Aberrant Alternative Splicing in Skeletal Muscle Of

ABERRANT ALTERNATIVE SPLICING IN SKELETAL MUSCLE OF

R6/2 HUNTINGTON’S DISEASE MICE

A Thesis

Presented to the

Faculty of

California State Polytechnic University, Pomona

In Partial Fulfillment

Of the Requirements for the Degree

Master of Science

Biological Sciences

Elizabeth Munguia

2016

SIGNATURE PAGE

THESIS: ABERRANT ALTERNATIVE SPLICING IN SKELETAL MUSCLE OF R6/2 HUNTINGTON’S DISEASE MICE

AUTHOR: Elizabeth Munguia

DATE SUBMITTED: Fall 2016

Biological Sciences Department

Dr. Robert J. Talmadge Thesis Committee Chair Biological Sciences

Dr. Andrew D. Steele Biological Sciences

Dr. Sepher Eskandari Biological Sciences

ACKNOWLEDGEMENTS

First and foremost, I would like to thank my thesis advisor, Dr. Robert J. Talmadge for the amazing opportunity to join his lab and be part of a great research project. I could not have completed my Master’s thesis without his help. I am gratefully indebted to him for his time, patience, expertise, and guidance.

I would also like to thank my thesis committee, Dr. Sepher Eskandari and Dr. Andrew D.

Steele for their time and intellectual contributions.

Finally, I want to thank my family and friends for their constant support and encouragement. Gracias mamá y papá por su amor y apoyo. Thank you Adam, Helen,

Steve, and Jenny for your love and countless adventures.

iii

ABSTRACT

Huntington’s disease (HD) is a fatal trinucleotide-repeat disorder that is characterized by neurodegeneration, which leads to motor and cognitive impairments. The motor impairments include chorea, rigidity, dystonia, and muscle weakness. Cognitive impairments include subcortical dementia, depression, mania, and suicide. These impairments increase in severity until the individual loses the ability to talk, walk, or reason. Previous research by our lab (Waters et al., 2013) demonstrated that in a transgenic mouse model for HD, i.e., the R6/2 mouse line, impairments in muscle function, including alterations in muscle excitability, chloride channel function, and chloride channel mRNA levels, were in part due to aberrant splicing of the chloride channel pre-mRNA. The R6/2 mouse line expresses the expanded CAG trinucleotide repeat from exon 1 of the human huntingtin (HTT) gene observed in human HD patients and represents a model of early onset HD. The data from Waters et al. (2013) are reminiscent of another trinucleotide-repeat disorder, myotonic dystrophy (DM), in which skeletal muscles have dramatic debilitations in the regulation of pre-mRNA splicing.

Therefore, this study investigated the changes in pre-mRNA splicing in multiple muscles of R6/2 mice for several genes that are known to be aberrantly spliced in DM, and may be aberrantly spliced in HD. These genes include the chloride channel (CLCN1), insulin receptor (INSR), titin (TTN), sarco(endo)plasmic reticulum Calcium ATPase (SERCA1), z-line associated protein (ZASP), troponin (TNNT3), and α-actinin 1 (ACTN1). Reverse transcriptase-polymerase chain reactions using primers designed to detect multiple splice variants were used to detect changes in alternative splicing in R6/2 and age-matched wild-type (WT) mice. Multiple muscles were assessed for alterations in mRNA splicing

iv including the tibialis anterior (TA), interosseous (IO), diaphragm (Dia), and soleus (Sol) muscles from late-stage R6/2 mice and WT controls. We found a significant difference in aberrantly spliced TTN mRNA in the TA of R6/2 mice relative to WT (p < 0.001)

(n=12/group). We also found a significant difference in aberrantly spliced CLCN1 (p <

0.05) and INSR (p < 0.05) mRNAs in the IO of R6/2 mice relative to WT (n=6/group).

However, we did not find significant differences in aberrantly spliced CLCN1 (p =

0.286), INSR (p = 0.716), TTN (p = 0.195), and ZASP (p = 0.496) mRNAs in the Dia of

R6/2 mice relative to WT (n=5/group). There were also no significant differences in aberrantly spliced CLCN1 (p = 0.500) and INSR (p = 0.264) mRNAs in the Sol of R6/2 mice (n = 6) relative to WT (n = 7). There were also no significant differences in aberrantly spliced TTN (p = 0.0774) mRNA in the IO muscle of R6/2 mice relative to

WT (n=6/group). We also found no significant differences in aberrantly spliced

SERCA1, TNNT3, and ACTN1 mRNAs in TA, IO, Dia, and Sol skeletal muscles of

R6/2 mice relative to WT. These results suggest the effect of HD on aberrant splicing is muscle specific and less pronounced than in DM. Thus, slower muscles, such as the Dia and Sol, may be less affected by HD in terms of aberrant alternative splicing, than faster muscles, such as the TA and IO.

TABLE OF CONTENTS

SIGNATURE PAGE ...... iii

ACKNOWLEDGEMENTS...... iii

ABSTRACT ...... iv

LIST OF TABLES ...... ix

LIST OF FIGURES ...... x

INTRODUCTION ...... 1

Huntington's Disease ...... 1

Huntington's Disease: Previous Research ...... 5

Alternative Splicing ...... 7

Animal Models of HD ...... 8

Myotonic Dystrophy ...... 10

Myotonic Dystrophy: Aberrant Alternative Splicing ...... 12

Chloride Channel (CLCN1) ...... 12

Insulin Receptor (INSR) ...... 12

Sarco(endo)plasmic reticulum Ca2+-ATPase pump (SERCA1) ...... 13

Skeletal Muscle ...... 13

Skeletal Muscle Composition ...... 13

Skeletal Muscle Contraction ...... 15

Muscle Proteins ...... 17

Titin (TTN) ...... 17

Z-line associated protein (ZASP) ...... 17

Troponin T3 (TNNT3) ...... 18

Alpha Actinin 1 (ACTN1) ...... 18

Thesis Objectives ...... 19

Study Questions ...... 20

Hypotheses ...... 20

MATERIALS AND METHODS ...... 21

Animal Model ...... 21

Experimental Procedures ...... 22

RNA Isolation ...... 22

RNA Quantification and Dilution ...... 23

Splicing Analysis ...... 24

Genes of Interest ...... 25

Statistical Methods ...... 26

RESULTS ...... 27

Chloride Channel (CLCN1) ...... 27

Insulin Receptor (INSR) ...... 30

Sarco(endo)plasmic reticulum Ca2+-ATPase Pump (SERCA1) ...... 33

Titin (TTN) ...... 35

vii

Troponin T3 (TNNT3) ...... 38

Alpha Actinin 1 (ACTN1) ...... 40

Z-line associated protein (ZASP) ...... 43

DISCUSSION ...... 46

CONCLUSION ...... 50

FUTURE STUDIES ...... 51

REFERENCES ...... 52

viii

LIST OF TABLES

Table 1. PCR Conditions ...... 24

Table 2. Primer Conditions ...... 25

Table 3. Summary of Aberrant Alternative Splicing ...... 47

LIST OF FIGURES

Figure 1. Sarcomere of the skeletal muscle...... 14

Figure 2. Gel showing CLCN1 mRNA splicing ...... 28

Figure 3. Expression of CLCN1 mRNA ...... 29

Figure 4. Gel showing INSR mRNA splicing ...... 31

Figure 5. Expression of INSR mRNA splicing ...... 32

Figure 6. Gel showing SERCA1 mRNA splicing ...... 34

Figure 7. Gel showing TTN mRNA splicing ...... 36

Figure 8. Expression of TTN mRNA splicing ...... 37

Figure 9. Gel showing TNNT3 mRNA splicing ...... 39

Figure 10. Gel showing ACTN1 mRNA splicing ...... 41

Figure 11. Expression of ACTN1 mRNA splicing ...... 42

Figure 12. Gel showing ZASP mRNA splicing ...... 44

Figure 13. Expression of ZASP mRNA splicing ...... 45

INTRODUCTION

Huntington's Disease

The first record of Huntington’s disease (HD) was written by Charles Oscar

Waters in a letter published in the Practice of Medicine in 1842. Subsequently, George

Huntington published his paper on HD (Huntington, 1872), Punnett discovered HD to be autosomal dominant (Punnett, 1908), the HD gene was isolated and the CAG repeat mutation was identified (Huntington’s Disease Collaborative Research Group, 1993), a mouse model for HD was produced (Mangiarini et al., 1996), and a high-throughput screen was published for HD (Heiser et al., 2002). However, despite all these advancements, a cure for HD has not been elucidated. Also, the treatments for HD that are available “only help to alleviate some of the movement and psychiatric symptoms associated with the pathology” (Bano et al., 2011).

Huntington’s disease (HD) is a fatal trinucleotide-repeat disorder that is characterized by neurodegeneration, which leads to motor and cognitive impairments

(Snell et al., 1993). The motor impairments include chorea, rigidity, dystonia, and muscle weakness (Ortega and Lucas, 2014). About 90% of HD patients will develop chorea, which is characterized by jerky and involuntary movement of the body’s upper and lower extremities (Kirkwood, 2001; Haddad, 1997). Rigidity is the slowing of voluntary movements, which leads to muscle stiffness (Storey and Beal, 1993). Involuntary movement that may lead to abnormal postures or movement, or both, characterizes dystonia. The types of dystonia that are more prevalent among HD patients are internal shoulder rotation, sustained fist clenching, excessive knee flexion, and foot inversion

(Louis et at., 1999). On average, HD patients develop three to four types of dystonia

(Louis et al., 1999).

Cognitive impairments also affect HD patients and they include subcortical dementia, depression, mania, and suicide (Ortega and Lucas, 2014). Patients with HD that express subcortical dementia display deficits in fronto-subcortical circuits that give rise to a variety of cognitive deficits (Zakzanis, 1998). These cognitive deficits include delayed recall and memory acquisition (Zakzanis, 1998). It has been observed that emotional and cognitive changes occur about three years before motor dysfunction begins

(Ortega and Lucas, 2014).

These impairments increase in severity until the individual loses the ability to talk, walk, or reason. Once these symptoms manifest they will progress until the patient becomes fully dependent on others, which can affect the family emotionally, socially, and economically (Huntington’s Disease Society of America, 2016). Huntington’s disease does not only affect the patient, but the lives of the entire family.

Previous research has shown that 1-5 individuals out of every 100,000 worldwide will develop HD (Marshall, 2004). It is also estimated that “more than a quarter of a million Americans have HD or are at risk of inheriting the disease from an affected parent” (Huntington’s Disease Society of America, 2016). The severity and the onset of HD depend on the number of CAG repeats present in the individual’s huntingtin gene (HTT). Previous research has shown that there is a negative correlation between age of onset and associated repeat lengths of CAG (Huntington Collaborative Research

Group, 1993). Affected individuals may have a CAG repeat number of 30 – 70 and those with a CAG repeat number of 9 – 34 may not become affected by HD (Snell et al., 1993).

This study has also shown that the two distributions overlap slightly around 30 -34 CAG

2 repeats, concluding that interpretation of the result in this range is uncertain (Snell et al.,

1993). However, data has shown that individuals with more than 40 CAG repeats will develop the disease in middle age and those with more than 50 CAG repeats will develop

HD as juveniles (Duyao et al., 1993).

A juvenile that develops HD, termed Juvenile Huntington’s disease (JHD), develops the disease before the age of 20 and these young individuals develop the more extreme form of it (Bates et al., 2014). Previous research has shown that in cases of JHD, epilepsy (recurrent and unprovoked seizures) and myoclonus (involuntary twitching of muscles) are more prevalent than in adult-onset HD (Seisling et al., 1997). Some researchers have separated patients with JHD to be those who develop the disease between the age of 11 to 20, and childhood onset HD to be those who develop the disease at the age of 10 or younger. It is estimated that about 20% of cases of JHD develop the disease at 10 years old or younger (Quarrell et al., 2012). Other research has shown that more seizures have been linked to younger onset of HD and higher CAG repeats (Cloud et al., 2012). Anticipation has been shown to be the culprit of early-onset HD.

Anticipation is described as a “phenomenon whereby a disease develops an earlier onset or more severe symptoms, as it is transmitted through the generations” (Bates, 2005).

Anticipation in HD is acquired through the paternal lineage (Bates, 2005).

As stated previously, the treatments available only help to alleviate some of the movement and psychiatric symptoms associated with HD pathology (Bano et al., 2011).

According to the Huntington’s Disease Society of America, the only FDA approved treatment is Xenazine® (tetrabenazine). The mechanism for how Xenazine® exerts its antichorea effects is not fully understood, however, it is believed to deplete monamines

® (i.e. dopamine) from the nerve terminals (Lundbeck, 2015). Xenazine helps in treating the involuntary movements associated with HD. Other medications available for individuals with HD include dopamine-depleting agents (i.e. reserpine, tetrabenazine) and dopamine-receptor antagonists (i.e. neuroleptics) (Medscape, 2015). The dopamine depleting drugs, specifically reserpine, have been shown to work well for other movement disorders such as Parkinson’s disease (Charles et al., 1963). Parkinson’s disease is a chronic and progressive disorder characterized by tremor, bradykinesia

(slowness of movement), rigidity and impaired balance and coordination (Parkinson’s

Disease Foundation, 2016). However, one of the problems with using these drugs is that individuals with HD are more vulnerable to side effects from medications. For example, tetrabenazine’s serious side effect is that it triggers depression and other psychiatric conditions (Mayo Clinic, 2015). Also, neuroleptics which, are antipsychotic drugs, may cause stiffness and rigidity over time, which may exacerbate HD neuromuscular symptoms.

Since medication to ameliorate involuntary muscle movements leads to serious side effects, and no cure has been found, it was proposed that epigenetics might be used to cure Huntington’s disease. Previous research done with Drosophila models of the HD polyglutamine disease, found that histone deacetylase inhibitors (HDAC) may slow or prevent the progressive neurodegeneration seen in HD (Steffan et al., 2001). Steffen et al.

(2001) and colleagues observed that the use of HDAC inhibitors alleviated symptoms observed in HD as a result of re-stabilization of gene transcription. This re-stabilization was due to a “shift of histone acetylation equilibrium towards increased acetylation of histones, relaxation of DNA-chromatin complexes and subsequent increase of gene

4 transcription” (Steffen et al., 2001). Thus, gene transcription may play an important role in HD pathology. Other research done with HDAC inhibitor drugs suggests its beneficial effects in other neurologic diseases, such as Parkinson's and Alzheimer's (Jakovcevski and Akbarian, 2012).

Huntington's Disease: Previous Research

Huntington’s disease is an autosomal dominant inherited disease in which the carriers will become affected (Bates et al., 2014; Punnet, 1908). It has been shown that

HD forms from a combination of increased gain-of-function of the mutant huntingtin

(mHTT) and the loss-of-function of the wild-type HTT (Bano et al., 2011). The mutant

HTT is caused by extended repeats of cytosine, adenine, and guanine (CAG) building blocks in exon-1 of the gene encoding for huntingtin protein (Bano et al., 2011). The

Gusella laboratory successfully found the location of the HTT gene to be on the short arm of chromosome 4 (Bates, 2005).

Other research has shown that the overexpression of mHTT leads to an increased glutamate release from afferent neurons (Cowan et al., 2008). The CAG repeats encode for the polyglutamine (poly Q) stretch at the N-terminus, which functions as a membrane association signal that can lead to mHTT aggregation, nuclear entry and toxicity of the nuclei of striatal neurons (Atwal et al., 2007). In afferent neurons, the increase in glutamate release enhances the NMDA(N-Methyl-D-aspartate)-Receptor activity, which leads to an intracellular Ca2+ increase (Cowan et al., 2008). The increase in intracellular

Ca2+ causes the activation of calpains, which are calcium-activated proteases that cleave the HTT protein into a series of “proteolytic products that promote NMDA-R-mediated

5 excitotoxicity” (Cowan et al., 2008). The excitotoxicity then damages or kills the cells when HTT proteolytic fragments accumulate and cannot be cleared.

The mHTT has been shown to accumulate in the cytoplasm of neurons axons and nuclei. Liu et al. (2015) investigated how these mHTT fragments were negatively impacting the neurons because this process remained unclear. Using R6/2 transgenic mice, they found that as the motor impairment progressed, the percentage of perinuclear and intranuclear mHTT changed, in parallel. Their findings showed that perinuclear inclusions disrupted the nuclear envelope of striatal neurons, accompanied by re-entry into the cell cycle, and eventual neuronal death. Research conducted by Li et al. (2001) also showed that huntingtin aggregates formed in the axons of striatal projection neurons lead to axonal dysfunction and degeneration in mice 11 to 27 months after birth. These same results were also seen in cultured striatal neurons expressing mutant huntingtin.

Previous research on transgenic mice with HTT deletion has shown that HTT is essential in mammmalian development (Nasir et al., 1995; Zeitlin et al., 1995). The deletion of the HTT gene suppresses HTT expression, increasing apoptosis, which leads to embryonic death (Nasir et al., 1995; Zeitlin et al., 1995). In addition, heterozygous knockout mice have shown an increase in neuronal loss in the subthalamic nucleus and basal ganglia, which leads to severe cognitive deficits (Nasir et al., 1995). In short, the deleterious influence of HD on the nervous system comes about due to a loss of normal

HTT (loss of function) and the elevation of mHTT (gain of function).

Most research done on the neurodegenerative process in HD has focused on the progressive loss of neurons in the striatum, which leads to cognitive and motor impairments. However, it was not clear how HD influenced skeletal muscle. Recently,

6 our lab (Waters et al., 2013) investigated the membrane properties in the R6/2 transgenic mouse model for HD. Waters et al. (2013) demonstrated that impairments in muscle function, including alterations in muscle excitability, chloride channel function, and chloride channel mRNA levels, were in part due to aberrant alternative splicing of Clcn1 mRNA (gene for CLC-1). The aberrant splicing resulted in an increase in exon 7A inclusion in the chloride channel mRNA in HD mice. Exon 7a inclusion causes the appearance of a premature stop codon resulting in non-sense mediated decay of the mRNA. As a consequence, there was a reduction of chloride channel mRNA, which likely result in less functional protein in the sarcolemma. At a physiological level, most of the resting conductance in the skeletal muscle is mediated by chloride through the muscle chloride channel so the reduction of the functional protein results in involuntary and prolonged skeletal muscle contractions due to hyperexcitability of the sarcolemma.

Also, the decrease in resting of chloride and potassium conductance may account for the self-triggering of contraction in the diseased muscle fibers. From this data, it was concluded that the action potential in R6/2 transgenic mice was more easily triggered and sustained than those of the WT mice.

Alternative Splicing

The central dogma of molecular biology is the flow of information from DNA to

RNA to proteins. This is a two-step process that involves transcribing the original strand of DNA into a messenger RNA (mRNA) and then translating the mRNA into a protein.

Transcription takes place in the nucleus of the cells. The template strand of DNA is read by RNA polymerase, which unwinds the double-stranded DNA, and matches the DNA

7 template with the complementary RNA nucleotide. As the RNA polymerase moves down the DNA, the RNA polymerase joins the incoming RNA nucleotide to one already joined on the DNA strand producing a pre-mRNA. In eukaryotes, such as humans, the pre- mRNA requires three processing reactions before it can be converted to a mature mRNA and then translated. A 5’-cap is added to the 5’ end of the RNA, which consists of 7- methylguanylate (m7G) bonded to three phosphate groups. At the 3’ end of the pre- mRNA, a 3’- poly A tail is added. The 5’-cap serves to initiate translation and the 3’-poly

A tail protects the mRNA strand from being degraded, extending the life of the mRNA, and thus, increasing the number of times a single mRNA molecule can be translated. The pre-mRNA transcript also contains exons (coding regions) and introns (non-coding regions). The introns are cleaved out of the pre-mRNAs by a process known as splicing, which produces the final mRNA (absent of introns). Alternative splicing allows the primary RNA transcript to generate different combinations of exons, in order to produce different mature mRNAs and different proteins.

Alternative splicing of pre-mRNAs is essential for producing multiple RNAs and protein isoforms from a single DNA segment. However, errors in alternative splicing may arise, causing various diseases that either have a polymorphism or a deleterious mutation.

One such disease is Huntington’s disease, which is a multisystemic disorder.

Animal Models of HD

A genetic mouse model that has been widely used is the R6/2 transgenic mouse model of HD. R6/2 transgenic mice are the most widely used animal model to study the pathogenesis of HD and they express a transgene, which includes exon 1, of the human

HTT gene with approximately 150 CAG repeats (Mangiarini et al., 1996). The R6/2 transgenic mouse line has the progressive phenotype and expresses the expanded CAG trinucleotide repeat in exon 1 of the human huntingtin gene in skeletal muscle and represents a model of early onset HD (Mangiarini et al., 1996). The mice used in this study ranged between 10-13 weeks old and fully expressed the progressive phenotype of

HD.

Carter et al. (1999) made strides in studying the behavioral phenotype of the R6/2 mouse line in order to understand its relevance and usefulness as a progressive model of

HD. They observed R6/2 transgenic mice to display motor deficits at 5 weeks old that slowly worsened until 12-13 weeks. The motor deficits observed included “irregular gait, resting tremor, stereotypical grooming, abrupt and irregularly timed shuddering movements, occasional epileptic seizures, and body weight loss” (Carter et al., 1999).

The development and progression of these motor deficits are similar to those experienced by HD patients. Five tests were conducted using R6/2 transgenic mice and WT in order to assess the neurological consequences of the R6/2 transgene expression. These tests included a swimming tank to observe the abnormalities in swimming, beam walking to compare fine motor skills, the rotarod for motor coordination and balance, footprint test to assess gait abnormalities, and prepulse inhibition of the acoustic startle response to evaluate motor reflex responses to noise stimulus. These tests were initiated at 5 – 6 weeks of age, retested at 8 – 9 weeks of age, and then weekly thereafter. Their data supported the use of R6/2 transgenic mice as a model for understanding the pathologies associated with HD and as a model to evaluate therapeutic strategies.

Myotonic Dystrophy

There are two types of myotonic dystrophy (DM): Type 1 and Type 2. The most common type of DM is type 1. Like HD, myotonic dystrophy 1 (DM1) is a trinucleotide- repeat disorder characterized by myotonia, progressive muscle weakness, cataracts, insulin resistance and cardiac conduction defects (Kimura et al., 2005). Myotonia is a predominant characteristic of DM1 and is associated with an impairment of muscle relaxation after muscle contraction (Charlet-B et al., 2002). Affected individuals may walk with a stiff and awkward gait.

Patients with DM1 are subdivided into four subtypes which include Mild/late onset/assymptomatic, classic, childhood onset, and congenital (Turner and Hilton-Jones,

2010). The clinical signs of mild/late onset/assymptomatic phenotype include cataracts and mild myotonia; those with classic phenotype include weakness, myotonia, cataracts, conduction defects, insulin insensitivity, balding, and respiratory failure; those with the childhood onset phenotype display facial weakness, myotonia, psychosocial problems, low IQ, conduction defects; those with congenital phenotype display infantile hypotonia

(low muscle tone involving reduced muscle strength), respiratory failure, learning disability, and cardiorespiratory complications after 40 years of age (Turner and Hilton-

Jones, 2010). About 3-15 individuals per 100,000 of European descent will be afflicted by DM1 (Harper, 2001).

Previous research has shown that DM1 is an autosomal inherited disease that is caused by extended repeats of cytosine, thymine, and guanine (CTG) in the 3’ untranslated region (UTR) of the myotonic dystrophy protein kinase (DMPK) which codes for a protein kinase found in skeletal muscles (Brook et al., 1992; Harris et al.,

1996). The DMPK gene is located on chromosome 19 (Brook et al., 1992; Harris et al.,

1992). The repeat size of CTG correlates more with age of onset and severity of the disease below 400 CTG repeats than CTG repeats above 400 (Gharenhbaghi-Schnell et al., 1998; Hamshere et al., 1999). This difference in correlation between phenotype and repeat size may be due to somatic instability in mitotic and post-mitotic tissues (Turner and Hilton-Jones, 2010).

Normal individuals have a CTG repeat between 5 and 37, and assymptomatic individuals have a CTG repeat between 38 and 49, but have an elevated risk of having children with a larger, expanded CTG repeat (Turner and Hilton-Jones, 2010; Martorell et al., 2001). Patients with DM1 have a CTG repeat from 50 to 4000. Interestingly, some individuals with 60 repeats and some individuals with up to 500 repeats are assymptomatic into middle age (Turner and Hilton-Jones, 2010). Childhood onset of

DM1 occurs in children under the age of 10 and display a 50-1000 CTG repeat; those with more than 1000 CTG repeats have an age of onset at birth (Turner and Hilton-Jones,

2010). These children, with congenital DM1, inherit the expanded mutant DMPK allele from the mother, as opposed to Huntington’s disease, where the anticipation is through the paternal lineage (Turner and Hilton-Jones, 2010; Bates, 2005).

To date, there is no cure for DM1 and there are no specific treatments for DM1.

There are, however, treatments for individuals who develop cataracts or heart problems as a consequence of DM1.

Myotonic Dystrophy: Aberrant Alternative Splicing

Chloride Channel (CLCN1)

In the skeletal muscle, the chloride channels function to help stabilize the muscle cell’s resting membrane potential. Research conducted by Charlet-B. et al. (2002) has shown that individuals with DM1 show an elevation of aberrant alternative splicing of multiple genes. One of these is the chloride channel (CLCN1). Aberrant regulation of

Clcn1 pre-mRNA splicing leads to an elevation of exon 7A inclusion in Clcn1 mRNA and a decrease in full-length Clcn1 mRNA expression and a comensurate reduction in

Clcn1 function (Charlet-B. et al., 2002), resulting in hyperexcitability of the skeletal muscles.

Insulin Receptor (INSR)

The insulin receptor is a membrane receptor associated with insulin-stimulated glucose uptake. Santoro et al. (2013) also found aberrant alternative splicing in the insulin receptor gene (INSR) of skeletal muscles from DM1 patients. The INSR gene encodes for two alternatively spliced isoforms (IR-A and IR-B). These two alternatively spliced variants are produced normally, however, individuals with DM1 display a relative increase in IR-A (predomintes in embryonic tissue) versues IR-B (highly expressed in adult skeletal muscle, liver, and adipose tissues). An elevation of IR-A, for individuals with DM1, result in development of insulin resistance at a greater average than those without DM1.

Sarco(endo)plasmic reticulum Ca2+-ATPase pump (SERCA1)

Individuals with DM1 also show an elevation of aberrant alternative splicing of the sarco(endo)plasmic reticulum Ca2+-ATPase pump (SERCA1) (Zhao et al., 2015).

SERCA1 functions as a pump that transports calcium ions from the sarcoplasm into the sarcoplasmic reticulum allowing for muscle relaxation. There are two alternatively spliced variants of SERCA1. SERCA1a is found primarily in adult fast-twitch muscle and SERCA1b is found in developing (neonatal) muscles. Hino et al. (2007) found that

SERCA1b excluded exon 22 in skeletal muscles of DM1 patients. In addition, Zhao et al.

(2015) and colleagues found that SERCA1b was overexpressed in DM1 patients. Since the Ca2+ uptake activity of SERCA1a (adult fast SERCA) was almost double that of

SERCA1b (developmental SERCA), DM1 patients have a lower Ca2+ uptake capacity, accounting for the abnormal intracellualar Ca2+ homeostasis, in DM1 skeletal muscles.

Skeletal Muscle

Skeletal Muscle Composition

The skeletal muscle is composed of muscle fibers (muscle cells), which are long, cylindrical and multinucleated. The skeletal muscle fibers are unique in that they develop from myoblasts (embryonic cell that develops into a muscle cell). Each muscle fiber is composed of many myofibrils. The myofibrils are themselves composed of many myofilaments. It is the myofibril’s sarcomere composition that give the muscle fiber the unique striation. Myofibrils are bundles of protein filaments and there are two types of myofilaments, which are thin filaments (which contain actin) and thick filaments (which contain myosin).

Figure 1. Sarcomere of the skeletal muscle.

Each myofibril is composed of more than ten thousand sarcomeres (repeating functional unit of the myofibril) placed in series. One sarcomere runs the length from one

Z line to another Z line (Figure 1) (Dzialowski, 2016). The Z line is a network of proteins and it is where the thin myofilaments are anchored in the sarcomere. The sarcomere is composed of A bands (dark bands) and I bands (light bands). The A band is formed by both the thin and thick filaments and the I bands are composed of thin filaments only.

The section of the sarcomere that only contains myosin is called the H zone (an area with no thin filament overlap at the middle of the sarcomere). The M line is located in the middle of the H zone and it is a network of proteins to which the thick filaments attach.

The sarcolemma is the cell membrane of the muscle fiber that covers the sarcoplasm (cytoplasm of striated muscle cells). It gives rise to transverse tubules (t- tubules). The sarcolemma contains many ion channels and pumps that function to maintain the negative resting membrane potential of the muscle fibers (Hopkins, 2006).

The resting membrane potential of skeletal muscles is close to -90 mV and receives a

14 significant contribution from Cl- conductance (Hopkins, 2006). If the Cl- current is not able to maintain the resting membrane potential, “the muscle would not repolarize sufficiently to regenerate the active state of the channels responsible for generation of succeeding action potentials” (Hopkins, 2006).

Skeletal Muscle Contraction

Contraction of the skeletal muscles is essential for locomotion, posture, respiration, and facial expression, among other functions. Voluntary movement of skeletal muscles is possible through innervation by somatic motor neurons. The motor neurons stimulate the muscle fibers to contract at the neuromuscular junction. The neuromuscular junction is composed of the motor end plate of the muscle and the axon terminal of the neuron. Located within the axon terminal are synaptic vesicles that contain and release the neurotransmitter acetylcholine when an action potential reaches the axon terminal. The motor endplate of the muscle, a small portion of the sarcolemma, contains acetylcholine receptors. Upon release from the nerve terminal, the acetylcholine will travel across the synaptic cleft and bind to the acetylcholine receptors at the motor end plate.

Once acetylcholine binds to the acetylcholine receptors, a gate within the receptor opens and the sodium channel pore of the receptor opens allowing sodium ion influx.

Thus, the receptors are ligand-gated sodium channels. The sodium influx causes an increase of the membrane potential, known as depolarization, above the threshold value of -55mV, which in turn causes voltage-gated Na+ channels to open, leading to an action potential of the muscle cell. Afterwards, the sodium channels self-deactivate and voltage-

15 gated potassium channels open. This leads to a rush of potassium ions out of the cell, down its electrochemical gradient. As a result, the membrane potential decreases

(repolarization), when the voltage-gated potassium channels are open and the membrane potential approaches the resting membrane potential (hyperpolarization). The Na+/K+ pumps help to restore the membrane potential as acetylcholine is broken down by acetyl cholinesterase. This enables the acetylcholine receptors to respond to another neuronal stimulus.

The action potential then travels throughout the sarcolemma and enters the t- tubule allowing the action potential to travel further into the muscle cell’s interior. The action potential in the t-tubules communicates with the sarcoplasmic reticulum (SR), leading to a release of calcium ions from the SR into the sarcoplasm. When the msucle is not contracting, calcium ions are stored in the SR. The calcium ions will then bind to troponin on the thin filament, troponin changes conformation, moving tropomyosin which exposes the binding site for myosin on actin allowing for cross-bridge formation (a direct binding of the myosin head to actin on the thin filament). Contraction of the muscle soon follows as the myosin head begins the cross-bridge cycle. Contraction occurs as the acto-myosin cross-bridges pull actin filaments towards the center of the sarcomere. This action is caused by the power stroke, which generates the force of contraction. The cross- bridge cycle continues as ATP binds to the myosin head causing detachment of the myosin heads from actin and ATP hydrolysis resets the heads for another cross-bridge cycle. If the action potentials cease, the calcium ions are transported, via active transport, back into the SR via the SERCA pump. As Ca2+ dissociates from troponin, tropomyosin restores actin active site blockage, and the muscle fiber relaxes.

Muscle Proteins

Titin (TTN)

Titin is a central sarcomeric protein that connects the thick filament to the Z-line

(see Figure 1). Physiologically, it helps regulate the stiffness and elasticity of the skeletal muscle fibers (Wang et al., 1991). Titin functions as a spring to prevent over-stretch of the sarcomere. There are three alternatively spliced isoforms, for the purpose of this study, they include Titin-L, Titin-M, and Titin-S. Shorter titin isoforms result in a stiffer spring-mecahnsim. An example of TTN dysfunction is tibial muscular dystropohy, which is an autosomal late-onset distal myophaty, characterized by weakness and atrophy, which are similar symptoms found in HD patients.

Z-line associated protein (ZASP)

The ZASP (Z-line associated protein) is a Z-line associated protein that helps stabilize the sarcomere during contraction. There are multiple splice variants. These multiple splice variants make it possible for ZASP to interact with alpha actinin, myotilin, and other Z-line proteins (Lin et al., 2014). The Z-line is important in maintaining the structural integrity of the sarcomere and in cases where a mutation arises in ZASP, such as in zaspopathy, actin disruption follows. Zaspopathy is an autosomal dominant myofibrillar myopathy with mutations in titin, dysferlin, GNE (UDP-N- acetylglucosamine 2-epimerase/N-acetylmannosamine kinase), desmin and myosin

(Griggs et al., 2007).

Troponin T3 (TNNT3)

Troponin T is part of the troponin complex (Troponin C, Troponin T, and Tropnin

I). Troponin T binds tropomyosin and modulates the Ca2+-induced activation of the thin filament. Troponin T3 aids in skeletal muscle contraction and studies by Ju et al. (2013) show that troponin T3 is expressed not only in skeletal muscles, but smooth muscles located in the aorta, bronchus and bladder. They concluded that this protein is important for normal growth and breathing for postnatal survival. In addition, skeletal muscles do not include Fetal Exon, as shown in DM studies conducted by Hao et al. (2008).

Alpha Actinin 1 (ACTN1)

Alpha actinin 1 helps anchor the myofibrillar actin filaments to the Z-line and it’s an important participant in muscle contraction. The sarcomeric Z-line functions by linking “titin and actin filaments from opposing sarcomere halves in a lattice connected by alpha-actinin” (Young et al., 1998). Mammals, such as humans, have four α-actinin encoding genes (ACTN1, ACTN2, ACTN3, and ACTN4). ACTN1 was studied for the purpose of this experiement. Actinins are important for muscle contraction, and disruption of its normal function may lead to muscle disorder such as Hereditary

Inclusion Body Myopathy (Amsili et al., 2008). Previous studies have shown alternatively spliced mRNAs of ACTN1 (Suzuki et al., 2012; Murphy and Young, 2015).

There are two alternatively spliced isoforms, for the purpose of this study, they include

Titin-L and Titin-S.

Thesis Objectives

Since the trinucleotide CAG encodes for glutamine during translation, the CAG repeats encode for the polyglutamine, poly Q (Q is the single letter amino acid code for glutamine), regions at the N-terminus (exon 1) of the huntingtin gene. The poly-Q regions appear to cause mutant huntingtin (mHTT) protein misfolding, aggregation, nuclear entry and toxicity to the nuclei of striatal neurons (Atwal et al., 2007). In addition, the poly-Q causes miss-splicing of mHTT resulting in the production of toxic

N-terminal fragments (Gipson et al., 2013). Up until now, minimal research has been conducted to determine the cellular mechanism by which mHTT causes muscle dysfunction. As stated previously, the data from Waters et al. (2013) are reminiscent of

DM, in which skeletal muscles have dramatic debilitations in the regulation of pre- mRNA splicing due to the CUG trinucleotide expansion in the DMPK gene (Brook et al.,

1992; Fu et al., 1992; Mahadevan et al., 1992). HD is associated with a CAG trinucleotide expansion and R6/2 mice (mouse model of HD) have miss-splicing of the

CLCN1 gene, similar to the aberrant splicing defects that occur with DM. Therefore, this study proposes to investigate the changes in pre-mRNA splicing in multiple muscles of

R6/2 mice for several genes that are known to be aberrantly spliced in DM1, and may be aberrantly spliced in HD (Charlet-B. et al., 2002; Santoro et al., 2013). These genes include the chloride channel (CLCN1), insulin receptor (INSR), sarco(endo)plasmic reticulum Ca2+- ATPase pump (SERCA1), titin protein (TTN), troponin (TNNT3), alpha actinin 1 (ACTN1), and Z-line associated protein (ZASP).

Study Questions

Two questions to be addressed in this study are: Is Huntington’s disease also associated with aberrant alternative splicing of multiple genes? Are different skeletal muscles similarly affected by aberrant alternative splicing of multiple genes?

Hypotheses

We hypothesized aberrant alternative splicing of multiple genes such as TTN,

INSR, SERCA1, TNNT3, ACTN1, and ZASP would occur in R6/2 muscles compared to

WT. We also hypothesized that different skeletal muscles would be differentially affected by aberrant alternative splicing of CLCN1, INSR, SERCA1, TTN, TNNT3, ACTN1, and

ZASP.

MATERIALS AND METHODS

Animal Model

The R6/2 [B6CBA-Tg(HDexon1)62Gbp/13 hemizygous] transgenic mouse model was used as a model system to study the influence of HD on muscle gene splicing. The

R6/2 mouse has the progressive phenotype associated with HD and expresses the expanded CAG trinucleotide repeat in exon 1 of the human huntingtin (HTT) gene observed in human HD patients and represents a model of early onset HD (Mangiarini et al., 1996). The R6/2 transgenic mouse is the most widely used animal model to study the pathogenesis of HD. R6/2 mice express a transgene which includes exon 1 of the human huntingtin gene containing approximately 150 CAG repeats (Mangiarini et al., 1996).

Specifically, R6/2 diseased mice are hemizygous for the transgene. Wild-type litter mates do not have the transgene and were used as controls. In the R6/2 diseased mice the transgene is expressed in skeletal muscle (Mangiarini et al., 1996). The mice used in this study ranged between 10 – 13 weeks of age, fully expressed the progressive phenotype of

HD and represent late-stage HD mice.

In order to analyze CLCN1, INSR, SERCA1, TTN, TNNT3, ACTN1, and ZASP gene splicing we obtained 12 HD and 12 WT tibialis anterior (TA) muscle samples, 6

HD and 7 WT pooled soleus (Sol) muscle samples, 5 HD and 5 WT diaphragm (Dia) muscle samples, and 3 HD and 3 WT interosseous (IO) muscle samples. Because of the small size of the mouse Sol (~10 mg), three Sol muscles were pooled together to generate one pooled sample. For example, 3 HD Sol muscles were pooled together to make

Sample A. Sample A accounted for one Sol sample overall.

The muscles were removed from euthenized mice in accordance with institutional animal care and use practices (Cal Poly Animal use protocol #13.017). Specifically, the mice were euthenized by exposure to a euthanizing dose of isoflurane followed by cervical dislocation. The muscles listed above were dissected from the mice, and frozen in liquid nitrogen. The frozen muscles were stored at -80° C until analyzed. The four different skeletal muscle samples used are of different fiber phenotypes and allow for an assessment of the influence of fiber phenotype on susceptibility to HD-pathology. The

TA is glycolytic and composed primarily of Type 2 or fast-twitch fibers (mostly Type

2b), and is used for dorsiflexion of the leg. The Sol is oxidative and is composed largely of Type 1 or slow-twitch fibers, and is used for plantar flexion (walking and running).

The Dia is highly oxidative and composed largely of Type 2 (mostly type 2x, with high amounts of type 1) fibers, and is a constantly active respiratoy muscle. The IO muscle is oxydative and composed primarily of Type 2 (mostly type 2a) fibers, and are useful for controlling the toes by adducting the digits.

Experimental Procedures

RNA Isolation

RNeasy Fibrous Tissue Mini Kits (Qiagen) were used to isolate RNA from each skeletal muscle sample. Each frozen muscle was placed in a 5 mL beaker and submerged into 300 µl of a cell lysis buffer. The samples were then minced with scissors. Then, 590

µl RNase free H2O and 10 µl Protenase K was added to each skeletal muscle sample. The samples were then homogenized and transferred to a centrifuge tube and incubated for 10 minutes at 55° F to digest myofibrillar protein components. The samples were then centrifuged at 10,000 RCF (g) for 10 minutes and the supernatant, containing RNA, was

22 transferred to a new centrifuge tube. Fifty µl of 100% ethanol was added to each tube and inverted. Afterwards, the samples were applied to a nucleic acid binding column and centrifuged for 27 seconds at 8,000 RCF (g). Both RNA and DNA bind to the column.

The flow through was discarded. A Wash Buffer (300 µl) was added to the column.

DNase was applied to each column and incubated for 10 minutes at room temperature to digest any DNA in the column. Again, Wash Buffer (350 µl) was added to each column and centrifuged for 27 seconds at 8,000 RCF (g). The flow-through was discarded and

RPE buffer (500 µl) was added to each column and centrifuged for 27 seconds at 8,000

RCF. The flow-through was discarded and then 500 µl of 80% ethanol was added to each column and centrifuged for 2 minutes at 8,000 RCF (g) and the flow-through was discarded. Then, 20 µl of RNase free water was added to each column and centrifuged for

1 minute at 22,000 RCF (g). The final step eluted the bound RNA from the column. The isolated RNA was stored frozen at -20°C.

RNA Quantification and Dilution

A 1:200 dilution of the isolated RNA was made using sterile filtered PBS by adding 597 µl of sterile filtered PBS and 3 µl of RNA to each corresponding tube sample.

A Bio-Ras SmartSpec 300 was used to read the A260 and A280 in order to assess the purity and concentration of RNA in each sample. Only samples with an A260 /A280 above 1.7 were used for analysis.

Splicing Analysis

In order to analyze splicing of CLCN1, TTN, INSR, SERCA1, TNNT3, ACTN1, and ZASP first cDNAs were synthesized with Superscript III reverse transcriptase

(Invitogen) using random primers. The PCR conditions for each gene mentioned above are noted in Table 1. To assess splicing patterns, PCR reactions were performed using specific primer pairs for each gene (Table 2).

Table 1. PCR conditions.

Gene Annealing Temperature Number of Cycles

CLCN1 52.0° C 30

INSR 60.0° C 32

SERCA1 52.0° C 27

TTN 52.0° C 27

TNNT3 52.0° C 27

ACTN1 52.0° C 27

ZASP 52.0° C 27

One µl of cDNA was added for each PCR reaction. See Table 1 for specific PCR conditions and Table 2 for primer sequences. Following PCR, the PCR products were separated using 2% Tris,borate,EDTA (TBE) agarose gels (CLCN1 and INSR) and 1.5%

TBE agarose gels (SERCA1, TTN, TNNT3, ACTN1, and ZASP). The gels were stained

24 with ethidium bromide and quantified using a FluorChem SP (Alpha Innotech) and UV- transilluminate, the splicing products were quantified in order to calculate the percentage of each splice variant.

Table 2. Primer Conditions

Exon Gene Primer Sequence (5’ – 3’) Inclusion/Exclusion F: GGAATACCTCACACTCAAGGCC CLCN1 Exon 7a R: CACGGAACACAAAGGCACTGAATGT F: CCTTCGAGGATTACCTGCAC INSR Exon 11 R: TGTGCTCCTCCTGACTTGTG F : GCTCATGGTCCTCAAGATCTCAC SERCA1 Exon 22 R: GGGTCAGTGCCTCAGCTTTG F: GTGTGAGTCGCTCCAGAAACG TTN Exon 5 and Exon 45 R: CCACCACAGGACCATGTTATTC F: TCTGACGAGGAAACTGAACAAG TNNT3 Fetal (F) Exon R: TGTCAATGAGGGCTTGGAG ACTN1 F: CGCCTCTTTCAACCACTTTG Exon SM and Exon R: TCATGATTCGGGCAAACTCT 19a F: GGAAGATGAGGCTGATGAGTGG ZASP Exon 10 and Exon 11 R: TGCTGACAGTGGTAGTGCTCTTTC

Genes of Interest

The genes for analysis were chosen based on previous data suggesting they are miss-spliced in DM, which shows some similarity to HD (Table 2).

Statistical Methods

HD and WT control samples were used and a two-tailed t-test was conducted to test for the significance between the graphs (the p-value was set at 0.05). Error bars were reported as standard error of mean.

RESULTS

Chloride Channel (CLCN1)

The TA muscle showed an elevation in aberrant alternative splicing as evidenced by an increase in exon 7a inclusion in late-stage R6/2 mice (Miranda et al., 2016). In this study, we found that the Sol and Dia from R6/2 mice did not show significant elevations in exon 7a inclusion, but the IO did (p < 0.05) in agreement with Waters et al. (2013)

(Figures 2 and 3).

Figure 2. Gel showing Clcn1 mRNA splicing that contains exon 7a (exon 7a+) and normal adult Clcn1 mRNA that lack exon 7a (exon 7a-) (A) Gel showing spliced Clcn1 mRNA in HD (n = 6) compared to WT (n = 7) Sol muscle (B) Gel showing spliced Clcn1 mRNA in HD (n = 5) compared to WT (n = 5) Dia muscle (C) Gel showing aberrantly spliced Clcn1 mRNA in HD (n = 3) compared to WT (n = 3) IO muscle.

A B

25.0 25.0

20.0 20.0

15.0 15.0

10.0 10.0 5.0 5.0 % Exon 7A Inclusion % Exon 7A Inclusion 0.0 0.0 WT HD WT HD

12.0 * 9.0

6.0

3.0 % Exon 7A Inclusion 0.0 WT HD

Figure 3. Expression of Clcn1 mRNA (A) Alternatively spliced Clcn1 mRNA expressed at a similar proportional level in HD (n = 6) compared to WT (n = 7) Sol skeletal muscle. (B) Alternatively spliced Clcn1 mRNA expressed at a similar proportional level in HD (n = 5) compared to WT (n = 5) Dia muscle (C) Aberrantly spliced Clcn1 mRNA expressed at a higher proportional level in HD (n = 3) compared to WT (n = 3) IO muscle. Error bars were reported as standard error of mean. *Significant difference of HD compared to WT muscle (p < 0.05)

Insulin Receptor (INSR)

The TA muscle showed an elevation in aberrant alternative splicing as evidenced by a decrease in IR-B in late-stage R6/2 mice (McKee, unpublished). In this study, we found that the Sol and Dia from R6/2 mice did not show a significant decrease in IR-B, but the IO did (p < 0.05) (Figures 4 and 5).

IR-B (exon 11+)

IR-A (exon 11-)

IR-B (exon 11+)

IR-A (exon 11-)

IR-B (exon 11+)

IR-A (exon 11-)

Figure 4. Gel showing INSR mRNA splicing that contains IR-B isoform (exon 11a+) and IR-A isoform (exon 11-) (A) Gel showing spliced INSR mRNA in HD (n =6) compared to WT (n = 7) Sol muscle (B) Gel showing spliced INSR mRNA in HD (n = 5) compared to WT (n = 5) Dia muscle (C) Gel showing aberrantly spliced INSR mRNA in HD (n = 3) compared to WT (n = 3) IO muscle.

A B

50.0 50.0 40.0 40.0 30.0 30.0 20.0 20.0 10.0 10.0 Relative mRNA abundance Relative mRNA Abundance 0.0 0.0 WT HD WT HD

60.0

45.0 *

30.0

15.0

Relative mRNA Abundance 0.0 WT HD

Figure 5. Expression of INSR mRNA (A) Alternatively spliced IR-B mRNA expressed at a similar proportional level in HD (n = 6) compared to WT (n = 7) Sol muscle. (B) Alternatively spliced IR-B mRNA expressed at a similar proportional level in HD (n = 5) compared to WT (n = 5) Dia muscle (C) Aberrantly spliced IR-B mRNA expressed at a higher proportional level in HD (n = 3) compared to WT (n = 3) IO muscle. Error bars were reported as standard error of mean. *Significant difference of HD compared to WT muscle (p < 0.05)

Sarco(endo)plasmic reticulum Ca2+-ATPase Pump (SERCA1)

In this study, we also found that the TA, Sol, and Dia from R6/2 mice showed

100% inclusion of SERCA1a (exon 22+), but no significant elevations in SERCA1a when compared to WT (Figure 6). Interestingly, the IO from R6/2 mice showed 100% exclusion of SERCA1b (exon 22-), but did not show significant differences when compared to WT (Figure 6).

SERCA1a (Exon 22+)

SERCA1b (Exon 22-)

Figure 6. Gel showing SERCA1 mRNA splicing isoforms with exon 22 inclusion (SERCA1a) and exon 22 (SERCA1b) exclusion (A) Gel showing 100% inclusion, SERCA1a, in HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing 100% inclusion, SERCA1a, in HD (n = 6) compared to WT (n = 7) Sol muscle (C) Gel showing 100% inclusion, SERCA1a, in HD (n = 5) compared to WT (n = 5) Dia muscle (D) Gel showing 100% exclusion, SERCA1b, in HD (n = 3) compared to WT (n = 3) IO muscle.

Titin (TTN)

In this study, the TA muscle showed significant elevations in TTN-L (exon 5+ and exon 45+) in late-stage R6/2 mice (p < 0.001) (Figures 7 and 8). Also, the Sol of

R6/2 mice showed 100% inclusion of TTN-L, but no significant differences when compared to WT (Figure 7). We also found that the Dia and IO from R6/2 mice did not show a significant difference for TTN-L when compared to WT (Figures 8).

TTN-L (Exon 5+, 45+)

TTN-M (Exon 5+, 45-)

TTN-S (Exon 5-, 45+)

TTN-L (Exon 5+, 45+)

TTN-S (Exon 5-, 45+)

TTN-L (Exon 5+, 45+)

TTN-S (Exon 5-, 45+)

Figure 7. Gel showing TTN mRNA splicing (A) Gel showing three spliced variants for TTN mRNA in HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing TTN-L 100% inclusion in HD ( (n = 6) compared to WT (n = 7) Sol muscle (C) Gel showing two spliced TTN mRNA in HD (n = 5) compared to WT (n = 5) Dia muscle (D) Gel showing two spliced variants for TTN mRNA in HD (n = 3) compared to WT (n = 3) IO muscle.

A B

75.0 100.0 * 60.0 80.0

45.0 60.0

30.0 40.0

15.0 20.0 Relative mRNA Abundance

Relative mRNA Abundance 0.0 0.0 WT HD WT HD

100.0

80.0

60.0

40.0

20.0

Relative mRNA Abundance 0.0 WT HD

Figure 8. Expression of TTN mRNA (A) Aberrantly spliced TTN-L mRNA expressed at a higher proportional level in HD (n = 12) compared to WT (n = 12) TA muscle. (B) Alternatively spliced TTN-L mRNA expressed at a similar proportional level in HD (n = 5) compared to WT (n = 5) Dia muscle (C) Alternatively spliced TTN-L mRNA expressed at a similar proportional level in HD (n = 3) compared to WT (n = 3) IO muscle. Error bars were reported as standard error of mean. *Significant difference of HD compared to WT muscle (p < 0.05)

Troponin T3 (TNNT3)

In this study, we found that the TA, Sol, Dia, and IO from R6/2 mice showed

100% exclusion of Fetal exon for TNNT3, but did not show a significant difference when compared to WT mice (Figure 9).

TNNT3 (Fetal Exon -)

Figure 9. Gel showing spliced TNNT3 mRNA (A) Gel showing 100% exclusion of Fetal exon in HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing 100% exclusion Fetal exon in HD ( (n = 6) compared to WT (n = 7) Sol muscle (C) Gel showing 100% exclusion of Fetal exon in HD (n = 5) compared to WT (n = 5) Dia muscle (D) Gel showing 100% exclusion of Fetal exon in HD (n = 3) compared to WT (n = 3) IO muscle.

Alpha Actinin 1 (ACTN1)

In this study, we found that the TA, Dia, and IO showed 100% exclusion of exon

SM and inclusion of exon 19 (Figure 10). The Sol showed two spliced variants for

ACTN1 (Figure 11). The TA, Sol, Dia, and IO from R6/2 mice did not show significant differences when compared to WT mice (Figures 10 and 11).

ACTN1-S

(Exon SM-, 19a+)

ACTN1-L (Exon SM+, 19a+)

ACTN1-S (Exon SM-, 19a+)

Figure 10. Gel showing spliced ACTN1 mRNA (A) Gel showing 100% exclusion of SM and 100% inclusion of exon 19 in HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing two spliced variants of ACTN1 mRNA splicing in HD ( (n = 6) compared to WT (n = 7) Sol muscle (C) Gel showing 100% exclusion of SM and 100% inclusion of exon 19 in HD (n = 5) compared to WT (n = 5) Dia muscle (D) Gel showing 100% exclusion of SM and 100% inclusion of exon 19 in HD (n = 3) compared to WT (n = 3) IO muscle.

30.0

20.0

10.0

Relative mRNA Abundance 0.0 WT HD

Figure 11. Expression of ACTN1 mRNA splicing. ACTN1 mRNA splicing showing the expression of ACTN1-S in HD (n=3) was expressed at similar proportional levels when compared to WT (n=2) Sol muscle.

Z-line associated protein (ZASP)

In this study, we found that the TA and IO showed 100% exclusion of exon 10 and exon 11 (Figure 12). The Sol showed two spliced variants of ZASP, while Dia showed three spliced variants of ZASP (Figure 12). The TA, Sol, Dia, and IO from R6/2 mice did not show significant differences when compared to WT mice (Figure 13).

ZASP-S (Exon 10-, 11-)

ZASP-L (Exon 10+, 11+)

ZASP-S (Exon 10-, 11-)

ZASP-L (Exon 10+, 11+) ZASP-M (Exon 10-, 11+)

ZASP-S (Exon 10-, 11-)

Figure 12. Gel showing ZASP mRNA splicing (A) Gel showing 100% exclusion of exon 10 and exon 11 in HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing two spliced variants of ZASP mRNA splicing in HD (n = 2) compared to WT (n = 2) Sol muscle (C) Gel showing three spliced variants of ZASP mRNA splicing in HD (n = 5) compared to WT (n = 5) Dia muscle (D) Gel showing 100% exclusion of exon 10 and exon 11 in HD (n = 3) compared to WT (n = 3) IO muscle.

A B

20.0 12.0

15.0 9.0

10.0 6.0

5.0 3.0

Relative mRNA Abundance 0.0 Relative mRNA Abundance 0.0 WT HD WT HD

Figure 13. Expression of ZASP mRNA. (A) ZASP-L mRNA expressed at similar level in HD (n = 2) compared to WT (n = 2) Sol muscle. (B) ZASP-L mRNA expressed at a similar proportional level in HD (n = 5) compared to WT (n = 5) Dia muscle.

DISCUSSION

The main objective of this study was to determine if Huntington’s disease (HD) is associated with aberrant alternative splicing of multiple genes. Previous studies from our lab showed defects in skeletal muscle chloride channel expression were in part due to aberrant alternative processing of Clcn1 mRNA (Waters et al., 2014). In R6/2 transgenic mice, the level of Clcn1+7a (exon7a inclusion) was elevated (Waters et al., 2013; Charlet et al., 2002). Miranda et al. (2016) also found an increase in the level of Clcn1+7a in TA

R6/2 transgenic mice, indicating an increase in aberrant alternative splicing of Clcn1 mRNA (Table 3). As a result muscle defects developed in R6/2 transgenic mice. In this study, we also found an increase in the level of Clcn1+7a in the IO of R6/2 mice relative to WT (Table 3).

In young WT mice the level of Clcn1+7a is normally high, representing a normal early developmental splicing pattern, and as WT mice age and undergo normal skeletal muscle maturation, the level of Clcn1+7a decreases (Charlet et al., 2002; Miranda et al.,

2016). In contrast, in the R6/2 HD transgenic mice, the level of Clcn1+7a remains high.

This implies that the embryonic splicing pattern was maintained in HD mice during maturation suggesting that the HD mice may have defects in normal muscle maturation.

Other studies have shown that aberrant alternative splicing may be due to mutated huntingtin mRNA with expanded trinucleotide repeats, sequestering muscleblind-like proteins (MBNL), which play an important role in the adult splicing pattern of Clcn1 mRNA (Lin et al., 2006). For example, the expressed mRNAs from the expanded CTG repeats of myotonic dystrophy (DM) patients bind to muscleblind proteins affecting their

RNA splicing ability (Ranum and Cooper, 2006). Muscleblind family members include

MBNL1, MBNL2, and MBNL3. Konieczny et al. (2014) stated that muscleblind family members “share structural similarities including four zinc-finger (ZnF) domains critical for recognizing a common consensus sequence in pre-mRNA and mRNA targets.” Since transgenic mice with disrupted expression of MBNL genes also show miss-regulation of

Clcn1 splicing including elevated exon 7a inclusion (Hao et al., 2007) the elevation in

Clcn1 exon 7a inclusion in HD mice could also be due to the trinucleotide repeat expansion in the huntingtin gene sequestering MBNL proteins. Thus, two possible mechanisms could cause the elevation in Clcn1 exon 7a inclusion with HD: 1) defective muscle maturation and 2) MBNL protein sequestration by expanded trinucleotide repeats.

Table 3. Summary of Aberrant Alternative Splicing.

CLCN1 INSR SERCA1 TTN TNNT3 ACTN1 ZASP

TA p<0.05* p<0.05# NS p<0.001 NS NS NS

SOL NS NS NS NS NS NS NS

DIA NS NS NS NS NS NS NS

IO p<0.05 p<0.05 NS p=0.0774 NS NS NS

*Miranda et al. (2016) NS: Non-Significant # McKee et al. (unpublished)

Since Mbnl2 was found to be involved in alternative splicing of the insulin receptor (IR) (Ho et al., 2004), our lab studied the impact of HD on IR mRNA splicing.

McKee et al. (unpublished data) found an increase in the level of the insulin receptor IR-

A isoform (exon 11-) and a decrease in the IR-B isoform (exon 11+) of TA of R6/2 transgenic mice compared to WT (Table 3). Similarly, in this study, we found a relative increase in the level of the insulin receptor IR-A isoform and a decrease in the IR-B isoform in the IO of R6/2 transgenic mice compared to WT. The IR-A isoform predominates in embryonic tissue and the IR-B isoform is highty expressed in adult skeletal muscle, liver, and adipose tissues. This data suggests that an increase in aberrant alternative splicing of INSR mRNA may be linked to defective Mbnl2 function. However, as IR-A isoform is highly expressed in embryonic tissues, a role for defective maturation cannot be ruled out.

Interestingly, we found no significant differences in aberrantly spliced CLCN1 and INSR mRNAs in the Dia or Sol of R6/2 relative to WT. The Sol and Dia, unlike the

TA and IO skeletal muscles, have high proportions of slow type 1 fibers. Our data suggests that the difference in muscle fiber composition may play an important role in the extent of aberrant alternative splicing of various genes in HD mice. It would be interesting to assesss the MBNL expression levels in Fast vs. Slow musles during development and in adult mice and humans.

The Hao et al. (2007) study on Mbnl2 deficient mice also found no significant impact on the splicing of ZASP, SERCA1, and m-TTN mRNA compared to WT in the fast vastus muscle. We also examined ZASP, SERCA1, TNNT3, and TTN mRNA splicing in the TA and IO muscles and found similar results. These two skeletal muscles,

48 like the vastus skeletal muscle, are also fast-twitch glycolytic (Type 2). We found no significant differences in aberrantly spliced TTN mRNA in the IO muscle of R6/2 transgenic mice, but did find a significant difference in aberrantly spliced TTN in the TA of R6/2 transgenic mice. The differences in our study and the Hao et al. (2007) study could be explained by muscle specificity unrelated to fiber type or perhaps the disruptions in splicing are mainly due to maturational deficiencies, and not a simple disruption in MBNL2 function.

We found no disruptions in gene splicing for ZASP, SERCA1, and TNNT3 in either the TA or the IO in R6/2 mice. Curiously, while all other muscles expressed the

SERCA1a (adult) isoform (exon 22+) the IO in WT and R6/2 mice expressed the

SERCA1b (developmental) isoform (exon 22-). This suggests that the IO undergoes an altered maturation process compared to other skeletal muscles.

The Dia and Sol were also analyzed for ZASP, SERCA1, TTN, and TNNT3 splicing to see if there were any differences between muscles of varying fiber type composition. No differences in mRNA splicing were observed for any of these genes in these muscles.

Finally, the TA, IO, Sol, and Dia were examined for ACTN1 splicing. No differences in splicing were observed for any of the muscles examined.

CONCLUSION

Two possible mechanisms could cause aberrant splicing patterns in HD. One possible mechanism involves defects in normal muscle maturation of R6/2 HD transgenic mice. Previous studies, using TA, and in our studies, using IO, the high levels of

Clcn1+7a (inclusion) implies that the embryonic splicing pattern was maintained in HD mice during muscle maturation. Secondly, the mutated huntingtin mRNA may be caused by expanded trinucleotide repeats sequestering muscleblind-like proteins, which lead to functional disturbance and subsequent aberrant alternative splicing. Also, late-stage R6/2 mice express elevated level of developmental myosin heavy chain isoforms suggesting a disruption in muscle maturation (Miranda et al., 2016). Thus, the disruptions in splicing may be due to maturational deficiencies, and not a simple disruption in muscleblind-like protein function.

We conclude that the effect of HD on aberrant alternative splicing seems to be muscle specific. The faster muscles (TA and IO) showed a higher degree of significant difference between R6/2 HD transgenic mice and WT mice. The data implies that faster muscles show a greater number of genes, at least the ones we looked at, that show aberrant alternative splicing.

FUTURE STUDIES

The next steps from this study would be to examine other RNA binding proteins, such as CUG-BP, to help us understand its role of aberrant alternative splicing in HD.

CUG-BP plays an important role in regulating various steps in RNA processing in the nucleus and cytoplasm, such as pre-mRNA alternative splicing, C to U RNA editing, deadenylation, mRNA decay, and translation (Dasgupta and Ladd, 2012). In addition, more research will need to be conducted to better understand the extent of aberrant altervative splicing of various genes of different skeletal muscle types.

Moreover, much research has been conducted in regards to the effects of mutant huntingtin aggregates on nucleus of neurons, however, research lacks in studying the effects of huntingtin aggregates in the nucleus of HD skeletal muscle cells. It has been shown that huntingtin aggregates in the nucleus disrupt the normal function of neurons, causing cell cycle re-entry and neuronal cell death (Liu et al., 2015). It is unknown how mutant huntingtin aggregates in the nucleus of muscle cells contribute to skeletal muscle atrophy in HD (Zielonka et al., 2014). Atrophy is described as the degeneration of muscle fibers. Also, it is uncertain whether mutant huntingtin aggregates in skeletal muscle nuclei affect aberrant alternative splicing of various genes important for normal skeletal muscle function. Understanding these underlying mechanisms will help us slow or halt the progression of HD by discovering better treatments.

REFERENCES

Amsili, S., Zer, H., Hinderlich, S., Krause, S., Becker-Cohen, M., et al. (2008). UDP-N- acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE) binds to alpha-actinin 1: novel pathways in skeletal muscle? PLoS One. 3(6):e2477

Atwal, R.S., Xiz, J., Pinchev, D., Taylor, J., Epand, R. M., & Truant, R. (2007). Huntingtin has a membrane association signal that can modulate huntingtin aggregation, nuclear entry and toxicity. Hum Mol Genet. 16(21), 2600-15

Bano, D., Zanetti, D., Mende, Y., Nicotera, P. (2011). Neurodegenerative processes in Huntington’s disease. Cell Death and Disease. 1-7.

Bates, G.P. (2015). Huntington’s Disease. Nature Reviews: Disease Primers. 1: 1-21

Bates, G.P. (2005). The molecular genetics of Huntington disease – a history. History of Genetic Disease.

Bates, G.P., Tabrizi, S. J., Jones, L. (2014). Huntington’s Disease. Oxford University Press. 4th Edition.

Bota, A., Malena, A., Loro, E., Del Moro, G., Suman, M., et al. (2013). Altered Ca2+ Homeostasis and Endoplasmic Reticulum Stress in Myotonic Dystrophy Type 1 Muscle Cells. Genes. 4(2), 275-292

Brook, J.D., McCurrach, M.E., Harley, H.G., et al. (1992). Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3-prime end of a transcript encoding a protein kinase family member. Cell. 68:799-808.

Brouillet, E., Hantraye, P., Ferrente, R.J., Dolan, R., Leroy-Willig, A., et al. (1995). Chronic mitochondrial energy impairment produces selective striatal degeneration and abnormal choreiform movements in primates. Proc. Natl Acad. Sci. USA 92:7105-7109

Carter, R.J., Lione, L.A., Humby, T., Mangiarini, L., Mahal, A., Bates, G.P., et al. (1999). Characterization of progressive motor deficits in mice transgenic for the human huntington’s disease mutation. The Journal of Neuroscience. 19(8)3248- 3257. Charlet-B, N., Savkur, R. S., Singh, G., Philips, A. V., Grice, E. A., & Cooper, T. A (2002). Loss of the muscle-specific chloride channel in type 1 myotonic dystrophy due to misregulated alternative splicing. Mol Cell. 10(1):45-53.

Cloud, L., Rosenblatt, A,, Margolis, R,, et al. (2012). Seizures in juvenile Huntington’s disease: frequency and characterization in the multicenter cohort. Mov Disord. 27:1797-1800

Cowan, C.M., Fan, M.M., Fan, J., Shehadeh, J., Zhang, L.Y., Graham, R.K., et al. (2008). Polyglutamine-modulated striatal calpain activity in YAC transgenic huntington disease mouse model: impact on NMDA receptor function and toxicity. J Neurosci. 28:12725–12735

Dasgupta, T., & Ladd, A.N. (2012), The importance of CELF control: molecular and biological roles of the CUG-BP, Elav-like family of RNA-binding protein. Wiley Interdiscip. Rev. RNA. 3,104–121

Dzialowski, E.M. (2016). Sarcomere. Unpublished lecture, Department of Biological Sciences, University of North Texas, Texas, USA.

Duyao, M., et al. (1993). Trinucleotide repeat length instability and age of onset in Huntington’s disease. Nature Genet. 4, 387–392

Faber, P.W., Alter, J.R., MacDonald, M.E., et al. (1999). Polyglutamine-mediated dysfunction and apoptotic death of Caenorhabditis elegans sensory neuron. Proc. Natl Acad. Sci. USA 96, 179-184

Fernandes, V.S., Santos, J.R., et al. (2016) Repeated treatment with a low dose of reserpine as a progressive model for Parkinson’s disease. 231(1):154-63

Fu, Y.H., Pizzuti, A., Fenwich, R.G. Jr., King J., Rajnarayan, S., et al. (1992). An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science. 255(5049):1256-8.

Gharehbaghi-Schnell, E,B., Finsterer, J., Korschineck, I., et al. (1998). Genotype- phenotype correlation in myotonic dystrophy. Clin Genet. 53:20-6.

Gipson, T.A, Andreas, N., Wexler, N.S., et al. (2013). Aberrantly spliced HTT, a new player in Huntington’s disease pathogenesis. RNA Biol. 10(11):1647-1652

Griggs, R., Vihola, A., Hackman, P., Talvinen, K., Haravuori, H., Faulkner, G., Eymard, B., Richard, I., Selcen, D., Engel, A., Carpen, O., Udd, B. (2007). Zaspopathy in a large classic late-onset distal myophathy family. Brain. 130(Pt 6): 1477-84

Hackman, P., Vihola, A., Haravuori, H., Marchand, S., Sarparanta, J., et al. (2002). Tibial Muscular Dystrophy is a Titinophathy Caused by Mutations in TTN, the Gene Encoding the Giant Skeletal-Muscle Protein Titin. Am. J. Hum. Genet. 71, 492- 500

Haddad, M. S., & Cummings, J.L. (1997). Huntington’s Disease. Psychiatr Clin North Am. 20(4):791-807

Hamshere, M.G., Harley, H., Harper, P., et al. (1999). Myotonic dystrophy: the correlation of (CTG) repeat length in leucocytes in age at onset is significant only for patients with small expansions. J Med Genet. 36:59-61.

Harper PS. (2001). Myotonic dystrophy. 3rd edition. London: Saunders

Harris, S., Moncrieff, C., Johnson, K. (1996). Myotonic dystrophy; will the real gene please step forward! Hum Mol Genet. 5 Spec No:1417-23.

Hao, M., Akrami, K., Wei, K., de Diego, C., Che, N., Ku, J.-H., Tidball, J., Graves, M.C., Shieh, P.B., & Chen F. (2007) Muscleblind-like 2 (Mbnl2) – Deficient Mice as a Model for Myotonic Dystrophy. Developmental Dynamics. 237:403-410

Heiser, V. et al. (2002). Identification of benzothiazoles as potential polyglutamine aggregation inhibitors of Huntington’s disease by using an automated filter retardation assay. Proc. Natil Acad. Sci. USA. 99:16440-16406

Hino, S.-H., Kondo, S., Sekiya, H., Saito, A., et al. (2007). Molecular mechanisms responsible for aberrant splicing of SERCA1 in myotonic dystrophy type 1. Human Molecular Genetics. Vol 16. No 23.

Ho, L.W. et al. (2001) The molecular biology of Huntington’s disease. Psychol. Med. 31, 3–14

Ho, T.H., Charlet, B.N., Poulos, M.G., Singh, G., Swanson, M.S., Cooper, T.A. (2004). Muscleblind proteins regulate alternative splicing. EMBO J. 23:3103–3112

Hopkins, P.M. (2006). Skeletal muscle physiology. Contin Educ Anaesth Crit Care Pain. 6 (1): 1-6

Huntington, G. (1872). On chorea. Medical and Surgical Reporter. 26:320-321

Huntington’s Disease Collaborative Research Group (1993). A novel gene containing a trinucleotide repeat that is unstable on Huntington’s disease chromosomes. Cell. 72, 971-983

Huntington’s Disease Medication. (2015). Retrieved from www. Emedicine.medscape.com/article/1150165-medication

Huntington’s Disease Society of America. (2016). Retrieved from http://hdsa.org

Jakovcevski, M., & Akbarian, S. (2012). Epigenetic mechanisms in neurodevelopmental and neurodegenerative disease. Nat Med. (18)1194-1204

Ju, Y., Li, J., Xie, C., Ritchlin, C.T., Xing, L., Hilton, M.J., & Schwarz, E.M. (2013). Troponin T3 expression in skeletal and smooth muscle is required for growth and postnatal survival: characterization of Tnnt3(tm2a(KOMP)Wsi) mice. Genesis. 51(9):667-75

Kaltenbach, L.S., et al. (2007). Huntingtin interacting proteins are genetic modifiers of neurodegeneration. PLoS Genet. 3, e82

Kimura, T., Nakamori, M., Lueck, J.D., Pouliquin, P., Aoike, F., et al. (2005). Altered mRNA splicing of the skeletal muscle ryanodine receptor and sarcoplasmic/endoplasmic reticulum CA2+- ATPase in myotonic dystrophy type 1. Hum Mol Genet. 14(15):2189-200

Kirkwood, S.C, Su, J.L., Conneally, P.M., Foroud, T. (2001). Progression of Symptoms in the early and Middle Stages of Huntington’s Disease. Archives of Neurobiology. 58(2):273-8

Konieczny, P., Stepniak-Konieczna, E., & Sobczak, K. (2014). MBNL proteins and their target RNAs, interaction adn splicing regulation. Nucleic Acids Research. 1: 1-15 doi: 10.1093/narlgku767

Li, H., Li, S.H., Yu, A.X., Shelbourne, P., & Li, X.J. (2001). Huntingtin Aggregate- Associated Axonal Degeneration is an Early Pathological Even in Huntington’s Disease Mice. The Journal of Neuroscience. 21(21):8473-8481

Lin X., Ruiz J., Bajraktari I., Ohman R., Banerjee S., Gribble K., Kaufman JD., et al. (2014). Z-disc-associated, Alternatively Spliced, PDZ Motif-containing Protein (ZASP) Mutations in teh Actin-binding Domain Cause Disruption of Skeletal Muscle Actin Filaments in Myofibrillar Myopathy. The Journal Of Biological Chemistry. 289, 13615-13626

Lin, X., Miller, J.W., Mankodi, A., Kanadia, R.N., Yuan, Y., Moxley, R.T., Swanson, M.S., & Thornton, C.A. (2006). Failure of MBNL1-dependent post-natal splicing transitions in myotonic dystrophy. Hum Mol Genet. 15, 2087-2097

Liu, K.Y., Shyu, Y.C., Barbaro, B.A., Lin, Y.T., Chern, Y., Thompson, L.M., et al. (2015). Disruption of the nuclear membrane by perinuclear inclusions of mutant huntingtin causes cell-cycle re-entry and striatal cell death in mouse and cell models of Huntington’s disease. Hum Mol Genet. 15;24(6):1602-16

Louis, E.D., Lee, P., Quinn, L., Marder, K. (1999). Dystonia in Huntington's disease: prevalence and clinical characteristics. Mov Disord.14(1):95-101

Lundbeck. (2015). Xenazine. Deerfield, IL.

Mahadevan, M., Tsilfidis, C., Sabourin, L., Shutler, G., Amemiya, C., et al. (1992). Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated region of the gene. Science. 255(5049):1253-5

Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., et al. (1996). Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell. (87) 493–506

Marshall, F.J. (2004). Clinical Features and Treatments of Huntington’s Disease. Clinical Disorders. Chapter 35.

Martorell, L., Monchkton, D.G., Sanchez, A., et al. (2001). Frequency and stability of the myotonic dystrophy type 1 premutation. Neurology. 56:328-35

Mayo Clinic. (2015). Retrieved from www.mayoclinic.org/diseases- conditions/huntingtons-disease/basics/treatment/con-20030685

Miller, J.P., et al. (2010). Matrix metalloproteinases are modifiers o huntingtin proteolysis and toxicity in Huntingon’s disease. Neuron. 67, 199-212

Murphy, A.C.H., & Young, P.W. (2015). The actinin family of acting cross-linking proteins – a genetic perspective. Cell and Bioscience. 5:49 DOI: 10.1186/s13578- 015-0029-7

Nasir, J., Floresco, S.B., O’Kusky, J.R., Diewet, V.M., Richman, J.M., Zeisier, J., et al. (1995). Targeted distruption of the Huntington’s disease gene results in embryonic lethality and behavioral and morphological chnages in heterozygotes. Cell. 81:811-823

Ortega, Z., & Lucas, J.J. (2014). Ubiquitin-proteosome system involvement in Huntington’s disease. Frontiers in Molecular Neuroscience. 1-11

Parkinson’s Disease Foundation. (2016). Retrieved from pdf.org/en/symptoms

Punnett, R. C. (1908). Mendelian inheritance in man. Proc. Nat. Hist. Soc. Med. 1, 135 – 168

Quarrell, O., O’Donovan, K.L., Strong, M., & Bandmann, O. (2012). The prevalence of juvenile Huntington’s disease: a review of the literature and meta-analysis. PloS Curr. 4:e4f8606b742ef3

Ranum, L.P., & Cooper, T.A. (2006). RNA-mediated neuromuscular disorders. Annu Rev Neurosci. 29:259–277

Ribai, P., Nguyen, K., Hahn-Barma, V., Gourfinkel-An, I., Vidailhet, M., Legout, A, et al. (2007). Psychiatric and cognitive difficulties as indicators of juvenile huntington disease onset in 29 patients. Arch Neurol. 64, 813-819

Rubinsztein, D.C. (2002). Lessons from animal models o Huntington’s disease. TRENDS in Genetics. Vol. 18 No.4 Santoro, M., Masciullo, M., Bonvissuto, D., Bianchi, M.L., Michetti, F., & Silvestri, G. (2013). Alternative splicing of human insulin receptor gene (INSR) in type I and type II skeletal muscle fibers of patients with myotonic dystrophy type 1 and type 2. Mol Cell Biochem. 380(1-2):259-65

Siesling, S., Vegter-van der Vlix, M., & Roos, R.A. (1997). Juvenile Huntington’s disease in the Netherlands. Pediatr Neurol.17:37 – 45

Skarnes, W.C., von Melchner, H., Wurst, W., Hicks, G., Nord, A.S., Cox, T., et al. (2004). A public gene trap resource for mouse functional genomics. Nat Genet. 36:543–544

Snell, R.G., MacMillan, J. C., Cheadle, J. P., Fenton, I., Lazarou, L. P., Davies, P., et al. (1993). Relationship between trinucleotide repeat expansion and phenotypic variation in Huntington’s disease. Nat Genet. 4:393-397

Steffan, J.S., et al. (2001). Histone deacetylase inhibitors arrest polyglutamine-dependent neurodegeneration in Drosophila. Nature. 413, 739-743

Steffan, J.S., et al. (2004). SUMO modification of Huntingtin and Huntington’s disease pathology. Science. 304, 100-104

Storey, E., & Beal M.F. (1993). Neurochemical substrates of rigidity and chorea in huntington’s disease. Brain. 116 (Pt 5):1201-22

Stryke, D., Kawamoto, M., Huang, C.C., Johns, S.J., King, L.A., Harper, C.A., Meng, E.C., Lee, R.E., Yee, A., et al. (2003). BayGenomics: a resource of insertional mutations in mouse embryonic stem cells. Nucleic Acids Res. 31:278–281

Suzuki, H., Takeuchi, M., Sugiyama, A., et al. (2012). Alternative splicing produces structural and functional changes in CUGBP2. BMC Biochemistry. 13:6

Turner, C., & Hilton-Jones, D. (2010). The myotonic dystrophies: diagnosis and management. J Neurol Neurosurg Psychiatry. 81:358-367. Doi:10.1136/jnnp.2008.158261

Vonsattel, J.P., & DiFiglia, M. (1998) Huntington disease. J. Neuropathol. Exp. Neurol. 57, 369–384

Waters, C.W., Varuzhanyan, G.; Talmadge, R.J., & Voss, A.A. (2013). Hutington disease skeletal muscle in hyperxcitable owing to chloride and potassium channel dysfunction. PNAS. 110 (22) 9160-9165

Wang, K., McCarter, R., Wright, J., Beverly, J., & Ramirez-Mitchell R. (1991). Regulation of skeletal muscle stiffness and elasticity by titin isoforms: A test of the segmental extension model of resting tension. Proc. Natl. Acad. Sci. USA. 88, 7101-7105

Zhao, Y., Ogawa, H. Yonekura, S., Mitsuhashi, H., Mitsuhashi, S., Nishino, I., et al. (2015). Functional analysis of SERCA1b, a highly expresed SERCA1 variant in myotonic dystrophy type 1 muscle. Biochim Biophys Acta. 1852(10 Pt A): 2042-7

Zakzanis, K.K. (1998). The subcortical dementia of Huntington’s disease. J. Clin. Exp. Neuropsychol. 20(4):565-78

Zeitlin, S., Liu, J.P., Chapman, D.L., Papaioannou, V.E., & Efstratiadis, A. (1995). Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington’s disease gene homologue. Nat Genet. 11:155-163

Zielonka, D., Piotrowska, I., Marcinkowski, J.T., & Mielcarek, M. (2014). Skeletal muscle pathology in Huntington’s disease. Frontiers in Physiology. Volume 5. Article 380: 1 – 5