Peroxisomes Control Mitochondrial Dynamics and the Mitochondrion-Dependent Pathway of Apoptosis

Home , Peroxisome

bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Peroxisomes control mitochondrial dynamics and the mitochondrion-

2 dependent pathway of apoptosis

4 Hideaki Tanaka1, Tomohiko Okazaki1, Mutsumi Yokota2, Masato Koike2, Yasushi

5 Okada3,4, Yukio Fujiki5, Yukiko Gotoh1

7 1Graduate School of Pharmaceutical Sciences, IRCN, The University of Tokyo,

8 Tokyo 113-0033, Japan; 2Department of Cell Biology and Neuroscience,

9 Juntendo University School of Medicine, Tokyo 113-8421, Japan; 3Laboratory for

10 Cell Dynamics Observation, Center for Biosystems Dynamics Research (BDR),

11 RIKEN, Osaka 565-0874, Japan; 4Department of Physics, Universal Biology

12 Institute (UBI), and the International Research Center for Neurointelligence (WPI-

13 IRCN), The University of Tokyo, Tokyo 113-0033, Japan; 5Division of Organelle

14 Homeostasis, Medical Institute of Bioregulation, Kyushu University, Fukuoka

15 812-8582, Japan.

18 Correspondence to Tomohiko Okazaki: [email protected], Yukiko

19 Gotoh: [email protected]

22 Short running title: Peroxisomes regulate mitochondrial dynamics

23 Key words: organelle, peroxisome, mitochondria, apoptosis, Drp1, caspase

1 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Nonstandard abbreviations: Drp1, dynamin-related protein 1; CCCP,

2 carbonylcyanide m-chlorophenylhydrazone; KO, knockout; MAM, mitochondrion-

3 associated membrane; MEF, mouse embryonic fibroblast; NAC, N-

4 acetylcysteine; OXPHOS, oxidative phosphorylation; 4-PBA, 4-phenylbutyrate;

5 Pex, peroxin; PTS1, peroxisome-targeting signal 1; ROS, reactive oxygen

6 species; TBHP, tert-butylhydroperoxide.

8 Summary Statements

9 We unveil a previously unrecognized role of peroxisomes in the regulation of

10 mitochondrial fission-fusion dynamics, mitochondrion-dependent caspase

11 activation, and cellular apoptosis.

2 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Abstract

2 Peroxisomes cooperate with mitochondria in the performance of cellular

3 metabolic functions such as fatty acid oxidation and maintenance of redox

4 homeostasis. Whether peroxisomes also regulate mitochondrial fission-fusion

5 dynamics or mitochondrion-dependent apoptosis has remained unclear, however.

6 We now show that genetic ablation of the peroxins Pex3 or Pex5, which are

7 essential for peroxisome biogenesis, resulted in mitochondrial fragmentation in

8 mouse embryonic fibroblasts (MEFs) in a manner dependent on dynamin-related

9 protein 1 (Drp1). Conversely, treatment with 4-phenylbutyric acid, an inducer of

10 peroxisome proliferation, resulted in mitochondrial elongation in wild-type MEFs,

11 but not in Pex3-deficient MEFs. We further found that peroxisome deficiency

12 increased the levels of cytosolic cytochrome c and caspase activity under basal

13 conditions without inducing apoptosis. It also greatly enhanced etoposide-

14 induced caspase activation and apoptosis, indicative of an enhanced cellular

15 sensitivity to death signals. Together, our data unveil a previously unrecognized

16 role of peroxisomes in the regulation of mitochondrial dynamics and

17 mitochondrion-dependent apoptosis. Given that mutations of peroxin genes are

18 responsible for lethal disorders such as Zellweger syndrome, effects of such

19 mutations on mitochondrion-dependent apoptosis may contribute to disease

20 pathogenesis.

3 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Introduction

2 Peroxisomes are organelles bound by a single membrane that play essential

3 roles in metabolic functions such as oxidation of fatty acid chains, catabolism of

4 reactive oxygen species (ROS), and synthesis of ether phospholipids in all

5 eukaryotic cells. The peroxin (Pex) family of proteins is required for the assembly

6 and function of peroxisomes (Fujiki et al., 2012; Waterham and Ebberink, 2012).

7 Deficiency of Pex3, a peroxisomal membrane protein necessary for membrane

8 assembly, thus results in the complete loss of peroxisomes (Muntau et al., 2000),

9 whereas deficiency of Pex5, a peroxisomal transporter, results in the loss of

10 peroxisomal matrix proteins (Otera et al., 1998). Peroxisomal dysfunction due to

11 Pex gene mutations is detrimental to human development, as evidenced by

12 human autosomal recessive genetic diseases (known as peroxisome biogenesis

13 disorders) such as Zellweger syndrome that result in death within the 1st year of

14 life (Goldfischer et al., 1973). Peroxisome-deficient mice also die during the

15 neonatal period (Baes et al., 1997; Maxwell et al., 2003). Both patients with

16 peroxisome biogenesis disorders and peroxisome-deficient mice manifest a

17 variety of characteristics including neurological dysfunction, hypotonia, and

18 craniofacial abnormalities (Muntau et al., 2000; Trompier et al., 2014; Waterham

19 and Ebberink, 2012).

20 Peroxisomes collaborate with other organelles in various physiological

21 and pathological contexts. In particular, peroxisomes engage in a functional

22 interplay with mitochondria with regard to the degradation of fatty acids and ROS

23 detoxification as well as to antiviral immunity (Dixit et al., 2010; Lismont et al.,

24 2015; Schrader and Yoon, 2007). The interplay between peroxisomes and

4 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 mitochondria is highlighted by the observation that the loss of Pex genes gives

2 rise to abnormalities in mitochondrial structure and metabolic function. For

3 instance, deletion of Pex5 in mouse hepatocytes affects the structure of

4 mitochondrial inner and outer membranes as well as gives rise to abnormal

5 (swollen) cristae (Baumgart et al., 2001; Goldfischer et al., 1973; Peeters et al.,

6 2015), reduced activity of oxidative phosphorylation (OXPHOS) complexes, loss

7 of the mitochondrial membrane potential, and increased ROS levels (Peeters et

8 al., 2015). Deletion of Pex5 was also shown to increase the number of

9 mitochondria as well as the level of glycolytic activity, possibly as a compensatory

10 response to the impairment of OXPHOS (Peeters et al., 2015). Deletion of Pex13

11 in mouse brain or of Pex19 in fly larvae resulted in similar dysfunction of OXPHOS,

12 elevated ROS levels, and an increased abundance of mitochondria (Bülow et al.,

13 2018; Rahim et al., 2016). Furthermore, human patients harboring PEX16

14 mutations manifest myopathy accompanied by mitochondrial abnormalities

15 (Salpietro et al., 2015). It remains unclear, however, which of these various

16 phenotypes in mice, flies, and humans reflect primary effects of peroxisome

17 deficiency or are secondary to primary effects such as ROS accumulation.

18 In addition to their roles in OXPHOS and redox regulation, mitochondria

19 are key players in the regulation of apoptosis. Various proteins that are normally

20 localized to the intermembrane space of mitochondria, including cytochrome c,

21 are released into the cytosol on apoptosis induction. In the cytosol, cytochrome c

22 interacts with Apaf-1 and pro-caspase-9 to form a large protein complex known

23 as the apoptosome. The resulting increase in the autocatalytic activity of pro-

24 caspase-9 leads to the cleavage and activation of pro-caspase-3 and pro-

5 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 caspase-7, and the active forms of these latter two enzymes then execute

2 apoptosis by cleaving numerous substrates (Wang and Youle, 2009).

3 Mitochondria are highly dynamic organelles that continually change their

4 morphology by fission and fusion processes, which contributes to mitochondrial

5 quality control and induction of apoptosis (Detmer and Chan, 2007; Suen et al.,

6 2008). Mitochondrial fission and fusion are mediated by evolutionarily conserved

7 members of the dynamin family of proteins. Fission is thus mediated by cytosolic

8 dynamins such as Drp1 (dynamin-related protein 1) and Dyn2, whereas fusion is

9 mediated by the membrane-anchored dynamins Mfn1-Mfn2 and Opa1,

10 respectively, in mammals (Detmer and Chan, 2007; Lee et al., 2016). The fission

11 process mediated by Drp1 appears to play a central role in the induction of

12 cytochrome c release and subsequent apoptosis in various physiological and

13 pathological contexts (Westermann, 2010).

14 Recent studies have shown that interactions with other organelles

15 contribute to the regulation of mitochondrial dynamics. Sites of contact between

16 mitochondria with ER (known as mitochondrion-associated membranes, MAMs)

17 play an important role in the regulation of mitochondrial fission (Friedman et al.,

18 2011) and have been implicated in that of apoptosis (Hoppins and Nunnari, 2012;

19 Prudent et al., 2015; Yang et al., 2018). Lysosomes also participate in the

20 regulation of mitochondrial dynamics (Wong et al., 2018). Mitochondria and

21 peroxisomes share key regulators of their fission including Drp1 as well as Fis1

22 and Mff1 (Camões et al., 2009; Delille et al., 2009; Kobayashi et al., 2007;

23 Schrader, 2006). However, whether peroxisomes also regulate mitochondrial

24 dynamics and mitochondrion-mediated apoptosis has remained unclear.

6 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 We have now investigated the role of peroxisomes in the regulation of

2 mitochondrial dynamics, caspase activation, and apoptosis by deleting Pex3 or

3 Pex5 in mouse embryonic fibroblasts (MEFs) under conditions in which the

4 cytosolic ROS level does not increase substantially. We found that deletion of

5 either Pex3 or Pex5 resulted in fragmentation of mitochondria, the appearance of

6 cytochrome c in the cytosol, and an increase in the amounts of cleaved caspase-

7 9 and caspase-3. Importantly, restoration of Pex3 or Pex5 expression in the

8 corresponding knockout (KO) MEFs attenuated these effects. Furthermore, we

9 found that ablation of Pex3 greatly enhanced the induction of apoptosis by the

10 DNA-damaging agent etoposide. Our results thus suggest that peroxisomes

11 regulate mitochondrial dynamics, caspase activity, and cell death so as to reduce

12 cellular sensitivity to damaging insults.

15 Results

17 Induction of mitochondrial fragmentation by Pex3 deletion

18 To examine an acute effect of peroxisome deficiency, we took advantage of

19 MEFs derived from Pex3fl/fl;Rosa-Cre-ERT2 mice, which are homozygous for a

20 floxed allele of Pex3 and harbor a tamoxifen-inducible transgene for Cre

21 recombinase (Fig. S1). We immortalized these cells by introducing SV40 large T

22 antigen and deleted Pex3 by adding 4-hydroxytamoxifen. Immunoblot analysis

23 detected Pex3 protein in control MEFs (not exposed to 4-hydroxytamoxifen) but

24 not in Pex3 KO MEFs (Fig. 1 A). Immunofluorescence analysis also detected

7 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 almost no punctate signals for Pex14 or for EGFP tagged with peroxisome-

2 targeting signal 1 (PTS1) in the Pex3 KO MEFs (Fig. 1 B), indicating the

3 successful depletion of peroxisomes in these cells.

4 With the use of our Pex3 KO MEFs, we then set out to identify

5 mitochondrial phenotypes of peroxisome deficiency that could be rescued by

6 reintroduction of peroxisomes. We examined mitochondrial morphology by

7 observing the intracellular distribution of Tom20, a mitochondrial outer membrane

8 protein, and ATP synthase β, a mitochondrial inner membrane protein, and found

9 that the extent of mitochondrial fragmentation was increased in Pex3 KO MEFs

10 (Fig. 1, C and D, Fig. S2 A). Huygens-based quantification indicated that the size

11 of mitochondria was significantly smaller in Pex3-deficient MEFs than that in

12 control MEFs (Fig. S2 B). The length of mitochondria also became shorter in

13 Pex3-deficient MEFs compared to that in control MEFs (Fig. S2 C). We then

14 asked whether restoration of Pex3 expression in these Pex3-deficient cells would

15 rescue this mitochondrial phenotype. Infection of Pex3 KO MEFs with a retrovirus

16 encoding Pex3 increased the abundance of Pex3 protein and induced the

17 formation of peroxisomes (Fig. 1, E and F). Importantly, this reintroduction of

18 Pex3 resulted in elongation of mitochondria in the Pex3-deficient MEFs (Fig. 1,

19 G and H), indicating that Pex3 suppresses mitochondrial fragmentation in a

20 reversible manner.

22 Induction of mitochondrial fragmentation by Pex5 deletion

23 Given that the effect of Pex3 deletion on mitochondrial morphology might have

24 been the result of a Pex3-specific function unrelated to peroxisome formation, we

8 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 examined whether deletion of a different Pex gene, Pex5, might confer a similar

2 phenotype. Deletion of Pex5 would be expected to result in loss of peroxisomal

3 matrix proteins but retention of the peroxisomal membrane, whereas that of Pex3

4 results in the complete loss of peroxisomes. To disrupt Pex5 in MEFs, we

5 adopted the CRISPR-Cas9 system with a gRNA targeted to Pex5 (Fig. S3 A). We

6 confirmed disruption of Pex5 gene (Fig. S3 B) as well as the loss of Pex5 protein

7 (Fig. 2 A) in the targeted cells. Examination of mitochondrial morphology revealed

8 that the extent of mitochondrial fragmentation was increased in the Pex5-deficient

9 MEFs compared with control (WT) MEFs (Fig. 2, B and C). Furthermore, this

10 phenotype of Pex5 deficiency was rescued by retrovirus-mediated restoration of

11 Pex5 expression (Fig. 2, D–F). These results thus provided further support for the

12 notion that peroxisomes suppress mitochondrial fragmentation.

14 Induction of mitochondrial elongation by a peroxisome proliferator

15 We next examined whether an increase (rather than a decrease) in the number

16 of peroxisomes might also affect mitochondrial morphology. We thus exposed

17 MEFs to 4-phenylbutyrate (4-PBA), an inducer of peroxisome proliferation. We

18 confirmed that 4-PBA increased the abundance of peroxisomes, as detected by

19 immunostaining of Pex14, in control MEFs (Fig. 3 A). Furthermore, we found that

20 4-PBA induced mitochondrial elongation in these cells (Fig. 3, A, C, and D).

21 Importantly, however, 4-PBA did not induce mitochondrial elongation or suppress

22 mitochondrial fragmentation in Pex3 KO MEFs (Fig. 3, B, C, and E), suggesting

23 that the induction of mitochondrial elongation by 4-PBA requires peroxisomes.

9 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Together, these results indicated that peroxisome abundance is a critical

2 determinant of mitochondrial fission-fusion dynamics.

4 Induction of cytochrome c diffusion by deletion of Pex3

5 Given the mitochondrial fragmentation apparent in peroxisome-deficient cells, we

6 next examined mitochondrial structure in more detail by electron micrography

7 (EM). Mitochondria were indeed smaller and shorter in Pex3 KO MEFs compared

8 with control MEFs (Fig. 4, A–C), consistent with the results of confocal

9 fluorescence microscopy (Fig. 1, C and D). The structure of cristae also appeared

10 to have collapsed, with the presence of an indistinct and irregular inner

11 membrane, in Pex3-deficient MEFs (Fig. 4 D), similar to the morphology

12 previously observed in Pex5-deficient hepatocytes (Baumgart et al., 2001;

13 Peeters et al., 2015).

14 Given that mitochondrial fragmentation and collapsed cristae are

15 associated with the release of cytochrome c from these organelles and the

16 intrinsic (mitochondrion-dependent) pathway of apoptosis (Otera et al., 2016;

17 Suen et al., 2008), we examined whether Pex3 deletion might affect the

18 distribution of cytochrome c. Whereas cytochrome c immunoreactivity was

19 detected almost exclusively in mitochondria of control MEFs, as shown by its

20 overlap with that of Tom20, cytochrome c signals were diffusely distributed in the

21 cytosol in addition to their punctate mitochondrial distribution in Pex3 KO MEFs

22 (Fig. 4, E and F). A high cell density appeared to further increase the amount of

23 cytochrome c in the cytosol of Pex3-deficient cells (Fig. S4). Quantitative analysis

24 revealed that the colocalization of cytochrome c with Tom20, as reflected by

10 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Pearson’s correlation coefficient (r), was significantly reduced in Pex3 KO MEFs

2 compared with control MEFs (Fig. 4 G), indicating that Pex3 deletion indeed

3 induced the diffusion of cytochrome c. Importantly, forced expression of Pex3

4 was sufficient to restore the normal (mitochondrial) distribution of cytochrome c

5 in Pex3 KO MEFs (Fig. 4, H–J). Together, these results thus showed that Pex3

6 suppresses the diffusion of cytochrome c.

8 Induction of cytochrome c diffusion by deletion of Pex5

9 We then examined whether deletion of Pex5 results in a similar redistribution of

10 cytochrome c. Cytochrome c signals were indeed found to be diffusely distributed

11 in the cytosol of Pex5 KO MEFs (Fig. 5, A and B). We also confirmed that forced

12 expression of Pex5 restored the mitochondrial localization of cytochrome c in the

13 Pex5-deficient cells (Fig. 5, C and D). Together, our results thus indicated that

14 functional peroxisomes, which require both Pex3 and Pex5, are necessary for

15 suppression of cytochrome c diffusion.

17 Pex3 deletion without an overt change in ROS and respiration levels

18 We next addressed the mechanism by which the diffusion of cytochrome c is

19 increased in peroxisome-deficient MEFs. Although previous studies have shown

20 that long-term deletion of Pex genes results in ROS accumulation (Bülow et al.

21 2018, Rahim et al. 2016), the cytosolic ROS level of our Pex3-deficient MEFs as

22 measured with CellROX did not appear to differ from that of control MEFs (Fig. 6,

23 A and B). Under the same condition, the treatment of these MEFs with tert-

24 butylhydroperoxide (TBHP), a ROS inducer, increased CellROX signals (Fig. 6,

11 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 A and B). Moreover, control and Pex3-deficient MEFs did not show a detectable

2 difference in mitochondrial ROS levels monitored by MitoSOX (Fig. 6, C and D).

3 These results suggest that (relatively acute) Pex3 deletion did not overtly

4 increase ROS levels in mitochondria or the cytosol of our cultured MEFs. We also

5 examined the rate of oxygen consumption in these cells, given that the

6 abundance and activity of OXPHOS components are reduced after the deletion

7 of Pex genes (Peeters et al., 2015). We again found, however, that control and

8 Pex3-deficient MEFs did not differ significantly in their basal or ATP-linked rates

9 of oxygen consumption (Fig. 6, E and F), suggesting that the mitochondrial

10 OXPHOS system remains intact after Pex3 deletion in MEFs. Considering that

11 we did not observe overt ROS accumulation or altered oxygen consumption in

12 these cells, it was unlikely that an increase in ROS levels was responsible for the

13 induction of cytochrome c diffusion. Indeed, treatment of Pex3 KO MEFs with the

14 ROS scavenger N-acetylcysteine (NAC) did not suppress mitochondrial

15 fragmentation or cytochrome c diffusion, whereas such treatment did attenuate

16 the TBHP-induced increase in CellROX signal intensity (Fig. S5).

18 Promotion of Drp1 association with mitochondria by deletion of Pex3

19 Given that Drp1 plays a pivotal role in mitochondrial fragmentation (fission) and

20 cytochrome c release (Estaquier and Arnoult, 2007; Otera et al., 2016) and that

21 Drp1 localizes not only to mitochondria but also to peroxisomes (Tanaka et al.,

22 2006; Waterham et al., 2007), we examined whether Pex3 deletion affects the

23 abundance or subcellular localization of Drp1. Immunofluorescence analysis

24 showed that the amounts of Drp1 both in the cytosol and associated with

12 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 mitochondria appeared to increase in Pex3 KO MEFs compared with control

2 MEFs (Fig. 7 A). Importantly, the extent of colocalization of Drp1 with Tom20 was

3 significantly higher in Pex3-deficient MEFs than in control cells (Fig. 7 B),

4 indicating that Pex3 ablation results in an increased localization of Drp1 to

5 mitochondria.

6 To examine whether Drp1 is responsible for the mitochondrial

7 fragmentation and cytochrome c diffusion observed in Pex3 KO MEFs, we

8 suppressed the function of Drp1 by introducing a catalytically inactive mutant

9 (K38A) of the protein that has been shown to act in a dominant negative manner

10 (Frank et al., 2001). Expression of Drp1(K38A) indeed both restored the

11 elongated morphology of mitochondria and attenuated cytochrome c diffusion in

12 Pex3-deficient MEFs (Fig. 7 C–E). Together, these results thus suggested that

13 Pex3 deletion induces mitochondrial fragmentation and cytochrome c diffusion by

14 promoting the localization of Drp1 to mitochondria.

16 Caspase activation and enhanced stress-induced apoptosis in Pex3-

17 deficient cells

18 The release of cytochrome c from mitochondria triggers activation of the Apaf-1–

19 caspase-9 complex (apoptosome) and caspase-3 and thereby induces apoptosis

20 (Hyman and Yuan, 2012). We therefore examined the effect of Pex3 deletion on

21 caspase activity and found that the levels of the cleaved forms of caspase-9 and

22 caspase-3 were increased in Pex3 KO MEFs compared with control MEFs (Fig.

23 8, A and B). These results thus suggested that Pex3 suppresses the activation of

24 caspase-9 and caspase-3 under basal conditions in MEFs. In contrast, we did not

13 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 detect any significant difference in the fraction of annexin V–positive (apoptotic)

2 cells between control and Pex3-deficient MEFs (Fig. 8, C and D), suggesting that

3 caspase activation induced by Pex3 deletion is not sufficient to trigger apoptosis.

4 We hypothesized that the elevated basal activity of caspases in Pex3 KO

5 MEFs might increase the vulnerability of these cells to cellular stressors. To test

6 this notion, we treated peroxisome-deficient cells with the DNA-damaging agent

7 etoposide. Both Pex3-deficient MEFs and Pex5-deficient MEFs manifested

8 increased levels of caspase-3 activation in response to etoposide treatment

9 compared with the corresponding control MEFs (Fig. 8, E and F). Furthermore,

10 annexin V staining revealed that Pex3 KO MEFs underwent apoptosis to a

11 significantly greater extent than did control MEFs in response to etoposide

12 treatment (Fig. 8, G and H). These results thus suggested that peroxisomes

13 prevent excessive caspase activity and the induction of apoptosis, and that they

14 thereby increase the resistance of cells to cellular stress such as that associated

15 with DNA damage.

17 Discussion

18 Although the cooperation between peroxisomes and mitochondria with regard to

19 cellular metabolism has been extensively studied, the possible contribution of

20 peroxisomes to mitochondrial fission-fusion dynamics has remained largely

21 unknown. Our results now show that peroxisomes play a key role in determination

22 of the balance between mitochondrial fission and fusion, with this balance being

23 essential for a wide range of biological processes including cellular

24 responsiveness to stressors (Detmer and Chan, 2007; Khacho et al., 2016; Weir

14 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 et al., 2017). Indeed, our data also show that peroxisomes are important for

2 protection of cells from mitochondrion-dependent apoptosis in response to DNA

3 damage. Our study therefore provides a new basis for understanding the function

4 of peroxisomes.

5 We found that the loss of peroxisomes induced the fragmentation of

6 mitochondria, whereas some previous studies showed that the loss of

7 peroxisomes promoted the enlargement of mitochondria (Bülow et al., 2018;

8 Rahim et al., 2016). This difference may be attributable to the long-term ablation

9 of peroxins in these previous studies, which likely resulted in secondary effects

10 due to the accumulation of ROS and subsequent cellular damage. In the present

11 study, we took advantage of a MEF culture in which the intracellular ROS level

12 was not greatly increased after peroxin ablation and found that the mitochondrial

13 fragmentation and cytochrome c diffusion induced by peroxin gene deletion were

14 rescued by restoration of peroxin expression, indicating that these phenomena

15 are primary effects of peroxisomal loss.

16 The mechanism responsible for peroxisome-mediated regulation of

17 mitochondrial fission-fusion dynamics remains unknown. Given that the fission

18 and fusion machineries of both organelles share components such as Drp1 and

19 Fis1 in mammalian cells (Schrader, 2006; Tanaka et al., 2006; Waterham et al.,

20 2007), peroxisomes and mitochondria may compete for these components.

21 Indeed, we found that Pex3 deletion increased Drp1 localization to mitochondria

22 and that inhibition of Drp1 rescued mitochondrial fragmentation in Pex3 KO MEFs.

23 These results thus implicate Drp1 function involved in the peroxisome-mediated

24 regulation of mitochondrial dynamics. Several studies have also shown that

15 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 peroxisomes are located adjacent to MAMs, which are described as

2 mitochondrial constriction sites (Cohen et al., 2014; Friedman et al., 2011; Horner

3 et al., 2011; Mattiazzi Usaj et al., 2015). Given that peroxisomes also make

4 physical contact with mitochondria (Fransen et al., 2017), these observations

5 raise the possibility that peroxisomes compete with ER for mitochondrial contact

6 sites. Whether peroxisomes actually regulate MAM formation warrants future

7 study. Furthermore, a recent study showed that lysosomes also make contacts

8 with mitochondria and regulate mitochondrial fission (Wong et al., 2018). Indeed,

9 >80% of mitochondrial fission sites were found to contact lysosomes, whereas

10 <20% of such sites contacted peroxisomes. Peroxisome-mitochondrion contacts

11 may thus hamper or promote the interaction between lysosomes and

12 mitochondria, resulting in modulation of the mitochondrial fission process.

13 Together, these previous and present observations reveal multiple types of

14 interorganellar communication that coordinately regulate mitochondrial fission-

15 fusion dynamics.

16 In this study, we propose that Drp1 mediates mitochondrial fragmentation

17 and subsequent cytochrome c diffusion in peroxisome-deficient cells. However,

18 it remains unknown what molecular mechanism underlies cytochrome c diffusion

19 after Drp1-mediated mitochondrial fragmentation in peroxisome-deficient cells.

20 One possibility is that peroxisomes compete with mitochondria for some

21 components necessary for cytochrome c diffusion. Cytochrome c is known to be

22 released through the pore composed of the Bcl-2 family members BAX and BAK

23 at the outer membrane of mitochondria (Tait and Green, 2010). Intriguingly, Fujiki

24 and colleagues reported that a fraction of BAK also localizes to peroxisomes

16 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 (Hosoi et al., 2017). Elimination of peroxisomes may thus alter BAK’s localization

2 from peroxisomes to mitochondria, and the increased mitochondrial BAK may

3 thereby facilitate cytochrome c diffusion in peroxisome-deficient cells. It would be

4 important to test the notion that molecules shared by mitochondria and

5 peroxisomes mediate their interorganellar communications.

6 Our results revealed not only the fragmentation of mitochondria in

7 response to the loss of peroxisomes, but also the elongation of mitochondria in

8 response to treatment of cells with the peroxisome proliferator 4-PBA. These

9 findings suggest that peroxisomal abundance is an important determinant of

10 mitochondrial dynamics. Cellular conditions that affect the abundance of

11 peroxisomes might thus also influence mitochondrial dynamics through

12 peroxisomes. In this regard, cellular stressors such as UV light exposure and

13 elevated ROS levels increase the number of peroxisomes in both plant and

14 mammalian cells (Schrader and Fahimi, 2006). This increase in peroxisomal

15 number or abundance may thus contribute to a protective response to allow cells

16 to cope with stress via suppression of mitochondrial fragmentation and caspase

17 activation. Such a notion is consistent with our present results showing that

18 peroxisomes reduce cellular sensitivity to toxic insults.

19 Fatty acids, such as oleic acid, and a high-fat diet are also thought to

20 increase the abundance of peroxisomes (Diano et al., 2011; Ishii et al., 1980;

21 Lock et al., 1989; Reddy and Mannaerts, 1994; Veenhuis et al., 1987). It would

22 thus be of interest to determine whether the high level of fatty acid synthesis

23 apparent in adult neural stem-progenitor cells (Knobloch et al., 2013) confers

24 resistance to cellular stress through an increase in the number of peroxisomes.

17 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Indeed, the abundance of peroxisomes is known to be high in radial glia cells

2 preserved for a long period and to be reduced by aging (Ahlemeyer et al., 2007),

3 with such changes possibly having consequences for mitochondrial regulation in

4 these cells.

5 Mitochondrion-dependent activation of caspases contributes not only to

6 removal of unnecessary cells during development or damaged cells exposed to

7 stress stimuli but also to regulation of tissue stem cell differentiation and terminal

8 differentiation of myoblasts, erythroblasts, and keratinocytes (Hollville and

9 Deshmukh, 2017). Furthermore, nonapoptotic caspase activation plays a key

10 regulatory role in the pruning of neurites and the formation and maturation of

11 neural circuits in the nervous system (Unsain and Barker, 2015). For example,

12 caspase-9 is necessary for axon pruning in dorsal root ganglion neurons and

13 cervical sympathetic neurons (Cusack et al., 2013; Simon et al., 2012).

14 Nonapoptotic caspase activation is also implicated in regulation of the

15 internalization of AMPA-sensitive glutamate receptors, which contributes to long-

16 term depression in hippocampal neurons (Li et al., 2010). Nonapoptotic activation

17 of caspases is thus essential for the control of various cellular processes. The

18 activation of caspases at a sublethal level in peroxisome-deficient cells observed

19 in the present study suggests that peroxisomes limit caspase activation under

20 low-stress conditions. It will be of interest to examine the possible role of

21 peroxisomes in various biological processes that require nonapoptotic caspase

22 activation.

23 Individuals with Zellweger syndrome and peroxin-deficient mice manifest

24 severe defects in various organs including the brain, bone, muscle, kidney and

18 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 liver. The mechanisms underlying this broad range of abnormalities remain

2 unknown, however. Dysfunction of the mitochondrial fusion machinery also gives

3 rise to neurodegenerative diseases, muscle atrophy, and osteogenic

4 abnormalities (Chen et al., 2010; Detmer and Chan, 2007; Romanello et al., 2010;

5 Touvier et al., 2015). Degeneration of Purkinje cells, one of the most prominent

6 features of patients with Zellweger syndrome (Barry and O'Keeffe, 2013;

7 Trompier et al., 2014), is thus also observed in mice with Purkinje cell–specific

8 deficiency of Mfn2 (Chen et al., 2007). The peroxisome-dependent regulation of

9 mitochondria uncovered in the present study therefore raises the possibility that

10 excessive mitochondrial fragmentation plays a causal role in the pathogenesis of

11 Zellweger syndrome. If so, our findings may provide a basis for the development

12 of new therapies for this lethal disease.

15 Materials and methods

17 Immunoblot analysis

18 Immunoblot analysis was performed as described previously (Okazaki et al.,

19 2013). Immune complexes were detected with a chemiluminescence reagent

20 [100 mM Tris-HCl (pH 8.5), 1.25 mM luminol, 0.2 mM coumaric acid, 0.009%

21 H2O2] and an Image Quant LAS4000 instrument (GE Healthcare). Blot intensities

22 were measured with Image J software.

24 Immunofluorescence microscopy

19 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Cells were fixed with 4% formaldehyde for 10 minutes at 37C, permeabilized

2 with 0.2% Triton X-100 in PBS for 5 minutes, and incubated for 30 minutes in

3 PBS containing 2% FBS and 2% BSA (blocking buffer). They were then exposed

4 first for 24 hours at 4°C to primary antibodies in blocking buffer and then for 1

5 hour at room temperature to Alexa Fluor–conjugated secondary antibodies

6 (Thermo Fisher Scientific) and Hoechst 33342 in blocking buffer. Moviol were

7 used as mounting medium. Images were acquired with a TCS SP5 confocal

8 microscope (Leica) and were processed with Photoshop CS software (Adobe).

9 Pearson’s correlation coefficient (r) for the colocalization of Tom20 and

10 cytochrome c as well as Manders’ M1 coefficient for the colocalization of Tom20

11 and Drp1 were calculated with Coloc 2 of Fiji.

13 Morphological quantification of mitochondria

14 In Figure S2, samples were prepared in the same way as in the

15 immunofluorescence experiments, except that ProLong Diamond were used as

16 mounting medium. Images were deconvoluted in Huygens software (Scientific

17 Volume Imaging). After the deconvolution process, voxels and length of

18 mitochondria were calculated with object analyzer, Huygens. 35 and 30 images

19 for Control and Pex3 KO MEFs respectively, from three independent experiment

20 were analyzed in this quantification.

22 EM

23 Cells were fixed in 0.1 M phosphate buffer (pH 7.2) containing 2% glutaraldehyde

24 and 2% paraformaldehyde, exposed to 1% OsO4, dehydrated, and embedded in

20 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Epon 812. Ultrathin sections (60 nm) were cut with an ultramicrotome (UC6, Leica

2 Microsystems), stained with uranyl acetate and lead citrate, and examined with a

3 Hitachi HT7700 electron microscope. The area and major axis of mitochondria in

4 images were measured with the use of Fiji software.

6 Measurement of ROS

7 Cells were incubated with 5 μM MitoSOX or 500 nM CellROX for 30 minutes at

8 37°C, isolated by exposure to trypsin, and resuspended in PBS containing 3%

9 FBS for analysis with a FACSAria flow cytometer (BD Biosciences).

11 Measurement of oxygen consumption rate

12 The oxygen consumption rate (OCR) of cells was measured with the use of a

13 Seahorse XF24 Extracellular Flux Analyzer (Seahorse Biosciences). Cells were

14 plated in 24-well Seahorse plates and cultured overnight, after which the medium

15 was replaced with Seahorse XF Base medium supplemented with 10 mM glucose,

16 1 mM pyruvate, and GlutaMAX (2 ml/liter, Thermo Fisher Scientific). The cells

17 were placed in a 37C incubator without CO2 before loading into the analyzer.

18 After measurement of basal respiration, the cells were exposed to 1 μM

19 oligomycin to measure the proton leak, to 1 μM carbonylcyanide m-

20 chlorophenylhydrazone (CCCP) to measure the maximal OCR, and to 0.5 μM

21 rotenone and 0.5 μM antimycin A to measure the nonmitochondrial OCR. The

22 ATP-linked OCR was calculated by a subtraction proton leak from basal OCR.

23 Cells plated simultaneously in 96-well plates were counted to normalize OCR

24 values.

21 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

2 Annexin V binding assay

3 Cells were stained with Cy5-coupled annexin V (Promokine) according to the

4 manufacturer’s instructions. Flow cytometric analysis of the stained cells was

5 performed with a FACSAria flow cytometer (BD Biosciences).

7 Cell culture and transfection

8 MEFs and Plat-E cells (Morita et al., 2000) were maintained in DMEM

9 supplemented with 10% FBS and 1% penicillin-streptomycin. Plat-E cells were

10 transfected with the use of the GeneJuice Transfection Reagent (Merck Millipore),

11 whereas transfection of MEFs was performed with Lipofectamine 2000 or with

12 Lipofectamine and PLUS Reagents (Thermo Fisher Scientific).

14 Deletion of Pex3

15 C57BL/6 mice harboring the Pex3tm3a(EUCOMM)Wtsi allele obtained from the EUCOMM

16 (European Conditional Mouse Mutagenesis Program) consortium were crossed

17 with Act-FLP transgenic mice (Kono et al., 2017) to remove the FRT-flanked

18 region and subsequently with Rosa-CreERT2 transgenic mice (obtained from the

19 U.S. National Cancer Institute) (Fig. S1). Mice heterozygous for the floxed allele

20 of Pex3 were mated, and the resulting homozygous embryos were isolated for

21 preparation of MEFs. The MEFs were immortalized by the introduction of SV40

22 large T antigen as described previously (Ando et al., 2000), and they were then

23 treated with 1 nM 4-hydroxytamoxifen to remove the loxP-flanked region.

22 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Immortalized MEFs treated with ethanol vehicle instead of 4-hydroxytamoxifen

2 were prepared as control cells.

4 Deletion of Pex5

5 3T3 MEFs (kindly provided by H. Ichijo) were transfected with the KO vector (see

6 Plasmids below) and were then sorted with a FACSAria flow cytometer (BD

7 Biosciences) to obtain GFP-positive cells, which were seeded as single cells in a

8 96-well plate.

10 Genomic PCR analysis

11 For confirmation of Pex5 deletion in MEFs, the cells were collected and lysed with

12 genotyping buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, gelatin

13 (0.1 mg/ml), 0.45 % NP-40, 0.45% Tween 20, proteinase K (500 μg/ml, Kanto

14 Chemical)] or lysis buffer [1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.1)] and

15 were then incubated consecutively at 55°C for 3 hours and 98°C for 10 minutes.

16 The Pex5 locus was amplified by PCR with the use of KOD FX Neo (Toyobo) and

17 the forward and reverse primers 5-

18 TCCCTTCCCCCAGCCCACTCCGGGTGCCTC-3 and 5-

19 TCGGCGATGAATTCTTGGGACCAGTCGGTCTCATT-3, respectively. The

20 PCR products were ligated into PCR-Blunt (Thermo Fisher Scientific) for

21 sequencing by Eurofin Genomics.

23 Retrovirus-mediated expression of Pex3 or Pex5, Drp1(K38A)

23 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Plat-E cells were transfected with pMXs-IG or either pMXs-Pex3-IG vector

2 encoding human Pex3 or pMXs-Pex5S-IG vectors encoding Chinese hamster

3 Pex5S, or pMXs-Drp1(K38A)-IG vector encoding rat Drp1(K38A) (Morita et al.,

4 2000). After three days, the culture supernatants were harvested for isolation of

5 retroviruses. Pex3 KO or Pex5 KO MEFs were infected with the corresponding

6 peroxin retrovirus or the control virus, after which the cells were sorted with a

7 FACSAria flow cytometer (BD Biosciences) to obtain GFP-positive cells. For

8 preparing Drp1(K38A) infected cells, Pex3 KO MEFs were infected with the

9 Drp1(K38A) retrovirus or the control virus and infected cells were sorted in the

10 same way as above.

12 Plasmids

13 The plasmid pUcD2Hyg/EGFP-PTS1 was described previously (Tamura et al.,

14 1998). Full-length cDNAs for human Pex3 or Chinese hamster Pex5S (His-

15 ClPex5S-HA) (Ghaedi et al., 2000; Matsumura et al., 2000) were subcloned into

16 the BamHI and XhoI sites of the pMXs-IG vector (kindly provided by T. Kitamura).

17 The p3xFLAG-ratDrp1K38A plasmid encoding rat Drp1(K38A) was kindly

18 provided by N. Ishihara. Full-length cDNAs for rat Drp1(K38A) were subcloned

19 into the EcoRI and XhoI sites of the pMXs-IG vector. For generation of the

20 CRISPR vector for Pex5 deletion, a pair of oligonucleotides encoding the gRNA

21 (forward, 5-CACCGCTGGTCACCATGGCAATGC-3; reverse, 5-

22 AAACGCATTGCCATGGTGACCAGC-3) was annealed and ligated into the

23 px458 vector (Ran et al., 2013).

24 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Reagents

2 NAC was obtained from Sigma-Aldrich. Etoposide, Hoechst 33342, a CellROX

3 Green Flow Cytometry Assay Kit (including TBHP, NAC), ProLong Diamond, and

4 MitoSOX Red Reagents were obtained from Thermo Fisher Scientific. Seahorse

5 XF Cell Mito Stress Test Kit were obtained from Primetech. 4-PBA was obtained

6 from Tocris.

8 Antibodies

9 Polyclonal and monoclonal antibodies to cleaved caspase-3 were obtained from

10 Cell Signaling; antibodies to p38 and to Tom20 were from Santa Cruz

11 Biotechnology; those to α-tubulin were from Sigma; those to cytochrome c and to

12 Drp1 were from BD Pharmingen; those to Pex14 were from Proteintech; those to

13 Pex3 were from Atlas Antibodies; those to ATP synthase β were from Thermo

14 Fisher Scientific; those to caspase-9 were from MBL Life Science; and those to

15 Pex5 were described previously (Okumoto et al., 2014).

17 Statistical analysis

18 Quantitative data are presented as means ± SEM and were compared with

19 Scheffe’s test or the unpaired Student’s t test. A P value of <0.05 was considered

20 statistically significant.

23 Acknowledgments

25 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 We thank M. Okajima (Graduate School of Pharmaceutical Sciences, The

2 University of Tokyo) for technical assistance, N. Ishihara (Institute of Life Science,

3 Kurume University) and T. Kitamura (The institute of Medical Sciences, The

4 University of Tokyo) for providing the plasmids, H. Ichijo (Graduate School of

5 Pharmaceutical Sciences, The University of Tokyo) for providing the cells. We

6 also appreciate our laboratory members for discussions.

9 Competing interests

10 The authors declare no competing financial interests.

13 Funding

14 This work was supported by a Grant-in-Aid from the Ministry of Education, Culture,

15 Sports, Science, and Technology (MEXT) of Japan; by Core Research for

16 Evolutionary Science and Technology of the Japan Science and Technology

17 Agency; in part by research fellowships from the Japan Society for the Promotion

18 of Science (JSPS) and the Global Centers of Excellence Program (Integrative

19 Life Science Based on the Study of Biosignaling Mechanisms) of MEXT; by the

20 Graduate Program for Leaders in Life Innovation, The University of Tokyo Life

21 Innovation Leading Graduate School, of MEXT; and by JSPS KAKENHI grants

22 JP16H05773, JP16H06280 and JP18J14098.

26 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 References

3 Ahlemeyer, B., Neubert, I., Kovacs, W. J. and Baumgart-Vogt, E. (2007). Differential

4 expression of peroxisomal matrix and membrane proteins during postnatal development of mouse

5 brain. J Comp Neurol 505, 1-17.

6 Ando, H., Kobayashi, M., Toda, S., Kikkawa, F., Masahashi, T. and Mizutani, S. (2000).

7 Establishment of a ciliated epithelial cell line from human Fallopian tube. Hum Reprod 15, 1597-

8 603.

9 Baes, M., Gressens, P., Baumgart, E., Carmeliet, P., Casteels, M., Fransen, M., Evrard,

10 P., Fahimi, D., Declercq, P. E., Collen, D. et al. (1997). A mouse model for Zellweger syndrome.

11 Nat Genet 17, 49-57.

12 Barry, D. S. and O'Keeffe, G. W. (2013). Peroxisomes: the neuropathological

13 consequences of peroxisomal dysfunction in the developing brain. Int J Biochem Cell Biol 45,

14 2012-5.

15 Baumgart, E., Vanhorebeek, I., Grabenbauer, M., Borgers, M., Declercq, P. E., Fahimi,

16 H. D. and Baes, M. (2001). Mitochondrial alterations caused by defective peroxisomal biogenesis

17 in a mouse model for Zellweger syndrome (PEX5 knockout mouse). Am J Pathol 159, 1477-94.

18 Bülow, M. H., Wingen, C., Senyilmaz, D., Gosejacob, D., Sociale, M., Bauer, R., Schulze,

19 H., Sandhoff, K., Teleman, A. A., Hoch, M. et al. (2018). Unbalanced lipolysis results in lipotoxicity

20 and mitochondrial damage in peroxisome-deficient. Mol Biol Cell 29, 396-407.

21 Camões, F., Bonekamp, N. A., Delille, H. K. and Schrader, M. (2009). Organelle

22 dynamics and dysfunction: A closer link between peroxisomes and mitochondria. J Inherit Metab

23 Dis 32, 163-80.

24 Chen, H., McCaffery, J. M. and Chan, D. C. (2007). Mitochondrial fusion protects

27 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 against neurodegeneration in the cerebellum. Cell 130, 548-62.

2 Chen, H., Vermulst, M., Wang, Y. E., Chomyn, A., Prolla, T. A., McCaffery, J. M. and

3 Chan, D. C. (2010). Mitochondrial fusion is required for mtDNA stability in skeletal muscle and

4 tolerance of mtDNA mutations. Cell 141, 280-9.

5 Cohen, Y., Klug, Y. A., Dimitrov, L., Erez, Z., Chuartzman, S. G., Elinger, D., Yofe, I.,

6 Soliman, K., Gärtner, J., Thoms, S. et al. (2014). Peroxisomes are juxtaposed to strategic sites on

7 mitochondria. Mol Biosyst 10, 1742-8.

8 Cusack, C. L., Swahari, V., Hampton Henley, W., Michael Ramsey, J. and Deshmukh, M.

9 (2013). Distinct pathways mediate axon degeneration during apoptosis and axon-specific pruning.

10 Nat Commun 4, 1876.

11 Delille, H. K., Alves, R. and Schrader, M. (2009). Biogenesis of peroxisomes and

12 mitochondria: linked by division. Histochem Cell Biol 131, 441-6.

13 Detmer, S. A. and Chan, D. C. (2007). Functions and dysfunctions of mitochondrial

14 dynamics. Nat Rev Mol Cell Biol 8, 870-9.

15 Diano, S., Liu, Z. W., Jeong, J. K., Dietrich, M. O., Ruan, H. B., Kim, E., Suyama, S.,

16 Kelly, K., Gyengesi, E., Arbiser, J. L. et al. (2011). Peroxisome proliferation-associated control of

17 reactive oxygen species sets melanocortin tone and feeding in diet-induced obesity. Nat Med 17,

18 1121-7.

19 Dixit, E., Boulant, S., Zhang, Y., Lee, A. S., Odendall, C., Shum, B., Hacohen, N., Chen,

20 Z. J., Whelan, S. P., Fransen, M. et al. (2010). Peroxisomes are signaling platforms for antiviral

21 innate immunity. Cell 141, 668-81.

22 Estaquier, J. and Arnoult, D. (2007). Inhibiting Drp1-mediated mitochondrial fission

23 selectively prevents the release of cytochrome c during apoptosis. Cell Death Differ 14, 1086-94.

24 Frank, S., Gaume, B., Bergmann-Leitner, E. S., Leitner, W. W., Robert, E. G., Catez, F.,

28 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Smith, C. L. and Youle, R. J. (2001). The role of dynamin-related protein 1, a mediator of

2 mitochondrial fission, in apoptosis. Dev Cell 1, 515-25.

3 Fransen, M., Lismont, C. and Walton, P. (2017). The Peroxisome-Mitochondria

4 Connection: How and Why? Int J Mol Sci 18.

5 Friedman, J. R., Lackner, L. L., West, M., DiBenedetto, J. R., Nunnari, J. and Voeltz, G.

6 K. (2011). ER tubules mark sites of mitochondrial division. Science 334, 358-62.

7 Fujiki, Y., Yagita, Y. and Matsuzaki, T. (2012). Peroxisome biogenesis disorders:

8 molecular basis for impaired peroxisomal membrane assembly: in metabolic functions and

9 biogenesis of peroxisomes in health and disease. Biochim Biophys Acta 1822, 1337-42.

10 Ghaedi, K., Tamura, S., Okumoto, K., Matsuzono, Y. and Fujiki, Y. (2000). The peroxin

11 pex3p initiates membrane assembly in peroxisome biogenesis. Mol Biol Cell 11, 2085-102.

12 Goldfischer, S., Moore, C. L., Johnson, A. B., Spiro, A. J., Valsamis, M. P., Wisniewski,

13 H. K., Ritch, R. H., Norton, W. T., Rapin, I. and Gartner, L. M. (1973). Peroxisomal and

14 mitochondrial defects in the cerebro-hepato-renal syndrome. Science 182, 62-4.

15 Hollville, E. and Deshmukh, M. (2017). Physiological functions of non-apoptotic

16 caspase activity in the nervous system. Semin Cell Dev Biol.

17 Hoppins, S. and Nunnari, J. (2012). Cell Biology. Mitochondrial dynamics and

18 apoptosis--the ER connection. Science 337, 1052-4.

19 Horner, S. M., Liu, H. M., Park, H. S., Briley, J. and Gale, M. (2011). Mitochondrial-

20 associated endoplasmic reticulum membranes (MAM) form innate immune synapses and are

21 targeted by hepatitis C virus. Proc Natl Acad Sci U S A 108, 14590-5.

22 Hosoi, K. I., Miyata, N., Mukai, S., Furuki, S., Okumoto, K., Cheng, E. H. and Fujiki, Y.

23 (2017). The VDAC2-BAK axis regulates peroxisomal membrane permeability. J Cell Biol 216,

24 709-722.

29 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Hyman, B. T. and Yuan, J. (2012). Apoptotic and non-apoptotic roles of caspases in

2 neuronal physiology and pathophysiology. Nat Rev Neurosci 13, 395-406.

3 Ishii, H., Fukumori, N., Horie, S. and Suga, T. (1980). Effects of fat content in the diet

4 on hepatic peroxisomes of the rat. Biochim Biophys Acta 617, 1-11.

5 Khacho, M., Clark, A., Svoboda, D. S., Azzi, J., MacLaurin, J. G., Meghaizel, C., Sesaki,

6 H., Lagace, D. C., Germain, M., Harper, M. E. et al. (2016). Mitochondrial Dynamics Impacts Stem

7 Cell Identity and Fate Decisions by Regulating a Nuclear Transcriptional Program. Cell Stem Cell

8 19, 232-247.

9 Knobloch, M., Braun, S. M., Zurkirchen, L., von Schoultz, C., Zamboni, N., Araúzo-

10 Bravo, M. J., Kovacs, W. J., Karalay, O., Suter, U., Machado, R. A. et al. (2013). Metabolic control

11 of adult neural stem cell activity by Fasn-dependent lipogenesis. Nature 493, 226-30.

12 Kobayashi, S., Tanaka, A. and Fujiki, Y. (2007). Fis1, DLP1, and Pex11p coordinately

13 regulate peroxisome morphogenesis. Exp Cell Res 313, 1675-86.

14 Kono, J., Konno, K., Talukder, A. H., Fuse, T., Abe, M., Uchida, K., Horio, S., Sakimura,

15 K., Watanabe, M. and Itoi, K. (2017). Distribution of corticotropin-releasing factor neurons in the

16 mouse brain: a study using corticotropin-releasing factor-modified yellow fluorescent protein

17 knock-in mouse. Brain Struct Funct 222, 1705-1732.

18 Lee, J. E., Westrate, L. M., Wu, H., Page, C. and Voeltz, G. K. (2016). Multiple dynamin

19 family members collaborate to drive mitochondrial division. Nature 540, 139-143.

20 Li, Z., Jo, J., Jia, J. M., Lo, S. C., Whitcomb, D. J., Jiao, S., Cho, K. and Sheng, M. (2010).

21 Caspase-3 activation via mitochondria is required for long-term depression and AMPA receptor

22 internalization. Cell 141, 859-71.

23 Lismont, C., Nordgren, M., Van Veldhoven, P. P. and Fransen, M. (2015). Redox

24 interplay between mitochondria and peroxisomes. Front Cell Dev Biol 3, 35.

30 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Lock, E. A., Mitchell, A. M. and Elcombe, C. R. (1989). Biochemical mechanisms of

2 induction of hepatic peroxisome proliferation. Annu Rev Pharmacol Toxicol 29, 145-63.

3 Matsumura, T., Otera, H. and Fujiki, Y. (2000). Disruption of the interaction of the

4 longer isoform of Pex5p, Pex5pL, with Pex7p abolishes peroxisome targeting signal type 2 protein

5 import in mammals. Study with a novel Pex5-impaired Chinese hamster ovary cell mutant. J Biol

6 Chem 275, 21715-21.

7 Mattiazzi Usaj, M., Brloznik, M., Kaferle, P., Zitnik, M., Wolinski, H., Leitner, F.,

8 Kohlwein, S. D., Zupan, B. and Petrovic, U. (2015). Genome-Wide Localization Study of Yeast

9 Pex11 Identifies Peroxisome-Mitochondria Interactions through the ERMES Complex. J Mol Biol

10 427, 2072-87.

11 Maxwell, M., Bjorkman, J., Nguyen, T., Sharp, P., Finnie, J., Paterson, C., Tonks, I.,

12 Paton, B. C., Kay, G. F. and Crane, D. I. (2003). Pex13 inactivation in the mouse disrupts

13 peroxisome biogenesis and leads to a Zellweger syndrome phenotype. Mol Cell Biol 23, 5947-57.

14 Morita, S., Kojima, T. and Kitamura, T. (2000). Plat-E: an efficient and stable system

15 for transient packaging of retroviruses. Gene Ther 7, 1063-6.

16 Muntau, A. C., Mayerhofer, P. U., Paton, B. C., Kammerer, S. and Roscher, A. A. (2000).

17 Defective peroxisome membrane synthesis due to mutations in human PEX3 causes Zellweger

18 syndrome, complementation group G. Am J Hum Genet 67, 967-75.

19 Okazaki, T., Higuchi, M. and Gotoh, Y. (2013). Mitochondrial localization of the

20 antiviral signaling adaptor IPS-1 is important for its induction of caspase activation. Genes Cells

21 18, 493-501.

22 Okumoto, K., Noda, H. and Fujiki, Y. (2014). Distinct modes of ubiquitination of

23 peroxisome-targeting signal type 1 (PTS1) receptor Pex5p regulate PTS1 protein import. J Biol

24 Chem 289, 14089-108.

31 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Otera, H., Miyata, N., Kuge, O. and Mihara, K. (2016). Drp1-dependent mitochondrial

2 fission via MiD49/51 is essential for apoptotic cristae remodeling. J Cell Biol 212, 531-44.

3 Otera, H., Okumoto, K., Tateishi, K., Ikoma, Y., Matsuda, E., Nishimura, M., Tsukamoto,

4 T., Osumi, T., Ohashi, K., Higuchi, O. et al. (1998). Peroxisome targeting signal type 1 (PTS1)

5 receptor is involved in import of both PTS1 and PTS2: studies with PEX5-defective CHO cell

6 mutants. Mol Cell Biol 18, 388-99.

7 Peeters, A., Shinde, A. B., Dirkx, R., Smet, J., De Bock, K., Espeel, M., Vanhorebeek, I.,

8 Vanlander, A., Van Coster, R., Carmeliet, P. et al. (2015). Mitochondria in peroxisome-deficient

9 hepatocytes exhibit impaired respiration, depleted DNA, and PGC-1α independent proliferation.

10 Biochim Biophys Acta 1853, 285-98.

11 Prudent, J., Zunino, R., Sugiura, A., Mattie, S., Shore, G. C. and McBride, H. M. (2015).

12 MAPL SUMOylation of Drp1 Stabilizes an ER/Mitochondrial Platform Required for Cell Death.

13 Mol Cell 59, 941-55.

14 Rahim, R. S., Chen, M., Nourse, C. C., Meedeniya, A. C. and Crane, D. I. (2016).

15 Mitochondrial changes and oxidative stress in a mouse model of Zellweger syndrome

16 neuropathogenesis. Neuroscience 334, 201-213.

17 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A. and Zhang, F. (2013).

18 Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308.

19 Reddy, J. K. and Mannaerts, G. P. (1994). Peroxisomal lipid metabolism. Annu Rev

20 Nutr 14, 343-70.

21 Romanello, V., Guadagnin, E., Gomes, L., Roder, I., Sandri, C., Petersen, Y., Milan, G.,

22 Masiero, E., Del Piccolo, P., Foretz, M. et al. (2010). Mitochondrial fission and remodelling

23 contributes to muscle atrophy. EMBO J 29, 1774-85.

24 Salpietro, V., Phadke, R., Saggar, A., Hargreaves, I. P., Yates, R., Fokoloros, C., Mankad,

32 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 K., Hertecant, J., Ruggieri, M., McCormick, D. et al. (2015). Zellweger syndrome and secondary

2 mitochondrial myopathy. Eur J Pediatr 174, 557-63.

3 Schrader, M. (2006). Shared components of mitochondrial and peroxisomal division.

4 Biochim Biophys Acta 1763, 531-41.

5 Schrader, M. and Fahimi, H. D. (2006). Peroxisomes and oxidative stress. Biochim

6 Biophys Acta 1763, 1755-66.

7 Schrader, M. and Yoon, Y. (2007). Mitochondria and peroxisomes: are the 'big brother'

8 and the 'little sister' closer than assumed? Bioessays 29, 1105-14.

9 Simon, D. J., Weimer, R. M., McLaughlin, T., Kallop, D., Stanger, K., Yang, J., O'Leary,

10 D. D., Hannoush, R. N. and Tessier-Lavigne, M. (2012). A caspase cascade regulating

11 developmental axon degeneration. J Neurosci 32, 17540-53.

12 Suen, D. F., Norris, K. L. and Youle, R. J. (2008). Mitochondrial dynamics and apoptosis.

13 Genes Dev 22, 1577-90.

14 Tait, S. W. and Green, D. R. (2010). Mitochondria and cell death: outer membrane

15 permeabilization and beyond. Nat Rev Mol Cell Biol 11, 621-32.

16 Tamura, S., Okumoto, K., Toyama, R., Shimozawa, N., Tsukamoto, T., Suzuki, Y., Osumi,

17 T., Kondo, N. and Fujiki, Y. (1998). Human PEX1 cloned by functional complementation on a

18 CHO cell mutant is responsible for peroxisome-deficient Zellweger syndrome of complementation

19 group I. Proc Natl Acad Sci U S A 95, 4350-5.

20 Tanaka, A., Kobayashi, S. and Fujiki, Y. (2006). Peroxisome division is impaired in a

21 CHO cell mutant with an inactivating point-mutation in dynamin-like protein 1 gene. Exp Cell

22 Res 312, 1671-84.

23 Touvier, T., De Palma, C., Rigamonti, E., Scagliola, A., Incerti, E., Mazelin, L., Thomas,

24 J. L., D'Antonio, M., Politi, L., Schaeffer, L. et al. (2015). Muscle-specific Drp1 overexpression

33 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 impairs skeletal muscle growth via translational attenuation. Cell Death Dis 6, e1663.

2 Trompier, D., Vejux, A., Zarrouk, A., Gondcaille, C., Geillon, F., Nury, T., Savary, S. and

3 Lizard, G. (2014). Brain peroxisomes. Biochimie 98, 102-10.

4 Unsain, N. and Barker, P. A. (2015). New Views on the Misconstrued: Executioner

5 Caspases and Their Diverse Non-apoptotic Roles. Neuron 88, 461-74.

6 Veenhuis, M., Mateblowski, M., Kunau, W. H. and Harder, W. (1987). Proliferation of

7 microbodies in Saccharomyces cerevisiae. Yeast 3, 77-84.

8 Wang, C. and Youle, R. J. (2009). The role of mitochondria in apoptosis*. Annu Rev

9 Genet 43, 95-118.

10 Waterham, H. R. and Ebberink, M. S. (2012). Genetics and molecular basis of human

11 peroxisome biogenesis disorders. Biochim Biophys Acta 1822, 1430-41.

12 Waterham, H. R., Koster, J., van Roermund, C. W., Mooyer, P. A., Wanders, R. J. and

13 Leonard, J. V. (2007). A lethal defect of mitochondrial and peroxisomal fission. N Engl J Med 356,

14 1736-41.

15 Weir, H. J., Yao, P., Huynh, F. K., Escoubas, C. C., Goncalves, R. L., Burkewitz, K., Laboy,

16 R., Hirschey, M. D. and Mair, W. B. (2017). Dietary Restriction and AMPK Increase Lifespan via

17 Mitochondrial Network and Peroxisome Remodeling. Cell Metab 26, 884-896.e5.

18 Westermann, B. (2010). Mitochondrial fusion and fission in cell life and death. Nat Rev

19 Mol Cell Biol 11, 872-84.

20 Wong, Y. C., Ysselstein, D. and Krainc, D. (2018). Mitochondria-lysosome contacts

21 regulate mitochondrial fission via RAB7 GTP hydrolysis. Nature 554, 382-386.

22 Yang, Z., Zhao, X., Xu, J., Shang, W. and Tong, C. (2018). A novel fluorescent reporter

23 detects plastic remodeling of mitochondria-ER contact sites. J Cell Sci 131.

34 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

35 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Figure 1. Deletion of Pex3 induces mitochondrial fragmentation. (A)

2 Immunoblot analysis of control and Pex3 KO MEFs with antibodies to Pex3 and

3 to p38 (loading control). Data are representative of three independent

4 experiments. (B) Immunofluorescence staining of control and Pex3 KO MEFs

5 expressing EGFP-PTS1 with antibodies to Pex14. Nuclei were stained with

6 Hoechst 33342. Scale bars, 20 μm. Data are representative of three independent

7 experiments. (C) Immunofluorescence staining of control and Pex3 KO MEFs

8 with antibodies to Tom20. The boxed regions in the upper panels are shown at

9 higher magnification in the lower panels. Scale bars, 20 μm. (D) Quantification of

10 mitochondrial fragmentation in control and Pex3 KO MEFs determined from

11 images as in (C). Data are means ± SEM from three independent experiments.

12 ***P < 0.005 (unpaired Student’s t test). (E) Immunoblot analysis of Pex3 in Pex3

13 KO MEFs infected with retroviruses encoding GFP either alone (pMXs-IG) or

14 together with Pex3 (pMXs-Pex3-IG). Data are representative of three

15 independent experiments. (F) Cells as in (E) were subjected to

16 immunofluorescence staining with antibodies to Pex14. Nuclei were stained with

17 Hoechst 33342. Scale bars, 20 μm. Data are representative of three independent

18 experiments. (G) Cells as in (E) were subjected to immunofluorescence staining

19 with antibodies to Tom20. The boxed regions in the upper panels are shown at

20 higher magnification in the lower panels. Scale bars, 20 μm. (H) Quantification of

21 mitochondrial fragmentation in images similar to those in (G). Data are means ±

22 SEM from three independent experiments. *P < 0.05 (unpaired Student’s t test).

36 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Figure 2. Deletion of Pex5 induces mitochondrial fragmentation. (A)

2 Immunoblot analysis of Pex5 in control and Pex5 KO MEFs. Data are

3 representative of three independent experiments. (B) Immunofluorescence

4 analysis of Tom20 in control and Pex5 KO MEFs. The boxed regions in the upper

5 panels are shown at higher magnification in the lower panels. Scale bars, 20 μm.

6 (C) Quantification of mitochondrial fragmentation in control and Pex5 KO MEFs

7 determined from images as in (B). Data are means ± SEM from three

8 independent experiments. *P < 0.05 (unpaired Student’s t test). (D) Immunoblot

9 analysis of Pex5 in Pex5 KO MEFs infected with retroviruses encoding GFP

10 either alone (pMXs-IG) or together with Pex5S (pMXs-Pex5S-IG). Data are

11 representative of three independent experiments. (E) Immunofluorescence

12 analysis of Tom20 in cells as in (D). The boxed regions in the upper panels are

13 shown at higher magnification in the lower panels. Scale bars, 20 μm. (F)

14 Quantification of mitochondrial fragmentation in control and Pex5 KO MEFs

15 determined from images as in (E). Data are means ± SEM from four independent

16 experiments. *P < 0.05 (unpaired Student’s t test).

18 Figure 3. The peroxisome proliferator 4-PBA induces mitochondrial

19 elongation. (A) Immunofluorescence staining of Pex14 and ATP synthase 

20 (mitochondrial marker) in control MEFs cultured with or without 1 mM 4-PBA for

21 48 hours. Nuclei were stained with Hoechst 33342. Scale bars, 20 μm. (B)

22 Quantification of mitochondrial elongation in control MEFs as in (A). Data are

23 means ± SEM for four independent experiments. *P < 0.05 (unpaired Student’s t

24 test). (C) Immunofluorescence analysis of Pex3 KO MEFs cultured and stained

37 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 as in (A). (D) Quantification of mitochondrial fragmentation in Pex3 KO MEFs as

2 in (C). Data are means ± SEM for four independent experiments. NS, unpaired

3 Student’s t test. (E) Summary of the quantification of mitochondrial morphology

4 in control and Pex3 KO MEFs cultured with or without 1 mM 4-PBA for 48 hours.

6 Figure 4. Deletion of Pex3 induces cytochrome c diffusion. (A) EM of control

7 and Pex3 KO MEFs. Scale bars, 1.0 μm. (B and C) Quantification of

8 mitochondrial area and major axis, respectively, in images similar to those in (A).

9 Data are means ± SEM for 21 cells of each genotype. **P < 0.01; ****P < 0.001

10 (unpaired Student’s t test). (D) High-magnification electron micrographs of control

11 and Pex3 KO MEFs. Scale bars, 250 nm. (E) Immunofluorescence staining of

12 Tom20 and cytochrome c in control and Pex3 KO MEFs. Nuclei were stained with

13 Hoechst 33342. Scale bars, 20 μm. (F) Quantification of the cells with cytochrome

14 c in the cytosol imaged as in (E). Data are means ± SEM from three independent

15 experiments. ****P < 0.001 (unpaired Student’s t test). (G) Colocalization of

16 cytochrome c with Tom20 as reflected by Pearson’s correlation coefficient (r) and

17 determined from images as in (E). Data are means ± SEM from three

18 independent experiments. *P < 0.05 (unpaired Student’s t test). (H)

19 Immunofluorescence staining of Tom20 and cytochrome c in Pex3 KO MEFs

20 infected with retroviruses encoding GFP either alone (pMXs-IG) or together with

21 Pex3 (pMXs-Pex3-IG). Nuclei were stained with Hoechst 33342. Scale bars, 20

22 μm. (I) Quantification of the cells with cytochrome c in the cytosol imaged as in

23 (H). Data are means ± SEM from three independent experiments. *P < 0.05

24 (unpaired Student’s t test). (J) Colocalization of cytochrome c with Tom20 as

38 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 reflected by Pearson’s correlation coefficient and determined from images as in

2 (H). Data are means ± SEM from three independent experiments. *P < 0.05

3 (unpaired Student’s t test).

5 Figure 5. Deletion of Pex5 induces cytochrome c diffusion. (A)

6 Immunofluorescence staining of Tom20 and cytochrome c in control and Pex5

7 KO MEFs. Nuclei were stained with Hoechst 33342. The boxed regions in the

8 upper panels are shown at higher magnification in the lower panels. Scale bars,

9 20 μm. (B) Quantification of the cells with cytochrome c in the cytosol imaged as

10 in (A). Data are means ± SEM for three independent experiments. *P < 0.05

11 (unpaired Student’s t test). (C) Immunofluorescence staining of Tom20 and

12 cytochrome c in Pex5 KO MEFs infected with retroviruses encoding GFP either

13 alone (pMXs-IG) or together with Pex5S (pMXs-Pex5S-IG). Nuclei were stained

14 with Hoechst 33342. The boxed regions in the upper panels are shown at higher

15 magnification in the lower panels. Scale bars, 20 μm. (D) Quantification of the

16 cells with cytochrome c in the cytosol imaged as in (C). Data are means ± SEM

17 from four independent experiments. *P < 0.05 (unpaired Student’s t test).

19 Figure 6. Pex3 deletion without overt changes in ROS and respiration levels.

20 (A) Representative flow cytometric analysis of cytosolic ROS levels as detected

21 by CellROX staining in control and Pex3 KO MEFs incubated with or without 200

22 μM TBHP for 60 minutes. (B) Quantification of CellROX-positive cells as in (A).

23 Data are means ± SEM from three independent experiments. **P < 0.01; NS, not

24 significant (Scheffe’s test). (C) Representative flow cytometric analysis of

39 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 mitochondrial ROS levels as detected by MitoSOX staining in control and Pex3

2 KO MEFs. (D) Quantification of MitoSOX-positive cells as in (C). Data are means

3 ± SEM from six independent experiments. NS, not significant (unpaired Student’s

4 t test). (E) Oxygen consumption rate (OCR) in control and Pex3 KO MEFs. Data

5 are means ± SEM of triplicates from a representative experiment. (F) Basal, ATP-

6 linked, proton-leak (+oligomycin), maximal (+CCCP), and nonmitochondrial

7 (Non-mito, +rotenone/antimycin A) OCR determined as in (E). Data are means ±

8 SEM from three independent experiments. NS, not significant (unpaired

9 Student’s t test).

11 Figure 7. Deletion of Pex3 promotes the association of Drp1 with

12 mitochondria. (A) Immunofluorescence staining of Tom20 and Drp1 in control

13 and Pex3 KO MEFs. Nuclei were stained with Hoechst 33342. Scale bars, 20 μm.

14 (B) Colocalization of Drp1 with Tom20 as reflected by Manders’ M1 coefficient

15 and determined from images as in (A). Data are means ± SEM for five

16 independent experiments. *P < 0.05 (unpaired Student’s t test). (C)

17 Immunofluorescence staining of Tom20 and cytochrome c in Pex3 KO MEFs

18 infected with retroviruses encoding GFP either alone (pMXs-IG) or together with

19 mutated Drp1 (Drp1(K38A)). Nuclei were stained with Hoechst 33342. Scale bars,

20 20 μm. Data are representative of three independent experiments. (D)

21 Quantification of mitochondrial fragmentation in images similar to those in (C).

22 Data are means ± SEM from three independent experiments. *P < 0.05 (unpaired

23 Student’s t test). (E) Quantification of the cells with cytochrome c in the cytosol

40 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 imaged as in (C). Data are means ± SEM from three independent experiments.

2 *P < 0.05 (unpaired Student’s t test).

6 Figure 8. Deletion of Pex3 induces caspase activation and enhances stress-

7 induced apoptosis. (A) Immunoblot analysis of caspase-3 and caspase-9 in

8 control and Pex3 KO MEFs. The pro and cleaved forms of the enzymes are

9 indicated. Black vertical lines indicate noncontiguous lanes. (B) Quantification of

10 the cleaved forms of caspase-3 and caspase-9 (normalized by p38) in blots

11 similar to those in (A). Data are means ± SEM for three independent experiments.

12 *P < 0.05, **P < 0.01 (unpaired Student’s t test). (C) Representative flow

13 cytometric analysis of Cy5-labeled annexin V staining for control and Pex3 KO

14 MEFs. (D) Quantification of cells positive for annexin V–Cy5 staining as in (C).

15 Data are means ± SEM from four independent experiments. NS, not significant

16 (unpaired Student’s t test). (E and F) Immunoblot analysis of the cleaved form of

17 caspase-3 in control and either Pex3 KO (E) or Pex5 KO (F) MEFs that had been

18 incubated in the absence (–) or presence of etoposide at 2 (+) or 4 (++) μM for

19 24 hours. Either -tubulin or p38 was examined as a loading control. Black

20 vertical lines indicate noncontiguous lanes. Data are representative of three

21 independent experiments. (G) Representative flow cytometric analysis of annexin

22 V–Cy5 staining for control and Pex3 KO MEFs that had been incubated for 24

23 hours with 2 μM etoposide or DMSO vehicle. (H) Quantification of cells positive

24 for annexin V–Cy5 staining as in (G). Data are means ± SEM from three

41 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 independent experiments. *P < 0.05; NS, not significant (unpaired Student’s t

2 test).

4 Supplemental Figure S1. Scheme for Pex3 disruption. The region of the Pex3

5 locus spanning exons 3 to 5 for Pex3tm3a(EUCOMM)Wtsi, Pex3tm3c(EUCOMM)Wtsi, and

6 Pex3tm3d(EUCOMM)Wtsi alleles. See Materials and methods for details.

8 Supplemental Figure S2. Deletion of Pex3 induces mitochondrial

9 fragmentation. (A) Deconvoluted Immunofluorescence images of control and

10 Pex3 KO MEFs with antibodies to Tom20 and ATP synthase β. Scale bars, 20

11 μm. (B) Quantification of mitochondrial volume with object analyzer, Huygens and

12 determined from imaged as in (A). Data are means ± SEM from 35 cells in control

13 MEFs and 30 cells in Pex3 KO MEFs from three independent experiments. *P <

14 0.05; ****P < 0.001 (unpaired Student’s t test). (C) Quantification of mitochondrial

15 length with object analyzer, Huygens and determined from imaged as in (A). Data

16 are means ± SEM from 35 cells in control MEFs and 30 cells in Pex3 KO MEFs

17 from three independent experiments. ***P < 0.005; ****P < 0.001 (unpaired

18 Student’s t test).

20 Supplemental Figure S3. Indel of Pex5 induced with the CRISPR-Cas9 system.

21 (A) Schematic representation of the targeting Pex5 with a gRNA. The gRNA

22 sequence is shown in yellow, protospacer adjacent motif (PAM) in blue, and start

23 codon in red. (B) Sequencing of Pex5 genomic DNA from Pex5 KO MEFs.

42 bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Insertion or replacement of nucleotides is shown in green. The start codon is

2 presented in red.

4 Supplemental Figure S4. A high cell density enhances cytochrome c

5 diffusion of Pex3 KO MEFs. Pex3 KO MEFs seeded at low or high cell densities

6 were subjected to immunofluorescence staining of Tom20 and cytochrome c.

7 Nuclei were stained with Hoechst 33342. Data are representative of three

8 independent experiments. Scale bars, 40 μm.

10 Supplemental Figure S5. Mitochondrial fragmentation and cytochrome c

11 diffusion are not mediated by ROS in Pex3 KO MEFs. (A) Flow cytometric

12 analysis of cytosolic ROS as detected by CellROX staining in Pex3 KO MEFs

13 incubated with or without 5 mM NAC for 1 hour and then in the additional absence

14 or presence of 200 μM TBHP for 1 hour. Data are representative of three

15 independent experiments. (B) Immunofluorescence staining of Tom20 and

16 cytochrome c in Pex3 KO MEFs incubated with or without 5 mM NAC for 6 hours.

17 Nuclei were also stained with Hoechst 33342. Scale bars, 20 μm. (C and D)

18 Quantification of mitochondrial fragmentation and the diffusion of cytochrome c

19 into the cytosol, respectively, for images similar to those in (B). Data are means

20 ± SEM for three independent experiments. NS, not significant (unpaired Student’s

21 t test).

43 FigurebioRxiv 1 preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A B EGFP-PTS1/ Pex14/ Control Pex3 KO EGFP-PTS1 Pex14 Hoechst MEFs MEFs

Pex3 42 kDa MEFs Control p38 38 kDa MEFs Pex3 KO C Control Pex3 KO D E MEFs MEFs 100 *** Pex3 KO MEFs pMXs- pMXs- 90 IG Pex3-IG 80 Pex3 42 kDa 70 p38 38 kDa 60 50 F Pex14/ 40 Hoechst

Tom20 30 20 Mitochondrial fragmentation (%) 10 IG pMXs- 0 Control Pex3 KO MEFs MEFs

G Pex3 KO MEFs H 100 Pex3 KO MEFs pMXs- pMXs- * IG Pex3-IG 90 pMXs- 80 Pex3-IG 70 60 50 40 30 20 Tom20 Mitochondrial fragmentation (%) 10 0 pMXs- pMXs- IG Pex3-IG Pex3 KO MEFs bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which Figure 2was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A B C Control Pex5 KO MEFs MEFs Control Pex5 KO 100 MEFs MEFs 90 * Pex5 80 kDa 80 70 p38 38 kDa 60 50 40

Tom20 30 20 10 Mitochondrial Mitochondrial fragmentation (%) 0 Control Pex5 KO MEFs MEFs D E F Pex5 KO MEFs Pex5 KO MEFs pMXs- pMXs- pMXs- pMXs- IG Pex5S-IG IG Pex5S-IG 100 90 80 kDa Pex5 80 70 *

p38 38 kDa 60 50 40 Tom20 30 20 10 Mitochondrial fragmentation (%) 0 pMXs- pMXs- IG Pex5S-IG Pex5 KO MEFs FigurebioRxiv preprint 3 doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A Pex14/ D 60 ATP synthase β/ * Pex14 ATP synthase β Hoechst 50

30 Control MEFs 20

10 Elongated mitochondria (%)

+ 4-PBA 4-PBA: - +

Control MEFs Control MEFs

B E Pex14/ NS ATP synthase β/ 100 Pex14 ATP synthase β Hoechst 90 80 70 60 50

Pex3 KO MEFs 40 30 20 10 Fragmented mitochondria (%) 0

+ 4-PBA 4-PBA: - +

Pex3 KO MEFs Pex3 KO MEFs C Control MEFs

Control MEFs + 4-PBA

Pex3 KO MEFs

Pex3 KO MEFs + 4-PBA

0 20 40 60 80 100 Fragmented Intermediate Elongated bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which Figure 4was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A Control MEFs Pex3 KO MEFs B C ** **** 0.9 1.6 0.8 1.4 ) 2 0.7 1.2 0.6 1.0 0.5 0.8 0.4 0.6 0.3 Mitochondrial area (µm D 0.2 0.4 Control MEFs Pex3 KO MEFs Mitochondrial major axis (µm) 0.1 0.2

0 0 Control Pex3 KO Control Pex3 KO MEFs MEFs MEFs MEFs

Tom20/ E cytochrome c/ F G Tom20 cytochrome c Hoechst C100 **** 1.0 90 0.9 * 80 0.8

MEFs 70

Control 0.7 60 0.6 c in the cytosol (%) 50 0.5 40 0.4 30 0.3 20 0.2 Pearson's Pearson's coefficient correlation MEFs 10 0.1 Pex3 KO 0 0 Cells with cytochrome Control Pex3 KO Control Pex3 KO MEFs MEFs MEFs MEFs H I J

Tom20/ 100 cytochrome c/ 1.0 Hoechst 90 * Tom20 cytochrome c * 0.9 80 0.8 70 0.7

IG 60 0.6 c in the cytosol (%) pMXs- 50 0.5 40 0.4 30 MEFs 0.3 Pex3 KO 20 0.2

10 Pearson's coefficient correlation 0.1 pMXs- Cells with cytochrome

Pex3-IG 0 0 pMXs- pMXs- pMXs- pMXs- IG Pex3-IG IG Pex3-IG Pex3 KO MEFs Pex3 KO MEFs FigurebioRxiv preprint doi:5 https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Tom20/ A cytochrome c/ B Tom20 cytochrome c Hoechst 100 90 * MEFs

Control 80 70

in the cytosol (%) 60 c 50 40 MEFs

Pex5 KO 30 20 10 Cells with cytochrome 0 Control Pex5 KO MEFs MEFs MEFs Control MEFs Pex5 KO

C Tom20/ cytochrome c/ D Tom20 cytochrome c Hoechst 100 90 80 IG

pMXs- 70

in the cytosol (%) 60

c * 50 MEFs

Pex5 KO 40 30 pMXs-

Pex5S-IG 20 10 Cells with cytochrome 0 pMXs- pMXs- IG Pex5S-IG

IG Pex5 KO pMXs- MEFs MEFs Pex5 KO pMXs- Pex5S-IG FigurebioRxiv preprint 6 doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A B 100 ** 90 ** NS NS 80 70 60 50

Cell number 40 30 20

CellROX CellROX-positive cells (%) 10 Control MEFs Control MEFs 0 + TBHP Control Pex3 KO Control Pex3 KO MEFs MEFs MEFs MEFs Pex3 KO MEFs Pex3 KO MEFs + TBHP TBHP: - + C D 100 90 Control MEFs 80 Pex3 KO MEFs 70 60 50 40

Cell number 30 NS 20

MitoSOX-positive cells (%) 10 0 MitoSOX Control Pex3 KO MEFs MEFs E Control MEFs F Control MEFs Pex3 KO MEFs Pex3 KO MEFs Rotenone/ Oligomycin FCCP Antimycin A NS 120 80 70 cells) cells) 100 3 3 60 80 50 NS NS 60 40 30 40 NS 20 NS 20 10 OCR (pmol/min per 10 OCR (pmol/min per 10 0 0 1 10 19 28 36 45 54 63 71 80 89 98 Basal ATP- Leak Maximal Non-mito Time (min) linked bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure 7 A Tom20/ B Drp1/ Tom20 Drp1 Hoechst 0.6 *

0.5

0.4 Control MEFs 0.3

0.2

Mander's coefficient Mander's 0.1

0 Pex3 KO MEFs Control Pex3 KO C Tom20/ MEFs MEFs cytochrome c/ Tom20 cytochrome c Hoechst IG pMXs- Pex3 KO MEFs pMXs- Drp1(K38A)-IG D E 100 100

90 90

80 ** 80

70 70

60 60 *

50 50

40 40

30 30

20 20 10

Mitochondrial fragmentation (%) 10

0 0 pMXs- pMXs- Cells with cytochrome c in the cytosol (%) pMXs- pMXs- IG Drp1(K38A)- IG Drp1(K38A)- IG IG Pex3 KO MEFs Pex3 KO MEFs FigurebioRxiv preprint 8 doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which A was not certified by peer review) is the author/funder.B All rights reserved. No reuse allowed without permission. Control Pex3 KO ** MEFs MEFs 8 * 2.0 Pro-caspase-9 45 kDa 7 1.8 Cleaved 1.6 caspase-9 6

1.4 5 Pro-caspase-9 1.2 Cleaved 37 kDa 4 1.0 caspase-9 35 kDa

Cleaved 0.8 (Long exposure) Cleaved 3 (fold change) (fold change)

caspase-9/p38 0.6 caspase-3/p38 2 Cleaved 0.4 caspase-3 17 kDa 1 0.2 0 0 38 kDa p38 Control Pex3 KO Control Pex3 KO MEFs MEFs MEFs MEFs

C D 100 90 80 70 60 50 -positive cells (%)

Ⅴ 40

Cell number Control MEFs 30 20 NS Pex3 KO MEFs 10 Annexin 0 Annexin Ⅴ-Cy5 Control Pex3 KO MEFs MEFs

F E Control Pex3 KO MEFs MEFs Control MEFs Pex5 KO MEFs Etoposide: - + - + Etoposide: - + ++ - + ++ Cleaved Cleaved 17 kDa 17 kDa caspase-3 caspase-3

α-Tubulin 50 kDa p38 38 kDa

G H * 100 90 DMSO Etoposide 80 70 60 50 40 Cell number Cell number 30 NS 20 Annexin V -positive cells (%) 10 Annexin Ⅴ-Cy5 Annexin Ⅴ-Cy5 0 Control Pex3 KO Control Pex3 KO Control MEFs MEFs MEFs MEFs MEFs Pex3 KO MEFs Etoposide: - + bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Supplemental Figure 1

FRT loxP FRT loxP loxP LacZ neo Exon 3 Exon 4 Exon 5 Pex3tm3a(EUCOMM)Wtsi

FLP

FRT loxP loxP

Exon 3 Exon 4 Exon 5 Pex3tm3c(EUCOMM)Wtsi

CRE

FRT loxP

Exon 3 Exon 5 Pex3tm3d(EUCOMM)Wtsi bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which Supplementalwas not certified Figure by peer review) 2 is the author/funder. All rights reserved. No reuse allowed without permission. Tom20/ A ATP synthase β/ Tom20 ATP synthase β Hoechst Control MEFs Pex3 KO MEFs

B 1.4 * 0.6 **** ) 3

) 1.2

3 0.5 (µm

1.0 β) 0.4 0.8 0.3 0.6 0.2 0.4 Volume (Tom20) (µm

0.2 0.1 Volume (ATP synthase

0 0 Control Pex3 KO Control Pex3 KO MEFs MEFs MEFs MEFs C *** 2.5 **** 1.8 1.6

2.0 1.4 ) (µm) β 1.2 1.5 1.0

0.8 1.0 0.6

Length (Tom20) (µm) 0.4 0.5

Length (ATP synthase 0.2

0 0 Control Pex3 KO Control Pex3 KO MEFs MEFs MEFs MEFs bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which Supplementalwas not certified Figure by peer review) 3 is the author/funder. All rights reserved. No reuse allowed without permission. A Exon 1

Pex5 gene

5’ AATCTTCTGTCCATCAGGGAAGCTGCTGGTCACCATGGCAATGCGGGAGCT 3’

B WT 5’ GCTGGTCACCATGGCAATGCGGGAGCTGGTGGAGGGCGAATGTGGGGGTG 3’

Alelle 1 5’ GCTGGTCACCATGGCAA^TGCGGGAGCTGGTGGAGGGCGAATGTGGGGGT 3’ A

WT 5’ TCCCTTCCCCCAGCCCACTCCGGGTGCCTCGGCCGGTCGGACGGTGCGGCCCGCGACGGCGAGCATTGGAGC Alelle 2 5’ TCCCTTCCCCCAGCCCACTCCGGGTGCCTCGGCCGGTCGGACGGTGCGGCCCGCGACGGCGAGCATTGGAGC CTGGGGGCGCGGGGTCGAGGCCCGTAAGTCCCCGCCGCTGCGGTGGCCTCGTGGGACGGGGTCGAGGCTGGG CTGGGGGCGCGGGGTCGAGGC^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ACATTTCCCCGAAAA GCGACGGGGCTGGGGGCGCGGGGCGCTGGGCGGGGACGGGCGCGGCCGGGGAGGGGGCTCAGGTGACACG GTGCCACCTGACGTCTAAGAAATGTTCCAATCAGCCATGTCTGGGAAGGTCTATGTGTGGATAGAAGAAAAAATTA AGCTGGGATCGGGACCCGCAGCTGGCGCCTGACCGGGGGTGTGGGTCCCGGTGTACGGTGGAAGGCGTCCCC CTACCATGACTGCATAGGTAGTGGATTCACAGGGACACACTGAGAGACATTGATTCCTCTTGTTCAAAACCCTGTC GCTGTCCCTCGTCAGGTTAGAGTTCGGGTCTAGCCGTGTTTATGATGCGCTCCCCGTGCTCCCCAGGGGTCCAG AAAATGATACAACATGTGAAGACACTGTTGACAGCTATACTTGTCACTGCTGGCTTGGATCATGATATTGATTACAA GCCCTTTTGTAGAGCTGCTGTTGGCGGGTGGTGTCTGAGCTGCCGTCCGCTGGAGGGGAAGCCCGAGCCGAAA AGACGATGACGATAAGATGGCCCCAAAGAAGGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGAC GCAGCGTTTCGAGTGGGAAGGCAGGACACAGCCTCCTCTTGGACTCCAGACACACCTCGGGGGGTGGCCCCGG AACAGCGACGTGGACAAGCTGTTCATCCACCTCTTCGTGTGTATTGGGTCCATGTATGCTCTAGATTGACTTAAGT GGGCCTGGCCCTTGTGGAGCCGTCGTGGGCCCATCTGCTCTAGATAGGGCCTGAGGCGTGCGTTGGGAAAGTCT AAAAGGTACTGTCAGTGTCTGTAATAGATGCTGAAGAGAGAGTGCCAAGGGAAACAGCTGTAAAGGCCCTCTAGG GGCTTCCCGACCACAGTTCTAATCTTCTGTCCATCAGGGAAGCTGCTGGTCACCATGGCAATGCGGGAGCTGGTG ATCCGACTGCTGTGTAAAGGAACAGCAGAAAAGCACCTGTGTTCCATCATCTGGTTATATCAGGACCTACTGTGTG GAGGGCGAATGTGGGGGTGCCAACCCGCTGATGAAGCTGGCCACC 3’ CAGGGCGAATGTGGGGGTGCCAACCCGCTGATGAAGCTGGCCACC 3’ bioRxiv preprint doi: https://doi.org/10.1101/407098; this version posted September 3, 2018. The copyright holder for this preprint (which Supplementalwas not certified Figure by peer review) 4 is the author/funder. All rights reserved. No reuse allowed without permission.

Tom20/ cytochrome c/ Tom20 cytochrome c Hoechst Sparse Pex3 KO MEFs Confluent A C B

Cell number 1000 0 200 400 600 800

Pex3 KO MEFs Supplemental Figure5 bioRxiv preprint

Mitochondrial fragmentation (%) NAC: + - -10 100 NAC: 10 20 30 40 50 60 70 80 90 3 0 was notcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. o2 cytochromec Tom20 CellROX 10 0 Pex3 KOMEFs doi: https://doi.org/10.1101/407098 NS 3 +- 10 4 D ;

Cells with cytochrome c in the cytosol (%) this versionpostedSeptember3,2018. 100 NAC: 10 20 30 40 50 60 70 80 90 Pex3 KOMEFs+TBHPNAC Pex3 KOMEFs+TBHP Pex3 KOMEFs 0 Pex3 KOMEFs cytochrome c/ NS Hoechst Tom20/ +- The copyrightholderforthispreprint(which