Birke-Javelle-BJ-2016-Prestin-And-The-Good
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. - 
												
												Activity-Dependent Regulation of Prestin Expression in Mouse Outer Hair Cells
J Neurophysiol 113: 3531–3542, 2015. First published March 25, 2015; doi:10.1152/jn.00869.2014. Activity-dependent regulation of prestin expression in mouse outer hair cells Yohan Song, Anping Xia, Hee Yoon Lee, Rosalie Wang, Anthony J. Ricci, and John S. Oghalai Department of Otolaryngology-Head and Neck Surgery, Stanford University, Stanford, California Submitted 4 November 2014; accepted in final form 19 March 2015 Song Y, Xia A, Lee HY, Wang R, Ricci AJ, Oghalai JS. patch-clamp recording conditions (Kakehata and Santos-Sac- Activity-dependent regulation of prestin expression in mouse outer chi, 1995 and 1996; Santos-Sacchi 1991; Santos-Sacchi et al. hair cells. J Neurophysiol 113: 3531–3542, 2015. First published 1998a). Thus, measuring the NLC is a common way of assess- March 25, 2015; doi:10.1152/jn.00869.2014.—Prestin is a membrane protein necessary for outer hair cell (OHC) electromotility and normal ing the amount of functional prestin within an OHC (Abe et al. 2007; Oliver and Fakler 1999;). hearing. Its regulatory mechanisms are unknown. Several mouse Downloaded from models of hearing loss demonstrate increased prestin, inspiring us to There are many ways to modulate the voltage dependence of investigate how hearing loss might feedback onto OHCs. To test force production by prestin protein within the plasma mem- whether centrally mediated feedback regulates prestin, we developed brane, such as changing the surrounding lipid environment, a novel model of inner hair cell loss. Injection of diphtheria toxin (DT) intracellular Ca2ϩ level, membrane tension, membrane poten- into adult CBA mice produced significant loss of inner hair cells tial, and ionic composition of the intracellular and extracellular without affecting OHCs. - 
												
												2.1 Drosophila Melanogaster
Overend, Gayle (2010) Drosophila as a model for the Anopheles Malpighian tubule. PhD thesis, University of Glasgow. http://theses.gla.ac.uk/1604/ Copyright and moral rights for this thesis are retained by the author A copy can be downloaded for personal non-commercial research or study, without prior permission or charge This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the Author The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the Author When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given Glasgow Theses Service http://theses.gla.ac.uk/ [email protected] Drosophila as a model for the Anopheles Malpighian tubule A thesis submitted for the degree of Doctor of Philosophy at the University of Glasgow Gayle Overend Integrative and Systems Biology Faculty of Biomedical and Life Sciences University of Glasgow Glasgow G11 6NU UK August 2009 2 The research reported within this thesis is my own work except where otherwise stated, and has not been submitted for any other degree. Gayle Overend 3 Abstract The insect Malpighian tubule is involved in osmoregulation, detoxification and immune function, physiological processes which are essential for insect development and survival. As the Malpighian tubules contain many ion channels and transporters, they could be an effective tissue for targeting with novel pesticides to control populations of Diptera. Many of the insecticide compounds used to control insect pest species are no longer suited to their task, and so new means of control must be found. - 
												
												Proteomics Analysis of Colon Cancer Progression
Saleem et al. Clin Proteom (2019) 16:44 https://doi.org/10.1186/s12014-019-9264-y Clinical Proteomics RESEARCH Open Access Proteomics analysis of colon cancer progression Saira Saleem1* , Sahrish Tariq1, Ifat Aleem1, Sadr‑ul Shaheed2, Muhammad Tahseen3, Aribah Atiq3, Sadia Hassan4, Muhammad Abu Bakar5, Shahid Khattak6, Aamir Ali Syed6, Asad Hayat Ahmad3, Mudassar Hussain3, Muhammed Aasim Yusuf7 and Chris Sutton2 Abstract Background: The aim of this pilot study was to identify proteins associated with advancement of colon cancer (CC). Methods: A quantitative proteomics approach was used to determine the global changes in the proteome of pri‑ mary colon cancer from patients with non‑cancer normal colon (NC), non‑adenomatous colon polyp (NAP), non‑met‑ astatic tumor (CC NM) and metastatic tumor (CC M) tissues, to identify up‑ and down‑regulated proteins. Total protein was extracted from each biopsy, trypsin‑digested, iTRAQ‑labeled and the resulting peptides separated using strong cation exchange (SCX) and reverse‑phase (RP) chromatography on‑line to electrospray ionization mass spectrometry (ESI‑MS). Results: Database searching of the MS/MS data resulted in the identifcation of 2777 proteins which were clustered into groups associated with disease progression. Proteins which were changed in all disease stages including benign, and hence indicative of the earliest molecular perturbations, were strongly associated with spliceosomal activity, cell cycle division, and stromal and cytoskeleton disruption refecting increased proliferation and expansion into the surrounding healthy tissue. Those proteins changed in cancer stages but not in benign, were linked to infammation/ immune response, loss of cell adhesion, mitochondrial function and autophagy, demonstrating early evidence of cells within the nutrient‑poor solid mass either undergoing cell death or adjusting for survival. - 
												
												Unraveling the Functional Role of the Orphan Solute Carrier, SLC22A24 in the Transport of Steroid Conjugates Through Metabolomic and Genome-Wide Association Studies
RESEARCH ARTICLE Unraveling the functional role of the orphan solute carrier, SLC22A24 in the transport of steroid conjugates through metabolomic and genome-wide association studies 1☯ 1☯ 1 1 2 Sook Wah Yee , Adrian Stecula , Huan-Chieh Chien , Ling Zou , Elena V. FeofanovaID , 1 1 3,4 5 Marjolein van BorselenID , Kit Wun Kathy Cheung , Noha A. Yousri , Karsten Suhre , Jason M. Kinchen6, Eric Boerwinkle2,7, Roshanak Irannejad8, Bing Yu2, Kathleen 1,9 a1111111111 M. GiacominiID * a1111111111 a1111111111 1 Department of Bioengineering and Therapeutic Sciences, University of California San Francisco, California, United States of America, 2 Human Genetics Center, University of Texas Health Science Center at Houston, a1111111111 Houston, Texas, United States of America, 3 Genetic Medicine, Weill Cornell Medicine-Qatar, Doha, Qatar, a1111111111 4 Computer and Systems Engineering, Alexandria University, Alexandria, Egypt, 5 Physiology and Biophysics, Weill Cornell Medicine-Qatar, Doha, Qatar, 6 Metabolon, Inc, Durham, United States of America, 7 Human Genome Sequencing Center, Baylor College of Medicine, Houston, Texas, United States of America, 8 The Cardiovascular Research Institute, University of California, San Francisco, California, United States of America, 9 Institute for Human Genetics, University of California San Francisco, California, United States of America OPEN ACCESS Citation: Yee SW, Stecula A, Chien H-C, Zou L, ☯ These authors contributed equally to this work. Feofanova EV, van Borselen M, et al. (2019) * [email protected] Unraveling the functional role of the orphan solute carrier, SLC22A24 in the transport of steroid conjugates through metabolomic and genome- Abstract wide association studies. PLoS Genet 15(9): e1008208. https://doi.org/10.1371/journal. - 
												
												Dopaminergic Loss of Cyclin-Dependent Kinase-Like 5 Recapitulates Methylphenidate-Remediable Hyperlocomotion in Mouse Model of CDKL5 Deficiency Disorder
Dopaminergic loss of cyclin-dependent kinase-like 5 recapitulates methylphenidate-remediable hyperlocomotion in mouse model of CDKL5 deficiency disorder Downloaded from https://academic.oup.com/hmg/article-abstract/doi/10.1093/hmg/ddaa122/5863032 by University of Exeter user on 26 June 2020 Cian-Ling Jhang1, Hom-Yi Lee3,4, Jinchung Chen5, Wenlin Liao1,2 * 1 Institute of Neuroscience, 2 Research Center for Mind, Brain and Learning, National Cheng-Chi University, Taipei 116, Taiwan 3 Department of Psychology, 4 Department of Speech Language Pathology and Audiology, Chung Shan Medical University, Taichung 402, Taiwan 5 Graduate Institute of Biomedical Sciences, Chang Gung University, Taoyuan 333, Taiwan UNCORRECTED MANUSCRIPT © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected] page 1 Downloaded from https://academic.oup.com/hmg/article-abstract/doi/10.1093/hmg/ddaa122/5863032 by University of Exeter user on 26 June 2020 * To whom correspondence should be addressed: Wenlin Liao, PhD Associate Professor Institute of Neuroscience, National Cheng-Chi University 64, Sec. 2, Chi-Nan Road, Wen-Shan District Taipei 116, Taiwan Phone: 886-2-29393091 ext. 89621 UNCORRECTEDEmail: [email protected] MANUSCRIPT page 2 ABSTRACT Cyclin-dependent kinase-like 5 (CDKL5), a serine-threonine kinase encoded by an X-linked gene, is highly expressed in mammalian forebrain. Mutations in this gene Downloaded from https://academic.oup.com/hmg/article-abstract/doi/10.1093/hmg/ddaa122/5863032 by University of Exeter user on 26 June 2020 cause CDKL5 deficiency disorder, a neurodevelopmental encephalopathy characterized by early-onset seizures, motor dysfunction and intellectual disability. - 
												
												The Hearing Gene Prestin Reunites Echolocating Bats
The hearing gene Prestin reunites echolocating bats Gang Li*, Jinhong Wang*, Stephen J. Rossiter†‡, Gareth Jones§, James A. Cotton†, and Shuyi Zhang*‡ *School of Life Science, East China Normal University, Shanghai 200062, China; †School of Biological and Chemical Sciences, Queen Mary, University of London, London E1 4NS, United Kingdom; and §School of Biological Sciences, University of Bristol, Bristol BS8 1UG, United Kingdom Edited by Morris Goodman, Wayne State University School of Medicine, Detroit, MI, and approved July 10, 2008 (received for review March 4, 2008) The remarkable high-frequency sensitivity and selectivity of the Among all mammals, sensitivity to the highest frequencies occurs mammalian auditory system has been attributed to the evolution of in echolocating cetaceans and bats (17), which use sound for mechanical amplification, in which sound waves are amplified by orientation and often for the detection, localization, and classifi- outer hair cells in the cochlea. This process is driven by the recently cation of prey (18, 19). The processing of echolocation signals discovered protein prestin, encoded by the gene Prestin. Echolocating begins at the hair cells in the organ of Corti, continues along the bats use ultrasound for orientation and hunting and possess the auditory nerve, and terminates in the auditory cortex in the brain highest frequency hearing of all mammals. To test for the involve- (1). Prestin seems to be of major importance for hearing high ment of Prestin in the evolution of bat echolocation, we sequenced frequencies and for selective hearing, and both of these processes the coding region in echolocating and nonecholocating species. The are vital for echolocation. - 
												
												Comparative Molecular Dynamics Investigation of the Electromotile Hearing Protein Prestin
International Journal of Molecular Sciences Article Comparative Molecular Dynamics Investigation of the Electromotile Hearing Protein Prestin Gianfranco Abrusci 1,2,†, Thomas Tarenzi 1,3,†, Mattia Sturlese 4 , Gabriele Giachin 5 and Roberto Battistutta 5 and Gianluca Lattanzi 1,3,∗ 1 Department of Physics, University of Trento, Via Sommarive 14, 38123 Trento, Italy; [email protected] (G.A.); [email protected] (T.T.) 2 Cineca, Via Magnanelli 6/3, Casalecchio di Reno, 40033 Bologna, Italy 3 TIFPA-INFN, Via Sommarive 14, 38123 Trento, Italy 4 Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Via Marzolo 5, 35131 Padova, Italy; [email protected] 5 Department of Chemical Sciences, University of Padova, Via Marzolo 1, 35131 Padova, Italy; [email protected] (G.G.); [email protected] (R.B.) * Correspondence: [email protected] † These authors contributed equally to this work. Abstract: The mammalian protein prestin is expressed in the lateral membrane wall of the cochlear hair outer cells and is responsible for the electromotile response of the basolateral membrane, following hyperpolarisation or depolarisation of the cells. Its impairment marks the onset of severe diseases, like non-syndromic deafness. Several studies have pointed out possible key roles of residues located in the Transmembrane Domain (TMD) that differentiate mammalian prestins as incomplete transporters from the other proteins belonging to the same solute-carrier (SLC) superfamily, which Citation: Abrusci, G.; Tarenzi, T.; are classified as complete transporters. Here, we exploit the homology of a prototypical incomplete Sturlese, M.; Giachin, G.; Battistutta, transporter (rat prestin, rPres) and a complete transporter (zebrafish prestin, zPres) with target R.; Lattanzi, G. - 
												
												From Escherichia Coli Heat-Stable Enterotoxin to Mammalian Endogenous Guanylin Hormones
Brazilian Journal of Medical and Biological Research (2014) 47(3): 179-191, http://dx.doi.org/10.1590/1414-431X20133063 ISSN 1414-431X Review From Escherichia coli heat-stable enterotoxin to mammalian endogenous guanylin hormones A.A.M. Lima1 and M.C. Fonteles1,2 1Unidade de Pesquisas Clı´nicas, Instituto de Biomedicina, Departamento de Fisiologia e Farmacologia, Escola de Medicina, Universidade Federal do Ceara´, Fortaleza, CE, Brasil 2Instituto de Cieˆncias Biome´dicas, Universidade Estadual do Ceara´, Fortaleza, CE, Brasil Abstract The isolation of heat-stable enterotoxin (STa) from Escherichia coli and cholera toxin from Vibrio cholerae has increased our knowledge of specific mechanisms of action that could be used as pharmacological tools to understand the guanylyl cyclase-C and the adenylyl cyclase enzymatic systems. These discoveries have also been instrumental in increasing our understanding of the basic mechanisms that control the electrolyte and water balance in the gut, kidney, and urinary tracts under normal conditions and in disease. Herein, we review the evolution of genes of the guanylin family and STa genes from bacteria to fish and mammals. We also describe new developments and perspectives regarding these novel bacterial compounds and peptide hormones that act in electrolyte and water balance. The available data point toward new therapeutic perspectives for pathological features such as functional gastrointestinal disorders associated with constipation, colorectal cancer, cystic fibrosis, asthma, hypertension, gastrointestinal barrier function damage associated with enteropathy, enteric infection, malnutrition, satiety, food preferences, obesity, metabolic syndrome, and effects on behavior and brain disorders such as attention deficit, hyperactivity disorder, and schizophrenia. Key words: Heat-stable enterotoxin; Guanylin; Guanylyl cyclase; Secretory diarrhea; Kidney function; Electrolyte and water balance Introduction The heat-stable enterotoxin (Sta) from Escherichia coli kidney function using pure STa toxin. - 
												
												Supplementary Table 2
Supplementary Table 2. Differentially Expressed Genes following Sham treatment relative to Untreated Controls Fold Change Accession Name Symbol 3 h 12 h NM_013121 CD28 antigen Cd28 12.82 BG665360 FMS-like tyrosine kinase 1 Flt1 9.63 NM_012701 Adrenergic receptor, beta 1 Adrb1 8.24 0.46 U20796 Nuclear receptor subfamily 1, group D, member 2 Nr1d2 7.22 NM_017116 Calpain 2 Capn2 6.41 BE097282 Guanine nucleotide binding protein, alpha 12 Gna12 6.21 NM_053328 Basic helix-loop-helix domain containing, class B2 Bhlhb2 5.79 NM_053831 Guanylate cyclase 2f Gucy2f 5.71 AW251703 Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12a 5.57 NM_021691 Twist homolog 2 (Drosophila) Twist2 5.42 NM_133550 Fc receptor, IgE, low affinity II, alpha polypeptide Fcer2a 4.93 NM_031120 Signal sequence receptor, gamma Ssr3 4.84 NM_053544 Secreted frizzled-related protein 4 Sfrp4 4.73 NM_053910 Pleckstrin homology, Sec7 and coiled/coil domains 1 Pscd1 4.69 BE113233 Suppressor of cytokine signaling 2 Socs2 4.68 NM_053949 Potassium voltage-gated channel, subfamily H (eag- Kcnh2 4.60 related), member 2 NM_017305 Glutamate cysteine ligase, modifier subunit Gclm 4.59 NM_017309 Protein phospatase 3, regulatory subunit B, alpha Ppp3r1 4.54 isoform,type 1 NM_012765 5-hydroxytryptamine (serotonin) receptor 2C Htr2c 4.46 NM_017218 V-erb-b2 erythroblastic leukemia viral oncogene homolog Erbb3 4.42 3 (avian) AW918369 Zinc finger protein 191 Zfp191 4.38 NM_031034 Guanine nucleotide binding protein, alpha 12 Gna12 4.38 NM_017020 Interleukin 6 receptor Il6r 4.37 AJ002942 - 
												
												Pflugers Final
CORE Metadata, citation and similar papers at core.ac.uk Provided by Serveur académique lausannois A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Sylvain Pradervand2, Annie Mercier Zuber1, Gabriel Centeno1, Olivier Bonny1,3,4 and Dmitri Firsov1,4 1 - Department of Pharmacology and Toxicology, University of Lausanne, 1005 Lausanne, Switzerland 2 - DNA Array Facility, University of Lausanne, 1015 Lausanne, Switzerland 3 - Service of Nephrology, Lausanne University Hospital, 1005 Lausanne, Switzerland 4 – these two authors have equally contributed to the study to whom correspondence should be addressed: Dmitri FIRSOV Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925406 Fax: ++ 41-216925355 e-mail: [email protected] and Olivier BONNY Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925417 Fax: ++ 41-216925355 e-mail: [email protected] 1 Abstract The distal parts of the renal tubule play a critical role in maintaining homeostasis of extracellular fluids. In this review, we present an in-depth analysis of microarray-based gene expression profiles available for microdissected mouse distal nephron segments, i.e., the distal convoluted tubule (DCT) and the connecting tubule (CNT), and for the cortical portion of the collecting duct (CCD) (Zuber et al., 2009). Classification of expressed transcripts in 14 major functional gene categories demonstrated that all principal proteins involved in maintaining of salt and water balance are represented by highly abundant transcripts. However, a significant number of transcripts belonging, for instance, to categories of G protein-coupled receptors (GPCR) or serine-threonine kinases exhibit high expression levels but remain unassigned to a specific renal function. - 
												
												WO 2016/090486 Al 16 June 2016 (16.06.2016) W P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/090486 Al 16 June 2016 (16.06.2016) W P O P C T (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12N 5/071 (2010.01) CI2N 5/073 (2010.01) kind of national protection available): AE, AG, AL, AM, C12N 11/02 (2006.01) C12Q 1/02 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (21) Number: International Application DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/CA20 15/05 1297 HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (22) International Filing Date: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, 9 December 2015 (09.12.2015) MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (25) Filing Language: English SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, (26) Publication Language: English TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 62/089,5 12 9 December 2014 (09. 12.2014) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (71) Applicant: NATIONAL RESEARCH COUNCIL OF TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, CANADA [CA/CA]; M-55, 1200 Montreal Road, Ottawa, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, Ontario K lA 0R6 (CA).