Glycosylation Inhibition Reduces Cholesterol Accumulation in NPC1 Protein-Deficient Cells

Glycosylation inhibition reduces cholesterol accumulation in NPC1 protein-deficient cells

Jian Li1, Maika S. Deffieu1, Peter L. Lee1, Piyali Saha, and Suzanne R. Pfeffer2

Department of Biochemistry, Stanford University School of Medicine, Stanford, CA 94305-5307

Edited by Stuart A. Kornfeld, Washington University School of Medicine, St. Louis, MO, and approved October 28, 2015 (received for review October 16, 2015) Lysosomes are lined with a glycocalyx that protects the limiting In this paper, we have used two approaches to modify the gly- membrane from the action of degradative enzymes. We tested the cocalyx. Alteration of glycosylation decreases lysosomal cholesterol hypothesis that Niemann-Pick type C 1 (NPC1) protein aids the transfer levels in NPC1-deficient Chinese hamster ovary (CHO) and human of low density lipoprotein-derived cholesterol across this glycocalyx. A cells. These experiments support a model in which NPC1 protein prediction of this model is that cells will be less dependent upon NPC1 functions to help cholesterol traverse the glycocalyx that lines the if their glycocalyx is decreased in density. Lysosome cholesterol content interior of lysosome limiting membranes. was significantly lower after treatment of NPC1-deficient human fibroblasts with benzyl-2-acetamido-2-deoxy-α-D-galactopyrano- Results and Discussion side, an inhibitor of O-linked glycosylation. Direct biochemical LAMP1 and LAMP2 proteins represent the major glycoproteins measurement of cholesterol showed that lysosomes purified from of the lysosome membrane (12). These proteins are glycosylated NPC1-deficient fibroblasts contained at least 30% less cholesterol on both asparagine residues (N linked) and serine or threonine when O-linked glycosylation was blocked. As an independent residues (O linked), and their oligosaccharides contribute sig- means to modify protein glycosylation, we used Chinese hamster nificantly to the structure of the lysosomal glycocalyx (11). We ovary ldl-D cells defective in UDP-Gal/UDP-GalNAc 4-epimerase in sought to alter glycosylation to explore the role of the glycocalyx which N- and O-linked glycosylation can be controlled. CRISPR in lysosomal cholesterol export. Inhibition of total N-linked generated, NPC1-deficient ldl-D cells supplemented with galactose glycosylation using deoxymannojirimycin treatment was toxic for accumulated more cholesterol than those in which sugar addition cells that were also lacking NPC1 function. We thus used subtler was blocked. In the absence of galactose supplementation, NPC1- means to modify the glycocalyx and investigated the contribu- deficient ldl-D cells also transported more cholesterol from lyso- tions of O-linked glycans to glycocalyx function. somes to the endoplasmic reticulum, as monitored by an increase Mucin type, O-linked glycosylation is initiated by the attachment 14 in cholesteryl [ C]-oleate levels. These experiments support a of GalNAc to serine or threonine residues by one of 20 UDP- model in which NPC1 protein functions to transfer cholesterol past GalNAc-polypeptidyl N-acetylgalactosaminyl-transferase enzymes a lysosomal glycocalyx. to form the so-called Tn antigen; subsequent sugars are then at- tached, most commonly galactose or GlcNAc. These two core forms cholesterol | lysosomal glycoprotein | lysosomal storage disease | glycocalyx can be further modified by the addition of sugar units such as GlcNAc, galactose, fucose, and sialic acid (14). ow-density lipoprotein-derived cholesterol is delivered to cells We first used benzyl 2-acetamido-2-deoxy-α-D-galactopyranoside Lby receptor-mediated endocytosis and transport to lysosomes. (BADG), an analog of GalNAc-α-1-O-serine/threonine that acts Within lysosomes, cholesterol esters are hydrolyzed and cholesterol as a competitive inhibitor to O-glycan chain extension (15, 16). is exported to the cytoplasm for cellular use (1). Cholesterol export Because some cell lines accumulate cytotoxic, nonphysiological aryl- requires two lysosomal glycoproteins: NPC1 and NPC2 (2, 3). glycans after many days of BADG treatment (17), we used shorter Patients carrying homozygous mutations in either of these proteins incubations and monitored for LAMP1 level increases that can present with Niemann-Pick type C (NPC) disease, a neurological indicate this type of accumulation (16, 17). BADG treatment al- disorder that is associated with massive accumulation of unesteri- tered the glycosylation of LAMP1 protein but did not affect its fied cholesterol and glycosphingolipids in lysosomes (2–4). abundance, as monitored by immunoblot of NPC1-deficient, pri- NPC2 is a small, soluble, cholesterol binding protein that is mary human fibroblasts (Fig. 1A). CellProfiler software (18) was thought to pick up cholesterol both from lipoprotein lipase and from the abundant, intralumenal membranes present within ly- Significance sosomes (5, 6). NPC1 is a much larger glycoprotein that contains 13 transmembrane domains and three, relatively large, lumenally Plasma lipoproteins carrying cholesteryl esters are taken up by ’ oriented domains (2). NPC1 s first (N-terminal), luminal domain low density lipoprotein receptors and delivered to lysosomes, binds cholesterol directly (7, 8); the second domain can bind where cholesterol is released and then exported for cellular NPC2 in a cholesterol-dependent manner and has been pro- use. Although cholesterol can partition freely between mem- ’ posed to facilitate transfer of cholesterol from NPC2 onto NPC1 s branes, it does not freely partition out of lysosomes—Niemann- N-terminal domain (9). Pick type C 1 (NPC1) protein is required for cholesterol export. The requirement for NPC1 and NPC2 proteins for cholesterol We show here that the requirement for NPC1 is decreased in export from lysosomes is somewhat enigmatic because cholesterol cells containing lower levels of protein glycosylation. These data can generally partition freely into membrane bilayers (10). The support a model in which NPC1 protein helps transfer cholesterol limiting membrane of lysosomes is lined predominantly by densely past the glycocalyx barrier that lines the interior of lysosomes. packed, highly glycosylated, lysosomal membrane proteins; their oligosaccharides are thought to protect the phospholipid bilayer Author contributions: J.L., M.S.D., P.L.L., and S.R.P. designed research; J.L., M.S.D., P.L.L., from hydrolytic destruction (11, 12). This glycoprotein coat can be and P.S. performed research; P.L.L. contributed new reagents/analytic tools; J.L., M.S.D., visualized by electron microscopy and has an average thickness of P.L.L., and S.R.P. analyzed data; and S.R.P. wrote the paper. about 8 nm (13). It has been proposed that NPC1 is needed to help The authors declare no conflict of interest. cholesterol traverse this glycocalyx (8). A direct prediction of this This article is a PNAS Direct Submission. model is that decreasing the lysosomal glycocalyx density should 1J.L., M.S.D., and P.L.L. contributed equally to this work. make cells less dependent on NPC1 function. 2To whom correspondence should be addressed. Email: [email protected].

14876–14881 | PNAS | December 1, 2015 | vol. 112 | no. 48 www.pnas.org/cgi/doi/10.1073/pnas.1520490112 Downloaded by guest on September 24, 2021 Cholesterol-filled lysosomes characteristic of NPC-deficient human fibroblasts show decreased motility and a more perinuclear localization (20–22). We noted that in HeLa cells depleted of NPC1 protein using siRNA (Fig. 2), BADG treatment increased lysosome number. In addition, BADG led to a less perinuclear distribution of lysosome-related structures in these cells as well as in fibroblasts from patients deficient in NPC1 function (Fig. 2 B and C). The change in lysosome number is consistent with resto- ration of more physiological levels of lysosomal cholesterol. To verify our findings by an independent method, we made use of CHO ldl-D cells to control protein glycosylation. CHO ldl-D cells lack UDP-Gal/UDP-GalNAc 4-epimerase activity, and thus cannot synthesize normal amounts of UDP-galactose and UDP-N- acetylgalactosamine from the corresponding glucose precursors (23). Simple addition of galactose and GalNAc to the culture medium enables ldl-D cells to synthesize the UDP-sugar nucleotide precursors via salvage pathways and fully corrects all glycosylation defects (23). Note that this protocol will impact both N- and O-linked glycosylation, both of which rely on these sugar nucleotide precursors. For these experiments, cells were maintained in 8 μM galactose and 100 μM N-acetylgalactosamine, and galactose was either removed or readded for 3 d before analysis. To test the impact of the glycocalyx on NPC1 protein function, we used CRISPR technology to generate NPC1-deficient CHO ldl-D cells. Immunoblotting of cell extracts confirmed the absence of NPC1 protein in these cells, compared with the parental cell line (Fig. 3A). Changes in glycosylation were readily detected in immunoblots of membrane glycoproteins from ldl-D cells grown with or without 8 μM galactose (Fig. 3A). Both NPC1 and LAMP2 proteins showed increased mobility upon SDS/PAGE in cells cultured in the absence of galactose (Fig. 3A) but returned to that of control cells when cells were supplemented with 8 μM galactose (Fig. 3A). Note that as expected, LAMP2 levels increased in FBS-cultured cells lacking NPC1 (24); LAMP2 levels were lower in cells in which glycosylation was inhibited (0 μM gal), likely due to protein destabilization. Cholesterol accumulation was tracked in CHO ldl-D cells using PFO* staining and the differences in accumulation were first Fig. 1. NPC1-deficient human fibroblasts harbor less cholesterol upon BADG quantified by flow cytometry. As expected, cells lacking NPC1 ac- treatment. (A) Immunoblot of LAMP1 protein after BADG treatment (48 h). cumulated more cholesterol as monitored by PFO* staining; less (B) Filipin intensity over lysosomes quantified using CellProfiler. The results are was present in control CHO ldl-D cells supplemented with 0 μMor expressed as an average of the mean intensity per lysosome ± SEM. A total of 8 μM galactose. Moreover, decreasing the extent of glycosylation by 1,483 lysosomes in 36 cells or 1,663 lysosomes in 44 cells were quantified without removal of galactose led to a significant decrease in cholesterol or with BADG treatment (48 h), respectively; unpaired, two-tailed t test P value accumulation in NPC1-deficient CHO ldl-D cells (Fig. 3 B and C). CELL BIOLOGY <0.0001. (C) Cholesterol content of isolated lysosomes obtained from control or A slight decrease was also detected in wild-type ldl-D control cells BADG-treated (72 h), NPC1-deficient human fibroblasts; unpaired, two-tailed < starved of galactose, analyzed by flow cytometry; however, this trend t test P value 0.002. (D) Cholesterol content was monitored using flow was not adequately significant as the P value was 0.08 (Fig. 3B). cytometry of PFO*-stained cells treated 72 h in lipoprotein-deficient serum in the presence and absence of BADG. Error bars, SEM; n = 4experiments,>4,000 cells Again, the decrease in lysosomal cholesterol in NPC1-deficient per condition per experiment; unpaired, two-tailed t test P value <0.0001. cells did not appear to be due to a loss in LDL receptor activity because the experiment was carried out after three days of culture in LPDS. Nevertheless, we tested LDL receptor activity directly by monitoring the ability of CHO ldl-D wild-type and NPC1-deficient next used in conjunction with fluorescence microscopy to quantify ldl-D cells to endocytose bodipy-LDL, with or without 3 d galac- the amount of filipin staining within LAMP2-positive lysosomes. tose supplementation; ∼20,000 cells were analyzed by flow Upon BADG treatment, lysosome-specific filipin staining decreased cytometry for each condition. As shown in Fig. 3D,NPC1-deficient 44% (Fig. 1B). To confirm that the staining observed represented cells showed 13% less LDL uptake per cell when cultured in 0 μM cholesterol and not another potential filipin binding partner, we galactose compared with 8 μM galactose; wild-type cells also isolated a lysosome-enriched fraction from BADG-treated, NPC- showed a similar decrease. NPC1-deficient cells showed higher deficient human fibroblasts and measured the cholesterol content overall LDL receptor activity, as expected for cells deficient in directly using a cholesterol oxidase-based assay. Treatment of cells cholesterol transport from lysosomes to the endoplasmic reticulum with BADG decreased cholesterol in isolated lysosomes (Fig. 1C), (ER) (23). This minor decrease in LDL uptake under glycosylation-deficient conditions is unlikely to explain the significantly re- consistent with the findings obtained using filipin staining. Finally, duced cholesterol storage observed. the differences observed did not appear to be due to minor dif- Cholesterol accumulation in CHO ldl-D cells was also moni- ferences in LDL receptor function, because similar decreases were tored by light microscopy. As expected, PFO*-stained control cells observed for cells cultured in lipoprotein deficient serum (LPDS) displayed a punctate lysosomal staining pattern; NPC1-deficient for a 3-d period, as monitored by staining with fluorescent per- cells showed significantly increased cholesterol content (Fig. 4A). fringolysin O* (PFO*) that binds to free cholesterol (19) (Fig. 1D). Consistent with our earlier findings, quantitation of PFO* staining

Li et al. PNAS | December 1, 2015 | vol. 112 | no. 48 | 14877 Downloaded by guest on September 24, 2021 ldl-D cells containing a less elaborate glycocalyx, we tested the ability of these cells to transfer LDL-derived cholesterol to the ER, as monitored by its availability for esterification by ER- localized ACAT. Cells grown for 3 d in LPDS were pulsed with LDL under conditions of cholesterol synthesis inhibition. As expected, NPC1- deficient CHO ldl-D cells grown in the presence of 8 μMgalactose showed only ∼5% the level of cholesteryl [14C]-oleate production detected in wild-type CHO ldl-D cells cultured under similar conditions (Fig. 5). Remarkably, omission of galactose from the NPC1-deficient ldl-D cell cultures led to an approximately four- fold increase in cholesteryl ester formation due to cholesterol export from lysosomes to the ER (Fig. 5). This increase was seen despite a 13% decrease in LDL receptor activity, compared with NPC1-deficient cells grown in the presence of galactose (Fig. 3D). Absence of NPC1 activity was still evident and consistent with the cholesterol accumulation still detected under these conditions (Fig. 4). In summary, we have shown here that altering the glycosylation of cellular glycoproteins influences the levels of cholesterol detected in lysosomes and its ability to be transported to the ER. Cells were less dependent on NPC1 function when glycosylation was modified by inhibition of O-GalNAc elongation or in the absence of UDP-Gal/UDP-GalNAc 4-epimerase activity. Lysosomes are lined by a glycocalyx that seems to impede the spontaneous partitioning of cholesterol into the limiting membrane (11–13). The major glycoproteins that comprise the lysosome limiting membrane are highly glycosylated, and oligosaccharides on lysosomal glycoproteins contribute to their overall stability in cells. Our data suggest that altering the structure of this carbohydrate barrier facilitates the access of cholesterol to the membrane for export. Access could facilitate spontaneous transfer of cholesterol into the bilayer, or permit NPC2 protein to mediate direct delivery to lysosomal membranes. At this stage, we cannot completely rule out other possible explanations for our findings. For example, Sugii et al. (27) showed that in NPC1 cells, acid lipase begins to act on LDL-derived cholesteryl esters in prelysosomal compartments. Perhaps conditions used here to thin the glycocalyx increase cholesteryl ester Fig. 2. BADG treatment increases lysosome number in NPC1-depleted HeLa hydrolysis, permitting cholesterol to escape from compartments or NPC1-deficient human patient fibroblasts. Quantification of LAMP1 earlier in the endocytic pathway. Although formally possible, we staining in NPC1-depleted HeLa cells (A) or NPC1-deficient human fibroblasts consider this unlikely to explain much of the data presented here. In (B and C). Lysosome number is presented as the mean number of lysosomes most experiments, cells were cultured without LDL for 3 d, and the per cell ± SEM. In A, 29 cells were counted ± BADG, respectively; unpaired, glycocalyx could only be slowly thinned due to the very slow turnover two-tailed t test P value <0.0001. (B and C) Micrographs of NPC1-deficient ± of fully glycosylated lysosomal glycoproteins present at the start. human patient fibroblasts stained with anti-LAMP1 antibody, BADG as Indeed, experiments monitoring the rate of glycosylation change of indicated. (Scale bar, 20 μm.) LAMP proteins showed that 3 d of culture was absolutely required to see complete glycosylation differences. Thus, the cholesterol in cells visualized on coverslips confirmed that NPC1-deficient changes monitored reflect cholesterol that had been endocytosed for — cells accumulated more cholesterol upon culture in 8 μMversus at least 24 h much more than enough time to reach the lysosome. 0 μM galactose (Fig. 4 A and B); the levels of both were higher Another possibility is that under-glycosylation of an unknown than those seen in the parental CHO ldl-D cells. No large dif- lysosomal cholesterol transporter could enhance its activity. Note ference was detected between control cells cultured ± galactose; that such a hypothetical transporter would be inactive under conditions of normal glycosylation, or we (and others, refs. 25, 26) would however, it should be noted that the intensity of wild-type cell have detected more cholesterol export to the ER in NPC1-deficient staining is at the lower limit of our range of sensitivity and many cells. Changes in the levels of sugar nucleotide glycosylation pre- fewer cells were analyzed than in the flow cytometry experiments cursors could influence metabolism such that cells activate lysosome presented in Fig. 3. Finally, analysis of the PFO*-labeled area biogenesis. However, in the parental CHO ldl-D cells, we did not revealed that NPC1-deficient CHO ldl-D cells contained smaller detect increases in the levels of LAMP2 or NPC1 proteins upon puncta (lysosomes) after culture in the absence of galactose, removal of galactose, inconsistent with this possibility. Finally, consistent with their decreased cholesterol content and apparently changes in the distribution or increased number of lysosomes may healthier physiological state (Fig. 4C). have in some way facilitated cholesterol export. Cholesterol is exported from lysosomes to the ER, where it is Kundra and Kornfeld (28) removed Asn-linked oligosaccha- esterified by acyl CoA: O-cholesterol acyltransferase (ACAT). LDL rides from lysosomal membrane glycoproteins and found that added to NPC1 mutant cells fails to increase ACAT-mediated Asn-linked glycans protect LAMP proteins from the action of cholesterol ester synthesis; cyclodextrin can overcome this block and proteases; they also found that LAMP1 and LAMP2 are not permit cholesterol export to the ER (25, 26). To show directly that required for maintaining the acidic pH, density, membrane stabil- lysosomal cholesterol export is improved in NPC1-deficient ity, or degradative capacity of lysosomes (28). Similar findings were

14878 | www.pnas.org/cgi/doi/10.1073/pnas.1520490112 Li et al. Downloaded by guest on September 24, 2021 obtained upon analysis of LAMP1/LAMP2 double-deficient fibroblasts (29). Lysosomes in double-deficient cells also accumulated significant amounts of lipid. Because of this abnor- mality, such cells could not be used to test the influence of LAMP1/2-specific oligosaccharides on NPC1 protein function. Why LAMP1/2-deficient cells lose their ability to support autophagy and also accumulate lipid represent important areas for future investigation. Growth of CHO ldl-D cells in the absence of galactose decreased LAMP2 levels and cholesterol accumulation. Because LAMP2 contributes significant glycan to the glycocalyx, these data are consistent with LAMP2 contributing to lysosomal cholesterol storage under these conditions. Although LAMP1 levels did not decrease in BADG-treated cells, these cells nevertheless showed decreased cholesterol accumulation coupled with LAMP1 under-glycosylation. N-butyl-deoxynojirimycin (miglustat) is an iminosugar analog of glucose and is thought to inhibit glucosylceramide synthase that catalyzes the formation of glucosylceramide, the first step in glycosphingolipid biosynthesis. N-butyl-deoxynojirimycin has shown promise in stabilizing patients deficient in NPC1 protein function (4) and is thought to do so by decreasing glycosphingolipid accumulation in lysosomes. Another minor possibility is that the iminosugar may influence glycocalyx structure, thereby enhancing cholesterol export, albeit to a small extent. It will be of interest to monitor potential changes in the lysosomal glycocalyx upon miglustat treatment. In summary, these data suggest that glycosylation inhibitors may be of therapeutic value in patients deficient in NPC1 function. Future challenges include determining the mechanism by which cholesterol departs lysosomes after tra- versing the glycocalyx barrier and developing tools to specifically regulate lysosomal glycosylation. Experimental Procedures PFO* Purification. PFO* plasmid, kindly provided by Arun Radhakrishnan (Uni- versity of Texas Southwestern, Dallas), was used to purify PFO* (19). In brief, expression was induced in Rosetta 2 cells with 1 mM isopropyl β-p-thio- galactopyranside for 4 h at 37 °C. Cells were suspended in buffer A [PBS, 10% (vol/vol) glycerol, protease inhibitors] and disrupted by Emulsiflex C-5 (Avestin). Clarified lysate was incubated with Ni-NTA (McLab) for 1 h at 4 °C and after washing with buffer A + 50 mM imidazole was eluted with buffer A + 300 mM imidazole. The eluate was concentrated with an Amicon Ultra 10-kDa cutoff centrifugal filter (Millipore), exchanged into buffer A + 1 mm EDTA, and stored at 4 °C. PFO* was directly conjugated to NHS ester Alexa Fluor 647 dye as per the manufacturer (Life Technologies). CELL BIOLOGY

Cell Culture. Wild-type “AG10803” fibroblasts and “GM30123” P237S/I1061T NPC1-deficient human fibroblasts were from Coriell Cell Repositories; CHO ldl-D cells (24) were from Bill Balch (The Scripps Research Institute, San Diego). NPC1 knockout CHO ldl-D clones were generated using CRISPR to the target sequence GGCCTTCTCATTACTTGCAGGGG in exon 4 found using CRISPy (30). Guide sequence cloned into PX458 was transfected into CHO ldl-D cells using FuGene 6 (Promega). Single cells positively transfected and expressing GFP were sorted by flow cytometry and after amplification were validated by immunoblot. HeLa cells were depleted of NPC1 using siRNA from Dharmacon at 50 nM for 72 h with N-Ter Nanoparticle siRNA trans- fection reagent (Sigma-Aldrich). Cell monolayers were maintained in DMEM or MEM α supplemented with 7.5% (vol/vol) FBS, 100 units/mL penicillin,

100 units/mL streptomycin in 5% CO2 at 37 °C.

Immunofluorescence. Cells grown on coverslips were fixed with 3.7% (vol/vol) paraformaldehyde for 15 min at room temperature. [For PFO* labeling, they

Fig. 3. Increased O-linked glycosylation leads to increased cholesterol accumula- − − tion in NPC1 / CHO ldl-D cells. (A) Immunoblot of NPC1 and LAMP2 proteins in cytometry per condition per experiment, error bars = SEM, n = 6pooledex- CHO ldl-D cells supplemented with 100 μM N-acetyl-galactosamine, ± galactose. periments, unpaired t test P values between each condition <0.01 except for CHO ldl-D cells in which the NPC1 gene was disrupted using CRISPR are that between 0 and 8 μM galactose in the wild-type population. (C)Repre- shown in the right three lanes. The mobility of molecular weight markers is sentative flow cytometry analysis as described in B.(D) LDL receptor activity indicated at right in kilodaltons. Samples were from cells cultured in 10% monitored by endocytosis of BODIPY-LDL (10 μg/mL; Life Technologies) for (vol/vol) FBS or 5% (vol/vol) lipoprotein-deficient serum and the indicated 45 min followed by fixation and flow cytometry. Shown are mean fluores- amounts of supplemental galactose for 72 h. (B) Mean PFO* staining from cence values, ∼19,000 cells per sample; shown is a representative example of CHO ldl-D cells ± 8 μM galactose. Over 4,000 cells were analyzed by flow an experiment carried out in duplicate.

Li et al. PNAS | December 1, 2015 | vol. 112 | no. 48 | 14879 Downloaded by guest on September 24, 2021 Fig. 4. PFO* stained objects are brighter and larger in NPC1−/− CHO ldl-D cells in the presence of galactose. (A) Representative images of CHO ldl-D cells stained with PFO* under the indicated conditions. Images of wild-type cells (Top row) have been lev- eled five times brighter than they would appear − − compared with NPC1 / cell levels. (Scale bar, 15 μm.) (B) Mean values of total intensity of PFO* objects per cell quantified using CellProfiler. (C) Mean values of the area of PFO* stained objects per cell in square micrometers as quantified by CellProfiler. Error bars, SEM. From Left to Right, 10, 9, 50, and 54 cells were analyzed with an average of more than 70 objects/ cell/condition quantified. NPC1−/− populations were statistically different between themselves and compared with other populations with unpaired, two- tailed t test P values <0.001.

were permeabilized 4 min with 0.1% Triton X-100 + buffer B [PBS, 1% (vol/vol) objects were segmented based on Topro-3 or DAPI staining using a “mixture BSA] and incubated in buffer B for an additional 60 min.] Cells were then of Gaussian” method or Otsu thresholding, respectively; lysosomal objects stained with either 50 μg/mL filipin complex (Sigma) for 45 min or 8 μg/mL were segmented based on LAMP1 or PFO* staining using Otsu thresholding; PFO* for 45 min. LAMP1 staining was performed with sequential incubation of cell objects were segmented using distance – B on previously detected nu- rabbit anti-LAMP1 antibody (1:1,000, Cell Signaling) and an Alexa Fluor 555 clear objects. The mean background filipin intensity, measured from the goat anti-rabbit antibody (1:1,000, Invitrogen), each for 1 h in buffer B at room cholesterol excluding nuclear objects, was subtracted from total filipin in- temperature. In filipin stained cells, nuclei were labeled with Topro-3 stain tensity values. The mean filipin intensity across lysosome objects, lysosomal size, total PFO* intensity in PFO* objects, and PFO* object size was measured (1:1,000, Invitrogen) in PBS for 15 min. Coverslips were mounted using Mowiol and the mean of these is presented ± SEM. or Vectashield with DAPI (Vector Laboratories) and imaged using a Leica SP2 confocal microscope and Leica software (for filipin-stained cells) or an Olympus Cell Sorting. All steps were at room temperature. Cells were trypsinized and IX70 microscope with a 60× 1.4 N.A. Plan Apochromat oil immersion lens fixed as described above. Cells in PBS were then analyzed using a BD Bio- (Olympus) and a charge-coupled device camera (CoolSNAP HQ, Photometrics). science LSRII UV flow cytometer (filipin) or FACScan Analyzer (PFO*). Maximum intensity projections were generated using softWoRx 4.1.0 software (Applied Precision) for PFO* stained cells. Immunoblot Analysis. Antibody binding was performed using 1 μg/mL rabbit anti- LAMP1, ∼1 μg/mL rabbit anti-NPC1 (Novus Biologicals), and mouse anti-CHO Cholesterol Accumulation Quantification by Microscopy. Images were acquired LAMP2 antibody culture supernatant (1B35, from Ira Mellman, Genentech, South as described above. Quantification of cholesterol accumulation, indicated by San Francisco, CA). Bound antibodies were visualized using chemiluminescence filipin or PFO* staining, was done using CellProfiler (18). In brief, nuclear (ECL Pierce Thermo Scientific or ECL Plus Amersham Bioscience) using a dilution of 1:4,000 anti-rabbit or anti-mouse IgG conjugated to horseradish peroxidase (Bio-Rad).

Determination of Cholesterol in Purified Lysosomes. NPC1-deficient human fibroblasts were treated with DMSO or 3 mM BADG for 72 h. Cells were swollen in 10 mM Hepes, pH 7.4 for 10 min and broken by resuspension in 10 mM Hepes,

pH 7.4, 150 mM NaCl, 1 mM ATP, 4 mM MgCl2, 1 mM EDTA, plus protease inhibitors followed by passage through a 22-gauge needle. Nuclei and unbroken cells were removed by centrifugation at 3,000 × g for 5 min. The supernatant was centrifuged in a Beckman TLA100.2 rotor for 15 min at 95,000 rpm; the pellet was resuspended in 10 mM Hepes, 2 M sucrose, pH 7.4, and layered onto a discontinuous sucrose gradient containing 500 μL2M, 750 μL 1.7 M, and 700 μL 0.5 M sucrose. Gradients were centrifuged in a TLS55 rotor for 1 h at 50,000 rpm; membranes at the 0.5 M and 1.7 M sucrose interface were collected as lysosomes. Total cholesterol content − − Fig. 5. Decreased glycosylation in NPC1 / CHO ldl-D cells increases cho- was determined using an Amplex Red Cholesterol Assay Kit (Invitrogen) lesterol transport from lysosomes to the ER. ACAT-catalyzed formation of according to the manufacturer and is reported per microgram of protein, + + cholesteryl [14C]oleate was measured ± galactose for NPC1 / (Left two bars) determined using Advanced protein assay reagent (Cytoskeleton). − − and NPC1 / CHO ldl-D cells (Right two bars) as indicated. Data shown were − − combined from two independent experiments carried out in duplicate; error Cholesterol Ester Formation. Wild-type and NPC1 / CHO ldl-D cells were bars, SEM. P value (0.0025) was determined by unpaired, two-tailed t test. cultured in MEM alpha (Gibco) with 7.5% (vol/vol) FBS and 100 μM

14880 | www.pnas.org/cgi/doi/10.1073/pnas.1520490112 Li et al. Downloaded by guest on September 24, 2021 N-acetyl-galactosamine ± 8 μM galactose (8 × 104 cells/60-mm dish). After 24 h, of lipid standard containing 8 μg/mL triolein, 8 μg/mL oleic acid, and 8 μg/mL cells were switched to the same medium with 5% (vol/vol) LPDS and assayed as cholesteryl oleate was added. Samples were spotted onto a silica gel 60 plastic described (31) with minor modification. After 72 h, 100 μg/mL LDL, 50 μM backed, thin layer chromatogram and developed in hexane. Cholesteryl oleate was lovastatin, and 50 μM sodium mevalonate were added for 5 h. Cells were pulse identified with iodine vapor, scraped from chromatograms, and radioactivity de- labeled for 4 h with 0.1 mM sodium [1-14C]oleate (American Radiolabeled termined by scintillation counting in 10 mL Biosafe II. Chemicals)–albumin complex. Cells were washed two times with 2 mL 50 mM Tris, 150 mM NaCl, 2 mg/mL BSA, pH 7.4, followed by 2 mL 50 mM Tris, 150 mM ACKNOWLEDGMENTS. This research was funded by grants from the Ara NaCl, pH 7.4. Cells were extracted and rinsed with hexane-isopropanol (3:2), Parseghian Medical Research Foundation and the National Institutes of pooled, and evaporated. After resuspending each sample in 60 μl hexane, 4 μL Health (DK37332).

1. Brown MS, Goldstein JL (1986) A receptor-mediated pathway for cholesterol ho- 17. Leteurtre E, et al. (2003) Induction of a storage phenotype and abnormal intracellular meostasis. Science 232(4746):34–47. localization of apical glycoproteins are two independent responses to GalNAcalpha-O-bn. 2. Carstea ED, et al. (1997) Niemann-Pick C1 disease gene: Homology to mediators of J Histochem Cytochem 51(3):349–361. cholesterol homeostasis. Science 277(5323):228–231. 18. Carpenter AE, et al. (2006) CellProfiler: Image analysis software for identifying and 3. Naureckiene S, et al. (2000) Identification of HE1 as the second gene of Niemann-Pick quantifying cell phenotypes. Genome Biol 7(10):R100. C disease. Science 290(5500):2298–2301. 19. Das A, Goldstein JL, Anderson DD, Brown MS, Radhakrishnan A (2013) Use of mutant 4. Rosenbaum AI, Maxfield FR (2011) Niemann-Pick type C disease: Molecular mecha- 125I-perfringolysin O to probe transport and organization of cholesterol in mem- nisms and potential therapeutic approaches. J Neurochem 116(5):789–795. branes of animal cells. Proc Natl Acad Sci USA 110(26):10580–10585. 5. Friedland N, Liou HL, Lobel P, Stock AM (2003) Structure of a cholesterol-binding 20. Ko DC, Gordon MD, Jin JY, Scott MP (2001) Dynamic movements of organelles con- protein deficient in Niemann-Pick type C2 disease. Proc Natl Acad Sci USA 100(5): taining Niemann-Pick C1 protein: NPC1 involvement in late endocytic events. Mol Biol 2512–2517. Cell 12(3):601–614. 6. Xu S, Benoff B, Liou H-L, Lobel P, Stock AM (2007) Structural basis of sterol binding by 21. Zhang M, et al. (2001) Cessation of rapid late endosomal tubulovesicular trafficking in NPC2, a lysosomal protein deficient in Niemann-Pick type C2 disease. J Biol Chem Niemann-Pick type C1 disease. Proc Natl Acad Sci USA 98(8):4466–4471. 282(32):23525–23531. 22. Lebrand C, et al. (2002) Late endosome motility depends on lipids via the small 7. Infante RE, et al. (2008) Purified NPC1 protein: II. Localization of sterol binding to a GTPase Rab7. EMBO J 21(6):1289–1300. 240-amino acid soluble luminal loop. J Biol Chem 283(2):1064–1075. 23. Kingsley DM, Kozarsky KF, Hobbie L, Krieger M (1986) Reversible defects in O-linked 8. Kwon HJ, et al. (2009) Structure of N-terminal domain of NPC1 reveals distinct sub- glycosylation and LDL receptor expression in a UDP-Gal/UDP-GalNAc 4-epimerase domains for binding and transfer of cholesterol. Cell 137(7):1213–1224. deficient mutant. Cell 44(5):749–759. 9. Deffieu MS, Pfeffer SR (2011) Niemann-Pick type C 1 function requires lumenal do- 24. Reddy JV, Ganley IG, Pfeffer SR (2006) Clues to neuro-degeneration in Niemann-Pick main residues that mediate cholesterol-dependent NPC2 binding. Proc Natl Acad Sci type C disease from global gene expression profiling. PLoS One 1:e19. USA 108(47):18932–18936. 25. Abi-Mosleh L, Infante RE, Radhakrishnan A, Goldstein JL, Brown MS (2009) Cyclo- 10. Maxfield FR, van Meer G (2010) Cholesterol, the central lipid of mammalian cells. Curr dextrin overcomes deficient lysosome-to-endoplasmic reticulum transport of choles- Opin Cell Biol 22(4):422–429. terol in Niemann-Pick type C cells. Proc Natl Acad Sci USA 106(46):19316–19321. 11. Wilke S, Krausze J, Büssow K (2012) Crystal structure of the conserved domain of the 26. Rosenbaum AI, Zhang G, Warren JD, Maxfield FR (2010) Endocytosis of beta- DC lysosomal associated membrane protein: Implications for the lysosomal glycocalyx. cyclodextrins is responsible for cholesterol reduction in Niemann-Pick type C mutant BMC Biol 10:62. cells. Proc Natl Acad Sci USA 107(12):5477–5482. 12. Schwake M, Schröder B, Saftig P (2013) Lysosomal membrane proteins and their 27. Sugii S, Reid PC, Ohgami N, Du H, Chang TY (2003) Distinct endosomal compartments central role in physiology. Traffic 14(7):739–748. in early trafficking of low density lipoprotein-derived cholesterol. J Biol Chem 13. Neiss WF (1984) A coat of glycoconjugates on the inner surface of the lysosomal 278(29):27180–27189. membrane in the rat kidney. Histochemistry 80(6):603–608. 28. Kundra R, Kornfeld S (1999) Asparagine-linked oligosaccharides protect Lamp-1 and 14. Schjoldager KT, Clausen H (2012) Site-specific protein O-glycosylation modulates pro- Lamp-2 from intracellular proteolysis. J Biol Chem 274(43):31039–31046. protein processing - deciphering specific functions of the large polypeptide GalNAc- 29. Eskelinen EL, et al. (2004) Disturbed cholesterol traffic but normal proteolytic func- transferase gene family. Biochim Biophys Acta 1820:2079–2094. tion in LAMP-1/LAMP-2 double-deficient fibroblasts. Mol Biol Cell 15(7):3132–3145. 15. Huet G, et al. (2003) Involvement of glycosylation in the intracellular trafficking of 30. Ronda C, et al. (2014) Accelerating genome editing in CHO cells using CRISPR Cas9 and glycoproteins in polarized epithelial cells. Biochimie 85(3-4):323–330. CRISPy, a web-based target finding tool. Biotechnol Bioeng 111(8):1604–1616. 16. Patsos G, et al. (2009) O-glycan inhibitors generate aryl-glycans, induce apoptosis and 31. Goldstein JL, Basu SK, Brown MS (1983) Receptor-mediated endocytosis of low- lead to growth inhibition in colorectal cancer cell lines. Glycobiology 19(4):382–398. density lipoprotein in cultured cells. Methods Enzymol 98:241–260. CELL BIOLOGY

Li et al. PNAS | December 1, 2015 | vol. 112 | no. 48 | 14881 Downloaded by guest on September 24, 2021