Ostreid Herpesvirus: a Pathogen of Oysters

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Virology: Research & Reviews Mini Review ISSN: 2514-4138 Ostreid herpesvirus: A pathogen of oysters Daniela Mandas1 and Fulvio Salati1* 1Fish Diseases and Aquaculture Center, IZS of Sardinia, State Veterinary Institute Via Parigi s.n., 09170 Oristano, Italy Abstract Ostreid Herpesvirus-1 (OsHV-1), OsHV-1 μvar and other variants are herpesviruses causing heavy mortalities, with losses ranging from 50 to 100%, on Pacific oyster (Crassostrea gigas), an important species worldwide cultured. Ostreid Herpesvirus-1 is one of the top 50 largest viral genome; OsHV-1 μvar is a variant of the virus OsHV-1 showing a systematic deletion of 12/13 base pairs sequence between ORF4 and ORF5. For the diagnosis of herpesvirus infection, traditional histopathological methods and biomolecular techniques have been developed, but, to confirm the disease, both methods should be used. This mini review reports some studies on the virus. Introduction susceptible to this virus, C. gigas appeared resistant to this virus disease. In late 70ies and early 80ies, high mortalities (more that 50%) of Pacific Pacific oyster (Crassostrea gigas) is an important species worldwide oyster larvae have been reported in commercial hatcheries from cultured showing great production figures in many countries such as Washington State in USA [6].The cause of C. gigas summer mortalities China, Japan, South Korea, U.S.A., Mexico, New Zealand, Australia, remained unclear, but studies suggested a complex etiology in which France, UK, Ireland, Spain, Italy, etc. However, oyster culture is environmental and physiological conditions of the host (age/weight periodically struck by heavy mortalities ranging from 50 to 100%. Oyster culture industry is based on both supply of the spat from the and sexual maturation) were involved [7,8]. wild and from hatchery, where most of the larvae are produced using Since 1992 sporadic high mortalities of larval C. gigas have been a “mass spawning” technique. Problems with low salinity, disease, or regularly observed in some commercial French hatcheries, occurring other water quality associated problems may delay or inhibit spawning. every year during summer in association with a herpes-like virus There are several different methods used for oyster growing. The (Ostreid Herpesvirus 1: OsHV-1) [9,10]. In 2008 summer mortalities methods range from culture on the bottom, to suspension in “poches”, were reported at a much larger scale. The mortality events affected baskets, etc., by rope and/or long-lines (Figure 1). Pacific cupped oysters juvenile oysters and up to 100% mortalities were observed in a will take from 18-30 months depending mainly on water temperature few weeks period between June and July. A new strain of OsHV-1 to reach a market size of 70–100 g live weight, > 75 mm shell length. denominated µvar was consistently observed. Extensive mortalities Losses of Pacific Oyster (C. gigas) have occurred globally for over were again observed in 2009 and from 2010 in all French coast and also 5 decades with heavy impact on oyster aquaculture. These losses in Ireland, Jersey and Italy. generally denominated as Summer Mortality are typically prolonged and affect older reproductively mature animals during summer months Ostreid Herpesvirus [1]. In Europe, C. gigas was introduced to replace Crassostrea angulata, The Virus Study Group of the International Committee on because significant summer mortalities have occurred since the late Taxonomy of Viruses (ICTV) has recently established a new order, eighties [2-4]. The Pacific oyster may also be infected by different the Herpesvirales, which includes herpesviruses of mammals, birds, viruses; an irido-like virus has been reported infecting French Pacific reptiles, amphibians, fish and bivalves. A carachteristic of Herpesvirales oysters [5]. Although the Portuguese oyster, C. angulata, was highly is the latent or inapparent infection that could be present in host cells, but without replication. Genetically, Herpesviridae (mammals), Alloherpesviridae (amphibians) and Malacoherpesviridae (bivalves) are very few correlated. There is an unique protein, a terminase sub-unit responsible for DNA packaging, that could be considered Herpesvirus- specific. Based on terminase gene’s taxonomy-tree, the virus of oyster is a clade a part from the other Herpesvirus. In Figure 2 herpesviruses dataset and phylogenic tree from Waltzek, et al. are shown [11]. Correspondence to: Salati F, Fish Diseases and Aquaculture Center, IZS of Sardinia, State Veterinary Institute Via Parigi s.n., 09170 Oristano, Italy, Tel: 328-6256492; E-mail: [email protected] Key words: pacific oyster, crassostrea gigas, malacoherpesviridae, ostreavirus, ostreid herpesvirus-1, OsHV-1 μvar, infection Figure 1. Oyster “poches” culture in S. Teodoro Lagoon (Italy). Received: April 14, 2017; Accepted: April 26, 2017; Published: April 29, 2017 Virol Res Rev, 2017 doi: 10.15761/VRR.1000112 Volume 1(2): 1-5 Mandas D (2017) Ostreid herpesvirus: A pathogen of oysters Figure 2. Herpesviruses dataset and phylogenic tree [11]. Malacoherpesviridae contains Ostreid Herpesvirus-1 (OsHV-1) as type) [16,17]. In particular, phylogenetic analysis results highlight its sole member, in the genus Ostreavirus [12]. Ostreid Herpesvirus-1 two distinct clusters with a different geographical, European and East is a virus which core contains a linear double-stranded DNA with an Asian, genotypes distribution. icosahedral capside [13]. The sequence has been deposited in 2005 by Davison, et al. [14] and it is at 27th ranking of the top 50 largest viral Diagnosis genome sequence list. The sequence of the OsHV-1 is deposited in Nowadays, since there are not cell cultures from oyster and/ GenBank (GenBank AY509253), lenght estimated of 207 kbp: Davison or alternative cell culture, the viral isolation is not possible and et al. showed that the genome is assembled by two regions UL (167,843 there are no sensitive serological detection methods, but traditional bp) and US (3370 bp), each flanked by inverted repeats TRL/IRL (7584 histopathological methods and biomolecular techniques are used for bp) and TRS/IRS (9774 bp), and separated by a X region of 1510 bp [14]. the diagnosis of herpesvirus infection. However, to confirm the disease, OsHV-1 µvar both methods should be used. Regarding the histopathological examination, what can be In the past decades, only Ostreid Herpesvirus 1 (reference type) and observed are the typical signs of a viral infection: connective tissue Ostreid Herpesvirus 1var were known; then other C region variants have cells with pycnosis, nuclear changes (moon shaped), including nuclei been detected. In 2008 an emerging variant, OsHV-1 µvar was isolated hypertrophy with marginated chromatin, and large intranuclear [15]. OsHV-1 μvar, shows a deletion in position 178204-178404 of about acidophilic inclusion bodies (Cowdry type A inclusions) [10,18- 200 bp which probably compromises the protein codified by ORF5, 21]. Moreover, the observation by electron microscopy of capsids or and there is an insertion of 27 bp not present in any published sequence nucleocapsids in the nucleus and virus particles in the cytoplasm or in (CCCACTGTGATATCATCGCAAATGAAT ). In particular, OsHV-1 cytoplasmic vesicles could only confirm the presence of a herpesvirus- μvar is a variant of the virus OsHV-1 of 529 bp fragment length, which like and/or a viral disease [10,18-20,22-24]. is defined on the basis of partial sequence data exhibiting a systematic deletion of 12/13 base pairs in TAC sequence between ORF4 and ORF5 On the other hands, both in situ hybridization (ISH) [25,26] and in the posion 178547 at 178572 of the genome (GenBank # HQ842610) PCR could be positive for the DNA of OsHV-1 and variants detection in comparison with OsHV-1. Moreover, in some cases a deletion with but not enough for the disease confirmation. To date, there are numerous only 10 bp in the same position was also observed. Furthermore, recent different PCR methods available for the detection of OsHV-1, but specific genomic regions analysis revealed the presence of at least nine different and characteristic are the primers C2 and C6, which bracket a region of genotypes, including two variants close to the OsHV-1 (reference 709 bp (178181-178889) [27-29] (Figure 3 and 4). Some methods of PCR Virol Res Rev, 2017 doi: 10.15761/VRR.1000112 Volume 1(2): 2-5 Mandas D (2017) Ostreid herpesvirus: A pathogen of oysters between 1995 and 2007, did not detect the same virus [31,32]. Furthermore, OsHV-1 µvar was recently detected in Wadden sea [33] and in Adriatic sea [17]. Virus infectivity Studies in vitro on virus stability and infectivity are very few. Ten pg µl-1 of extracted viral DNA were experimentally detected for 1, 9 and 16 day at 20, 11 and 4°C respectively and, in a second experiment, 100 pg µl-1 were detected after 51 days at each of the same temperatures [34]. However, the relationship between DNA detection in the PCR and infectivity is unknown. As a general rule of many aquatic animals viruses, considering also what observed in the field, the survival of OsHV is longer at lower temperatures. OsHV virus, as other herpesviruses, could be present in host cells without replication, at latent or inapparent infection status and could be reactivated and recommences replication under a summ of environmental (such as water temperature, salinity, etc.) and host Figure 3. Example of OsHV-1 gel from diseased C. gigas. The gel shows the reference virus and virus-negative oyster tissue. Es. Samples line 1 to 5: positive; Sample line 6: stressing conditions (i.e. age and sexual maturation of the host), etc. negative; C+ = reference OsHV-1; C- =negative. OsHV-1 was also detected in apparently healthy farmed oysters [27,29] and, again, in healthy farmed C. gigas from the Gulf of California [35]; while, regarding the oysters in the wild, the presence of OsHV-1 was recently confirmed in European natural C. gigas [17].
Recommended publications
  • Ostreid Herpesvirus Type 1 Replication and Host Response in Adult Pacific

    Ostreid Herpesvirus Type 1 Replication and Host Response in Adult Pacific

    Segarra et al. Veterinary Research 2014, 45:103 http://www.veterinaryresearch.org/content/45/1/103 VETERINARY RESEARCH RESEARCH Open Access Ostreid herpesvirus type 1 replication and host response in adult Pacific oysters, Crassostrea gigas Amélie Segarra1, Laury Baillon1, Delphine Tourbiez1, Abdellah Benabdelmouna1, Nicole Faury1, Nathalie Bourgougnon2 and Tristan Renault1* Abstract Since 2008, massive mortality outbreaks associated with OsHV-1 detection have been reported in Crassostrea gigas spat and juveniles in several countries. Nevertheless, adult oysters do not demonstrate mortality in the field related to OsHV-1 detection and were thus assumed to be more resistant to viral infection. Determining how virus and adult oyster interact is a major goal in understanding why mortality events are not reported among adult Pacific oysters. Dual transcriptomics of virus-host interactions were explored by real-time PCR in adult oysters after a virus injection. Thirty-nine viral genes and five host genes including MyD88, IFI44, IkB2, IAP and Gly were measured at 0.5, 10, 26, 72 and 144 hours post infection (hpi). No viral RNA among the 39 genes was detected at 144 hpi suggesting the adult oysters are able to inhibit viral replication. Moreover, the IAP gene (oyster gene) shows significant up-regulation in infected adults compared to control adults. This result suggests that over-expression of IAP could be a reaction to OsHV-1 infection, which may induce the apoptotic process. Apoptosis could be a main mechanism involved in disease resistance in adults. Antiviral activity of haemolymph againstherpessimplexvirus(HSV-1)wasnotsignificantly different between infected adults versus control. Introduction infection of C.
  • WSC 10-11 Conf 13 Layout Template

    WSC 10-11 Conf 13 Layout Template

    The Armed Forces Institute of Pathology Department of Veterinary Pathology Conference Coordinator Matthew Wegner, DVM WEDNESDAY SLIDE CONFERENCE 2010-2011 Conference 13 8 December 2010 Conference Moderator: Tim Walsh, DVM, Diplomate ACVP CASE I: 10-4242 / 10-6076 (AFIP 3170327). protozoa. Tubule epithelium is expanded by numerous multicellular protozoa consisting of large, 100-150 µm Signalment: 30 Sydney rock oysters, QX resistant sporangiosorae containing 8-16 sporonts, each 10-15 broodstock, (Saccostrea glomerata). µm, tear-shaped and 2-3 spherical, refractile eosinophilic spores. Occasional intraluminal History: 100% of oysters were at risk with 25% sick sporangiosorae are noted. There is marked increase in and 75% mortality. granular enterocytes with diapedesis of haemocytes across tubule epithelium. Surrounding Leydig tissue is Gross Pathology: The oysters varied in size (53.6 ± diffusely collapsed and infiltrated by low to moderate 8.9 mm shell height). They were in poor condition numbers of haemocytes. Underlying the gill and palp with minimal gonadal development (1.6 ± 0.9 on a 1-5 epithelium, moderate infiltrates of haemocytes are scale) and pale digestive glands (1.9 ± 0.9 on a 1-3 noted diffusely in the Leydig tissue. scale). On close examination, several of the oysters appeared to be dead. Contributor’s Morphologic Diagnosis: Digestive gland: Adenitis, proliferative, chronic, multifocal, Laboratory Results: Of the 30 oysters examined by severe, with haemocyte accumulation and myriad PCR, 24 (80%) were confirmed positive for Marteilia intracellular protozoa consistent with Marteilia sydnei; sydnei. Confirmation of a successful DNA extraction Sydney rock oyster (Saccostrea glomerata). from each oyster was done using a second PCR specific for Saccostrea glomerata (Sydney rock oyster) Contributor’s Comment: Diseases caused by DNA.
  • Analysis of Clinical Ostreid Herpesvirus 1 (Malacoherpesviridae) Specimens by Sequencing Amplified Fragments from Three Virus Ge

    Analysis of Clinical Ostreid Herpesvirus 1 (Malacoherpesviridae) Specimens by Sequencing Amplified Fragments from Three Virus Ge

    Journal of Virology Archimer May 2012 vol. 86 (10), Pages 5942-5947 http://archimer.ifremer.fr http://dx.doi.org/10.1128/JVI.06534-11 © 2012, American Society for Microbiology. All Rights Reserved. Analysis of Clinical Ostreid Herpesvirus 1 (Malacoherpesviridae) is available on the publisher Web site Webpublisher the on available is Specimens by Sequencing Amplified Fragments from Three Virus Genome Areas Tristan Renaulta, *, Pierrick Moreaua, Nicole Faurya, Jean-François Pepina, Amélie Segarraa and Stephen Webbb authenticated version authenticated - a Ifremer (Institut Français pour la Recherche et l'Exploitation de la Mer), Laboratoire de Génétique et de Pathologie, Ronce les Bains, La Tremblade, France b Cawthron Institute, Nelson, New Zealand *: Corresponding author : Tristan Renault, Tel. : 33 5 46 76 26 26 ; Fax: 33 5 46 76 26 11 email address : Tristan.Renault@ifremer Abstract: Although there are a number of ostreid herpesvirus 1 (OsHV-1) variants, it is expected that the true diversity of this virus will be known only after the analysis of significantly more data. To this end, we analyzed 72 OsHV-1 “specimens” collected mainly in France over an 18-year period, from 1993 to 2010. Additional samples were also collected in Ireland, the United States, China, Japan, and New Zealand. Three virus genome regions (open reading frame 4 [ORF4], ORF35, -36, -37, and -38, and ORF42 and -43) were selected for PCR analysis and sequencing. Although ORF4 appeared to be the most polymorphic genome area, distinguishing several genogroups, ORF35, -36, -37, and -38 and ORF42 and -43 also showed variations useful in grouping subpopulations of this virus.
  • HSV-1 Reprogramming of the Host Transcriptional Environment By

    HSV-1 Reprogramming of the Host Transcriptional Environment By

    Title Page HSV-1 reprogramming of the host transcriptional environment by Sarah E. Dremel B.S., University of Minnesota Twin Cities, 2015 Submitted to the Graduate Faculty of the School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2020 Committee Page UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Sarah E. Dremel It was defended on March 20, 2020 and approved by Jennifer Bomberger, Associate Professor, Department of Microbiology and Molecular Genetics Fred Homa, Professor, Department of Microbiology and Molecular Genetics Nara Lee, Assistant Professor, Department of Microbiology and Molecular Genetics Martin Schmidt, Professor, Department of Microbiology and Molecular Genetics Dissertation Director: Neal DeLuca, Professor, Department of Microbiology and Molecular Genetics ii Copyright © by Sarah E. Dremel 2020 iii Abstract HSV-1 reprogramming of the host transcriptional environment Sarah E. Dremel, PhD University of Pittsburgh, 2020 Herpes Simplex Virus-1 (HSV-1) is a ubiquitous pathogen of the oral and genital mucosa. The 152 kilobase double stranded DNA virus employs a coordinated cascade of transcriptional events to efficiently generate progeny. Using Next Generation Sequencing (NGS) techniques we were able to determine a global, unbiased view of both the host and pathogen. We propose a model for how viral DNA replication results in the differential utilization of cellular factors that function in transcription initiation. Our work outlines the various cis- and trans- acting factors utilized by the virus for this complex transcriptional program. We further elucidated the critical role that the major viral transactivator, ICP4, plays throughout the life cycle.
  • Diversity of Large DNA Viruses of Invertebrates ⇑ Trevor Williams A, Max Bergoin B, Monique M

    Diversity of Large DNA Viruses of Invertebrates ⇑ Trevor Williams A, Max Bergoin B, Monique M

    Journal of Invertebrate Pathology 147 (2017) 4–22 Contents lists available at ScienceDirect Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip Diversity of large DNA viruses of invertebrates ⇑ Trevor Williams a, Max Bergoin b, Monique M. van Oers c, a Instituto de Ecología AC, Xalapa, Veracruz 91070, Mexico b Laboratoire de Pathologie Comparée, Faculté des Sciences, Université Montpellier, Place Eugène Bataillon, 34095 Montpellier, France c Laboratory of Virology, Wageningen University, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands article info abstract Article history: In this review we provide an overview of the diversity of large DNA viruses known to be pathogenic for Received 22 June 2016 invertebrates. We present their taxonomical classification and describe the evolutionary relationships Revised 3 August 2016 among various groups of invertebrate-infecting viruses. We also indicate the relationships of the Accepted 4 August 2016 invertebrate viruses to viruses infecting mammals or other vertebrates. The shared characteristics of Available online 31 August 2016 the viruses within the various families are described, including the structure of the virus particle, genome properties, and gene expression strategies. Finally, we explain the transmission and mode of infection of Keywords: the most important viruses in these families and indicate, which orders of invertebrates are susceptible to Entomopoxvirus these pathogens. Iridovirus Ó Ascovirus 2016 Elsevier Inc. All rights reserved. Nudivirus Hytrosavirus Filamentous viruses of hymenopterans Mollusk-infecting herpesviruses 1. Introduction in the cytoplasm. This group comprises viruses in the families Poxviridae (subfamily Entomopoxvirinae) and Iridoviridae. The Invertebrate DNA viruses span several virus families, some of viruses in the family Ascoviridae are also discussed as part of which also include members that infect vertebrates, whereas other this group as their replication starts in the nucleus, which families are restricted to invertebrates.
  • Whole-Proteome Phylogeny of Large Dsdna Virus Families by an Alignment-Free Method

    Whole-Proteome Phylogeny of Large Dsdna Virus Families by an Alignment-Free Method

    Whole-proteome phylogeny of large dsDNA virus families by an alignment-free method Guohong Albert Wua,b, Se-Ran Juna, Gregory E. Simsa,b, and Sung-Hou Kima,b,1 aDepartment of Chemistry, University of California, Berkeley, CA 94720; and bPhysical Biosciences Division, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 Contributed by Sung-Hou Kim, May 15, 2009 (sent for review February 22, 2009) The vast sequence divergence among different virus groups has self-organizing maps (18) have also been used to understand the presented a great challenge to alignment-based sequence com- grouping of viruses. parison among different virus families. Using an alignment-free In the previous alignment-free phylogenomic studies using l-mer comparison method, we construct the whole-proteome phylogeny profiles, 3 important issues were not properly addressed: (i) the for a population of viruses from 11 viral families comprising 142 selection of the feature length, l, appears to be without logical basis; large dsDNA eukaryote viruses. The method is based on the feature (ii) no statistical assessment of the tree branching support was frequency profiles (FFP), where the length of the feature (l-mer) is provided; and (iii) the effect of HGT on phylogenomic relationship selected to be optimal for phylogenomic inference. We observe was not considered. HGT in LDVs has been documented by that (i) the FFP phylogeny segregates the population into clades, alignment-based methods (19–22), but these studies have mostly the membership of each has remarkable agreement with current searched for HGT from host to a single family of viruses, and there classification by the International Committee on the Taxonomy of has not been a study of interviral family HGT among LDVs.
  • Three Virus Genome Areas Sequencing Amplified

    Three Virus Genome Areas Sequencing Amplified

    Analysis of Clinical Ostreid Herpesvirus 1 (Malacoherpesviridae) Specimens by Sequencing Amplified Fragments from Three Virus Genome Areas Downloaded from Tristan Renault, Pierrick Moreau, Nicole Faury, Jean-François Pepin, Amélie Segarra and Stephen Webb J. Virol. 2012, 86(10):5942. DOI: 10.1128/JVI.06534-11. Published Ahead of Print 14 March 2012. Updated information and services can be found at: http://jvi.asm.org/ http://jvi.asm.org/content/86/10/5942 These include: REFERENCES This article cites 21 articles, 9 of which can be accessed free at: http://jvi.asm.org/content/86/10/5942#ref-list-1 on May 6, 2014 by IFREMER BIBLIOTHEQUE LA PEROUSE CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Analysis of Clinical Ostreid Herpesvirus 1 (Malacoherpesviridae) Specimens by Sequencing Amplified Fragments from Three Virus Genome Areas Downloaded from Tristan Renault,a Pierrick Moreau,a Nicole Faury,a Jean-François Pepin,a Amélie Segarra,a and Stephen Webbb Ifremer (Institut Français pour la Recherche et l’Exploitation de la Mer), Laboratoire de Génétique et de Pathologie, Ronce les Bains, La Tremblade, France,a and Cawthron Institute, Nelson, New Zealandb Although there are a number of ostreid herpesvirus 1 (OsHV-1) variants, it is expected that the true diversity of this virus will be known only after the analysis of significantly more data. To this end, we analyzed 72 OsHV-1 “specimens” collected mainly in France over an 18-year period, from 1993 to 2010.
  • Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID-19 Pandemic: a Repo

    Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID-19 Pandemic: a Repo

    Evidence to support safe return to clinical practice by oral health professionals in Canada during the COVID-19 pandemic: A report prepared for the Office of the Chief Dental Officer of Canada. November 2020 update This evidence synthesis was prepared for the Office of the Chief Dental Officer, based on a comprehensive review under contract by the following: Paul Allison, Faculty of Dentistry, McGill University Raphael Freitas de Souza, Faculty of Dentistry, McGill University Lilian Aboud, Faculty of Dentistry, McGill University Martin Morris, Library, McGill University November 30th, 2020 1 Contents Page Introduction 3 Project goal and specific objectives 3 Methods used to identify and include relevant literature 4 Report structure 5 Summary of update report 5 Report results a) Which patients are at greater risk of the consequences of COVID-19 and so 7 consideration should be given to delaying elective in-person oral health care? b) What are the signs and symptoms of COVID-19 that oral health professionals 9 should screen for prior to providing in-person health care? c) What evidence exists to support patient scheduling, waiting and other non- treatment management measures for in-person oral health care? 10 d) What evidence exists to support the use of various forms of personal protective equipment (PPE) while providing in-person oral health care? 13 e) What evidence exists to support the decontamination and re-use of PPE? 15 f) What evidence exists concerning the provision of aerosol-generating 16 procedures (AGP) as part of in-person
  • Cyprinid Herpesvirus 3

    Cyprinid Herpesvirus 3

    1 © 2015. This manuscript version is made available under the CC-BY-NC-ND 4.0 license 2 http://creativecommons.org/licenses/by-nc-nd/4.0/ 3 doi:10.1016/bs.aivir.2015.03.001 4 Running title: Cyprinid herpesvirus 3 5 Title: Cyprinid herpesvirus 3, an archetype of fish alloherpesviruses 6 Authors and Affiliations 7 Maxime Boutier 1, Maygane Ronsmans 1, Krzysztof Rakus 1, Joanna Jazowiecka-Rakus 1, 8 Catherine Vancsok 1, Léa Morvan 1, Ma. Michelle D. Peñaranda 1, David M. Stone 2, Keith 9 Way 2, Steven J. van Beurden 3, Andrew J. Davison 4 and Alain Vanderplasschen 1* 10 11 1 Immunology-Vaccinology (B43b), Department of Infectious and Parasitic Diseases, 12 Fundamental and Applied Research for Animals & Health (FARAH), Faculty of Veterinary 13 Medicine, University of Liège, B-4000 Liège, Belgium. 14 2 The Centre for Environment, Fisheries and Aquaculture Science, Weymouth Laboratory, 15 Barrack Road, The Nothe, Weymouth, Dorset DT4 8UB, United Kingdom. 16 3 Department of Pathobiology, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 17 1, 3584CL Utrecht, The Netherlands. 18 4 MRC - University of Glasgow Centre for Virus Research, 8 Church Street, Glasgow G11 19 5JR, United Kingdom. 20 21 22 * Corresponding author. Mailing address: Immunology-Vaccinology (B43b), Department of 23 Infectious and Parasitic Diseases, Faculty of Veterinary Medicine, University of Liège, 24 B-4000 Liège, Belgium. Phone: 32-4-366 42 64 - Fax: 32-4-366 42 61 25 E-mail: [email protected] 26 Author’s contacts (see affiliations above) 27 28 Maxime Boutier: [email protected] ; +32 4 366 42 66 29 Maygane Ronsmans: [email protected] ; +32 4 366 42 66 30 Krzysztof Rakus: [email protected] ; +32 4 366 42 66 31 Joanna Jazowiecka-Rakus: [email protected] ; +32 4 366 42 66 32 Catherine Vancsok: [email protected] ; +32 4 366 42 66 33 Léa Morvan: [email protected] ; +32 4 366 42 66 34 Ma.
  • Investigation of Leporid Herpesvirus 4, an Emerging Pathogen of Rabbits: Infection and Prevalence Studies

    Investigation of Leporid Herpesvirus 4, an Emerging Pathogen of Rabbits: Infection and Prevalence Studies

    Investigation of Leporid herpesvirus 4, an Emerging Pathogen of Rabbits: Infection and Prevalence Studies by Janet Ruth Sunohara-Neilson A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Doctor of Veterinary Science Guelph, Ontario, Canada © Janet R. Sunohara-Neilson, December, 2013 ABSTRACT INVESTIGATION OF LEPORID HERPESVIRUS 4, AN EMERGING PATHOGEN OF RABBITS: INFECTION AND PREVALENCE STUDIES Janet Sunohara-Neilson Advisor: University of Guelph, 2013 Dr. Patricia V. Turner Leporid herpesvirus 4 (LeHV-4) is a recently identified alphaherpesvirus that causes lethal respiratory disease in rabbits. Diagnosis has been dependent on the observation of distinctive intranuclear inclusion bodies in affected tissues. The objectives of this body of work were to describe the course of infection in laboratory rabbits, develop a serological test for the detection of antibodies to LeHV-4, and survey Ontario commercial meat rabbits and pet rabbits for LeHV- 4 antibody prevalence. Based on the results of an initial dose-range finding pilot study, 22 New Zealand white rabbits were inoculated intranasally with LeHV-4 and monitored for 22 days post- infection (dpi). Clinical signs of infection, including dyspnea, serous oculonasal discharge, pyrexia and weight loss, were evident from 2 to 7 dpi. LeHV-4 was isolated from nasal secretions between 2 and 10 dpi. Gross and microscopic pathology was evaluated and suppurative necrohemorrhagic pneumonia and splenic necrosis were the major findings at peak infection (5 to 7 dpi), at which time eosinophilic herpetic inclusions were present in nasal mucosa, skin, spleen, and lung. Virus neutralization (VN) assay demonstrated serum antibodies starting at 11 dpi and persisting until the study end (22 dpi).
  • Viral Metagenomic Profiling of Croatian Bat Population Reveals Sample and Habitat Dependent Diversity

    Viral Metagenomic Profiling of Croatian Bat Population Reveals Sample and Habitat Dependent Diversity

    viruses Article Viral Metagenomic Profiling of Croatian Bat Population Reveals Sample and Habitat Dependent Diversity 1, 2, 1, 1 2 Ivana Šimi´c y, Tomaž Mark Zorec y , Ivana Lojki´c * , Nina Kreši´c , Mario Poljak , Florence Cliquet 3 , Evelyne Picard-Meyer 3, Marine Wasniewski 3 , Vida Zrnˇci´c 4, Andela¯ Cukuši´c´ 4 and Tomislav Bedekovi´c 1 1 Laboratory for Rabies and General Virology, Department of Virology, Croatian Veterinary Institute, 10000 Zagreb, Croatia; [email protected] (I.Š.); [email protected] (N.K.); [email protected] (T.B.) 2 Faculty of Medicine, Institute of Microbiology and Immunology, University of Ljubljana, 1000 Ljubljana, Slovenia; [email protected] (T.M.Z.); [email protected] (M.P.) 3 Nancy Laboratory for Rabies and Wildlife, ANSES, 51220 Malzéville, France; fl[email protected] (F.C.); [email protected] (E.P.-M.); [email protected] (M.W.) 4 Croatian Biospeleological Society, 10000 Zagreb, Croatia; [email protected] (V.Z.); [email protected] (A.C.)´ * Correspondence: [email protected] These authors contributed equally to this work. y Received: 21 July 2020; Accepted: 11 August 2020; Published: 14 August 2020 Abstract: To date, the microbiome, as well as the virome of the Croatian populations of bats, was unknown. Here, we present the results of the first viral metagenomic analysis of guano, feces and saliva (oral swabs) of seven bat species (Myotis myotis, Miniopterus schreibersii, Rhinolophus ferrumequinum, Eptesicus serotinus, Myotis blythii, Myotis nattereri and Myotis emarginatus) conducted in Mediterranean and continental Croatia. Viral nucleic acids were extracted from sample pools, and analyzed using Illumina sequencing.
  • Genetic Analysis of M94 of Murine Cytomegalovirus

    Genetic Analysis of M94 of Murine Cytomegalovirus

    Genetic analysis of M94 of murine cytomegalovirus Silke Maninger M¨unchen2010 Genetic analysis of M94 of murine cytomegalovirus Silke Maninger Dissertation zur Erlangung des Doktorgrades der Fakult¨atf¨urChemie und Pharmazie der Ludwig{Maximilians{Universit¨at M¨unchen vorgelegt von Silke Maninger aus Wiesbaden-Sonnenberg M¨unchen 2010 Erkl¨arung Diese Dissertation wurde im Sinne von x13 Absatz 4 der Promotionsordnung vom 29. Januar 1998 von Herrn Prof. Koszinowski betreut und von Herrn Prof. Beckmann vor der Fakult¨atf¨urChemie und Pharmazie vertreten. Ehrenw¨ortliche Versicherung Diese Dissertation wurde selbst¨andig,ohne unerlaubte Hilfe erarbeitet. M¨unchen, am 15.04.2010 ..................................................................... (Unterschrift des Autors) Dissertation eingereicht am : 15.04.2010 Erstgutachter : Herr Prof. Koszinowski Zweitgutachter : Herr Prof. Beckmann Tag der m¨undlichen Pr¨ufung : 29.06.2010 Contents Summary xv Zusammenfassung xvii 1 Introduction 1 1.1 Herpesviridae .................................. 1 1.1.1 Clinical relevance of human cytomegalovirus . 2 1.1.2 The murine cytomegalovirus model of HCMV . 3 1.1.3 Structure of cytomegaloviruses . 4 1.1.4 The genome of cytomegaloviruses . 4 1.1.5 Replication of cytomegaloviruses . 5 1.2 Genetics of herpesviruses . 8 1.2.1 Forward Genetics . 8 1.2.2 Reverse Genetics . 8 1.2.3 Mutagenesis of bacterial artificial chromosomes . 9 1.2.4 Random mutagenesis . 9 1.2.5 Dominant negative mutants . 11 1.3 The M94 gene of murine cytomegalovirus . 12 1.4 Aims of this study . 12 2 Materials and Methods 14 2.1 Material . 14 CONTENTS v 2.1.1 Devices . 14 2.1.2 Consumables . 15 2.1.3 Reagents .