Mutations in the Mitotic Check Point Gene, MAD1L1, in Human Cancers

Oncogene (2001) 20, 3301 ± 3305 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc SHORT REPORT Mutations in the mitotic check point gene, MAD1L1, in human cancers

Kunihiro Tsukasaki*,1, Carl W Miller1, Erin Greenspun1, Shervin Eshaghian1, Hiroshi Kawabata1, Takeshi Fujimoto2, Masao Tomonaga2, Charles Sawyers3, Jonathan W Said4 and H Phillip Koeer1

1Division of Hematology/Oncology, Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles, California, CA 90048, USA; 2Department of Hematology, Atomic Bomb Disease Institute, Nagasaki University School of Medicine, Nagasaki 852, Japan; 3Department of Medicine, Center for Health Sciences, UCLA School of Medicine, Los Angeles, California, CA 90048, USA; 4Department of Pathology, Center for Health Sciences, UCLA School of Medicine, Los Angeles, California, CA 90048, USA

Aneuploidy is a characteristic of the majority of human aneuploidy and is observed in many types of tumors cancers, and recent studies suggest that defects of mitotic (Cahill et al., 1998; Pihan and Doxsey, 1999; checkpoints play a role in carcinogenesis. MAD1L1 is a Takahashi et al., 1999). The mitotic checkpoint is checkpoint gene, and its dysfunction is associated with usually defective in cancer cells with CIN. Many genes chromosomal instability. Rare mutations of this gene including the MAD (mitotic arrest de®ciency) and have been reported in colon and lung cancers. We BUB (budding uninhibited by benzimidazole) family of examined a total of 44 cell lines (hematopoietic, genes have been identi®ed in yeast as well as many prostate, osteosarcoma, breast, glioblastoma and lung) other organisms, and these code for proteins which and 133 fresh cancer cells (hematopoietic, prostate, play a role in the mitotic checkpoint (Elledge, 1996; breast and glioblastoma) for alterations of MAD1L1 by Amon, 1999). However, very little is known of mitotic RT ± PCR ± SSCP and nucleotide sequencing. Eight checkpoint abnormalities in human cancers. The hu- mutations consisting of missense, nonsense and frame- man homologue of the yeast MAD1, known as shift mutations were found, together with a number of MAD1-like1 (MAD1L1) was identi®ed by searching nucleotide polymorphisms. All the alterations in cell lines for cellular targets of the Tax oncoprotein of human T- were heterozygous. Frequency of mutations was rela- lymphotropic virus type-1 (HTLV-1) (Jin et al., 1998). tively high in prostate cancer (2/7 cell lines and 2/33 MAD1L1 was inactivated by the Tax protein, which tumor specimens). We placed a mutant truncated might explain the multi-lobulated nuclei and aneuploi- MAD1L1, found in a lymphoma sample, into HOS, dy, observed in adult T-cell leukemia/lymphoma (ATL) Ht161 and SJSA cell lines and found that it was less cells (Kamihira et al., 1994; Tsukasaki et al., 1999). inhibitory than wild type MAD1L1 at decreasing cell HTLV-1 initiates ATL, but full manifestation of the proliferation. Co-expression experiments showed that the disease requires chromosomal and nucleotide altera- mutant form had a dominant-negative eect. Further- tions (Poiesz et al., 1980; Tsukasaki et al., 2000). Only more, this mutant impaired the mitotic checkpoint as a few reports concerning alterations of the mitotic shown by decreased mitotic indices in HOS cells checkpoint genes in humans have been published expressing mutant MAD1L1 after culture with the including mutation of the BUB1 and BUBR1 gene in microtubule-disrupting agent, nocodazole. Our results a small fraction of colon cancers, and mutation of the suggest a pathogenic role of MAD1L1 mutations in MAD1L1 gene in one out of 49 lung cancers, but not various types of human cancer. Oncogene (2001) 20, in any of 19 colon cancers (Cahill et al., 1999; Nomoto 3301 ± 3305. et al., 1999). In the present study, we sought to determine if MAD1L1 was involved in the pathogen- Keywords: MAD1L1; mitotic checkpoint; chromoso- esis of a variety of human cancers. mal instability; prostate cancer; breast cancer; adult T- Analysed in this study were 44 human cell lines (19 cell leukemia/lymphoma hematopoietic: HL60, NB4, U937, K562, BC1, BC2, BC3, KS1, Jurkat, Raji, CA46, JD38, JD39, JD176, EW36, Daudi, ST1, SO4, KK1; six prostate: LNCaP, Genetic instability in cancers exists in two distinct PC3, DU145 MDAPC2A, MDAPC2B, LAPC4; ®ve arenas, the nucleotide and chromosomal level (Len- osteosarcomas: U20S, HOS, Ht161, SAOS, MG63; ®ve gauer et al., 1998). Chromosomal instability (CIN) is breasts: MCF7, T47D; MDAMB436, MDAMB468, characterized at the cytogenetic level by marked MDAMB231; ®ve glioblastomas: AJ, DB, SJ, N39, PH; four lungs: HTB171, HTB172, HTB180, HTB182) and 133 primary tumor samples (47 ATL, 20 B-cell lymphomas, 33 prostate cancers, 21 breast cancers and *Correspondence: K Tsukasaki Received 30 November 2000; revised 23 February 2001; accepted 12 glioblastomas). The entire coding region of 26 February 2001 MAD1L1 was ampli®ed by RT ± PCR (Figure 1). MAD1 mutation in human cancers K Tsukasaki et al 3302 shift and six missense and all of these were located at a conserved codon and caused a profound substitution in an amino acid (Table 1). For the cell lines, mutations were found in KS1, LNCaP and LAPC4 which were heterozygous having both shifted and wild type bands on the autoradiogram from the SSCP (Figure 1). Also, many samples had either one of the four previously reported polymorphisms or two new ones (Table 1) (Cahill et al., 1999; Nomoto et al., 1999). Five silent mutations, each in single samples, were also identi®ed. To determine whether the mutant (mut)-MAD1L1 gene identi®ed in a B-cell lymphoma (diuse large cell type; 96227ML-MAD1L1) (Table 1) could have functional activity, we cloned the wild type (wt)- MAD1L1 gene, placed it in an expression vector, generated the mutation, veri®ed its nucleotide sequence and con®rmed the expression of the MAD1L1 gene in Figure 1 RT ± PCR ± SSCP analysis of MAD1L1 gene in cell transfected cells by immunoblotting (data not shown). lines and tumor samples. Left panel shows representative results The ®rst assay determined the eect of the mutation on using the F1-R1 primer set. Asterisk indicates the shifted band that represents the MAD1 mutation in KS1. Note that the clonogenic growth (Figure 2). As compared to empty abnormal mobility shift in KS1 is neither present in BC3 nor in vector, transfection of HOS, Ht161 and SJSA cells with the other two lymphoma samples. Right panel shows representa- wt-MAD1L1 reduced their colony numbers. Clono- tive results using the F4-R4 primer set. Asterisk indicates the genic growth after transfection with mut-MAD1L1 MAD1L1 mutation in 4286PC. Arrowheads indicate common polymorphic alleles. Total RNA was prepared with TRIZOL resulted in signi®cantly (P50.01) more colonies as (GIBCO ± BRL, NY, USA) and used for DNA synthesis with compared to transfection of the wild type vector in random hexamers and MMLV-RT (Promega, WI, USA). each cell lines (Figure 2a). To investigate further the The following primers were used to amplify the entire coding eect of wt- and mut-MAD1L1 on cell growth, a region of MAD1L1 (GeneBank accession no. gi 4580766): F1, 5'- titration analysis of Ht161 clonogenic growth was GGGACAGTCTCTGTAATCGCG and R1, 5'-TCCACTCGA- GCCCTCTTGTG for codons 1 ± 84; F2, 5'-GGAGAAAATG- performed using the various vectors. Expression of CAGATGGAGCTGAGT and R2, 5'-GAGATCCTCCCCTT- mut-MAD1L1 rescued in a dose-dependent manner the CAGTGC for codons 70 ± 167; F3, 5'-CAGGCTGGCGA- inhibition of clonal growth mediated by wt-MADL1, GACCATCAA and R3, 5'-GTACCAGCTCAGACTTCATGT- suggesting a dominant negative eect of mut-MAD1L1 TCT for codons 154 ± 251 F4, 5'-AAGGATCTGGAGCAG- AAGCTG and R4, 5'-GAATCTGGAAAGGTCTTCTGGAG on wt-MADL1 (Figure 2b). Wild-type MAD1L1, for codons 226 ± 337 and F5, 5'-GAGAGACTGGACCAGAC- shown in the last column in the ®rst set of columns, CATG and R5, 5'-TGAGCAGCAGGACCCGTTTCT for co- caused about a 95% reduction in colonies, while the dons 318 ± 405 F6, 5'-CTGTTGGAGGAGAGGAAGAAGC and mutant MAD1L1 resulted in a 65% reduction. An R6, 5'-CAGCTCCATCTCCAGCATGTC for codons 380 ± 477 equal mixture of the two expression vectors produced a F7, 5'-GCTGGGAGGCCAGAAACAAAGA, and R7, 5'-GTT- CAGGCTCATGTGCAGCAC for codons 463 ± 548 F8, 5'- 70% inhibition. GGTGACTATGACCAGAGCAGGA and R8, 5'-TGCGGA- To determine the eect of wt- and mut-MAD1L1 at ACTCCTGGATCTTGGT for codons 534 ± 630 F9, 5'-CAG- the mitotic checkpoint, we expressed them in HOS cells CGGCTCAAGGAGGTTTTC and R9, 5'-ACCTGCAGGT- and evaluated the cell cycle following microtubule CAGGCCAAG for codons 616 ± 718. PCR ampli®cation of the cDNA was carried out for 35 cycles of 1 min at 948C, 1 min at disruption using nocodazole (Figure 3). The wild type 608C, and 2 min at 728C. The last elongation step was extended HOS cells had greater than a 60% mitotic index after to 6 min. All PCR was carried out under standard conditions, nocodazole treatment, consistent with the cells preser- 1.5 mM MgCl2 and 1 mM of each primer. SSCP analysis was done ving their mitotic checkpoint (data not shown). DNA using a MDE gel (FMC BioProducts) as previously reported content was analysed by two color FACS analysis (Gombart et al., 1995). All positive results using SSCP were repeated for con®rmation. Aberrantly migrating bands were using GFP and PI. Furthermore, regardless of vectors excised from the gel and reampli®ed with primers identical to (empty, wt-MAD1L1 or mut-MAD1L1) after transfec- those used for SSCP. Puri®ed PCR products were sequenced by tion, over 70% of these cells accumulated a DNA the ABI PRIZM dye terminator cycle sequencing reaction content of 4C following nocodazole treatment (Figure (Perkin-Elmer, Foster, CA, USA). Nucleotide changes were con®rmed by primers for both 5' and 3' directions. Sequencing 3a). In contrast, expression of the mut-MAD1L1 of a non-shifted band in each case was used as a negative control. signi®cantly decreased the mitotic index of the HOS In case of cell lines, mutations were also con®rmed from aliquot cells after nocodazole treatment compared to the of these cell lines from other institutions untreated cells (P50.01) or those transfected with the wt-MAD1L1 expressing vector (P50.05) (Figure 3b). Because KS1 and BC3 were established independently from the same individual (Said et al., 1996; Arvanitakis MAD1L1 was found to be expressed in each of the et al., 1996) and only KS1 has mutation in MAD1L1, tumors, consistent with its function in actively dividing we compared the mitotic index after nocodazole cells (data not shown). After SSCP and sequencing, treatment between the two cell lines. Both had eight mutations were found: one nonsense, one frame- impaired mitotic checkpoint, however, with no sig-

Oncogene MAD1 mutation in human cancers K Tsukasaki et al 3303 Table 1 Mutations in MAD1L1 in human cancers Tumor/cell linea Tissue Nucleotide altered b Codon altered Side chain of AA Conservationc

KS1 Lymphoid 86C?T S29L Polar to nonpolar S conserved 2335PC Prostate 175C?T R59C Basic to nonpolar R conserved 4286PC Prostate Deletion: 749 ± 809 Frameshift: stop codon at 318 LAPC4 Prostate 1079G?A R359Q Basic to polar R conserved 8392BC Breast 1531G?A E515K Acidic to basic Acidic conserved LNCaP Prostate 1666C?T R556C Basic to nonpolar Basic conserved 943280BC Breast 1705G?A E569K Acidic to basic Acidic conserved 96277ML Lymphoid 1947C?G Y649terd

BC1 Lymphoid 273C?T T91T Silent mutation 3995PC Prostate 366G?A E122E Silent mutation 87ATL Lymphoid 1923C?T I641I Silent mutation Daudi Lymphoid 1959G?A S653S Silent mutation MD-MBA-468 Breast 2080C?T L694L Silent mutation

Numerous cancer types 663C?T H221H Polymorphism Numerous cancer types 958C?T L320L Polymorphism Numerous cancer types 1499C?T T500M Polymorphism Numerous cancer types 1673G?A R558H Polymorphism Numerous cancer types 1698G?A A566A Polymorphism Numerous cancer types 1833C?T A611A Polymorphism aThe names of fresh tumors start with numbers and those of cell lines with letters. bThe nucleotide positions refer to the sequence of the MAD1 transcript (GeneBank accession no. gi4580766); the ®rst codon of the ORF was designated +1. cAmino acid (AA) conservation in vertebrates (human, mouse and frog). dter: termination

ni®cant dierence in the index between the two (data and found none of the eight mutations that we not shown). The reason for the lack of dierence detected. This suggests that the changes we identi®ed between the cell lines is unclear but may be related to are somatic mutations and not polymorphisms. insucient sensitivity of the assay or some alteration in This is the ®rst report that the frequency of other mitotic check point genes in BC3. MAD1L1 mutations is relatively high in prostate Our results show that a subset of human prostate cancer (2/7 cell lines, 2/33 fresh samples). The and breast cancers, and lymphomas carry mutations of molecular mechanisms underlying the development MAD1L1. We functionally analysed one of these and progression of prostate cancers are poorly under- mutations and demonstrated for the ®rst time that stood (Sciavolino and Abate-Shen, 1998). Loss of mutant MAD1L1 has functional signi®cance lending heterozygosity is more frequent than microsatellite support to the concept that it has a role in the instability, suggesting CIN plays a role in this disease development and/or progression of these cancers. (Cunningham et al., 1996). Whether MAD1L1 muta- Concerning the genetic alterations of MAD1L1, a tions are involved in initiation or progression of previous report found no mutation in 19 colon cancer prostate cancer is unknown. Because mutant MAD1L1 cell lines with CIN, another study uncovered one is probably associated with CIN, those cells harboring missense mutation in 49 lung cancers (Cahill et al., this mutation would be expected more easily to acquire 1999; Nomoto et al., 1999). We found three mutations additional genetic alterations (Jin et al., 1998). in 44 cell lines and ®ve mutations in 133 fresh cancers. A study showed that MAD1L1 could be inactivated We were unable to obtain RNA from non-malignant by the Tax protein; however, Tax is expressed only in cells from the individuals with MAD1L1 mutations. about one out of 106 ATL cells in vivo (Kinoshita et al., Thus, we do not know if the MAD1L1 alterations are 1989; Jin et al., 1998). Except for one silent mutation, germline or localized to the transformed cells. How- we found no MAD1L1 alterations in ATL. Recently, a ever, the mutation in KS1 is somatic because no report has been published on mutations in the BUB1 mutation was detected in BC3, and both cell lines were and BUBR1 genes in ATL (Ohshima et al., 2000). established independently from the same individual These latter mutations might be possibly associated (Said et al., 1996; Arvanitakis et al., 1996). We can not with CIN in ATL. totally rule out that some of the missense mutations The precise function of MAD1L1 in the mitotic identi®ed in this study are very rare polymorphisms. spindle checkpoint remains unknown (Amon, 1999). Notably, however, all missense mutations occurred at According to a model, the spindle checkpoint halts conserved codons, and all the changes in amino acids cell-cycle progression prior to anaphase. The MAD1, resulted in a profound change in the side chain (Table MAD2, BUB1 and BUB3 checkpoint components bind 1). Furthermore, Cahill et al. (1999) and Nomoto et al. to the unattached kinetochore, potentially forming a (1999) examined 68 cancer- and 156 normal- samples protein complex (Amon, 1999). Association of MAD1 for alterations over entire coding region of MAD1L1, with MAD2 causes hyperphosphorylation of MAD1 in

Oncogene MAD1 mutation in human cancers K Tsukasaki et al 3304

Figure 2 Eect of MAD1L1 expression on cell growth. (a) Clonal recovery of MAD1L1-transfected SJSA, Ht161 and HOS cells was compared with control-transfected cells. The expression vectors (empty, wild-type (wt)-MAD1L1 or mutant (mut)- MAD1L1 from the fresh lymphoma cells, 96277ML) are indicated. (b) Titration analysis of the vectors on clonal recovery Figure 3 Eect of MAD1L1 expression on mitosis. (a) The cell- of Ht161 cells. The results represent the means (+s.d.) of cycle distribution of HOS cells transfected with mut-MAD1L1 triplicated experiments, and each experimental point had triplicate before and after nocodazole treatment. Analysis was done by ¯ow dishes. For each experiment, cells were transfected with a titration cytometry. 2' and 4' refer to the DNA contents of each cell line in of either empty (emp) versus wild type (wt) vector; emp versus G1 and G2/M phases, respectively. (b) Mitotic index in mutant (mut) vector or mut versus wt vector. HOS, Ht161 and nocodazole treated, MAD1L1-transfected HOS cells were com- SJSA cells (ATCC) were grown in RPMI 1640 with 10% fetal pared with control-transfected HOS cells. The bars represent bovine serum. We cloned full-length human MAD1L1 (kindly relative mitotic indices compared with control cells. The cells were provided by Dr Kuan-teh Jeang,) into the pcDNA3.1 vector (Jin transfected with either mutant (mut; 96277ML), wild-type (wt)- et al., 1998). A ¯ag epitope was attached to the 5' of the MADL1 or empty vector. For analysis of the mitotic checkpoint, MAD1L1. Mutation constructs were generated in expression we used HOS cells which preserves its' mitotic checkpoint after vectors by non-PCR-based, site-directed mutagenesis (Transfor- treatment with nocodazole. HOS cells were co-transfected with mer Site-Directed Mutagenesis Kit; Clontech, CA, USA) and one of the three vectors described above (2 mg) as well as with con®rmed by sequencing of the nucleotides. For clonal antibiotic pEGFP-C (0.5 mg) using Geneporter for 48 h. For the last 20 h, recovery assays, we transfected 16106 HOS, Ht161 and SJSA cells were cultured in the presence of nocodazole (200 nM) cells with one of the following three vectors (2 mg): pcDNA3.1-wt- (Sigma). Cells were ®xed with 70% ethanol, treated with Mad1L1, pcDNA3.1-mut-MAD1L1 or empty pcDNA3.1 by 100 mg/ul RNAase and stained with 1 mg/ul propidium iodide Geneporter (GTS, CA, USA). After 48 h, cells were trypsinized (PI). To determine the mitotic index (percentage of viable cells and diluted 1 : 50 to 1 : 10 and cultured in medium containing arrested in mitosis), at least 100 GFP-positive cells were counted G418 (500 mg/ml). Resistant clones were scored after 10 days by for each measurement using ¯uorescence microscopy. Flow ®xing and staining with Wright-Giemsa. Clonal recovery was cytometric analysis was also conducted to evaluate the cell-cycle determined by counting with an inverted microscope after pro®le of cells harvested after treatment with nocodazole. Cells staining. Transfectants were screened for MAD1L1 expression were stained with 50 mg/ul PI and analysed with the help of two by immunoblotting with anti-FLAG antibody, M5 (Sigma, St. color FACScan and Cellquest 3.1f software (Becton Dickinson, Louis, MO, USA) as described previously (Kawabata et al., 1999) CA, USA)

Oncogene MAD1 mutation in human cancers K Tsukasaki et al 3305 yeast and is critical for checkpoint function (Chen et MAD1L1 also impairs the mitotic checkpoint as shown al., 1999). The minimum segment of human MAD1L1 by decreased mitotic indices after nocodazole treatment for contacting MAD2 and Tax are amino acids 465 ± of HOS cells overexpressing this mutant. Taken 584 and 324 ± 498, respectively (Jin et al., 1998). together, mutant MAD1 may contribute to two major Interestingly, ®ve out of the eight mutations in this phenotypes of many human cancers, i.e., immortaliza- study were within these two segments. tion and chromosomal instability. Further studies are In this study, overexpression of wt-MAD1L1 needed to determine whether defects in other genes also inhibited cell growth. Co-expression of mut-MAD1L1 contribute to mitotic checkpoint defects and CIN in with wt-MAD1L1 rescued in a dose-dependent manner human cancers. Agents that can activate the cell-cycle the wt-MAD inhibition of clonal growth, suggesting checkpoint might be useful as a way to exploit the that the mut-MAD1L1 could behave in a dominant dierence between normal and malignant cells and negative fashion. All the MAD1L1 mutations in cell improve the results of chemotherapy. lines were heterozygous. The relatively weak intensity of the shifted band in fresh tumor samples compared to the wild-type bands in Figure 1, as well as a previous report, suggests that either the tumor has Acknowledgments The work was supported in part by NIH and Defense retention of the normal allele and/or prominent Department grants as well as the Lymphoma Research contamination with normal cells (Nomoto et al., Foundation, C. and H. Koeer and Parker Hughes Trust, 1999). The ®rst would be reminiscent of the hetero- the Horn and Aron Eschman Foundations and LaPCURE. zygous mutations reported for another mitotic check- HP Koeer holds the Mark Goodson Endowed Chair of point gene, BUB1 (Cahill et al., 1998). Mutant Oncology Research.

References

Amon A. (1999). Curr.Opin.Genet.Dev.,9, 69 ± 75. Lengauer C, Kinzler KW and Vogelstein B. (1998). Nature, Arvanitakis L, Mesri EA, Nador RG, Said JW, Asch AS, 396, 643 ± 649. Knowles DM and Cesarman E. (1996). Blood, 88, 2648 ± Nomoto S, Haruki N, Takahashi T, Masuda A, Koshikawa 2654. T, Takahashi T, Fujii Y, Osada H and Takahashi T. Cahill DP, da Costa LT, Carson-Walter EB, Kinzler KW, (1999). Oncogene, 18, 7180 ± 7183. Vogelstein B and Lengauer C. (1999). Genomics, 58, 181 ± Ohshima K, Haraoka S, Yoshioka S, Hamasaki M, Fujiki T, 187. Suzumiya J, Kawasaki C, Kanda M and Kikuchi M. Cahill DP, Lengauer C, Yu J, Riggins GJ, Willson JK, (2000). Cancer Lett., 158, 141 ± 150. Markowitz SD, Kinzler KW and Vogelstein B. (1998). Pihan GA and Doxsey SJ. (1999). Semin. Cancer Biol., 9, Nature, 392, 300 ± 303. 289 ± 302. Chen RH, Brady DM, Smith D, Murray AW and Hardwick Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD KG. (1999). Mol. Biol. Cell., 10, 2607 ± 2618. and Gallo RC. (1980). Proc.Natl.Acad.Sci.USA,77, Cunningham JM, Shan A, Wick MJ, McDonnell SK, Schaid 7415 ± 7419. DJ, Tester DJ, Qian J, Takahashi S, Jenkins RB, Bostwick SaidW,ChienK,TakeuchiS,TasakaT,AsouH,ChoSK, DG and Thibodeau SN. (1996). Cancer Res., 56, 4475 ± de Vos S, Cesarman E, Knowles DM and Koeer HP. 4482. (1996). Blood, 87, 4937 ± 4943. Elledge SJ. (1996). Science, 274, 1664 ± 1672. Sciavolino PJ and Abate-Shen C. (1998). Ann. Med., 30, Gombart AF, Morosetti R, Miller CW, Said JW and Koeer 357 ± 368. HP. (1995). Blood, 86, 1534 ± 1539. Takahashi T, Haruki N, Nomoto S, Masuda A, Saji S, Osada Jin DY, Spencer F and Jeang KT. (1998). Cell, 93, 81 ± 91. H and Takahashi T. (1999). Oncogene, 18, 4295 ± 4300. Kamihira S, Atogami S, Sohda H, Momita S, Toryia K, Tsukasaki K, Imaizumi Y, Tawara M, Fujimoto T, Ikeda S, Yamada Y and Tomonaga M. (1994). Leuk. Res., Fukushima T, Hata T, Maeda T, Yamada Y, Kamihira 18, 79 ± 84. S and Tomonaga M. (1999). Br. J. Haematol., 105, 369 ± Kawabata H, Yang R, Hirama T, Vuong PT, Kawano S, 375. Gombart AF and Koeer HP. (1999). J. Biol. Chem., 274, Tsukasaki K, Koeer P and Tomonaga M. (2000). Baillieres 20826 ± 20832. Best Pract Res. Clin. Haematol., 13, 231 ± 243. Kinoshita T, Shimoyama M, Tobinai K, Ito M, Ito S, Ikeda S, Tajima K, Shimotohno K and Sugimura T. (1989). Proc. Natl. Acad. Sci. USA, 86, 5620 ± 5624.

Oncogene