaOx retention, while purified nucleolin inhibits it
(Sorokina et al., 2004; Verkoelen and Verhulst, 2007).
In the process of cell-cell contact, nucleolin functions as a receptor for bacterial and eukaryotic cells. An enterohemorrhagic Escherichia coli strain O157:H7 uses intimins to adhere to cells in culture and intestinal epithelia in vivo. Cell surface nucleolin binds to all three types of intimins , and at similar affinity. Antibodies against nucleolin inhibit attachment of O157:H7 to cell culture. Intimins and nucleolin colocalize when
28 visualized by immunohistochemistry in vitro and in vivo. In piglets, neonatal calves and mice, immunostained nucleolin was found closely associated with adherent bacteria in intestinal sections (Sinclair and O’Brien, 2002; Sinclair and O’Brien, 2004; Sinclair et al., 2006). Macrophages also express nucleolin on their surface, where nucleolin serves as a receptor for polylactosaminyl saccharide chains on early apoptotic cells but not late apoptotic cells that expose phosphatidylserine. Purified nucleolin inhibits the binding of early apoptotic cells to macrophages, which relies on its sequence of residues 284-709 including the bipartite NLS, RBDs and GAR domain (Hirano et al., 2005). Nucleolin on the cell surface of several immune cells may be essential for the development of immune response in vivo, and may be a target for bacterial lipopolysaccharides.
Besides being a receptor for various extracellular ligands, cell surface nucleolin has also been recognized as a tumor marker and angiogenic marker of tumor blood vessels. It is the cell surface target of a tumor-homing peptide called F3. F3 selectively binds to endothelial cells in tumor blood vessels and to tumor, where nucleolin accumulates at the cell surface. Monoclonal antibody against nucleolin prevents this accumulation (Christian et al., 2003). Due to the overexpression of cell surface nucleolin in cancer cells an aptamer named AS1411 (also known as AGRO100) was designed to target nucleolin therapeutically. AS1411 is an aptamer of a 26-mer unmodified guanosine-rich oligonucleotide, which binds to nucleolin directly and induces its internalization and inhibition of DNA replication. It has been shown to inhibit human tumor growth both in vitro and in vivo, and is being tested in clinical trials. Promising results were observed in the phase I dose escalation study in patients with advanced solid tumors without serious adverse event (Ireson and Kelland, 2006). Recent advances in understanding the
29 molecular mechanism of its anti-tumor activity revealed that AS-1411 binds to the nuclear factor B (NF B) essential modulator (NEMO) and prevents tumor necrosis factor (TNF) induced NF B activation. Interestingly, nucleolin is also found in complex with NEMO after AS-1411 treatment (Girvan et al., 2006; Teng et al., 2007).
Cell surface nucleolin is also an angiogenic marker targeted by endostatin. The angiogenic function of surface nucleolin is downstream of vascular endothelial growth factor (VEGF) and involves an actin-associated motor protein MyH9. Down-regulation of cell surface nucleolin in endothelial cells significantly inhibits the migration of endothelial cells and prevents capillary-tubule formation (Huang et al., 2006).
Conversely, the anti-angiogenic activity of endostatin attributed to its high affinity binding to cell surface nucleolin and/or inhibition of phosphorylation of nuclear nucleolin. Antibodies against nucleolin abrogate the ability of endostatin to bind to surface nucleolin and suppress blood vessel formation (Shi et al., 2007).
Table 1.1 Extracellular ligands for cell surface nucleolin Category Ligand (binding motif) References Nutrient Low-density lipoprotin Semenkovich et al., 1990 Extracellular Laminin-1 (IKVAV motif) Kibbey et al., 1995 matrix Growth factor Hepatocyte growth factor Tate et al., 2006 Coxakie B De Verdugo et al., 1995 Baculovirus Makela et al., 2008 Viruses HPIV-3 Bose et al., 2004 HIV-1 (V3 loop, gp120) Callebaut et al, 1998 Midkine Said et al., 2002 HB-19 Nisole et al., 2002 Anti-HIV Pleotrophin Said et al., 2005 Lactoferrin Legrand et al., 2004 Fructosyllysine Srivastava and Pollard, 1999 Glycoprotein L-selectin Harms et al., 2001 Acharan sulfate Joo et al., 2005
30 Inorganic Calcium oxalate Sorokina and Kleinman, 1999 material Early apoptotic cell Hirano et al., 2005 Cell (polylactosaminyl saccharide) E. coli strain O157:H7 (intimin) Sinclair and O’Brien, 2002 F3 peptide Christian et al., 2003 Anti-tumor AS1411 Ireson and Kelland, 2006 Endostatin Shi et al., 2007 Different types of ligands for cell surface nucleolin are summarized in Table 1.1. In general, nucleolin seems to play a pro-survival and anti-apoptoic role in and out of the cell. Cell surface nucleolin in particular is targeted by a variety of natural or artificial ligands, some of which (such as D3 antibody against nucleolin and AS1411) find a direct route into the nucleus. Therefore, we speculate that surface nucleolin might provide a portal from cell membrane directly into the nucleus for growing cells as a means to convey extracellular pro- or anti-growth signals, which can be exploited for direct delivery of cargos into the nucleus. As we established that transfection of rhodamine- labeled DNA nanoparticles might be associated with nucleolin, and nucleolin is present on certain cell types, it is tempting to suspect that cell surface nucleolin may play a role during the uptake of DNA nanoparticles. We further investigated the role of nucleolin in the uptake and transfection of the nanoparticles in Chapter 2.
Association of nucleolin with cytoskeleton
Nucleolin has long been known as a shuttling protein between the nucleus and cytoplasm. More recently it has been shown to shuttle to the cell surface as well. Its ability to traffic relies on its regulated nuclear localization signal, and its association with other cellular proteins and motor proteins (Ginisty et al., 1999; Huang et al., 2006;
Hovanessian et al., 2000). In 2004, two groups of researchers demonstrated separately using slightly different techniques that nucleolin is present in the human Staufen 1 RNP
31 complex (Villace et al., 2004; Brendel et al., 2004). The double-stranded RNA binding protein Staufen assembles with mRNAs and transporting molecules and mediates cytoplasmic trafficking and translation of mRNA (Brendel et al., 2004). Using tandem- affinity purification or one-step affinity purification followed by MS identification, the
Staufen RNP complex was purified and it protein composition analyzed. Both studies identified nucleolin, ribosomal proteins and, most interestingly, kinesin as components of the complex (Villace et al., 2004; Brendel et al., 2004), while one of the studies identified additional cytoskeletal proteins (tubulins, tau, actin), cytoskeleton regulators (cdc42, rac1), and motor proteins (dynein, myosin) (Villace et al., 2004). In addition to be a component of a nuclear-cytoplasmic transporting complex, nucleolin may function as a transporter to deliver some molecules directly into nucleus. The nuclear translocation of urokinase-type plasminogen activator (uPA) has been shown to require the direct binding to nucleolin to its kringle domain (Stepanova et al., 2008).
On the other hand, cell surface nucleolin is reported to associate with the actin filaments in some recent studies. In cultured renal tubular cells, surface nucleolin is associated with cytoskeletal fractions (Sorokina and Kleinman, 1999). In HeLa cells surface nucleolin could be clustered at the extracellular side of the plasma membrane by a nucleolin antibody. This clustering is dependent on the existence of an intact actin cytoskeleton (Hovanissian et al., 2000). In angiogenic endothelial cells, this association is mediated by an actin-based motor protein namely nonmuscle myosin heavy chain 9
(MyH9). Subsequent studies suggested that MyH9 is a physical linker between nucleolin and actin cytoskeleton, and disruption of MyH9 expression causes a re-localization of the surface nucleolin from a diffused pattern to several punctate spots (Huang et al., 2006).
32 Cell cycle and cyclin dependent kinase (Cdk)
The most interesting aspect of nucleolin function is that it is expressed, by an unknown mechanism, on the cell surface, and shuttles between membrane, cytoplasm and nucleus. Although the cytoplasmic-nuclear shuttling has been well elucidated, little is known about how cell surface nucleolin is regulated. Since phosphorylation by Cdk1 plays a key role in the intracellular trafficking of nucleolin, we hypothesize that this phosphorylation might also participate in regulating surface nucleolin. Cdk1 is a critical kinase driving the progress of mitosis, by which eukaryotic cells duplicate themselves.
Under the right conditions, cells synthesize an additional copy of their chromosomes and split into two cells with each containing one copy of full genetic information via mitosis.
This cycle of synthesis and cell division is defined as cell cycle, which comprises four phases: synthesis or S phase, gap or G2 phase, mitotic or M phase, and another gap G1 phase. In M phase, cell morphology and physiology change dramatically. At prophase, interphase chromatin condenses into well-defined chromosomes that can be visualized in the light microscope. Previously duplicated centrosomes (microtubule organizing center,
MTOC) migrate apart and form the poles of the future spindle apparatus. Microtubules assemble from the two centrosomes toward all directions, and the nuclear envelope breaks down at this stage. At prometaphase, microtubules find and attach to kinetochores, which are protein complexes formed around the centromeres on chromosomes. When the kinetochores on two sister chromatids are attached to microtubules from opposite centrosomes (ie., spindle formation), the duplicated chromosomes migrate toward the center of the cell, which will later become the “metaphase plate”. When all chromosomes reach the metaphase plate, a sudden loss of cohesion starts anaphase, which continues
33 when all sister chromatids are separated. Telophase starts when all chromosomes have reached the poles and the nuclear envelope starts to reform. Finally the mother cell is divided in two by cytokenesis, driven by the contraction of cell membrane and underlying actin cytoskeleton. Phosphorylation and proteolysis play a prominent role in these events
(Nigg, 2001; Malumbres and Barbacid, 2002).
The progression of cell cycle is driven mainly by cyclin dependent kinases (Cdk) that are activated sequentially at different phases. Recently other kinases such as the Polo like kinase and Aurora family kinases have also been found to be important during cell cycle.
Activation of Cdks requires binding of cyclins, which are transiently expressed at specific stages. This is one of the means cells use to regulate the cell cycle. Cdk4 and 6, activated by D type cyclins, and Cdk2, activated mainly by E type cyclins, function through G1/S phases. Progression of G2 through completion of M phases is controlled primarily by
Cdk1, which is complexed with A type cyclins at G2 phase and B type cyclins at M phase. A series of events occurring at mitotic entry, including spindle assembly, chromosome condensation and nuclear envelope breakdown, are attributable to phosphorylation of Cdk1 substrates. On the other hand, exit from mitosis, such as spindle disassembly, chromosome decondensation, nuclear envelope reformation and cytokenesis, is due to inactivation of Cdk1, which is in turn executed by destruction of cyclin B by the anaphase-promoting complex/cyclosome (APC/C) (Nigg, 2001; Ferrari,
2006). Therefore, Cdk1 is the major driving force of the G2/M progression. Nucleolin is heavily phosphorylated by Cdk1 during mitosis, which results in the mobilization of nuclear nucleolin into the cytoplasm (Belenguer et al., 1990; Peter et al., 1990).
Endocytosis and its regulation
34 As mentioned above, nonviral gene therapy vectors have to overcome several barriers before the transgene can be expressed. We have shown that PEGylation and compaction protect DNA nanoparticles in an in vivo environment. We also learned that after entering cytoplasm, the nanoparticles go through the NPC and deposit the DNA into the nucleus where it is expressed. The missing link between these processes is how DNA nanoparticles attach to the cell surface and get internalized into the cytoplasm. Cells employ diverse endocytic pathways to absorb nutrition or interact with signaling molecules and thereby communicate with the extracellular environment. Endocytosis is a process of the uptake of extracellular cargos via invagination and internalization of plasma membrane. The uptake of cargos may take the form of phagocytosis, which is employed only by specialized cell types such as macrophages and neutrophils to clear large pathogens or cell debris, or pinocytosis, which occurs in almost all cells for a
35 variety of cargos (Figure 1.8). Several forms of pinocytosis have been discovered including macropinocytosis, clathrin-mediated endocytosis (CME) and non-clathrin- mediated endocytosis. Macropinocytosis is active intake of large amount of extracellular milieu by closure of membrane ruffles. This process requires reorganization of actin cytoskeleton, therefore is sensitive to drugs like cytochalasin D. It also involves Rho family small GTPase, and might participate in the regulation of signal transduction and cell migration (Conner and Schmid, 2003). This section will be focused on receptor- mediated endocytosis, while non-CME will be discussed in the next section.
Clathrin-mediate endocytosis is the best-studied type of endocytosis. It is constitutively active in all mammalian cells and is the main player of the uptake of nutrients, regulation of signaling molecules on the membrane, cell and serum homeostasis, and transmission of synaptic signals. It was discovered and first characterized as a class of membrane vesicles derived from “coated pits” at the cell surface by electron microscopy. The coated pits are clathrin-coated vesicles (CCV) that enclose membrane receptors, their ligands and other extracellular cargos. Typical ligands traveling in CCVs include low-density lipoprotein (LDL), transferrin and EGF, which upon binding to their receptors stimulate the assembly of CCVs (Roy, 2005). The coat is a polygonal cage like structure formed by self-assembling clathrin molecules with assisting assembly proteins (AP). Two essential APs are monomeric AP180 and heterotetrameric adaptor complex AP2. Other accessory proteins such as Eps15, endophilin and amphiphysin regulate the process of vesicle formation. The CCVs depart from the plasma membrane and become early endosomes, which diverge from this point.
Some early endosomes become recycling endosomes and fuse back into the plasma
36 membrane, while others are acidified and fuse with lysosomes. The formation of CCVs requires a large GTPase called dynamin, while the sorting and trafficking of the internalized vesicles involve small GTPases of the Rab family, the Rho family and Cdc42
(Liberari et al., 2008; Conner and Schmid, 2003). Trafficking of the vesicles also requires coordination of the cytoskeleton and motor proteins associated with the cytoskeleton.
Dynein, for example, which travels toward the minus end of microtubules, is found associated with late endosomes and lysosomes (Murray and Wolkoff, 2003). Generally speaking, vesicles move bidirectionally at cell periphery, while the movement becomes biased toward the minus end of the microtubules around center of the cells. Both kinesin, which tracks towards plus end of microtubules, and dynein, and actin associated myosins have been reported to be involved in this process. Rab family GTPases provide docking sites for the motors on vesicles (Murray and Wolkoff, 2003).
Cells exert tight temporal and spatial regulation on CME, for example by phosphorylation and dephosphorylation of the coat proteins. For instance, dynamin, amphiphysin and AP180 are all phosphorylated in resting neurons and become rapidly dephosphorylated upon membrane depolarization. Kinases such as Src kinase, PKA,
PKC, casein kinase II and some Cdks are also found to directly phosphorylate CCV related proteins. For example, Src kinase directly phosphorylates clathrin, which might be part of the signaling cascade of some growth factors (Roy, 2005). Cyclin G–associated kinase (GAK)/auxillin on the other hand phosphorylates AP2, AP180 and adaptor protein
-arrestin, which is also phosphorylated by Src kinase (Liberari et al., 2008; Conner and
Schmid, 2003).
Lipid raft and clathrin-independent endocytosis
37 Clathrin independent endocytosis (CIE) may also be used by various cargos to enter the cell. It has been suspected that CIE is mediated by lipid rafts, because many examples of CIE are sensitive to cholesterol depletion. Lipid rafts are membrane microdomains rich in cholesterol and glycosphingolipids. Their best-known function is signal transduction and modulation, especially in lymphocytes. Upon binding of cell surface receptors, lipid rafts are recruited to the site of signaling following actin polymerization around the site.
These rafts aggregate into macrodomains, which amplifies signals from the immune synapse (Rodgers et al., 2005). Single-molecule tracking revealed that lipids and proteins of different rafts constantly undergo crosstalk, which is elevated during signal transduction at the immune synapse (Kusumi et al., 2005). Aside from lymphocytes, EGF receptor and Ras, endothelial nitric oxide synthase (eNOS) signaling are also conducted in lipid rafts (Laude and Prior, 2004).
Various techniques have been employed to isolate lipid rafts from the rest of the membrane, and the most widely used method is based on the resistance of the rafts to solubilization by ice-cold Triton X-100. When cell lysate of cold 1% Triton X-100 is separated on a 5/35/40% sucrose step gradient, lipid rafts float to the 5/35% interface
(Iwabuchi et al., 1998; Pike, 2004). Proteins are partitioned into lipid rafts through different routes. Caveolin, flotillin and annexin among others are raft resident proteins that directly bind to raft lipid. Such proteins also bind and recruit other signaling proteins such as Cbl associated protein (CAP). Proteins with glycosylphosphatidylinositol (GPI) anchors on the cell surface can insert their long saturated acyl chains into rafts via interaction of the GPI anchor with cholesterol and glycosphingolipids (Roy, 2005).
38 One of the best-understood instances of CIE is caveolae-mediated endocytosis that requires caveolin. Other clathrin- and caveolin-independent pathways may be categorized as to whether or not dynamin is involved (Table 1.2). Caveolae are 50-70 nm flask shaped membrane invaginations with caveolin on the cytoplasmic side. Caveolin and caveolae are suggested to be important for the metabolism and transport of cholesterol and glycosphingolipids. Other cargos for caveolae include albumin, simian virus 40
(SV40), cholera toxin B (CtxB) and antibody clustered GPI-anchored proteins (Cheng et al., 2006; Mayor and Pagano, 2007). Transforming growth factor- (TGF- ) receptors, which reside in lipid rafts in the resting state, are internalized in caveolae upon binding to
TGF- and are downregulated on the cell surface (Roy, 2005). The internalized cargoes can integrate into the classic endosome-lysosome axis, or can be transported in caveolin- positive vesicles called caveosomes to other cellular organelles such as the ER or Golgi complex (Mayor and Pagano, 2007). Like CME, caveolae-mediated endocytosis is also regulated by kinases like Src and PKC (Kirkham and Parton, 2005).
The endocytosis of interleukin-2 (IL-2) takes the clathrin- and caveolin-independent, dynamin dependent pathway (Lajoie and Nabi, 2007). IL-2 bound IL-2 receptor- (IL-
2R- ) partitions into lipid rafts, which are internalized subsequently. The internalization process is not inhibited by dominant negative (DN) clathrin or other CME components, but is sensitive to inhibition of DN dynamin and RhoA. The IgE receptor and C cytokine receptor may also be internalized through this mechanism. Members of the clathrin-, caveolin- and dynamin-independent pathways include some GPI-anchored proteins, CtxB
(although can also be taken up in caveolae mediated endocytosis), both of which rely on
Cdc42, and major histocompatibility complex I (MHC I), 1 integrin, E-cadherin and IL-
39 2R-, all of which require ADP-ribosylation factor-6 (ARF-6) (Mayor and Pagano, 2007;
Kirkham and Parton, 2005).
Viruses can hijack the natural endocytic pathways to infect host cells, which is why they are often used as gene delivery tools as mentioned before. Most viruses, such as
HIV-1 and adenovirus, are internalized via CME, and the latter escape the endosome and lysosome due to the acidic pH. Proteases in the lysosome can also facilitate the escape of
Ebola virus and SARS corona virus. Influenza virus uses both CME and clathrin- independent pathways (Marsh and Helenius, 2006). SV40 takes the caveolae route, while recent data suggest that a clathrin-, caveolin- and dynamin-independent, Cdc42- dependent pathway is also involved (Kirkham and Parton, 2005).
Means to study different forms of endocytosis
To dissect the pathways viruses use to enter the cell, many pharmacological methods have been developed to inhibit specific pathways. Macropinocytosis is driven by actin polymerization, and is therefore sensitive to depolymerizing agent such as cytochalasin
D. Amiloride, an inhibitor of Na+/H+ exchange, has also been used to block macropinocytosis (Sieczkarski and Whittaker, 2002). An example is that cytochalasin D significantly reduce the entry of intracellular mature form of vaccinia virus. K+ depletion, brefeldin A (BFA), chlorpromazine and dominant negative clathrin and Eps15 are used to target CME. DN Eps15 has been shown to block the infection of Sindbis virus, and may have the same effect on Semliki Forest virus (SFV) and adenovirus. Cholesterol depletion by sterol binding drugs, like nystatin, filipin and methyl--cyclodextrin, and DN caveolin inhibit caveolae-mediate endocytosis, which has been studied extensively on SV40.
Clathrin- and caveolin-independent endocytosis, which is employed by influenza and
40 Sendai viruses, may depend on dynamin, therefore be sensitive to DN dynamin. Since
Rab family GTPase, Rho family GTPase and PKC are also involved in endocytosis, DN forms or inhibitors of these proteins are also developed in experiments (Sieczkarski and
Whittaker, 2002; Mayor and Pagano, 2007). A summary of all reported types of endocytosis, and examples and inhibitors of individual pathways is listed in Table 1.2.
Summary
Our lab is interested in developing and understanding nonviral gene therapy for treating CF. Compacted DNA nanoparticles have been shown in various instances to be effective in delivering transgene into non-dividing cells. Prior to this project, we had shown that DNA nanoparticles are protected from degradation in vivo by compaction and
PEGylation, and once inside the cell they enter the nucleus through the NPC. Until then we had little knowledge as to how DNA nanoparticles attach to and enter the cell in between these two steps. Preliminary data suggested that nucleolin, being a shuttle protein between cell surface, cytoplasm and the nucleus, might play a role during the uptake of DNA nanoparticles. The internalization of the nanoparticles may employ a clathrin- and caveolin- independent pathway. On the other hand, little is known about how nucleolin is expressed and regulated on the cell surface. We therefore focused on the interaction of DNA nanoparticles with cell surface nucleolin, regulation of surface nucleolin by phosphorylation by Cdk1, and the endocytosis of DNA nanoparticles from the membrane to the cytoplasm.
41 Table 1.2 Examples of different endocytic pathways and their inhibitors. CtxB, cholera toxin B; DN, dominant negative; GPI-AP, glycosylphosphatidylinositol- anchored protein; IL-2, interleukin-2; TGF- , transforming growth factor- ; SV40, simian virus 40. Clathrin-independent Type of Macro- Clathrin- Dynamin-dependent Dynamin-independent endo- pinocytosis dependent cytosis Caveolae- RhoA Cdc42 Arf6 mediated regulated regulated regulated SV40 Transferrin CtxB GPI-AP Examples Arginine8 Low-density TGF- GPI-AP 1 integrin peptide lipoprotein receptor IL-2 CtxB E-cadherin DN DN DN DN Arf6 caveolin RhoA Cdc42 Inhibitors Cytochalasin Chlorpromazine DN dynamin -D DN clathrin Filipin. Nystatin. Methyl- -cyclodextrin. Amiloride DN Eps15 Other sterol-binding drugs Mayor and Pagano, 2007; Reference Suzuki et al., Conner and Kirkham and Parton, 2005; 2002. Schmid, 2003. Sieczkarski and Whittaker, 2002.
42 Chapter 2.
Cell surface nucleolin serves as receptor for DNA nanoparticles
composed of PEGylated polylysine and DNA
Xuguang Chen1,2, Dianne M. Kube2, Mark J. Cooper3, and Pamela B. Davis1,2
1Department of Biochemistry, 2Department of Pediatrics, Case Western Reserve
University School of Medicine, and 3Copernicus Therapeutics, Inc.
(Part of this manuscript, except the BIAcore studies on unPEGylated, TFA nanoparticles and CK30 peptides, has been published in Molecular Therapy, 2008, 16: 333-42)
43 Summary:
Compacted DNA nanoparticles deliver transgenes efficiently to the lung following intrapulmonary dosing. Here we show that nucleolin, a protein known to shuttle between nucleus, cytoplasm, and the cell surface, is a receptor for DNA nanoparticles at the cell surface. By surface plasmon resonance, we demonstrate that nucleolin binds to DNA nanoparticles directly. The presence of nucleolin on the surface of HeLa and 16HBEo- cells was confirmed by surface biotinylation assay and immunofluorescence. Rhodamine labeled DNA nanoparticles colocalize with nucleolin on the cell surface, as well as in the cytoplasm and nucleus, but not with transferrin or markers of early endosome or lysosome following cellular uptake. Reducing nucleolin on the cell surface by serum-free medium or siRNA against nucleolin treatment leads to significant reduction in luciferase reporter gene activity, while overexpressing nucleolin has the opposite effect.
Competition for binding to DNA nanoparticles with exogenous purified nucleolin decreases the transfection efficiency by 60-90% in a dose-dependent manner. Therefore, the data strongly suggest that cell surface nucleolin serves as a receptor for DNA nanoparticles, and that nucleolin is essential for internalization and/or transport of the nanoparticles from cell surface to the nucleus.
44 Introduction:
DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted cysteine- polylysine peptides (PEG-CK30) have minimal toxicity, are non-immunogenic, and transfect non-dividing cells in vivo at high efficiencies (Ziady et al., 2003b; Ziady et al.,
2003c; Farjo et al., 2006). In a clinical trial for delivery of CFTR to nasal epithelium of patients with cystic fibrosis, cAMP stimulated chloride transport activity was induced in most of the participants, and no drug-associated adverse events were observed (Konstan et al., 2004). The compacted DNA nanoparticles are composed of plasmid DNA and a
30–mer lysine peptide with an N-terminal cysteine substituted with polyethylene glycol
(PEG). Calculation of the volume of the nanoparticles based on electron micrographs indicates that one DNA molecule is complexed with a sufficient number of polylysine peptides to produce a charge neutral complex (Liu et al., 2003). The mechanism by which these particles are taken up by some cell types, but not others, is unknown. In the course of studies on intracellular trafficking of DNA nanoparticles, we found a close association of uptake with the presence of substantial amounts of nucleolin in the cytoplasm (unpublished data). Most interestingly, the DNA nanoparticles do not seem to enter the endosome-lysosome pathway following uptake. We then investigated the relationship between nucleolin and uptake of DNA nanoparticles.
Nucleolin is a ubiquitous eukaryotic protein conserved through yeast to human. It has well characterized functions in the ribosomal biogenesis pathway, and participates in multiple steps from regulating rDNA transcription to the assembly of ribosomal proteins and RNAs (Ginisty et al., 1999; Srivastava and Pollard, 1999). Nucleolin is also involved in mRNA metabolism, by binding to and stabilizing mRNAs such as GADD45 (growth
45 arrest and DNA damage inducible gene 45) and Bcl-2 (Zhang et al., 2006; Sengupta et al., 2004). Its versatility depends on the multi-domain feature of its primary structure.
Although it lacks a transmembrane domain or signal sequence, nucleolin was nevertheless found to be present on the surface of various cell types. In HEp2 cells, antibodies against nucleolin are taken up in an energy dependent fashion (Deng et al.,
2006). Nucleolin serves as a default receptor for apoB and apoE-containing lipoprotein
(Semenkovich et al., 1990). The neurite-promoting IKVAV motif on laminin-1 in the extracellular matrix is a ligand for nucleolin, and promotes differentiation of neurons and neural cell lines (Kibbey et al., 1996). Another class of extracellular ligands for nucleolin is viruses and anti-viral molecules. Nucleolin binds to Coxsackie B virus on the cell surface (de Verdugo et al., 1995) and serves as a co-receptor for HIV-1 virus by binding to the V3 loop of gp120 protein (Callebaut et al., 1998). Some anti-HIV agents, such as midkine (Said et al., 2002), pseudo-peptide HB-19 (Nisole et al., 2002) and pleiotrophin (Said et al., 2005), block attachment of HIV-I virus to CD4+ T cells by binding to nucleolin. Nucleolin also interacts directly with human parainfluenza virus type 3 (HPIV-3), and is required for internalization, but not attachment, of HPIV-3 to airway epithelial cells (Bose et al., 2004). Nucleolin is a eukaryotic receptor for the intimins of enterohemorrhagic Escherichia coli O157:H7 (Sinclair et al., 2004).
Our study focused on the mechanism of the cellular uptake of DNA nanoparticles.
Using fluorescence microscopy, we discovered that internalized DNA nanoparticles colocalize with nucleolin and an antibody against it on the cell membrane, in the cytoplasm as well as the nucleolus. We also found that DNA nanoparticles bind to nucleolin directly and tightly, using the surface plasmon resonance technique. By cell
46 surface biotinylation and immunofluorescence, we confirmed the presence of nucleolin on the surface of HeLa cells and 16HBEo- immortalized human bronchial epithelial cells.
Manipulation of cell surface nucleolin affects the transfection efficiency of DNA nanoparticles. Exogenous purified nucleolin inhibits the transfection of DNA nanoparticles in HeLa cells. In summary, the above evidence strongly supports our hypothesis that surface nucleolin serves as a receptor for DNA nanoparticles and is essential for their cellular uptake.
47 Results:
DNA nanoparticles localize to nucleolus after internalization
We initially followed the uptake of DNA nanoparticles labeled with rhodamine by a protein-DNA clamp in well-differentiated airway epithelial cells grown at an air-liquid interface. These cells internalize DNA nanoparticles into the cytoplasm as soon as 15 min after application (Figure 2.1A, 15 min). By 1 hr, most of the DNA nanoparticles concentrate in nucleolus-like structures in the nucleus (Figure 2.1A, 1 hr). The GFP gene carried by the nanoparticles is expressed at 18 hours, confirming the functionality of the labeled nanoparticles (Figure 2.1A, 18 hr). By costaining cells treated with rhodamine- labeled nanoparticles with FITC-conjugated nucleolin antibody, we found that DNA nanoparticles accumulate in the nucleolus, where nucleolin is concentrated (Figure 2.1B,
48 arrow). To examine whether the DNA nanoparticles are internalized into the cells via clathrin-coated pits, we co-stained these cells for early endosomal marker
EEA1 or lysosomal protease Cathepsin D. As shown in Figure 2.2 A and B, human tracheal epithelial cells take up rhodamine-labeled DNA nanoparticles into the cytoplasm (arrows) and nucleolus after 30 min and 1 hr. The rhodamine fluorescence in either case does not colocalize with
EEA1 (Figure 2.2A) or Cathepsin D (Figure 2.2B) staining in the cytoplasm (green vesicle-shaped staining). Therefore, it is not likely that DNA nanoparticles enter cells via the endosome-lysosome pathway.
Nucleolin binds to DNA nanoparticles directly.
Given that DNA nanoparticles colocalize with nucleolin in both cytoplasm and nucleus, we hypothesize that nucleolin might bind to DNA nanoparticles directly and play an important role during the process of transfection. To test the binding hypothesis, we exploited the sensitivity and accuracy of the Surface Plasmon Resonance technique
(SPR), and found tight binding of nucleolin to DNA nanoparticles. We purified nucleolin from the cytoplasmic extract of exponentially growing Jurkat cells. The purity of the nucleolin protein was confirmed by Coomassie blue staining as one band at about 105 kDa (Figure 2.3A), which could be recognized by MS-3 antibody against nucleolin on
49 Western blot (data not shown).
We immobilized DNA nanoparticles on a CM5 chip to 150.2 RU, and subjected the chip to flows of nucleolin at concentrations of 0, 10, 25, 50, 100 and 200 nM (Figure
2.3B). The sensorgram shows a dose dependent binding, which is specific after subtraction of the response from a blank surface. The binding curves were fitted to a
Langmuir 1:1 binding model using the BIAevaluation program, which gives an
4 -1 -1 association rate constant (ka) of 1.71 ± 0.01 10 M •s and a dissociation rate constant
-4 -1 (kd) of 4.41 ± 0.14 10 s . The resulting dissociation constant at equilibrium (KD) is
25.9 nM. The data set fits a Langmuir 1:1 model quite well with a 2 of 0.34. The maximal response of the chip, Rmax, is 72.1 ± 0.6 RU as calculated from this fitting, which also indicates that this data set is suitable for kinetic analysis. We then calculated the stoichiometry of nucleolin to DNA nanoparticle using equation Eq 2.2 (Methods and
Materials). The maximal ratio of nucleolin to one DNA nanoparticle is 53.6 ± 0.4. The
50 binding of nucleolin to
DNA nanoparticles is specific, as purified GFP protein under the same conditions did not produce any response from the same chip (Figure 2.4A).
We also tried to perform the SPR experiment in reverse, which is to immobilize nucleolin on the CM5 chip and flow DNA nanoparticles as the analyte. The resulting sensorgram indicates significant non-specific binding of DNA nanoparticles to the matrix of the chip (Figure
2.4B). The relative response is negative at the beginning of the injection of the analyte after subtraction of the blank surface. So it was not possible to model the binding using
BIAevaluation software in this case. This non-specific binding was reduced but not eliminated by performing the experiment on a CM3 chip with a shorter dextran matrix
(data not shown). The dissociation phase in this case shows a low but consistent increase
51 in the response, which indicates rebinding of the nanoparticle to the chip surface during the dissociation process or the avidity effect of DNA nanoparticles binding to nucleolin.
Binding of nucleolin to unPEGylated and TFA nanoparticles
Both first generation unPEGylated nanoparticles and 2nd generation PEGylated nanoparticles using trifluoracetate (TFA) as counterion for the CK30PEG peptide have shown efficient in vivo gene transfer comparable to that of the acetate PEGylated nanoparticles tested above. Consequently, we investigated the possibility that these particles also bind to nucleolin by the same BIAcore technique. We immobilized unPEGylated and TFA nanoparticles on CM5 as described before, and used the same concentrations of purified nucleolin as analyte (Figure 2.5).
Nucleolin binds to the first generation unPEGylated nanoparticles at a ka of 1.08 ± 0.01 105
M-1•s-1, and
dissociates at a kd of
7.30 ± 0.06 10-4 s-1.
The 2 of the fitting is 0.38, similar to that of the fitting of
52 the PEGylated acetate particles. This yields a dissociation constant (KD) of 6.73 nM, which is 3.85 fold lower than 25.9 nM of the acetate nanoparticles (Figure 2.5A). The reason of this increase in affinity may be attributed to the 6.32 fold increase of association rate (ka) and similar dissociation rate of nucleolin on the TFA nanoparticles.
It is suggested that the PEG chain functions as a protective shield against unwanted interactions with other molecules, as the core of the particle is rich in both positive and negative charges. Consistently, removal of PEG seems to enhance the binding of nucleolin, especially the association phase.
Binding of nucleolin to the TFA nanoparticles seems to behave very similarly to acetate particles. The association rate is 6.50 ± 0.04 104 M-1•s-1, and dissociation rate is
2.10 ± 0.05 10-5 s-1. Nucleolin binds to and detach from the TFA nanoparticles at rates of about 4 fold higher than acetate particles, yielding a KD of 32.3 nM, very similar to acetate nanoparticles (Figure 2.5B). There are two implications of this finding: First of all, both TFA and acetate nanoparticles deliver transgenes in vivo at comparable efficiency at least in the airway. Nucleolin binds to both nanoparticles at similar affinity, which is consistent with the theory that they share the same route into the cells. Secondly, difference in the shape of the nanoparticles might be due to the conformational differences during the formation of the nanoparticles mediated by the electrostatic interactions of poly-lysine and DNA, which may be the main contributor to associating with nucleolin.
Binding of nucleolin to CK30 peptides
Human nucleolin has four acidic stretches rich in aspartate and glutamate at the N- terminus. It is very likely that this region might mediate at least in part the binding of
53 nucleolin to CK30 compacted DNA nanoparticles. We examined whether nucleolin binds to PEGylated or unPEGylated CK30 peptide by BIAcore technique. CK30 and CK30PEG were immobilized on adjacent flow cells in a CM5 sensor chip, and were subjected to nucleolin solution at concentrations of 0, 10, 25, 50, 100 and 200 nM. Sensorgrams from both cells show steady increase of response as time and concentration of nucleolin increases after subtraction of response from the blank cell, which suggests that nucleolin binds specifically to both peptides (Figure 2.6). Fitting of both sensorgrams into a
Langmuir 1:1 model yields reasonably low 2, 0.88 and 0.61 respectively, validating the
4 - fitting. The association and dissociate rates of nucleolin to CK30 are 1.25 ± 0.04 10 M
1•s-1, and dissociation rate is 2.84 ± 0.13 10-3 s-1 respectively (Figure 2.6A), while the ka and kd of nucleolin to
CK30PEG are 1.48 ± 0.04
104 M-1•s-1, and dissociation rate is 3.07 ± 0.11 10-3 s-1
(Figure 2.6B). Apparently the binding rates of nucleolin to both peptides are very similar and close to that of the acetate nanoparticles, while it detaches from the peptides at about 10 fold higher rate than from the acetate
54 nanoparticles. Therefore, the affinity of nucleolin to the CK30 and CK30PEG peptides are 208 and 228 nM, which are also about 10 fold weaker than the 25.9 nM of the acetate nanoparticles. The kas of the peptides are about five fold lower than that of the TFA nanoparticles, while the dissociation rates are similar to one another. Therefore, in contrast to the acetate particles that have lower dissociation rate, much lower association rate is the main contributor to the lower affinity of the peptides than TFA nanoparticles to nucleolin. When compared to the unPEGylated nanoparticles, both peptides bind to nucleolin at about 10 fold lower rate and detach at 3 fold higher rate, giving a total about
30 fold lower affinity. The above analysis suggests that the binding of nucleolin to the nanoparticles requires both positively charged CK30 peptides and negatively charged
DNA. In addition, although PEG doesn’t seem to influence the binding of nucleolin to the peptides, it appears to play some roles in the binding of nucleolin to the intact nanoparticles.
Nucleolin exists at the cell surface
To confirm the presence of nucleolin on the cell surface of our cell model, we applied a reactive biotinylation reagent that does not penetrate the plasma membrane. Biotinylated
HeLa and 16HBEo- cell lysates were subjected to neutravidin-agarose beads pull down, followed by Western blot using a nucleolin specific or control antibodies (Figure 2.7A).
Nucleolin is present in the neutravidin pulldown lane (NA-PD), so it was accessible to the biotinylation reagent on the cell surface of both HeLa and 16HBEo- cells. As shown in Fig. 3a, syndecan-4, a cell adhesion molecule, is enriched in the pulldown lane of
HeLa cell and to a lesser extent, in 16HBEo- cells, while GAPDH (glyceraldehyde-3- phosphate dehydrogenase) is restricted to the cytoplasmic extract and is absent in the
55 pulldown lane in both cell lines. Fibrillarin, a nucleolar protein with high sequence homology to nucleolin, serves as another negative control. It is not present in either the pulldown lane or the cytoplasmic lane as expected (Figure 2.7A, fibrillarin).
Cell surface nucleolin was also visualized by indirect fluorescence staining. As shown in the deconvolved pictures of cells staining for nucleolin and fibrillarin on both cell surface and inside the cell, only nucleolin is present on the cell surface while both proteins appear in the nucleolus (yellow spots in the permeabilized pictures in Figure 2.7B). Cell surface nucleolin appears as punctate spots in both cell lines tested (arrows in the non-permeabilized pictures in Figure
56 2.7B), which suggests that it is restricted in a fine sub-structure on the membrane rather than a diffuse distribution. This is unlikely caused by the fixation process or the crosslinking of the secondary antibody, as unfixed cells and fluorescent primary antibody yield similar results (Figures 2.8-10).
Uptake of DNA nanoparticles by HeLa and 16HBEo- cells
To determine the kinetics of DNA nanoparticle entry into the cells, a time course experiment was performed using rhodamine labeled DNA nanoparticles incubated with
HeLa and 16HBEo- cells for 15 min to 18 hr. In both cell models the nanoparticles start to appear in the cytoplasm by 15 min, and enter and accumulate in the nucleus within 1 hr
(Figure 2.8 A and B). At 4 hr, the pattern of the rhodamine fluorescence inside the cells does not change significantly, while higher intensity of intracellular rhodamine was
57 observed at later time points. The internalized nanoparticles colocalize with nucleolin in both cytoplasm and nucleus as indicated by the yellow color from the red and green merge (Figure 2.8 A and B, arrows). In HeLa cells the internalization of rhodamine labeled DNA nanoparticles were also observed with co-staining of cytoplasmic. With saponin instead of Triton permeabilization, we obtained cytoplasmic staining of nucleolin in HeLa cells, which also colocalizes with cytoplasmic DNA nanoparticles at early time points (arrows, 15-30 min Figure 2.8A). The nuclear envelope was intact, as judged by the lack of nuclear nucleolin staining. At later time points (1-4 hr), the nanoparticles accumulate in the nucleus (Figure 2.8 A and B). When permeabilized with Triton X-100, we were able to obtain nucleolin staining in the enter cell. In this case, nucleolar colocalization of the nanoparticles and nucleolin was also observed (arrow, Triton 4 hr,
Figure 2.8A).
However it is difficult to determine whether these internalized nanoparticles are membrane-bound based on current data. Internalization of DNA nanoparticles is inhibited at 4°C, as few or no labeled nanoparticles were observed in HeLa cells after 4-hour incubation with rhodamine labeled DNA nanoparticle at 4°C in contrast to those at 37°C
(Figure 2.9A). We then co-incubated fixed or unfixed HeLa cells with rhodamine labeled nanoparticles and H-250 at 4°C for 30 min, and observed colocalization of the nanoparticles and cell surface nucleolin (Figure 2.9B, arrows). The punctate pattern of cell surface nucleolin is not affected by the fixation procedure. We also performed a co- uptake experiment with the rhodamine labeled DNA nanoparticles and biotin-conjugated human transferrin, which serves as an indicator of early endosomes (Figure 2.9C). During a 4-hr incubation, no colocalization was observed between DNA nanoparticles and
58 transferrin even at early time points when most DNA nanoparticles were in the cytoplasm.
In contrast to the route followed by transferrin and its lack of colocalization with
DNA nanoparticles, a monoclonal antibody against nucleolin (MS-3) enters HeLa cells via a similar route as the nanoparticles, and colocalizes with them during trafficking into the nucleus. HeLa cells were incubated with both FITC labeled MS-3 antibody and rhodamine labeled nanoparticles for 30 min, washed with PBS, and then observed from 0 min to 4 hr post incubation. The rhodamine-labeled nanoparticles have extensive colocalization with the antibody (yellow in the merge pictures, Figure 2.10A), which
59 further indicates that nucleolin is associated with the nanoparticles during trafficking.
Moreover, we observed that both the nanoparticles and the antibody appeared in the nuclei of some cells as early as the end of the 30 min incubation. Nuclear entry of the
DNA nanoparticles is shown more clearly by deconvolution of photomicrographs (Figure
2.10B) comparing cells incubated for 0 hr and 1 hr at 37°C. DNA nanoparticles (red) are in the nucleus at 1 hr, but not at 0 hr. The accumulation of the nanoparticles, however, was not homogeneous, as some cells had extensive peri-nuclear rhodamine fluorescence
60 but no nuclear entry even at 4 hr. We speculate that this might be due to the difference in the expression level and/or post-translational modification of nucleolin. Other factors, such as the phase of the cell cycle, might also affect whether or not the nanoparticles are effectively transported into the nucleus.
Manipulating surface nucleolin affects expression from DNA nanoparticles
Since nucleolin is present at the cell surface and binds to DNA nanoparticles directly, it is a candidate receptor for the nanoparticles. Therefore, surface nucleolin expression was manipulated, and nanoparticle gene transfer observed. HeLa cells were treated with serum free medium (Figure 2.11), which is reported to reduce the surface expression of nucleolin, and which produced 35.7% reduction in cell surface nucleolin by cell surface biotinylation and Western blot. Cytoplasmic nucleolin or syndecan-4 (data not shown), in contrast, did not change following serum starvation. As expected, cells treated with serum free medium expressed 72.2% less reporter gene activity from DNA nanoparticles, compared to untreated control cells (Figure 2.11B), a significant reduction.
Since serum starvation surely has effects other than reducing cell surface nucleolin, we knocked down the expression of nucleolin more specifically, using an siRNA against nucleolin 48 hours prior to application of the nanoparticles. The effect of nucleolin knockdown in Hela cells was confirmed using quantitative Real-time PCR and Western
61 blot. The siRNA against nucleolin knocked down about 90% of the total nucleolin mRNA compared to the control siRNA against GAPDH (Figure 2.12A), after normalization to the amount of total RNA. The protein level of cell surface and
62 cytoplasmic nucleolin was reduced by 58.6% and 46.0% respectively (Figure 2.12 B and
C). Actin or syndecan-4 was not affected by either siRNA (Figure 2.12B). Reporter gene expression from DNA nanoparticles was decreased by 54.7% in nucleolin siRNA treated cells compared to control siRNA treated cells (Figure 2.12D). Luciferase activity was normalized to total protein, which was comparable in control and experimental conditions, so this reduction is not likely due to some generalized impairment of protein synthesis. We also evaluated the effect of nucleolin knockdown on the transfection by
Lipofectamine 2000, a liposomal transfection reagent. We did not observe significant difference in the luciferase activity in siRNAs against nucleolin and GAPDH treated cells.
While knockdown of nucleolin reduces transfection efficiency of DNA nanoparticles, overexpressing a nucleolin-GFP fusion protein increases the luciferase reporter expression by 47.7% compared to cells expressing GFP alone (Figure 2.13A). The fusion protein migrates as a
130kD band on
SDS-PAGE, and is recognized by the same antibody as recognizes endogenous nucleolin (Figure
2.13A). Endogenous
63 nucleolin, actin and syndecan-4 were not affected by overexpression of either GFP fused nucleolin or GFP (Figure 2.13B).
Purified nucleolin inhibits internalization of DNA nanoparticles
To address more directly whether surface nucleolin serves as a receptor for DNA nanoparticles, we performed a competition assay. The luciferase DNA nanoparticles were mixed with purified nucleolin (molar ratios of nucleolin to nanoparticle 17.2:1, 68.7:1, and 172:1) prior to application on HeLa cells. Neither the addition of nucleolin nor the 1 hr incubation at 37°C disrupted the integrity of the nanoparticles (Figure 2.14A). As shown in Figure 2.14B, exogenous nucleolin significantly blocked transfection by DNA nanoparticles in a dose-dependent fashion with a 90% inhibition at the highest concentration. It is likely that the exogenous nucleolin competes with cell surface nucleolin for binding to the DNA nanoparticles, thereby inhibiting the nanoparticles from attaching to the membrane.
64 Discussion:
Compacted DNA nanoparticles containing CFTR cDNA, delivered to the nasal epithelium in patients with cystic fibrosis, resulted in increased cAMP-stimulated chloride transport in 8 of 12 subjects, with four patients’ values reaching the normal range at one time point, and no adverse effects attributed to the drug (Konstan et al.,
2004). They appear to surmount one of the major barriers to non-viral gene transfer in vivo – accessing the nucleus of non-dividing cells. A study using microinjection of complexes shows that DNA nanoparticles reach the nucleus of non-dividing cells and go through the Nuclear Pore Complex (NPC) to gain access to the nucleus (Liu et al., 2003).
The mechanism by which the DNA nanoparticles enter the cell and are conducted rapidly
(within 1 hr in many cells) into the nucleus has not been elucidated. We hypothesize that nucleolin plays a critical role in the process of trafficking from cell membrane into the nucleus based on the following observations. The DNA nanoparticles do not employ the traditional clathrin-mediated endocytosis (CME) to enter the cell, as they do not appear to colocalize with markers in this pathway (EEA1, Cathepsin D and transferrin), which is consistent with a previous report (Walsh et al., 2006). Similar to antibodies against nucleolin, the DNA nanoparticles enter and accumulate in the nucleus within 1 hr (Figure
2.10). During this process, these two markers colocalize at the cell membrane and through the cytoplasm into the nucleus. Moreover, internalization of both is energy dependent and is inhibited at 4°C (Figure 2.9A; Deng et al., 1996). Together with the data that the nanoparticles colocalize with nucleolin on the cell surface and exogenous nucleolin inhibits their transfection, it is appealing to suggest that nucleolin provides a direct and non-destructive route from the cell membrane into the nucleus. In line with this
65 hypothesis, nucleolin is well known for shuttling between various compartments of the cell (Srivastava and Pollard, 1999; Hovanessian et al., 2000).
The binding of nucleolin to DNA nanoparticles, as revealed by the SPR experiments, has a KD of 25.9 nM, a value about ten fold less than the binding of nucleolin to another ligand, lactoferrin, which has a KD of about 238 nM, also obtained from SPR experiments
(Legrand et al., 2004). Considering the potential stoichiometry of the binding, the actual avidity effect from multiple nucleolin binding to the same DNA nanoparticles is extremely high. It is not likely that such binding would readily dissociate at physiological conditions, similar to the SPR experiment with nucleolin immobilized on the chip with a particularly long 6 min buffer washing. This might also help to explain the efficiency of the nanoparticles. The maximal number of nucleolin molecules that may bind to one
DNA nanoparticle is calculated at 53.6 ± 0.4 from the “nanoparticle-on-chip” SPR experiment (Figure 2.3B). Since we know that the nanoparticles compacted with acetate as counterion are rod-shaped, with diameter of about 10 nm and length of about 211 nm
(Fink et al., 2006), we may calculate the overall surface area of the nanoparticles to be about 6.79 103 nm2 (Eq 2.3, Methods and Materials). The volume of a nucleolin molecule is estimated to be about 92.5 nm3 (Peptide Calculator, see Materials and
Methods). Assuming the nucleolin molecule is cubic, we then are able to estimate the surface area of one side of the molecule to be 20.5 nm2 (Eq 2.4, Methods and Materials).
The maximal area occupied by 53.6 nucleolin molecules will be 1.10 ± 0.1 103 nm2, which is less than the total surface area of one nanoparticle. Therefore, this calculation further supports the validity of the SPR results.
66 The binding of the nanoparticles to nucleolin seems to be highly specific and not simply a charge interaction, as GFP protein, which has a pI of 5.0-5.9 (Richards et al.,
1999) compared to 5.5-6.1 of nucleolin (Tuteja and Tuteja, 1998), does not bind to the nanoparticles as any concentrations tested (Figure 2.4). This binding is not likely an electrostatic interaction between the acidic stretch of nucleolin and polylysine solely, because the binding of either PEGylated or non-PEGylated polylysine peptide (CK30) is of much lower affinity (about 220 nM compared to 25.9 nM with the nanoparticles).
Moreover, DNA nanoparticles are nearly charge neutral rather than positively charged
(Liu et al., 2003). Therefore, the high-affinity interaction of nucleolin with the nanoparticles seems to require intact nanoparticles composed by both DNA and polylysine, and a more complex mechanism than simple electrostatic interaction with the polylysine peptide. In this instance, PEG may enhance rather than inhibit the binding.
The DNA nanoparticles are highly compacted with negatively charged DNA and positively charged poly-lysine (Liu et al., 2003). The electrostatic interactions mimic compaction of genomic DNA by histones into nucleosomes and chromatin. The mechanism by which the compacted complex is unpacked and the reporter gene is expressed is so far not clear. It was reported recently that nucleolin functions as a histone chaperone to regulate gene expression in the nucleus (Angelov et al., 2006). It was found that nucleolin greatly enhances the chromatin remodeling machineries SWI/SNF and
ACF, destabilizes histone octamer, and facilitates transcription through the nucleosome
(Angelov et al., 2006). The final result from these chaperone activities is stimulation of transcription through compacted genomic DNA. Nucleolin might act similarly on the compacted nanoparticles to stimulate transcription of the plasmid DNA.
67 In summary, our results strongly support the hypothesis that nucleolin is the cell surface target of DNA nanoparticles, and may be a key transporter for DNA nanoparticles from the membrane through to the nucleus. To exploit our knowledge of the interaction with cell surface nucleolin to improve transfection efficiency of DNA nanoparticles, a better understanding of the mechanism of both the internalization of the nanoparticles into the cell and the export of nucleolin to the cell surface is needed. Further characterization of the binding of nucleolin and DNA nanoparticles might also facilitate the design of better therapeutics.
68 Materials and Methods:
Reagents: All chemicals are purchased from Fisher Scientific (Fairlawn, NJ) or Sigma
(St. Louis, MO). DNA nanoparticles were compacted as described (Liu et al., 2003).
Luciferase plasmid and PEGylated polylysine were provided by Copernicus
Therapeutics, Inc (Cleveland, OH). Purified GFP protein was purchased from Invitrogen
(Carlsbad, CA). Antibodies: MS-3 and H-250 against nucleolin, H-140 against syndecan-
4, C-15 against EEA1 and H-75 against Cathepsin-D were purchased from Santa Cruz
(Santa Cruz, CA), 6C5 against GAPDH was from Chemicon (Temecula, CA), 38F3 against fibrillarin was from Abcam (Cambridge, MA). siRNA and Real-Time PCR: The sequence of siRNA specific for nucleolin mRNA is 5’-
GACAGUGAUGAAGAGGAGG-3’, as reported by Sakaguchi (Sakaguchi et al., 2003). siRNA and control siRNA against GAPDH mRNA was synthesized by Ambion (Austin,
TX). Logarithmically growing HeLa cells were transfected with siRNAs using
Oligofectamine 2000 (Invitrogen). For DNA nanoparticle transfection, the DNA nanoparticles were administered 48 hr after siRNAs were introduced. Knockdown effect was tested by real-time PCR using primers:
NCL1-5’: GTGGAGAAGAGGTCGTCATACC
NCL1-3’: AACTGTCTTCTTGGCAGGTGTT
The primer set amplifies nucleotides 125-294 of the human nucleolin open reading frame
(170 bp product). First strand cDNA was synthesized with Reverse Transcriptase AMV
(Roche Diagnostics, Indianapolis, IN) from 1 g total RNA, and RT-PCR was performed on a Roche LightCycler Systems using LightCycler FastStart DNA Master SYBR Green
I kit (Roche).
69 Cell Cultures: Well-differentiated airway epithelial cells grown at the air-liquid interface are established and maintained as described (Karp et al., 2002) from human tracheal specimens obtained at post mortem examination. HeLa cells were maintained in DMEM; the 16HBEo- cell line, in MEM; the Jurkat cell line, in RPMI1640 medium; all media were supplemented with 10% fetal bovine serum and antibiotics (Mediatech, Herndon,
VA).
Purification of nucleolin: Methods are adapted from Reference 25. Jurkat cells were lysed, and the cytoplasmic extract passed through a DEAE-Sepharose Fast Flow column
(Amersham Biosciences, Piscataway, NJ). Bound proteins eluted with 1 M NaCl in sodium phosphate buffer pH 7.0 were passed through a Heparin–Sepharose column
(Amersham Biosciences) and eluted with 0.6 M ammonium sulfate. Five or six eluted fractions from the heparin column contained a single 105 kDa protein band corresponding to nucleolin, as confirmed by Western blot with MS-3 antibody. Pooled nucleolin was dialyzed against phosphate buffered saline (PBS) containing 1 mM
Pefabloc at 4°C overnight before storage at -80°C.
Surface Plasmon Resonance (SPR): SPR experiments were performed on a BIAcore
3000 (Piscataway, NJ) model at 25°C. DNA nanoparticles were immobilized on CM5 sensor chips by the primary amine method. DNA nanoparticles (100 g/mL in acetate buffer at pH 5.5), and injected to a pre-activated sensor chip surface at a flow rate of 10
L/min. Nucleolin was immobilized on the same chip by the primary amine method.
Nucleolin (20 g/mL in acetate buffer pH 4.5) was injected at a flow rate of 10 L/min.
Running buffer for immobilization reactions was HPS-N (BIAcore), and PBS (pH 7.2) was used in binding analysis for nucleolin, GFP and DNA nanoparticles. Binding curves
70 were fitted into 1:1 Langmuir binding model, if feasible, using BIAevaluation 4.0 software. Equations used to analyze the data are as following:
Eq 2.1: Maximal response of the chip.
R MW S = L A m Rmax MWL
Where RL is the amount of ligand coupled to the chip in RU, MWA is molecular weight of analyte (nucleolin in this case, 76.4 kDa), MWL is molecular weight of ligand (DNA
3 nanoparticles, about 8.53 10 kDa), and Sm is number of binding sites on ligand for analyte. Sm (stoichiometry) can then be derived by rearranging Eq1 as:
R MW = max L Eq 2.2: Sm RL MWA
Rmax and RL are obtained in the experiment in Fig. 2b.
Cell surface biotinylation and Western blot: Cell surface biotinylation assay was performed on HeLa and 16HBEo- cells using EZ-Link Sulfo-NHS-LC-Biotin (Pierce
Biotechnology, Rockford, IL) in ice cold PBS (500 g/mL). HeLa cells were washed with PBS three times. Freshly dissolved biotinylation reagent was left on the cells for 1 hour at 4°C, and repeated once. Reaction was quenched by 100 mM glycine in PBS.
Cells were then washed 2 times with PBS and lysed with buffer containing 50 mM
Tris/HCl (pH 8.0), 120 mM NaCl, 5 mM EDTA and 1% Triton X-100 supplemented with protease inhibitor cocktail (Sigma). Biotinylated proteins were pulled down from 500 g cell lysate with 50 l wet neutravidin-conjugated agarose beads (Pierce) overnight at 4°C.
Beads were washed with lysis buffer three times and eluted with SDS-PAGE buffer containing 2% SDS and 5% -mercaptoethanol at 100°C for 10 min, and eluted proteins were analyzed by Western blot. Blot membranes were analyzed using VersaDoc Model
71 3000 Imaging System (Bio-Rad Laboratories, Hercules, CA). Densitometry was performed using Quantity One 1-D Analysis Software from Bio-Rad. Results are presented as mean ± SD of triplicates from the same blot.
Fluorescence microscopy: Cells were grown on 4-well or 8-well Nunc chamber slides
(Nalge Nunc Intl, Rochester, NY), and fixed in 4% paraformaldehyde (Electron
Microscopy Sciences, Hatfield, PA) at room temperature for 15 min, then stained with primary antibodies at concentrations of 2-4 g/mL, and Alexafluor-488 or Alexafluor-
568 conjugated goat anti-mouse or rabbit secondary antibodies (Molecular Probes,
Invitrogen Corporation, Carlsbad, California) at dilution of 1:500. The nucleus was counterstained with 2 g/ml Hoechst 33258 (Molecular Probes) in PBS at room temperature for 10 min prior to mounting in VectorShield (Vector Laboratories,
Burlingame, CA). The slides were examined using a Zeiss Axiovert 200 wide field microscope with the proper filter. For some images acquired z-stacks were deconvolved with Hygens confocal deconvolution software and further processed with Autoquant,
ImageJ and Adobe Photoshop software as noted in the figure legends.
Labeling of DNA nanoparticles with rhodamine: DNA nanoparticles applied to human primary airway epithelial cells were labeled with rhodamine conjugated peptide-nucleic acid on pGeneGRIP (Genlantis, San Diego, CA). For HeLa and 16HBEo- cells, plasmid was labeled with LabelIT Tracker intracellular nucleic acid localization kit from Mirus
Bio (Madison, WI) at 0.25:1 ratio (v:w) following the manufacturer’s guidelines.
Labeled DNA purified by ethanol precipitation at -20°C for 30 min was dissolved in double distilled water at concentration of 0.2 mg/ml. Labeled DNAs were compacted with CK30PEG10k into DNA nanoparticles (Liu et al., 2003).
72 Luciferase reporter assay: HeLa cells were plated on 24-well plates at about 40% confluence 1 day prior to transfection. DNA nanoparticles containing luciferase gene were applied at 1.6 g DNA (approximately 4.6 10-13 mol) per well to the cells in growth medium for 9-12 hr, then replaced by fresh growth medium. For competition experiment, DNA nanoparticles were premixed with 0.61 g, 2.45 g or 6.14 g purified nucleolin (8.0 10-12, 3.2 10-11 or 8.0 10-11 mol) prior to incubation with the cells.
Cells were harvested at 48 hr, and luciferase activity measured according to the manual of Promega Luciferase Assay system (Madison, WI). At least two separate experiments were each conducted in triplicate. Activity was calculated by dividing light units by total protein (RLU/mg), and are shown as mean ± SD. Significance was defined as p value <
0.05 as calculated by Student T test.
Calculation of surface areas of DNA nanoparticles and nucleolin: The average surface area of DNA nanoparticles was calculated assuming the nanoparticles are rod shaped and using published parameters (Fink et al., 2006). The surface area of the nucleolin molecule was calculated assuming it is cubic. The approximate volume of the nucleolin molecule was estimated (Peptide Calculator, http://www.basic.northwestern.edu/biotools/proteincalc.html).
Eq 2.3: Average surface area of the nanoparticles.
= + 2 ASN dNP lNP dNP /2
Where ASN is the total surface area of the rod, dNP is the diameter (width), and lNP is the length (assuming both ends of the rod are flat).
Eq 2.4: Surface area of one side of cubic nucleolin molecule.
= 2/3 ANCL VNCL
73 Where ANCL is the surface area of nucleolin, VNCL is the approximate volume of nucleolin
(assuming the shape of nucleolin molecule is cubic).
74 Chapter 3.
Regulation of cell surface expression of nucleolin by cell cycle dependent
kinase Cdk1
Xuguang Chen1, 2, Pamela B. Davis1.
1Departments of Pediatrics, 2Department of Biochemistry
Case Western Reserve University School of Medicine
75 Summary:
In the previous chapter, we demonstrated that nucleolin, a conserved eukaryotic protein with multifaceted cellular functions, is expressed on the surface of certain cell types, and serves as am important receptor for DNA nanoparticles. However, the mechanisms regulating its appearance at the cell surface are not clear. Here we propose that the expression of cell surface nucleolin is regulated by cyclin dependent kinase (Cdk) cdc2/Cdk1, but not casein kinase II (CK2). C-terminal truncated nucleolin constructs with the N-terminal 69 aa are expressed on the cell surface, and addition of eight consecutive Cdk phosphorylation sites at residues 70-123 significantly increases cell surface expression. The N-terminal 123 residues also mediate efficient nuclear import and less efficient nucleolar localization. Cell surface nucleolin is upregulated 6-7.5 hours after the release of double thymidine block, corresponding to the transition to G2/M phase. Inhibition of Cdk1 by RO-3306 after release of the block inhibits both threonine phosphorylation and cell surface expression of nucleolin, while inhibition of CK2 by
4,5,6,7-tetrabromobenzotriazole (TBB) or 2-dimethyl-amino-4,5,6,7-tetrabromo-1H- benzimidazole (DMAT) has little effect. Inhibition of dephosphorylation by okadaic acid increases surface nucleolin. Site directed mutagenesis of Cdk sites to the phospho- mimicking glutamate significantly increases cell surface expression while alanine mutation of the same sites has the opposite effect.
76 Introduction:
Nucleolin is a ubiquitously expressed protein conserved throughout eukaryotes. It plays important roles in ribosomal biogenesis, mRNA metabolism and chromosomal remodeling (Ginistin et al., 1999; Srivastava and Pollard, 1999; Storck et al., 2007). In certain cell types, it is also expressed on the cell surface, where it serves as a receptor for various ligands including DNA nanoparticles (Chen et al., 2008), which are gene therapy vectors in clinical trial for treating cystic fibrosis (CF) (Konstan et al., 2004). We previously showed that cell surface nucleolin serves as a receptor for DNA nanoparticles in HeLa, immortalized human tracheal epithelial cell 16HBEo-, and well-differentiated human airway epithelial cells grown at air-liquid interface (Chen et al., 2008). It is of our great interest to improve the efficacy of nonviral gene therapy by DNA nanoparticles by increasing their cell surface receptor and facilitating their cellular uptake. Therefore we investigated the regulatory mechanism of surface expression of nucleolin.
Nucleolin’s versatility in function comes from its multi-domain structure. The N- terminal 280 aa of nucleolin contains 4 acidic stretches rich in aspartate and glutamate, eight consecutive Cdk phosphorylation consensus repeats (Belenguer, et al., 1990; Peter et al., 1990) and multiple serines and threonines, which could be phosphorylated by casein kinase II (CK2). The nuclear targeting of nucleolin appears to be controlled by a bipartite nuclear localization signal (NLS) located in part at aa 280 – 300. Amino acids
300 – 650 contain four RNA binding domains (RBDs), and the C-terminal 59 amino acids are rich in glycines and methylated arginines (GAR domain), which mediates its interaction with other proteins and its localization in the nucleolus (Srivastava and
Pollard, 1999). Despite lack of a transmembrane domain or glycosylphosphatidylinositol
77 (GPI) anchored sequence, nucleolin is found at the cell surface in airway epithelial cells
(Bose et al., 2004), macrophages (Hirano et al., 2005), tumor cells (Girvan et al., 2006,
Teng et al., 2007) and angiogenic endothelial cells (Huang et al., 2006; Shi et al., 2007) and other cell types, where it binds to a variety of extracellular ligands, including growth factor laminin-1 and pleiotrophin (Kibbey et al., 1995; Said et al., 2002), glycoproteins
L-selectin and acharan sulfate (Harms et al., 2001; Joo et al., 2005), human parainfluenza virus type 3 (HPIV-3) (Bose et al., 2004), human immunodeficiency virus type 1 (HIV-1)
(Callebaut et al., 1998; Nisole et al., 2002a) and anti-HIV molecules like midkine and
HB-19 (Said et al., 2002; Nisole et al., 2002b), anti-tumor agents like endostatin (Shi et al., 2007), a tumor homing peptide F3 (Christian et al., 2003) and aptamer AS1411
(Girvan et al., 2006; Teng et al., 2007), a hemorrhagic strain of E coli (Sinclair and
O’Brien, 2002; Sinclair and O’Brien, 2004; Robinson et al., 2006), apoptotic cells
(Hirano et al., 2005), a non-viral gene transfer vector namely DNA nanoparticles (Chen et al., 2008), and even inorganic materials such as calcium oxalate (CaOx) crystals in renal tubules (Sorokina and Kleinman, 1999).
Compacted DNA nanoparticles are non-viral gene delivery vectors in clinical trial for treating genetic disorders including cystic fibrosis, which have been shown to partially correct the chloride transport defect in CF patients (Konstan et al., 2004; Liu et al., 2003;
Ziady et al., 2003a; Ziady et al., 2003b). We previously discovered that cell surface nucleolin serves as a receptor for the DNA nanoparticles, and is important for gene delivery (Chen et al., 2008). We observed that transfection by DNA nanoparticles in
HeLa cells decreases by 72.2% following 24-hour serum-free medium treatment, which reduces cell surface nucleolin by 35.7% (Chen et al., 2008). It has been shown that
78 nucleolin in different cellular compartments has different isoelectric points, and that cytoplasmic and cell surface nucleolin contain more negative charges than nuclear nucleolin, presumably due to increased phosphorylation (Hovanessian et al., 2000). Since removal of serum affects cell cycle progression, we hypothesize that the expression of nucleolin is regulated by cell cycle dependent kinase, most likely cdc2, which phosphorylates nucleolin and regulates its nuclear/cytoplasmic shuttling (Belenguer et al., 1990; Peter et al., 1990). Understanding the regulation of cell surface nucleolin may not only enrich our knowledge on cell cycle regulation and cellular trafficking of proteins, but also allow us to improve current therapy for cancer, viral infection and gene delivery.
Here we report that the N-terminus and Cdk sites of nucleolin are essential for its cell surface expression. Activation of Cdk1 during G2/M transition in a synchronous HeLa cell population increases cell surface nucleolin by 2 to 3 fold, depending on the technique of analysis. Inhibition of Cdk1 during G2 phase inhibits the increase of surface nucleolin and its phosphorylation, while inhibition of CK2 has little effect. Inhibition of protein phosphatase by okadaic acid also increases surface nucleolin. Mutation of the Cdk sites to mimic phosphorylated status promotes surface expression of nucleolin. In summary, these data suggest that phosphorylation of nucleolin by Cdk1 is an important positive regulator of its cell surface expression.
79 Results:
The N-terminus of nucleolin is required for its expression on the cell surface
Since it has no intrinsic signal sequence, transmembrane domain or GPI anchoring domain, we made serial deletions of nucleolin to delineate the amino acid sequence responsible for cell surface expression. We subcloned nucleolin missing various lengths at its C-terminus into a mammalian expression vector and fused the open reading frame of green fluorescent protein (GFP) protein to the C-terminus as an epitope tag (Fig 3.1 A and B, Table 3.1) under the control of a CMV promoter. The expression of the truncated
80 nucleolin fusion proteins was confirmed by Western blot using antibodies against GFP at the C-terminus and antibody N17 recognizing the N-terminal 2 – 17 amino acids (a.a.) of nucleolin. As shown in Figure 3.1C, C-terminal truncated nucleolins (NCLD 1 – 7) are recognized by both GFP and N17 antibodies, while the N-terminal truncated nucleolins
(NCLD 8 and 9) are only recognized by the GFP antibody. Endogenous nucleolin was also detected by N17 with apparent Mr ~100 kDa. To test for cell surface expression, truncated nucleolins were expressed in HeLa cells, which were biotinylated on ice, lysates pulled down with neutravidin beads, and the eluted proteins Western blotted for
GFP. As shown in Figure 1, deletion of C-terminal portions of nucleolin, including the
GAR domain (NCLD1), 4 RBDs (NCLD 2), the bipartite NLS (NCLD 3) and the last 3 of the 4 acidic stretches (NCLD 4, 5 and 6), increases its cell surface expression (Fig
3.2A and B). Further deletion of a.a. 70 – 123 (Cdk sites, D7), where the eight consecutive consensus Cdk sites are located, significantly decreases cell surface expression by 2/3 (Fig 3.2B, comparison of D6 and D7). In contrast, truncated nucleolin
(D8) missing the N-terminal 63 a.a., which contains the first acidic stretch (Fig 3.1 A and
B, the leftmost yellow region labeled AS1), or missing the Cdk sites alone (D9), is not
81 expressed at the cell surface (Fig 3.2A). Therefore, the N-terminal 69 a.a. of nucleolin is required for its appearance at cell surface, while the Cdk sites (a.a. 64 – 123) are essential for efficient surface expression. The N-terminal 69 residues of nucleolin contain a highly acidic region at a.a. 22 – 44 rich in aspartate and glutamate (Fig 3.1A, AS1).
Intracellular localization of truncated nucleolin constructs
To further investigate the effect of different domains of nucleolin on its cellular localization, we visualized the truncated nucleolin-GFP fusion proteins by fluorescent microscopy with costaining of cell surface nucleolin-GFP (Fig 3.3) or total nucleolin (Fig
3.4). Neither vector nor GFP transfected cells display surface GFP, although the expression of GFP was confirmed in the entire cell. In contrast, nucleolin-GFP is concentrated in the nucleolus of interphase cells, and also stained on the cell surface of transfected cells with a red-emitting secondary antibody. NCLD1 lacking the GAR domain also enters the nucleus, but is distributed in the nucleoplasm and less concentrated in the nucleolus, which is consistent with previous reports that the GAR
82
domain is essential for the nucleolar localization. Similarly NCLD 2 – 6 with the N- terminal 123 a.a. localize to both nucleoplasm and nucleolus and little is found in the
83 cytoplasm, which indicates that this region of nucleolin might contain a functional nuclear localization signal (NLS). In contrast, NCLD7-GFP, although enters the nucleus in high quantity, is not localized to the nucleolus and exists also in the cytoplasm. The predicted molecular weights of NCLD6-GFP and NCLD7-GFP are about 39.5 and 34.4 kDa respectively, both of which are around the upper limit of free diffusion across the nuclear pore complex (NPC) (Fried and Kutay, 2003). Therefore, the appearance and concentration of NCLD 3 – 7 in the nucleus should require an NLS in the N-terminal 69 a.a. Detailed sequence analysis reveals a putative monopartite NLS PQKKGKK at a.a. 48
– 54, which might be responsible for the nuclear targeting of the C-terminal truncated nucleolins missing the classic bipartite NLS at residue 280. Unlike nuclear import, nucleolin has been reported to interact with U3 snoRNA, which is an intrinsic nucleolar small RNA needed for pre-rRNA processing (Ginisty et al., 1998). Therefore, it is
84 nucleolar localization of most proteins does not require a consensus sequence or motif, but is mediated by interaction with other nucleolar proteins or RNAs. The N-terminus of possible that the nucleolar targeting of NCLD6 is mediated by such interaction, which might be disrupted by deletion of the Cdk sites in NCLD7. Conversely, siRNA knockdown of nucleolin in HeLa cells inhibits pre-rRNA synthesis, disrupts nucleolar structure and induces cell cycle arrest at G2 to M phases (Ugrinova et al., 2007), suggesting the involvement of the Cdk sites of nucleolin in regulating both cell cycle progression and ribosomal biogenesis. On the other hand N-terminal truncated nucleolin
NCLD8, which lacks the monopartite NLS and the first acidic stretch, is highly concentrated in the nucleolus, which confirms the function of the bipartite NLS and GAR domain in mediating nuclear and nucleolar localization of nucleolin. NCLD9, which contains only the 8 Cdk sites, is diffusely distributed similar to GFP protein alone. This indicates that the Cdk sites by themselves are not sufficient for either nuclear or nucleolar targeting, but both the N-terminal 69 a.a. and the Cdk sites are required for nucleolar localization. All of the C-terminal truncated nucleolins stain positive for cell surface expression, while neither NCLD8 nor NCLD9 is observed on the surface, which is consistent with the biotinylation results in the previous section.
Surface nucleolin is upregulated at the G2/M phase transition
Nucleolin is heavily phosphorylated during mitosis by Cdk1. Thus we tested the expression of cell surface nucleolin during cell cycle progression in a synchronous HeLa cell population following double thymidine block (DTB) as described before
(Richardson et al., 2000; Yang et al., 2004). In general, HeLa cells were treated with 2 mM thymidine for 18 hours, washed and incubated with thymidine-free medium for 9
85 hours and thymidine added for another 17 hours, which was considered time 0. High concentration of thymidine blocks DNA replication, therefore cells were at S phase at time 0. Within 7.5 hours cells progressed to M phase, which was completed at about 12 hours (Richardson et al., 2000). We analyzed surface nucleolin by cell surface biotinylation at 2.5-hour intervals (Fig 3.5A) and plotted the result in Figure 3.5B after normalization to a constitutive cell adhesion molecule, syndecan-4. Surface nucleolin peaked at 7.5 hours coinciding with the completion of G2 phase and the onset of M
86 phase. The maximum surface nucleolin at 7.5 hours reached three times the value at time
0 (S phase).
As the efficiency of the biotinylation reaction and neutravidin pulldown could vary at different time points, which might introduce artificial variation during calculation, we examined surface nucleolin by subcellular fractionation as well (Fig 3.6 A and B). The purity of each fraction was confirmed by Western blot of the nuclear marker fibrillarin and the cytosolic marker tubulin (not shown). At 1.5-hour intervals after release of DTB,
HeLa cells were lysed with hypotonic buffer. The supernatant was further centrifuged, and the pellets containing membrane and cytoskeletal fractions were solubilized using buffers containing 1% Triton X-100 and 1% SDS respectively, while the supernatant was regarded as cytosolic fraction. Membrane-associated and cytosolic nucleolin at different stages of cell cycle were Western blotted and plotted in Figure 3.6 A and B. Consistent with the biotinylation result, we observed a peak of membrane nucleolin at 6 – 7.5 hours with an increase of 3 fold compared to that of time 0 (Fig 3.6B). Surface nucleolin returned to the initial level, comparable to that of S phase, before the completion of M phase (10.5 hours) and remained low thereafter (15 hours). In contrast, cytosolic nucleolin continued to increase until 13.5 hours corresponding to the completion of M phase (Fig 3.6B). This result is consistent with previous findings that phosphorylation of nucleolin during M phase by Cdk1 is responsible for its redistribution from the nucleus to the cytoplasm (Belenguer, et al., 1990; Peter et al., 1990). Results from both techniques agree that cell surface nucleolin peaks at the G2/M phase transition, consistent with a positive regulatory role of the activation of Cdk1 in this process. Another implication of this data is that the increase of surface nucleolin is a specifically regulated process and
87 not due to the increase of synthesis or accumulation of nucleolin in the cytoplasm. Since the active form of Cdk1 is complexed with type A cyclin in G2 phase (Kaldis and Aleem,
2005), this regulation is likely achieved by the phosphorylation by the active Cdk1/A during G2 phase.
RO-3306 inhibits cell surface expression and threonine phoshphorylation of
88 nucleolin
RO-3306 was designed as a specific inhibitor for Cdk1 complexed with cyclin B1, but is a lesser inhibitor for Cdk1/A, therefore it has been used to synchronize cells at early M phase by inhibiting Cdk1/cylin B1 (Vassilev et al., 2006; Vassilev, 2006;
Krasinska et al., 2008). As we observed the increase of surface nucleolin following G2 phase at the G2/M transition, we speculated that inhibition of Cdk1 would counteract this effect and inhibit the increase of surface nucleolin. Consequently, we examined cell
89 surface nucleolin in HeLa cells 6 hours after the release of DTB in the absence or presence of 9 M RO-3306 (Vassilev et al., 2006). The Ki of RO-3306 for Cdk1/B1 and
Cdk1/A is 35 nM and 110 nM respectively. Therefore at the working concentration of 9
M, both cyclin B1 and A complexed Cdk1 should be inhibited. We consistently observed a 3-fold increase of surface nucleolin 6 hours after release of DTB without RO-
3306 assayed by surface biotinylation (Fig 3.7 A and B). Addition of RO-3306 decreased surface expression markedly to 46.9% of that without RO-3306, although the levels were still increased by 2.15 fold over that without synchronization and 3.03 fold above time 0
(Fig 3.7 A and B). Transfection by DNA nanoparticles in DTB-synchronized HeLa cells increases 2.10 fold at 6 hours following the release of the block, and decreases again at
12 hours (Fig 3.7C), converge nicely with the fluctuation of cell surface nucleolin. Since
7 of the 8 Cdk sites are threonines, we used threonine phosphorylation as an indicator of
Cdk phosphorylation. Nucleolin at 0 or 6 hours after DTB with or without RO-3306 was immunoprecipitated with a rabbit polyclonal antibody N17 against the N-terminal amino acids 2 – 17, and Western blotted for phospho-threonine with a rabbit polyclonal pan- phosphothreonine antibody (Fig 3.7D). Threonine phosphorylation of nucleolin 6 hours after DTB increased by 15% compared to time 0, while RO-3306 decreased threonine phosphorylation by 10% of time 0 (Fig 3.7E). Therefore, its appears that surface expression and Cdk1 phosphorylation of nucleolin increase concomitantly following G2 phase, and both of the effects are inhibited by blocking the activation of Cdk1.
We also tested this inhibitor in an asynchronous HeLa cell population for its effect on the expression of cell surface nucleolin and subsequent effect on the transfection efficiency of DNA nanoparticles, which has been shown to rely on the level of its
90 receptor, surface nucleolin (Chen et al., 2008). Pre-incubation of RO-3306 for 1 hour increased cell surface nucleolin by about 50%, and this increase was sustained until 4 hours (Fig 3.8 A and B). In contrast, longer incubation (6 – 8 hours) led to decline of surface nucleolin to the basal level (Fig 3.8B).
We then examined the effect of RO-3306 pretreatment on the transfection of DNA nanoparticles in both asynchronous HeLa and human bronchial epithelial cells 16HBEo-.
In three separate experiments, preincubation of cells with RO-3306 for one hour prior to transfection with DNA nanoparticles significantly increases expression of the reporter
91 gene from nanoparticles by 84.1% in HeLa cells (Fig 3.8C), and pretreatment for four hours slightly enhances transfection by 32.1% although not statistically significant.
Similar increases in transfection were also observed in 16HBEo- cells. Both 1-hour and
4-hour pretreatments of 16HBEo- with RO-3306 increase luciferase expression from the nanoparticles significantly by 28.1% and 35.6% respectively (Fig 3.8C). These results are consistent with the increase in the level of cell surface nucleolin demonstrated in the biotinylation experiments (Fig 3.8B). The improvement in surface nucleolin and transfection by DNA nanoparticles following a short period of RO-3306 treatment is likely due to the enrichment of cells at G2/M phases after Cdk1 inhibition (Vassilev,
2006).
Threonine to glutamate mutations of Cdk sites increase surface expression of nucleolin
Since it appears that the Cdk sites and the phosphorylation of these sites are important for regulating cell surface expression of nucleolin, we decided to analyze these sites by site-directed mutagenesis. There is no previous knowledge as to which of the 8 Cdk sites at residue 64 – 123 (1 serine, 7 threonines) are used in vivo, so we mutated all the 8 sites to glutamic acids (T8E mutant) to mimic the phosphorylated status of these sites, or to alanines (T8A) to inhibit phosphorylation on these sites (Table 3.2 and 3.3). Both mutants were fused to GFP epitope tag at the C-terminus as the wild type (WT) to distinguish them from endogenous nucleolin. Surface expression of GFP tagged proteins were normalized to total level for quantification. As we expected, the glutamate mutant has significantly more cell surface expression (+51.8%) than WT nucleolin (Fig 3.9 A and
B). The alanine mutant, on the other hand, has lower surface expression (-26.4%)
92 compared to WT, although not statistically significant (Fig 3.9B). Therefore, phosphorylation of the Cdk sites apparently increases surface expression of nucleolin while inhibition of phosphorylation has the opposite effect.
We also analyzed threonine and serine phosphorylation in the mutants compared to the WT. Lysates from HeLa cells transiently expressing wild type, T8E or T8A nucleolin-GFP were immunoprecipitated with a rabbit anti-GFP antibody, and Western blotted with primary antibodies specifically against phosphothreonine and phosphoserine
(Fig 3.9C). WT full-length nucleolin is heavily phosphorylated on both threonines and serines as judged by the Western blot. Both T8E and T8A mutants have much lower
93 threonine phosphorylation compared to wild type (Fig 3.9D). Threonine phosphorylation is not completely abolished in the mutants because nucleolin contains 8 CK2- phosphorylatable sites downstream of residue 123. Since deletion of these sites did not prevent surface expression of nucleolin, we believe that phosphorylation of these sites probably has little effect on cell surface expression of nucleolin. The N-terminal 123 amino acids nucleolin contain four serine consensus sites for CK2 phosphorylation, so we also analyzed serine phosphorylation of the mutants. Glutamate mutations on the Cdk sites increased serine phosphorylation, while alanine mutations decreased it (Fig 3.9D).
Given that CK2 prefers sites in an acidic environment, it is consistent with the fact that
T8E has more negative charges while T8A has less than wild type.
CK2 phosphorylation has little impact on the cell surface expression of nucleolin
Besides the 8 consensus Cdk sites within the N-terminal 123 a.a. of nucleolin, there are 4 serines in the first acidic stretch, which are predicted to be phosphorylated by casein kinase II. We also mutated these sites to alanines (S to A mutants, Table 3.4) in full- length nucleolin-GFP in order to see whether they play a role in regulating surface nucleolin. Mutation of the first two CK2 sites (S12A) has little effect on the serine phosphorylation, while mutation of serines 3 and 4 (S34A) diminished most serine phosphorylation from Western blot (Fig 3.10B). Mutation of all the four serines (SA) has the same effect as S34A, suggesting that serines 3 and/or 4 are likely to be the only two
CK2 sites phosphorylated in vivo.
In contrast to the effect on serine phosphorylation, when expressed in HeLa cells S to
A mutations of serines 1&2 and/or 3&4 have little effect on the expression of cell surface nucleolin (Fig 3.10A), which suggests that these sites are probably not required for the
94 regulation of surface nucleolin expression. Consistent with this hypothesis, 4-hour inhibition of CK2 by either 25 M TBB or 5 M DMAT (Sarno et al., 2005; Pagano et al., 2008) does not change the cell surface level of nucleolin (Fig 3.10C). However, inhibition of protein phosphatases by 9 nM okadaic acid (Sontag and Sontag, 2006) increases surface nucleolin by about two fold (Fig 3.10C). Considering that phosphorylation of the Cdk sites increases surface nucleolin, inhibition of dephosphorylation of the same sites should have similar effect. Therefore, cell surface expression of nucleolin is likely to be regulated by phosphorylation and/or dephosphorylation on the Cdk sites, and it apparently does not involve CK2.
Despite the lack of influence on cell surface nucleolin, we nevertheless tested the effect of CK2 inhibitors as well as okadaic acid on the transfection of DNA
95 nanoparticles. HeLa cells pretreated with DMSO, RO-3306, TBB, DMAT or OA for four hours were transfected with 2 g DNA nanoparticles carrying luciferase reporter gene for
2 hours after removal of the drug and washing of the cells with fresh medium (Fig
3.10D). RO-3306 showed slight increase in the reporter expression although it doesn’t reach significance. None of other drugs including OA showed any effect on luciferase expression compared to DMSO treatment or no treatment. It appears that even though
OA increases cell surface nucleolin transiently after 4-hour treatment, its effect faded rapidly after removal of the drug and surface nucleolin probably returned to normal level during the transfection. It is thus necessary to further investigate the dynamics of surface nucleolin expression after and during drug treatments to enhance nanoparticle transfection.
Effect of extracellular pH, EDTA and K+ on the association of nucleolin to the cell membrane
Since nucleolin relies on its N-terminal 69 a.a. to be on the cell surface, we speculate that nucleolin utilizes this region to bind to other plasma membrane proteins.
This region contains the first of the 4 acidic stretches of nucleolin, so if the binding to other membrane proteins involves this acidic stretch, it is likely to be susceptible to the charge in the extracellular environment. Therefore, we examined whether pH, EDTA or
K+ affects the stability of cell surface nucleolin.
We first incubated HeLa cells with Hank’s buffered salt solution (HBSS) at pH ranging from 4.1 to 9.1 at 37°C for 10 min. The HBSS supernatant was then centrifuged and filtered through 0.22 m filter to remove cell debris, and concentrated from 10 ml to about 100 L using a 30-kDa molecular weight cutoff Centricon, and the proteins
96 separated by SDS-PAGE and subjected to Western blot for nucleolin and actin to ensure the intactness of the cells after the treatment (Fig 3.11A). Supernatants from exposure to
HBSS of pH 5.1 and 6.1 contain nucleolin, while at other pHs little nucleolin is observed in the supernatant. The isoelectric point (pI) of nucleolin was reported to be around 5.5 –
6.1 in the nucleus and slightly lower (4.5 – 5) on the cell surface (Chen et al., 2008;
Hovanessian et al., 2000). Therefore, at extracellular pH of 5.1 – 6.1, the total charge of nucleolin should be minimal, so its ability to form electrostatic interactions should be diminished. These observations therefore support our hypothesis that nucleolin relies on the electrostatic interactions of the acidic region with membrane proteins to be held on
97 the cell surface.
Nucleolin, especially the N-terminal acidic stretches, has been reported to bind to
Ca+ (Sorokina and Kleinman, 1999; Sorokina et al., 2004) and calcium oxalate (CaOx) crystals on the cell surface in renal tubules in vivo (Kumar et al., 2003; Sorokina et al.,
2004; Verkoelen and Verhulst, 2007). To tests whether the binding of nucleolin to Ca2+ has functional relevance for its residence on the membrane, we examined whether increasing concentrations of a chelating agent, EDTA, release nucleolin into the medium,
HeLa cells were therefore incubated with 0 – 10 mM EDTA in HBSS at 37°C for 10 min and processed as before. Concentrated supernatants were Western blotted for nucleolin using the MS-3 antibody against the C-terminal RBDs of nucleolin (Figure 3.11B left) or the N17 antibody against the N-terminal 2 – 17 a.a. (Fig 3.11B, right). Release of nucleolin into the medium increased with increasing concentration of EDTA, suggesting that Ca2+ might be involved in nucleolin’s binding to the membrane anchor directly or indirectly through affecting its secondary structure. Each antibody recognized a distinct pattern of degraded form of nucleolin, neither of which was seen when EDTA was not present. Degradation increased as the concentration of EDTA increased. The N17 antibody detected mainly N-terminal fragments at 85, 60, 50 42 and 35 kDa, while the
MS-3 antibody detected fragments at about 90, 60 and 40 kDa. Since nucleolin is able to undergo self-catalyzed proteolysis (Srivastava and Pollard, 1999), these data suggest that removal of Ca2+ increases degradation of nucleolin. This might occur if Ca2+ promotes secondary and tertiary structure for nucleolin that is resistant to self-degradation, and removal of Ca2+ allows nucleolin to assume a structure susceptible to autodegradation.
On the other hand, when 0.2 or 0.4 M K+ instead of EDTA was added to the medium,
98 nucleolin was also released in the medium, in a dose dependent fashion (Fig 3.11B), suggesting that K+ might also be involved in disruption of the secondary structure and/or binding to the membrane anchor.
99 Discussion:
Functions and localization of nucleolin in different intracellular compartments, mainly nucleus and cytoplasm, have been well studied. However, recent research has shown that cell surface nucleolin plays a key role in communicating with the extracellular environment. For instance, we previously discovered that delivery of transgene by DNA nanoparticles depends on cell surface nucleolin (Chen et al., 2008). The variety of ligands that bind to nucleolin on the cell surface highlights the importance of surface nucleolin.
However, especially compared to the abundant studies on the regulation of nucleolin shuttling between nucleus and cytoplasm, little is known about the mechanism of how nucleolin is delivered or anchored to the cell surface. Here we report that the arrival of nucleolin to the surface membrane depends on its first acidic stretch and is regulated by
Cdk1 phosphorylation.
The N-terminus of nucleolin is rich in acidic amino acids, and has been reported to be involved in binding to the CaOx crystals in renal tubules (Kumar et al., 2003; Sorokina et al., 2004). Our data here indicate that the N-terminal 1 – 69 a.a., in which the first acidic stretch resides, is required for nucleolin to be expressed on the cell surface, and the Cdk sites (located in a.a. 64 – 123) promote surface expression. Deletion of other portions of nucleolin, namely the C-terminal GAR domain, the RBD domains and the last 3 of 4 acidic stretches does not inhibit cell surface expression. These suggest that although they are very similar in primary sequences, the four acidic stretches of nucleolin may play different roles, some of which include anchoring itself on the membrane and binding to other ligands. Since nucleolin lacks membrane-spanning domains or GPI anchoring sequences, it is likely to be anchored by interaction with other surface proteins, some of
100 which may occur by charge interactions.
We found that phosphorylation of the Cdk sites in vivo might regulate surface expression of nucleolin. Previous studies have shown that the isoelectric point of nucleolin from the nucleus is higher than the pI of cytoplasmic or surface nucleolin
(Hovanessian et al., 2000), indicating that post-translational modifications such as phosphorylation of nucleolin might be different on the cell surface. Since nucleolin is heavily phosphorylated by cell cycle dependent kinase cdc2/Cdk1 during mitotic (M) phase (Belenguer et al., 1990; Peter et al., 1990), we tested whether phosphorylation on the 8 consecutive Cdk sites at a.a. 70 – 123 plays any role in regulation of its surface expression. We found indeed that addition of these sites to the N-terminal 69 residues significantly improves cell surface expression. In addition, both cell surface nucleolin and threonine phosphorylation of nucleolin (7 of 8 Cdk1 sites are threonines) peak at the transition of G2/M phase, when Cdk1 is activated. Inhibition of Cdk1 in a synchronous cell population diminishes the increase of both surface nucleolin and threonine phosphorylation. Mutation of the 8 Cdk sites to glutamate, to mimic the negative charge conferred by phosphorylation, increases surface expression, while alanine mutation at the same sites, which prevents phosphorylation, has the opposite effect. Inhibition of dephosphorylation by okadaic acid also increases nucleolin on the cell surface. Therefore, it appears that phosphorylation of nucleolin on the Cdk sites by Cdk1 is a positive regulator of its cell surface expression. In contrast, CK2 phosphorylation appears to have little impact on the surface expression, since inhibition of CK2 phosphorylation by either chemical inhibitors like TBB and DMAT or mutagenesis of CK2 sites to alanine does not change the cell surface level of nucleolin.
101 Understanding how cell surface nucleolin is regulated may not only help us understand a basic aspect of cellular physiology, but also provide us a therapeutic target for improving current gene therapy, preventing viral infections that utilize surface nucleolin as receptor or coreceptor, and specifically identifying and eliminating tumor cells, some of which are rich in surface nucleolin. Among those potential applications, given our prior work (Chen et al., 2008), we are most interested in improving the efficacy of the non-viral gene therapy vector, DNA nanoparticles. In the in vitro cell culture model, we are able to pharmacologically manipulate the level of cell surface nucleolin by adding the Cdk1 inhibitor RO-3306 or the phosphatase inhibitor okadaic acid to the cells.
Both cell surface nucleolin and transfection of DNA nanoparticles increase after 1-hour treatment of RO-3306 in HeLa and 16HBEo- cells, which might be due to the enrichment of a subpopulation of cells in G2 and M phases (Vassilev, 2006), as it has been shown that these cells have higher surface nucleolin. Although okadaic acid increases cell surface nucleolin, it does not significantly improve nanoparticle transfection. It might also be relevant to test the effect of other Cdk1 inhibitors such as roscovitine, or Cdk1 activaters such as resveratrol on surface nucleolin and transfection by the nanoparticles. It should be possible in an animal model to manipulate surface nucleolin to enhance the delivery of transgene by DNA nanoparticles, although there are still technical hurdles that need to be overcome for this method to be useful. Further work should address how much increase of surface nucleolin can be obtained by manipulating its phosphorylation, how cells in the particular target tissue respond to such treatment, and to what extent precise control of the timing of drug application will be required in vivo.
Besides gene therapy, our observations may inform some current approaches to
102 cancer therapy. Cell surface nucleolin has been found in tumor and angiogenic endothelial cells (Christian et al., 2003; Shi et al., 2007), and has been targeted in cancer therapy using aptamer AS1411 (Girvan et al., 2006; Teng et al., 2007). Recently, HB-19, a pseudopeptide that has been shown to bind to cell surface nucleolin and inhibit HIV-1 infection, was reported to suppress tumor growth and angiogenesis (Destouches et al.,
2008). Our findings that surface nucleolin peaks at the transition of G2/M phase, and that this increase is dependent on the activation of Cdk1 are consistent with previous knowledge that tumor cells have dysregulated cell cycle with hyperactive or overexpressed Cdk1 (Malumbres and Barbacid, 2002). Therefore cancer cells at the
G2/M transition should be most susceptible to drugs that target cell surface nucleolin.
One might consider dosing of such molecules at intervals to allow cells at different stages of cell cycle to progress to G2/M phase and thereby achieve maximum nucleolin targeting.
In summary, the N-terminal 69 a.a. of nucleolin that contains the first acidic stretch is required for its expression at the cell surface, and phosphorylation of Cdk sites at a.a. 64
– 123 by Cdk1 increases such delivery. Besides the pharmacologic implications noted above, future studies should also focus on identifying molecular partners of nucleolin at the cell surface that might further enhance the efficiency of DNA nanoparticles in vivo.
Besides increasing the availability of nucleolin on the cell surface for DNA nanoparticles, we were also studying the endocytic machinery that internalizes the nanoparticles after its binding to the receptor nucleolin, in the hope of facilitating this process for more efficient gene delivery.
103 Materials and methods:
Reagents: Thymidine and other chemicals not specified below were purchased from
Sigma (St. Louis, MO). Cdk1 inhibitor RO-3306, CK2 inhibitors TBB and DMAT, and okadaic acid were purchased from CalBiochem (Gibbstown, NJ). Antibodies: MS-3, H-
250 against nucleolin were from SantaCruz (Santa Cruz, CA); N17 against N-terminal nucleolin from Sigma; rabbit anti-phosphothreonine from Zymed (Invitrogen, Carlsbad,
CA); rabbit anti-phosphoserine from Novus (Littleton, CO); rabbit anti-GFP from
Invitrogen; 6C5 against GAPDH was from Chemicon (Temecula, CA),
Cell culture and transfection: HeLa cells were maintained in DMEM (Mediatech,
Herndon, VA) supplemented with 10% fetal bovine serum and antibiotics (Mediatech) as described before. Transient transfection of HeLa cells were performed using
Lipofectamine 2000 (Invitrogen, Carlsbad, CA) as instructed by the manufacturer.
Transfected cells were processed as below and Western blots were performed to analyze the expression of transgenes using specific antibodies against epitope tag (GFP) or other antigens. Proteins separated on an SDS polyacrylamide gel electrophoresis (SDS-PAGE) were transferred to a PVDF membrane (BioRad, Hercules, CA), blocked with 3% bovine serum albumin (BSA) in Tris buffered saline with 0.05% Tween-20 (TBS-T), and incubated with primary antibodies at 4°C overnight, washed with TBS-T and incubated with secondary donkey anti-mouse or rabbit antibodies conjugated with horse radish peroxidase (HRP) from Jackson Immunoresearch (West Grove, PA) at 1:10,000 dilution room temperature for 1 hour. Membranes were developed with Super Signal West Pico kit (Pierce, Rockford, IL) and imaged with VersaDoc 3000 system (BioRad). The intensity of desired bands were quantified using Quantity One 1-D Analysis Software
104 (BioRad) and results presented as mean ± s.d. when applicable. The significance of comparisons was calculated under student T-test.
Construction of truncated nucleolin-GFP fusion proteins: Wild-type full-length and C- terminal truncated nucleolins were generated by polymerase chain reaction (PCR) using the AccuPrime Taq DNA polymerase system (Invitrogen). The PCR products were purified with QIAquick gel extraction system (QIAGEN) and fused into pcDNA3/CT-
GFP construct (Invitrogen) by TOPO cloning as instructed. Positive clones were selected by sequencing and purified for transfection using EndoFree Maxi Prep kit (QIAGEN,
Valencia, CA). The sequence of each construct was confirmed by sequencing and expression profile. Sequences of the DNA oligonucleotides used to generate truncated nucleolin constructs are listed in Table 3.1. C-terminal truncated nucleolin constructs were produced with the same 5’ primer NCL5’ and different 3’ primers (FL, D 1 – 7). N- terminal truncated constructs were made using 5’ primer NCL63-5’ and 3’ primers
NCLFL3’ (NCLD8) or NCL123-3’ (NCLD9) respectively.
Table 3.2 DNA oligos for generating truncated nucleolins. NCL5’ GCC ATC ATG GTG AAG CTC GC NCLFL3’ (FL) CAA ACT TCG TCT TCT TTC CT NCL650-3’ (D1) CAC CCT TAG GTT TGG CCC AG NCL300-3’ (D2) CTG TGC CTT CCA CTT TCT GTT NCL280-3’ (D3) TTC CAG GTG CTT CTT TGA CAG NCL211-3’ (D4) CCA TAG CTT CTT CTT CAG AGT CAT C NCL141-3’ (D5) TGG CAT TCT TGC CAT TCT TTG NCL123-3’ (D6) TAC CAG GAG TTG CTA CCA ATG C NCL69-3’ (D7) TTG CTG GGG AAA CGA CCA CCT NCL63-5’ GCC GCCC ATG GTG GTC GTT TCC CCA ACA AAA
105 Site-directed mutagenesis of nucleolin: Multi-site or single-site mutagenesis of nucleolin specifically on the Cdk sites or CK2 sites were achieved using QuikChange Multi Site-
Directed or QuikChange II XL Site-Directed Mutagenesis kits (Stratagene, La Jolla, CA) respectively. DNA oligos used in each mutagenic reaction are listed in Table 3.2 – 3.4.
Table 3.3 DNA oligos for mutating Cdk sites to glutamate (E). CAA AGA AGG TGG TCG TTG AGC CAA CAA AAA AGG CdkE1 TTG CAG CdkE2 AAG GTT GCA GTT GCC GAA CCA GCC AAG AAA GCA G CCA AGA AAG CAG CTG TCG AGC CAG GCA AAA AGG CdkE3 CAG CdkE4 CAA AAA GGC AGC AGC AGA ACC TGC CAA GAA GAC AG CCT GCC AAG AAG ACA GTT GAA CCA GCC AAA GCA CdkE5 GTT AC CdkE6 CAG CCA AAG CAG TTA CCG AAC CTG GCA AGA AGG G CdkE7 TGG CAA GAA GGG AGC CGA ACC AGG CAA AGC ATT GG GGC AAA GCA TTG GTA GCA GAG CCT GGT AAG AAG CdkE8 GGT GC
Table 4.3 DNA oligos for mutating Cdk sites to alanine (A). CdkA1 AAG AAG GTG GTC GTT GCC CCA ACA AAA AAG G CdkA2 AAG GTT GCA GTT GCC GCA CCA GCC AAG AAA G CdkA3 AAG AAA GCA GCT GTC GCT CCA GGC AAA AAG G CdkA4 AAA AAG GCA GCA GCA GCA CCT GCC AAG AAG CdkA5 GCC AAG AAG ACA GTT GCA CCA GCC AAA GCA G CdkA6 GCC AAA GCA GTT ACC GCA CCT GGC AAG AAG CdkA7 GGC AAG GGA GCC GCA CCA GGC AAA G CdkA8 AAA GCA TTG GTA GCA GCT CCT GGT AAG AAG G
106 Table 3.5 DNA oligos for mutating CK2 sites to alanine. CKA1 GAG GTA GAA GAA GAT GCT GAA GAT GAG GAA ATG CKA2 GAA GAT GAG GAA ATG GCA GAA GAT GAA GAA G GTC AGA AGA TGA AGA AGA TGA TGC TGC TGG AGA CKA34 AGA GGT CGT CAT ACC Detection of cell surface proteins by biotinylation: HeLa cells washed and in suspension were biotinylated by EZ-Link Sulfo-NHS-LC-Biotin (Pierce) dissolved at 500 ug/mL in phosphate buffered saline (PBS, Invitrogen) at 4°C. The biotinylation reaction proceeded for 2 hours: fresh biotinylation reagent was added at 1 hour. The reaction was quenched by 100 mM glycine solution in PBS, and cells washed with PBS two times before lysis with RIPA buffer (50 mM TrisHCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% NP40,
0.5% deoxycholate, 0.1% SDS, supplemented with protease and phosphatase inhibitors from Sigma). Lysate (1 mg) was pulled down using 50 L neutravidin conjugated agarose beads at 4°C overnight, and eluted with 1x SDS-PAGE loading buffer containing
1% SDS at 100°C for 10 min, and analyzed by Western blot.
Fluorescent microscopy: Cells grown on 4-well Nunc chamber slides (Nalge Nunc Intl,
Rochester, NY) were transfected with plasmid DNA as described. At 48 hours post- transfection, cells were incubated with rabbit anti-GFP antibody at 1:200 dilution in PBS at 4°C for 45 min, and then fixed in 4% paraformaldehyde (Electron Microscopy
Sciences, Hatfield, PA) at room temperature for 20 min. Post-fixation procedures and imaging process were performed as described before (Chen et al., 2008). Micrographs were further processed with ImageJ and Adobe Photoshop softwares.
Cell cycle synchronization by double thymidine block: DTB was performed essentially as described before (Richardson et al., 2000; Yang et al., 2004) with little modifications.
In general, HeLa cells plated 1 day before DTB were treated with 2 mM thymidine in
107 growth medium for 18 hours. Thymidine was then washed out and cells allowed grow in fresh medium for 9 hours before another 18-hour incubation with 2 mM thymidine. The end of the second thymidine treatment was set to time 0, and the cells were chased in fresh growth medium for 0 – 18 hours depending on the particular experiment.
Subcellular fractionation of HeLa cells: The fractionation of HeLa cells into cytosolic, membrane, cytoskeletal and nuclear fractions were performed as described before
(Burinskaya et al., 1998; Nisole et al., 2002a) with minor modifications. Cells were washed extensively with PBS, scraped and pelleted at 1,000 g for 5 min at 4°C. Washed cells were then homogenized in a hypotonic solution (10 mM Hepes pH 6.9, 10 mM KCl,
2 mM MgCl2) with a Dounce homogenizer on ice. Nuclei were pelleted at 1,000 g for 3 min and washed twice in PBS before extraction in the NTENT buffer (10 mM TrisHCl pH 7.6, 400 mM NaCl, 1 mM EDTA and 1% Triton X-100). The nuclear lysate was centrifuged at 14,000g for 10 min and the supernatant was referred to as the nuclear fraction. The supernatant obtained after pelleting intact nuclei was further centrifuged at
14,000 g for 30 min and the supernatant corresponding to the cytosolic fraction was recovered while the pellet was resuspended in NTENT buffer containing 150 mM NaCl instead of 400 mM. This latter suspension was recentrifuged at 14,000 g for 30 min to separate the cytoskeletal (the pellet) and membrane (supernatant) fractions. The pellet after NTENT resuspension corresponding to the cytoskeletal fraction was dissolved in 2x
SDS-PAGE loading buffer at 100°C. All buffers were supplemented with protease inhibitors (Sigma).
Immunoprecipitation of endogenous and GFP-tagged nucleolin: HeLa cells treated as described in the figure legends were lysed with RIPA buffer supplemented with protease
108 and phosphatase inhibitors. Lysate (1 mg) pre-cleared with 50 l Protein-A conjugated agarose beads (Roche, Indianapolis, IN) was incubated with 4 l of the rabbit N17 antibody against N-terminal nucleolin (endogenous) or GFP antibody (nucleolin-GFP) at
4°C for 1 hour prior to addition of the Protein-A agarose beads over night. The beads were washed extensively with RIPA and TBS-T buffers, and eluted with 1x SDS-PAGE loading buffer for Western blot analysis.
Transfection of DNA nanoparticles: DNA nanoparticles carrying luciferase reporter gene was compacted as described before (Chen et al., 2008). HeLa cells plated in 24-well plates 1 day before all treatment were incubated with 2 g nanoparticles for each well after drug treatment in DMEM for 2 hours before exchange to growth medium. Cells were harvested at 48 hours post-transfection and luciferase activity was determined by the Luciferase Assay system (Promega, Madison, WI). Protein concentration in the lysates was examined with DC protein Assay Kit (BioRad). Final luciferase activity was expressed as relative light unit (RLU) per mg protein. Results were presented in mean ± s.d. and significance was calculated using Student’s T-test.
Release of cell surface nucleolin: HeLa cells plated in 10-cm plate 1 day before the experiment were incubated with 10 mL Hanks’ Balanced Salt Solution (HBSS) at 37°C for 10 min. The HBSS supernatant was centrifuged at 1,000 g for 5 min at 4°C and filtered through 0.22 m filter to remove cell debris. The filtered HBSS was concentrated from 10 ml to about 100 L using a Centricon (Millipore, Billerica, MA) of 30-kDa molecular weight cutoff by centrifugation at 3,000 g for about 20 min at 4°C. The concentrated HBSS was then separated on a 10% SDS-PAGE, and analyzed by Western blot for nucleolin and actin to ensure the intactness of the cells after treatments.
109 Chapter 4.
Gene delivery by DNA nanoparticles via lipid-raft mediated, dynamin-
independent endocytosis
Xuguang Chen1, 2, Pamela B. Davis1.
1Departments of Pediatrics, 2Department of Biochemistry
Case Western Reserve University School of Medicine
110 Summary:
Compacted DNA nanoparticles are non-viral gene delivery vectors in clinical trial for treating cystic fibrosis. The cellular uptake mechanism of the nanoparticles is not entirely clear. We have previously reported that cell surface nucleolin serves as a receptor for
DNA nanoparticles. Here we report that nucleolin exist in the low-density lipid raft fractions on a sucrose density gradient, and nucleolin-bound DNA nanoparticles can be recovered in the same fractions. The identity of the raft fractions were confirmed by the presence of markers such as caveolin-1 and flotillin-1, and the absence of non-raft marker phospholipase C. Nucleolin colocalizes with the raft marker, flotillin on the plasma membrane, and can be co-immunoprecipitated with flotillin. Drugs, including filipin, nystatin and methyl- -cyclodextrin (M CD) that disrupt lipid rafts, significantly inhibit luciferase reporter gene expression from the nanoparticles. In contrast, chlorpromazine, which inhibits clathrin-mediated endocytosis, or cytochalasin-D and amiloride, which inhibit macropinocytosis, have little effect on the transfection of DNA nanoparticles. A dominant negative (K44A) dynamin promotes transfection by 10 fold rather than inhibiting it. Drugs such as taxol and nocodazole that disrupt microtubules, but not cytochalasin D and phalloidin that disrupt actin filaments, inhibit expression from the transfected nanoparticles. The transfection of DNA nanoparticles seems to be saturable, presumably depending on the availability of the receptor and endocytic machinery.
Polarized 16HBEo- cells, which have nucleolin on the apical membrane only, can be transfected from the apical surface but not from the basolateral surface by DNA nanoparticles. In summary, the uptake of DNA nanoparticles seems to be mediated by lipid rafts on the cell membrane and is independent of dynamin.
111 Introduction:
As described in the Introduction and previous two chapters, gene delivery by DNA nanoparticles relies on their cell surface receptor nucleolin, which is in turn positively regulated by cyclin dependent kinase Cdk1. Single nucleolin binds to the nanoparticles at
25.9 nM KD. Purified nucleolin protein inhibits the transfection of nanoparticles.
Manipulation of nucleolin by overexpression or siRNA knockdown increases or decreases the transfection as surface nucleolin is increased or decreased. Nucleolin colocalizes with rhodamine-labeled DNA nanoparticles on the cell surface and inside the cells, and they seem to follow the same intracellular trafficking pattern (Chen et al.,
2008). Cell surface expression of nucleolin that lacks a transmembrane domain or signal sequence is regulated by Cdk1, which phosphorylates it and promotes surface expression during M phase of the cell cycle (Chapter 3; Peter et al., 1990). However, it is not clear how DNA nanoparticles, upon binding to surface nucleolin, is internalized into the cytoplasm via a non-degradative pathway independent of traditional clathrin-mediated endocytosis, as suggested by previous data (Chen et al., 2008).
DNA nanoparticles are progressing towards clinical application for the treatment of cystic fibrosis. In a clinical trial for delivery of CFTR to the nasal epithelium of patients with CF, cAMP stimulated chloride transport activity was induced in most of the participants, and no drug-associated adverse events were observed (Konstan et al., 2004).
The nanoparticles have minimal toxicity, are non-immunogenic, and transfect non- dividing cells in vivo at high efficiencies (Ziady et al., 2003b; Ziady et al., 2003c; Liu et al., 2003). They have been used to deliver transgene into airways of mouse, ferret, sheep and rabbit (communication with Dr Mark Cooper), midbrain and striatum of rat and
112 mouse brain (Yurek et al., 2005), and mouse retina (Farjo et al., 2006; Cai et al., 2008).
Inflammation in the mouse lung does not interfere with the efficiency of transfection by the nanoparticles (Ziady, unpublished). The compacted DNA nanoparticles are formulated with plasmid DNA and polyethylene glycol (PEG)-substituted cysteine- polylysine peptides (CK30PEG). The mechanism by which these particles are taken up by some cell types, but not others, is not yet clear.
Nucleolin is a ubiquitous eukaryotic protein involved in multiple steps from regulating rDNA transcription to the assembly of ribosomal proteins and RNAs (Ginisty et al., 1999; Srivastava and Pollard, 1999). It also regulates mRNA metabolism (Cemens et al., 1999; Rajagopalan et al., 1998; Chen et al., 2000), and has chromosomal remodeling activity (Angelov et al., 2006). Despite lack of a transmembrane domain or glycosylphosphatidylinositol (GPI) anchored domain, nucleolin was found on the cell surface to be a receptor for a variety of extracellular ligands, including lipoprotein, laminin-1, viruses such as Coxsackie B, HIV-1 and human prainfluenza type 3 and antiviral molecules (Kibbey et al., 1995; De Verdugo et al., 1995; Callebaut et al, 1998;
Bose et al, 2004). In tumor tissues, nucleolin was found on the cell surface of tumor cells and angiogenic endothelium, and has been a target of an anti-tumor agent (Christian et al., 2003; Ireson and Kelland, 2006).
Cells internalize extracellular materials via various phagocytic and pinocytic pathways. Macropinocytosis results from closure of membrane ruffles driven by massive actin cytoskeleton reorganization, which may be disrupted by cytochalasin D (Conner and Schmid, 2003). Clathrin-mediate endocytosis is the best understood variety of pinocytosis. It has characteristic clathrin coated pits and endocytic vesicles, which end up
113 in the lysosome or being recycled back to the membrane (Liberari et al., 2008; Conner and Schmid, 2003). Clathrin independent endocytosis (CIE) is suspected to be mediated by lipid rafts, which are special membrane domains enriched in cholesterol and glycosphingolipids, so many CIE are sensitive to cholesterol depletion by drugs like filipin, nystatin and methyl -cyclodextrin (M CD) (Sieczkarski and Whittaker, 2002).
Caveolae-mediated endocytosis is a type of CIE, which is characterized by caveolin- coated membrane invaginations. Both clathrin- and caveolin- mediated endocytoses depend on the GTPase called dynamin to complete the membrane fission during vesicle formation. Endocytosis independent of clathrin, caveolin and dynamin has also been reported (Mayor and Pagano, 2007; Kirkham and Parton, 2005).
During our study of the uptake of the nanoparticles, we noticed that they do not colocalize with endosomal or lysosomal markers, and so may not enter clathrin-mediated endocytosis (Chen et al., 2008). Cell surface nucleolin resides in distinct spots, as if clustered in membrane domains. Also, Walsh et al. reported that amiloride inhibits macropinocytosis, preventing the nanoparticles from entering the cells (Walsh et al.,
2006). However, little is known about whether the nanoparticles utilize other endocytic pathways, including caveolin-mediated and lipid raft-mediated caveolin-independent pathways, either dependent or independent of dynamin. Therefore, we have characterized the endocytic pathway of the nanoparticles and the involvement of cytoskeleton in this process as reports have shown (Dean et al., 2005).
Here we find that DNA nanoparticles transfect cells in a saturable fashion, and enter only via the apical surface of polarized airway epithelial cells. Moreover, nucleolin is found only on the apical membrane of the polarized cells, which not only supports our
114 previous finding that nucleolin is critical for the transfection of DNA nanoparticles, but also validates our investigation into the regulation of surface nucleolin to facilitate the transfection. Transfection of the nanoparticles is sensitive to drugs that interfere with the lipid raft endocytic pathway, but not to those that inhibit macropinocytosis or clathrin- mediated endocytosis. Both nucleolin and DNA nanoparticles can be recovered from the lipid raft fractions of sucrose gradient. Nucleolin colocalizes with the lipid raft marker flotillin on the membrane. Expression of a dominant negative form of dynamin does not inhibit transfection by DNA nanoparticles, indicating that dynamin is not involved in its uptake. Moreover, disruption of microtubules significantly inhibits transfection, while manipulation of the actin cytoskeleton has little effect.
115 Results:
Transfection of DNA nanoparticles is saturable
Receptor-mediated endocytosis can be limited by the titer of receptors on the cell membrane and the rate of their cycling. We have identified the putative receptor, nucleolin, for DNA nanoparticles, so we tested whether their transfection is saturated at high amount. Therefore, we transfected HeLa cells in 24-well plate with increasing amounts of DNA nanoparticles from 1 to 16 g per well. The luciferase expression from the nanoparticles showed a dose-dependent increase from 2.14105 to 4.26108 RLU/mg lysate as the amount of DNA increased (Fig 4.1A). The log of the luciferase reporter expression and the amount of nanoparticles were then plotted in a double inverse relationship (Eq 4.1) and fitted to the Michaelis-Menten equation, from which the maximal expression and the amount of DNA needed for half maximum expression (Km)
8 were calculated. The luciferase activity saturates at 7.8810 RLU/mg and Km is 0.70 g
(Fig 4.1B). This could signify that nanoparticle binding is also saturable. This result might help us design better strategies when applying DNA nanoparticles for clinical use.
In fact, of the 8 patients who have positive chloride transport correction in the phase I
116 trial (Konstan et al., 2004), 1 is from the lowest dose level (0.8 mg), 3 from the medium dose level (2.67 mg) and 4 from the highest level (8 mg). It is possible that in patients with higher amount of receptors in the airway, lower dose is necessary to achieve clinical benefit, while in those with lower receptor expression, the transduction may be saturated at a certain dose level.
DNA nanoparticles enter polarized 16HBEo- cells from the apical surface
DNA nanoparticles deliver transgenes effectively in the airway epithelia of mouse, rat, rabbit, sheep and human (Ziady et al., 2003b; Konstan et al., 2004). It is not clear, however, whether the nanoparticles can enter the polarized airway epithelial cells from apical or basolateral surface, since the basolateral side of the epithelia is not accessible in the in vivo setting. Consequently, we exploited the advantage of the 16HBEo- cells, an immortalized human tracheal epithelial cell line that can polarize into a monolayer on filter cultures and mimic the in vivo airway epithelia. The polarized cells are accessible from both apical and basolateral sides, as the pore size of the filter is larger than the nanoparticles. To ensure that the nanoparticles are capable of transfecting 16HBEo- cells, we compared naked DNA and nanoparticles on non-polarized 16HBEo- cells grown on 24-well plate (Fig 4.2).
DNA nanoparticles showed 2 orders of magnitude higher transfection than naked
DNA. In addition, we found no difference in the transfection of DNA nanoparticles on the wildtype and CFTR-deficient cells
117 derived from the 16HBEo- cell line (unpublished). We subsequently applied the same amount of nanoparticles to polarized 16HBEo- cells on the filters and assayed for luciferase expression after 48 hours. Nanoparticles on the apical surface result in almost the same amount of luciferase expression as in non-polarized cells, while those applied to the basolateral side give luciferase expression even below the level of naked DNA. When the same amount of nanoparticles is divided at equal concentration and delivered on both sides, the reporter expression is at an intermediate level. Therefore, it seems that only the apical membrane of the polarized 16HBEo- cells contains the necessary machinery for transfection by DNA nanoparticles.
Cell surface nucleolin is found only on the apical surface of 16HBEo- cells
Since nucleolin serves as a receptor for DNA nanoparticles on the membrane (Chen et al., 2008), we suspect that the apical preference of DNA nanoparticles could be due to the uneven distribution of surface nucleolin on different membranes. To test this hypothesis, we examined cell surface nucleolin on either side of the filter by cell surface biotinylation (Fig 4.3).
Nucleolin is found only on the apical membrane but not on the basolateral side, while actin as a control is pulled down by cell surface adhesion molecules and is found in both fractions. This result can explain why the polarized
16HBEo- cells take up DNA nanoparticles only from the apical surface. It is also consistent with a previous report that an alveolar cell line, A549 cell, grown on the filter has surface nucleolin only on the apical membrane (Bose et al., 2004).
118 Transfection of DNA nanoparticles depends on the integrity of lipid rafts
Since there has been a report suggesting that amiloride, which inhibits macropinocytosis, inhibits internalization of rhodamine-labeled nanoparticles (Walsh et al., 2006), we wanted to examine whether this effect extends to the expression of the transgene from the nanoparticles. To target different endocytic pathways, we used chlorpromazine to inhibit clathrin-mediated endocytosis, ethyl isopropyl amiloride
(EIPA) to inhibit macropinocytosis, or filipin, nystatin and M CD to inhibit lipid raft mediated endocytosis. When added with the nanoparticles to HeLa cells, all lipid raft inhibitors significantly reduced expression of the luciferase reporter from nanoparticles by 79.5-91.5% (Fig 4.4A). Protein content of the cells was not affected. In contrast, cells treated with chlorpromazine express transgene as efficiently as control DMSO treated cells. EIPA decreased reporter gene expression somewhat, but not significantly (p =
0.12), but with marked toxicity to the cells (25.6% less protein recovery compared to vehicle treated cells, Fig 4.4B).
As addition of some drugs were toxic, which might complicate the interpretation of the result, we decided to look at whether preincubation of the same drugs prior to DNA nanoparticles has any effect on reporter expression (Fig 4.4C). Pretreatment of filipin and
M CD for 1 hour reduced the transfection by 72.9% and 73.7% respectively. Both reductions reached statistically significant level with p values of 0.001. None of the other drugs (chlorpromazine, EIPA and nystatin) showed significant effect on the transfection, and little toxicity was observed monitored by the protein content in the harvested cell lysates. The lack of effect of nystatin may be due to the washout of the drug by fresh
119 medium after the treatment. Therefore, cholesterol depletion with filipin and M CD inhibit on the transfection of DNA nanoparticles.
The drug EIPA, which is thought to inhibit macropinocytosis, had a slight inhibitory effect on the transfection of the nanoparticles, although in no experiment has it reached statistical significance. We suspected that this might be due to its pleiotropic effect on the organization and/or trafficking of lipid rafts. To determine whether it affects different or the same pathway as filipin and M CD, we tested EIPA or filipin alone or in combination prior to transfection of HeLa cells by DNA nanoparticles (Fig 4.4D). EIPA again showed
120 an insignificant 36.2% reduction in reporter expression, while filipin significantly decreases the transfection by 64.6% (p values 0.12 and 0.01 respectively). When both drugs were added to the medium before transfection, luciferase expression decreased
66.4% to a level similar to filipin alone. There is apparently no synergy or additive effect of EIPA on filipin, so both drugs probably affect the same endocytic pathways.
Therefore, transfection of DNA nanoparticles relies on lipid rafts, which are disrupted by filipin, M CD and nystatin.
Surface nucleolin appears in clusters on the plasma membrane
Cell surface nucleolin has been identified in various cell types using techniques such as cell surface biotinylation and indirect immunofluorescent staining (Chen et al., 2008).
During our study of fluorescent staining of surface nucleolin in HeLa and 16HBEo- cells, we found that the pattern of surface nucleolin staining appears to be distinct spots rather than diffuse. It is suggestive to us that this pattern might represent the physiological state of surface nucleolin, which might be clustered in distinct domains of the plasma membrane. Due to the limitation to the resolution of light microscope, we tried to visualize surface nucleolin by electron microscopy following immunogold labeling. HeLa cells stained with primary MS-3 antibody and secondary goat anti-mouse IgG conjugated with 10 nm gold particles were fixed and sectioned in directions parallel to and perpendicular to the culture surface. When examined under the transmission electron microscope, gold particles were always found in clusters close to the membrane (Fig 4.5).
All of the clusters were found on the outer side of the membrane, validating the impermeable nature of the membrane during the staining. Some of the gold particles were found close to membrane curvature (Fig 4.5 upper right), suggesting an ongoing
121 membrane process. No particles were observed in or near classical coated vesicles, indicating that clathrin is not involved. Based on these data, we speculate that nucleolin exists in specified membrane domains, which are distinct from clathrin-coated pits.
Nucleolin exists in lipid rafts
Cell surface nucleolin appears in punctate spots by immunofluorescent staining, and exists in clusters on the membrane as revealed by immunogold labeling and electron microscopy. To further explore the possibility that cell surface nucleolin is present in lipid membrane domains, we employed sucrose gradient ultracentrifugation technique to
122 separate lipid rafts from other components of the lipid membrane. HeLa, HEK293 and
16HBEo-, were lysed with 500 mM Na2CO3 and loaded at the bottom of a 5/35/40% sucrose gradient, which was centrifuged at 45,000 rpm for 20 hours (Iwabuchi et al.,
1998; Yanagisawa et al., 2004). Lipid rafts have a low density, and migrate upwards to the interface of the 5/35% sucrose interface, while other membrane proteins, other cytoplasmic and nuclear proteins stay at the bottom. Nucleolin was retrieved in the lower-
123 density fractions 5 – 7 coinciding with the lipid raft markers caveolin-1 and flotillin-1 in all three cell lines (Fig 4.6). The non-raft membrane marker phospholipase C- 2 subunit
(PLC 2) was recovered at the bottom fractions. It should be noted that nucleolin as a bona fide “intracellular protein” primarily exists in the nucleolus, while some may be found in the nucleoplasm and cytoplasm. Only a small fraction of total nucleolin resides on the plasma membrane, which has been shown in both cell surface biotinylation and immunofluorescent staining experiments. Consequently, the majority of nucleolin in the total cell lysate is found in the bottom of the sucrose gradient, corresponding to nuclear
124 and cytoplasmic nucleolin.
We also colocalized cell surface nucleolin along with the lipid raft marker, flotillin.
Flotillin is an integral membrane protein found in many studies to be important for endocytosis via lipid rafts (Mayor and Pagano, 2007). We stained non-permeabilized
HeLa cells for surface nucleolin (red) and flotillin or the transferrin receptor as a control
(green). Both the transferrin receptor and flotillin show exclusive plasma membrane staining, while nucleolin is again stained as distinct spots. Surface nucleolin does not colocalize with the transferrin receptor, consistent with our previous finding that rhodamine-labeled DNA nanoparticles do not colocalize with transferrin during their trafficking. In contrast, surface nucleolin shows extensive colocalization with flotillin, which was confirmed by deconvolution of selected fields (Fig 4.7). Therefore, nucleolin is found in lipid rafts.
Since nucleolin appears in lipid rafts and colocalizes with flotillin-1, we examined
125 whether there is direct binding between nucleolin and flotillin-1, and whether this binding will be affected by depletion of lipid rafts. We immunoprecipitated (IPed) nucleolin from
HeLa, HEK293 and 16HBEo- cell lysates, and Western blotted for flotillin-1 in the IP
(Fig 4.8A). We did find that flotillin-1 coIPs with nucleolin in all three cell lines. We then depleted cholesterol and lipid rafts in HeLa cells with M CD, and tested the binding of flotillin-1 with nucleolin by coIP, and their cell surface expression by surface biotinylation. No significant change in the association of flotillin-1 with nucleolin or in their cell surface expression level (Fig 4.8B). Therefore, it seems that M CD disrupts the intracellular trafficking of nucleolin and flotillin-1 rather than interfering with their association or expression. The inhibition of nanoparticle transfection by M CD is likely due to the inhibition of trafficking rather than cell surface attachment as well.
DNA nanoparticles are also found in lipid raft fractions
As nucleolin was found in lipid rafts, and the transfection of the nanoparticles seem to dependent on both nucleolin and lipid rafts, we examined whether DNA nanoparticles also exist in the low-density fractions. When loaded without cell lysate at the bottom of the sucrose gradient, neither naked DNA nor DNA nanoparticles migrate to low-density fractions (Fig 4.9A). We lysed Hela cells in Na2CO3 as previously shown, mixed the lysate with 25 g DNA nanoparticles and separated the lipid rafts by sucrose gradient ultracentrifugation. As control we mixed the lysate with the same amount of naked DNA and processed similarly. Although the majority of nucleolin is from the nucleus and stays at the bottom, nucleolin is present in the lipid raft fractions (fraction 5) of both gradients, which is confirmed by the exclusive presence of flotillin in this fraction but not in fraction 12. The non-raft marker PLC 2 stays at fraction 12 as predicted (Fig 4.9B). We
126 then looked for the presence of plasmid DNA in fractions 5 (raft) and 12 (non-raft) after dialysis and trypsinization to release DNA from the nanoparticles. The majority of the plasmid was found in fraction 12 in lysates along with both naked DNA and nanoparticles. However, when we amplified a fragment in the colE1 origin of the plasmid using PCR, we found the plasmid DNA in fraction 5 of the lysate with nanoparticles but
127 not in the same fraction of the naked DNA (Fig 4.9C). Apparently DNA nanoparticles migrate into the density-buoyant lipid raft fractions in association with nucleolin. The amount of nucleolin in fraction 5 of the nanoparticle gradient seems to be decreased compared to that in the same fraction of the naked DNA gradient. Given that the large majority of the nanoparticles exist in the bottom of the gradient, the decrease is likely due to the binding of nucleolin to the majority of DNA in the bottom.
Transfection of DNA nanoparticles does not require dynamin
Among different types of endocytosis, dynamin has been found to be crucial for vesicle formation in clathrin-mediatedand caveolin-mediated endocytosis. We therefore tested whether expression of the dominant negative K44A mutant of dynamin, which inhibits its GTPase activity and function, has any effect on the transfection of nanoparticles. The expression of FLAG-tagged wildtype dynamin and GFP-tagged K44A mutant was confirmed by Western blot (Fig 4.10A). When we added DNA nanoparticles to HeLa cells transiently expressing wildtype or K44A dynamin, the luciferase reporter expression was significantly enhanced 10 fold in the K44A dynamin transfected cells compared to wildtype or vector
128 transfected cells, in three separate experiments (Fig 4.10B). Therefore it seems that dynamin is not involved in the uptake of DNA nanoparticles.
Transfection of DNA nanoparticles depends on microtubules but not actin filaments
The delivery of transgenes into the cells, especially into the nucleus, seems to involve the integrity and/or rearrangement of microtubules and actin filaments. The actin network beneath the plasma membrane may serve to impede the movement of naked DNA or facilitate SV40 virus entry (Dean et al., 2005).
We therefore examined whether disruption of the actin filament has any effect on the transfection of DNA nanoparticles. Cytochalasin D, which promotes disassembly of actin filament, or phalloidin, which inhibits the disassembly and reorganization of actin, was added to HeLa cells along with DNA nanoparticles. Luciferase reporter expression was assayed at 48 hours post-transfection, and there was no difference between treated and vehicle-treated cells. Microtubules may serve as a track for trafficking, and cargo and motor proteins associated with microtubules have been found to be involved in viral trafficking (Marsh and Helenius, 2006). When taxol or nocodazole, which inhibit depolymerization or polymerization of microtubules, was added to the cells with DNA
129 nanoparticles, the reporter gene expression reduced significantly by 71.1% and 31.4% respectively. Similar results were observed when the two drugs were pre-incubated or incubated both prior to and during the transfection. Therefore, transfection by DNA nanoparticles relies on microtubules but not on actin filaments.
130 Discussion:
DNA nanoparticles have shown great potential as a gene transfer agent, and have been tested successfully in both in vivo and clinical settings. Of all the barriers for a DNA vector to cross in order to express the transgene, it must first be able to arrive and attach to the cell surface and cross the lipid bilayer membrane (Davis and Cooper, 2007). We previously showed that cell surface nucleolin acts as a receptor for DNA nanoparticles and facilitates its internalization and probably trafficking as well. However, we still have very little knowledge as to how the nanoparticles bind to nucleolin on the cell surface and are internalized into the cytoplasm and subsequently nucleus. Here we report that the endocytic mechanism for DNA nanoparticles depends on the integrity of lipid rafts.
Filipin, nystatin and M CD bind to cholesterol and inhibit the formation and/or trafficking of lipid rafts. In the case of the nanoparticles, we found a strong inhibition of transfection when cells were either pretreated or incubated during transfection with these drugs. Given the consistency of all three drugs, it is very likely that lipid rafts play an important role in the uptake of the nanoparticles. Chlorpromazine, which inhibits clathrin-mediated endocytosis, does not affect transfection, which is consistent with our previous knowledge that rhodamine-labeled DNA nanoparticles do not colocalize with endosomal and lysosomal markers following clathrin-mediated endocytosis. Amiloride, which inhibits macropinocytosis, was found by other to inhibit the cellular entry of rhodamine-labeled DNA nanoparticles using fluorescence microscopy (Walsh et al.,
2006). However, we do not find a significant inhibitory effect of EIPA, an amiloride derivative, on the expression of transgene from DNA nanoparticles. This result is consistent with our later finding that cytochalasin D has no influence on the transfection
131 of DNA nanoparticles. Therefore, it seems unlikely that macropinocytosis participates significantly in the uptake of the nanoparticles. The slight decrease of transfection by
EIPA we observed might be attributed to its toxicity and pleiotropic effect on the lipid rafts as we discovered later that it has no additive or synergistic effect over filipin.
In line with the inhibitor study, nucleolin exists in lipid rafts. Cell surface nucleolin appears in punctate spots on both HeLa and 16HBEo- cells. Without a transmembrane domain or a GPI-anchored sequence, the presence of nucleolin on the outer surface of the membrane is likely to depend on the binding to other membrane-anchored proteins, most likely in the lipid rafts. By immunofluorescent staining, we confirmed the sucrose flotation data that nucleolin colocalizes with raft marker, flotillin. We also found direct association of nucleolin with flotillin in both HeLa and 16HBEo- cells by coimmunoprecipitation, and the association is not affected by depletion of lipid rafts with
M CD. Therefore it appears that M CD inhibits transfection by DNA nanoparticles via disruption of their cellular trafficking rather than attachment to cell surface nucleolin. It has been suggested that flotillin is an integral component of some endocytic vesicles and plays an important role in regulating the uptake via lipid rafts. It therefore will be intriguing to further investigate the involvement of flotillin in the uptake of DNA nanoparticles. Recently we found that cell surface expression of nucleolin is regulated by phosphorylation (Chapter 3). Therefore, both the export of nucleolin to and its retrieval from the membrane are highly regulated processes. The model that suggests the nanoparticle transfection is saturable fits into this theory.
The saturability of nanoparticle transfection and apparent receptor-mediated endocytosis is consistent with previous experience that in the clinical trial patients
132 respond to a wide range of doses of nanoparticles. This is further supported by the study in polarized 16HBEo- cells. Previous studies using A549 cells grown on a filter has shown that surface expression of nucleolin might also be polarized in these cells (Bose et al., 2004). A549 cells do not represent the best airway epithelial model, as they are derived from a human alveolar basal cell carcinoma that might not exhibit normal cell physiology. Therefore we chose to study the human bronchial epithelial cell line
16HBEo-, which has been tested for surface nucleolin expression and nanoparticle transfection. Expression of cell surface nucleolin and transfection of DNA nanoparticles occur only at the apical surface of polarized 16HBEo- cells on filter. The expression from
DNA nanoparticles transfected in non-polarized cells and from the apical surface of the polarized cells are comparable, suggesting that its receptor, nucleolin, is restricted to the apical membrane when polarization occurs.
Previous literature suggests that endocytosis and intracellular trafficking of DNA or other gene delivery agents is highly dependent upon and regulated by the cytoskeleton. In the case of DNA nanoparticles, we found that transfection requires intact microtubules, but not necessarily actin filaments. The movement of naked DNA is highly restricted at the periphery of cells by the sub-membrane actin meshwork (Dean et al., 2005). The trafficking of the compacted DNA nanoparticles on the other hand does not seem to be influenced by actin. This might be related to the compactness of the nanoparticles, the volume of which is similar to the sum of the volume of all the atoms (Liu et al., 2003).
The small size of the nanoparticles might allow it to penetrate the actin meshwork without being retained, while other molecules such as nucleolin might also facilitate in
133 this process. Conversely, disruption the actin cytoskeleton doesn’t inhibit transfection, but showed a slight but consistent increase, which did not reach statistical significance.
The dependency of the nanoparticle transfection on microtubules suggests a similarity of the trafficking pattern to other endocytic vesicles such as caveolin-containing vesicles.
Caveolin vesicles travel along microtubules and concentrate at the microtubule- organizing center (MTOC), sometimes with great speed (Mundy et al., 2002; Nichols,
2003). Although DNA nanoparticles probably do not enter via caveolae-mediated endocytosis, since their uptake is dynamin-independent and they do not colocalize with caveolin, DNA nanoparticles could be transported along microtubules toward the center of the cell by a similar mechanism to the caveolin-coated vesicles. Such transport could explain the rapidity of the appearance of nanoparticles in the nucleus that we have observed.
134 Materials and methods:
Reagents and plasmids: All chemicals are purchased from Fisher Scientific (Fairlawn,
NJ) or Sigma (St. Louis, MO). DNA nanoparticles were compacted as described.
Luciferase plasmid and PEGylated polylysine were provided by Copernicus
Therapeutics, Inc (Cleveland, OH). Antibodies: MS-3 against nucleolin, mouse anti- transferrin receptor and phospholipase C- 2 subunit were from SantaCruz (Santa Cruz,
CA); mouse anti-caveolin-1 and flotillin-1 from BD Bioscience (San Jose, CA). The wildtype and K44A dynamin expressing plasmids were generously provided by Dr
Pravin Sehgal from New York Medical College, Valhalla, NY.
Cell culture: Cell culture and transfection: HeLa cells were maintained in DMEM
(Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum and antibiotics
(Mediatech). Transient transfection of HeLa cells were performed using Lipofectamine
2000 (Invitrogen, Carlsbad, CA) as instructed by the manufacturer. HEK293 and
16HBEo- cells were maintained in MEM (Mediatech) supplemented with 10% fetal bovine serum and antibiotics (Mediatech). Filters were coated with 1% human fibronectin
(Gibco, Carlsbad, CA) and 1% collagen (Collagen Biomaterials) in LHC Basal Media
(Gibco), and dried overnight before seeding with 0.3 million 16HBEo- cells. Cells on filters were allowed to grow for 24 – 48 hours before use.
Transfection of DNA nanoparticles and reporter luciferase assay: DNA nanoparticles carrying luciferase reporter gene was compacted as described before (Chen et al., 2008).
HeLa cells plated in 24-well plates 1 day before all treatment were incubated with 2 g nanoparticles for each well after drug treatment in DMEM for 2 hours before exchange to growth medium. In the case of 16HBEo- cells on filters, 2 g nanoparticles were diluted
135 in 350 L full growth medium for apical application or 1 mL medium for basal application, or 1.35 mL medium for apical (350 L) plus basal (1 mL) applications. Cells were harvested at 48 hours post-transfection and luciferase activity was determined by the Luciferase Assay system (Promega, Madison, WI). Protein concentration in the lysates was examined with DC protein Assay Kit (BioRad). Final luciferase activity was expressed as relative light unit per mg protein (RLU/mg). Results were presented in mean
± s.d. and significance was calculated using Student’s T-test.
Fitting of the suturation curve of nanoparticle transfection: HeLa cells were transfected with 1 – 16 g DNA nanoparticles carrying luciferase reporter in 500 L growth medium for 48 hours and luciferase activity was assayed as described. The log of luciferase activity (Luc) was plotted against the amount of DNA (DNA) in a double-inverse equation as following:
1 Km 1 1 Eq 4.1 = + Luc LucMAX DNA LucMAX
Whereas LucMAX is the maximal log luciferase activity, and Km is the amount of DNA needed to reach half the maximal log luciferase activity.
Cell surface biotinylation: Cell surface biotinylation assay was performed on HeLa and
16HBEo- cells using EZ-Link Sulfo-NHS-LC-Biotin (Pierce Biotechnology, Rockford,
IL) in ice cold PBS (500 g/mL). HeLa cells were washed with PBS three times. Freshly dissolved biotinylation reagent was left on the cells for 1 hour at 4°C, and repeated once.
Reaction was quenched by 100 mM glycine in PBS. Cells were then washed 2 times with PBS and lysed with RIPA buffer (50 mM TrisHCl pH 8.0, 150 mM NaCl, 1 mM
EDTA, 1% NP40, 0.5% deoxycholate, 0.1% SDS, supplemented with protease and phosphatase inhibitors from Sigma). Lysate (1 mg) was pulled down using 50 L
136 neutravidin conjugated agarose beads (Pierce) at 4°C overnight, washed with lysis buffer three times and eluted with 1x SDS-PAGE loading buffer containing 1% SDS at 100°C for 10 min, and analyzed by Western blot.
Immunoprecipitation and Western blot: HeLa, HEK293 or 16HBEo- cells treated as described in the figure legends were lysed with RIPA buffer supplemented with protease and phosphatase inhibitors. Lysate (1 mg) pre-cleared with 50 l Protein-A conjugated agarose beads (Roche, Indianapolis, IN) was incubated with 4 l of the rabbit N17 antibody against N-terminal nucleolin (endogenous) or GFP antibody (nucleolin-GFP) at
4°C for 1 hour prior to addition of the Protein-A agarose beads over night. The beads were washed extensively with RIPA and TBS-T (Tris buffered saline with 0.05% Tween-
20) buffers, and eluted with 1x SDS-PAGE loading buffer for Western blot analysis.
Proteins separated on an SDS polyacrylamide gel electrophoresis (SDS-PAGE) were transferred to a PVDF membrane (BioRad, Hercules, CA), blocked with 3% bovine serum albumin (BSA) in TBS-T, and incubated with primary antibodies at 4°C overnight, washed with TBS-T and incubated with secondary donkey anti-mouse or rabbit antibodies conjugated with horse radish peroxidase (HRP) from Jackson Immunoresearch
(West Grove, PA) at 1:10,000 dilution room temperature for 1 hour. Membranes were developed with Super Signal West Pico kit (Pierce, Rockford, IL) and imaged with
VersaDoc 3000 system (BioRad). The intensity of desired bands were quantified using
Quantity One 1-D Analysis Software (BioRad) and results presented as mean ± s.d. when applicable. The significance of comparisons was calculated using student T-test.
Immunocytochemistry and electron microscopy: HeLa cells grown on glass coverslips were incubated with primary antibody MS-3 diluted at 1:25 with 1% BSA in PBS for 45
137 min, washed, and fixed in 4% paraformaldehyde(Electron Microscopy Sciences, Hatfield,
PA) at room temperature for 10 min. Fixed cells were blocked with 1% BSA and 10% normal goat serum (Sigma) in PBS at room temperature for 30 min, and secondary 10 nm gold-labeled goat anti-mouse antibody was added at 1:50 dilution in blocking buffer at room temperature for 2 hours. The gold particles were stabilized with 2.5% glutaldehyde in PBS at room temperature for 1 hour before counterstained with uranyl acetate, embedded, cut into 60 nm sections using ultramicrotome and examined in the Electron
Microscopy Core Facility at CWRU under assistance of Dr Hisashi Fujioka and Ms
Midori Hitomi.
Fluorescence microscopy: HeLa cells were grown on 4-well or 8-well Nunc chamber slides (Nalge Nunc Intl, Rochester, NY) before incubation with H-250 antibody against nucleolin at the same dilution as in the previous section. The cells were then fixed in 4% paraformaldehyde at room temperature for 20 min, blocked with 1% BSA and 10% normal goat serum (Sigma) in PBS supplemented with 0.1% Triton X-100 and 0.1% saponin at room temperature for 30 min. Mouse anti-flotillin antibody diluted at 1:100 with 1% BSA in PBS was then added to the cells and incubated at room temperature for 1 hour. Secondary antibodies (Alexafluor-488 conjugated goat anti-rabbit and Alexafluor-
568 conjugated goat anti-mouse) (Molecular Probes, Carlsbad, CA) were added at concentrations of 4 g/mL at room temperature for 1 hour before the nucleus was counterstained with 2 g/ml Hoechst 33258 (Molecular Probes) in PBS at room temperature for 10 min. The slides were mounted in VectorShield (Vector Laboratories,
Burlingame, CA), and examined using a Zeiss Axiovert 200 wide field microscope with the proper filter. For some images acquired z-stacks were deconvolved with Hygens
138 confocal deconvolution software and further processed with ImageJ and Photoshop softwares.
Isolation of lipid rafts by sucrose density gradient: Preparation of lipid raft was performed as described before with minor modifications (Iwabuchi et al., 1998;
Yanagisawa et al., 2004). HeLa or HEK293, 16HBEo- cells were homogenized in 350
L cold 0.5 M Na2CO3 using a loose fitting homogenizer (20 strokes). NEC homogenate was placed at the bottom of ultracentrifuge tube (Beckman, Palo Alto, CA) and mixed with an equal volume of 80% sucrose (w/v) in 25 mM MES, pH 6.5, 0.15 M NaCl (MES- buffered saline, MBS). The homogenate was then overlaid with 2.1 mL of 35% sucrose and 1.4 mL of 5% sucrose in MBS containing 250 mM sodium carbonate, and centrifuged at 200,000 g for 20 hours in a Beckman SW41 rotor. Twelve fractions were collected from the top of the gradient. Lipid raft-containing light-scattering band just above the 5/35% sucrose interface was mainly collected in fraction 5. Gradient fractions were subjected to SDS-PAGE and Western blot-analysis.
Amplification and visualization of plasmid DNA from gradient fractions: Fractions 5 and 12 from the centrifuged sucrose gradient of HeLa cell lysates mixed with 25 g naked DNA or compacted DNA nanoparticles were dialyzed in the Slide-A-Lyzer dialysis cassette (Pierce) against Tris-buffered saline with 0.05% Tween-20 at 4°C overnight. The dialyzed fractions were then trypsinized with 2.5% trypsin (Sigma) for 2 hours at 37°C and extracted with phenol-chloroform. The extracted DNA (1 L) was amplified with PCR for a fragment in the colE1 replication origin in the plasmid using the AccuPrime Taq DNA polymerase system (Invitrogen). The DNA primers used for this PCR reaction are as following:
139 colE1 5’: CTA CCA GCG GTG GTT TGT TT colE1 3’: GGC GCT TTC TCA TAG CTC AC
The PCR reaction cycles as: 94°C 5 min, 1 time; 94°C 30 seconds, 55°C 30 seconds,
68°C 30 second, 18 cycles; 68°C 10 min; 4°C. The PCR product was then separated on
1% agarose gel and visualized by ethidium bromide staining.
140 Chapter 5. Discussion and future directions
Non-viral gene therapy for CF
Cystic fibrosis is the most prevalent genetic disorder in Caucasian populations. It impacts multiple organs and tissues, and causes mortality of patients in their 30s (Davis,
2006). Although current care and therapies have already successfully addressed several
CF defects such as malnutrition, thickened airway mucus, increased inflammation and
Pseudomonas infection, the ultimate “cure” that might allow CF patients to live a normal life remains at large. CF disease is not fatal immediately, but rather develops slowly after birth, which suggests to us that early interventions correcting the most basic molecular defects of CF should be able to slow down or even reverse the progression of the disease in the later life (Davis, 2006). Gene therapy is based on the idea that by delivering a functional copy of CFTR gene to the critical tissues, for instance the airway epithelium, we should be able to restore CFTR function and prevent the downstream pathological events from occurring. Another favorable factor for gene therapy in treating CF is that the airway epithelium is contiguous with the environment and therefore readily accessible to therapeutic manipulations. Therefore, it is not only necessary, but also feasible to pursue a viable gene delivery method for CF.
Viral vectors exploit natural pathways viruses use to enter human cells. The use of recombinant, replication-deficient viruses is presumably the first choice due to safety considerations. In animal experiments, viral vectors usually are capable of transducing a high percentage of the cell population and overexpress the transgene, and so development of this approach continues. However, safety and technical issues give us pause. In the CF airway already prone to inflammation, introduction of a foreign virus might induce or
141 accelerate inflammation and airway damage. Exchange of genetic information between recombinant viral vector and viruses in the environment might result in an artificially accelerated evolution of pathogenic viruses. Integrating viruses, such as retroviruses, face the problem of insertional mutagenesis. From a technical point of view, some viruses such as adenovirus require particular types of receptors to be accessible. Disruption of epithelial tight junctions by EDTA and exposing the coxsackievirus and adenovirus receptor (CAR) expressed on the basolateral membrane of the airway epithelium facilitates transduction of adenoviral vectors. AAV vectors have small cloning capacity in their genome and there is still debate on which serotype is most favorable for the airway.
Lentiviral vectors are increasingly gaining attention, although they do not naturally transduce airway epithelium (White and Ponnazhagan, 2006).
Cationic lipids are also under extensive research and is expected to progress to phase
I clinical trial in UK this year. The lipid GL67A manufactured by Genzyme is optimized for efficient DNA transfer without eliciting severe inflammatory response as some other lipids do. Preliminary studies in mice and sheep use aerosolized GL67A mixed with
CpG-less plasmid DNA carrying CFTR gene result in the same level of inflammation as vehicle, and no systemic response was observed. However, similar to the polyK vector, cationic lipid might also require further improvement in its gene transfer efficiency to minimize cost and maximize outcome. Recently, caboxymethycellulose was shown to increase transfection of GL67A in mouse airway by 4 fold (Griesenbach et al., 2008).
Although the increase may not be reproduced in Pseudomonas infected CF airways, this result suggests that pharmacological means might be employed as a supplement to non- viral gene therapy to improve effectiveness.
142 Two non-viral synthetic DNA carriers, PEGylated polyK and cationic lipid GL67A, are being actively explored in the gene delivery in CF patients. DNA nanoparticles have been shown in 8 out of 12 patients to improve CFTR function in nasal epithelium with little adverse effects (Konstan et al., 2004). In mouse models, it effectively delivers transgene to the airway epithelium resulting in expression of the reporter gene in 30-80% of epithelial cells (Ziady et al., 2003a and b). It induces minimal cytokine and inflammatory cell response and has no toxicity observed. Moreover, studies in other organisms such as rabbit, ferret, and sheep, and in other tissues such as brain and ocular cells, have showed its effectiveness in gene transfer. Therefore, DNA nanoparticles seem to be a potential candidate for further investigation and even clinical application. The most urgent problem with DNA nanoparticles that impedes its application is the expression level of the transgene. Although only 5-10% of the airway epithelial cells need to be transduced in order to obtain physiological CFTR function, a relatively high dose (0.8 – 8 mg DNA as used in the phase I clinical trial in the nose, a limited surface area) is required to achieve this goal (Konstan et al., 2004). The cost of manufacturing clinical-grade plasmid DNA in quantities anticipated for lung may be prohibitory.
Elements in the transgene expressing cassette of the plasmid DNA have been studied extensively. Promoters, enhancers, introns and mRNA stabilizing elements, as well as
Kozak sequence and codon optimization are among those that have been optimized, with great improvement in both intensity and duration of gene expression over the vector used in the clinical trial. On the other hand, it is also critical for us to identify the basic gene delivery mechanisms of DNA nanoparticles so that we can find cost effective approaches to enhance the delivery, which was the goal of the studies reported here.
143 In this study, we discovered that nucleolin serves as a cell surface receptor for DNA nanoparticles, and binds to them at 25.9 nM affinity. Fluorescently labeled DNA nanoparticles share similar intracellular trafficking pattern with antibody against nucleolin. Knockdown by siRNA or overexpression of surface nucleolin decreases or increases transfection by the nanoparticles. We also found that cell surface nucleolin is upregulated at G2/M phases of cell cycle by phosphorylation by Cdk1, which can be inhibited by a drug, RO-3306. The N-terminal 69 residues and the Cdk sites (aa 64-123) of nucleolin are critical for efficient surface expression. The DNA nanoparticles are endocytosed via lipid raft-mediated endocytosis, which can be inhibited by filipin, nystatin or methyl- -cyclodextrin. Both nucleolin and nanoparticles can be recovered in lipid raft fractions of a sucrose gradient separation of cell lysate. Nucleolin colocalizes with flotillin on the cell surface, and coIPs with it. The uptake of DNA nanoparticles is not inhibited by dominant negative dynamin or disruption of actin filaments by cytochalasin D or phalloidin, but can be inhibited by disrupting microtubules with taxol and nocodazole. In the following sections we will discuss our data and their impact on our understanding of gene delivery in general, derive hypotheses that are pertinent to improving nonviral gene therapy by DNA nanoparticles, and propose future studies to test these hypotheses.
Application of DNA nanoparticles in CF
The main target of DNA nanoparticles has been CFlung, while most of our previous studies have focused on wild type cells. It would be of great relevance in terms of clinical application to study the impact of CF genotype and phenotype on the gene transfer efficacy in vivo. We propose to study transfection of DNA nanoparticles and cell surface
144 receptor nucleolin using a pair of wild type and CF cell lines derived from the same parental human bronchial epithelial cell 16HBEo-. The 16HBEo-AS (CF phenotype) and
16HBEo-S (WT phenotype) cells were generated by stably expressing an anti-sense RNA against or sense RNA of the CFTR transcript in 16HBEo- cells. We will use these cells to address the questions of whether the CF phenotype will affect gene transfer and expression of cell surface nucleolin, and whether inflammation, which is clinical relevant to many CF patients, will influence these outcomes.
It has been shown that CFTR might localize in the lipid rafts and mutations of CFTR might interfere with cholesterol synthesis and trafficking (White et al., 2007), so it is critical for us to study whether the trafficking and expression of DNA nanoparticles are affected in CF cells compared to non-CF cells. Preliminary experiment indicates that transfection by DNA nanoparticles in both cell lines are comparable (Fig 5.1). We will also perform cell surface biotinylation experiments on non-polarized and polarized cells of both phenotypes to examine the level of cell surface nucleolin. We expect that nucleolin in both cells types should be comparable too.
One of the most impressive characteristics of CF patients is exaggerated inflammation in the lung. We have shown that by stimulating 16HBEo- cells with
TNF/IL1 , we were able to mimic the molecular events of inflammation in CF and non-
CF cells. Therefore, we will test the expression of transgene from DNA nanoparticles and
145 the level of cell surface nucleolin following treatment of 16HBEo-AS (CF) and 16HBEo-
S (non-CF) cells with TNF/IL1 . The stimulatory molecules will be applied for various period of time from 1 hour to 24 hour before cells are biotinylated. For the nanoparticle transfection experiments, we will need to scrutinize the dosing and timing of the stimulation further because the transfection is likely to be sensitive to the level of nucleolin in the long run. If inflammation increases surface nucleolin, we may be able to enhance gene transfer by the nanoparticles in vivo with short-lived pharmacological stimuli. This will also further validate the use of this therapy in CF patients, who often have some degree of airway inflammation.
Interaction of DNA nanoparticles and nucleolin
The most direct biochemical evidence that nucleolin participates in the uptake of
DNA nanoparticles is the direct binding study of nucleolin with nanoparticles of various compositions and components of the nanoparticles. We have proven from the surface plasmon resonance experiments that DNA nanoparticles bind to nucleolin directly at 25.9 nM affinity. However, it is not yet clear how this interaction occurs and what part(s) of
DNA nanoparticles and nucleolin are necessary or in direct contact. We will first analyze the data we’ve obtained and propose studies that might be needed to further address this issue. The binding of the nanoparticles to their cell surface receptor nucleolin is likely to be the first and a critical step of their cellular uptake. Therefore, a better understanding of this process may help us improve the formulation and construction of DNA nanoparticles as a viable clinical therapy for CF.
The interaction of DNA nanoparticles with nucleolin seems to be specific since purified GFP protein, which has similar pI to nucleolin, doesn’t attach to the
146 nanoparticles at all. However, we can’t rule out the possibility that other membrane proteins might also be involved in the binding or uptake. CK30 peptides, whether or not attached to PEG, also bind to nucleolin, although at 10-fold lower affinity than intact nanoparticles, which suggests that the polyK peptide is responsible for this lower-affinity binding to nucleolin. Nucleolin contains 4 acidic stretches rich in aspartate and glutamate, which are likely candidates for interaction with the CK30 peptides. We have postulated that the first acidic stretch (a.a. 22-44) within the N-terminal 69 residues that are responsible for the attachment of nucleolin to the cell surface is likely to associate with membrane integrated proteins to retain nucleolin at the surface, and therefore may be inaccessible to other extracellular interactions. However, the last 3 of 4 acidic regions at residues 142-179, 184-211 and 233-270 might be available for the CK30 peptides alone or within the nanoparticles. It is clear from the affinities that CK30 alone is not sufficient for the 25.9 nM KD of the intact nanoparticles, so we suspect that the DNA component might also be involved in the binding. Nucleolin indeed has been shown to have histone chaperone activity and enhances the binding of chromatin remodeling complex SWI/SNF to nucleosomes. The central RBDs are capable of binding strongly to both naked DNA and in vitro reconstituted nucleosomes (Angelov et al., 2006). Given the similarity of compacted nanoparticles to the compacted heterochromatin, it is tempting to speculate that the RBD domain of nucleolin might be at least partly responsible for its high-affinity interaction with DNA nanoparticles. Another intriguing finding of Angelov et al. is that the N-terminal acidic domain possesses histone chaperone activity similar to but weaker than full-length nucleolin. It is thus possible that aside from attaching to the nanoparticles at cell surface, the acidic regions might also be involved in the unpacking of the
147 nanoparticles after nuclear import, which allows the transcription machineries to access the transgene.
Dissecting the interaction of nanoparticles with nucleolin using surface plasmon resonance technique
BIAcore, which utilizes surface plasmon resonance to study interactions on a molecular level, has proven a powerful technique in delineating interactions between nucleolin and DNA nanoparticles on a molecular level. We would like to exploit this technique in future studies on dissecting the interaction of individual domains of nucleolin with the nanoparticles. We predict that both the N-terminal acidic region and the central RBDs of nucleolin may be involved in binding to the nanoparticles, and to test this hypothesis, we will exploit our truncated nucleolin constructs with a GFP epitope tag at the C-terminus. The GFP tag will not interfere with the binding assay for it has no affinity to the nanoparticles (Fig 2.4). The current setting of BIAcore studies, mainly immobilizing DNA nanoparticles on CM5 chip, will allow us to analyze binding of different forms of truncated or post-translationally modified nucleolin on the same chip, thereby comparing the binding curves directly.
Generally speaking, C-terminal truncated nucleoli-GFP fusion proteins will be expressed in mammalian cell cultures, purified by immunoprecipitation and subjected to
BIAcore analysis with DNA nanoparticles pre-immobilized on a CM5 chip. Different cell lines such as HeLa, HEK293 and CHO (Chinese hamster ovary) cells will be tested for the highest expression by Western blot. Using mammalian cell cultures should allow correct post-translational modifications on the recombinant protein, as it has been shown that nucleolin undergo series of modifications such as phosphorylation, methylation and
148 glycosylation. Although Drosophila cells and E. coli usually express recombinant proteins at high level, they might not process truncated nucleolin correctly. Once we establish which cell line to use, we must determine the amount of protein we can obtain from a small-scale transfection and purification. Empirically one series of BIAcore binding studies will require 5 to 10 g of ligand protein. The desired cell line will be transiently transfected with vectors expressing the truncated nucleolins, lysed and immunoprecipitated with an antibody against GFP and protein-A agarose beads as we did in Chapter 3. We have been able to obtain a sufficient amount of IP for a few Western blots from one 10-cm dish of transfected HeLa cells. For C-terminal truncated nucleolins, we will also be able to test the IP efficiency of the N17 antibody against the N-terminal
2-17 residues of nucleolin, as we have shown also in Chapter 3. We estimate that either antibody might yield up to 1 g of recombinant protein from IP, therefore we might need
5 – 10 10-cm dishes of transient transfection, which will require a large amount of transfection reagent. Alternatively, we may develop cell lines stably expressing the transgene by selecting for the G418 marker on the vector backbone. Once we obtain sufficient protein, we will test purity by Coomassie blue staining before we subject them to the binding experiment as described.
We predict that deletion of the GAR domain (NCLD1, see Chapter 3) might not interfere with the binding, while deletion of the RBD domains should decrease the affinity. Further deletions of the acidic stretches will further disrupt the interaction. The
N-terminal truncated nucleolin NCLD8 without the first acidic stretch (AS1) should still be able to bind to the nanoparticles at affinity similar to full-length nucleolin as it preserves all of the regions membrane accessible to the solution while the N terminal 69
149 residues are likely to be anchored with certain integral membrane proteins and inaccessible to binding of DNA nanoparticles. We speculate that increasing the affinity of
DNA nanoparticles to nucleolin may facilitate their uptake and increase transfection.
Therefore, once we know the region(s) of nucleolin that bind to DNA nanoparticles, we may enhance their performance in vivo by incorporating other nucleolin binding elements, such as the AS1411 aptamer or the F3 tumor homing peptide (Girvan et al.,
2006; Christian et al., 2003) or nucleolin-binding DNA sequences, in the nanoparticles to facilitate their binding to receptors. However, this approach might not be feasible in vivo, because the uptake of the nanoparticles depends on the availability of surface nucleolin and endocytic machinery, which may be the rate-limiting step during transfection.
Another direction to be explored with the BIAcore technique is whether the phosphorylation status of nucleolin affects the binding and uptake of DNA nanoparticles.
Our research indicates that DNA nanoparticles travel from cell surface to the nucleus in company with nucleolin. However, it is not clear whether interaction of DNA nanoparticles and nucleolin varies at different subcellular locations. Since nucleolin from cytoplasm and the nucleus has different isoelectric points, we will test whether they exhibit any difference in the affinity to the nanoparticles by BIAcore experiment.
Previous BIAcore experiments used cytoplasmic nucleolin purified from Jurkat cells. We will purify nuclear nucleolin using similar protocols, basically DEAE-sepharose ion exchange chromatography followed by heparin affinity chromatography. Cytoplasmic and nuclear nucleolin will be subject to binding of DNA nanoparticles immobilized on the same CM5 chip, and the binding curves and KD will be compared directly. We predict
150 that cytoplasmic nucleolin with more phosphorylation probably has higher affinity to the nanoparticles.
Nucleolin is phosphorylated in vivo by cdc2/Cdk1 and casein kinase II (Belenguer et al., 1990; Peter et al., 1990; Srivastava and Pollard, 1999). We would like to study whether phosphorylation by different kinases has any effect on its interaction with the nanoparticles. Cytoplasmic nucleolin purified by heparin affinity column will be dephosphorylated by alkaline phosphatase on the column, which will strip off most of the phosphate groups on nucleolin. The dephosphorylated nucleolin will be eluted directly, and the affinity for the nanoparticles measured on BIAcore. Alternatively the hypophosphorylated nucleolin will be treated on the column with various recombinant kinases such as Cdk1 and CK2 along with ATP as the phosphate donor, then eluted from the column for binding to the nanoparticles. We expect that Cdk1 but not CK2 phosphorylated nucleolin has higher affinity to nanoparticles, based on the fact that CK2 phosphorylation promotes the nuclear localization of nucleolin while Cdk1 phosphorylation promotes cytoplasmic relocalization.
Diverse use of SPR technology
The SPR technique provided us a versatile technical platform that has been used in analyzing the interaction of different forms of DNA nanoparticles with nucleolin. Under usual conditions when the two molecules to be analyzed are similar in size, one should be able to immobilize either one as ligand and use the other one as analyte in solution. In the case of DNA nanoparticles and nucleolin, however, meaningful results were obtained only when DNA nanoparticles were immobilized on the sensor chip. When nucleolin was immobilized on a CM5 chip and DNA nanoparticles were in solution, the sensor chip
151 showed a biphasic association phase with an initial drop to negative values followed by a drastic increase at all concentrations of the analyte (Fig 2.4). The dissociation phase was also confusing as the response increases rather than decreases as buffer was flowed over the sensory surface. Considering the nature of the sensor chip surface, one may draw several conclusions from the above observations. The first is that DNA nanoparticles showed remarkable background binding to the blank surface, which exceeds its binding to the nucleolin-attached surface and results in a net negative response after subtraction of the response from blank surface. To understand this background binding, we investigated the chemistry of the chip surface and immobilization reaction (Fig 5.2). The
CM5 chip is constituted with flexible dextran chains, on which reside a number of carboxyl groups that can be used for the immobilization reaction with amine groups on the ligand. The surface may be viewed as a 3-dimensional matrix of carboxyl groups or
152 ligand nucleolin if the immobilization is performed. The physical size of the nanoparticles is likely to be responsible for the initial background signal, and when they diffuse into the dextran matrix, more binding to nucleolin but not the blank surface occurs giving rise to the climbing dissociation phase.
Using nucleolin immobilized on the chip has obvious practical advantages such as the possibility to compare different batch or sources of nanoparticles directly on the same background. Therefore, we tested other available types of sensor. The main goal is to minimize background binding of nanoparticles to the dextran matrix, so we tried CM3 chip, which has shorter dextran chains with the same density of carboxyl groups for immobilizing nucleolin (Fig 5.3). Apparently nucleolin immobilized on the CM3 chip gives lower drop of response in the initial association phase. The minimum response from the CM5 chip is about -350 RU with a maximum of about 200 RU, while the minimum response from the CM3 chip is about -100 RU with a maximum of about 300 RU. It strongly supports our hypothesis that the dextran matrix is responsible for the extremely high background binding in CM5 chips, which is alleviated by shortening the dextran.
However, we still have not been able to avoid the biphasic association phase and the rising dissociation phase, presumably because the residual dextran is still interfering with the assay.
Another available type of
153 chip C1 has no dextran: the reactive carboxyl groups are attached directly to the gold sensory surface. We predict that it might be the favorable choice if future studies are to completely address this issue.
Besides attaching nucleolin on CM3 chips, we also tested the effectiveness of the
CM3 chip and CM4 chip, which has similar length of dextran to CM5 but with lower density of reactive groups. We immobilized DNA nanoparticles on the CM3 and CM4 chips using the same chemical reaction as we did with CM5 chips and tested the binding of nucleolin in solution (Fig 5.4). As shown here, both of the chips give dose- and time- dependent increase of response in the association phase, suggesting a specific binding. The spike at the injection and stop injection point on both chips might be due to contaminants or a difference in the temperature of the chip and buffer. Fitting of the CM3 binding curves to a 1:1 model with drifting baseline gives the best 2 of 0.374.
The ka and kd of this interaction are 3.50 ± 0.04
154 105 M-1•s-1 and 6.50 ± 0.15 10-4 s-1 respectively. The equilibrium dissociation constant is
18.6 nM by calculation, similar to that calculated from the binding on CM5. The
2 sensorgram of CM4 chip fits best into a 1:1 binding model with a of 0.684. The ka and
4 -1 -1 -4 -1 kd of this interaction are 9.37 ± 0.21 10 M •s and 1.65 ± 0.03 10 s respectively.
The affinity is calculated 17.7 nM, similar to the previous two calculations. Taken together, all the three types of sensor chips give similar affinity data, while CM5 chip sensorgram fits best into a classical 1:1 binding model. There are marked deviations of the fitting of CM3 and CM4 chips, which might be due to insufficient immobilization.
Detecting cell surface nucleolin in vivo
DNA nanoparticles have successfully delivered transgenes in mouse, rabbit, ferret, sheep and human airways (Ziady et al., 2003a; Konstan et al., 2004; unpublished data), brain of mouse and rat (Yurek et al., 2005) and mouse retina (Farjo et al., 2005; Cai et al., 2008). We would like to correlate the ability of in vivo gene transfer with the expression of their receptor nucleolin in various tissue, which may further support our theory that nucleolin is critical for gene transfer by DNA nanoparticles and help us predict what other tissues and organs will the nanoparticles be useful in. In support of this theory, nucleolin plays a critical role in the cellular uptake of DNA nanoparticles in cell culture, which is supported by the direct binding, colocalization and manipulation of nucleolin expression experiments (Chapter 2). It is likely that the in vivo gene transfer of the nanoparticles rely on cell surface nucleolin too, judging from several lines of supporting evidence. Firstly, the pattern of transfection by DNA nanoparticles in mouse airway is spotty, with some cells expressing both very high and very low levels of the reporter gene (Fig 1.4, 5.5A). Preliminary staining of permeabilized mouse airway
155 sections for nucleolin shows uneven intensity among different cells (Fig 5.5B), suggesting that the level of nucleolin varies within a cell population. The staining is not designed to look particularly for cell surface nucleolin, but our cell cycle studies indicate that the level of cell surface nucleolin depends on the stage of cell cycle, so cells at different stages may stain differently. Secondly, DNA nanoparticles have successfully delivered GFP reporter gene and therapeutic neural protective genes into neurons and glial cells of rodent midbrain and striatum in vivo (Fig 5.5C). In a primary culture of rodent midbrain and striatal neurons, we also observed cell surface expression of
156 nucleolin on these neurons (Fig 5.5 D and E). This expression might correlate with the ability of the nanoparticles to transfect these cells. Taken together, we believe that the in vivo transfection of DNA nanoparticles also depends on the expression level of surface nucleolin.
We propose to further test this hypothesis by following studies. To detect cell surface nucleolin expressed in mouse airway, we may apply a solution of an antibody against nucleolin intranasally in mice, harvest nasal epithelium and lung, and stain for the antibody in the airway sections. Control mice will be injected with pre-immune serum of the same species. Although the MS-3 mouse monoclonal antibody against nucleolin is excellent for immunohistochemistry, in the proposed study antibody from another species should be used to avoid the interference of endogenous mouse antibody with interpretation of the results. The rabbit H-250 antibody against nucleolin shows similar staining and intracellular trafficking patterns to the MS-3 antibody, thus serves our purpose. In a preliminary study we performed intranasal injection of rhodamine-labeled
MS-3 antibody in C57/BL6 mice, and tried to detect the rhodamine fluorescence in live animals following the injections. Unfortunately, the fluorescence signal could not be detected in the injected mice above the control saline-injected mice. However, this failure could be due to absorption of fluorescence by the mouse chest tissue and hairs, and the instability of the rhodamine fluorescence in vivo. Studies in our lab are exploring novel non-quenching fluorescent tags for in vivo live tracking of the DNA nanoparticles, which will be described below. Another technical obstacle with the study is that nasal instillation often results in uneven distribution in the lung, and this is true even when the solution is nebulized as an aerosol. To circumvent this problem, we might harvest the
157 entire mouse lung, and infuse antibody intratracheally before processing and staining, in order to distribute the antibody to all airways. Similarly, to detect surface nucleolin in rodent brain in vivo, we may inject antibody against nucleolin into the same site as the nanoparticles have been injected, harvest the brain and stain for the antibody. If rats instead of mice are studied (as stereotactic injection is easier to perform in rats), the MS-3 antibody may also be used.
Targeting cell surface nucleolin using DNA nanoparticles
Among many cell types that appear to express cell surface nucleolin in vivo, tumor and cells and angiogenic endothelial cells are particularly interesting as they bear significant therapeutic potential. A variety of molecules have been developed to target these tissues by the interaction with different regions of cell surface nucleolin. AS1411 is a guanosine-rich phosphodiester oligodeoxynucleotide that forms stable guanosine- quadroplex structures and interacts with the RNA binding domains of nucleolin. It has been shown to mediate the translocation of cell surface nucleolin to the nucleus, and inhibit the proliferation of tumor cells (Girvan et al., 2006). HB-19 is a pseudopeptide consisting of five Lys-Pro-Arg tripeptides covalently linked to the lysine side chains of the template H2NLys-Lys-Lys-Gly-Pro-Lys-Glu-Lys-AhxCONH2. The structure of this pseudopeptide renders it resistant to degradation in human serum. It was originally shown to bind to the C-terminal GAR domain of nucleolin, thereby inhibiting the cellular entry of HIV-1 virus (Nisole et al., 2002). A recent study using this molecule to target tumor tissues has shown that it also bind to the surface of human umbilical vein endothelial cells (HUVEC), the PC3 human prostatic carcinoma cell line MDA-MB-231 and MDA-
MB-435 human breast carcinoma cell lines via nucleolin and inhibit their growth both in
158 vitro and in vivo in mouse xenograft models (Destouches et al., 2008). F3 cell penetrating peptide is a 34–amino acid fragment of a high mobility group protein, HMG2N, and has a sequence of “AKVKDEPQRRSARLSAKPAPPKPEPKPKKAPAKK”. It is rich in positively charged lysine, and is believed to bind to the N-terminal acidic domain of nucleolin. It was initially described to home to the blood vessels of various tumor tissues and tumor cells of certain types. It also translocates into the nucleus of tumor cells and inhibits their growth. In a mouse xenograft model, it enriches in the MDA-MB-435 tumors and the angiogenic blood vessels of a matrigel model after tail vein injection
(Christian et al., 2003). Endostatin is a 20-kDa fragment of the C-terminus of collagen
XVIII isolated for its ability to inhibit tumor angiogenesis of a murine hemangioendothelioma culture. It binds to nucleolin at an affinity of 23.2 nM. Nucleolin was found on the surface of human microvascular endothelial cells (HMEC), and mediates the migration and tubular formation of these cells during the angiogenesis induced by vascular endothelial growth factor (VEGF) (Huang et al., 2006). The nucleolin-mediated angiogenesis is inhibited by endostatin both in culture and in vivo in the B16/F10 mouse melanoma xenograft, subcutaneous xenograftment of HeLa carcinoma and orthotopic Lewis lung carcinoma (LLC) xenograft in Balb/c nude and C57 black mice (Shi et al., 2007). Therefore, cell surface nucleolin seems to be a tumor and angiogenic marker, and has been successfully targeted in vivo by several anti-tumor and anti-angiogenic molecules.
As we have shown, the transfection of DNA nanoparticles relies on the expression of cell surface nucleolin in cell culture and probably in vivo too. It is a very intriguing option for us to further explore the application of the nanoparticles in other tissues and
159 organisms. Research from other groups supports potential application in the brain and ocular tissues. Since cell surface nucleolin is enriched in tumor cells and proliferating blood vessels, we would like to investigate whether DNA nanoparticles will be of use in such field. This line of research will be focused on determining the transfection efficiency of DNA nanoparticles in tumor and endothelial cells in culture, localization and expression of DNA nanoparticles in tumor xenograft model in vivo, and potentially therapeutic anti-tumor targeting of DNA nanoparticles carrying apoptotic genes. Firstly, we have established that DNA nanoparticles transfect human cervical carcinoma cell
HeLa effectively in culture. We will test the reporter gene expression in other cancer cell lines, such as prostatic carcinoma MDA-MB-231, breast carcinoma MDA-MB-435 and lung carcinoma LLC cells as used in the aforementioned studies. Secondly, we will reproduce the xenograft models of these cells in mouse, apply DNA nanoparticles carrying luciferase reporter gene by ectopic or intravenous injections, and detect the expression of the reporter gene in mouse tissue sections or live animals. Controls in these experiments will be saline and naked DNA. Bioluminescence imaging technique allows us to detect the expression of luciferase gene by peritoneal injection of the luciferase substrate luciferin into live animals and observe the bioluminescence catalyzed by luciferase proteins. Alternatively, we may also harvest the mice at different time points, fix them and section different tissues and detect the luciferase expression by immunohistochemistry. If we observe significantly higher expression of reporter expression in the tumor xenograft compared to other tissues in the same animal and the same tissues in controls animals, we can conclude that DNA nanoparticles deliver transgene in nucleolin expressing tumor cells efficiently. Then we will be able to progress
160 to the third stage of the study, in which we will inject DNA nanoparticles carrying apoptotic genes into mice carrying tumor xenograft and see if these tumors regress. The exact gene to be selected and construction of the expressing vector will require careful selection. In summary, we are very interested in carrying out studies on whether DNA nanoparticles are capable of cancer gene therapy in culture and in vivo.
Endocytic pathway(s) employed by DNA nanoparticles
We now have a clearer image of how DNA nanoparticles are internalized into the cells by lipid raft mediated endocytosis. However, we have not yet been able to find a definitive regulator of the uptake. As reviewed by Mayor and Pagano, lipid raft mediated endocytosis may be regulated by caveolin, GTPases RhoA and Cdc42 and ADP- ribosylation factor ARF6. Since caveolin and RhoA regulated endocytosis both depend on dynamin, it is likely that Cdc42 and/or ARF6 or even other proteins are involved in the endocytosis of DNA nanoparticles (Mayor and Pagano, 2007). We will investigate which one(s) of the mentioned GTPases participates in this process by employing dominant negative (DN) forms of RhoA, Cdc42 or ARF6. HeLa cells will be transfected by vectors expressing wild type and DN forms of the GTPases prior to transfection with
DNA nanoparticles carrying luciferase reporter gene. The expression of the reporter will be assayed as a measurement of the cellular uptake. In addition, to follow the early events of the trafficking of DNA nanoparticles, we will express wild type or DN GTPases in
HeLa cells and apply rhodamine-labeled nanoparticles to these cells. The cells will then be fixed and stained for these GTPases at various time points from 30 minutes to 4 hours.
We cannot predict whether localization and inhibition of transfection will be achieved with any or all of the DN enzymes at this point.
161 Since several endocytic markers using lipid raft mediated endocytosis have been extensively studied in the past, we may also observe the trafficking of these markers and ask the question whether DNA nanoparticles colocalize with any of the markers during this process. Interleukin-2 (IL-2) seems to employ mainly RhoA regulated endocytosis, while cholera toxin B (CtxB) is relatively specific for caveolin and Cdc42 mediated endocytosis (Mayor and Pagano, 2007; Kirkham and Parton, 2005). GPI-anchored protein 1 integrin is internalized by ARF6 dependent pathway, suggesting antibody against 1 integrin may serve as a marker of this pathway. To perform the colocalization study, HeLa cells will be incubated with rhodamine-labeled DNA nanoparticles along with one of the markers, including IL-2, CtxB and antibody against 1 integrin, conjugated to FITC for 30 minutes to 4 hours before the cells are fixed and observed under fluorescent microscope. This study will provide us more insights into the intracellular trafficking of DNA nanoparticles and may allow us to improve this process by targeting specific regulators.
We are also interested in further defining the involvement of cytoskeleton in the uptake of DNA nanoparticles. From the inhibitor study we now understand that microtubules rather than actin filaments are required for transfection by the nanoparticles.
Therefore we propose to perform colocalization studies with rhodamine labeled DNA nanoparticles with fluorescent staining of microtubules and actin filaments. We expect cytoplasmic DNA nanoparticles to colocalize with microtubules instead of actin.
Disruption of microtubules by taxol or nocodazole should disrupt this colocalization and result in inefficient transport of nanoparticles to the nucleus and less nuclear and peri- nuclear nanoparticles observed.
162 Fluorescent labeling of DNA nanoparticles for real-time tracking
Although current labeling of the nanoparticles with rhodamine allows us to visualize them using fluorescent microscopy, there are still some disadvantages in this technique. The rhodamine label we used photobleaches during the imaging process, making it impossible to take picture stacks and view the nanoparticles in a three- dimensional context, or track the nanoparticles in real time in live cells. It is also impossible to directly image the nanoparticles in live animals without the expression of the reporter gene carried by the nanoparticles. To characterize the trafficking of the nanoparticles in live cultured cells and animals, Dr Anna Samia in our lab is currently developing new fluorescent tags, namely semiconductor quantum dots (QDs), for the DNA nanoparticles. We initially studied the toxicity and labeling of the nanoparticles in cell cultures in collaboration. QDs are formulated with a semiconductor nanocrystal core (CdSe for example), and an outer amphiphilic coating. QDs have been used in biomedical imaging and electronics industries (Hardman, 2006). The optical property of these QDs makes it superior to organic fluorophores. The fluorescent spectrum of the QDs can be tuned from red to blue by adjusting the size of the core (Fig 5.6). Furthermore, the fluorescence of QDs does not photobleach by the excitation light, which makes it a convenient candidate for live cell and in vivo imaging (Hardman, 2006; Derfus et al., 2004).
The QDs developed by our lab has a bi-functional lipid coating, which has primary amine groups on the surface. Therefore, we were able to conjugate the primary amine
163 groups of the QD coating to the NHS functional group of the PEG moiety of the
CK30PEG peptide. The conjugation was confirmed by agarose gel electrophoresis and pulldown assays. To compare the potential toxicity of the free QDs with the QD-PEG-
CK30 conjugates we performed a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay on HeLa cells (Fig 5.7). The unconjugated QDs did not show significant toxicity on the cells at physiologically relevant concentrations. At higher concentrations, they showed mild toxicity in a dose and time dependent manner. When incubated for 1 hour, there is no significant difference in the viability of the cells between
QD treated and untreated groups at concentrations below 0.00625 mg/ml, which is 2-3 fold higher than the concentration used in the DNA compaction. After a 24-hour treatment, more than 90% of HeLa cells are viable at the same concentration, which means that the cells tolerate the QDs well. In contrast, the QD-PEG-CK30 showed higher toxicity, also in a dose and time dependent fashion. HeLa cells treated with 0.00625 mg/ml QD-PEG-CK30 are about 80% viable after 1 hour, but only about 20% after 24 hours. Similar results were obtained in
Vero cells (data not shown). The difference in viability between treated and untreated groups is significant at even the lowest concentrations tested, which killed about 20% of the cells. The toxicity of the
QDs mainly come from deterioration of the coating and degradation of the nanocrystal core, as cadmium and
164 selenium are both toxic if they leach into the cell. The increased toxicity associated with the QD-PEG-CK30 conjugation might be caused by the enhanced cell entry ability of the
QD, as demonstrated in the following cellular uptake studies.
The intense and photostable fluorescence of the CdSe/ZnS nanocrystals allowed us to image the trafficking of the free and conjugated QDs using HeLa cells as a model. As shown in Figure 5.8, the free QDs tend to remain outside of the cell, at the plasma membrane. After 4-hour incubation of QDs with HeLa cells, little or no intracellular red fluorescence was observed. A few red fluorescent dots localize on the membrane, which is outlined by the green wheat germ agglutinin (WGA) staining. In contrast, the QD-
PEG-CK30 conjugate entered cells readily within 30 minutes. The majority of the cells take up QD-PEG-CK30 into the cytoplasm as shown in the 3-D reconstruction of the deconvolved pictures (Fig 5.8B). At 4 hours, more QDs were observed in the cytoplasm, and some reside in the peri-nuclear region. The ability of the conjugated QDs to enter the cell may be conferred by added positive charges in the polyK peptide. The positive charges might allow the QD to bind to the cell membrane or negatively charged glycoproteins more efficiently and be captured by endocytic or macropinocytic pathways.
165 Once inside the cell, the poly-lysine peptide may serve as a nuclear localization signal
(NLS) for the QDs. Another possible explanation is that highly positively charged peptides may function as cell penetrating peptide (CPP) as shown in the case of an octo-
arginine (R8) peptide (Suzuki et al., 2002).
The QD-PEG-CK30 conjugate can still bind to DNA as the unconjugated peptide does, which was confirmed by a pulldown assay. Therefore we progress to compact DNA nanoparticles using the QD-conjugated peptide and the luciferase reporter plasmid. The structure and stability of the QD labeled nanoparticles were confirmed by transmission electron microscopy and DNase I protection assays. To test the gene delivery activity of these nanoparticles, we transfected HeLa cells with QD labeled or unlabeled nanoparticles. As shown in Figure 5.9, DNA nanoparticles compacted with unconjugated
PEG-CK30 peptide transfected HeLa cells and yielded luciferase activity at 4.35 ± 0.17
6 10 RLU/mg protein. Addition of QD or QD + PEG-CK30 in to the unlabeled nanoparticles does not affect the transfection. DNA nanoparticles compacted with QD-
PEG-CK30 also transfect
HeLa cells, although at lower efficiency (3.93 ±
0.50 105 RLU/mg protein). The difference might be due to the toxicity of the QD labeled DNA nanoparticles, as we observed that the protein
166 concentrations of cells treated with the QD labeled nanoparticles treated group were about 50% of those treated with unlabeled DNA nanoparticles (data not shown).
Therefore, the QD labeled DNA nanoparticles appear to enter HeLa cells causing gene transfer accompanied by increased cytotoxicity. We are working on optimizing the composition of the lipid coating of the QDs, refining the conjugation step and trying to minimize the toxicity.
Since the ultimate goal of this study is to use QD labeled DNA nanoparticles in imaging, we followed the intracellular trafficking of QD labeled DNA nanoparticles in
HeLa cells by fluorescence microscopy. As a control, we labeled PEG-CK30 with fluorescein (FITC) to obtain double-labeled nanoparticles. The QD labeled nanoparticles were observed inside the cells, some inside the nuclei (Fig 5.10, arrows in QD-NP-FITC panels), after 1-hour incubation. Most of the intracellular QDs co-localize with FITC fluorescence (yellow in merge pictures of QD and FITC), indicating that these nanoparticles are indeed labeled with both tags. In contrast, free QDs mixed with
167 compacted nanoparticles appear at the periphery of the cells or sometimes non- specifically bound to the glass slide. Therefore, the nanoparticle-bound QDs are able to gain access into the nucleus along with the nanoparticles, which confirms their ability to transfect cells and explains the increased cellular toxicity of the QD labeled nanoparticles. Cell viability after 1-hour incubation did not show significant difference between QD labeled and unlabeled groups. Therefore, for this type of studies, toxicity is not an outstanding issue as in the expression experiment. This should also allow us to perform short-term fluorescent tracking studies in live cells and animals in the future.
Meanwhile, Dr Samia is developing another fluorescent nanocrystal with gold clusters (Au-PEG), which are much smaller and much less toxic (Fig 5.11). We performed cytotoxicity assays for the Au-PEG clusters on two different cell lines (Fig
5.11A). Even at relatively high concentrations (0.2 mg/mL) cell viability was 100% for both HeLa and Vero cell lines. The fluorescence of the Au-PEG was also observed in
HeLa cells after 1-hour incubation but not in the untreated cells (Fig 5.11B). In summary, we are making promising progresses toward live imaging of DNA nanoparticles in both cell culture and in vivo.
Molecular partners of nucleolin and DNA nanoparticles
168 Aside from the applications of DNA nanoparticles in vivo, we would also like to further investigate the cell biology of their cellular uptake and regulation of cell surface expression of nucleolin. The most intriguing question that arises from our study is how nucleolin, without a transmembrane domain or GPI anchor is retained on the plasma membrane. The answer may lie in its binding partners. These molecules may hold the key to understand the trafficking of nucleolin between the nucleus, cytosol and membrane, and how they may be exploited to facilitate gene transfer as well.
Since our primary interest is cell surface nucleolin, we need to purify this pool of nucleolin to relative high homogeneity so that the high amount of cytosolic and nuclear nucleolin does not interfere with the downstream analysis and interpretation. The success in purification of membrane nucleolin in the lipid raft fractions opens another window of study on the property and behavior of cell surface nucleolin. As we are now able to separate lipid raft fractions of the membrane, we should be able to further purify nucleolin from these fractions, and analyze its post-translational modifications and binding partners, either or both of which may be essential for the transfection of DNA nanoparticles. Towards this end, we have developed a HeLa cell line that stably expresses
FLAG tagged nucleolin, which will allow downstream affinity purification using high affinity antibody against FLAG. The FLAG tagged nucleolin reaches the cell surface in substantial quantity. We have also obtained enough proteins using transient transfection of this construct for Coomassie blue following IP with FLAG antibody and SDS-PAGE separation. Both full-length nucleolin NCL123 tagged with FLAG immunoprecipitate a set of proteins, several of which are common between the two IP’s (Fig 5.12, arrows).
169 To purify nucleolin from the lipid raft fractions, HeLa cells stably expressing nucleolin-FLAG or the vector backbone will be lysed and separated as described. Fractions
5 – 7 will be collected and dialyzed against
Tris-buffered saline with 0.05% Tween-20 for IP with FLAG antibody conjugated agarose beads. The bound proteins will be eluted with 3x FLAG peptide solution and separated on a SDS-PAGE. Protein bands will be revealed by silver staining and those that present in the nucleolin-FLAG cells but not the control cells will be subjected to analysis by matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) and identification by peptide fingerprinting or direct sequencing using MS/MS. We expect to find lipid raft markers and integral membrane proteins, which will be confirmed by coIP in native cells without overexpression of nucleolin.
As an alternative approach to purify cell surface nucleolin-interacting proteins directly, we may biotinylate cells with NHS-SS-biotin, which has a reducible disulfide bond. Cell lysates will be subjected to purification with streptavidin beads, and elution
170 with dithiothreitol, which will cleave the disulfide bond between the biotin label and cell surface proteins. These proteins will be subject to immunoprecipitation with anti-FLAG antibody, so that only cell surface proteins that interact with nucleolin will be pulled down for 2D gel separation and identification. If the proteins associated with nucleolin are those identified with lipid rafts, we will infer that nucleolin resides in lipid rafts at the cell surface. The identified proteins can then be confirmed by colocalization studies using immunofluorescent staining.
To study the molecular machinery of the cellular uptake and trafficking of DNA nanoparticles, we propose to study the “interactome” of DNA nanoparticles as well. It is technically challenging to pull down DNA nanoparticles, as there are no antibodies that recognize them. Therefore for this study, we developed His-tagged nanoparticles. A His6 tag is covalently linked to the
PEG of the CK30PEG peptide before compaction into nanoparticles. These His- tagged nanoparticles transfect at similar efficiency as the untagged ones, and EM and
DNase I protection assay also verified that their physical properties were not altered.
Preliminary data has shown that His-tagged nanoparticles,
171 but not the unlabeled ones, can be successfully pulled down with Ni coupled beads. We expect to pull down nucleolin and other proteins that it binds to in this context. Indeed, in a preliminary experiment with pulldown using Ni coupled beads, we have identified nucleolin in a Western blot (Fig 5.13A). Moreover, using HRP conjugated streptavidin we observed other cell surface biotinylated proteins also pulled down by the His tagged nanoparticles (Fig 5.13B). We will further pursue this study by separating the pulldown proteins on a 2-D gel and identify the protein spots by MS. Unlabeled nanoparticles will also be subject to binding of cell lysates and downstream processing as a control.
To determine whether the proteins we identify are essential for the arrival of nucleolin at the cell surface, we can treat cells with siRNA directed against these proteins, and then measure both surface nucleolin and reporter gene expression from
DNA nanoparticles. Controls will be siRNA of the same nucleotide composition but scrambled sequence or a presumed irrelevant siRNA such as anti-GAPDH. If suppression of the binding partners has no effect on the expression from DNA nanoparticles, they may not be important in either binding of nanoparticles or arrival of nucleolin at the cell surface, but if suppression of the binding partner suppresses surface nucleolin and reporter gene expression, the protein will likely be important for one or the other process, or both. These proteins will be further studied by fluorescent immunostaining and colocalization with cell surface nucleolin or rhodamine-labeled DNA nanoparticles. We may also overexpress them to see whether this will increase cell surface nucleolin and/or facilitate the transfection of the nanoparticles.
Phosphorylation and regulation of cell surface nucleolin
172 Another layer of cellular regulation on nucleolin function is post-translational modification, mainly phosphorylation. Although we now know that Cdk1 rather than
CK2 phosphorylation of nucleolin promotes its cell surface expression, we still have little idea which of the many serines and threonines are actually phosphorylated in vivo. This will also be an important question following the study of the interaction of DNA nanoparticles with differently phosphorylated nucleolin as described in previous sections.
The FLAG tagged nucleolin provide us a useful platform to perform this type of research.
After purification of nucleolin-FLAG by IP with FLAG antibody and separation of the
IPed proteins by 2D-gel and silver staining, we will identify the nucleolin spot on a separate Western blot, digest the spot by trypsin and subject the peptide mixture to enrichment of phospho-peptides by Iron(III)-immobilized metal ion affinity chromatography (IMAC) and identification of peptide sequence by tandem MS (MS/MS)
(Nühse et al., 2007). Once sequenced and identified, a specific phospho-peptide ion can be selected in subsequent unpurified samples based on its m/z and its chromatographic peak compared to the peak of the unmodified form for quantitation, allowing us to estimate the extent of phosphorylation. By purifying nucleolin from cell surface, cytoplasm and the nucleus, we should be able to tell which sites of nucleolin are phosphorylated and whether there is any difference in the usage of phosphorylation sites in different compartments. This approach of studying post-translational modification has been employed in many experimental settings, although its effectiveness relies on the efficiency of the IMAC step as well as the ability of the peptides to be detected by the
MS equipment. The presence of certain phosphorylation can be confirmed by Western blot using phospho-specific antibodies. Using the same techniques, we can determine the
173 phosphorylation status of nuclear and cytoplasmic nucleolin, and compare them with the cell surface form of nucleolin, which by prediction should bear more phosphorylation on the Cdk sites.
Since we have established the positive regulatory role of cdc2/Cdk1 on cell surface nucleolin, we propose to directly manipulate the activity of Cdk1 in our model cell system and examine the subsequent change of surface nucleolin level and nanoparticle transfection. Although RO-3306 seems to inhibit Cdk1 specifically and effectively, a more specific means is to overexpress a dominant negative (DN) form of Cdk1
(Golsteyn, 2004; Ferrari, 2006). DN Cdk1 has been successfully expressed in HeLa cells and shown to inhibited TNF induced apoptosis (Meikrantz and Schlegel, 1996). DN forms of other Cdks (Cdk2, Cdk3, Cdk5) were also used in this study and may serve as controls for our purpose. We should also test if there is any direct association of nucleolin with one of the Cdks, particularly Cdk1 by immunoprecipitation. This experiment will be conducted in a synchronized population of HeLa cells to improve the sensitivity of the assay and help the interpretation of the results.
We may also be able to target Cdk1 activity by targeting its cyclin partners. Cdk1 binds to A and B type cyclins at different cell stage (Nigg, 2001). Cyclin B is expressed and stabilized at the onset of M phase, and degraded by the APC, while cyclin A is expressed at the G2 phase prior to the onset of mitosis (Nigg, 2001; Kaldis and Aleem,
2005). Therefore, Cyclin A seems to be a more reasonable candidate that influence surface nucleolin expression indirectly by stimulating Cdk1 at the onset of M phase.
Overexpression of cyclin B2 but not B1 or A stimulates migration of HeLa cells (Manes et al., 2003). We may use a similar approach to overexpress cyclin B and A, and look at
174 cell surface expression of nucleolin. We predict that overexpression of one of the cyclins should increase both Cdk1 activity and surface nucleolin.
Summary
We have shown the importance of nucleolin in gene transfer by DNA nanoparticles, regulation of cell surface nucleolin by Cdk1 and cellular uptake of the nanoparticles via lipid raft-mediated endocytosis. Although we now have a primitive model of how DNA nanoparticles cross the barrier of cell membrane and cytoplasm, more questions have risen from our current data. Moreover, the limitation of in vivo efficacy of gene transfer is urging great improvement of formulation or therapeutic approaches to facilitate and enhance nonviral gene transfer by DNA nanoparticles. We reason that by studying how the CF defect affects gene transfer, we will determine whether and how clinical mutations and pathology like inflammation and Pseudomonas infection affect the efficiency of
DNA nanoparticles. This part should be relatively straightforward and will be conducted first.
At another level, more in-depth understanding of the molecular interaction between
DNA nanoparticles and nucleolin and potential regulation of this binding will help us design better gene transfer vectors. Besides the lung, brain and retina, DNA nanoparticles might be used in other tissues that express cell surface nucleolin. Of these potential targets of the nanoparticles, tumor and angiogenic blood vessels could be of great therapeutic value. These future studies are more complex and should be designed and conducted with great care. We are making progress toward studying the in vivo trafficking of DNA nanoparticles by tagging them with fluorescent QDs or Au clusters.
175 Proteomic studies on the binding partners of nucleolin and DNA nanoparticles, and on the phosphorylation status of nucleolin in different cellular compartments may also yield useful information about how to improve the performance of DNA nanoparticles.
Since we have already established HeLa cells stably overexpressing FLAG-tagged nucleolin, and tested in preliminary experiments the feasibility of FLAG pulldown, we should be able to readily proceed with our proven protocol of purifying surface nucleolin.
In summary, we have achieved better understanding of gene transfer by DNA nanoparticles, and we are planning to implement studies to further this understanding and improve this nonviral vector.
176 Bibliography
Alete, D. E., Weeks, M. E., Hovanession, A. G., Hawadle, M., and Stoker, A.W. (2006). Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-sigma. FEBS J. 273, 4668-81. Angelov, D., Bondarenko, V. A., Almagro, S., Menoni, H., Mongelard, F., Hans, F., et al. (2006). Nucleolin is a histone chaperone with FACT-like activity and assists remodeling of nucleosomes. EMBO J, 25, 1669-79. Belenguer, P., Caizergues-Ferrer, M., Labbé, J. C., Dorée, M., and Amalric, F. (1990). Mitosis-specific phosphorylation of nucleolin by p34cdc2 protein kinase. Mol Cell Biol. 10, 3607-18. Bose, S., Basu, M., and Banerjee, A. K. (2004). Role of nucleolin in human parainfluenza virus type 3 infection of human lung epithelial cells. J Virol. 78, 8146- 8158. Boucher, R. C. (2004). New concepts of the pathogenesis of cystic fibrosis lung disease. Eur Respir J. 23, 146-58. Brendel, C., Rehbein, M., Kreienkamp, H. J., Buck, F., Richter, D., Kindler, S. (2004). Characterization of Staufen 1 ribonucleoprotein complexes. Biochem J. 384, 239- 46. Bukrinskaya, A., Brichacek, B., Mann, A., and Stevenson, M. (1998). Establishment of a functional human immunodeficiency virus type 1 (HIV-1) reverse transcription complex involves the cytoskeleton. J Exp Med. 188, 2113-25. Cai, X., Conley, S., Naash, M. (2008). Nanoparticle applications in ocular gene therapy. Vision Res. 48, 319-24. Callebaut, C., Blanco, J., Benkirane, N., Krust, B., Jacotot, E., Guichard, G., Seddiki, N., Svab, J., Dam, E., Muller, S., et al. (1998). Identification of V3 loop- binding proteins as potential receptors implicated in the binding of HIV particles to CD4(+) cells. J Biol Chem 273, 21988-21997. Ceman, S., Brown, V., Warren, S. T. (1999). Isolation of an FMRP-associated messenger ribonucleoprotein particle and identification of nucleolin and the fragile X- related proteins as components of the complex. Mol Cell Biol. 19, 7925-32. Chen, C-Y., Gherzi, R., Andersen, J. S., Gaietta, G., Jürchott, K., Royer, H-D., Mann, M., Karin, M. (2000). mRNA stabilization during T-cell activationNucleolin and YB-1 are required for JNK-mediated interleukin-2. Genes & Dev. 14, 1236-1248. Chen, X., Kube, D. M., Cooper, M. J., and Davis, P. B. (2008). Cell surface nucleolin serves as receptor for DNA nanoparticles composed of pegylated polylysine and DNA. Mol Ther. 16, 333-42. Cheng, Z. J., Singh, R. D., Marks, D. L., Pagano, R. E. (2006). Membrane microdomains, caveolae, and caveolar endocytosis of sphingolipids. Mol Membr Biol. 23, 101-10.
177 Conner, S. D., Schmid, S. L. (2003). Regulated portals of entry into the cell. Nature. 422, 37-44. Cottin, V., Thibout, Y., Bey-Omar, F., Durieu, I., Laoust, L., Morel, Y., Cordier, J. F. (2005). Late CF caused by homozygous IVS8-5T CFTR polymorphism. Thorax. 60, 974-5. Christian, S., Pilch, J., Akerman, M. E., Porkka, K., Laakkonen, P., and Ruoslahti, E. (2003). Nucleolin expressed at the cell surface is a marker of endothelial cells in angiogenic blood vessels. J Cell Biol. 163, 871-878. Davis, P. B. (2006). Cystic fibrosis since 1938. Am J Respir Crit Care Med. 173, 475-82. Davis, P. B., Cooper, M. J. (2007). Vectors for airway gene delivery. AAPS J. 9, E11-7. Davies, J. C., Alton, E. W., Bush, A. (2007). Cystic fibrosis. BMJ. 335, 1255-9. Dean, D. A., Strong, D. D., Zimmer, W. E. (2005). Nuclear entry of nonviral vectors. Gene Ther. 12, 881-890. Deng, J-S., Ballou, B., Hofmeister, J. K. (1996). Internalization of anti-nucleolin antibody into viable HEp-2 cells. Mol Biol Rep, 23, 191-5. Derfus, A. M., Chan, W. C. W., Bhatia, S. N. (2004). Probing the cytotoxicity of semiconductor quantum dots. Nano Lett. 4, 11-18. Destouches, D., El Khoury, D., Hamma-Kourbali, Y., Krust, B., Albanese, P., Katsoris, P., Guichard, G., Briand, J. P., Courty, J., and Hovanessian, A. G. (2008). Suppression of tumor growth and angiogenesis by a specific antagonist of the cell-surface expressed nucleolin. PLoS ONE. 3, e2518. Fähling, M., Mrowka, R., Steege, A., Nebrich, G., Perlewitz, A., Persson, P. B., Thiele, B. J. (2006). Translational control of collagen prolyl 4-hydroxylase-alpha(I) gene expression under hypoxia. J Biol Chem. 281, 26089-101. Fähling, M., Mrowka, R., Steege, A., Martinka, P., Persson, P. B., Thiele, B. J. (2006). Heterogeneous nuclear ribonucleoprotein-A2/B1 modulate collagen prolyl 4- hydroxylase, alpha (I) mRNA stability. J Biol Chem. 281, 9279-86. Farjo, R., Skaggs, J., Quiambao, A. B., Cooper, M. J., Naash, M. I. (2006). Efficient non-viral ocular gene transfer with compacted DNA nanoparticles. PLoS ONE, 1, e38. Ferrari, S. (2006). Protein kinases controlling the onset of mitosis. Cell. Mol. Life Sci. 63, 781-795. Fink, T. L., Klepcyk, P. J., Oette, S. M., Gedeon, C. R., Hyatt, S. L., Kowalczyk, T. H., et al. (2006). Plasmid size up to 20 kbp does not limit effective in vivo lung gene transfer using compacted DNA nanoparticles. Gene Ther, 13, 1048-51. Fried, H., Kutay, U. (2003). Nucleocytoplasmic transport: taking an inventory. Cell Mol Life Sci. 60, 1659-88. Galati, D., Bocchino, M. (2007). New insights on the perturbations of T cell cycle during HIV infection. Curr Med Chem. 14, 1920-4. Ginisty, H., Amalric, F., Bouvet, P. (1998). Nucleolin functions in the first step of
178 ribosomal RNA processing. EMBO J. 17, 1476-86. Ginisty, H., Sicard, H., Roger, B., and Bouvet P. (1999). Structure and functions of nucleolin. J Cell Sci. 112, 761-772. Girvan, A. C., Teng, Y., Casson, L. K., Thomas, S. D., Jüliger, S., Ball, M. W., Klein, J. B., Pierce, W. M. Jr, Barve, S. S., and Bates, P. J. (2006). AGRO100 inhibits activation of nuclear factor-kappaB (NF-kappaB) by forming a complex with NF-kappaB essential modulator (NEMO) and nucleolin. Mol Cancer Ther. 5, 1790-9. Golsteyn, R. M. (2005). Cdk1 and Cdk2 complexes (cyclin dependent kinases) in apoptosis: a role beyond the cell cycle. Cancer Lett. 217, 129-38. Griesenbach, U., Meng, C., Farley, R., Sinn, P. L., McCray, P. B. Jr, Cheng, S. H., Scheule, R. K., Alton, E. W. F. W. (2008). Carboxymethylcellulose increases nonviral gene transfer in mouse airways. Mol Ther. 16, S260. Grinstein, E., Du, Y., Santourlidis, S., Christ, J., Uhrberg, M., Wernet, P. (2007). Nucleolin regulates gene expression in CD34-positive hematopoietic cells. J Biol Chem. 282, 12439-49. Guggino, W. B., Stanton, B. A. (2006). New insights into cystic fibrosis: molecular switches that regulate CFTR. Nat Rev Mol Cell Biol. 7, 426-36. Hardman, R. (2006). A toxicologic review of quantum dots: toxicity depends on physicochemical and environmental factors. Environ Health Perspect. 114, 165-72. Harms, G., Kraft, R., Grelle, G., Volz, B., Dernedde, J., and Tauber, R. (2001). Identification of nucleolin as a new L-selectin ligand. Biochem J. 360(Pt 3), 531-8. Hirano, K., Miki, Y., Hirai, Y., Sato, R., Itoh, T., Hayashi, A., Yamanaka, M., Eda, S., and Beppu, M. (2005). A multifunctional shuttling protein nucleolin is a macrophage receptor for apoptotic cells. J Biol Chem. 280, 39284-39293. Hovanessian, A. G. (2006). Midkine, a cytokine that inhibits HIV infection by binding to the cell surface expressed nucleolin. Cell Res. 16, 174-81. Hovanessian, A. G., Puvion-Dutilleul, F., Nisole, S., Svab, J., Perret, E., Deng, J. S., and Krust, B. (2000). The cell-surface-expressed nucleolin is associated with the actin cytoskeleton. Exp Cell Res. 261, 312-328. Huang, Y., Shi, H., Zhou, H., Song, X., Yuan, S., and Luo, Y. (2006). The angiogenesis function of nucleolin is mediated by vascular endothelial growth factor and nonmuscle myosin. Blood. 107, 3564-3571. Ireson, C. R., Kelland, L. R. (2006). Discovery and development of anticancer aptamers. Mol Cancer Ther. 5, 2957-62. Iwabuchi, K., Yamamura, S., Prinetti, A., Handa, K., Hakomori, S. (1998). GM3- enriched microdomain involved in cell adhesion and signal transduction through carbohydrate-carbohydrate interaction in mouse melanoma B16 cells. J Biol Chem. 273, 9130-8. Izumi, R. E., Valdez, B., Banerjee, R., Srivastava, M., Dasgupta, A. (2001). Nucleolin stimulates viral internal ribosome entry site-mediated translation. Virus Res. 76, 17-29.
179 Jiang, Y., Xu, X. S., Russell, J. E. (2006). A nucleolin-binding 3' untranslated region element stabilizes beta-globin mRNA in vivo. Mol Cell Biol. 26, 2419-29. Joo, E. J., ten Dam, G. B., van Kuppevelt, T. H., Toida, T., Linhardt, R. J., and Kim, Y. S. (2005). Nucleolin: acharan sulfate-binding protein on the surface of cancer cells. Glycobiology. 15, 1-9. Kaldis, P. and Aleem, E. (2005). Cell cycle sibling rivalry: Cdc2 vs. Cdk2. Cell Cycle. 4, 1491-4. Karp, P. H., Moninger, T. O., Weber, S. P., Nesselhauf, T. S., Launspach, J. L., Zabner, J., Welsh, M. J. (2002) An in vitro model of differentiated human airway epithelia. Methods for establishing primary cultures. Methods Mol Biol, 188, 115-37. Kibbey, M. C., Johnson, B., Petryshyn, R., Jucker, M., and Kleinman, H. K. (1995). A 110-kD nuclear shuttling protein, nucleolin, binds to the neurite-promoting IKVAV site of laminin-1. J Neurosci Res. 42, 314-322. Kirkham, M., Parton, R. G. (2005). Clathrin-independent endocytosis: new insights into caveolae and non-caveolar lipid raft carriers. Biochim Biophys Acta. 1746, 349-63. Klink, D., Schindelhauer, D., Laner, A., Tucker, T., Bebok, Z., Schwiebert, E. M., Boyd, A. C., Scholte, B. J. (2004). Gene delivery systems--gene therapy vectors for cystic fibrosis. J Cyst Fibros. 2, 203-12. Konstan, M. W., Davis, P. B., Wagener, J. S., Hilliard, K. A., Stern, R. C., Milgram, L. J., Kowalczyk, T. H., Hyatt, S. L., Fink, T. L., Gedeon, C. R., et al. (2004). Compacted DNA nanoparticles administered to the nasal mucosa of cystic fibrosis subjects are safe and demonstrate partial to complete cystic fibrosis transmembrane regulator reconstitution. Hum Gene Ther. 15, 1255-1269. Krasinska, L., Cot, E,. and Fisher, D. (2008). Selective chemical inhibition as a tool to study Cdk1 and Cdk2 functions in the cell cycle. Cell Cycle. 15, 1702-8. Kumar, V., Farell, G., Deganello, S., and Lieske, J. C. (2003). Annexin II is present on renal epithelial cells and binds calcium oxalate monohydrate crystals. J Am Soc Nephrol. 14, 289-97. Kusumi, A., Ike, H., Nakada, C., Murase, K., Fujiwara, T. (2005). Single-molecule tracking of membrane molecules: plasma membrane compartmentalization and dynamic assembly of raft-philic signaling molecules. Semin Immunol. 17,3-21. Lajoie, P., Nabi, I. R. (2007). Regulation of raft-dependent endocytosis. J Cell Mol Med. 11, 644-653. Laude, A. J., Prior, I. A. (2004). Plasma membrane microdomains: organization, function and trafficking. Mol Membr Biol. 21, 193-205. Le Roy, C., Wrana, J. L. (2005). Clathrin- and non-clathrin-mediated endocytic regulation of cell signalling. Nat Rev Mol Cell Biol. 6, 112-26. Legrand, D., Vigie, K., Said, E. A., Elass, E., Masson, M., Slomianny, M. C., et al. (2004). Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells. Eur J Biochem, 271, 303-17.
180 Liberali, P., Rämö, P., Pelkmans, L. (2008). Protein kinases: starting a molecular systems view of endocytosis. Annu Rev Cell Dev Biol. 24, 501-23. Liu, G., Li, D., Pasumarthy, M. K., Kowalczyk, T. H., Gedeon, C. R., Hyatt, S. L., Payne, J. M., Miller, T. J., Brunovskis, P., Fink, T. L., et al. (2003). Nanoparticles of compacted DNA transfect postmitotic cells. J Biol Chem. 278, 32578-32586. Liu, G., Molas, M., Grossmann, G. A., Pasumarthy, M., Perales, J. C., Cooper, M. J., Hanson, R. W. (2001). Biological properties of poly-L-lysine-DNA complexes generated by cooperative binding of the polycation. J Biol Chem. 276, 34379-87. Ma, N., Matsunaga, S., Takata, H., Ono-Maniwa, R., Uchiyama, S., Fukui, K. (2007). Nucleolin functions in nucleolus formation and chromosome congression. J Cell Sci. 120, 2091-105. Mäkelä, A. R., Närvänen, A., Oker-Blom, C. (2008). Peptide-mediated interference with baculovirus transduction. J Biotechnol. 134, 20-32. Mall, M. A. (2008). Role of cilia, mucus, and airway surface liquid in mucociliary dysfunction: lessons from mouse models. J Aerosol Med Pulm Drug Deliv. 21, 13-24. Malumbres, M. and Barbacid M. (2001). To cycle or not to cycle: a critical decision in cancer. Nat Rev Cancer. 1, 222-31. Manes, T., Zheng, D. Q., Tognin, S., Woodard, A. S., Marchisio, P. C., and Languino, L.R. (2003). Alpha(v)beta3 integrin expression up-regulates cdc2, which modulates cell migration. J Cell Biol. 161, 817-26. Marsh, M., Helenius, A. (2006). Virus Entry: Open Sesame. Cell. 124, 729-740. Mayor, S., Pagano, R. E. (2007). Pathways of clathrin-independent endocytosis. Nat Rev Mol Cell Biol. 8, 603-12. Medina-Kauwe, L. K., Xie, J., Hamm-Alvarez, S. (2005). Intracellular trafficking of nonviral vectors. Gene Ther. 12, 1734-51. Meikrantz, W., Schlegel, R. (1996). Suppression of apoptosis by dominant negative mutants of cyclin-dependent protein kinases. J Biol Chem. 271, 10205-9. Mundy, D. I., Machleidt, T., Ying, Y. S., Anderson, R. G., Bloom, G. S. (2002). Dual control of caveolar membrane traffic by microtubules and the actin cytoskeleton. J Cell Sci. 115, 4327-39. Murray, J. W., Wolkoff, A. W. (2003). Roles of the cytoskeleton and motor proteins in endocytic sorting. Adv Drug Deliv Rev. 55, 1385-403. Nichols, B. (2003). Caveosomes and endocytosis of lipid rafts. J Cell Sci. 116, 4707-14. Nigg, E. A. (2001). Mitotic kinases as regulators of cell division and its checkpoints. Nat Rev Mol Cell Biol. 2, 21-32. Nisole, S., Krust, B., and Hovanessian, A. G. (2002). Anchorage of HIV on permissive cells leads to coaggregation of viral particles with surface nucleolin at membrane raft microdomains. Exp Cell Res. 276, 155-173. Nisole, S., Said, E. A., Mische, C., Prevost, M. C., Krust, B., Bouvet, P., Bianco A.,
181 Briand, J. P., and Hovanessian, A. G. (2002). The anti-HIV pentameric pseudopeptide HB-19 binds the C-terminal end of nucleolin and prevents anchorage of virus particles in the plasma membrane of target cells. J Biol Chem. 277, 20877-20886. Noone, P. G., Pue, C. A., Zhou, Z., Friedman, K. J., Wakeling, E. L., Ganeshananthan, M., Simon, R. H., Silverman, L. M., Knowles, M. R. (2000). Lung disease associated with the IVS8 5T allele of the CFTR gene. Am J Respir Crit Care Med. 162, 1919-24. Nühse, T., Yu, K., Salomon, A. (2007). Isolation of phosphopeptides by immobilized metal ion affinity chromatography. Curr Protoc Mol Biol. Chapter 18:Unit 18.13. Pagano, M. A., Bain, J., Kazimierczuk, Z., Sarno, S., Ruzzene, M., Di Maira, G., Elliott, M., Orzeszko, A., Cozza, G., Meggio, F., and Pinna, L. A. (2008). The selectivity of inhibitors of protein kinase CK2: an update. Biochem J. 415, 353-65. Persson, P. B., Skalweit, A., Mrowka, R., Thiele, B. J. (2003). Control of renin synthesis. Am J Physiol Regulatory Integrative Comp Physiol. 285, 491-497. Peter, M., Nakagawa, J., Dorée, M., Labbé, J. C., and Nigg, E. A. (1990). Identification of major nucleolar proteins as candidate mitotic substrates of cdc2 kinase. Cell. 60, 791-801. Pike, L. J. (2004). Lipid rafts: heterogeneity on the high seas. Biochem J. 378, 281-92. Rajagopalan, L. E., Westmark, C. J., Jarzembowski, J. A., Malter, J. S. (1998). hnRNP C increases amyloid precursor protein (APP) production by stabilizing APP mRNA. Nucleic Acids Res. 26, 3418-23. Ratjen, F. (2006). Restoring airway surface liquid in cystic fibrosis. N Engl J Med. 354, 291-3. Richards, D. P., Stathakis, C., Polakowski, R., Ahmadzadeh, H., Dovichi, N. J. (1999) Labeling effects on the isoelectric point of green fluorescent protein. J Chromatogr A, 853, 21-5. Richardson, R. T., Batova, I. N., Widgren, E. E., Zheng, L. X., Whitfield, M., Marzluff, W. F., and O'Rand, M. G. (2000). Characterization of the histone H1-binding protein, NASP, as a cell cycle-regulated somatic protein. J Biol Chem. 275, 30378-86. Riordan, J. R. (2008). CFTR function and prospects for therapy. Annu Rev Biochem. 77, 701-26. Robinson, C. M., Sinclair, J. F., Smith, M. J., and O'Brien, A. D. (2006). Shiga toxin of enterohemorrhagic Escherichia coli type O157:H7 promotes intestinal colonization. Proc Natl Acad Sci U S A. 103, 9667-72. Rodgers, W., Farris, D., Mishra, S. (2005). Merging complexes: properties of membrane raft assembly during lymphocyte signaling. Trends Immunol. 26, 97-103. Rosenecker, J., Huth, S., Rudolph, C. (2006). Gene therapy for cystic fibrosis lung disease: current status and future perspectives. Curr Opin Mol Ther. 8, 439-45. Rowe, S. M., Miller, S., Sorscher, E. J. Cystic fibrosis. (2005). N Engl J Med. 352, 1992-2001.
182 Said, E. A., Courty, J., Svab, J., Delbé, J., Krust, B., Hovanessian, A. G. (2005). Pleiotrophin inhibits HIV infection by binding the cell surface-expressed nucleolin. FEBS J. 272, 4646-59. Said, E. A., Krust, B., Nisole, S., Svab, J., Briand, J. P., and Hovanessian, A. G. (2002). The anti-HIV cytokine midkine binds the cell surface-expressed nucleolin as a low affinity receptor. J Biol Chem. 277, 37492-37502. Sakaguchi, M., Miyazaki, M., Takaishi, M., Sakaguchi, Y., Makino, E., Kataoka, N., et al. (2003). S100C/A11 is a key mediator of Ca2+-induced growth inhibition of human epidermal keratinocytes. J Cell Biol, 163, 825-35. Sarno, S., Ruzzene, M., Frascella, P., Pagano, M.A., Meggio, F., Zambon, A., Mazzorana, M., Di Maira, G., Lucchini, V., and Pinna, L. A. (2005). Development and exploitation of CK2 inhibitors. Mol Cell Biochem. 274, 69-76. Schneider, H. R., Mieskes, G., Issinger, O. G. (1989). Specific dephosphorylation by phosphatases 1 and 2A of a nuclear protein structurally and immunologically related to nucleolin. Possible influence on the regulation of rRNA synthesis. Eur J Biochem. 180, 449-55. Semenkovich CF, Ostlund RE Jr, Olson MO, Yang JW. (1990). A protein partially expressed on the surface of HepG2 cells that binds lipoproteins specifically is nucleolin. Biochemistry. 29, 9708-13. Shi, H., Huang, Y., Zhou, H., Song, X., Yuan, S., Fu, Y., and Luo, Y. (2007). Nucleolin is a receptor that mediates antiangiogenic and antitumor activity of endostatin. Blood. 110, 2899-906. Sieczkarski, S. B., Whittaker, G. R. (2002). Dissecting virus entry via endocytosis. J Gen Virol. 83, 1535-1545. Sinclair, J. F., Dean-Nystrom, E. A., O'Brien, A. D. (2006). The established intimin receptor Tir and the putative eucaryotic intimin receptors nucleolin and beta1 integrin localize at or near the site of enterohemorrhagic Escherichia coli O157:H7 adherence to enterocytes in vivo. Infect Immun. 74, 1255-65. Sinclair, J. F. and O'Brien, A. D. (2002). Cell surface-localized nucleolin is a eukaryotic receptor for the adhesin intimin-gamma of enterohemorrhagic Escherichia coli O157:H7. J Biol Chem. 277, 2876-85. Sinclair, J. F. and O'Brien, A. D. (2004). Intimin types alpha, beta, and gamma bind to nucleolin with equivalent affinity but lower avidity than to the translocated intimin receptor. J Biol Chem. 279, 33751-8. Singh, K., Laughlin, J., Kosinski, P. A., Covey, L. R. (2004). Nucleolin is a second component of the CD154 mRNA stability complex that regulates mRNA turnover in activated T cells. J Immunol. 173, 976-85. Sontag, J. M. and Sontag, E. (2006). Regulation of cell adhesion by PP2A and SV40 small tumor antigen: an important link to cell transformation. Cell Mol Life Sci. 63, 2979- 91. Sorokina, E. A. and Kleinman, J. G. (1999). Cloning and preliminary characterization
183 of a calcium-binding protein closely related to nucleolin on the apical surface of inner medullary collecting duct cells. J Biol Chem. 274, 27491-6. Sorokina, E. A., Wesson, J. A. and Kleinman, J. G. (2004). An acidic peptide sequence of nucleolin-related protein can mediate the attachment of calcium oxalate to renal tubule cells. J Am Soc Nephrol. 15, 2057-65. Srivastava, M., and Pollard, H. B. (1999). Molecular dissection of nucleolin's role in growth and cell proliferation: new insights. FASEB J. 13, 1911-1922. Stepanova, V., Lebedeva, T., Kuo, A., Yarovoi, S., Tkachuk, S., Zaitsev, S., Bdeir, K., Dumler, I., Marks, M. S., Parfyonova, Y., Tkachuk, V. A., Higazi, A. A., Cines, D. B. (2008). Nuclear translocation of urokinase-type plasminogen activator. Blood. 112, 100-10. Storck, S,. Shukla, M., Dimitrov, S., and Bouvet, P. (2007). Functions of the histone chaperone nucleolin in diseases. Subcell Biochem. 41, 125-44. Takagi, M., Absalon, M. J., McLure, K. G., Kastan, M. B. (2005). Regulation of p53 translation and induction after DNA damage by ribosomal protein L26 and nucleolin. Cell. 123, 49-63. Tate, A., Isotani, S., Bradley, M. J., Sikes, R. A., Davis, R., Chung, L. W., Edlund, M. (2006). Met-Independent Hepatocyte Growth Factor-mediated regulation of cell adhesion in human prostate cancer cells. BMC Cancer. 6, 197. Teng, Y., Girvan, A. C., Casson, L. K., Pierce, W. M Jr, Qian, M., Thomas, S. D., and Bates, P. J. (2007). AS1411 alters the localization of a complex containing protein arginine methyltransferase 5 and nucleolin. Cancer Res. 67, 10491-500. Tsou, J. H., Chang, K. Y., Wang, W. C., Tseng, J. T., Su, W. C., Hung, L. Y., Chang, W. C., Chen, B. K. (2008). Nucleolin regulates c-Jun/Sp1-dependent transcriptional activation of cPLA2alpha in phorbol ester-treated non-small cell lung cancer A549 cells. Nucleic Acids Res. 36, 217-27. Turck, N., Lefebvre, O., Gross, I., Gendry, P., Kedinger, M., Simon-Assmann, P., Launay, J. F. (2006). Effect of laminin-1 on intestinal cell differentiation involves inhibition of nuclear nucleolin. J Cell Physiol. 206, 545-55. Tuteja, R., Tuteja, N. (1998). Nucleolin: a multifunctional major nucleolar phosphoprotein. Crit Rev Biochem Mol Biol. 33, 407-36. Ugrinova, I., Monier, K., Ivaldi, C., Thiry, M., Storck, S., Mongelard, F., Bouvet, P. (2007). Inactivation of nucleolin leads to nucleolar disruption, cell cycle arrest and defects in centrosome duplication. BMC Mol Biol. 8, 66. Vassilev, L. T. (2006). Cell cycle synchronization at the G2/M phase border by reversible inhibition of CDK1. Cell Cycle. 5, 2555-6. Vassilev, L. T., Tovar, C., Chen, S., Knezevic, D., Zhao, X., Sun, H., Heimbrook, D. C., and Chen, L. (2006). Selective small-molecule inhibitor reveals critical mitotic functions of human CDK1. Proc Natl Acad Sci U S A. 103, 10660-5. de Verdugo, U. R., Selinka, H. C., Huber, M., Kramer, B., Kellermann, J.,
184 Hofschneider, P. H., Kandolf, R. (1995) Characterization of a 100-kilodalton binding protein for the six serotypes of coxsackie B viruses. J Virol, 69, 6751-7. Verkoelen, C. F. and Verhulst, A. (2007). Proposed mechanisms in renal tubular crystal retention. Kidney Int. 72, 13-8. Verma, I. M., Weitzman, M. D. (2005). Gene therapy: twenty-first century medicine. Annu Rev Biochem. 74, 711-38. Villacé. P., Marión, R. M., Ortín, J. (2004). The composition of Staufen-containing RNA granules from human cells indicates their role in the regulated transport and translation of messenger RNAs. Nucleic Acids Res. 32, 2411-20. Walsh, M., Tangney, M., O'Neill, M. J., Larkin, J. O., Soden, D. M., McKenna, S. L., et al. (2006). Evaluation of cellular uptake and gene transfer efficiency of pegylated poly-L-lysine compacted DNA: implications for cancer gene therapy. Mol Pharm, 3, 644- 53. White, A. F., Ponnazhagan, S. (2006). Airway epithelium directed gene therapy for cystic fibrosis. Med Chem. 2, 499-503. Yanagisawa, M., Nakamura, K., Taga, T. (2004). Roles of lipid rafts in integrin- dependent adhesion and gp130 signalling pathway in mouse embryonic neural precursor cells. Genes Cells. 9, 801-9. Yang, C., Maiguel, D. A., Carrier, F. (2002). Identification of nucleolin and nucleophosmin as genotoxic stress-responsive RNA-binding proteins. Nucleic Acids Res. 30, 2251-60 Yang, Z., Jakymiw, A., Wood, M. R., Eystathioy, T., Rubin, R.L., Fritzler, M.J., and Chan, E.K. (2004). GW182 is critical for the stability of GW bodies expressed during the cell cycle and cell proliferation. J Cell Sci. 117, 5567-78. Yurek, D. M., Fletcher-Turner, A., Cooper, M. J. (2005). Compacted DNA nanoparticles effectively transfect brain cells in vitro and in vivo. Mol Ther. 11, S253. Zhang, J., Tsaprailis, G., Bowden, G. T. (2008). Nucleolin stabilizes Bcl-X L messenger RNA in response to UVA irradiation. Cancer Res. 68, 1046-54. Zhang, Y., Bhatia, D., Xia, H., Castranova, V., Shi, X., & Chen, F. (2006). Nucleolin links to arsenic-induced stabilization of GADD45alpha mRNA. Nucleic Acids Res, 34, 485-95. Zheng, X., Zhang, Y., Chen, Y. Q., Castranova, V., Shi, X., Chen, F. (2005). Inhibition of NF-kappaB stabilizes gadd45alpha mRNA. Biochem Biophys Res Commun. 329, 95-9. Ziady, A. G., Davis, P. B., Konstan, M. W. (2003). Non-viral gene transfer therapy for cystic fibrosis. Expert Opin Biol Ther. 3, 449-58. Ziady, A. G., Ferkol, T., Dawson, D. V., Perlmutter, D. H., Davis, P. B. (1999). Chain length of the polylysine in receptor-targeted gene transfer complexes affects duration of reporter gene expression both in vitro and in vivo. J Biol Chem. 274, 4908-16. Ziady, A. G., Gedeon, C. R., Miller, T., Quan, W., Payne, J. M., Hyatt, S. L., Fink,
185 T. L., Muhammad, O., Oette, S., Kowalczyk, T., et al. (2003). Transfection of airway epithelium by stable PEGylated poly-L-lysine DNA nanoparticles in vivo. Mol Ther. 8, 936-947. Ziady, A. G., Gedeon, C. R., Muhammad, O., Stillwell, V., Oette, S. M., Fink, T. L., Quan, W., Kowalczyk, T. H., Hyatt, S. L., Payne, J., A. et al. (2003). Minimal toxicity of stabilized compacted DNA nanoparticles in the murine lung. Mol Ther. 8, 948-956.
186