Degrading Syntrophs Smithella Propionica Gen. Nov., Sp. Nov. and Syntrophobacter Wolinii

Total Page:16

File Type:pdf, Size:1020Kb

Degrading Syntrophs Smithella Propionica Gen. Nov., Sp. Nov. and Syntrophobacter Wolinii International Journal of Systematic Bacteriology (1 999),49, 545-556 Printed in Great Britain Characterization of the anaerobic propionate- degrading syntrophs Smithella propionica gen. nov., sp. nov. and Syntrophobacter wolinii Yitai Liu,' David L. Balkwill,2 Henry C. Aldri~h,~Gwendolyn R. Drake2 and David R. Boone' Author for correspondence: David R. Boone. Tel: + 1 503 725 3865. Fax: + 1 503 725 3888. e-mail: booned@,pdx.edu 1 Department of A strain of anaerobic, syntrophic, propionate-oxidizing bacteria, strain LYPT Environmental Biology, (= OCM 661T; T = type strain), was isolated and proposed as representative of a Portland State University, PO Box 751, Portland, OR new genus and new species, Smithella propionica gen. nov., sp. nov. The strain 97207-0751, USA was enriched from an anaerobic digestor and isolated. Initial isolation was as a * Department of Biological monoxeni c propi on at e-d eg ra d i ng co-cuIt u re conta i n i ng Methanospirillum Science, Florida State hungateii JF-lT as an H,- and formate-using partner. Later, an axenic culture University, Ta Ila hassee, FL, was obtained by using crotonate as the catabolic substrate. The previously USA described propionate-degrading syntrophs of the genus Syntrophobacter also 3 Department of grow in co-culture with methanogens such as Methanospirillum hungateii, Microbiology and Cell Science, University of forming acetate, CO, and methane from propionate. However, Smithella Florida, Gainesville, FL, propionica differs by producing less methane and more acetate; in addition, it USA forms small amounts of butyrate. Smithella propionica and Syntrophobacter wolinii grew within similar ranges of pH, temperature and salinity, but they differed significantly in substrate ranges and catabolic products. Unlike Syntrophobacter wolinii, Smithella propionica grew axenically on crotonate, although very slowly. Co-cultures of Smithella propionica grew on propionate, and grew slowly on crotonate or butyrate. Syntrophobacter wolinii and Syntrophobacterpfennigii grow on propionate plus sulfate, whereas Smithella propionica did not. Comparisons of 165 rDNA genes indicated that Smithella propionica is most closely related to Syntrophus, and is more distantly related to Syntrophobacter. Keywords : Swithella propionica, propionate-oxidizing bacteria, anaerobic digestor INTRODUCTION electron carriers for this transfer. Propionate oxidation with H, and formate production as the electron sink is Propionate is an important intermediate in methano- exergonic only when H, and formate concentrations genic fermentation: it is the precursor of a large are very low (Boone & Bryant, 1980; McInerney & fraction of methane from anaerobic digestors (Boone, Bryant, 198 1; Schink, 1997) (Table 1, equation A). 1982, 1984; Kaspar & Wuhrmann, 1978a), and its The propionate-degrading bacterium Syntrophobacter & accumulation inhibits anaerobic digestion (Kaspar wolinii was first isolated in co-cultures in which one or Wuhrmann, 1978b). Propionate is oxidized to acetate & both of these catabolic products were continuously and CO, (Boone, 1984; Stadtman Barker, 1951), removed by methanogens or sulfate-reducing bacteria with the electrons generated from this oxidation (Boone & Bryant, 1980). More recently, Syntropho- ultimately transferred to methanogens that form meth- bacter wolinii was shown to be phylogenetically related ane by CO, reduction. H, (Boone & Bryant, 1980; to sulfate-reducing bacteria (Harmsen et al., 1993). Wolin, 1982) and formate (Boone et al., 1989; Stams & Syntrophobacter et al., This led to the demonstration that Dong, 1995; Thiele 1988) are the interspecies wolinii can grow slowly on propionate with sulfate as electron acceptor, and allowed the first isolation of this The GenBank accession number for the 165 rRNA sequence of strain LYPT bacterium in axenic culture (Wallrabenstein et al., is AFI 26282. 1994). Stams et al. (1993) showed that propionate 00911 0 1999 IUMS 545 Y. Liu and others Table 1. Possible catabolic reactions during the anaerobic degradation of propionate Reaction Equation AQ H, at equilibrium* (kJ/reaction)t Pa nM I. Hydrogen-producing reactions A CH,CH,COO- + 2H,O -, CH,COO- + CO, + 3H, 71.7 12.1 89.2 B CH,CH,CH,COO- + 2H,O + 2CH,COO- + H++ 2H, 48.3 275 2024 11. Hydrogen-consuming reactions C CO, + 4H, + CH, + 2H,O - 130.7 0.3 17 2.33 D CH,CH,COO- + CO, + 3H, -+ CH,CH,CH,COO- + 2H,O -71.5 12-3 90.6 E(D + B) CH,CH,COO- + CO, + H, -, 2CH,COO- + H+ - 23.3 0.025 0.18 111. Combined hydrogen-producing and hydrogen-consuming reactions F(B + 1/2C) CH,CH,CH,COO- + 1/2CO, + H,O + - 17.1 2CH,COO- + H++ 1/2CH, G(4A + 3C) 4CH,CH,COO- + 2H,O --+ 4CH,COO- + CO, + 3CH, - 105.6 H(A + D) 2CH,CH,COO- -, CH,COO- + CH,CH,CH,COO- 0.12 I(3F +A) 4CH,CH,COO- + 2C0, + 2H,O + 7CH,COO- + 3H+ 1.91 * H, activity for AG = 0 with the following activities: CH,, 0.5 atm; CO,, 0-5 atm; acetate, propionate and butyrate at 1 mM; pH = 7. j. H,, CO,, and CH, in the gaseous state; H' at lo-' mol activity per kg; all other substances in aqueous solution at 1 mol of activity per kg; 25 "C (Thauer et al., 1977). enrichment cultures could also grow in the absence of generated internally, such as by propionate oxidation syntrophic interactions by fermenting fumarate to (Table 1, equation H) or, in part, by butyrate oxidation succinate and CO,, and demonstrated the enzymes of (Table 1, equation D). a fermentative pathway that includes acetyl-CoA oxidation to CO, (Plugge et al., 1993). They were In this paper, we report the isolation of strain LYPT, a unable to grow Syntrophobacter wolinii axenically on bacterium that syntrophically degrades propionate fumarate because fumarate was metabolized by the with butyrate as a small but significant product, and sulfate-reducing bacterium present in that syntrophic that also slowly degrades butyrate. We propose it as Smithellapropionica culture (Stams et al., 1993). In this paper, we report the the type strain of gen. nov., sp. isolation of the type strain of Syntrophobacter wolinii nov. This strain's 16s rDNA sequence, whose de- from its co-culture with Desulfovibrio strain GI1 in termination is reported herein, has been used to monoxenic co-culture with Methanospirillurn hungateii develop primers that detect phylogenetically similar and in axenic culture with fumarate as a catabolic organisms in anaerobic digestors (Sauer et al., 1997). substrate. Portions of this material were reported previously (Liu et al., 1998). Propionate degradation by Syntrophobacter wolinii (Houwen et al., 199 l), anaerobic sediments (Schink, 1985), anaerobic digestors (Robbins, 1987, 1988 ; METHODS Tholozan et al., 1988) and other methanogenic en- Source of inoculum and cultures. The source from which vironments (Boone, 1984; Houwen et al., 1987, 1990; strain LYPT was enriched was an up-flow anaerobic filter Koch et al., 1983) occurs mainly by the methyl-malonyl inoculated with digested domestic sewage sludge and op- pathway, with succinate as a symmetrical intermediate. erated with propionate as the major feedstock for 6 months. This pathway leads to the production of 1 mol acetate, Cultures were obtained from the Oregon Collection of 1 mol CO, and three pairs of electrons (i.e. a total of Methanogens (OCM) : Syntrophobacter wolinii DBT in co- culture with Desulfovibrio G11 (= OCM 467), Syntro- 3 mol H, and formate) per mol propionate degraded phomonas wolfeii LYB (= OCM 65), which is a butyrate- (Table 1, equation A). However, some propionate in oxidizing syntroph (Boone et al., 1989). Methanosarcina anaerobic digestors is reductively carboxylated to barkeri NIH-1 (= OCM 266) was purified from Methano- butyrate (Samain et al., 1984; Tholozan et al., 1988), sarcina barkeri NIH (= OCM 265) (Blaylock & Stadtman, and this reduction can occur in the absence of 1966) by roll-tube isolation in MS medium with 50 mM methanogenesis (Samain et al., 1984). This six-electron methanol. Methanospirillurn hungateii JF- lT( = OCM 16T) reduction (e.g. Table 1, equation D) probably does not is a H,- and formate-utilizing methanogen. use H, as electron donor if it is a catabolic reaction, Media and culture technique. We used the anaerobic because the reaction is not exergonic at the low H, techniques of Hungate (1969) with some modifications concentrations found in anaerobic digestors. However, (Miller & Wolin, 1974; Sowers & Noll, 1995). Except where the electrons to accomplish this reduction could be noted, we used MS medium (Boone et al., 1989), an 546 international Journal of Systematic Bacteriology 49 Smithella propionica gen. nov., sp. nov. anaerobic bicarbonate-buffered medium with 2 g 1-1 each of cycle sequencing method according to the manufacturer’s Trypticase peptone and yeast extract; MES (0.5 g 1-l) and procedures (McBride et al., 1989). The following primers Na,S. 9H,O (0.25 g 1-I) were the reducing agents. MS en- were used for sequencing : C (5’ ACGGGCGGTGTGTAC) richment medium was the same as MS medium except that (Lane et al., 1985), corresponding to positions 1406-1392 in yeast extract and Trypticase peptone were reduced to 0.5 g the 16s rDNA nucleotide sequence of Escherichia coii of each per litre. We also used MS low-nutrient medium in (Brosius et al., 1978) ; C-complement (5’ GTACACACCG- which the amount of yeast extract was reduced to CCCGT; E. coli positions 1392-1406); H (5’ ACACGA- 0.01 g 1-land Trypticase peptone was omitted. Agar media GCTGACGACAGCCA; positions 1075-1056); G (5’ CC- contained 18 g purified agar 1-l. For isolations, we placed AGGGTATCTAATCCTGTT ; positions 800-78 1) ; G- cultures into anaerobic jars with an anoxic gas to eliminate complement (5’ AACAGGATTAGATACCCTGG ; posi- oxygen diffusion through the stoppers, thus allowing longer tions 78 1-800) ; A (5’ GTATTACCGCGG[C/G]TGCTG ; anoxic incubations. positions 536519) ; P (5’ CTGCTTCCTCCCGTAGGAG; positions 357-339) ; P-complement (5’ CTACGGGAGGC- Analytical techniques. Methane was quantified by GC with & AGCAG; positions 342-357); and F,C (5’ AGAGTT- flame-ionization detection (Maestrojuan Boone, 199 1) TGATC[A/C]TGGCTC ; positions 8-25).
Recommended publications
  • Core Sulphate-Reducing Microorganisms in Metal-Removing Semi-Passive Biochemical Reactors and the Co-Occurrence of Methanogens
    microorganisms Article Core Sulphate-Reducing Microorganisms in Metal-Removing Semi-Passive Biochemical Reactors and the Co-Occurrence of Methanogens Maryam Rezadehbashi and Susan A. Baldwin * Chemical and Biological Engineering, University of British Columbia, 2360 East Mall, Vancouver, BC V6T 1Z3, Canada; [email protected] * Correspondence: [email protected]; Tel.: +1-604-822-1973 Received: 2 January 2018; Accepted: 17 February 2018; Published: 23 February 2018 Abstract: Biochemical reactors (BCRs) based on the stimulation of sulphate-reducing microorganisms (SRM) are emerging semi-passive remediation technologies for treatment of mine-influenced water. Their successful removal of metals and sulphate has been proven at the pilot-scale, but little is known about the types of SRM that grow in these systems and whether they are diverse or restricted to particular phylogenetic or taxonomic groups. A phylogenetic study of four established pilot-scale BCRs on three different mine sites compared the diversity of SRM growing in them. The mine sites were geographically distant from each other, nevertheless the BCRs selected for similar SRM types. Clostridia SRM related to Desulfosporosinus spp. known to be tolerant to high concentrations of copper were members of the core microbial community. Members of the SRM family Desulfobacteraceae were dominant, particularly those related to Desulfatirhabdium butyrativorans. Methanogens were dominant archaea and possibly were present at higher relative abundances than SRM in some BCRs. Both hydrogenotrophic and acetoclastic types were present. There were no strong negative or positive co-occurrence correlations of methanogen and SRM taxa. Knowing which SRM inhabit successfully operating BCRs allows practitioners to target these phylogenetic groups when selecting inoculum for future operations.
    [Show full text]
  • Desulfovirga Adipica Gen. Nov., Sp. Nov., an Adipate-Degrading, Gram-Negative, Sulfate-Reducing Bacterium
    International Journal of Systematic and Evolutionary Microbiology (2000), 50, 639–644 Printed in Great Britain Desulfovirga adipica gen. nov., sp. nov., an adipate-degrading, Gram-negative, sulfate-reducing bacterium Kazuhiro Tanaka,1 Erko Stackebrandt,2 Shigehiro Tohyama3 and Tadashi Eguchi3 Author for correspondence: Kazuhiro Tanaka. Tel\Fax: j81 298 61 6083. e-mail: ktanaka!nibh.go.jp 1 Applied Microbiology A novel, mesophilic, Gram-negative bacterium was isolated from an anaerobic Department, National digestor for municipal wastewater. The bacterium degraded adipate in the Institute of Bioscience and Human-Technology, presence of sulfate, sulfite, thiosulfate and elemental sulfur. (E)-2- Higashi 1-1, Tsukuba, Hexenedioate accumulated transiently in the degradation of adipate. (E)-2- Ibaraki 305-8566, Japan Hexenedioate, (E)-3-hexenedioate, pyruvate, lactate, C1–C12 straight-chain fatty 2 Deutsche Sammlung von acids and C2–C10 straight-chain primary alcohols were also utilized as electron Mikroorganismen und donors. 3-Phenylpropionate was oxidized to benzoate. The GMC content of the Zellkulturen GmbH, Mascheroder Weg 1b, DNA was 60 mol%. 16S rDNA sequence analysis revealed that the new isolate D-38124 Braunschweig, clustered with species of the genus Syntrophobacter and Desulforhabdus Germany amnigenus. Strain TsuAS1T resembles Desulforhabdus amnigenus DSM 10338T 3 Department of Chemistry with respect to the ability to utilize acetate as an electron donor and the and Materials Science, inability to utilize propionate without sulfate in co-culture with Tokyo Institute of T T Technology, O-okayama, Methanospirillum hungatei DSM 864. Strains TsuAS1 and DSM 10338 form a Meguro-ku, Tokyo ‘non-syntrophic subcluster’ within the genus Syntrophobacter. Desulfovirga 152-8551, Japan adipica gen.
    [Show full text]
  • Sp. Nov., New Syntrophically Propionate-Oxidizing Anaerobe Growing in Pure Culture with Propionate and Sulfate
    Arch Microbiol (1995) 164:346-352 Springer-Verlag 1995 Christina Wallrabenstein Elisabeth Hauschild Bernhard Schink Syntrophobacter pfennigii sp. nov., new syntrophically propionate-oxidizing anaerobe growing in pure culture with propionate and sulfate Received: 3 July 1995 / Accepted: 16 August 1995 Abstract A new strain of syntrophically propionate-oxi- teria (Zehnder 1978). Fermentation of propionate to ac- dizing fermenting bacteria, strain KoPropl, was isolated etate, CO2, and hydrogen is a highly endergonic process from anoxic sludge of a municipal sewage plant. It oxi- (calculations of free energies after Thauer et al. 1977): dized propionate or lactate in cooperation with the hydro- CH3CH2COO + 2 H20----)CH3COO -t-CO2 + 3 H 2 (1) gen- and formate-utilizing Methanospirillum hungatei AG 0" = +76.0 kJ/mol propionate and grew as well in pure culture without a syntrophic part- ner with propionate or lactate plus sulfate as energy The hydrogen partial pressure has to be kept low by the source. In all cases, the substrates were oxidized stoichio- partner organism to make the reaction energetically feasi- metrically to acetate and CO2, with concomitant forma- ble, e.g., in syntrophic methanogenic propionate degrada- tion of methane or sulfide. Cells formed gas vesicles in tion: the late growth phase and contained cytochromes b and c, 4 CH3CH2COO- + 2 H20--M CH3COO- + CO2+3 CH 4 (2) a menaquinone-7, and desulforubidin, but no desul- AG 0" = -26.5 kJ/mol propionate foviridin. Enzyme measurements in cell-free extracts indi- cated that propionate was oxidized through the methyl- However, the amount of free energy liberated during syn- malonyl CoA pathway.
    [Show full text]
  • 'Candidatus Desulfonatronobulbus Propionicus': a First Haloalkaliphilic
    Delft University of Technology ‘Candidatus Desulfonatronobulbus propionicus’ a first haloalkaliphilic member of the order Syntrophobacterales from soda lakes Sorokin, D. Y.; Chernyh, N. A. DOI 10.1007/s00792-016-0881-3 Publication date 2016 Document Version Accepted author manuscript Published in Extremophiles: life under extreme conditions Citation (APA) Sorokin, D. Y., & Chernyh, N. A. (2016). ‘Candidatus Desulfonatronobulbus propionicus’: a first haloalkaliphilic member of the order Syntrophobacterales from soda lakes. Extremophiles: life under extreme conditions, 20(6), 895-901. https://doi.org/10.1007/s00792-016-0881-3 Important note To cite this publication, please use the final published version (if applicable). Please check the document version above. Copyright Other than for strictly personal use, it is not permitted to download, forward or distribute the text or part of it, without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license such as Creative Commons. Takedown policy Please contact us and provide details if you believe this document breaches copyrights. We will remove access to the work immediately and investigate your claim. This work is downloaded from Delft University of Technology. For technical reasons the number of authors shown on this cover page is limited to a maximum of 10. Extremophiles DOI 10.1007/s00792-016-0881-3 ORIGINAL PAPER ‘Candidatus Desulfonatronobulbus propionicus’: a first haloalkaliphilic member of the order Syntrophobacterales from soda lakes D. Y. Sorokin1,2 · N. A. Chernyh1 Received: 23 August 2016 / Accepted: 4 October 2016 © Springer Japan 2016 Abstract Propionate can be directly oxidized anaerobi- from its members at the genus level.
    [Show full text]
  • Tropical Soil Metagenome Library Reveals Complex Microbial Assemblage
    bioRxiv preprint doi: https://doi.org/10.1101/018895; this version posted May 3, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Tropical Soil Metagenome Library Reveals Complex Microbial Assemblage Kok-Gan Chan 1# and Zahidah Ismail 1 1 Division of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia # Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +603-7967-5162; Fax: +603-7967-4509. 1 1 bioRxiv preprint doi: https://doi.org/10.1101/018895; this version posted May 3, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 2 Abstract 3 In this work, we characterized the metagenome of a Malaysian mangrove soil sample via next 4 generation sequencing (NGS). Shotgun NGS data analysis revealed high diversity of microbes 5 from Bacteria and Archaea domains. The metabolic potential of the metagenome was 6 reconstructed using the NGS data and the SEED classification in MEGAN shows abundance of 7 virulence factor genes, implying that mangrove soil is potential reservoirs of pathogens. 8 9 Keywords: Metagenomics, Mangrove, Soil, Proteobacteria 10 2 bioRxiv preprint doi: https://doi.org/10.1101/018895; this version posted May 3, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
    [Show full text]
  • Phylogenetic Profile of Copper Homeostasis in Deltaproteobacteria
    Phylogenetic Profile of Copper Homeostasis in Deltaproteobacteria A Major Qualifying Report Submitted to the Faculty of Worcester Polytechnic Institute In Partial Fulfillment of the Requirements for the Degree of Bachelor of Science By: __________________________ Courtney McCann Date Approved: _______________________ Professor José M. Argüello Biochemistry WPI Project Advisor 1 Abstract Copper homeostasis is achieved in bacteria through a combination of copper chaperones and transporting and chelating proteins. Bioinformatic analyses were used to identify which of these proteins are present in Deltaproteobacteria. The genetic environment of the bacteria is affected by its lifestyle, as those that live in higher concentrations of copper have more of these proteins. Two major transport proteins, CopA and CusC, were found to cluster together frequently in the genomes and appear integral to copper homeostasis in Deltaproteobacteria. 2 Acknowledgements I would like to thank Professor José Argüello for giving me the opportunity to work in his lab and do some incredible research with some equally incredible scientists. I need to give all of my thanks to my supervisor, Dr. Teresita Padilla-Benavides, for having me as her student and teaching me not only lab techniques, but also how to be scientist. I would also like to thank Dr. Georgina Hernández-Montes and Dr. Brenda Valderrama from the Insituto de Biotecnología at Universidad Nacional Autónoma de México (IBT-UNAM), Campus Morelos for hosting me and giving me the opportunity to work in their lab. I would like to thank Sarju Patel, Evren Kocabas, and Jessica Collins, whom I’ve worked alongside in the lab. I owe so much to these people, and their support and guidance has and will be invaluable to me as I move forward in my education and career.
    [Show full text]
  • Dynamic Evolution of Selenocysteine Utilization in Bacteria: a Balance Between Selenoprotein Loss and Evolution of Selenocysteine from Redox Active Cysteine Residues
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Vadim Gladyshev Publications Biochemistry, Department of October 2006 Dynamic evolution of selenocysteine utilization in bacteria: a balance between selenoprotein loss and evolution of selenocysteine from redox active cysteine residues Yan Zhang University of Nebraska-Lincoln, [email protected] Hector Romero Instituto de Biología, Facultad de Ciencias, Uruguay Gustavo Salinas Instituto de Higiene, Avda A Navarro 3051, Montevideo, CP 11600, Uruguay Vadim Gladyshev University of Nebraska-Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/biochemgladyshev Part of the Biochemistry, Biophysics, and Structural Biology Commons Zhang, Yan; Romero, Hector; Salinas, Gustavo; and Gladyshev, Vadim, "Dynamic evolution of selenocysteine utilization in bacteria: a balance between selenoprotein loss and evolution of selenocysteine from redox active cysteine residues" (2006). Vadim Gladyshev Publications. 6. https://digitalcommons.unl.edu/biochemgladyshev/6 This Article is brought to you for free and open access by the Biochemistry, Department of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Vadim Gladyshev Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Open Access Research2006ZhangetVolume al. 7, Issue 10, Article R94 Dynamic evolution of selenocysteine utilization in bacteria: a comment balance between selenoprotein loss and evolution of selenocysteine from redox active cysteine residues Yan Zhang*, Hector Romero†, Gustavo Salinas‡ and Vadim N Gladyshev* Addresses: *Department of Biochemistry, University of Nebraska, 1901 Vine street, Lincoln, NE 68588-0664, USA. †Laboratorio de Organización y Evolución del Genoma, Laboratorio de Organización y Evolución del Genoma, Dpto de Biología Celular y Molecular, Instituto ‡ de Biología, Facultad de Ciencias, Iguá 4225, Montevideo, CP 11400, Uruguay.
    [Show full text]
  • Syntrophobacter Furnaroxidans Sp. Nov., a Syntrophic Propionate-Degrading Sulfate- Reducing Bacterium
    international Journal of Systematic Bacteriology (1 998), 48, 1383-1 387 Printed in Great Britain ~ ~~ Syntrophobacter furnaroxidans sp. nov., a syntrophic propionate-degrading sulfate- reducing bacterium Hermie J. M. Harmsen, Bernardina L. M. Van Kuijk, Caroline M. Plugge, Antoon D. L. Akkermans, Willem M. De Vos and Alfons J. M. Stams Author for correspondence: Alfons J. M. Stams. Tel: + 31 317 482105. Fax: + 31 317 483829. e-mail : fons.stams(u) algemeen.micr.wau.nl Laboratory of A syntrophic propionate-oxidizing bacterium, strain MPOBT,was isolated from Microbiology, a culture enriched from anaerobic granular sludge. It oxidized propionate Wageningen Agricultural University, Hesselink van syntrophically in co-culture with the hydrogen- and formate-utilizing Suchtelenweg 4, 6703 CT Methanospirillurn hungateii, and was able to oxidize propionate and other Wageningen, organic compounds in pure culture with sulfate or fumarate as the electron The Netherlands acceptor. Additionally, it fermented f umarate. 16s rRNA sequence analysis revealed a relationship with Syn trophobacter wolinii and Syn trophobacter pfennigii. The G+C content of its DNA was 60.6 mol%, which is in the same range as that of other Syntrophobacter species. DNA-DNA hybridization studies showed less than 26% hybridization among the different genomes of Syntrophobacter species and strain MPOBT. This justifies the assignment of strain MPOBT to the genus Syntrophobacter as a new species. The name Syntrophobacter fumaroxidans is proposed; strain MPOBT(= DSM 10017T)is the type strain. INTRODUCTION pionate by the use of HS-CoA transferase (1 1). 16s rRNA sequence analysis of S. wolinii, S. pfennigii, For a long time, Syntrophobacter niolinii was the only strain HP1.l and strain MPOBT revealed that these described bacterium which could oxidize propionate syntrophic bacteria are closely related and belong to syntrophically in co-culture with the hydrogen-con- the delta subclass of Proteobacteria (3, 4, 19).
    [Show full text]
  • Activity and Interactions of Methane Seep Microorganisms Assessed by Parallel Transcription and FISH-Nanosims Analyses
    The ISME Journal (2016) 10, 678–692 © 2016 International Society for Microbial Ecology All rights reserved 1751-7362/16 OPEN www.nature.com/ismej ORIGINAL ARTICLE Activity and interactions of methane seep microorganisms assessed by parallel transcription and FISH-NanoSIMS analyses Anne E Dekas1, Stephanie A Connon, Grayson L Chadwick, Elizabeth Trembath-Reichert and Victoria J Orphan Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA, USA To characterize the activity and interactions of methanotrophic archaea (ANME) and Deltaproteo- bacteria at a methane-seeping mud volcano, we used two complimentary measures of microbial activity: a community-level analysis of the transcription of four genes (16S rRNA, methyl coenzyme M reductase A (mcrA), adenosine-5′-phosphosulfate reductase α-subunit (aprA), dinitrogenase reductase (nifH)), and a single-cell-level analysis of anabolic activity using fluorescence in situ hybridization coupled to nanoscale secondary ion mass spectrometry (FISH-NanoSIMS). Transcript analysis revealed that members of the deltaproteobacterial groups Desulfosarcina/Desulfococcus (DSS) and Desulfobulbaceae (DSB) exhibit increased rRNA expression in incubations with methane, suggestive of ANME-coupled activity. Direct analysis of anabolic activity in DSS cells in consortia with ANME by FISH-NanoSIMS confirmed their dependence on methanotrophy, with no 15 + NH4 assimilation detected without methane. In contrast, DSS and DSB cells found physically independent of ANME (i.e., single cells) were anabolically active in incubations both with and without methane. These single cells therefore comprise an active ‘free-living’ population, and are not dependent on methane or ANME activity. We investigated the possibility of N2 fixation by seep Deltaproteobacteria and detected nifH transcripts closely related to those of cultured diazotrophic 15 Deltaproteobacteria.
    [Show full text]
  • Syntrophobacter Fumaroxidans Strain (MPOB(T))
    UCLA UCLA Previously Published Works Title Complete genome sequence of Syntrophobacter fumaroxidans strain (MPOB(T)). Permalink https://escholarship.org/uc/item/8mq584qm Journal Standards in genomic sciences, 7(1) ISSN 1944-3277 Authors Plugge, Caroline M Henstra, Anne M Worm, Petra et al. Publication Date 2012-10-01 DOI 10.4056/sigs.2996379 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Standards in Genomic Sciences (2012) 7:91-106 DOI:10.4056/sigs.2996379 Complete genome sequence of Syntrophobacter T fumaroxidans strain (MPOB ) Caroline M. Plugge1*, Anne M. Henstra1,2, Petra Worm1, Daan C. Swarts1, Astrid H. Paulitsch-Fuchs3, Johannes C.M. Scholten4, Athanasios Lykidis5, Alla L. Lapidus5, Eugene Goltsman5, Edwin Kim5, Erin McDonald2, Lars Rohlin2, Bryan R. Crable6, Robert P. Gunsalus2, Alfons J.M. Stams1 and Michael J. McInerney6 1Laboratory of Microbiology, Wageningen University, Wageningen, Netherlands 2Department of Microbiology, Immunology, and Molecular Genetics, University of California, Los Angeles, CA, USA 3Wetsus, Centre of Excellence for Sustainable Water Technology, Leeuwarden, Netherlands 4Microbiology Group, Pacific Northwest National Laboratory, Richland, WA, USA 5Joint Genome Institute, Walnut Creek, CA, USA 6Department of Botany and Microbiology, University of Oklahoma, Norman, OK, USA *Corresponding author: Caroline M. Plugge ( [email protected]) Keywords: Anaerobic, Gram-negative, syntrophy, sulfate reducer, mesophile, propionate conversion, host-defense systems, Syntrophobacteraceae, Syntrophobacter fumaroxidans, Methanospirillum hungatei Syntrophobacter fumaroxidans strain MPOBT is the best-studied species of the genus Syntrophobacter. The species is of interest because of its anaerobic syntrophic lifestyle, its in- volvement in the conversion of propionate to acetate, H2 and CO2 during the overall degra- dation of organic matter, and its release of products that serve as substrates for other microor- ganisms.
    [Show full text]
  • Peat: Home to Novel Syntrophic Species That Feed Acetate- and Hydrogen-Scavenging Methanogens
    The ISME Journal (2016) 10, 1954–1966 © 2016 International Society for Microbial Ecology All rights reserved 1751-7362/16 www.nature.com/ismej ORIGINAL ARTICLE Peat: home to novel syntrophic species that feed acetate- and hydrogen-scavenging methanogens Oliver Schmidt, Linda Hink, Marcus A Horn and Harold L Drake Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany Syntrophic bacteria drive the anaerobic degradation of certain fermentation products (e.g., butyrate, ethanol, propionate) to intermediary substrates (e.g., H2, formate, acetate) that yield methane at the ecosystem level. However, little is known about the in situ activities and identities of these syntrophs in peatlands, ecosystems that produce significant quantities of methane. The consumption of butyrate, ethanol or propionate by anoxic peat slurries at 5 and 15 °C yielded methane and CO2 as the sole accumulating products, indicating that the intermediates H2, formate and acetate were scavenged effectively by syntrophic methanogenic consortia. 16S rRNA stable isotope probing identified novel species/strains of Pelobacter and Syntrophomonas that syntrophically oxidized ethanol and butyrate, respectively. Propionate was syntrophically oxidized by novel species of Syntrophobacter and Smithella, genera that use different propionate-oxidizing pathways. Taxa not known for a syntrophic metabolism may have been involved in the oxidation of butyrate (Telmatospirillum-related) and propionate (unclassified Bacteroidetes and unclassified Fibrobac- teres). Gibbs free energies (ΔGs) for syntrophic oxidations of ethanol and butyrate were more favorable than ΔGs for syntrophic oxidation of propionate. As a result of the thermodynamic constraints, acetate transiently accumulated in ethanol and butyrate treatments but not in propionate treatments. Aceticlastic methanogens (Methanosarcina, Methanosaeta) appeared to outnumber hydrogenotrophic methanogens (Methanocella, Methanoregula), reinforcing the likely importance of aceticlastic methanogenesis to the overall production of methane.
    [Show full text]
  • Metagenomic Analyses of the Late Pleistocene Permafrost
    Discussion Paper | Discussion Paper | Discussion Paper | Discussion Paper | Biogeosciences Discuss., 12, 12091–12119, 2015 www.biogeosciences-discuss.net/12/12091/2015/ doi:10.5194/bgd-12-12091-2015 BGD © Author(s) 2015. CC Attribution 3.0 License. 12, 12091–12119, 2015 This discussion paper is/has been under review for the journal Biogeosciences (BG). Metagenomic Please refer to the corresponding final paper in BG if available. analyses of the late Pleistocene Metagenomic analyses of the late permafrost Pleistocene permafrost – additional E. Rivkina et al. tools for reconstruction of Title Page environmental conditions Abstract Introduction E. Rivkina1, L. Petrovskaya2, T. Vishnivetskaya3, K. Krivushin1, L. Shmakova1, Conclusions References 4,7 3 4,5,6 M. Tutukina , A. Meyers , and F. Kondrashov Tables Figures 1Institute of Physicochemical and Biological Problems in Soil Science, Russian Academy of Sciences, Pushchino, Russia J I 2Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow, Russia J I 3 University of Tennessee, Center for Environmental Biotechnology, Knoxville, USA Back Close 4Bioinformatics and Genomics Programme, Centre for Genomic Regulation (CRG), Barcelona, Spain Full Screen / Esc 5Universitat Pompeu Fabra (UPF), Barcelona, Spain 6Institució Catalana de Recerca i Estudis Avançats (ICREA), Barcelona, Spain Printer-friendly Version 7Institute of Cell Biophysics, Russian Academy of Sciences, Pushchino, Russia Interactive Discussion 12091 Discussion Paper | Discussion Paper | Discussion Paper | Discussion Paper | Received: 17 June 2015 – Accepted: 14 July 2015 – Published: 4 August 2015 Correspondence to: E. Rivkina ([email protected]) BGD Published by Copernicus Publications on behalf of the European Geosciences Union. 12, 12091–12119, 2015 Metagenomic analyses of the late Pleistocene permafrost E.
    [Show full text]