Dysregulated Expression of Mitotic Regulators Is Associated with B-Cell Lymphomagenesis in HOX11-Transgenic Mice

Oncogene (2006) 25, 2575–2587 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE Dysregulated expression of mitotic regulators is associated with B-cell lymphomagenesis in HOX11-transgenic mice

EChen1,2, MS Lim3, S Rosic-Kablar2, J Liu2,4, P Jolicoeur5, ID Dube´ 1,2,6 and MR Hough1,2,6

1Institute of Medical Science, University of Toronto, Toronto, Ontario, Canada; 2Department of Molecular and Cellular Biology, Sunnybrook and Women’s College Health Sciences Centre, Toronto, Ontario, Canada; 3Department of Pathology, University of Utah, Salt Lake City, UT, USA; 4Department of Medical Biophysics, University of Toronto, Toronto, Ontario, Canada; 5Clinical Research Institute of Montre´al, McGill University, Montre´al, Quebec, Canada and 6Department of Laboratory Medicine & Pathobiology, University of Toronto, Toronto, Ontario, Canada

Dysregulated expression of the homeobox gene, HOX11 Keywords: HOX11; homeobox; aneuploidy; insertional is a frequent etiologic event in T-cell acute lymphoblastic mutagenesis leukemias. HOX11-transgenic mice (IgHl-HOX11Tg)- expressing HOX11 in the B-cell compartment develop B-cell lymphomas with extended latency. The latency Introduction suggests that additional genetic events are required prior to the onset of malignant lymphoma. We report the Dysregulated expression of the orphan homeobox gene, identification of 17 HOX11 collaborating genes, revealed HOX11 is a frequent etiologic event in pediatric T-cell through their propensity to be targeted in a proviral acute lymphoblastic leukemias (T-ALLs). Aberrant acti- insertional mutagenesis screen. Seven integrations dis- vation of HOX11 can be achieved by a t(10;14)(q24;q11) rupted genes in mitotic spindle checkpoint control, chromosome rearrangement, juxtaposing the HOX11 suggesting that cells with elevated HOX11 expression gene downstream of the T-cell receptor (TCR) a/d are especially sensitive to dysregulation of chromo- regulatory elements (Dube´ et al., 1986, 1991). While the some segregation during mitosis. IgHl-HOX11Tg primary t(10;14) translocation is seen in only 4–7% of reported B-lymphocyte cultures exposed to the aneugenic agents, T-ALL cases, a recent study revealed elevated HOX11 colchicine and colcemid, exhibited increased incidences of expression levels in leukemic blasts in B50% (37/76) of chromosome missegregation as assessed by cytokinesis- pediatric T-ALL cases (Kees et al., 2003). Moreover, block micronucleus assays. Additionally, IgHl-HOX11Tg an additional 30% of pediatric T-ALLs exhibited cultures were shown to exhibit aberrant bypass of spindle inappropriate activation of the related HOX11 gene, checkpoint arrest, as assessed by the increased presence of HOX11L2 (Mauvieux et al., 2002). Clinically, patients cycling cells determined by assessment of DNA content with HOX11-positive lymphoblasts have a better prog- and by BrdU immunolabelling. Western immunoblotting nosis when treated with modern combination chemother- revealed elevated expression of the mitotic effector mole- apy than patients with T-ALLs involving activation of cules, cyclin A, cyclin B1 and cdc20 in IgHl-HOX11Tg HOX11L2 (Ferrando et al., 2002, 2004). The incidence of cultures. Moreover, spontaneously arising lymphoid HOX11-positive lymphomas correlates with increasing neoplasms in IgHl-HOX11Tg mice frequently exhibit age, indicating a longer latency for disease manifestation aberrant expression of mitotic regulators, concomitant and suggesting the requirement of additional genetic with increased development of micronuclei, abnormal events prior to malignancy (Asnafi et al., 2004). mitotic checkpoint control and increased incidences of Early attempts at generating clinically relevant mouse abnormal karyotypes when expanded in culture. Collec- models of HOX11-related disease by using the Lck tively, these findings indicate that abnormal regulation of proximal promoter to drive expression of HOX11 spindle checkpoint control as a result of HOX11 over- during early stages of thymocyte development were expression leads to a heightened predisposition for unsuccessful and resulted in embryonic lethality. The development of aneuploidy, contributing to oncogenesis. first in vivo model of HOX11-associated lymphoma- Oncogene (2006) 25, 2575–2587. doi:10.1038/sj.onc.1209285; genesis was generated by ectopically expressing HOX11 published online 9 January 2006 in the B-cell compartment by placing the transgene under the control of the immunoglobulin heavy chain (IgH) promoter and enhancer sequences. Within 2 years, Correspondence: Dr M Hough, Department of Molecular and Cellular HOX11-transgenic mice (IgHm-HOX11Tg) developed Biology, Sunnybrook and Women’s College Health Sciences Centre, mature marginal zone B-cell lymphomas, originating 2075 Bayview Avenue, Room S232, Toronto, Ontario, Canada M4N in the spleen with frequent dissemination of lympho- 3M5. E-mail: [email protected] matous tissue to distant sites, including the thymus, Received 29 June 2005; revised 22 September 2005; accepted 26 October lymph nodes, lungs and kidneys (Hough et al., 1998). 2005; published online 9 January 2006 These mice represented a relevant model of B-lymphoma Dysregulated expression of mitotic regulators E Chen et al 2576 disease progression in which to develop immuno- zone B-cell malignancies with extended latency (Hough therapies (Rosic-Kablar et al., 2000). Moreover, the et al., 1998), indicating the necessity of additional extended latency prior to the development of lymphoma genetic lesions to cooperate with HOX11 in the onco- indicated that additional genetic events were necessary genic process. Attempts to accelerate B-cell lymphoma prior to the onset of malignancy, and therefore, these in these mice by infection of neonates with the mice represented a powerful system in which to identify Moloney murine leukemia virus (MMLV) were unsuc- genetic pathways underlying the pathogenesis of cessful, as all mice injected with the virus developed HOX11-mediated lymphomagenesis. T-cell lymphomas at B3 months postinjection, with Retroviral insertional mutagenesis in mice is a no effects on the B-cell compartment (Thy1 þ popu- powerful approach for the identification of genes that lation in spleen: 68.9% in wild type versus 67.9% in participate in tumorigenesis. It is particularly useful IgHm-HOX11Tg mice, n ¼ 6) (Table S1 in Supplementary for the identification of genes that are downstream, Information). This lack of effect was likely due to the cooperating events in multistep malignant transforma- preference of the MMLV to target early thymocyte tion processes (Berns, 1991; Jonkers and Berns, 1996). progenitors. Inoculation of transgenic mice with slow, nononcogene- An alternative novel approach of utilizing the Du5H bearing retroviruses results in disease acceleration by mAIDS virus as an insertional mutagen was developed random proviral insertions within the host genome and given the virus preference for infecting mature B-cells subsequent disruption of adjacent genomic regions. (Huang et al., 1989, 1991). However, mutagenesis Retroviral-derived DNA sequences that integrate studies in the CD1 IgHm-HOX11Tg mice using the adjacent to cellular oncogenes or within coding regions Du5H mAIDS virus were hampered by the decreased of tumor suppressors, can result in altered host gene susceptibility of CD1 mice to infection with the Du5H expression contributing, ultimately, to clonal expansion mAIDS virus (Huang et al., 1992). To overcome this of the infected cell. While the proviral tagging approach difficulty, the CD1 IgHm-HOX11Tg mice were back- has resulted in the discovery of many genes involved in crossed with C57BL6/J mice for >20 generation to lymphoid and myeloid leukemias (Li et al., 1999; Hwang give rise to heterozygous IgHm-HOX11Tg mice on a et al., 2002; Kim et al., 2003; Erkeland et al., 2004; mAIDS-susceptible, inbred C57BL6/J genetic back- Iwasaki et al., 2004; Shin et al., 2004), less work has been ground. To confirm that this line of C57BL6/J conducted on mature B-cell lymphomas. IgHm-HOX11Tg mice (hereafter referred to as the In this report, we employ a novel approach to identify IgHm-HOX11Tg mice) also developed B-cell malignan- genes that collaborate with HOX11 in tumorigenesis in cies, a cohort of 25 IgHm-HOX11Tg mice together with a mature B-lymphocyte target population by using the a control cohort of 25 age- and sex-matched C57BL6/J Du5H murine AIDS (mAIDS) virus (Aziz et al., 1989; control littermates were followed for 24 months. At Chattopadhyay et al., 1989) to accelerate lymphoma the end of this period, all but one of the control mice development in IgHm-HOX11Tg animals. Most cells were healthy, whereas 60% (15/25) of the IgHm- infected by the Du5H-defective virus are mature HOX11Tg mice had developed mature B-cell malig- IgM þ IgD þ B-cells where the virus has been shown to nancies. The median age of disease onset for the 15 be capable of functioning as an insertional mutagen affected mice was 603 days (Figure 1a, blue curve). (Huang et al., 1991, 1995). In one study, inoculation of The latency period was longer and the pene- susceptible C57BL6/J mice with helper-free stocks of trance lower than that seen with IgHm-HOX11Tg mice Du5H mAIDS virus identified two common integra- on a CD1 genetic background (>80% developed tion sites, Dis-1 and Dis-2, in 20 and 13% of infected marginal zone lymphomas by B420 days), indicating mice, respectively (Huang et al., 1995). This approach, strain-specific variability in disease penetrance and when applied to IgHm-HOX11Tg animals, resulted in presentation. the identification of 17 HOX11 collaborating genes, Histological examination of a spectrum of tissues, revealed through their propensity to be targeted by including bone marrow, spleen, thymus, lymph nodes, the Du5H mAIDS virus during clonal expansion. The kidney, liver and lungs from the 15 diseased mice identified provirally tagged genes collectively intimate indicated that the IgHm-HOX11Tg developed a lympho- a mechanism for HOX11-mediated oncogenesis, whereby matous disease, with the spleen being the principal elevated HOX11 expression leads to enhanced sensitivity organ involved. Normal splenic follicular architecture to dysregulation of segregation of genetic material during was disrupted, with extensive expansion of the germinal mitosis and increased susceptibility for the development center and infiltration of the white pulp into the of aneuploidies, a prelude to transformation. surrounding red pulp (Figure 1b). The lymphoma cells were a relatively uniform population of large pleomorphic centroblasts characterized by prominent nuclear membranes with 1–2 inconspicuous nucleoli Results surrounded by a small rim of cytoplasm. Mediastinal involvement was seen in 13% (2/15) of diseased mice, C57BL6/J IgHm-HOX11Tg mice develop mature B-cell with the mediastinal masses comprised of neoplastic malignancieswith delayed latency lymphocytes with a similar phenotype as those described We have previously reported that IgHm-HOX11Tg mice in the spleen. Numerous mitotic figures and apoptotic bred on a CD1 genetic background develop marginal debris in the form of tingible body macrophages were

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2577

Figure 1 Analysis of C57BL6/J IgHm-HOX11Tg mice. (a) Kaplan–Meier disease-free survival curve comparison between wild-type C57BL6/J mice (black line), uninfected IgHm-HOX11Tg mice (blue line) and mAIDS-infected IgHm-HOX11Tg animals (orange line). Survival proﬁles of mAIDS-infected wild-type animals were not included in the curve because they were killed simultaneously with their transgenic counterparts while still in a disease-free state in order to obtain proper age-matched controls. (b) Histological examination of eosin—hematoxylin-stained sections of spleen (Sp), tumor (Tum), kidney (Kd), liver (Lv) and lung (Lu) tissues. Magniﬁcations are as indicated. (c) Flow cytometric analysis performed on spleen, thymus, lymph node and bone marrow tissues using antibodies against B220, IgM and IgD, and CD4 and CD8.

also seen within the tumor. Immunohistochemical for classification of lymphoid neoplasms in mice (Morse staining of tumor sections with B220 antibodies et al., 2002). indicated the presence of a high proportion of strongly positive B220 þ cells. Other organs frequently exhibiting lymphomatous infiltrates were the liver, lung and kidney Du5H mAIDS virusacceleratesB-cell malignanciesin (Figure 1b). Flow cytometric analyses of age- and IgHm-HOX11Tg mice sex-matched control and IgHm-HOX11Tg mice revealed To identify genes associated with accelerated disease normal thymocyte subpopulations in C57BL6/J mice, development in IgHm-HOX11Tg mice, 10 38-day-old whereas thymuses infiltrated with lymphoma cells were C57BL6/J and 10 IgHm-HOX11Tg mice were each profoundly abnormal, often showing increased numbers inoculated with 1 ml of a helper-free stock of the of CD4ÀCD8À double-negative subpopulation and an Du5H strain of the mAIDS virus. Between 3 and 12 accompanying increase in B220 þ cells (Figure 1c). months postinoculation, nine IgHm-HOX11Tg mice Lymphoma cells expressed both IgM and IgD, indicat- exhibited a statistically significant acceleration of disease ing they were mature B-cells. These findings are symptoms relative to an uninfected IgHm-HOX11Tg consistent with our previous observations that the target cohort (Po0.01) characterized by decreased activity or cell for transformation by HOX11 in IgHm-HOX11Tg visual detection of tumor masses (Figure 1a, orange mice is not an early stage lymphocyte originating in the curve). Infected C57BL6/J control animals were asymp- marrow but rather a mature, peripheral B-cell, and tomatic up to 1 year postinfection. When moribund, indicate a diagnosis of a germinal center-derived diffuse IgHm-HOX11Tg mice were killed simultaneously with an large B-cell lymphoma based on the Bethesda proposal age- and sex-matched control mAIDS-infected C57BL6/

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2578 J littermate. The 10th IgHm-HOX11Tg animal with no HOX11Tg mice described in Figure 1. Thymic involve- disease was excluded from further investigation. All nine ment was seen in 100% (9/9) of the mAIDS-injected inoculated IgHm-HOX11Tg animals exhibited spleno- IgHm-HOX11Tg studied, and bone marrow cellularity megaly and thymic enlargement relative to inoculated also appeared to be increased in the IgHm-HOX11Tg C57BL6/J controls (Figure 2a, Table 1), with two mice (Figure 2c). Flow cytometric analyses of thymuses animals showing lymph node enlargement. PCR analy- isolated from the mAIDS-injected IgHm-HOX11Tg sis revealed all nine thymic tumor samples exhibited animals revealed a high percentage (62%) of cells detectable levels of Du5H proviral DNA and Du5H staining negatively for the T-cell markers CD4 and mRNA (Figure 2b) when assessed by PCR. CD8, and positively for the B-cell markers, B220 (56%), Histological examination demonstrated that, while and IgM and IgD (30%) (Figure 2d). The cell surface mAIDS-injected C57BL6/J animals possessed an intact immunophenotyping results shown are representative of follicular architecture in the spleen, mAIDS-injected four examined animals (Table 1). Additionally, thymic IgHm-HOX11Tg mice spleens were characterized by tumors isolated from mAIDS-infected IgHm-HOX11Tg expanded white pulp regions comprised of pleomorphic mice exhibited elevated expression of bcl6, CD10 and centroblasts reminiscent of the phenotype seen in IgHm- CD23 (Figure S1 in Supplementary Information), a gene

Figure 2 Analysis of Du5H mAIDS-infected IgHm-HOX11Tg mice. (a) Analysis of spleen, thymus and body weight from IgHm- HOX11Tg (tg) and wild-type (wt) animals following viral inoculation. Statistically significant differences with a P-value o0.05 as assessed by Student’s T-test are indicated by the asterisk (*). (b, top) PCR determination of Du5H proviral DNA in thymic tumor tissues from gDNA isolated from nine Du5H mAIDS-infected IgHm-HOX11Tg animals and one thymic tumor from one Du5H-infected C57BL6/J animal. Du5H proviral DNA was detectable in all inoculated animals. Numbers indicate specific tumors. (Bottom) RT– PCR determination of Du5H cDNA in thymic tumor tissues isolated from nine infected IgHm-HOX11Tg animals and one thymic tumor from one Du5H-infected C57BL6/J animal. (c) Histological examination of eosin—hematoxylin-stained sections from spleen, thymus and bone marrow tissues from Du5H-infected wild-type and IgHm-HOX11Tg animals. Magnifications are as indicated. (d) Flow cytometric analysis performed on tumor cell suspensions using antibodies against B220, IgM and IgD, and CD4 and CD8.

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2579 Table 1 Summary of mAIDS-infected IgHm-HOX11Tg Mice Mouse Age at killing Mass (g) Molecular phenotype (%) Spleen histological identiﬁer (days) phenotype Spleen ThymusBody CD4 À CD8- B220+ IgM+ IgD+

Controlsa 81–329 2.9770.56 0.2970.25 31.2674.98 8.470.7 4.671.1 4.270. 6 Variable, with occasional mild germinal center expansions 188 81 3.87 0.19 25.42 62.5 56.0 30.4 Follicular hyperplasia, aggressive white pulp inﬁltration into red pulp 177 119 4.82 4.27 30.54 60.9 48.2 26.7 Follicular hyperplasia 179 137 4.92 0.97 27.92 44.1 40.6 20.9 Expanded germinal centers 653 175 3.10 1.84 24.87 — — — Follicular hyperplasia 644 175 7.08 0.87 25.15 — — — NA 649 195 2.85 1.58 33.87 52.4 50.73 28.38 Mild germinal center expansion 180 293 4.41 0.41 37.21 — — — Mild germinal center expansion 647 325 4.87 1.48 30.23 — — — NA 645 329 4.43 1.45 29.30 — — — NA

NA: not applicable. aControls represent the nine randomly selected, age- and sex-matched mAIDS-infected C57BL6/J control animals killed simultaneously with the sick IgHm-HOX11Tg animal. expression signature representative of a lymphoma whereas a minority (4/17) were situated within coding originating from the germinal center. Collectively, the regions of genes. histological, immunophenotypic and molecular exam- Of the 17 RISs, seven fell near or within genes known ination of the accelerated tumors in the mAIDS-infected to participate in regulation of chromosome segregation IgHm-HOX11Tg mice is indicative of a germinal center- (Ubr1, Mad1l1, Bub3, Aurka, Pim1, Cmt2a, Cse1l ). derived diffuse large cell lymphoma similar to those Quantitative real-time RT–PCR (qPCR) was used to seen in the naturally progressing lymphoma in IgHm- validate differential expression of the seven genes. HOX11Tg mice, and represents an accelerated form of Invariably, tumor cells exhibiting a proviral insertion the disease. flanking a gene exhibited upregulation of the target mRNA transcripts, while tumors with a proviral insertion within a gene exhibited downregulation of the target transcript (Figure 3a). Differential expression Virusintegration sitesin Du5H-induced lymphomas of Aurka transcripts in mouse 188 and Cmt2a transcripts To isolate virus–host junction DNA fragments, inverse in mouse 649 was detected by qPCR without the PCR (IPCR) was applied to the panel of nine Du5H- identification of a corresponding integration site by the induced spleens and thymic tumors isolated from IPCR screen. These differential gene expressions may inoculated animals exhibiting accelerated disease. Host reflect alternative mechanisms by which gene expression flanking genomic sequences in the IPCR-generated was altered during oncogenesis or may represent cases in amplicons were determined by sequencing from nested which proviral insertions were missed by our screen. primers in long terminal repeat (LTR) sequences of the There were no significant fluctuations in expression of viral genome. Analysis of a small portion of the LTR in the phospho-Histone H3 (pH3) mitotic marker in the the obtained sequence included the requisite deletion of samples as determined by Western immunoblotting, 2 bp at the end of the viral LTRs confirming that the indicating that the differential expression profiles of the amplified fragments were derived from bona fide proviral mitotic regulators examined were not due to differences integration sites. Preliminary IPCR screens were per- in the mitotic fraction within the tumor samples formed on splenic B-cells and resulted in the identifica- (Figure 3b). tion of 37 different retroviral integration sites (RISs). Given the heterogeneity of the B-cell population in the spleen, IPCR screens were repeated on the thymic HOX11 overexpression confers increased sensitivity to tumors in order to identify integration events which aneugenic stress were biased towards genes whose disruption were The identification of several genes that participate in the capable of leading to clonal expansion and formation regulation of sister chromatid segregation as proviral of a tumor at a distant site. In theory, these targets targets suggested that HOX11-overexpressing cells may would represent particularly crucial collaborators in the possess an increased susceptibility to chromosome HOX11-mediated tumorigenesis process. Using this segregation errors. To test this theory, primary B-cell process, 17 RISs were corroborated and reproduced in cultures were initiated from IgHm-HOX11Tg animals and the nine thymic tumors analysed (Table 2 and Table S2 treated with spindle toxins which destabilize micro- in Supplementary Information). Eight integrations were tubules, prevent the formation of spindle fibers and found to match with known integration sites in the perturb chromosome segregation during anaphase Mouse Retroviral Tagged Cancer Gene Database (Bourner et al., 1998). Chromosome missegregation (MRTCGD) (Akagi et al., 2004). Most (13/17) of the events following exposure to low doses of colchicine RISs were situated flanking transcriptional units, and colcemid were determined by the cytokinesis-block

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2580 Table 2 Du5H mAIDS integration sites in IgHm-HOX11Tg mice Gene Virusintegration site Mouse identiﬁer, No. of tumors Chromosome Unique database localization orientationa identiﬁer Mouse Human

Chromosome segregation regulatory genes Ubr1 Within exon 10 177fwd, 179 fwd, 188 fwd 3 2E5 15q13 NM_009461 Mad1l1 Within intron 2 177inv 1 5G2 7p22 NM_010752 Bub3 Within intron 4 644inv 1 7F3 10q26 NM_009774 Aurka 30 kb downstream of gene 179fwd 1 2H3 20q13 NM_039210 Pim1 4-8 kb downstream of gene 179fwd, 647fwd 2 17B1 6p21.2 NM_008842 Cmt2a 2 kb upstream of gene 653inv 1 17B3 6p21.1 NM_025649 Cse1l 3 kb upstream of gene 647fwd 1 2H3 20q13 NM_023565

Potential cancer-causing genes Niban Within intron 1 (upstream of ATG) 177fwd 1 1G2 NA NM_022018 MeLa 1 kb downstream of gene 179fwd 1 8E1 NA NM_008581 Tde1 3 kb upstream of gene 645inv, 649fwd 2 2H3 20q13.1 NM_012032 Evi38 12 kb downstream of gene 644fwd 1 1E4 1q32 NM_007570 Tiam Within intron 3 647inv 1 16A1 21q22 NM_009384

Other genes HIPK3 5 kb upstream of gene 179fwd 1 2E2 11p13 NM_010434 Ia invariant chain 40 kb downstream 180inv 1 7 5q32 NM_010545 Ivns1abp 3 kb upstream 644fwd, 653fwd 2 1G2 1q25.1 NM_028582 Wasf2 12 kb downstream of gene 180inv 1 4D3 1p36 NM_153423 Bif1 3 kb upstream of gene 645inv 1 10B2 6q21 NM_153398

aOrientation of integrated provirus; fwd: foward; inv: inverse; NA: not applicable.

Figure 3 Analysis of expression levels of chromosome segregation regulatory genes in thymic tumors by quantitative real-time RT– PCR (qPCR). Graphical representation of qPCR determination of Ubr1, Mad1l1, Bub3, Aurka, Pim1, Cmt2a and Cse1l in thymic tumor tissues isolated from nine Du5H-infected IgHm-HOX11Tg animals (nos. 177, 179, 180, 188, 644, 645, 647, 649 and 653) and one thymic tumor from one Du5H-infected C57BL6/J animal (no. 175). Fold changes are expressed relative to the Du5H-infected C57BL6/J control (no. 175), which was arbitrarily designated as 1.00. Note the log scale. Each qPCR reaction was performed in triplicate and standardized to a B220 internal control. Tumor samples with retroviral integrations at each loci are indicated with an asterisk(*).

micronucleus (CBMN) assay. Treatment of IgHm- characteristics were detected in the IgHm-HOX11Tg HOX11Tg B-cell cultures with 40–50 ng/ml colchicine B-lymphocyte cultures relative to control cultures, such or with 20–50 ng/ml colcemid for 24 h yielded statisti- as changes in doubling times and responses to apoptotic cally signiﬁcant increased frequencies of micronuclei stimuli (Figure S2 in Supplementary Information). formation when compared to wild-type cultures, in- The mechanism by which HOX11 overexpression dicative of aberrant segregation of genetic material confers a heightened susceptibility to aneuploidy follow- during anaphase (Figure 4d). Fluorescent micrographs ing introduction of aneugenic insults may be associated of a representative normal binucleated cell (Figure 4a), with the ability of HOX11 to potentiate bypass of and micronucleus-positive binucleated cells following aneugen-induced spindle checkpoint arrest, allowing for treatment with colchicine (Figure 4b) or colcemid chromosome missegregation. This hypothesis was sup- (Figure 4c) are shown. No additional phenotypic ported by analysis of B-cell numbers in culture following

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2581 colchicine and colcemid treatment after 24 h. Although not statistically significant, control cultures appeared to exhibit a mild decline in cell numbers with increasing levels of colchicine and colcemid whereas the IgHm- HOX11Tg B-cell cultures were not affected (Figure 4d). One possible explanation is that the wild-type cultures were being subjected to a cell cycle arrest during mitosis through an activation of the spindle assembly checkpoint that was being ignored in the IgHm-HOX11Tg cultures. To investigate this theory, control and IgHm- HOX11Tg B-cell cultures were synchronized by a double thymidine block for 48 h, released into 50 ng/ml colchicine for 16 h, and mitotic cells were quantified at various time points by DNA content analysis. Whereas control lymphocytes exhibited a prolonged mitotic arrest between 16–24 h with increased numbers of cells containing a tetraploid (4n) complement of DNA, IgHm- HOX11Tg B-cells more rapidly bypassed this arrest (Figure 5a). The ability of HOX11-overexpressing B-lymphocytes to resume cell cycle notwithstanding spindle checkpoint arrest was further verified by BrdU labelling to quantitate levels of cycling cells 24 h following release into colchicine. In these corroborative studies, we detected a statistically significant increase in BrdU-positive B-lymphocytes in IgHm-HOX11Tg cul- Figure 4 Increased chromosome missegregation in primary B-lymphocyte cultures. (a–c) Representative fluorescent micro- tures relative to wild-type cultures (43.2 versus 28.4%, Tg graphs of a binucleated IgHm-HOX11Tg lymphocyte (a), and P ¼ 0.015) (Figure 5b). The ability of IgHm-HOX11 micronucleus-positive binucleated cells induced by colchicine cells to aberrantly bypass mitotic arrest may be (b) and colcemid (c). Note the presence of the micronuclei indi- associated with its ability to facilitate the upregulation cated by the arrows. (d) Micronucleus assays performed on primary B-lymphocyte cultures revealed statistically significant increases of key effector mitotic proteins. Western immunoblot in micronuclei formation relative to wild-type B-lymphocyte analysis revealed upregulation of cyclin A, cyclin B1, cultures following overnight treatment with 40–50 ng/ml colchicine and cdc20, a subunit of the anaphase-promoting or with 20–50 ng/ml colcemid. Statistically significant differences complex, in IgHm-HOX11Tg B-lymphocytes relative to with a P-value o0.05 as assessed by Student’s T-test are indicated control lymphocytes (Figure 5c). Levels of the G1/S by the asterisk (*). In each independent culture, 200 binucleated cells were scored. The results are representative of two independent checkpoint effector protein, cyclin D2, and housekeep- experiments. ing proteins, gp94 and b-actin, were unaltered. Taken

Figure 5 Aberrant spindle checkpoint regulation in IgHm-HOX11Tg primary B-lymphocyte cultures. (a) Quantitation of B lymphocytes in G1, S and G2/M phases of the cell cycle by measurement of DNA content at various time points following release of synchronized cultures into low-dose colchicine by propidium-iodide staining using flow cytometry. For each sample, 20 000 events were recorded. (b) Detection of cycling B lymphocytes following colchicine-induced arrest by BrdU immunolabelling. Statistically significant differences with a P-value o0.05 as assessed by Student’s T-test are indicated by the asterisk (*). For scoring of BrdU-positive cells, 10 random fields were counted. (c) Western immunoblotting analysis of wild-type and IgHm-HOX11Tg primary B-cell cultures to assess levels of HOX11, Wilm’s tumor (Wt1) protein, cyclins D2, B1 and A, cdc20, gp94 and b-actin.

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2582 together, these results indicate that the chromosome Aurka, Bub3, Pim1, Cse1l and Ubr1 gene products segregation errors observed in IgHm-HOX11Tg B-lym- during the evolution of spontaneous malignancies phocytes is caused by abnormal cell cycle progression (Figure 6a). Importantly, deregulated expression of in HOX11-expressing cells, which may be linked to most of the genes occurred in a mutually exclusive perturbations of expression of key genes involved in manner in the tumors (Figure 6b). The lone exception regulation of mitosis. was Ubr1, in which loss of expression was always detected in conjunction with disrupted expression of Deregulated expression of mitotic reglators during other genes, suggesting that loss of Ubr1 in conjunction lymphomagenesis in IgHm-HOX11Tg mice with deregulated HOX11 expression alone is insufficient To assess the relevance of deregulated expression of for malignancy and requires yet more genetic lesions. these genes in HOX11-mediated B-cell lymphoma- Again, the differential expression profiles did not genesis, their expression profiles were assessed on a panel correlate with fluctuations in the mitotic fraction in of 10 spontaneously arising B-cell malignancies derived the tumors as determined by expression of the pH3 from IgHm-HOX11Tg mice. Real-time qPCR performed mitotic marker (Figure 6c). on purified B220 þ splenocytes from moribund mice Four tumor samples (Tumor nos. 2–4 and 6) were revealed frequent misregulation of expression of the expanded ex vivo for further analysis. Wild-type and

Figure 6 Deregulated expression of mitotic regulators in lymphoid malignancies in IgHm-HOX11Tg mice. (a) Analysis of expression levels of Ubr1, Mad1l1, Bub3, Aurka, Pim1, Cmt2a and Cse1l in thymic tumors from spontaneously arising lymphomas by quantitative real-time RT–PCR (qPCR). Control samples included RNA obtained from puriﬁed B-lymphocytes obtained from pre-malignant, 2-month-old wild-type (wt B) and IgHm-HOX11Tg (tg B) mice. A total of 10 independent lymphomatous samples are represented by gray boxes. Fold changes are expressed relative to the wild-type B-lymphocyte sample, which was arbitrarily designated as 1.00. Note the log scale. Each qPCR reaction was performed in triplicate and standardized to a B220 internal control. (b) Schematic representation of gene expression changes. Red boxes indicate elevated expression, blue boxes indicate diminished expression, yellow boxes indicate no effect.

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2583 IgHm-HOX11Tg B-lymphocyte cultures derived from 1 in IgHm-HOX11Tg B-cell cultures in these experiments to 2 month, pre-malignant mice were initiated in parallel (in conjunction with the lack of increase of micronuclei as control cultures. In the absence of exogenous formation at the untreated data point in Figure 4d) aneugenic stress, tumor nos. 3, 4 and 6 exhibited confirms that HOX11 by itself appears to be unable to statistically significant increases in micronuclei forma- cause missegregation of chromosomes but merely tion following 4 days in culture (Po0.05) when confers an increased susceptibility to segregation errors compared to the wild-type or IgHm-HOX11Tg B-cell in the presence of additional aneugenic insults. How- cultures (Figure 7a). Cultures derived from tumor no. 2 ever, that the HOX11-expressing tumors inherently also exhibited an increase in micronuclei formation, possessed increased chromosome segregation errors led although the trend was not statistically significant us to investigate whether the tumor cells also exhibited a (P ¼ 0.16). The lack of significant micronuclei formation similar propensity to bypass mitotic arrest, similar to the

Figure 7 Aberrant spindle checkpoint regulation in lymphoid malignancies in IgHm-HOX11Tg mice. (a) Micronucleus assays performed on wild-type B-lymphocyte cultures, IgHm-HOX11Tg B-lymphocyte cultures and B220 þ splenocyte cultures derived from lymphoid neoplasms isolated from four IgHm-HOX11Tg mice (nos.2–4, and 6). Statistically significant differences with a P-value o0.05 as assessed by Student’s T-test are indicated by the asterisk (*). In each independent culture, 200 binucleated cells were scored. (b) Quantitation of B-lymphocytes in the G2/M phase of the cell cycle by measurement of DNA content at various time points following release of synchronized cultures into colchicine by propidium-iodide staining using flow cytometry. For each sample, 30 000 events were recorded. (c) Quantitation of mitotic B-lymphocytes by measurement of phospho-Histone H3 positivity at various time points following release of synchronized cultures into low-dose colchicine by flow cytometry. (d) Quantitation of numerical chromosome aberrations by flow cytometry was measured as described by Muehlbauer and Schuler (2005). (e) Assessment of ploidy of primary B-lymphocyte and tumor cultures following 4 days in culture. In all, 20 and 40 metaphase spreads were analysed for primary B-lymphocyte cultures and tumor cultures, respectively. (f) DAPI-stained fluorescent micrographs of representative diploid (top left), hypodiploid (top right), hyperdiploid (bottom left) and polyploid (bottom right) chromosome spreads.

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2584 IgHm-HOX11Tg B-cells. Therefore, double thymidine- breast milk of AKXD and BXH2 mouse lines and blocked tumor cultures were released into colchicine, MMLV infections are typically conducted on newborn and the mitotic fractions were assessed by quantitation pups, Du5H mAIDS inoculations are performed on of cells with a tetraploid (4n) complement of DNA and 30- to 40-day-old pups in order to target a more mature by flow cytometric detection of the pH3 mitotic marker. B-cell. The limited lifespan of the mature B-cell target Both methods reiterated the tendency of IgHm-HOX11Tg population likely increases the probability of clonal B lymphocytes to bypass mitotic arrest as evidenced extinction prior to the development of malignancy. by the more rapid decline of mitotic cells at the 18 h In our viral screen using IgHm-HOX11Tg mice, the time point relative to wild-type B-lymphocyte cultures preponderance of targets (7/17 or 41%) involving genes (compare dashed lines in Figures 7b and c). Moreover, that play a role in the regulation of chromosome tumor cultures were found to behave similarly with the segregation suggests genes belonging to this functional IgHm-HOX11Tg B-lymphocyte cultures and similarly group represent especially relevant oncogenic targets in exhibited a tendency to bypass mitotic arrest (solid lines HOX11-associated B-cell lymphomagenesis pathways. in Figure 7b and c). To determine whether the mitotic In particular, of the seven RISs identified, integration defects of the tumor cells were associated with abnormal within the coding region of the Ubr1 gene was seen in karyotypes, the extent of aneuploidy was determined three independent animals and represented the most using a flow cytometric method for detection of commonly identified of the RISs. The Ubr1 gene numerical chromosomal aberrations (Muehlbauer and encodes a member of the E3 ubiquitin ligase family Schuler, 2005), in addition to preparation of chromo- of proteins, responsible for facilitating the direct ubi- some spreads and counting of chromosome numbers. quitination of substrate proteins as a mechanism In both cases, increased percentages of mitotic cells for designating proteins destined for proteosomal de- exhibiting hyperdiploid and polyploid karyotypes gradation (Varshavsky, 1996). Recent evidence has were observed in the four tumor samples (Figure 7d demonstrated a role for the Ubr1 gene product in and e). Representative spreads are shown in Figure 7f. the degradation of the SCC1 component of cohesin, Therefore, spontaneously arising tumors in IgHm- a multiprotein complex responsible for regulating HOX11Tg mice have similar characteristics as IgHm- chromosome segregation during anaphase. Ubr1-null HOX11Tg B-lymphocyte cultures exposed to exogeneous Saccharomycescerevisiae mutants possess a long-lived aneugenic stress, including increased micronuclei for- SCC1 protein and consequently exhibit loss of fidelity mation and abnormal mitotic checkpoint control, of chromosome maintenance with increased incidences ultimately culminating in the development of aneuploid of chromosome loss and aneuploidy (Rao et al., 2001). karyotypes. Studies aimed at elucidating the synergistic cooperativ- ity between these two genes in B-cell lymphomagenesis revealed elevated incidences of chromosome missegregation in IgHm-HOX11Tg/Ubr1À/À primary B-lymphocyte Discussion cultures and increased incidences of aneuploid karyotypes relative to Ubr1À/À cells (manuscript submitted). In this study, we used a novel approach to identify Such subsequent validation studies demonstrate the disease genes involved in the pathogenesis of mature relevance of the targets identified in insertional muta- B-cell malignancies that occur in transgenic mice expres- genesis screens, and highlight the usefulness of the sing the HOX11 oncoprotein by performing in vivo Du5H mAIDS virus as a tool in similar types of studies retroviral mutagenesis using helper-free stocks of the in other mature B-cell lymphoma models. Du5H mAIDS virus. In contrast to other studies using It is interesting to note that HOX11 overexpression, the MMLV or in the AKXD or BXH2 inbred mouse by itself, does not appear to be sufficient in conferring lines to accelerate pre-T and pre-B lymphomas or abnormal chromosome segregation, and that the elicita- myeloid leukemias (Li et al., 1999; Hwang et al., 2002; tion of missegregation errors is dependent on the Kim et al., 2003; Erkeland et al., 2004; Iwasaki et al., introduction of either an exogenous aneugenic stressor 2004; Shin et al., 2004), this approach exploited the such as the microtubule-destabilizing drugs, colchicine preferential tropism of the mAIDS virus for mature B or colcemid, or an accompanying genetic alteration in lymphocytes and successfully accelerated cancer pro- crucial mitotic spindle checkpoint genes. The stochastic gression in IgHm-HOX11Tg mice. The relatively low nature of oncogenesis underlying HOX11-overexpres- number of integrations observed (B1.9 per tumor) is sing malignancies may account for the incomplete consistent with reports that the Du5H mAIDS virus penetrance of the disease phenotype seen not only in yields fewer (between 2 and 4) integration events when the IgHm-HOX11Tg mice, but also in the clinic where compared to MMLV (between 6 and 10) or with other unaffected individuals with a t(10;14)(q24;q11) trans- models of recombinant inbred mouse strains character- location have been identified (Lichty et al., 1995). ized by laterally transmitted retroviruses (Huang et al., Additionally, when HOX11-associated lymphomas do 1995). The fewer integration events observed in each develop, it is invariably associated with an extended tumor likely reflects the limited progenitor activity of the latency in IgHm-HOX11Tg mice as well as in diagnosed target cell population of the Du5H mAIDS virus as well human T-ALLs (Ferrando et al., 2004). The prolonged as the age at which the inoculations are administered. delay prior to disease development likely reflects the Whereas, retroviruses are transmitted laterally in the need for the HOX11-overexpressing cell to overcome

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2585 two obstacles to achieve transformation: (1) to acquire Inverse PCR an additional mutation in a gene-regulating chromo- Inverse-PCR analysis of flanking genomic regions was some segregation, and (2) to acquire sufficient chromo- performed as previously described (Li et al., 1999). The some abnormalities to be cancer promoting. However, mAIDS-specific primers used were MAIDS-FW: TACTTCC another implication of this disease mechanism is the TTGTTCTTGTTTT; MAIDS-RV: TCAACCCCAAGCCT þ CATTTA. PCR products were purified using the QiaEXII expectation that HOX11 cancers would be especially glass milk purification kit (QIAGEN, Mississauga, ON, sensitive to high doses of spindle poisons, which should Canada), and directly sequenced at the Core Molecular promote catastrophic chromosomal abnormalities and Biology Facility at York University, Toronto, Canada. induce cell death. Indeed, relative to other T-ALL subtypes, HOX11 þ T-ALLs have been demonstrated to be exceedingly responsive to combination chemothera- Real-time qPCR pies (Asnafi et al., 2004; Ferrando et al., 2004), which Trizol-extracted RNA was reverse transcribed into cDNA typically employ spindle poisons in the treatment using the SuperScript II First-Strand cDNA Synthesis Kit regimen. It may also explain the refractory nature of (Invitrogen) according to manufacturer’s protocols. Reverse relapsed HOX11 þ T-ALLs to chemotherapy, which transcription reactions were diluted to 50 ml, and 2 ml of the likely possess a complex karyotype, and the resultant diluted reaction mixture was used for qPCR amplification need for bone marrow transplantation therapy for using the QuantiTect SYBR Green PCR kit (QIAGEN) second-line treatment (Asnafi et al., 2005). according to manufacturer’s protocols. The primers used for the qPCR reaction were as follows: CSE1LF: ATGGAGT HOX11 overexpression has previously been impli- CCTTCGTACAGCGCA; CSE1LR: CCAGATAGCTGTGA cated in aberrant regulation of both G1/S progression CAAAGCGA; CMT2AF: AGGAACCTTCCAATCCTGCG (Riz and Hawley, 2005) in addition to transition into GA; CMT2AR: AGAAGTCTCGTAGGTGACTGAG; BUB3F: mitosis (Kawabe et al., 1997). Specifically, overexpres- GGTCTACACCCTGTCAGTGTCT; BUB3R: GTGGCACT sion of HOX11 in Jurkat T-lymphocyte cell lines leads TGAAGGCGTACTTG; AURKAF: CAGAAGAATGAG to aberrant bypass of G2/M arrest induced by ionizing CAGCCTGCAG; AURKAR: CTGTTCCAAGGGGCGCA radiation (Kawabe et al., 1997). These dual functions of TATTC; MAD1L1F: ACTCCACTGCGTCAAACCTCTC; HOX11 mirror those of another transcription factor, MAD1L1R: CTCTTGTGTGCACGAGGACTGT; PIM1F: FoxM1, a forkhead box transcription factor, recently GATAGTTTCGTGCTGATCCTGG; PIM1R: GTAGACTG shown to be required for proper mitotic spindle TGTCCTTGAGCAGC; B220F: GCTATGATCTGCGCAA GAAAAG; B220R: CTTTCGGGCATCTTTGATGGGA. checkpoint function and chromosome stability (Laoukili Thermocycling conditions were an initial denaturation step et al., 2005). Altered expression of FoxM1 in U2O2 at 941C for 15 min, followed by 32 cycles of 941C for 30 s, cancer cells led to defects in chromosome alignment and 601C for 30 s and 721C for 1 min in an ABI Prism 7000 Real abnormal progression through mitosis. Comparable to Time Thermocycler. FoxM1, HOX11-overexpression also leads to aberrant spindle checkpoint control, bypass of mitotic arrest and chromosome missegregation, leading ultimately to Primary B-lymphocyte cultures karyotypic abnormalities and cellular transformation. B-lymphocytes were isolated from 1- to 3-month-old mice (for Thus, the current report represents the first demonstra- primary B-lymphocyte cultures) or from moribund mouse tion of a homeobox transcription factor in a similar spleens (for primary tumor cultures) by disruption of whole disease paradigm, and should provide new avenues of spleen tissues through a 40 mm nylon cell strainer. Cells were investigation into understanding the molecular mechan- treated with 0.165 M NH4Cl-Tris for 15 min to lyse erythro- isms by which HOX11 functions to induce lymphocyte cytes. Primary B-lymphocytes were isolated using the MACS transformation. magnetic bead sorting system (Miltenyi Biotech, Auburn, CA, USA), according to manufacturer’s instructions. Flow cytometric analysis of purified cells indicated a purity of B-cells of >90%. Purified B220 þ B-lymphocytes were maintained at a 6 Materials and methods cell density of 2 Â 10 cells per ml in DMEM supplemented with 20% FCS, 2 mML-glutamine, 1% penicillin/streptomycin, Du5H mAIDS-induced lymphomas 0.05% anti-CD40 antibody and 10 ng/ml recombinant murine IgHm-HOX11Tg mice, originally developed in the CD1 genetic interleukin-4. Media change was performed 48 h after initia- background, were backcrossed with C57BL6/J mice for >20 tion of cultures. generation to give heterozygous IgHm-HOX11Tg mice on a C57BL6/J background. Wild-type and IgHm-HOX11Tg mice were maintained in the animal facility of the Sunnybrook and CBMN assays Women’s College Health Sciences Centre and housed under Day 4 primary B-lymphocyte cultures were treated with pathogen-free conditions in microisolators. For Du5H mAIDS various concentrations of colchicine or colcemid in conjunc- inoculation, 10 control and 10 IgHm-HOX11Tg mice, aged tion with 3 mg/ml cytochalasin B for 16 h. Cells were collected 38 days, were inoculated twice intraperitoneally with helper- by centrifugation at 1000 rpm for 10 min, washed once in free stocks of the Du5H mAIDS virus. Inoculations were Carnoy’s fixative (3:1 methanol:glacial acetic acid), and performed with 1 ml of viral extracts at a 7-day interval. resuspended in Carnoy’s fixative at B100 000 cells per ml. When moribund, mice were killed, and spleen, thymus, lymph Approximately 10 drops of the cell suspension were dropped node and tumor tissues were harvested. PCR analysis of the onto a horizontally held slide, and the slides were air dried for Du5H provirus, and the Du5H and b-actin transcripts were 1 h at room temperature. Slides were stained with 10 mg/ml performed as previously described (Casabianca et al., 2003). acridine orange for 2 min, followed by two washes with dH2O.

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2586 Stained slides were scored under fluorescent microscopy. For metry was described previously (Muehlbauer and Schuler, each independent culture, 200 binucleated cells were scored. 2005). Preparation of chromosome spreads from cultures was described previously (Dube´ et al., 1986). Bromodeoxyridine (BrdU) labelling and immunocytochemistry To induce mitotic arrest, day 3 primary B-lymphocyte cultures were treated with 50 ng/ml colchicine overnight. BrdU was Immunoblotting analysis added to a final concentration of 10 mM and incubated at 371C Proteins were separated on SDS–PAGE, blotted to nitrocellu- for 2 h. B-lymphocytes were then collected by centrifugation at lose membrane, and probed at various dilutions with a 1000 r.p.m. for 10 min and fixed in Carnoy’s fixative, followed primary antibody recognizing HOX11 (1:2000), Wt1 (1:200), by DNA denaturation in 2 M HCl for 1 h at 371C. Cells were cyclin D2 (1:200), cyclin B1 (1:200), cyclin A (1:500), cdc20 pretreated by incubation with PBS supplemented with 3% (1:200), gp94 (1:1000), pH3 (Ser10) (2 mg/ml) or b-actin bovine serum albumin for 2 h at 371C. Immunostaining was (1:3000) for 4 h at room temperature, followed by three washes performed using an anti-BrdU antibody (Stressgen, Victoria, with PBST for 20 min each. Membranes were subsequently BC, Canada) at a dilution of 1:100 for 2 h at 371C, followed by incubated with either anti-mouse (1:10 000) or anti-rabbit staining with a FITC-conjugated anti-mouse antibody (Stress- (1:10 000) antibody conjugated to horseradish peroxidase for gen) at a dilution of 1:500 for 1 h at 371C. Slides were 1 h at room temperature. The Wt1 antibody was obtained from evaluated using fluorescence microscopy. In all, 10 random Novus Biologicals, the gp94 antibody was obtained from fields were scored for BrdU positivity. Stressgen, the anti-pH3 antibody was obtained from Upstate, the b-actin antibody was obtained from Sigma, and all other DNA Content and pH3 analysis antibodies were obtained from Santa Cruz Biotechnologies For DNA content, day 2 primary B-lymphocyte cultures (Santa Cruz, CA, USA). were subjected to a double-thymidine block, and released into 50 ng/ml colchicine. Cells were processed for DNA content determination or pH3 immunostaining as previously described Acknowledgements (Diamond and DeMaggio, 2000; Muehlbauer and Schuler, 2005). For each sample, 10 000–30 000 events were acquired on We gratefully acknowledge the staff of the Sunnybrook a FACSCalibur flow cytometer, and cell cycle distributions Animal Care Unit for excellent assistance with animal were performed using the Modfit software. husbandry. We thank Drs Daniel Dumont and Jorge Filmus for critical reading of this manuscript and for helpful Ploidy analysis discussions. EC is an Ontario Graduate Scholar in Science Detection of numerical aberrations in mitotic cells using a dual and Technology. This work was supported by funding from DNA content/pH3 immunostaining approach by flow cyto- the National Cancer Institute of Canada (#13309) to MRH.

References

Akagi K, Suzuki T, Stephens RM, Jenkins NA, Copeland NG. Hough MR, Reis MD, Singaraja R, Bryce DM, Kamel-Reid (2004). Nucl Acids Res 32: D523–D527. S, Dardick I et al. (1998). Proc Natl Acad Sci USA 95: Asnaﬁ V, Beldjord K, Libura M, Villarese P, Millien C, 13853–13858. Ballerini P et al. (2004). Blood 104: 4173–4180. Huang M, Simard C, Jolicoeur P. (1989). Science 246: Asnaﬁ V, Buzyn A, Thomas X, Huguet F, Vey N, Boiron JM 1614–1617. et al. (2005). Blood 105: 3072–3078. Huang M, Simard C, Jolicoeur P. (1992). J Virol 66: Aziz DC, Hanna Z, Jolicoeur P. (1989). Nature 338: 505–508. 2398–2406. Berns A. (1991). J Cell Biochem 47: 130–135. Huang M, Simard C, Kay DG, Jolicoeur P. (1991). J Virol 65: Bourner RD, Parry EM, Parry JM. (1998). Mutat Res 404: 6562–6571. 191–197. Huang M, Takac M, Kozak CA, Jolicoeur P. (1995). J Virol Casabianca A, Orlandi C, Fraternale A, Magnani M. (2003). 69: 4069–4078. J Virol Methods 110: 81–90. Hwang HC, Martins CP, Bronkhorst Y, Randel E, Berns A, Chattopadhyay SK, Morse HC, Makino III M, Ruscetti SK, Fero M et al. (2002). Proc Natl Acad Sci USA 99: Hartley JW. (1989). Proc Natl Acad Sci USA 86: 11293–11298. 3862–3866. Iwasaki M, Kuwata T, Yamazaki Y, Jenkins NA, Copeland Diamond RA, DeMaggio S (eds). Living Color: Protocols NG, Osato M et al. (2004). Blood 105: 784–793. in Flow Cytometry and Cell Sorting, Springer Lab Manual. Jonkers J, Berns A. (1996). Biochim Biophys Acta 1287: 29–57. Springer: Berlin, 2000. Kawabe T, Muslin AJ, Korsmeyer SJ. (1997). Nature 385: Dube´ ID, Kamel-Reid S, Yuan CC, Lu M, Wu X, Corpus G 454–458. et al. (1991). Blood 78: 2996–3003. Kees UR, Heerema NA, Kumar R, Watt PM, Baker DL, Dube´ ID, Raimondi SC, Pi D, Kalousek DK. (1986). Blood 67: La MK et al. (2003). Leukemia 17: 887–893. 1181–1184. Kim R, Trubetskoy A, Suzuki T, Jenkins NA, Copeland NG, Erkeland SJ, Valkhof M, Heijmans-Antonissen C, van Lenz J. (2003). J Virol 77: 2056–2062. Hoven-Beijen A, Delwel R, Hermans MH et al. (2004). Laoukili J, Kooistra MR, Bras A, Kauw J, Kerkhoven RM, J Virol 78: 1971–1980. Morrison A et al. (2005). Nat Cell Biol 7: 126–136. Ferrando AA, Neuberg DS, Dodge RK, Paietta E, Larson Li J, Shen H, Himmel KL, Dupuy AJ, Largaespada DA, RA, Wiernik PH et al. (2004). Lancet 363: 535–536. Nakamura T et al. (1999). Nat Genet 23: 348–353. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Lichty BD, Ackland-Snow J, Noble L, Kamel-Reid S, Dube Raimondi SC et al. (2002). Cancer Cell 1: 75–87. ID. (1995). Leuk Lymphoma 16: 209–215.

Oncogene Dysregulated expression of mitotic regulators E Chen et al 2587 Mauvieux L, Leymarie V, Helias C, Perrusson N, Falkenrodt Riz I, Hawley RG. (2005). Oncogene 14: 5561–5575. A, Lioure B et al. (2002). Leukemia 16: 2417–2422. Rosic-Kablar S, Chan K, Reis MD, Dube ID, Hough MR. Morse HC, Anver III MR, Fredrickson TN, Haines DC, (2000). Proc Natl Acad Sci USA 97: 13300–13305. Harris AW, Harris NL et al. (2002). Blood 100: 246–258. Shin MS, Fredrickson TN, Hartley JW, Suzuki T, Agaki K, Muehlbauer PA, Schuler MJ. (2005). Mutat Res 585: 156–169. Morse III HC. (2004). Cancer Res 64: 4419–4427. Rao H, Uhlmann F, Nasmyth K, Varshavsky A. (2001). Varshavsky A. (1996). Proc Natl Acad Sci USA 93: Nature 410: 955–959. 12142–12149.

Supplementary Information accompanies the paper on Oncogene website (http://www.nature.com/onc)

Oncogene