University of Kentucky UKnowledge
Pharmaceutical Sciences Faculty Patents Pharmaceutical Sciences
8-11-2020
Method and System for Terpene Production Platforms in Yeast
Joseph Chappell University of Kentucky, [email protected]
Xun Zhuang University of Kentucky
Shuiqin Wu University of Kentucky
Follow this and additional works at: https://uknowledge.uky.edu/ps_patents
Part of the Pharmacy and Pharmaceutical Sciences Commons Right click to open a feedback form in a new tab to let us know how this document benefits ou.y
Recommended Citation Chappell, Joseph; Zhuang, Xun; and Wu, Shuiqin, "Method and System for Terpene Production Platforms in Yeast" (2020). Pharmaceutical Sciences Faculty Patents. 193. https://uknowledge.uky.edu/ps_patents/193
This Patent is brought to you for free and open access by the Pharmaceutical Sciences at UKnowledge. It has been accepted for inclusion in Pharmaceutical Sciences Faculty Patents by an authorized administrator of UKnowledge. For more information, please contact [email protected]. I 1111111111111111 1111111111 1111111111 lllll 111111111111111 1111111111 11111111 US010738328Bl c12) United States Patent (10) Patent No.: US 10,738,328 Bl Chappell et al. (45) Date of Patent: * Aug. 11, 2020
(54) METHOD AND SYSTEM FOR TERPENE Asadollahi et al. 2008 (Production of Plant Sesquiterpenes in PRODUCTION PLATFORMS IN YEAST Saccharomyces cerevisiae: Effect ofERG9 Repression on Sesquiterpene Biosynthesis; Biotechnology and Bioengineering 99(3): 666-677).* (71) Applicant: University of Kentucky Research Tarshis et al. 1994 (Crystal Structure of Recombinant Farnesyl Diphosphate Synthase at 2.6 A Resolution; Biochemistry 33: 10871- Foundation, Lexington, KY (US) 10877). * Genetic Nomenclature Guide. 1998. SGD (Saccharomyces Genome (72) Inventors: Joe Chappell, Lexington, KY (US); Database) http://genome-www.stanford.edu/Saccharomyces/. * Xun Zhuang, Lexington, KY (US); Wu Takahashi et al. 2007 (Biotechnology and Bioengineering; 97( 1): 170- Shuiqin, San Diego, CA (US) 181 ). * Kayscek et al. 2015 (Yeast as a cell factory: current state and perspectives; Microbial Cell Factories 14:94). (Year: 2015).* (73) Assignee: UNIVERSITY OF KENTUCKY Kim, Tae-Dong, et al., "Expression and Functional Characterization RESEARCH FOUNDATION, of Three Squalene Synthase Genes Associated with Saponin Bio Lexington, KY (US) synthesis in Panas ginseng", Plant Cell Physiol., (2010) 52(1): 125-137. ( *) Notice: Subject to any disclaimer, the term ofthis Asadollahi MA, Maury J, Moller K, Nielsen KF, Schalk M, Clark patent is extended or adjusted under 35 A, Nielsen J (2008) Production of plant sesquiterpenes in Sac U.S.C. 154(b) by O days. charomyces cerevisiae: Effect of ERG9 repression on sesquiterpene biosynthesis. Biotechnology and Bioengineering 99: 666-677. This patent is subject to a terminal dis Asadollahi MA, Maury J, Schalk M, Clark A, Nielsen J (2010) claimer. Enhancement of farnesyl diphosphate pool as direct precursor of sesquiterpenes through metabolic engineering of the mevalonate pathway in Saccharomyces cerevisiae. Biotechnology and Bioen (21) Appl. No.: 14/092,496 gineering 106: 86-96. Bedoukian PE (1983) Perfumery and flavour materials. Perfumer & (22) Filed: Nov. 27, 2013 Flavorist 8: 1, 3-6. Bergstrom JD, Dufresne C, Bills GF, Nallinomstead M, Byrne K Related U.S. Application Data (1995) Discovery, biosynthesis, and mechanism of action of the (60) Provisional application No. 61/730,412, filed on Nov. zaragozic acids ~potent inhibitors of squalene synthase. Annual 27, 2012. Review of Microbiology 49: 607-639. Bourot S, Karst F (1995) Isolation and characterization of the saccharomycescerevisiae sutl gene involved in sterol uptake. Gene (51) Int. Cl. 165: 97-102 Buckingham J (2003) Dictionary of Natural Products. C12P 5100 (2006.01) Chapman & Hall/CRC Chemical Database. (52) U.S. Cl. Bhilwade HN, Tatewaki N, Nishida H, Konishi T (2010) Squalene CPC ...... C12P 51007 (2013.01) as novel food factor. Current Pharmaceutical Biotechnology 11: ( 58) Field of Classification Search 875-880. None Casida JE (2009) Pest toxicology: the primary mechanisms of See application file for complete search history. pesticide action. Chemical Research in Toxicology 22: 609-619. Fischer MJC, Meyer S, Claude! P, Bergdoll M, Karst F (2011) Metabolic engineering of monoterpene synthesis in yeast. Biotech (56) References Cited nology and Bioengineering 108: 1883-1892. Huang Z-R, Lin Y-K, Fang J-Y (2009) Biological and pharmaco U.S. PATENT DOCUMENTS logical activities of squalene and related compounds: potential uses in cosmetic dermatology. Molecules 14: 540-554. 6,531,303 Bl 3/2003 Millis et al. 6,689,593 B2 * 2/2004 Millis ...... C07C 403/08 Janke C, Magiera MM, Rathfelder N, Taxis C, Reber 5, Maekawa 435/155 H, Moreno-BorchartA, Doenges G, Schwob E, Schiebel E, Knop M 6,828,092 Bl 12/2004 Dixon et al. (2004) A versatile toolbox for PCR-based tagging of yeast genes: 7,172,886 B2 2/2007 Keasling et al. new fluorescent proteins, more markers and promoter substitution 7,927,862 B2 4/2011 Millis et al. cassettes. Yeast 21: 947-962. 7,985,567 B2 7/2011 Chou et al. (Continued) 8,114,645 B2 2/2012 Pitera et al. 2004/0072323 Al 4/2004 Matsuda et al. 2007/0015237 Al 1/2007 Bailey et al. Primary Examiner - Mary Maille Lyons 2008/0020438 Al 1/2008 Matsuda et al. (74) Attorney, Agent, or Firm - Stephen J. Weyer, Esq.; 2009/0324800 Al 12/2009 Bailey et al. Stites & Harbison, PLLC 2011/0021843 Al 1/2011 Bailey et al. 2011/0039299 Al 2/2011 Bailey et al. (57) ABSTRACT 2012/0149886 Al 6/2012 Bailey et al. A method is provided for producing modified mutant yeast OTHER PUBLICATIONS and the resulting yeast that can be used as a platform for terpene production. The method includes chemical muta Grabowska et al. 1998 (Effect of squalene synthase gene disruption genesis to effect ergosterol dependent growth in yeast. on synthesis of polyprenols in Saccharomyces cerevisiae; FEBS Subsequently, these yeast are subjected to an erg9 knockout Letters 434:466-408). * mutation to thereby produce ergosterol dependent growth/ Takahashi et al. 2007 (Metabolic Engineering of Sesquiterpene erg9 knockout mutation yeast cell lines. The resulting yeast Metabolism in Yeast; Biotechnology and Bioengineering; 97( 1): 170- are well suited for use in the production of terpenes. 181 ). * Kennedy et al. 1999 (Transcriptional regulation of the squalene 14 Claims, 15 Drawing Sheets synthase gene (ERG9) in the yeast Saccharomyces cerev1s1ae; Biochimica et Biophysica Acta 1445:110-122).* Specification includes a Sequence Listing. US 10,738,328 Bl Page 2
(56) References Cited of the triterpene sweetener glycyrrhizin. Proceedings of the National Academy of Sciences of the United States of America 105: 14204- 14209. OTHER PUBLICATIONS Shianna KV, Dotson WD, Tove S, Parks LW (2001) Identification Keasling J (2009) Synthetic biology in pursuit of inexpensive, of a UPC2 homolog in Saccharomyces cerevisiae and its involve effective, anti ~malarial drugs. Bio societies 4: 275-282. ment in aerobic sterol uptake. Journal of Bacteriology 183: 830-834. Kirby J, Romanini DW, Paradise EM, Keasling JD (2008) Engi Silva L, Coutinho A, Fedorov A, Prieto M (2006) Competitive neering triterpene production in Saccharomyces cerevisiae-beta binding of cholesterol and ergosterol to the polyene antibiotic amyrin synthase from Artemisia annua. Febs Journal 275: 1852- nystatin. A fluorescence study. Biophysical Journal 90: 3625-3631. 1859. Takahashi S, Yeo Y, Greenhagen BT, McMullin T, Song L, Maurina Maertens JA (2004) History of the development of azole deriva Brunker J, Rosson R, Noel JP, Chappell J (2007) Metabolic engi tives. Clinical Microbiology and Infection 10: 1-10. neering of sesquiterpene metabolism in yeast. Biotechnology and Martin VJJ, Pitera DJ, Withers ST, Newman JD, Keasling JD (2003) Bioengineering 97: 170-181. Engineering a mevalonate pathway in Escherichia coli for produc Tu Y (2011) The discovery of artemisinin ( qinghaosu) and gifts tion of terpenoids. Nature Biotechnology 21: 796-802. from Chinese medicine. Nature Medicine 17: 1217-1220. Mathis JR, Back K, Starks C, Noel J, Poulter CD, Chappell J (1997) Wall ME, Wani MC ( 1995) Paclitaxel-from discovery to clinic. IN Pre-steady-state study of recombinant sesquiterpene cyclases. Bio GICTTOIVDM Georg, ed, Taxane Anticancer Agents: Basic Sci chemistry 36: 8340-8348. ence and Current Status, vol. 583, pp. 18-30. Nicolaou KC, Yang Z, Liu JJ, Ueno H, Nantermet PG, Guy RK, Wu SQ, Schalk M, Clark A, Miles RB, Coates R, Chappell J (2006) Claiborne CF, Renaud J, Couladouros EA, Paulvannan K, Sorensen Redirection of cytosolic or plastidic isoprenoid precursors elevates EJ (1994) Total synthesis of taxol. Nature 367: 630-634. terpene production in plants. Nature Biotechnology 24: 1441-1447. Reddy LH, Couvreur P (2009) Squalene: A natural triterpene for use Zhang DL, Jennings SM, Robinson GW, Poulter CD (1993) Yeast in disease management and therapy. Advanced Drug Delivery squalene synthase----expression, purification, and characterization of Reviews 61: 1412~1426. soluble recombinant enzyme. Archives of Biochemistry and Bio Seki H, Ohyama K, Sawal S, Mizutani M, Ohnishi T, Sudo H, physics 304: 133~ 143. Akashi T, Aoki T, Saito K, Muranaka T (2008) Licorice beta-amyrin 11-oxidase, a cytochrome P450 with a key role in the biosynthesis * cited by examiner U.S. Patent Aug. 11, 2020 Sheet 1 of 15 US 10,738,328 Bl
9 l 1 T
...... U.S. Patent Aug. 11, 2020 Sheet 2 of 15 US 10,738,328 Bl
MVAP.-rt.hway Essential oHs
~:;:;::::.·-:- .:::;:
Taxo! (pacmaxen -
Figure 2 e• 00 • ~ ~ ~ ~ <-"OH ._OH =~ O Fl?GJ•l O O rRr::·; O O m.:!GJ o -- . ~--·• ~-/!' A.~ II II ______.. II ,_JH II ]-lt,lG:'.► ~---·""OH j~ OP~ OPPER(il9-~ OP • ., _ .,u~ ~Sc"•' - o" HO~ S-CoA H( COOH COOH p n.cet\· l-l.ot\ L\c·~to·i ·... •ctv! ., -._r•• L1 A 3~h:vd.n)xy¥3¥glut,,:ryJ~Co_,_:\ . . . 01-l > , :.. ., _ , , : lsoperuenyl ~ ~ •l·"l(' <" , , Mevalomc acict l ho.,p .. omc,alond,e D,phosphomevalonatc ... _ , _ , _!· \ .. ~ ,- .. Oh) \ (rVJVP) _ "'\. _ l,-\>f\..)fJJlOSfJJld c; (MYA)1 · ,. (MiPPj (]PP) ~ ~
•·· ·,-··1r .... ¾,.. ¾.._ "'" ...__ERC20 d,,w-> , .,. .... ""' ~¾... ¾...... __ t:l.,::_ '" N 0 ,- .. _ OPP OPP N /:RV1 l·arne,;yl-- 0 pyrophosphatt- Gemnyl-- (F PP) pyrophosphat<, (GPP) "¾./'-.....~/'-.....~/"--/'S:::::, <::::::, <::::::, ~OPP
Sqnalcn,· D;methyhllyl rJ'1 pyrophosphate (DMAPP) ('D= irpr[·-••_\,.) ('D..... (,H 0 ERO? ' .... ______.. --·······► .... "¾./'-.....A/-...... /'S:::::, <::::::, <::::::, Ul ---·--···► ' 2,3-0xfrfosqualenr HO ------···► -----··--► Las10::;teroJ HO d r,r;_ Figure 3 "'""' '"=-....l w w00 N 00
="'""' e• 00 • ~ ~ NH2 ~ ~ ~ ____.,.~COSCoA ____.,. A,COSCoA r HO OH ~ to / • ,~.,~OH ~ HOOC~CH20H ~ HOOC~COSCoA .... '" ~COOH N Mcvalonic acid Hidro'<:ylmrthyi gimaryl-CoA 0 2-0xisocapmna!c N 0 tSpc,ntancouc U:t:f.l rJJ ('D= ' ('D 0 OH ...... i;... H Lcu2 ~OH • ,,u4 0 0.... ~ .... ◄ Ul ~S-CoA H~O[ ~ H 00 ~ 0 Act'tyl-CoA 2-lsopronyl-J-oxosuccinate 3-lsopropylmalatc 2-Isopropylrnala::e d r.,;_ "'""' Figure 4 '"=--..l w w00 N 00 ="'""' ~ ' e• 00 ( Acetyl-CoA Ellfl~ !Jl!lffl: ) Wild type • ~ yeast ~ I HMJ-coAI~lr4ll4l:J@ml',\m)TJ!h'1HiS3fiell2finl!ffii!ll"il® ;; I ~ ~ i j =~ I t ; Ii i MVA ! Exogenous ~ I t _ ,J,, ~.... l DMAPP + IPP --'), FPP --'), Squalene > > > Sterol <~~ Sterol .... '" N 0 •• ,.,v,vmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm ,.,///,• N \,❖❖, 0 rJJ _.-./~.u.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.- ! -.-. • ❖.. ('D= ('D // ~ ...... "\~ ..... l Acetyl-CoA ~ ~~ \ Mutant, Ul 0.... ~ :=: !~ 1:=:•. selected .... 1~ i :=: Ul GCA 1 yeast ,l HM - o •• ~*••·1··?§····· H•• rvi.~:ra;his3)J~y~;xnet l~;µra3;5t)E········· H ,i ~ :=: !~ 1:=:•. ~ i :=: I MVA "I d rJl. i I sUE E l t > . 1 . xogenous "'""' DMAPP + IPP --'), FJ:>P Squalene > Sterol , t Sterol '"=--..l I + > w ; ~:~ f 00 \ y / w N ~...... FOH / 00 Figure 5 ="'""' e Independent colonies • Selection for aerobic sterol uptake mutants r:J)_ selected and each grown in • Selection for growth 2 different liquid media ~ EMS on medium containing ~ +Nystatin ~ mutagenesis ~ +Squalestatin =~ ~~-~:-~~-~ ~ ~ I~ r:J Growth Growth ~ A-:!+pa~~lf, ► ~ .... BY4741 Phase I :-' -+ N 0 Growth~ No ~growth N 0 +squalestatin +squalestatin +ergosterol rJJ ('D= ('D..... O'I 0 .... Ul d r.,;_ "'""' '"=-....l w w00 N 00 Figure 6 ="'""' e• 00 • RT: 0.00 -30.00 I I I I I ~ ~ ~ :., :.... !. ~ External I /'•..:::;_,, ...... , .. ,.,.,,/'.:. .:;/'·,./''..:::;_,, ... A.... OH (A)BY4741 I I I =~ cederene I stndard Farnesol 50 1mg/L > ~= 40 .... 30 ...... N 20 0 N 10 0 0 2 4 6 8 12 14 1 18 20 22 24 26 28 Ti e (min) I rJJ ('D=- ('D RT: 0.00 -30.00 ..... --.J 0 90 {B) ZX178-08 .... "l80 Ul 70 60 40 d r.,;_ 30 20 ...="'""' 10 --..lw 00 2 4 6 8 22 24 26 28 w N 00 .Figure 7 ="'""' U.S. Patent Aug. 11, 2020 Sheet 8 of 15 US 10,738,328 Bl Cl) a... :c :::c ll.. 0 ~--a.. ➔ LL LL i 160 ,;::::======------, e• 00 • - Premnaspirodiene ~ JI H@~===~==md Farnesol ~ 140 ...... ~ ~ =~ 120 - ...... ~ ...... ~ 100 - .... '" N ...... 0 N ..._...I 0 C, 80 J T ...... E rJJ ('D= ..,.. ('D 60 _I ..... - - 1,0 0 .... Ul --r- 40 - --r- 20 - I I d ...... I 1: r.,;_ """" o :,_,_,,, '"=-....l I I, I I Ii I I I II I I w 4741 zx22-04 zx22-07 zx24-02 zx24-06 zx31-04 zx97-05 zx178-03 zx178-08 2-2 w00 N 00 Figure 9 = """" U.S. Patent Aug. 11, 2020 Sheet 10 of 15 US 10,738,328 Bl IPP D:\IAPP IP~ PPr--1 ~ Monoterpene GPP IPP'i PP;--/4 - Sesquiterpene FPP IP.P~ PP;--/4 FPP - Diterpene GGPI' - Triterpene St1nal.me Figure 10 U.S. Patent Aug. 11, 2020 Sheet 11 of 15 US 10,738,328 Bl zx198 zx184 zx178 zx171 zx170 zx169 zx168 zx167 zx166 zx161 zx156 zx154 zx141 zx140 zx139 zx119 zx107 zx97 zx89 zx82 zx75 zx70 G) zx62 C zx61 ::::i zx59 zx58 ti) -CV zx54 zx52 ~ zx46 zx45 zx40 zx39 zx38 zx37 zx36 zx35 zx34 zx33 zx32 zx31 zx27 zx24 zx23 zx22 zx21 zx20 zx19 zx16 zx15 zx2 zx1 0 10 20 30 40 50 60 70 FOH product (mg/L) Figure 11 U.S. Patent Aug. 11, 2020 Sheet 12 of 15 US 10,738,328 Bl kb 1,650 1,000 Figure 12 U.S. Patent Aug. 11, 2020 Sheet 13 of 15 US 10,738,328 Bl ZXl/11•08 zx178-07 zx178-06 co .... zx178-05 zx178-04 Nx zx178-03 zx178-02 zx178-01 zx97-08 zx97-07 zx97-06 .... zx97-05 ~ N zx97-04 zx97-03 zx97-02 zx97-01 ZX.11-UH zx31-07 zx31-06 ,.., zx31-05 ->< N zx31-04 zx31-03 zx31-02 zx31-01 zx27-08 zx27-07 ,._ zx27-06 zx27-05 > Figure 13 U.S. Patent Aug. 11, 2020 Sheet 14 of 15 US 10,738,328 Bl BamHl Spel Figure 14 U.S. Patent Aug. 11, 2020 Sheet 15 of 15 US 10,738,328 Bl BY4741 haploid wild type yeast was mutagenized with EMS ,,. ,. Plated onto YPD media containing: Nystatin - selects for ergosterol biosynthesis mutants Squalestatin - inhibits squalene synthase, mimic of erg9 mutation Cholesterol - restores growth, supplants ergosterol Picked 200 colonies "I ,. Replica plated all 200 colonies onto YPD+squalestatin and YPD+squalestatin+ergostero 1plates Screened for colonies that only grew in the presence of ergosterol 134 colonies grew on both plates, only 66 demonstrated ergosterol dependent growth ,,. ,. Grew the 66 positive colonies in liquid YPD+squalestatin+ergosteroi media and screened for fameso 1 accumulation 20 colonies did not accumulate FOH 46 colonies accumulated 1-60 mg FOH/L 9 colonies accumulated more than 50 mg FOH/L ,,. ,. Introduce ERG9 Knockout mutations in the 8 of the 9 selected lines, First, verify for no growth without ergosterol addition to the media, follow-up with PCR confirmation of erg9 KO, then screened for FOH accumulation by 8 independent colonies from each line. Eleven of 64 independent lines accumulated more than 70 mg/L FOH in small scale test tube culture. Figure 15 US 10,738,328 Bl 1 2 METHOD AND SYSTEM FOR TERPENE Monoterpenes are well known as the volatile essence of PRODUCTION PLATFORMS IN YEAST flowers and plants and such mixtures can account for up to 5% of plant dry weight (Buchanan et al., 2002). Menthol and CROSS-REFERENCE TO RELATED camphor are common monoterpenes found in diverse plant APPLICATION 5 families and whose structural complexity in terms of stereo and regio-chemistry are emphasized in FIG. 2. Besides This application claims the benefit of provisional patent providing pleasing fragrances, monoterpenes have been application No. 61/730,412, filed Nov. 27, 2012, herein shown to function as signal molecules in defense mecha incorporated by reference. nisms against pathogens (Hick et al., 1999). Hence, 10 monoterpenes have the commercial value as flavors, fra FIELD OF THE INVENTION grances, essential oils, and as anticancer and antimicrobial drugs (Burke et al., 1997). Sesquiterpenes (C15) are also The presently-disclosed subject matter relates to methods found in essential oils, and many sesquiterpenes possess for producing or generating modified yeast, and the resulting antibiotic activities, prompting suggestions that they are yeast, and in particular yeast that can be used for various 15 produced by plants as a defense mechanism. Diterpenes aspects of terpene production. For example, the subject (C20) include gibberellins (plant hormones), vitamin A, as matter relates to methods and systems for building terpene well as pharmaceutical important metabolites such as taxol, production platforms in yeast which have various introduced an exceptional anticancer regent (Barkovich & Liao, 2001). mutations. These platforms or cell lines can be further Triterpenes (C30) include the brassinosteroids, phytosterols modified, e.g. genetically engineered to produce specific 20 important for lipid membrane composition, and components enzymes and/or terpenes. of surface waxes, such as oleanolic aid of grapes. Squalene, the major content of shark liver oil, is a linear triterpene and BACKGROUND OF THE INVENTION common ingredient in cosmetic products (Buchanan et al., 2002), has special utility as a lubricant for high performance Plants, microorganisms and animals produce a large vari 25 machinery, and is a common adjuvant in many pharmaceu ety of organic chemical compounds, some of which are used tical formulations (Bhilwade et al., 2010, Huang et al., 2009, universally for growth and metabolism and others seem to Reddy & Couvreur, 2009). Tetraterpenes (C40) include play specialized roles in the life cycle of the organism carotenoid accessory pigments, like lycopene, the monocy (Maimone & Baran, 2007). As such, two large classes of clic gamma-carotene, and the bicyclic alpha- and beta- natural products are widely recognized. Primary metabolites 30 carotenes, which perform essential for the light reactions of are those essential for live in all eukaryotic organisms, while photosynthesis. Longer chain terpenes, so-called polyter specialized metabolites appear to give species specific penes, contain more than 8 isoprene units and include advantages for occupying distinct environmental niches. examples like ubiquinone and rubber (Buchanan et al., The distinctive role specialized metabolites play in an organ 2002). isms natural history, for example how these metabolites 35 There are two pathways for terpene biosynthesis in plant provide protection against microbial challenge, have also cells. One is the mevalonate pathway pathway (MVA) which not escape attention for their possible utility in a wide range is well established and discovered in the 1960s (Bouvier et of applications. For example, many of the currently used al., 2005). The other is the mevalonate independent pathway, drugs are derived or inspired from plant-derived specialized or more properly referred to as the methylerythritol-phos- chemicals and are commonly referred to as Natural Products 40 phate pathway (MEP), which was more recently discovered (Buchanan et al., 2002). Capturing the chemical and struc (Bouvier et al., 2005). The MEP pathway was first discov tural diversity of Natural Products has recently been iden ered in prokaryote cells, and then confirmed to exist in plant tified as a major objective within the scientific community in cells (Barkovich & Liao, 2001). Interestingly, plants utilize large part because of the wide array of applications Natural these two pathways to meet different terpene biosynthetic Products can have and the resulting economical implica 45 needs. Sesquiterpenes, sterols, triterpenes and oligoterpenes tions. (side chain of dolichols) are synthesized in the cytosol via Terpenes and terpenoids are a large and diverse family of the MVA pathway, while monoterpenes, diterpenes, terater Natural Products with more than 55,000 having been iden penes, and polyterpenoids are synthesized in chloroplasts tified (Maimone & Baran, 2007). However, based on the via the MEP pathway using pyruvate and glyceraldehydes- biosynthetic mechanisms responsible for terpenes, chemists 50 3-phosphate as the primary precursors (FIG. 2). have predicted that only a small fraction of all the possible The principal product of the mevalonate pathway is terpene compounds have been discovered (Bouvier et al., sterols, for example cholesterol in animal cells, stigmasterol 2005). Terpenes are derived from the five carbon isoprene and campesterol in plant cells, and ergosterol in fungi, which unit with different combinations of the isoprene units gen all play essential roles in establishing the structural integrity erating different classes of the terpene products. The clas 55 of membranes, establishing permeability and fluidity, and sification and biosynthesis of terpenoids are based on the also serving as signal compounds in cellular communication number of five-carbon units they contain as illustrated in (Buchanan et al., 2002). In Saccharomyces cerevisiae, only FIG. 1. Monoterpenes (consisting of 10 carbons), sesquit the mevalonate pathway is known to operate and no com erpenes (15 carbon derivatives), and diterpenes (20 carbon ponents of the MEP pathway have been found (Maury et al., derivatives), arise from the corresponding intermediates 60 2005). FIG. 3 shows the intermediates and the related genes geranyl diphosphate (GPP), farnesyl diphosphate (FPP), and involved in the yeast mevalonate pathway (Maury et al., geranylgeranyl diphosphate (GGPP). These intermediates in 2005). Two molecules of acetyl-CoA are condensed by turn arise by the sequential head to tail condensation of CS acetoacetyl-CoA thiolase, which is encoded by ERGl0, to units. Higher order terpenes like triterpene (30 carbons) are synthesize acetoacetyl-CoA. A second condensation reac- formed from two famesyl units condensed head-to-head. 65 tion between acetoacetyl-CoA and acetyl-CoA is then cata Likewise, tetraterpenes ( 40 carbons) are formed from two lyzed by HMG-CoA synthase encoded by ERG13 to yield geranylgeranyl units condensed head-to-head. 3-hydroxy-3methyglutaryl-CoA (HMG-CoA). US 10,738,328 Bl 3 4 TABLE 1 Biological activities and commercial applications of typical terpenoids Commercial Class Biologic activities applications Examples Monoterpenoids Signal molecules and Flavors, fragrances, Limonene, menthol, used as defense cleaning products, camphor, linalool mechanisms against anticancer, pathogens antibacterial, antioxidant, essential oil, biofuel Sesquiterpenoids Antibiotic, antiturnor, Flavors, fragrances, Nootkatone, antiviral, immuno- pharmaceuticals artemisinin, patchoulol, suppressive, and ( antibacterial, nerolidol, famesol, hormonal activities, antifungal), capsidol, famesene, defensive agents or insecticides, biofuels bisabolene pheromones Diterpenoids Hormonal activities, Anticancer agents, Gibherellins, phytol, growth regulator, feedstock for taxol, kaurene, anti tumor, industrial chemical abietadiene, kaurenoic antimicrobial and applications acid, abietic acid anti-inflammatory properties Triterpenoids Membrane Biologic markers, Sterols, hopanoids, component, steroid biofuel, skin squalene, hormones moisturizers in botryococcene. cosmetics, immunologic adjuvant in vaccines. Tetraterpenoids Antioxidants, Food additives, Lycopene, beta- photosynthetic colorants, antioxidants carotene components, pigments, and nutritional elements (vitamins) HMG-CoA is reduced by HMG-CoA reductase to yield ingly, a yeast line engineered with a chimeric diterpene mevalonate. This reaction is catalyzed by HMG-CoA reduc synthase targeted to the cytoplasm along with prenyltrans- tase, which is encoded by 2 separate loci in yeast. Both loci 35 ferases streamlined for GGPP biosynthesis, yielded 2-3 appear to compensate for a knockout loss of the other gene. times more diterpene when the expression vector also pro The CS position of mevalonate is phosphorylated by vided a leu2 auxotrophic selection marker gene. The inter mevalonate kinase, encoded by ERG12. Then a second pretation provided by the authors was that the extra leucine kinase, phosphomevalonate kinase, encoded by ERGS, cata produced by the auxotrophic selection marker gene provided 40 lyzes the successive phosphorylation to yield diphosphom another source for IPP via the leucine catabolic pathway evalonate. In the next step the diphosphomevalonate is (FIG. 4). (Zhou et al., 2012). converted into IPP (isopentenyl diphosphate) by mevalonate Prenyltransferases generate allylic diphosphate esters diphosphate decarboxylase, encoded by ERG19. IPP GPP, FPP, and GGPP. These compounds can undergo a isomerase, encoded by IDil converts IPP into DMAPP 45 variety of reactions, which include cyclization reactions (dimethylallyl diphosphate). The condensation of the CS catalyzed by terpene synthases, yielding diverse terpenes building blocks ofIPP and DMAPP into FPP is catalyzed by based on regio- and stereo-chemical constraints built into the FPP synthase, which is encoded by ERG20. FPP can then be reactions. Prenyltransferases and terpene syntahases utilize used as substrate for stern! and other isoprenoid biosynthetic electrophilic reaction mechanisms to mediate the catalytic needs. 50 reactions (Ohnuma et al., 1996) and typically share a con Recent studies have discovered that FPP is also available served aspartate-rich DDXXD motif thought important for in yeast mitochondria, as evidenced by increasing novel the initial substrate binding and metal-dependent ionization sesquiterpene production three-times by targeting a sesqui step leading to the first reaction carbocation intermediates. terpene synthase to the mitochondria compartment com In the prenyltranferase reactions, the allylic diphosphate pared with targeting this same enzyme to the cytosol (Farhi 55 ester can be ionized to form a carbocation, then condensed et al., 2011 ). The origin of FPP in mitochondria could be the with a second IPP in another round of elongation. IPP and DMAPP arising in cytosol being imported and Terpenes are a very large class of structurally diverse converted in the mitochondria to FPP. Alternatively, a hypo compounds made by organisms in all kingdoms of life. The thetical leucine metabolism model for the formation of terpenes from plants are perhaps the most extensively terpene in S. cerevisiae is also a possibility. The leucine 60 described as evident by well over 100,000 different terpenes catabolism pathway (MCC pathway) is known to occur in reported in the literature (Buckingham, 2003). Terpenes are the mitochondria of other eukaryotic mammal and plant also widely recognized for their diverse utility and applica cells (Anderson et al., 1998), in mitochondria leucine tions. For example, taxol, a diterpene widely recognized for metabolite to form 3-Hydroxy-3-methylglutaryl-CoA, its application as a chemotherapeutic agent, was first iso- which can be catalyzed by HMGR to produce mevalonic 65 lated from the bark and needles of several Taxits plant acid, and then produce IPP and DMAPP through MVA species (Wall and Wani, 1995). Likewise, Artemisinin, a pathway as shown in FIG. 4 (Carrau et al., 2005). Interest- sesquiterpene isolated from the plant Artemisia annua, has US 10,738,328 Bl 5 6 been developed as a key pharmacological agent for the cell lines. In one further specific form of the present method, control of malaria (Tu, 2011 ). Patchouli, another sesquiter the ergosterol dependent growth yeast are subject to an erg9 pene, is a popular aromatic found in colognes, perfumes and knockout mutation by inserting a foreign gene sequence into many other household cleaning products (Wu et al., 2006). the ergosterol dependent growth yeast at a location of erg9 Menthol is a monoterpene obtained from mint family plants 5 to effect gene replacement, thereby generating the erg9 and is a popular ingredient in many foods and consumer knockout mutation. In an alternative further method, the products (Bedoukian, 1983). Triterpenes such as squalene, foreign gene sequence can confer chemical resistance to the obtained from various plant sources and the livers of deep ergosterol dependent growth/erg9 knockout mutation yeast sea sharks, have utility as a nutraceutical product, is used cell line. extensively in many types of cosmetics, has special utility as 10 The present invention, in another form thereof, relates to a lubricant for high performance machinery, and is a com a non naturally occurring yeast which has ergosterol depen mon adjuvant in many pharmaceutical formulations (Huang dent growth and is erg9-. et al., 2009; Reddy and Couvreur, 2009; Bhilwade et al., The present invention, in yet another form thereof relates 2010). to ergosterol dependent growth/erg9 knockout mutation Terpenes are, however, generally made by plants and 15 yeast cell lines produced by the aforementioned method. microbes in small amounts and components of complex The present method and cell lines provide advantages mixtures that vary with growth and environmental condi over wild type and other prior known modified yeast cell tions, making it difficult to reproducibly obtain large lines. For example, the present method and resulting cell amounts of any one terpene constituent (Wu et al., 2006). lines are especially beneficial for use as terpene platforms Chemical synthesis ofterpenes is often costly and inefficient 20 for further modification to specifically produce desired ter (Nicolaou et al., 1994). Chemical synthesis also suffers from penes which include monodie and triterpenes. generating enantiomeric mixtures, which adds other com The yeast lines generated in accordance with this disclo plications if one particular stereochemical form of a terpene sure have utility for the production of diverse classes of is desired. Given such difficulties, there are many on-going terpenes including monoterpenes, sesquiterpenes, diterpenes efforts to create robust, reliable and efficient biological 25 and triterpenes. systems for the production of distinct classes of terpenes, and more so for the generation of stereochemically pure BRIEF DESCRIPTION OF THE FIGURES forms of terpenes (Martin et al., 2003; Wu et al., 2006; Takahashi et al., 2007; Asadollahi et al., 2008; Kirby et al., FIG. 1 shows biosynthesis of terpenes from natural 2008; Seki et al., 2008; Keasling, 2009; Asadollahi et al., 30 sources, which often occurs as diverse mixtures with vary 2010; Fischer et al., 2011). ing compositions in limited amounts due to environmental influences, in which roduction of single specific terpenes in SUMMARY OF THE INVENTION genetically engineered yeast would alleviate such variability and yield highly valued, single entity compounds. The presently disclosed subject matter relates to methods 35 FIG. 2 is schematic outline of two terpene biosynthetic for producing modified yeast cell lines to produce "plat pathways that operate in plants (the MVA and MEP path forms" in yeast and the resulting modified yeast or plat ways), their intracellular locations, and examples of the forms. The production platforms can be further modified to chemical compounds derived from each. produce specific terpenes such as monoterpenes, diterpenes FIG. 3 illustrates mevalonate pathway for ergosterol bio- and/or triterpenes. 40 synthesis in yeast (S. cerevisiae ). Referring generally to one specific technique for produc FIG. 4 illustrates an alternative metabolic pathway for ing modified yeast cell lines in accordance with the present HMG-CoA formation pathway through leucine catabolism disclosure, a series of steps are used to generate genetically pathway. modified yeast. The steps include chemical mutagenesis FIG. 5 illustrates the metabolic pathway in modified yeast followed by growth on a semi-solid medium containing 45 strains in accordance with the present invention. nystatin, squalestatin and cholesterol. Individual yeast colo FIG. 6 is a flow diagram showing the biogenesis of nies growing on the semi-solid medium are screened for modified yeast in accordance with one aspect of the present ergosterol dependent growth and then subject to an erg9 invention. (squalene synthase) knockout mutation. Yeast having the FIG. 7 is a graph showing metabolism of two strains erg9 knockout mutation are confirmed via having ergosterol 50 BY4741(A) and ZX178-08(B). dependent growth. Accordingly, the present technique com FIG. 8 illustrates how yeast strains produced in accor bines chemical mutagenesis to generate ergosterol depen dance with the present method can be used for producing dent yeast lines followed by generating erg9- knockout specific chemicals. mutations in the ergosterol dependent yeast lines. One FIG. 9 shows how the yeast lines developed as outlined in unique aspect of this method includes the use of squalestatin 55 FIG. 8 in comparison to the starting yeast line 4741 were to screen chemically induced mutations in yeast which show chemically profiled for their terpene biosynthetic capacities. ergosterol dependent growth. FIG. 10 is a chart showing the production of various The present invention, or one form thereof relates to a compounds of different strains in accordance with the pres method for generating terpene producing cell lines. The ent invention. method includes combining yeast with a chemical mutagen- 60 FIG. 11 is a graph showing quantitation of FOH levels in esis agent to induce mutations in the yeast to generate yeast lines having an exogenous stern! requirement growth. chemically mutated yeast. The chemically mutated yeast are FIG. 12 is a gel confirming erg9 knockout mutation in selected by growth in the presence of nystatin, squalestatin accordance with the present invention. and cholesterol, followed by selecting for ergosterol depen FIG. 13 is a chart showing the quantitation ofFOH levels dent growth. The ergosterol dependent growth yeast are 65 in SUE, erg9 mutant lines of yeast demonstrated to have an subjected to an erg9 knockout mutation to thereby produce exogenous stern! requirement for growth and resistance to ergosterol dependent growth/erg9 knockout mutation yeast hygromycin. US 10,738,328 Bl 7 8 FIG. 14 is a flow chart showing constructs used for line. In phase I, chemical mutagenesis is used to introduce evaluate yeast sesquiterpene productions. SUE mutations, which are identified by selecting for yeast FIG. 15 is a flow diagram showing the steps in the cells that do not have a functioning ergosterol biosynthetic development of yeast. pathway and can only grow in the presence of exogenous 5 cholesterol. The SUE mutation was created by subjecting DETAILED DESCRIPTION wild type yeast strain BY4741 to EMS mutagenesis (see supplemental materials and methods information for specif The present method and modified yeast will now be ics) to introduce random mutations in the whole genome, described with reference to the figures and exemplary followed by selection on plates containing three important experiments, examples and methods. The figures, experi 10 selection agents: nystatin; cholesterol; and squalestatin. ments and examples are merely to provide a more thorough Nystatin binds to ergosterol in the cell membrane causing understanding of the present method and modified yeast. non-selective membrane permeability and leads to cell death However, other methods and generated yeast can be envi (Silva et al., 2006). Nystatin thus selects against cells that sioned consistent with the scope and spirit of the present have ergosterol in their membranes. However, yeast have an disclosure. 15 absolute requirement for sterols in order for their mem FIG. 5 illustrates one approach used to generate yeast cell branes to function properly. Hence, by having the mutagen lines in accordance with the present disclosure. The ized yeast plated in the presence of cholesterol, which approach of FIG. 5 outlines a method for generating yeast nystatin camiot bind to, only yeast that can take up the cell lines that provide for robust biosynthesis or precursors exogenous cholesterol under aerobic conditions and prop- that can be utilized in the production of many difference 20 erly incorporate the cholesterol into their membranes sur classes of terpenes. The strategy takes advantage of the vive. Squalestatin is a potent inhibitor of squalene synthase native mevalonate (MVA) pathway that operates normally in and eliminates the yeast's ability to synthesize ergosterol yeast for the biosynthesis of ergosterol, the dominant sterol (Bergstrom et al., 1995), thus assuring that the surviving found in yeast. Ergosterol is the main product of the yeast yeast have a dispensable mevalonate pathway. mevalonate pathway, is an important membrane component, 25 In phase II, yeast lines demonstrating an absolute require- and is essential for yeast growth. If the ergosterol biosyn ment for exogenous sterols for growth were chemical pro thetic pathway is blocked or inhibited, yeast die. In fact, this filed by GC-MS (FIG. 11). Aliquots of those yeast lines is the basis for many pharmacological drugs to control exhibiting normal growth characteristics, having growth fungal infections in man (Maertens, 2004) and agricultural rates comparable to wild type yeast, were extracted and their chemicals to control fungal infection in plants (Casida, 30 chemical constituents separated by gas chromatography and 2009). To further complicate matters, wild type yeast can identified by their mass fragmentation patterns. The parental take up exogenously supplied sterol from their environment line BY4741 does not accumulate detectable amounts of only under anaerobic conditions. FOH under these conditions. Mutant lines accumulating 50 In order to be able to efficiently channel terpene biosyn or more mg/ml ofFOH were selected for phase III knockout thetic intermediates from the ergosterol biosynthetic path- 35 mutagenesis of the squalene synthase gene, ERG9. way, a SUE (sterol uptake enhancement) mutation support As shown in FIG. 11, quantitation ofFOH levels in yeast ing the aerobic uptake and utilization of exogenous sterol lines having an exogenous sterol requirement for growth. was first created (Bourot and Karst, 1995; Shianna et al., Yeast lines were grown as test tube shake cultures with 3 ml 2001 ). A SUE mutation is thus a yeast line that can meet all of YPD media containing 40 µg/ml of ergosterol and 40 its sterol needs by an exogenous source of sterol, and 40 µg/ml of squalestatin for 6 days prior to sampling the therefore making the endogenous ergosterol biosynthetic cultures. One ml aliquots of cultures were mixed vigorously pathway dispensable. The SUE mutation was then comple with 1 ml of acetone, then allowed to stand for 15 min. One mented by the introduction of a knockout mutation in the ml of hexane containing a cedrene external standard was ERG9 gene (squalene synthase) (Zhang et al., 1993), result then added, vortexed, centrifuged in a clinical centrifuge for ing in a yeast line where the MVA pathway was still 45 5 min, and the upper hexane phase removed and concen operational up to the biosynthesis of FPP and hence, inter trated to 100 plunder a nitrogen stream. One µl aliquots of mediates in the pathway (DMAPP, IPP and FPP) could be the hexane extracts were then subjected to GC-MS and FOH diverted to the biosynthesis of other non-essential terpene levels quantified relative to the external standard. components. In order to follow and select for the desired The objective in phase III was to obtain a knockout mutant lines, the yeast lines could be monitored for farnesol 50 mutation of the ERG 9 (squalene synthase) gene, thus (FOH) accumulation, the dephosphorylated form offarnesyl assuring the dispensable nature of the endogenous diphosphate. If the MVA pathway in the yeast line continued mevalonate pathway for ergosterol biosynthesis. Site spe to operate as proposed, then one would expect carbon flux cific recombination was afford by appending 5' and 3' to FPP to continue. But, because the downstream utilization regions surrounding the native ERG9 gene onto a hygro- of FPP by squalene synthase was abolished, then the accu- 55 mycin selection marker gene (see supplementary materials mulating FPP would be subject to the endogenous phos and methods information), then introducing this linear gene phatase activity for its conversion to FOH, which could be construct into selected yeast lines from the phase II screen used as an initial screen for monitoring development of the ing under conditions to promote site-specific, double recom mutant yeast line. Further engineering of such a yeast line bination with the native ERR9 gene. The knockout mutants could then take advantage of the FPP, DMAPP and IPPpools 60 were then selected by plating the cells in the presence of for their diversion to the biosynthesis of monoterpenes (10 ergosterol and hygromycin. Recombination as depicted in carbon compounds), sesquiterpenes ( 15 carbon compounds), FIG. 6 should result in the coding region of the ERG9 gene diterpenes (20 carbon compounds) and triterpenes (30 car being displaced/substituted by the hygromycin resistance bon compounds). marker gene. Confirmation of such a substitution event was The following experiments were conducted to develop 65 obtained by screening the genomic DNA of the selected yeast with a dispensible mevalonate pathway. FIG. 6 illus yeast colonies for the hygromycin marker gene in proximity trates three (3) phases in the development of a desired yeast to genomic DNA sequences normally found 3' to the ERG9 US 10,738,328 Bl 9 10 coding region. Using genomic DNA isolated from hygro lar manipulations were from Stratagene (San Diego, Calif.), mycin resistant colonies as template with a hygromycin Takara (Shiga, Japan), Invitrogen (San Diego, Calif.), and specific primer (HphF) and a primer specific to a genomic New England Biolab (Ipswich, Mass.). DNA sequence found 3' to the ERG9 gene (ERG9 450DwR), Bacteria and yeast were grown using standard culture a PCR amplification product of approximately 1,538 bp 5 practices. YPD media for growing yeast without selection would be expected and is evident in the colonies so tested in consisted of 1% Bactoyeast extract, 2% Bacto-peptone, and FIG. 12. 2% glucose ( or 0.5% glucose for select experiments). YPDE In FIG. 12, PCR confirmation for the ERG9 knockout media was YPD media supplemented with ergosterol ( 40 mutation include DNA isolated from four independent colo mg/L) for ergosterol dependent lines. YPDNCS media for nies selected for substitution of the hygromycin resistance 10 the SUE mutation screening was YPD media supplement gene for the ERG9 gene, used as PCR template with a with 40 mg/L Nystatin, 40 mg/L cholesterol and 40 mg/L hygromycin specific primer and a specific primer for the squalestatin. YPDSE media was YPD media supplement genomic DNA surrounding the ERG9 locust. If the HphF with 40 mg/L squalestatin and 40 mg/L ergosterol. Minimal gene did insert and replace the ERG9 gene, the expected media, SCE (pH 5.3), contained 0.67% Bacto-yeast nitrogen amplification product would be 1,538 bp. Independent colo 15 base (without amino acids), 2% dextrose, 0.6% succinic nies from each of the erg9 knockout lines were then re acid, 0.14% Sigma yeast dropout solution (-his,-leu,-ura, evaluated for their growth in liquid media and the dispens trp ), uracil (300 mg/L), L-tryptophan (150 mg/L), L-histi able nature of their mevalonate pathway checked by their dine (250 mg/L), L-methionine (200 mg/L), L-leucine (1 accumulation of FOH (FIG. 13). g/L) and 40 mg/L ergosterol. Cholesterol and ergostrol As shown in FIG. 13, quantitation ofFOH levels in SUE, 20 stocks were 10 mg/mL in 50% Triton X-100, 50% ethanol erg9 mutant lines of yeast demonstrated to have an exog and kept at -20° C. Selection media was prepared similarly enous stern! requirement for growth and resistance to hygro except without supplementing the media with the indicated mycin. Cultures were grown in 3 ml test tube cultures of reagent based on the yeast auxotrophic makers. All solid SCE media supplemented with histidine, leucine, uracil, media plates were prepared with 2% Bacto-Agar. tryptophan and methionine for 6 days before extracting and 25 Ethyl Methane-Sulfonate (EMS) Mutagenesis quantifying their FOH levels by GC-MS as described in Strain BY4 7 41 (MATa;his3Al ;leu2A0;metl 5A0;ura3A0) FIG. 11. (Janke et al., 2004) was used as the parental yeast line. Qualification of a New Mutant Yeast Strain for its Utility to BY4741 cells were incubated overnight at 30° C. in 5 ml Produce a Desired Terpene Compound. YPD medium with shaking at 200 rpm, and used to establish Nine of the yeast lines harboring a SUE mutation and 30 a 200 ml YPD shake flask culture. When the yeast culture having the native ERG9 gene deleted were evaluated indi OD600 reached approximately 1.0, the cells were spun rectly for the available of terpene biosynthetic intermediates, down by centrifugation (10 min at 4,000xg), and washed and specifically FPP, to support sesquiterpene biosynthesis twice with 20 ml 0.lM sodium phosphate buffer, pH7.0. in comparison to the parental strain BY4741 (FIG. 7). Cells were concentrated by centrifugation again, re-sus- Hyoscyamus prenmaspirodiene synthase (HPS), a catalyti 35 pended in 1 ml 0. lM sodium phosphate buffer, transferred to cally active sesquiterpene synthase first isolated from a 14 ml FALCON culture tubes, treated with 300 pi EMS Hyoscyamus muticus, was chosen for this evaluation (1.2 g/ml, Sigma), followed by incubation at 30° C. for 1 because HPS has been characterized for its expression in hour with shaking. To stop the mutagenesis, 8 ml of sterile bacteria (Mathis et al., 1997) and in yeast (Takahashi et al., 5% sodium thiosulfate (Fisher) were added to yeast cells by 2007). An appropriate HPS gene expression vector was 40 inactive EMS. Cells were pelleted, washed with 8 ml sterile engineered into the indicated yeast lines and the subsequent water, concentrated by centrifugation, re-suspended in 1 ml transformants screened for premnaspirodiene accumulation sterile water and 100 pl aliquots plated onto YPD-NCS agar when the yeast were grown as 30 ml shake flask cultures plate (YPD plus 50 mg/L cholesterol, 50 mg/L nystatin, 50 with SCE media containing leucine, tryptophan, uracil, and mg/L squalesatin, 2% Bacto-agar). In some experiments, the methionine for 12 days at 23° C. Yeast line ZXl 78-08 45 washed cells were resuspend in 1 ml YPDE liquid media for accumulated the highest level of premnaspirodiene, up to recovery overnight before plating on YPD-NCS agar 114±26 mg/L, with FOH levels of 23.6±14.5 mg/L. In medium. The cultures were incubated for up to 2 weeks at comparison, the parental line BY4 7 41 accumulated 10 times 30° C. until distinct colonies became visible. less prenmaspirodiene, 10.94±3.12 mg/L, with no famesol Yeast Transformation and Culture Performance accumulation detected. 50 Yeast strains were transformed with the respective vector FIG. 9 shows a comparison of terpene accumulation constructs using the FROZEN-EZ Yeast Transformation II levels in yeast lines (ZX series) developed as terpene Kit (Zymo Research, Orange, Calif.) according to the manu production platforms. Each of the ZX cell lines as well as the facturer's recommendations. About 1 pg of plasmid or about wild type parental line (BY4741) were independently trans 5 pg of linearized DNA was used per transformation and formed with an expression vector harboring the Hyoscyamus 55 followed by selection on agar plates of SCE medium lacking prenmaspirodiene synthase gene. The yeast lines were then specified amino acids for the auxotrophic markers or YPDE grown for 12 days prior to chemically profiling them for containing 300 mg/L hygromycin B for screening for erg9 their cell constituents by GC-MS and quantifying the levels knockout at 30° C. Variable numbers of independent colo of premnaspirodiene and famesol found in each. nies were subsequently picked and used to start 3 ml cultures The following experiments methods and procedures pro 60 in minimal media to characterize their terpene production vide additional background with regard to the method for capacities. Aliquots of these cultures were analyzed for producing terpene platforms in yeast and the resulting yeast terpene production after 6 days of incubation at 30° C. with produced. shaking by GC-MS. Cultures exhibiting the highest terpene Chemical and Media Preparations production levels were chosen for further studies and All chemical reagents were obtained from Sigma-Aldrich 65 archived as glycerol stocks at -80° C. Selected lines were (St. Louis, Mo.), BD Bioscience (Franklin Lakes, N.J.), or characterized for cell growth and terpene production using Fisher Scientific (Chicago, Ill.), while reagents for molecu- 30 mL shake flask cultures. Starter cultures grown to satu- US 10,738,328 Bl 11 12 ration in minimal media were inoculated into 30 ml SCE ofYPDE media for an additional 6 hours before being plated media and 1 mL aliquots withdrawn at every other day on YPDE hygromycin (300 mg/L) agar plates at 28° C. intervals for 10-15 days. Cell growth was monitored as the Independent single colonies were picked for ergosterol change in optical density at 600 nm every two days, using dependent test, PCR confirmation of recombination with appropriate dilutions for cultures at later stages of growth. 5 hphF and ERG9 450DWR primer, as well as farnesol production analysis. The recombination sequence was fur Terpene production was determined by GC-MS similar to ther confirmed by DNA sequencing of a corresponding PCR the initial screening method. amplification product. GC-MS Detection and Quantification of Terpenes Expression of the HPS Gene in Yeast To determine terpene accumulation levels, aliquots of The yeast GPD promoter (Pgpd) was amplified from the 10 cultures grown for 6 to 12 days were extracted with hexane PYM-N14 plasmid described by Janke et al. (2004) using and aliquots evaluated by GC-MS. In general, to 1 volume the primers GPD-BamHIF and GPD-NotIR primers and of culture, 1 volume of acetone was added and mixed inserted into the pESC-His vector digested with BamHl and vigorously for 3 to 5 min to lyre the cells. The sample was Not! to replace the original GALl/10 promoters. The result- then allowed to incubate at room temperature for 10 min 15 ing plasmid was named pESC-His-gpd. The HPS gene was before adding 1 volume of hexane containing a known cloned into Not! and Spel sites of pESC-His-gpd to obtain amount of cedrene external standard. The mixture was again the yeast expression vector pESC-His-gpd-HPS as previ mixed vigorously, then centrifuged in a clinical centrifuge ously by Takahashi et al. (2007). Yeast lines transformed for 5 min at maximum speed. The upper organic layer was with this construct were then evaluated for their production collected and when necessary, concentrated under a N2 of the sesquiterpene prenmaspirodiene as a measure of the 20 stream to ½o the original volume. An aliquot of the organic available of intermediates of the mevalonate biosynthetic phase (1 µ!) was then analyzed by GC-MS with a Varian pathway for the biosynthesis of new terpenes. CP-3800 GC coupled to a Varian Saturn 2200 MS/MS Referring to FIG. 14, a yeast expression vector was (Varian Medical Systems) using a Supelco SLB-5 ms fused designed for a strong, consecutive expression of the sesqui- silica capillary column (30 mx0.25 mmx0.25 µm film thick 25 terpene synthase HPS gene directed by the gpd promoter ness, Supelco). The initial oven temperature was set at 70° (Pgpd) and termination provided by the ADH terminator C. for 1 min, ramped to 200° C. at 8° C./min, and then sequence (ADHterm). ramped to 300° C. at 20° C./min and held for 5 min more. In FIG. 15, steps are shown for the development of yeast Farnesol and prenmaspirodiene levels were calculated rela having a desirable mevalonate biosynthetic pathway and tive to the cedrene external standard. number of colonies screened at each stage. 30 Construction of the Squalene Synthase (ERG9) Knockout FIG. 8 shows FOH accumulation in a yeast line (178-08) Mutation selected for a dispensable mevalonate biosynthetic pathway The primers ERG9PS1 and ERG-250downS2 were used in comparison to that accumulating in the parental line to amplify the hygromycin resistance gene, hphNTl, from (BY4741) used to generate the new mutant yeast lines. the PFA6-hph-NT1 vector (Janke et al., 2004), and at the GC-MS chromatograph of hexane extracts were prepared 35 same time add DNA sequences homologous to regions from the wild type and engineered yeast lines. The top of surrounding the ERG9 gene in the yeast genome. These FIG. 8, for (A) BY4741, shows no farnesol accumulated in primers are flanked by 42 nucleotide sequences (underlined) parental yeast. In the bottom part of FIG. 8, (B) ZXl 78-08, homologous to DNA sequences found 250 base pairs 5' over 100 mg ofFOH/L accumulated in the newly developed (upstream) and 3' (downstream), respectively, of the ERG9 yeast line, as quantified on the basis of a cedrene external 40 gene found in the yeast genome. The purified PCR fragment standard. was transformed into various yeast lines identified for their The following table shows primers used in various ability to accumulate farnesol (FIG. 11) and grown in 2 ml molecular manipulations described in the present disclosure. Sequence Primer Name Primer sequence Identifier ERG9p Sl GTACATTTCATAGCCCATCTTCAACAACAATACCGACTTA SEQ ID NO: 1 CCCGTACGCTGCAGGTCGAC SEQ ID NO: 2 ERG9 CAGATTGACGGAGAGAGGGCCACATTGTTTGTCGGCAA SEQ ID 250dw52 NO: 3 TAAATCGATGAATTCGAGCTCG SEQ ID N0:4 Hph F ATGGGTAAAAAGCCTGAACTCA SEQ ID NO: 5 Hph R TTATTCCTTTGCCCTCGGACGAG SEQ ID NO: 6 ERG9 AGATGCTAGTCAATGGCAGAAG SEQ ID 450cl Wr NO: 7 ERG9p300upF TGCTTACACAGAGTGAACCTGC SEQ ID NO: 8 ERG9 300R CTCGTGGAAGTGACGCAAC SEQ ID NO: 9 HPS Natl F gggGCGGCCGCaAAAACA atggccccagctatagtgatgag SEQ ID NO: 10 HPS SpeIR gACTAGT tcaaatatcaatagaatccacc SEQ ID N0:11 pGPD-BamHIF SegGGATCCagmatcattatcaatactcgcc SEQ ID NO: 12 US 10,738,328 Bl 13 14 -continued Sequence Primer Name Primer sequence Identifier pGPD-Not!R gggGCGGCCGCgagctcagmatcattatc SEQ ID NO: 13 It will be understood that various details of the presently Keasling J (2009) Synthetic biology in pursuit of inexpen 10 disclosed subject matter can be changed without departing sive, effective, antimalarial drugs. Biosocieties 4: 275-282 from the scope of the subject matter disclosed herein. Kirby J, Romanini D W, Paradise E M, Keasling J D (2008) Furthermore, the foregoing description is for the purpose of Engineering triterpene production in Saccharomyces cer illustration only, and not for the purpose of limitation. evisiae-beta-amyrin synthase fromArtemisia annua. Febs Journal 275: 1852-1859 15 REFERENCES Maertens J A (2004) History of the development of azole derivatives. Clinical Microbiology and Infection 10: 1-10 Numerous references have been cited throughout this Martin VJ J, Pitera DJ, Withers ST, Newman JD, Keasling disclosure including the following. All are incorporated by JD (2003) Engineering a mevalonate pathway in Escheri reference. 20 chia coli for production of terpenoids. Nature Biotech nology 21: 796-802 Asadollahi MA, Maury J, Moller K, Nielsen K F, Schalk M, Clark A, Nielsen J (2008) Production of plant sesquiter Mathis JR, Back K, Starks C, Noel J, Poulter CD, Chappell J (1997) Pre-steady-state study ofrecombinant sesquiter penes in Saccharomyces cerevisiae: Effect of ERG9 pene cyclases. Biochemistry 36: 8340-8348 repression on sesquiterpene biosynthesis. Biotechnology 25 Nicolaou KC, Yang Z, Liu J J, Ueno H, Nantermet PG, Guy and Bioengineering 99: 666-677 R K, Claiborne C F, Renaud J, Couladouros EA, Paul Asadollahi M A, Maury J, Schalk M, Clark A, Nielsen J vannan K, Sorensen E J (1994) Total synthesis oftaxol. (2010) Enhancement of famesyl diphosphate pool as Nature 367: 630-634 direct precursor of sesquiterpenes through metabolic 30 Reddy L H, Couvreur p (2009) Squalene: A natural triter- engineering of the mevalonate pathway in Saccharomyces pene for use in disease management and therapy. cerevisiae. Biotechnology and Bioengineering 106: Advanced Drug Delivery Reviews 61: 14121426 86-Bedoukian PE (1983) Perfumery and flavour materi- Seki H, Ohyama K, Sawal S, Mizutani M, Ohnishi T, Sudo als. Perfumer & Flavorist 8: 1, 3-6 H, Akashi T, Aoki T, Saito K, Muranaka T (2008) Licorice Bergstrom J D, Dufresne C, Bills G F, Nallinomstead M, 35 beta-amyrin 11-oxidase, a cytochrome P450 with a key Byrne K (1995) Discovery, biosynthesis, and mechanism role in the biosynthesis of the triterpene sweetener gly cyrrhizin. Proceedings of the National Academy of Sci of action of the zaragozic acids potent inhibitors of ences of the United States of America 105: 14204-14209 squalene synthase. Annual Review of Microbiology 49: Shianna K V, Dotson W D, Tove S, Parks L W (2001) 607-639 40 Identification of a UPC2 homolog in Saccharomyces Bhilwade H N, Tatewaki N, Nishida H, Konishi T (2010) cerevisiae and its involvement in aerobic stern! uptake. Squalene as novel food factor. Current Pharmaceutical Journal of Bacteriology 183: 830-834 Biotechnology 11: 875-880 Silva L, Coutinho A, Fedorov A, Prieto M (2006) Competi Bourot S, Karst F (1995) Isolation and characterization of 45 tive binding of cholesterol and ergosterol to the polyene the saccharomyces-cerevisiae sutl gene involved in stern! antibiotic nystatin. A fluorescence study. Biophysical uptake. Gene 165: 97-102 Buckingham J (2003) Diction Journal 90: 3625-3631 ary of Natural Products. Chapman & Hall/CRC Chemical Takahashi S, Yeo Y, Greenhagen B T, McMullin T, Song L, Database Maurina-Brunker J, Rosson R, Noel JP, Chappell J (2007) Casida J E (2009) Pest toxicology: The primary mechanisms 50 Metabolic engineering of sesquiterpene metabolism in of pesticide action. Chemical Research in Toxicology 22: yeast. Biotechnology and Bioengineering 97: 170-181 609-619 Tu Y (2011) The discovery of artemisinin (qinghaosu) and Fischer M J C, Meyer S, Claude! P, Bergdoll M, Karst F gifts from Chinese medicine. Nature Medicine 17: 1217- (2011) Metabolic engineering of monoterpene synthesis 1220 in yeast. Biotechnology and Bioengineering 108: 1883- 55 Wall ME, Wani MC (1995) Paclitaxel-from discovery to 1892 clinic. In GICTTOIVDM Georg, ed, Taxane Anticancer Huang Z-R, Lin Y-K, Fang J-Y (2009) Biological and Agents: Basic Science and Current Status, Vol 583, pp pharmacological activities of squalene and related com 18-30 pounds: potential uses in cosmetic dermatology. Mo!- 60 Wu S Q, Schalk M, Clark A, Miles R B, Coates R, Chappell ecules 14: 540-554 J (2006) Redirection of cytosolic or plastidic isoprenoid Janke C, Magiera M M, Rathfelder N, Taxis C, Reber 5, precursors elevates terpene production in plants. Nature Maekawa H, Moreno-BorchartA, Doenges G, Schwab E, Biotechnology 24: 1441-1447 Schiebel E, Knop M (2004) A versatile toolbox for Zhang D L, Jennings S M, Robinson G W, Poulter C D PCR-based tagging of yeast genes: new fluorescent pro- 65 ( 1993) Yeast squalene synthase-expression, purification, teins, more markers and promoter substitution cassettes. and characterization of soluble recombinant enzyme. Yeast 21: 947-962 Archives of Biochemistry and Biophysics 304: 133143 US 10,738,328 Bl 15 16 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS, 13 <210> SEQ ID NO 1 <211> LENGTH, 40 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer sequence <400> SEQUENCE, 1 gtacatttca tagcccatct tcaacaacaa taccgactta 40 <210> SEQ ID NO 2 <211> LENGTH, 20 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer sequence <400> SEQUENCE, 2 cccgtacgct gcaggtcgac 20 <210> SEQ ID NO 3 <211> LENGTH, 38 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer sequence <400> SEQUENCE, 3 cagattgacg gagagagggc cacattgttt gtcggcaa 38 <210> SEQ ID NO 4 <211> LENGTH, 22 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer sequence <400> SEQUENCE, 4 taaatcgatg aattcgagct cg 22 <210> SEQ ID NO 5 <211> LENGTH, 22 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 5 atgggtaaaa agcctgaact ca 22 <210> SEQ ID NO 6 <211> LENGTH, 23 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 6 ttattccttt gccctcggac gag 23 <210> SEQ ID NO 7 <211> LENGTH, 22 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence US 10,738,328 Bl 17 18 -continued <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 7 agatgctagt caatggcaga ag 22 <210> SEQ ID NO 8 <211> LENGTH, 22 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 8 tgcttacaca gagtgaacct gc 22 <210> SEQ ID NO 9 <211> LENGTH, 19 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 9 ctcgtggaag tgacgcaac 19 <210> SEQ ID NO 10 <211> LENGTH, 41 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 10 ggggcggccg caaaaacaat ggccccagct atagtgatga g 41 <210> SEQ ID NO 11 <211> LENGTH, 29 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 11 gactagttca aatatcaata gaatccacc 29 <210> SEQ ID NO 12 <211> LENGTH, 32 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 12 cgggatccag tttatcatta tcaatactcg cc 32 <210> SEQ ID NO 13 <211> LENGTH, 31 <212> TYPE, DNA <213> ORGANISM, Artificial Sequence <220> FEATURE, <223> OTHER INFORMATION, primer <400> SEQUENCE, 13 ggggcggccg cgagctcagt ttatcattat c 31 US 10,738,328 Bl 19 20 The invention claimed is: selecting for yeast exhibiting ergosterol dependent growth 1. A non-naturally occurring yeast having: and farnesyl accumulation in an amount of 50 mg/Lor (a) dispensable mevalonate and ergosterol biosynthetic greater of farnesol when cultured in the presence of pathways, mutation(s) conferring the ability to use nystatin and squalestatin. exogenous stern! to meet its stern! requirements under 5 5. The non-naturally occurring yeast of claim 1, in which aerobic growth conditions in the presence of nystatin the yeast are from yeast line ZXl 78. and squalestatin but does not require exogenous stern! 6. A stern! dependent growth/ERG9 gene knockout muta in order to grow in the absence of nystatin and squal- tion (llerg9) yeast cell lines having: estatin; (a) dispensable mevalonate and ergosterol biosynthetic 10 pathways, mutation(s) conferring the ability to use (b) a wild type squalene synthase gene; exogenous stern! to meet its stern! requirements under (c) harboring a mutation in one of the genes associated aerobic growth conditions in the presence of nystatin with the enzymes comprising the mevalonate biosyn and squalestatin but will require exogenous stern! in thetic pathway or a mutation in a genetic locus effecting order to grow in the absence of nystatin and squalesta production of farnesyl diphosphate or farnesol; and 15 tin; (d) accumulating 50 mg/L or greater amounts of farnesol (b) the dispensable mevalonate and ergosterol biosyn when cultured in the presence of nystatin, squalestatin thetic pathway mutation(s) comprise replacement of and exogenous stern!, wild type ERG9 gene with a selectable marker gene; said non-naturally occurring yeast produced by a method ( c) harboring a mutation in one of the genes associated comprising: 20 with the enzymes comprising the mevalonate biosyn combining yeast with a chemical mutagenesis agent to thetic pathway or a mutation in a genetic locus effecting induce mutations in the yeast to generate chemically production of farnesol diphosphate or farnesol; and mutated yeast; ( d) accumulating 60 mg/L or greater amounts of farnesol culturing the chemically mutated yeast in the presence of when cultured in the presence of exogenous stern! but nystatin, squalestatin and cholesterol to produce yeast 25 not nystatin and squalestatin, which have (i) the dispensable stern! biosynthetic path the stern! dependent growth/ERG9 gene knockout muta way, (ii) the ability to utilize exogenous sterols to meet tion (llerg9) yeast produced by a method comprising: its aerobic growth needs in the presence of nystatin and combining yeast with a chemical mutagenesis agent to squalestatin but does not require exogenous stern! in induce mutations in the yeast to generate chemically order to grow in the absence of nystatin and squalesta- 30 mutated yeast; tin, (iii) the dispensable mevalonate biosynthetic path culturing the chemically mutated yeast in the presence of way due to one or more mutations introduced into loci nystatin, squalestatin and cholesterol to produce the of an enzyme comprising the mevalonate biosynthetic yeast which have (i) the dispensable stern! biosynthetic pathway other than the ERG9 gene locus or a mutation pathway, (ii) the ability to utilize exogenous sterols to in a genetic locus effecting production of farnesyl 35 meet its aerobic growth needs in the presence of diphosphate or farnesol, and (iv) a wild type squalene nystatin and squalestatin but do not require exogenous synthase gene; and stern! in order to grow in the absence of nystatin and selecting for yeast exhibiting stern! dependent growth and squalestatin, (iii) the dispensable mevalonate biosyn farnesyl accumulation in an amount of 50 mg/L or thetic pathway due to one or more mutations introduced greater of farnesol when cultured in the presence of 40 into loci of an enzyme comprising the mevalonate nystatin and squalestatin to thereby produce the non biosynthetic pathway other than the ERG9 gene locus naturally occurring yeast. or a mutation in a genetic locus effecting production of 2. The non-naturally occurring yeast of claim 1, wherein farnesyl diphosphate or farnesol; the yeast harbors a stern! uptake enhancement mutation selecting for yeast with stern! dependent growth and (SUE) or is phenotypically a SUE mutant. 45 farnesol accumulation and for accumulating 50 mg/Lor 3. The non-naturally occurring yeast of claim 1, wherein greater amounts of farnesol when cultured in the pres the yeast is a mutant yeast selected from the group consisting ence of nystatin, squalestatin and exogenous stern!; and of Candida albicans and Saccharomyces cerevisiae. introducing the ERG9 gene mutation by gene replacement 4. A method for producing stern! dependent growth yeast of wild type ERG9 gene with an antimicrobial resis cell lines generating terpene, the method comprising: 50 tance gene to produce the yeast that (i) will require combining yeast with a chemical mutagenesis agent to exogenous stern! in order to grow when cultured in the induce mutations in the yeast to generate chemically absence of nystatin and squalestatin, and (ii) have mutated yeast; farnesol accumulation in 60 mg/L or greater when culturing the chemically mutated yeast in the presence of cultured in the presence of exogeneous stern!. nystatin, squalestatin and cholesterol to produce yeast 55 7. The non-naturally occurring yeast of claim 6, wherein which have (i) a dispensable stern! biosynthetic path the yeast harbors a stern! uptake enhancement mutation way, (ii) an ability to utilize exogenous stern! to meet (SUE) or is phenotypically a SUE mutant. its aerobic growth needs in the presence of nystatin and 8. A method for producing stern! dependent growth/ERG9 squalestatin but does not require exogenous stern! in gene knockout mutation (llerg9) yeast cell lines, the method order to grow in the absence of nystatin and squalesta- 60 comprising: tin, (iii) a dispensable mevalonate biosynthetic pathway combining yeast with a chemical mutagenesis agent to due to one or more mutations introduced into loci of an induce mutations in the yeast to generate chemically enzyme comprising the mevalonate biosynthetic path mutated yeast; way other than the ERG9 gene locus or a mutation in culturing the chemically mutated yeast in the presence of a genetic locus effecting production of farnesyl diphos- 65 nystatin, squalestatin and cholesterol to produce yeast phate or farnesol, and (iv) a wild type squalene syn which have (i) a dispensable stern! biosynthetic path thase gene; and way, (ii) an ability to utilize exogenous sterols to meet US 10,738,328 Bl 21 22 its aerobic growth needs in the presence of nystatin and 9. The yeast of claim 1, wherein the mutation is in one of squalestatin but do not require exogenous sterol in the genes encoding the enzymes of the mevalonate biosyn order to grow in the absence of nystatin and squalesta thetic pathway. tin, (iii) a dispensable mevalonate biosynthetic pathway 10. The yeast of claim 6, wherein the mutation is in one due to one or more mutations introduced into loci of an 5 of the genes encoding the enzymes of the mevalonate enzyme comprising the mevalonate biosynthetic path biosynthetic pathway. way other than the ERG9 gene locus or a mutation in a genetic locus effecting production of famesyl diphos 11. The method of claim 8, further comprises introducing phate or farnesol; an expression vector into the yeast cell line, which vector selecting for yeast with sterol dependent growth and expresses a gene for a terpene synthase. 10 famesol accumulation and for accumulating 50 mg/Lor 12. The method of claim 11, wherein the terpene synthase greater amounts of famesol when cultured in the pres is for sesquiterpene synthase. ence of nystatin, squalestatin and exogenous sterol; and 13. The sterol dependent growth yeast cell line of claim 6, introducing an ERG9 gene mutation by gene replacement wherein the method producing the yeast cell line further of wild type ERG9 gene with an antimicrobial resis 15 comprises introducing an expression vector into the yeast tance gene to produce yeast that (i) will require exog- cell line, which vector expresses a gene for terpene synthase. enous sterol in order to grow when cultured in the absence of nystatin and squalestatin, and (ii) have 14. The sterol dependent growth yeast cell line of claim famesol accumulation in 60 mg/L or greater when 13, wherein the terpene synthase is for sesquiterpene. cultured in the presence of exogeneous sterol. * * * * *