Self-Activation of Serine/Threonine Kinase Afsk on Autophosphorylation at Threonine-168
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Metabolic Engineering of Escherichia Coli for Poly(3-Hydroxybutyrate)
Lin et al. Microb Cell Fact (2015) 14:185 DOI 10.1186/s12934-015-0369-3 RESEARCH Open Access Metabolic engineering of Escherichia coli for poly(3‑hydroxybutyrate) production via threonine bypass Zhenquan Lin1,2,3†, Yan Zhang1,2,3†, Qianqian Yuan1,2,3,4, Qiaojie Liu1,2,3, Yifan Li1,2,3, Zhiwen Wang1,2,3, Hongwu Ma4*, Tao Chen1,2,3,5* and Xueming Zhao1,2,3 Abstract Background: Poly(3-hydroxybutyrate) (PHB), have been considered to be good candidates for completely biode- gradable polymers due to their similar mechanical properties to petroleum-derived polymers and complete biodeg- radability. Escherichia coli has been used to simulate the distribution of metabolic fluxes in recombinant E. coli pro- ducing poly(3-hydroxybutyrate) (PHB). Genome-scale metabolic network analysis can reveal unexpected metabolic engineering strategies to improve the production of biochemicals and biofuels. Results: In this study, we reported the discovery of a new pathway called threonine bypass by flux balance analysis of the genome-scale metabolic model of E. coli. This pathway, mainly containing the reactions for threonine synthesis and degradation, can potentially increase the yield of PHB and other acetyl-CoA derived products by reutilizing the CO2 released at the pyruvate dehydrogenase step. To implement the threonine bypass for PHB production in E. coli, we deregulated the threonine and serine degradation pathway and enhanced the threonine synthesis, resulting in 2.23-fold improvement of PHB titer. Then, we overexpressed glyA to enhance the conversion of glycine to serine and activated transhydrogenase to generate NADPH required in the threonine bypass. -
Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits. -
Glucan Phosphorylase-Catalyzed Enzymatic Reactions Using Analog Substrates to Synthesize Non-Natural Oligo- and Polysaccharides
catalysts Review α-Glucan Phosphorylase-Catalyzed Enzymatic Reactions Using Analog Substrates to Synthesize Non-Natural Oligo- and Polysaccharides Jun-ichi Kadokawa Department of Chemistry, Biotechnology, and Chemical Engineering, Graduate School of Science and Engineering, Kagoshima University, 1-21-40 Korimoto, Kagoshima 860-0065, Japan; [email protected]; Tel.: +81-99-285-7743 Received: 9 October 2018; Accepted: 16 October 2018; Published: 19 October 2018 Abstract: As natural oligo- and polysaccharides are important biomass resources and exhibit vital biological functions, non-natural oligo- and polysaccharides with a well-defined structure can be expected to act as new functional materials with specific natures and properties. α-Glucan phosphorylase (GP) is one of the enzymes that have been used as catalysts for practical synthesis of oligo- and polysaccharides. By means of weak specificity for the recognition of substrates by GP, non-natural oligo- and polysaccharides has precisely been synthesized. GP-catalyzed enzymatic glycosylations using several analog substrates as glycosyl donors have been carried out to produce oligosaccharides having different monosaccharide residues at the non-reducing end. Glycogen, a highly branched natural polysaccharide, has been used as the polymeric glycosyl acceptor and primer for the GP-catalyzed glycosylation and polymerization to obtain glycogen-based non-natural polysaccharide materials. Under the conditions of removal of inorganic phosphate, thermostable GP-catalyzed enzymatic polymerization of analog monomers occurred to give amylose analog polysaccharides. Keywords: analog substrate; α-glucan phosphorylase; non-natural oligo- and polysaccharides 1. Introduction Oligo- and polysaccharides are widely distributed in nature and enact specific important biological functions in accordance with their chemical structures [1]. -
HER2 Stabilizes EGFR and Itself by Altering Autophosphorylation Patterns in a Manner That Overcomes Regulatory Mechanisms and Pr
Oncogene (2013) 32, 4169–4180 & 2013 Macmillan Publishers Limited All rights reserved 0950-9232/13 www.nature.com/onc ORIGINAL ARTICLE HER2 stabilizes EGFR and itself by altering autophosphorylation patterns in a manner that overcomes regulatory mechanisms and promotes proliferative and transformation signaling Z Hartman1, H Zhao1 and YM Agazie1,2 One of the causes of breast cancer is overexpression of the human epidermal growth factor receptor 2 (HER2). Enhanced receptor autophosphorylation and resistance to activation-induced downregulation have been suggested as mechanisms for HER2-induced sustained signaling and cell transformation. However, the molecular mechanisms underlying these possibilities remain incompletely understood. In the current report, we present evidence that show that HER2 overexpression does not lead to receptor hyper-autophosphorylation, but alters patterns in a manner that favors receptor stability and sustained signaling. Specifically, HER2 overexpression blocks epidermal growth factor receptor (EGFR) tyrosine phosphorylation on Y1045 and Y1068, the known docking sites of c-Cbl and Grb2, respectively, whereas promoting phosphorylation on Y1173, the known docking site of the Gab adaptor proteins and phospholipase C gamma. Under these conditions, HER2 itself is phosphorylated on Y1221/1222, with no known role, and on Y1248 that corresponds to Y1173 of EGFR. Interestingly, suppressed EGFR autophosphorylation on the Grb2 and c-Cbl-binding sites correlated with receptor stability and sustained signaling, suggesting that HER2 accomplishes these tasks by altering autophosphorylation patterns. In conformity with these findings, mutation of the Grb2-binding site on EGFR (Y1068F–EGFR) conferred resistance to ligand-induced degradation, which in turn induced sustained signaling, and increased cell proliferation and transformation. -
Defective Galactose Oxidation in a Patient with Glycogen Storage Disease and Fanconi Syndrome
Pediatr. Res. 17: 157-161 (1983) Defective Galactose Oxidation in a Patient with Glycogen Storage Disease and Fanconi Syndrome M. BRIVET,"" N. MOATTI, A. CORRIAT, A. LEMONNIER, AND M. ODIEVRE Laboratoire Central de Biochimie du Centre Hospitalier de Bichre, 94270 Kremlin-Bicetre, France [M. B., A. C.]; Faculte des Sciences Pharmaceutiques et Biologiques de I'Universite Paris-Sud, 92290 Chatenay-Malabry, France [N. M., A. L.]; and Faculte de Midecine de I'Universiti Paris-Sud et Unite de Recherches d'Hepatologie Infantile, INSERM U 56, 94270 Kremlin-Bicetre. France [M. 0.1 Summary The patient's diet was supplemented with 25-OH-cholecalci- ferol, phosphorus, calcium, and bicarbonate. With this treatment, Carbohydrate metabolism was studied in a child with atypical the serum phosphate concentration increased, but remained be- glycogen storage disease and Fanconi syndrome. Massive gluco- tween 0.8 and 1.0 mmole/liter, whereas the plasma carbon dioxide suria, partial resistance to glucagon and abnormal responses to level returned to normal (18-22 mmole/liter). Rickets was only carbohydrate loads, mainly in the form of major impairment of partially controlled. galactose utilization were found, as reported in previous cases. Increased blood lactate to pyruvate ratios, observed in a few cases of idiopathic Fanconi syndrome, were not present. [l-14ClGalac- METHODS tose oxidation was normal in erythrocytes, but reduced in fresh All studies of the patient and of the subjects who served as minced liver tissue, despite normal activities of hepatic galactoki- controls were undertaken after obtaining parental or personal nase, uridyltransferase, and UDP-glucose 4epirnerase in hornog- consent. enates of frozen liver. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off -
The Role of Some of the Krebs Cycle Reactions in the Biosynthetic Functions of Thiobacillus Thioparus
AN ABSTRACT OF THE THESIS OF Gerald G. Still for the PhD in Chemistry (Name) (Degree) (Major) Date thesis is presented May 14, 1965 Title THE ROLE OF SOME OF THE KREBS CYCLE REACTIONS IN THE BIOSYNTHETIC FUNCTIONS OF THIOBACILLUS THIOPARUS Abstract approved Redacted for Privacy (Major professor) Aseptic radiorespirometry has been used to examine the utilization of external carbon sources by proliferat- ing Thiobacillus thioparus cells. These studies reveal that glucose, galactose, mannose, fructose, ribose, DL- glutamate, and L- aspartate were not utilized by this chemoautotrophic organism. However, it has been shown that trace amounts of acetate, glycine, DL- serine, DL- alanine, succinate and fumarate can be utilized by T. thioparus cells. To elucidate the nature of the biosynthetic pathways operative in this bacteria, proliferating cell cultures were allowed to metabolize specifically 14C labeled substrates. The resulting 14C labeled cells were sub- sequently hydrolyzed, their amino acids isolated and subjected to degradation experiments. Examination of the respective fates of the label in DL- alanine- 2 -14C, acetate- 1 -14C, or acetate -2 -14C in the cellular metabolism revealed that the Krebs Cycle path- way is not functioning as a respiratory mechanism in T. thioparus. However, most of the reactions of the Krebs Cycle pathway are involved in the biosynthesis of carbon skeletons for various amino acids. A CO2 fixa- tion pathway of the C3 +C1 type is instrumental in provid- ing C4 dicarboxylic acids and those amino acids derived therefrom. Acetate can be incorporated into a -keto- glutarate and those amino acids derived therefrom, but cannot be incorporated into the C4 dicarboxylic acids. -
Understanding and Exploiting Post-Translational Modifications for Plant Disease Resistance
biomolecules Review Understanding and Exploiting Post-Translational Modifications for Plant Disease Resistance Catherine Gough and Ari Sadanandom * Department of Biosciences, Durham University, Stockton Road, Durham DH1 3LE, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-1913341263 Abstract: Plants are constantly threatened by pathogens, so have evolved complex defence signalling networks to overcome pathogen attacks. Post-translational modifications (PTMs) are fundamental to plant immunity, allowing rapid and dynamic responses at the appropriate time. PTM regulation is essential; pathogen effectors often disrupt PTMs in an attempt to evade immune responses. Here, we cover the mechanisms of disease resistance to pathogens, and how growth is balanced with defence, with a focus on the essential roles of PTMs. Alteration of defence-related PTMs has the potential to fine-tune molecular interactions to produce disease-resistant crops, without trade-offs in growth and fitness. Keywords: post-translational modifications; plant immunity; phosphorylation; ubiquitination; SUMOylation; defence Citation: Gough, C.; Sadanandom, A. 1. Introduction Understanding and Exploiting Plant growth and survival are constantly threatened by biotic stress, including plant Post-Translational Modifications for pathogens consisting of viruses, bacteria, fungi, and chromista. In the context of agriculture, Plant Disease Resistance. Biomolecules crop yield losses due to pathogens are estimated to be around 20% worldwide in staple 2021, 11, 1122. https://doi.org/ crops [1]. The spread of pests and diseases into new environments is increasing: more 10.3390/biom11081122 extreme weather events associated with climate change create favourable environments for food- and water-borne pathogens [2,3]. Academic Editors: Giovanna Serino The significant estimates of crop losses from pathogens highlight the need to de- and Daisuke Todaka velop crops with disease-resistance traits against current and emerging pathogens. -
Protein Kinase C As a Paradigm Alexandra C
Biochem. J. (2003) 370, 361–371 (Printed in Great Britain) 361 REVIEW ARTICLE Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Alexandra C. NEWTON1 Department of Pharmacology, University of California at San Diego, La Jolla, CA 92093-0640, U.S.A. Phosphorylation plays a central role in regulating the activation down-regulation of PKC as a paradigm for how these sites and signalling lifetime of protein kinases A, B (also known as control the function of the ABC kinases. Akt) and C. These kinases share three conserved phosphorylation motifs: the activation loop segment, the turn motif and the Key words: phosphoinositide 3-kinase, phosphoinositide-depen- hydrophobic motif. This review focuses on how phosphorylation dent kinase-1 (PDK-1), phosphorylation motif, protein kinase A at each of these sites regulates the maturation, signalling and (PKA), protein kinase B (PKB)\Akt, protein kinase C (PKC). INTRODUCTION by phosphorylation as a paradigm for control of ABC kinase function by phosphorylation. Almost half a century ago Krebs, Graves and Fischer reported b that the first discovered protein kinase, phosphorylase kinase, ARCHITECTURE OF ABC KINASES was, itself, activated by phosphorylation [1]. Two decades later, Fischer and colleagues showed that the kinase that phosphory- Protein kinases A, B\Akt and C have in common a conserved lates phosphorylase kinase, later named protein kinase A (PKA), kinase core whose function is regulated allosterically by a was also phosphorylated [2]. Reversible control by phosphory- corresponding regulatory moiety (Figure 1). In the case of PKA, lation\dephosphorylation is now firmly established as a fun- the regulatory moiety is a separate polypeptide, whereas the damental mechanism for regulating the function of most of the regulatory determinants are on the same polypeptide as the 500 or so members of the mammalian protein kinase superfamily. -
Biomoleculesbiomolecules
1414Unit Objectives BiomoleculesBiomolecules After studying this Unit, you will be able to • explain the characteristics of “It is the harmonious and synchronous progress of chemical biomolecules like carbohydrates, reactions in body which leads to life”. proteins and nucleic acids and hormones; • classify carbohydrates, proteins, A living system grows, sustains and reproduces itself. nucleic acids and vitamins on the The most amazing thing about a living system is that it basis of their structures; is composed of non-living atoms and molecules. The • explain the difference between pursuit of knowledge of what goes on chemically within DNA and RNA; a living system falls in the domain of biochemistry. Living • describe the role of biomolecules systems are made up of various complex biomolecules in biosystem. like carbohydrates, proteins, nucleic acids, lipids, etc. Proteins and carbohydrates are essential constituents of our food. These biomolecules interact with each other and constitute the molecular logic of life processes. In addition, some simple molecules like vitamins and mineral salts also play an important role in the functions of organisms. Structures and functions of some of these biomolecules are discussed in this Unit. 14.114.114.1 Carbohydrates Carbohydrates are primarily produced by plants and form a very large group of naturally occurring organic compounds. Some common examples of carbohydrates are cane sugar, glucose, starch, etc. Most of them have a general formula, Cx(H2O)y, and were considered as hydrates of carbon from where the name carbohydrate was derived. For example, the molecular formula of glucose (C6H12O6) fits into this general formula, C6(H2O)6. But all the compounds which fit into this formula may not be classified as carbohydrates. -
Molecular Basis of Tank-Binding Kinase 1 Activation by Transautophosphorylation
Molecular basis of Tank-binding kinase 1 activation by transautophosphorylation Xiaolei Maa,1, Elizabeth Helgasonb,1, Qui T. Phungc, Clifford L. Quanb, Rekha S. Iyera, Michelle W. Leec, Krista K. Bowmana, Melissa A. Starovasnika, and Erin C. Dueberb,2 Departments of aStructural Biology, bEarly Discovery Biochemistry, and cProtein Chemistry, Genentech, South San Francisco, CA 94080 Edited by Tony Hunter, Salk Institute for Biological Studies, La Jolla, CA, and approved April 25, 2012 (received for review December 30, 2011) Tank-binding kinase (TBK)1 plays a central role in innate immunity: it the C-terminal scaffolding/dimerization domain (SDD), a do- serves as an integrator of multiple signals induced by receptor- main arrangement that appears to be shared among the IKK mediated pathogen detection and as a modulator of IFN levels. family of kinases (3). Deletion or mutation of the ULD in TBK1 Efforts to better understand the biology of this key immunological or IKKε severely impairs kinase activation and substrate phos- factor have intensified recently as growing evidence implicates phorylation in cells (22, 23). Furthermore, the integrity of the aberrant TBK1 activity in a variety of autoimmune diseases and ULD in IKKβ is not only required for kinase activity (24) but was fi cancers. Nevertheless, key molecular details of TBK1 regulation and shown also to confer substrate speci city in conjunction with the β substrate selection remain unanswered. Here, structures of phos- adjacent SDD (25). Recent crystal structures of the IKK phorylated and unphosphorylated human TBK1 kinase and ubiq- homodimer demonstrate that the ULD and SDD form a joint, uitin-like domains, combined with biochemical studies, indicate three-way interface with the KD within each protomer of the a molecular mechanism of activation via transautophosphorylation.