Ostreid Herpesvirus: a Pathogen of Oysters
Total Page：16
File Type：pdf, Size：1020Kb
Virology: Research & Reviews Mini Review ISSN: 2514-4138 Ostreid herpesvirus: A pathogen of oysters Daniela Mandas1 and Fulvio Salati1* 1Fish Diseases and Aquaculture Center, IZS of Sardinia, State Veterinary Institute Via Parigi s.n., 09170 Oristano, Italy Abstract Ostreid Herpesvirus-1 (OsHV-1), OsHV-1 μvar and other variants are herpesviruses causing heavy mortalities, with losses ranging from 50 to 100%, on Pacific oyster (Crassostrea gigas), an important species worldwide cultured. Ostreid Herpesvirus-1 is one of the top 50 largest viral genome; OsHV-1 μvar is a variant of the virus OsHV-1 showing a systematic deletion of 12/13 base pairs sequence between ORF4 and ORF5. For the diagnosis of herpesvirus infection, traditional histopathological methods and biomolecular techniques have been developed, but, to confirm the disease, both methods should be used. This mini review reports some studies on the virus. Introduction susceptible to this virus, C. gigas appeared resistant to this virus disease. In late 70ies and early 80ies, high mortalities (more that 50%) of Pacific Pacific oyster (Crassostrea gigas) is an important species worldwide oyster larvae have been reported in commercial hatcheries from cultured showing great production figures in many countries such as Washington State in USA [6].The cause of C. gigas summer mortalities China, Japan, South Korea, U.S.A., Mexico, New Zealand, Australia, remained unclear, but studies suggested a complex etiology in which France, UK, Ireland, Spain, Italy, etc. However, oyster culture is environmental and physiological conditions of the host (age/weight periodically struck by heavy mortalities ranging from 50 to 100%. Oyster culture industry is based on both supply of the spat from the and sexual maturation) were involved [7,8]. wild and from hatchery, where most of the larvae are produced using Since 1992 sporadic high mortalities of larval C. gigas have been a “mass spawning” technique. Problems with low salinity, disease, or regularly observed in some commercial French hatcheries, occurring other water quality associated problems may delay or inhibit spawning. every year during summer in association with a herpes-like virus There are several different methods used for oyster growing. The (Ostreid Herpesvirus 1: OsHV-1) [9,10]. In 2008 summer mortalities methods range from culture on the bottom, to suspension in “poches”, were reported at a much larger scale. The mortality events affected baskets, etc., by rope and/or long-lines (Figure 1). Pacific cupped oysters juvenile oysters and up to 100% mortalities were observed in a will take from 18-30 months depending mainly on water temperature few weeks period between June and July. A new strain of OsHV-1 to reach a market size of 70–100 g live weight, > 75 mm shell length. denominated µvar was consistently observed. Extensive mortalities Losses of Pacific Oyster (C. gigas) have occurred globally for over were again observed in 2009 and from 2010 in all French coast and also 5 decades with heavy impact on oyster aquaculture. These losses in Ireland, Jersey and Italy. generally denominated as Summer Mortality are typically prolonged and affect older reproductively mature animals during summer months Ostreid Herpesvirus [1]. In Europe, C. gigas was introduced to replace Crassostrea angulata, The Virus Study Group of the International Committee on because significant summer mortalities have occurred since the late Taxonomy of Viruses (ICTV) has recently established a new order, eighties [2-4]. The Pacific oyster may also be infected by different the Herpesvirales, which includes herpesviruses of mammals, birds, viruses; an irido-like virus has been reported infecting French Pacific reptiles, amphibians, fish and bivalves. A carachteristic of Herpesvirales oysters [5]. Although the Portuguese oyster, C. angulata, was highly is the latent or inapparent infection that could be present in host cells, but without replication. Genetically, Herpesviridae (mammals), Alloherpesviridae (amphibians) and Malacoherpesviridae (bivalves) are very few correlated. There is an unique protein, a terminase sub-unit responsible for DNA packaging, that could be considered Herpesvirus- specific. Based on terminase gene’s taxonomy-tree, the virus of oyster is a clade a part from the other Herpesvirus. In Figure 2 herpesviruses dataset and phylogenic tree from Waltzek, et al. are shown [11]. Correspondence to: Salati F, Fish Diseases and Aquaculture Center, IZS of Sardinia, State Veterinary Institute Via Parigi s.n., 09170 Oristano, Italy, Tel: 328-6256492; E-mail: [email protected] Key words: pacific oyster, crassostrea gigas, malacoherpesviridae, ostreavirus, ostreid herpesvirus-1, OsHV-1 μvar, infection Figure 1. Oyster “poches” culture in S. Teodoro Lagoon (Italy). Received: April 14, 2017; Accepted: April 26, 2017; Published: April 29, 2017 Virol Res Rev, 2017 doi: 10.15761/VRR.1000112 Volume 1(2): 1-5 Mandas D (2017) Ostreid herpesvirus: A pathogen of oysters Figure 2. Herpesviruses dataset and phylogenic tree [11]. Malacoherpesviridae contains Ostreid Herpesvirus-1 (OsHV-1) as type) [16,17]. In particular, phylogenetic analysis results highlight its sole member, in the genus Ostreavirus [12]. Ostreid Herpesvirus-1 two distinct clusters with a different geographical, European and East is a virus which core contains a linear double-stranded DNA with an Asian, genotypes distribution. icosahedral capside [13]. The sequence has been deposited in 2005 by Davison, et al. [14] and it is at 27th ranking of the top 50 largest viral Diagnosis genome sequence list. The sequence of the OsHV-1 is deposited in Nowadays, since there are not cell cultures from oyster and/ GenBank (GenBank AY509253), lenght estimated of 207 kbp: Davison or alternative cell culture, the viral isolation is not possible and et al. showed that the genome is assembled by two regions UL (167,843 there are no sensitive serological detection methods, but traditional bp) and US (3370 bp), each flanked by inverted repeats TRL/IRL (7584 histopathological methods and biomolecular techniques are used for bp) and TRS/IRS (9774 bp), and separated by a X region of 1510 bp [14]. the diagnosis of herpesvirus infection. However, to confirm the disease, OsHV-1 µvar both methods should be used. Regarding the histopathological examination, what can be In the past decades, only Ostreid Herpesvirus 1 (reference type) and observed are the typical signs of a viral infection: connective tissue Ostreid Herpesvirus 1var were known; then other C region variants have cells with pycnosis, nuclear changes (moon shaped), including nuclei been detected. In 2008 an emerging variant, OsHV-1 µvar was isolated hypertrophy with marginated chromatin, and large intranuclear [15]. OsHV-1 μvar, shows a deletion in position 178204-178404 of about acidophilic inclusion bodies (Cowdry type A inclusions) [10,18- 200 bp which probably compromises the protein codified by ORF5, 21]. Moreover, the observation by electron microscopy of capsids or and there is an insertion of 27 bp not present in any published sequence nucleocapsids in the nucleus and virus particles in the cytoplasm or in (CCCACTGTGATATCATCGCAAATGAAT ). In particular, OsHV-1 cytoplasmic vesicles could only confirm the presence of a herpesvirus- μvar is a variant of the virus OsHV-1 of 529 bp fragment length, which like and/or a viral disease [10,18-20,22-24]. is defined on the basis of partial sequence data exhibiting a systematic deletion of 12/13 base pairs in TAC sequence between ORF4 and ORF5 On the other hands, both in situ hybridization (ISH) [25,26] and in the posion 178547 at 178572 of the genome (GenBank # HQ842610) PCR could be positive for the DNA of OsHV-1 and variants detection in comparison with OsHV-1. Moreover, in some cases a deletion with but not enough for the disease confirmation. To date, there are numerous only 10 bp in the same position was also observed. Furthermore, recent different PCR methods available for the detection of OsHV-1, but specific genomic regions analysis revealed the presence of at least nine different and characteristic are the primers C2 and C6, which bracket a region of genotypes, including two variants close to the OsHV-1 (reference 709 bp (178181-178889) [27-29] (Figure 3 and 4). Some methods of PCR Virol Res Rev, 2017 doi: 10.15761/VRR.1000112 Volume 1(2): 2-5 Mandas D (2017) Ostreid herpesvirus: A pathogen of oysters between 1995 and 2007, did not detect the same virus [31,32]. Furthermore, OsHV-1 µvar was recently detected in Wadden sea [33] and in Adriatic sea [17]. Virus infectivity Studies in vitro on virus stability and infectivity are very few. Ten pg µl-1 of extracted viral DNA were experimentally detected for 1, 9 and 16 day at 20, 11 and 4°C respectively and, in a second experiment, 100 pg µl-1 were detected after 51 days at each of the same temperatures [34]. However, the relationship between DNA detection in the PCR and infectivity is unknown. As a general rule of many aquatic animals viruses, considering also what observed in the field, the survival of OsHV is longer at lower temperatures. OsHV virus, as other herpesviruses, could be present in host cells without replication, at latent or inapparent infection status and could be reactivated and recommences replication under a summ of environmental (such as water temperature, salinity, etc.) and host Figure 3. Example of OsHV-1 gel from diseased C. gigas. The gel shows the reference virus and virus-negative oyster tissue. Es. Samples line 1 to 5: positive; Sample line 6: stressing conditions (i.e. age and sexual maturation of the host), etc. negative; C+ = reference OsHV-1; C- =negative. OsHV-1 was also detected in apparently healthy farmed oysters [27,29] and, again, in healthy farmed C. gigas from the Gulf of California [35]; while, regarding the oysters in the wild, the presence of OsHV-1 was recently confirmed in European natural C. gigas [17].