MOLECULAR SYSTEMATICS OF SUBTERRANEAN TERMITES COPTOTERMES SPP., MICROSATELLITE DEVELOPMENT AND POPULATION GENETICS OF Coptotermes gestroi (WASMANN) (BLATTODEA: RHINOTERMITIDAE)
YEAP BENG KEOK
UNIVERSITI SAINS MALAYSIA 2010 MOLECULAR SYSTEMATICS OF SUBTERRANEAN TERMITES COPTOTERMES SPP., MICROSATELLITE DEVELOPMENT AND POPULATION GENETICS OF Coptotermes gestroi (WASMANN) (BLATTODEA: RHINOTERMITIDAE)
BY
YEAP BENG KEOK
Thesis submitted in fulfillment of the requirements for the degree of Doctor of Philosophy
March 2010 ACKNOWLEDGEMENTS
This work would not have been completed without the generosity, support, and encouragement of many people. Utmost thanks must extend to my mentors, Professor Dr.
Lee Chow Yang and Associate Professor Dr. Ahmad Sofiman Othman. Prof. Lee, my main supervisor, constantly guided and lifted me with his wisdom. He introduced me to termites and gave me a lot of encouragement by providing me many opportunities to attend seminars and conferences throughout Asia countries. He has continued to support and promote my work tirelessly and widen my vision in this ground. Dr. Sofiman, my co-supervisor, gave me a very friendly and valuable advices and guidance, supported me to many useful workshops, and provided a well-equipped laboratory for my molecular study.
I extend my sincerest gratitude to Professor Abu Hassan, for being the ever helpful and generous Dean of School of Biological Sciences. To Dr. Zairi Jaal, thank you for being the very supportive, cheerful and bighearted coordinator of Vector Control
Research Unit. To Dr. Siti Azizah, for her support and always put a lot of effort organizing very informative workshops. To all staff of School of Biological Sciences and VCRU who have help me in one way and another, thank you for your assistance throughout my research.
Not forgetting Jing Wen, Lay Tyng, and Pooi Yen who never fail to offer their hands and brains to help me in solving my problems. Thanks for their caring, bringing the joyousness into my days. Say Piau, who always with serious face, always stands by my side and help in editing my writing. To the rest of the past and present members of
Urban Entomology Laboratory, Annie, Boon Hoi, Edwin, Fong Kuan, Hui Siang, Jia
i Wei, Kean Teik, Kim Fung, Kok Boon, Nadiah, Nellie, Ru Yuan, Sam, Su Yee, Sui
Yaw, Tomoki, Veera, Yee Fatt etc., thank you for whatever big or little things that you have done that made my research life a different.
I also would like to record my gratefulness to Charunee Vongkaluang (Royal
Forest Department, Bangkok, Thailand); Carlos Garcia (Forest Product Department,
Laguna, the Philippines); Julian Yates, III (University of Hawaii, Honolulu, HI);
Tsuyoshi Yoshimura (Kyoto University, Kyoto, Japan); Lim Kay Min and Tee Pui Lai
(NLC General Pest Control, Penang, Malaysia); Kean-Teik Koay (Ridpest Shah Alam,
Selangor, Malaysia), Sulaeman Yusuf (LIPI, Bogor, Indonesia), Theo Evans
(Commonwealth Scientific and Industrial Research Organization Entomology, Canberra,
Australia); John Ho and Tan Eng Kooi (Singapore Pest Management Association,
Singapore); Chun-Chun Tsai (Aletheia University, Tainan, Taiwan); Nancy Lee
(ChungHsi Chemical Co., Taipei, Taiwan); Xie (Jia Fei Jie Pest Control Co., Tainan,
Taiwan); and Junhong Zhong (Guangdong Entomological Institute, Guangzhou, China) who helped with the collection of the termite specimens used in this study.
Special thanks to Ed Vargo (North Carolina State University, US); M. E. Scharf
(University of Florida, Gainesville, FL); Michael Lenz (Commonwealth Scientific and
Industrial Research Organization Entomology, Canberra, Australia) for constructive criticism and comments on my manuscripts.
My candidature as Ph.D. student in USM was supported by a scholarship from
Ministry of Science, Technology and Innovation, Malaysia. and a Research University
(RU) grant from Universiti Sains Malaysia.
ii Last but not least, I express my sincere thanks from the bottom of my heart to my family members for their endless love, understanding, support, and encouragement
Thanks for always been there, cheering me on to greater achievements and success.
iii TABLE OF CONTENTS
Page ACKNOWLEDGEMENTS i TABLE OF CONTENTS iv LIST OF TABLES viii LIST OF FIGURES x LIST OF ABBREVIATION xiii ABSTRAK xiv ABSTRACT xvii
CHAPTER ONE: GENERAL INTRODUCTION 1
CHAPTER TWO: LITERATURE REVIEW 2.1 Significance of termites in the ecosystem 4 2.2 Subterranean termites: Coptotermes spp. 6 2.2.1 Colony structure 9 2.2.2 Species identification and distribution of C. gestroi 13 2.2.3 Economic important of C. gestroi in Southeast Asia 17 2.3 Advances in molecular genetic techniques 18 2.3.1 Genetic markers 19 2.3.2 Application of mitochondrial DNA for studying termite genetic 21 2.3.3 Application of DNA microsatellites for studying termite population genetic 24
CHAPTER THREE: MOPHOLOGICAL COMPARISONS AND GENETIC RELATIONSHIP BETWEEN Coptotermes gestroi AND Coptotermes vastator (BLATTODEA: RHINOTERMITIDAE) 3.1 Introduction 27 3.2 Materials and methods 3.2.1 Termite samples 29
iv 3.2.2 DNA extraction 31 3.2.3 Data collection 31 3.2.4 Nucleotide data analysis 32 3.3 Results and discussion 3.3.1 Morphological characteristics 33 3.3.2 Nucleotide analyses 37 3.3.3 Phylogenetic relationships inferred from 12S, 16S, and COII genes 37 3.3.4 Implication of finding to pest management industry 43
CHAPTER FOUR: MOLECULAR SYSTEMATICS OF COPTOTERMES (BLATTODEA: RHINOTERMITIDAE) FROM EAST ASIA AND AUSTRALIA 4.1 Introduction 45 4.2 Materials and methods 4.2.1 Sample collection 47 4.2.2 DNA extraction 52 4.2.3 Polymerase chain reaction (PCR) amplification and DNA sequencing 52 4.2.4 Phylogenetic analysis 54 4.3 Results and discussion 4.3.1 Morphology 55 4.3.2 DNA sequence results 59 4.3.3 Phylogenetic analysis 59 4.3.4 Australian Coptotermes 65 4.3.5 Southeast Asian Coptotermes 66 4.3.6 Coptotermes gestroi 67 4.3.7 Chinese Coptotermes 69
v CHAPTER FIVE: GENETIC RELATIONSHIP BETWEEN Coptotermes heimi AND Coptotermes gestroi (BLATTODEA: RHINOTERMITIDAE) 5.1 Introduction 74 5.2 Materials and methods 5.2.1 Termite samples 75 5.2.2 Morphological measurements 78 5.2.3 DNA extraction, amplification, and sequencing 81 5.2.4 Phylogenetic analysis 82 5.3 Results and discussion 5.3.1 Morphological characteristics 83 5.3.2 Genetic analysis 89 5.3.3 Phylogenetic relationship inferred from 12S, 16S, COII, and combined gene analysis 90
CHAPTER SIX: IDENTIFICATION OF POLYMORPHIC MICROSATELLITE MARKERS FOR THE ASIAN SUBTERRANEAN TERMITE Coptotermes gestroi (WASMANN) (BLATODEA: RHINOTERMITIDAE) 6.1 Introduction 98 6.2 Materials and methods 99 6.3 Results and discussion 100
CHAPTER SEVEN: GENETIC ANALYSIS OF COLONY AND POPULATION STRUCTRUTURE OF THE ASIAN SUBTERRANEAN TERMITE, Coptotermes gestroi, IN NATIVE AND INTRODUCED POPULATIONS 7.1 Introduction 104 7.2 Materials and methods 7.2.1 Site and sample collection 105 7.2.2 Genotype analysis and markers evaluation 105
vi 7.2.3 Population genetic structure 110 7.2.4 Colony breeding structure 112 7.3 Results 7.3.1 Basic genetic data 113 7.3.2 Breeding system and simulations of population structure 114 7.3.3 Genetic differentiation within and among populations 119 7.4 Discussion 7.4.1 Breeding system and population structure 123 7.4.2 Gene flow 125
CHAPTER EIGHT: SUMMARY AND CONCLUSION 128
BIBLIOGRAPHY 131
VITAE 153
vii LIST OF TABLES Page
Table 2.1. Methods available for genetically characterizing individuals 20 and populations and their applicability to each issue. Techniques with + can be used for the purpose specified, and several +s indicate that the technique has high utility; ? indicates that the technique is useful in only some cases; and – indicates that the technique is not useful in this context (Adapted from Frankham et al. 2002)
Table 3.1 Termite specimens and Genbank published sequences used in 30 this study
Table 3.2 Measurements (in mm) of termite soldiers of three Coptotermes 35 spp.
Table 4.1 Information on the termite specimens collected and used in 48 this study
Table 4.2 Published GenBank sequences used in this study 50
Table 4.3 Primers used for PCR and sequencing 53
Table 4.4 Measurement (in millimeters) of the soldier termite specimens 57 used in this study and those from Chapter Three
Table 4.5 Nucleotide and haplotype variations for 12S gene among 71 C. formosanus, C. dimorphus and C. cochlearus
Table 4.6 Nucleotide and haplotype variations for 16S gene among 72 C. formosanus, C. dimorphus, and C. cochlearus
Table 5.1 Information on termite samples used in this study 76
Table 5.2 Morphometric data (in millimeters) of the soldier termite 79 specimens of C. heimi and C. gestroi
Table 5.3 Eigenvector elements and percentage of total variance of 85 principle components of morphometic data from C. gestroi and C. heimi soldiers
Table 5.4 Within-group correlation of variables to the canonical variates 86
Table 6.1 Characterization of 11 microsatellite loci of C. gestroi. 102
viii Number of individuals examined (n) (only one individual per colony was genotyped), sequenced allele (*), annealing temperature (Ta), number of alleles (Na), observed heterozygosity (HO), expected heterozygosity (HE), and probability by HW exact test (P) are listed for each locus
Table 7.1 Population, location, number of colony (N), and number of 107 Coptotermes gestroi workers that were analyzed (n)
Table 7.2 Number of alleles and frequency of most common allele at 109 ten microsatellite loci for the three populations with the highest number of alleles and sum of the 12 putative populations
Table 7.3 Empirical measures of F-statistics and worker relatedness 115 coefficients for total colonies, simple and extended families of Coptotermes gestroi in 12 population groups and computer simulations data for several possible breeding systems of subterranean termites derived from Thorne et al. (1999), Bulmer et al. (2001), and Vargo (2003)
ix LIST OF FIGURES
Page
Figure 2.1 Phylogenetic scheme of termite evolution showing the 6 presumed relationships of the seven termite families (adapted from Higashi and Abe 1997). The numbers on the lines represent the number of genera/species in the different families (Abe et al. 2000).
Figure 2.2 Distribution of Coptotermes spp. (dark area). 9 Modified from Pearce (1997).
Figure 2.3 Coptotermes gestroi soldier, with a dorsal and profile 15 view of the head, pronotum, and postmentum showing the morphological characteristics: (a) total length, (b) length without head, (c) length of head at base of mandibles, (d) head, length to fontanelle, (e) maximum width of head, (f) width of head at base of mandibles, (g) labrum length, (h) labrum maximum width, (i) segment I of antennae, length, (j) segment II of antennae, length, (k) segment I of antennae, width, (l) segment II of antennae, width, (m) pronotum length, (n) pronotum width, (o) gula length, (p) gula maximum width, (q) gula minimum width.
Figure 2.4: The genetic map of mtDNA. 22 Modified from Crozier and Crozier (1993)
Figure 2.5 Microsatellite mutations generated by slipped-strand 25 mispairing (adapted from Brohede 2003).
Figure 3.1 A single most parsimonious tree obtained for 12S gene 40 by using heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥ 50%. GenBank accession numbers represent the samples that are pooled from the National Center for Biotechnology Information (NCBI) database.
Figure 3.2 A single most parsimonious tree obtained for 16S gene 41 by using heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥ 50%. GenBank accession numbers represent the samples that are pooled from the NCBI database.
x Figure 3.3 A single most parsimonious tree obtained for COII gene 42 by using heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥ 50%. GenBank accession numbers represent the samples that are pooled from the NCBI database.
Figure 4.1 The most parsimonious tree obtained for the 12S gene 61 using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥50%.
Figure 4.2 The most parsimonious tree obtained for the 16S gene 62 using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥50%.
Figure 4.3 The most parsimonious tree obtained for the COII gene 63 using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥50%.
Figure 4.4 The most parsimonious tree obtained for combined genes 64 using a heuristic search option in PAUP4.0b10 (Swofford 2002) with morphological characters (bold number below branches). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥50%. 1, pear-shaped head; 2, large size head; 3, small size head; 4, flat head; 5, number of teeth on mandibles; 6, long mandibles; 7, short mandibles; 8, mandibles strongly curve inward; 9, one pair of setae of fontanelle; and 10, two pairs of setae at fontanelle.
Figure 5.1 Plot of the first two principle components for nineteen 87 termite populations.
Figure 5.2 Plot of the first two canonical variables for nineteen termite 88 populations.
Figure 5.3 A single most parsimonious tree obtained for 12S gene by 93 using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1000 replicates are listed above the branches supported at >50%.
xi Figure 5.4 A single most parsimonious tree obtained for 16S gene by 94 using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1000 replicates are listed above the branches supported at >50%.
Figure 5.5 A single most parsimonious tree obtained for COII gene by 95 using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1000 replicates are listed above the branches supported at >50%.
Figure 5.6 The most parsimonious tree obtained for combined 12S, 16S 96 and COII genes by using a heueristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1000 replicates are listed above the branches supported at >50%.
Figure 7.1 Map of sample locations. 106
Figure 7.2 Relationship between pairwise estimates of FST/(1- FST) and 120 geographical distance of Coptotermes gestroi colonies within each of the four largest population groups.A: Penang Island, B: Kuala Lumpur, C: Singapore, and D: Taiwan.
Figure 7.3 Relationship between pairwise estimates of FST /(1- FST) and 121 geographical distance among Coptotermes gestroi populations. The correlation coefficients were significant for both A: among Malaysia populations, and B: All 12 populations in the study.
Figure 7.4 Genetic relationships among the 12 putative Coptotermes 122 gestroi populations based on microsatellite data. The bootstraps values for 1 000 replicates are listed above the branches supported at ≥50%. Branch lengths are proportional to the genetic distance between nodes.
xii LIST OF ABBREVIATION
ANOVA Analysis of variance bp Base pair (s)
°C Degree Celsius
DNA Deoxyribonucleic acid dNTP Deoxyribonucleotide triphosphates
E East
EDTA Ethylene diaminetetraacetic acid h Hour (s)
MgCl2 Magnesium Chloride min Minute (s)
N North
NaCl Sodium chloride
PCR Polymerase chain reaction
P Probability
SDS Sodium Dodecyl Sulfate sec Second (s)
W West
xiii SISTEMATIK MOLEKUL ANAI-ANAI TANAH COPTOTERMES SPP.,
PERKEMBANGAN MIKROSATELIT DAN GENETIK POPULASI Coptotermes
gestroi (WASMANN) (BLATTODEA: RHINOTERMITIDAE)
ABSTRAK
Disertasi ini memfokuskan kajian sistematik dan hubungan filogenetik antara anai-anai tanah (genus Coptotermes), di samping menentukan genetik populasi khususnya spesis Coptotermes gestroi (Wasmann). Hubungan filogenetik 14 spesis putatif Coptotermes: Coptotermes acinaciformis Froggatt, Coptotermes cochlearus Xia
& He, Coptotermes curvignathus Holmgren, Coptotermes dimorphus Xia & He,
Coptotermes frenchi Hill, Coptotermes formosanus Shiraki, Coptotermes gestroi,
Coptotermes guangzhouensis Ping, Coptotermes heimi (Wasmann), Coptotermes kalshoveni Kemner, Coptotermes lacteus (Froggatt), Coptotermes sepangensis Krishna,
Coptotermes travians (Haviland), dan Coptotermes vastator Light ditentukan dengan menggunakan jujukan DNA mitokondria (gen 12S,16S, dan COII). Jujukan sedia ada untuk spesies-spesies di atas yang diperoleh daripada GenBank turut disertakan dalam analisis ini. Analisis matrik nukelotida gabungan gen 12S, 16S dan COII menggunakan parsimoni maksimum (maximum parsimony) dan kemungkinan maksimum (maximum likelihood) menunjukan dua klad utama dengan enam klad sampingan: I (C. acinaciformis), II (C. lacteus dan C. frenchi), III (C. curvignathus), IV (C. kalshoveni, C. sepangensis dan C. travians), V (C. gestroi, C. heimi, dan C. vastator), dan VI (C. formosanus, C. cochlearus, C. dimorphus dan C. guangzhouensis). Berdasarkan model
2-parameter Kimura, jujukan interspesifik berpasangan antara C. gestroi, C. vastator, dan C. heimi menunjukkan perbezaan hanya sehingga 0.80% antara C. gestroi dan C.
xiv vastator dan 2.13% antara C. vastator dan C. heimi. Sukatan morfometrik menggunakan
16 karakter menunjukkan banyak pertindihan di antara individu-individu yang dikaji daripada tiga spesies ini. Berdasarkan filogenetik molekular dan data morfometrik, adalah dicadangkan bahawa C. vastator dan C. heimi merupakan sinonim junior C. gestroi. Selain itu, turut dicadangkan bahawa C. cochlearus dan C. dimorphus berkemungkinan merupakan sinonim junior C. formosanus dengan perbezaan nukleotida sehingga 1.0%. Seterusnya, 11 penanda mikrosatelit dihasilkan untuk C. gestroi. Lapan daripada 11 penanda mikrosatelit tersebut digunakan untuk menentukan struktur koloni dan populasi serta kemungkinan mod organisasi reproduktif spesies C. gestroi. Sejumlah
89 koloni telah disampel daripada tujuh buah negara (Malaysia, Thailand, Singapura,
Indonesia, Filipina, Taiwan, dan Hawaii) dan dibahagikan kepada 12 kumpulan populasi putative (Kedah, Pulau Pinang, Seberang Prai, Kuala Lumpur, Johor, Sabah, Singapore,
Thailand, Indonesia, the Philipines, Taiwan, and Hawaii) mengikut lokasi geografinya.
Analisis genotip pekerja anai-anai dalam koloni menunjukan 72 (80%) merupakan famili ringkas. 17 koloni lain (20%) merupakan famili kembangan yang diterajui banyak neotenik yang berkemungkinan berasal daripada pasangan reproduktif primer. Terdapat perbezaan genetik yang kurang ketara (FST = 0.073) antara populasi anai-anai semenanjung Malaysia (Kedah, Pulau Pinang, Seberang Prai, Kuala Lumpur, Johor), mencadangkan aliran genetik yang sederhana sesama populasi ini. Secara relatif, terdapat aliran genetik yang sederhana (FST = 0.192) di antara kesemua 12 populasi putatif yang dikaji, serta terdapat korelasi positif antara jarak genetik dan jarak geografi yang menyarankan aliran genetik yang terhad antara populasi tersebut. Kesimpulannya, tidak terdapat pengasingan jarak genetik antara dua populasi yang terbesar (Pulau
xv Pinang dan Kuala Lumpur) mungkin disebabkan oleh penglibatan manusia dalam penyebaran dan frakmentasi koloni-koloni di kawasan bandar.
xvi MOLECULAR SYSTEMATICS OF SUBTERRANEAN TERMITES
COPTOTERMES SPP., MICROSATELLITE DEVELOPMENT AND
POPULATION GENETICS OF Coptotermes gestroi (WASMANN)
(BLATTODEA: RHINOTERMITIDAE)
ABSTRACT
This dissertation focused on the systematics and phylogenetic relationships of the subterranean termites (genus Coptotermes), and population genetics of Coptotermes gestroi (Wasmann). The phylogenetic relationships of 14 putative Coptotermes spp.
[Coptotermes acinaciformis Froggatt, Coptotermes cochlearus Xia & He, Coptotermes curvignathus Holmgren, Coptotermes dimorphus Xia & He, Coptotermes frenchi Hill,
Coptotermes formosanus Shiraki, Coptotermes gestroi, Coptotermes guangzhouensis
Ping, Coptotermes heimi (Wasmann), Coptotermes kalshoveni Kemner, Coptotermes lacteus (Froggatt), Coptotermes sepangensis Krishna, Coptotermes travians (Haviland), and Coptotermes vastator Light] were determined using mitochondrial DNA sequences
(12S, 16S, and COII genes). Available sequences from the Genbank for these species were also included in the analyses. Maximum parsimony and maximum likelihood of the combined nucleotide matrices of the 12S, 16S, and COII genes resulted in two major clades with six subclades: I (C. acinaciformis), II (C. lacteus and C. frenchi), III (C. curvignathus), IV (C. kalshoveni, C. sepangensis, and C. travians), V (C. gestroi, C. heimi, and C. vastator), and VI (C. formosanus, C. cochlearus, C. dimorphus, and C. guangzhouensis). The interspecific pairwise sequence divergence based on the Kimura
2-parameter model among C. gestroi, C. vastator, and C. heimi was only 0.80% between
xvii C. gestroi and C. vastator and 2.13% between C. vastator and C. heimi. Morphometric measurements of 16 characteristics revealed numerous overlaps among the examined individuals of these three species. Based on the molecular phylogenetics and morphometric data, it is proposed that C. vastator and C. heimi are junior synonyms of
C. gestroi. In addition, C. cochlearus and C. dimorphus are possible junior synonyms of
C. formosanus (with nucleotide differences of up to 1.0%).
Next, 11 microsatellite markers were developed for C. gestroi. Eight of the microsatellite markers were used to infer the colony and population structure and possible modes of reproductive organization of C. gestroi. A total of 89 colonies were sampled from seven countries (Malaysia, Thailand, Singapore, Indonesia, the
Philippines, Taiwan, and Hawaii) and sorted into 12 putative population groups (Kedah,
Penang Island, Penang mainland, Kuala Lumpur, Johor, Sabah, Singapore, Thailand,
Indonesia, the Philipines, Taiwan, and Hawaii) based on their geographical localities..
Analysis of worker genotypes within colonies suggested that 72 colonies (80%) were simple families. The other 17 colonies (20%) were extended families headed by numerous neotenics, which probably descended from the primary pair of reproductives.
There was negligible genetic differentiation (FST = 0.073) among the Peninsular
Malaysia populations (Kedah, Penang Island, Penang mainland, Kuala Lumpur, and
Johor population groups) suggesting moderate gene flow among them. Comparatively, there was moderate genetic differentiation (FST = 0.192) among the 12 putative studied population groups. In these colonies, a positive correlation between genetic distance and geographic distance was detected, suggesting rather restricted gene flow among them.
Finally, there was no significant isolation by distance within the two largest colonies
xviii (Penang and Kuala Lumpur); presumably humans aid in the dispersal and fragmentation of colonies in cities.
xix CHAPTER ONE
GENERAL INTRODUCTION
Termites are eusocial insects that live close together in large communities of several hundred to several million individuals. These communities are composed of functional reproductives together with numerous apterous sterile soldiers and workers, nymphs, and broods in a physically connected structure (nest) (Thorne et al. 1999).
Ecologically, termites thrive in abundance. They are the primary insect group adapted to consume wood and dry plants by turning this nutritionally poor matter into protein biomass, and they provide a possible input of nitrogen through symbiont fixation (Wood and Sands 1978, Abe 1995). These insects also damage agricultural crops, wooden constructions, and other wood products in most subtropical and tropical countries, including Malaysia (Lee et al. 1999, Lee 2007).
Based on their colonial behaviour and food consumption, termites can be grouped into dry wood, damp wood, harvester, or subterranean termites (Nutting and
Jones 1990). Dry wood termites can derive water metabolically and thus do not require moisture from their environment. They are usually found infesting structures above the soil surface, such as posts, stumps, and even wood on the 15th floors of commercial buildings (Krishna 1989, Robinson 1996). Damp wood termites require relatively high moisture in the wood they consume. They are found in dead, damp, and rotten logs
(Krishna 1989). Harvester termites store food products, or harvest fungus which grows in their galleries (Collins 1981, Darlington 1982). Subterranean termites establish large colonies that are in contact with the soil (Krishna 1989). Of the 2600 termite species in the world, subterranean termites of the genus Coptotermes are by far the most
1 destructive to human carpentry endeavors, costing billions of dollars annually for damage repair and treatment (Su and Scheffrahn 1990, 2000). Once the soil nest is established, subterranean termites may enter unprotected wooden structures through contact with the soil, cracks in masonry, or by shelter tubes constructed from soil and glandular secretions.
Coptotermes spp. are believed to have originated in the Orient, from which they were transported around the world, probably as infestations in the hulls of wooden boats and in lumber. Coptotermes spp. appear to be environmentally adaptive across a wide and varied geography (Weesner 1970). In the United States and Hawaii, subterranean termite control and damage repair costs increased from US$ 2 billion to as high as
US$ 11 billion annually in year 2002 (Jones 2000, Su 2002). In Southeast Asia, management efforts of termites cost an estimated US$ 400 million per year, and
Coptotermes spp. are responsible for >90% of the total infestation (Lee 2002, 2007).
With the gradual establishment of large-scale forest plantations, Coptotermes spp. became major pests of fast growing trees and cause a considerable amount of damage in plantations.
Coptotermes taxonomy is complex and has been plagued with controversies.
Identification based on morphology is difficult and sometimes erratic because morphological traits are determined by both genetic and environmental influences (e.g., climate and diet) (Kirton 2005). Differences can be great between genera, but not between species (Krishna 1970). Errors often have been made in both naming and identifying Coptotermes spp.. For example, inconsistencies in the pest status of
Coptotermes havilandi (Holmgren) in different regions of its geographic range were due to misidentification and taxonomic confusion between Coptotermes travians (Haviland),
2 C. havilandi, and Coptotermes gestroi (Wasmann) (Kirton and Brown 2003). Kirton and
Brown (2003) also suggested that Coptotermes heimi (Wasmann) might be a junior synonym of C. gestroi. Kirton (2005) suspected that Coptotermes vastator Light was a junior synonym of C. gestroi.
Molecular phylogenetic analyses can reveal the relationships among populations and differentiate species regardless of the termite caste (Szalanski et al. 2003). Many recent studies have demonstrated the potential of using mitochondrial gene sequence analysis for accurate species identification and to study phylogeny and gene flow (Liu and Beckenbach 1992, Kambhampati 1995, Kambhampati et al. 1996, Frati et al. 1997,
Miura et al. 1998, Austin et al. 2004, Ye et al. 2004, Jenkins et al. 2007).
Kirton (2005) reviewed the importance of accurate identification to the pest management industry. With the recognition of a single pest species, information about the species from different geographical regions can be pooled. Industry will also be able to avoid duplicative testing of termite management strategies for what was originally thought to be different pest species in different regions, which will in the long run save time, money and resources. Thus, the objectives of this thesis were:
1. To resolve the genetic relationships among C. vastator, C. heimi, and C.
gestroi;
2. To study the molecular systematics of Coptotermes spp. from East Asia via
phylogenetic analyses of three mitochondrial genes (12S, 16S, and COII);
3. To isolate microsatellite DNA loci from C. gestroi for population studies;
4. To characterize the colony and genetic structure of C. gestroi populations from
Asia.
3 CHAPTER TWO LITERATURE REVIEW
2.1 Significance of termites in the ecosystem
The fossil record indicates that termites evolved about 220 million years ago
(Collins 1988, Thorne and Carpenter 1992). Evidence indicates that phylogenetically termites are closely related to cockroaches (Kambhampati 1995). Termites are thought to be derived from a primitive group of wood-feeding cockroaches (Cryptocercus). Both have unique mutualistic intestinal protists, endosymbiotic flavobacteria in the visceral section of the fat body, and in some higher forms, externally cultivated basidiomycete fungi (Bignell and Eggleton 1998, Nalepa and Bandi 2000).
Termites fall into seven families consisting of 281 genera with over 2600 described species (Krishna 1970, Kambhampati and Eggleton 2000). The majority of termites live in tropical and subtropical regions, but they also spread into the temperate zone. About two-thirds of the Earth's land surface between the latitudes 48° N and 45° S is inhabited by termites (Lee and Wood 1971). In tropical and subtropical regions, their numbers exceed 6000 individuals m–2, and their biomass ranges from 5 and 50 gm–2, often surpassing biomass of mammalian herbivores, which range from 0.01 and 17.5 g m–2 (Lee and Wood 1971, Collins 1989).
Termites can be classified into phylogenetically lower and higher groups
(Krishna 1970) (Figure 2.1). The lower termite group consists of six families. They harbor a dense and diverse population of both prokaryotes and flagellated protists in their gut. In terms of their diet, they are restricted to wood or grass (Honigberg 1970,
Noirot 1992). Higher termites (Termitidae) include soil-feeding (humivorous), wood and
4 grass-feeding (xylophagous), and fungus-cultivating species. The majority of termite species belong to the higher termite group (80% of all species). These species also harbor a dense and diverse array of prokaryotes but typically lack flagellated protists and have a more elaborate morphology and social organization (Honigberg 1970, Noirot
1992). Instead, an acquisition of cellulases with the food (in case of the fungus- cultivating termites) or a host origin of the cellulolytic activities has been suggested
(Breznak and Brune 1994). It is widely accepted that termites have a major impact on the decomposition of plant material, thereby increasing microsite heterogeneity, humification, soil conditioning (i.e., translocating and altering soils physically and chemically and maintaining soil fertility), the release of immobilized N and P, the improvement of drainage and aeration, and an increase in exchangeable cations (Lee and
Wood 1971, Wood and Sands 1978, Wood 1988, Collins 1989, Martius 1994, Brussaard and Juma 1996, Lavelle et al. 1997, Holt and Lepage 2000, Donovan et al. 2001).
Therefore, termites actively take part in the permanent alteration of their habitat, especially in tropical ecosystems.
5
Figure 2.1: Phylogenetic scheme of termite evolution showing the presumed relationships of the seven termite families (adapted from Higashi and Abe 1997). The numbers on the lines represent the number of genera/species in the different families (Abe et al. 2000).
Due to their high biomass and density, termites significantly contribute to the emission of atmospheric trace gases such as methane and carbon dioxide (Zinder 1993).
Zimmerman et al. (1982) estimated the contribution of termites to global methane emissions to be as high as 45%. However, more recent estimations based on a larger data set, together with consideration of the great differences in methane emission rates among different termite species, reduced their contribution to less than 5% (Sanderson 1996,
Bignell et al. 1997, Sugimoto et al. 1998).
2.2 Subterranean termites: Coptotermes spp.
The Rhinotermitidae evolved from an extinct ancestral Hodotermitidae, which shared the primitive hodotermitid imago-worker mandibles of the Archotermopsis-
Stolotermes type, with three marginal teeth in the left mandible, and also possessed
6 ocelli (Ahmad 1950). Emerson (1955) speculated that the Oriental region was the main center of origin and dispersal of the Rhinotermitidae. This is the most important family of lower termites in Malaysian forests (Collins 1988, Tho 1992). They occur in standing or fallen trunks and limbs and can cause severe damage to timber and living trees. The
Rhinotermitidae includes six subfamilies: Coptotermitinae, Heterotermitinae,
Psammotermitinae, Termitogetoninae, Stylotermitinae, and Rhinotermitinae.
The Coptotemitinae, includes a single genus Coptotermes, is the most primitive
Rhinotermitidae subfamily, with 71 described species (Kambhampati and Eggleton
2000). Coptotermes contains the largest number of species that are economically important structural pests (Su and Scheffrahn 2000). Coptotermes spp. are widely distributed in tropical and subtropical regions (Figure 2.2), and their spread is facilitated by humans. Environmental factors are known to affect the geographical distribution of subterranean termites (Kofoid 1934). Temperature and moisture are the main environmental factors that affect both geographical and local distribution of termite genera and species (Kofoid 1934). Critical temperatures define ecological or behavioral tolerance (Hu and Appel 2004), and temperature changes may influence seasonal, local, and diurnal distribution. Local occurrence of termites is determined by moisture
(atmospheric and soil), temperature (which regulates relative humidity), and moisture
(which accelerates, restricts, or inhibits vital processes in termites) (Kofoid 1934).
Subterranean termites require a highly humid environment, and this requirement may limit their mobility. However, when they invade tubs or pots containing plants growing in soil, timber that is kept at a constant high moisture level, or timber in contact with the ground for some time before shipment, Coptotermes spp. are readily transported by humans (Adamson 1938, Lever 1952). Termites can build nests out of packing
7 material and fill aboveground voids, which can retain moisture; these abilities are likely to enhance the survival of these pests when they are inadvertently transported (Jenkins et al. 2002).
Many Coptotermes spp. have been identified outside of their native range, including Coptotermes acinaciformis (Froggatt), Coptotermes amanii (Sjöstedt),
Coptotermes crassus Snyder, Coptotermes formosanus Shiraki, Coptotermes frenchi Hill,
C. gestroi , C. heimi, Coptotermes lacteus (Froggatt), Coptotermes testaceus (Linnaeus), and C. vastator. Of these species, C. formosanus and C. gestroi are the most invasive species. They often become economically important pests when they become established in new regions. In the United States, subterranean termite control and damage repair cost approximately US$ 11 billion per year (Su 2002). In Southeast Asia, management of subterranean termites costs an estimated US$ 400 million per year, and Coptotermes spp. are responsible for >90% of the total infestation (Lee 2002, 2007).
8
Figure 2.2: Distribution of Coptotermes spp. (dark area). Modified from Pearce (1997).
2.2.1 Colony structure
Colony founding in subterranean termites is believed to begin after a mating flight, when a male and female alate pair begin reproducing and establish a colony
(Thorne et al. 1999). Over time, neotenics (non-alate derived reproductives) may replace the loss of one or both of the primary reproductives within the nest. A few or dozens of neotenics may develop in colonies, and then inbreeding is believed to occur. This is a trait unique to some families of termites, including the Rhinotermitidae, and it should increase the genetic relatedness within colonies and the genetic contrast among colonies.
According to Myles (1999), nymphoid and ergatoid neotenics in the
Rhinotermitidae may serve either as replacement reproductives or as supplementary reproductives. The following species of the genus Coptotermes are known to produce neotenic reproductives: C. acinaciformis, C. amanii, C. curvignathus, C. formosanus, C. frenchi, C. heimi, C. intermedius, C. lacteus, C. niger, C. sjostedt, and C. vastator (Lenz
9 and Barrett 1982, Lenz et al. 1986, Lenz et al. 1988, Lenz and Runko 1993, Myles
1999). The rate of neotenic development varies greatly among Coptotermes spp. (Lenz et al. 1988). Costa-Leonardo et al. (1999) reported that C. gestroi produces nymphs throughout the year and non-functional neotenics, even in the presence of the imaginal pair. Functional neotenics were also found in colonies of this species, but physogastry was less developed than that of the primary queens (Lelis 1999).
Besides swarming, termite colony proliferation by “budding” has also been suggested based on observational and empirical studies (Thorne et al. 1999). As colonies grow and expand their foraging range, groups of workers (foragers) can split off from the main colony and establish their own independent colony. This creates complicated colony structures consisting of widespread interconnected foraging areas and multiple nests containing a variable number of reproductives. Budding may be detected by the presence of population viscosity (Husseneder et al. 1998, Vargo 2003b). It is also possible for different colonies to fuse or for unrelated reproductives to be adopted into colonies (Clément 1986, Jenkins et al. 1999, Matsuura and Nishida 2001); these processes would lower the genetic contrast among colonies and decrease genetic relatedness within colonies.
The subterranean termite nest in its simplest form consists simply of galleries that extend into the ground and form a more or less diffuse network, with enlarged and more spacious chambers in some places. Such diffuse structures do not have any sharp boundaries, and the network of chambers and galleries also varies over time. All phases of intermediate structure exist between the diffuse nest and the concentrated nests, which occupy a definitive volume and are very distinct from the surrounding soil (Noirot 1970).
10 Concentrated nests most often are constructed as a single unit, but sometimes they consist of several independent units that have the same architecture and are connected by subterranean galleries. Each unit is termed a calie, and when a group of calies are associated with a single colony, the nest is termed polycalic. In the
Rhinotermitidae, certain Coptotermes spp. may build concentrated subterranean nests composed of carton which is probably stercoral (Noirot 1970).
A colony of subterranean termites consists of functional reproductives (king and queen), soldiers, workers, nymphs and brood that live together in close association and forming a physically connected structure (nest) (Krishna 1989). The main role of the queen is to produce eggs. The queen develops an enlarged abdomen containing ovariales and associated tissues (a condition known as being physogastric) (Collins 1984). Besides laying eggs, the queen also is involved in pheromonal regulation of the production of each caste in a colony (Noirot and Noirot-Timothee 1969). Large colonies may include a number of supplementary reproductives, which produce eggs to augment or replace the founding queen (Bignell and Eggleton 1998).
Soldiers and workers are wingless and can be either sterile male or female
(Weesner 1987). They lack compound eyes and ocelli (Ross 1956, Thorne 1996, Pearce
1997). Soldiers usually represent one-tenth of the population at most (Harris, 1957). The major role of soldiers is to defend the colony (Bignell and Eggleton 1998). Thus, they are morphologically large in size and have enlarged mandibles or stopper-like heads for defensive purposes (Krishna 1989). In certain genera, such as Coptotermes, soldiers have a frontal gland that discharges a defensive secretion through a frontal pore that can be toxic or repellent to intruders (Richards and Davies 1978). Soldiers are not capable of feeding on their own and thus depend on workers to feed them via trophallaxis. The
11 worker caste is the most numerous and plays a major role in the survival of the colony.
They forage for food, which consists mainly of wood, paper, and other cellulose-based materials. They carry the food back to their nest, process the digesta, and feed other castes members (Thorne 1996). They are also responsible for constructing the mound and mud tubes (Harris 1957).
Winged reproductives (or alates) of both sexes are produced in large numbers in a mature colony (i.e., aged 3–4 years old) (O’Toole 2003). These alates are potential founders of new colonies when they swarm out of mature nests at particular times of the year (often during or just before rains) (Pearce 1997, Bignell and Eggleton, 1998, Lee and Robinson 2001). They make short, often rather feeble, dispersal flights and then pair up on the ground after the wings have been shed (dealation) (Bignell and Eggleton,
1998). The paired termites will then select a new nesting site, and once they are established mating takes place.
Like cockroaches, termites are hemimetabolic, meaning that they have egg, nymph, and adult stages but no pupal stage. The first batch of eggs is produced by the female within a few days after mating. The larvae are fed with nutrient-rich salivary secretions produced by the parents. The larvae normally undergo a number of moults until they achieve the mature form as sterile workers or soldiers, depending on the need of the colony (Harris 1957). Caste differentiation in termites is not genetically linked but rather is determined by extrinsic factors such as pheromones and hormones (Krishna
1970, Robinson 1996). When a colony is first founded, usually all of the larvae become workers; after some period of time, an occasional larva grows into a soldier (Harris
1957). The colony grows slowly for many years, accompanied by a continuous increase in the number of individuals, enlargement of the nest, and much building activity
12 (Bignell and Eggleton, 1998). Once the colony is well organized, larvae develop into winged termites and the full cycle of development is complete (Harris 1957).
2.2.2 Species identification, and distribution of C. gestroi
Coptotermes gestroi belongs to the family Rhinotermitidae and the genus
Coptotermes. The head of C. gestroi soldiers is pear shaped, rounded laterally, and armed with slender and slightly incurved mandibles. No teeth are apparent on the mandibles. The head possesses a distinct pair of pale, crescent-shaped spots just antero- dorsal of the ocelli (Kirton and Brown 2003). Soldiers have a large opening on the forehead called the fontanelle, from the base of which one pair of setae project dorsal- laterally. The lateral profile of the top of the head just behind the fontanelle shows a weak bulge. The maximum head width of soldiers ranges from 1.34 to 1.53 mm, and the colour ranges from yellow to orange (Tho 1992). Coptotermes gestroi soldiers constitute about 10–15% of foraging groups, aggressively bite when challenged, and exude a white mucous-like secretion from the fontanelle (Scheffrahn and Su 2000). This secretion is used for defensive purposes, and it also gives the soldier body its white coloration (Tho and Kirton 1990, Chey 1996, Woods 2005). The head, pronotum, and dorsal abdomen are dark brown in C. gestroi alates. The darker pigmentation of the C. gestroi alate head provides a contrasting background for two light patches on the face called antennal spots.
The alates of C. gestroi have a total length with wings of about 13–14 mm and a maximum head width of 1.4 mm.
Figure 2.3 shows the important morphological characters of the soldier caste that are commonly used in termite identification. Although still commonly used, many researchers believe that the traditional morphometric approach (i.e., a univariate method)
13 is inadequate for discriminating termite species because the key measurements usually overlap extensively. The multivariate morphometric approach using statistical analyses such as principal component analysis (PCA) and discriminant function analysis (DFA) seem to be better tools for termite identification (Cadrin 2000). In PCA, a relatively small number of factors that represent correlation among sets of many interrelated variables are identified. PCA does not require a priori grouping but rather combines and summarizes the associated measured variables into a number of principle components
(PCs), which are referred to as patterns of covariation in size and shape in morphometric analysis (Wiley 1981).
DFA is a multivariate extension of analysis of variance (ANOVA) that can be used to study variation and covariation among taxonomic groups (Fisher 1936). It is an optimization technique used to categorize the sample according to the examined morphological variables. DFA requires a priori grouping, and discriminant functions
(DFs) are calculated by deriving a weighted combination of variables that have maximal variances between groups relative to within groups. These DFs will reclassify the individuals into the designated groups (Turan 1999).
14
Figure 2.3: Coptotermes gestroi soldier, with a dorsal and profile view of the head, pronotum, and postmentum showing the morphological characteristics: (a) total length, (b) length without head, (c) length of head at base of mandibles, (d) head, length to fontanelle, (e) maximum width of head, (f) width of head at base of mandibles, (g) labrum length, (h) labrum maximum width, (i) segment I of antennae, length, (j) segment II of antennae, length, (k) segment I of antennae, width, (l) segment II of antennae, width, (m) pronotum length, (n) pronotum width, (o) gula length, (p) gula maximum width, (q) gula minimum width.
15 Coptotermes gestroi is an Asian subterranean termite that is endemic to
Southeast Asia. It is the primary pest species of Coptotermes originating from the Indo-
Malayan Region (Assam, Burma, Thailand, Malaysia, and the Indonesian archipelago)
(Roonwal 1970, Tho 1992, Kirton and Brown 2003). Over the last century, human activity has spread this termite species far beyond its native range. It was collected in the
Marquesas Islands (Pacific Ocean) in 1932 and in Mauritius and Reunion (Indian
Ocean) in 1936 and 1957, respectively (Light 1932, Moutia 1936, Paulian 1957).
Coptetermes gestroi has also been found in Madagascar (southern Indian Ocean)
(Edwards and Mill 1986).
Coptotermes gestroi is limited to more tropical localities (to 26 ° N). In the New
World tropics, this species was first reported in Brazil in 1923 and in Barbados in 1937.
Recent collections from other West Indian islands include Antigua, Barbuda, Cuba,
Grand Cayman, Grand Turk, Jamaica (Montego Bay and Port Antonio), Little Cayman,
Montserrat, Nevis, Providenciales, Puerto Rico (San Juan), St. Kitts, and on a boat from the U. S. Virgin Islands (Araujo 1958, Constantino 1998, Scheffrahn et al. 1990, 2003).
It has also been collected in southern Mexico.
In 1996, C. gestroi was collected for the first time in the continental United
States from a storefront and a church in Miami, Florida (Scheffrahn et al. 1994, Su et al.
1997). In 1999, a colony of C. gestroi was discovered infesting a waterfront house in
Key West, Florida. In 2001, a single alate was collected in Lauderhill, Broward Country,
Florida. In 2004, it was verified that six structures in Key West were infested with C. gestroi. A boat moored off Fleming Key and another in dry dock on Stock Island (east of
Key West) also were infested. Three private boats in Florida were found to have shipboard infestations: one arriving from Jamaica, one from Virgin Gorda, and one from
16 Providenciales. These boats were docked in Ft. Pierce, Hollywood, and Ft. Lauderdale, respectively.
In 2005, C. gestroi was found in the cities of Ft. Lauderdale and Riviera Beach
(adjacent to the north of West Palm Beach). These discoveries are new records for established, land-based colonies of this species in Palm Beach and Broward Counties.
The Riviera Beach infestations mark a substantial northward range expansion for this species in Florida, and they are the northernmost established colonies of this tropical species worldwide. More recently, C. gestroi was recorded for the first time in Taiwan
(Tsai and Chen 2003).
2.2.3 Economic importance of C. gestroi in Southeast Asia
Coptotermes gestroi is one of the most economically important and widespread urban pests in Southeast Asia (Su et al. 1997, Kirton and Brown 2003, Lee et al. 2003,
Kirton 2005, Kirton and Azmi 2005). It is a destructive pest of structural wood and agricultural crops in Thailand, Malaysia, and Indonesia (Ahmad 1965, Gay 1967,
Roonwal 1979). Records show that C. gestroi in Southeast Asia attacks dead and dying trees of various species, construction timber, furniture, structural wood, plastics, and synthetic fibers (Roonwal 1979). Coptotermes gestroi forms large colonies, can penetrate a variety of materials and consume a wide range of wood types, and is always a severe structural pest wherever it occurs.
Termite damage and control is estimated to cost approximately US$ 400 million per year in Southeast Asia, and a large proportion of this is caused by C. gestroi (Lee
2007). In Malaysia and Singapore, 85% of buildings infested by termites in urban areas
17 are infested with C. gestroi (Kirton and Azmi 2005). In Thailand, 90% of termite infestations in urban areas are caused by C. gestroi (Sornnuwat et al. 1996).
2.3 Advances in molecular genetic techniques
The advent of molecular genetic approaches has provided a powerful method to gain insight into termite autecology and synecology. Termites are uncontroversially placed within the Orthopteroid group of insect orders (Boudereaux 1979, Hennig 1981).
However, the relationships of termites, mantids, and cockroaches within the superorder
Dictyoptera have been vigorously debated. Recent molecular phylogenetic studies that reviewed the position of Isoptera among the Dictyoptera concluded that termites are nested within cockroaches (Maekawa et al. 1999, Lo et al. 2000, 2003, Terry and
Whiting 2005), thus making Blattaria paraphyletic as presently constituted. Eggleton
(2001) agreed that termites probably are eusocial cockroaches; although their exact position has not yet been firmly established, Cryptocercus is the most plausible sister group. With a more comprehensive molecular phylogenetic study, Inward et al. (2007) proposed that the species presently included in Isoptera should be classified within the family Termitidae as part of the order Blattodea within the superoder Dictyoptera.
Others studies have focused on the family group relationships within the Isoptera
(Noirot 1995, Kambhampati and Eggleton 2000, Thompson et al. 2000), species-level relationships within genera (Miura et al. 2000), and smaller scale phlyogenetic patterns, generally as part of taxonomic revision (Miller 1991, Costantino 1995, Roisin et al.
1996). Scheffrahn et al. (2005) provided genetic evidence for the synonymy of
Nasutitermes corniger, N. costalis, and N. polygynus, and Austin et al. (2005) reported the synonymy of Reticulitermes flavipes and R. santonensis.
18 Besides systematics and taxonomic studies, techniques of molecular biology also provide important new insights into the development and caste differentiation, breeding structure, as well as colony and population dynamics (Roisin and Lenz 1999, Thorne et al. 1999, Lain´e and Wright 2003, Vargo 2003a, b, Raina et al. 2004).
2.3.1 Genetic markers
Various genetic markers, such as RFLP (restriction fragment length polymorphism), AFLP (amplified fragment length polymorphism), RAPD (random amplification of polymorphic DNA), VNTR (variable number tandem repeat), microsatellite polymorphism, SNP (single nucleotide polymorphism), STR (short tandem repeat), mitochondrial DNA, allozymes, and DNA fingerprints, can be used to infer historical attributes of populations or species and to study evolutionary biology
(e.g., phylogenetics and population genetics). Different genetic markers have different characteristics and inheritance patterns and therefore target different but overlapping research areas.
Table 2.1 shows some of the techniques that are useful for studying a vast range of issues. Although allozyme polymorphism has been successfully applied in studies of termites (Clément 1981), this biochemical technique requires either living samples or samples preserved by freezing at –80°C, and all samples have to be from the same caste.
In general, DNA-based molecular methods are more useful. DNA sequences, which can be obtained rapidly by the polymerase chain reaction (PCR) and PCR-based cycle sequencing, are expected to be similar among different castes and developmental stages.
Thus, termite samples from different castes can be preserved in ethanol, facilitating the
19
Table 2.1. Methods available for genetically characterizing individuals and populations and their applicability to each issue. Techniques with + can be used for the purpose specified, and several +s indicate that the technique has high utility; ? indicates that the technique is useful in only some cases; and – indicates that the technique is not useful in this context (Adapted from Frankham et al. 2002)
Issue Chromosomes Allozymes mtDNA RAPD Microsatellites DNA fingerprint Non-instrusive sampling – – +++ ++ +++ - Forensics – + +++ ++ ++ ++ Population size – – +++ + + ?
Estimating Ne – ++ ++ – +++ ? Demographic history – – ++ – + ? Detecting and dating bottlenecks – ++ ++ ++ +++ ? Detecting selection + + +++ + +++ ++ Migration and gene flow – ++ + ++ +++ ++ Individual identification and tracking – – ++ + +++ - Population structure – ++ +? ++ +++ ++ Phylogeography – – +++ – +++ - Source populations to recover endanger species – ++ + ++ +++ +++ Introgression + ++ + ++ +++ ++ Secondary contact – – +++ – +++ + Taxonomic status +++ ++ ++ +++ +++ +++ Sites for reintroduction – – + + +++ - Populations for reintroduction – ++ + ++ +++ +++ Reproductive systems – ++ – + +++ ? Paternity – + – + +++ +++ Founder relationships – ? – +++ ++ +++ Sources for new founders for endangered populations – ++ + ++ +++ ++
20 collection of samples. DNA sequence data contain appropriate phylogenetic information, which should alleviate the problem of homology assignment and incongruence.
2.3.2 Application of mitochondrial DNA for studying termite genetics
In the last 20 years, the extensive use of DNA sequence data and advances in analytical methods have transformed phylogenetic systematics. Phylogenetic relationships among termites, cockroaches, and mantises were examined based on mitochondrial ribosomal RNA genes (Kambhampati 1995, 1996). In 1996, the first termite molecular phylogeny using the mitochondrial 16S rRNA gene was published
(Kambhampati et al. 1996). It is now universally accepted that DNA sequences are a rich source of characters for estimating phylogenies (Hillis et al. 1996).
Mitochondrial DNA (mtDNA) is a double-stranded ring of extrachromosomal
DNA located in the mitochondria. It was discovered in the 1960s by electron microscopy as DNase-sensitive threads inside mitochondria and also by biochemical assays of highly purified mitochondrial fractions (Nass and Nass 1963, Haslbrunner et al.
1964). In most animals, mtDNA is a single circular molecule that contains a homologous set of genes encoding 13 proteins, two ribosomal RNA genes (rRNA), 22 transfer RNA genes (tRNA), and a non-coding section known as the D-loop or control region, and it
~16–20 kb in size (Figure 2.4).
21
Figure 2.4: The genetic map of mtDNA. Modified from Crozier and Crozier (1993).
MtDNA is an ideal genetic marker, and it has been widely used in systematics and phylogenetic studies of termites (Liu and Beckenbach 1992, Kambhampati 1995,
Kambhampati et al. 1996, Frati et al. 1997, Miura et al. 1998, Austin et al. 2004, Ye et al. 2004, Jenkins et al. 2007). Szalanski et al. (2003) reported the first molecular technique for Reticulitermes spp. differentiation in which >97% and 87% of the samples were successfully identified to species using 16S and COII mtDNA genes, respectively.
Mitochondrial genes are known to evolve more rapidly than nuclear genes. The relatively fast mutation rate results in significant variation in mtDNA sequences between species and, comparatively, small variance within species. Differences between
22 haplotypes can be detected through length heterogeneity, restriction fragment analysis, or sequencing of mtDNA regions. Thus, mtDNA is a good marker for analyzing relatively close relationships, such as species relationships within a genus, and for population studies (Miura et al. 2000).
mtDNA is maternally inherited without recombination, thus making it suitable for identifying the distribution of matrilines within populations and colonies. Compared with nuclear DNA, mtDNA has a greater number of copies per cell, which increases the chance of obtaining a useful sample, especially from old samples that have been stored for a long time. In addition, mtDNA can be easily amplified from a variety of taxa and, because it is haploid, the sequence can be obtained without cloning. The high evolutionary rate and an effective population size of mtDNA provide the opportunity to uncover the pattern and tempo of recent historical events without an extensive sequencing effort. Finally, as an area of low recombination, the whole molecule can be assumed to have the same genealogical history. Therefore, mtDNA is the marker of choice in many population, biogeographic, and phylogenetic studies. Its use has been recommended in taxonomic studies, and Hebert et al. (2003) proposed that all described species be given an mtDNA sequence tag or bar-code.
More specifically, sequences of the mitochondrial genes cytochrome oxidase subunit II (COII), rRNA large subunit (16S), and rRNA small subunit (12S) have been extensively applied in phylogenetic reconstructions for a variety of taxa (Liu and
Beckenbach 1992, Kambhampati 1995, 1996, Kambhampati et al. 1996, Frati et al. 1997,
Miura et al. 1998, Austin et al. 2004, Ye et al. 2004, Jenkins et al. 2007). They are suitable for comparing closely related species and genera, and they have shown
23 consistent results in termites samples collected from different locations (Austin et al.
2005).
2.3.3 Application of DNA microsatellites for studying termite population genetics
Microsatellite loci were discovered in the late 1980s. Microsatellites are small sequences of 1–6 bp that are tandemly repeated and typically span between twenty to a few hundred bases and are widely dispersed in eukaryotic and prokaryotic genomes.
(Beckmann and Weber 1992, Weber and Wong 1993, Hancock 1999, Schlötterer 2000).
Microsatellites are commonly located in non-coding intergenic regions and demonstrate high levels of polymorphism (Litt and Luty 1989, Tautz 1989). The variability in the number of repeated nucleotides in an allele is caused by two potential mutational mechanisms: unequal crossing-over (UCO) also called gene conversion (Smith, 1976,
Jeffrey et al., 1994) and slipped-strand mispairing (SSM, also referred to as DNA polymerase slippage) (Levinson and Gutman 1987, Eisen 1999, Hancock 1999, Zane et al. 2002).
In UCO, the two chromosome strands are misaligned during crossing-over, which results in a deletion in one DNA molecule and an insertion in the other. This happens most easily for tandem repeated sequences where the recombination machinery cannot easily determine the correct annealing between two strands (Hancock, 1999). In slipped-strand mispairing, during replication the nascent strand may re-anneal out of phase with the template strand. Eventually, the nascent strand will be longer than the template if the looped-out bases occurred in the nascent strand (insertion mutation) or shorter if the looped-out bases occurred in the template strand (deletion mutation)
(Hancock 1999, Brohede 2003) (Figure 2.5).
24
Figure 2.5: Microsatellite mutations generated by slipped-strand mispairing (adapted from Brohede 2003).
Microsatellite genotyping targets simple repetitive sequences with high mutation rates in non-coding regions of the genome. It provides excellent resolution in elucidating termite population structure and breeding systems and in the identification of colonies.
Microsatellite markers have revealed considerable genetic polymorphism even in introduced termite species on small spatial scales (Husseneder et al. 2003).
25 Alleles that can be amplified using PCR contain repetitive sequences that vary in length according to the variable number of repeats, and they are co-dominant. As microsatellites are usually short in length (100–300 bp), they can still be amplified by
PCR even if the sample DNA was degraded (Taberlet et al. 1999). Microsatellite markers are generally species specific, with greater resolving power and sensitivity compared with other multilocus techniques, such as AFLP (Selkoe and Toonen 2006).
The proportion of heterozygotes (individuals that carry different alleles at gene loci on corresponding chromosomes) in colonies and populations can be detected and analyzed using standard statistical procedures of population genetics. Microsatellite genotypes are assumed to be inherited according to Mendelian rules and thus contain information about ancestries and relationships of individual termites, colonies, and populations (Hoy 1994). The Infinite Allele Model (IAM, Kimura and Crow, 1964) is the appropriate model of microsatellite mutational evolutionary events to use when the mutational process is unknown (O’Connell and Wright, 1997). IAM considers the fact that mutation of microsatellites involves any number of tandem repeats and always gives rise to a new allele that was not previously encountered in the population (Estoup and
Cornuet, 1999). An 18-repeat allele could be just as closely related to a 15-repeat allele as a 16-repeat allele. All that matters is that they are different alleles. In other words, size is not important. The statistic that this model uses is called FST.
26 CHAPTER THREE
MORPHOLOGAL COMPARISONS AND GENETIC RELATIONSHIP
BETWEEN Coptotermes gestroi AND Coptotermes vastator (BLATTODEA:
RHINOTERMITIDAE)1
3.1 Introduction
Among the termite genera within Rhinotermitidae, Coptotermes is probably regarded as the most economically important genus worldwide (Lo et al. 2006). Several species of Coptotermes, including the Formosan subterranean termite, C. formosanus, and the Asian subterranean termite, C. gestroi have been known for their destructive nature to buildings and structures in subtropical and tropical regions, respectively. Su
(2002) reported that C. formosanus accounted for a considerable proportion of the total damage by termites worldwide.
In Malaysia, Thailand, and Singapore, C. gestroi contributes >85% of the total termite damage in buildings and structures in the urban area (Lee 2002, Lee et al. 2003).
Geographic distribution of C. gestroi occurs from Assam through Burma and Thailand to Malaysia and the Indonesian archipelago (Kirton and Brown 2003). It is marked as the most destructive pest termite, damaging structural wood in the urban areas in
Southeast Asia (Kirton 2005). Coptotermes gestroi, reported as C. havilandi in Gay
(1969), has been brought into new geographical regions including the Turks and Caicos
Islands in the Caribbean (Scheffrahn et al. 1990), and Florida in North America (Su et al.
1997) by “hitch-hiking” in the cargo onboard ships and wooden components of sailing
1 Published in Journal of Economic Entomology 100(2): 467–474 (2007), impact factor for 2008: 1.346
27 vessels (Kirton and Brown 2003). More recently, it has also been reported in Taiwan
(Tsai and Chen 2003).
Despite C. gestroi being widely distributed in the tropical Southeast Asia, C. vastator is the primary subterranean termite species in the urban environment in the
Philippines (Yudin 2002), and it accounts for >90% of the termite damage to timber and wooden structures in metro Manila and other urban areas (Acda 2004). Damage costs nearly US$1 million to residential and commercial properties of the Mariana Islands and between US$8 and 10 million for the damage in and around Manila (Yudin 2002). This species was unintentionally introduced to Hawaii in 1918 during a shipment of banana stumps from Manila (Ehrhorn 1934, Gay 1969). Coptotermes vastator was found infesting a single structure in Honolulu at 1963, and it was not discovered again in
Hawaii until 1999 (Woodrow et al. 2001). To date, C. vastator is recognized and known to cause major problems in the islands of Hawaii, Guam, and Saipan (Su and Scheffrahn
1998, Woodrow et al. 2001, Yudin 2002).
Both C. gestroi and C. vastator are very similar based on analysis of morphological characteristics, and it was suspected that C. vastator is a junior synonym of C. gestroi (Kirton 2005). However, no attempt has been executed so far to address this issue from a molecular phylogenetic perspective. Molecular phylogenetic analyses are able to reveal the relationships among populations and to differentiate species regardless of the termite caste (Szalanski et al. 2003). Mitochondrial genes are known to evolve more rapidly than nuclear genes and are therefore good markers to analyze relatively close relationships, such as the species relationships within a genus (Miura et al. 2000). In this chapter, I combined analysis of three mitochondrial genes (12S, 16S, and COII) to determine the genetic relationship between C. gestroi and C. vastator.
28 3.2 Materials and methods
3.2.1 Termites samples
Sixteen termites populations collected from Malaysia, Thailand, Singapore,
Indonesia, the Philippines, Japan, and the United States (Table 3.1) were preserved in absolute ethanol. Five to ten Coptotermes soldiers were randomly selected from each of the populations except Singapore populations due to the limited specimens. The following characteristics were measured using a stereomicroscope (model SZ2-LGB,
Olympus, Tokyo, Japan): total length, length without head, length of head at base of mandibles, head (length to fontanelle), maximum width of head, width of head at base of mandibles, segment I of antennae (length), segment I of antennae (width), segment II of antennae (length), segment II of antennae (width), labrum length, maximum width of labrum, minimum gula width, maximum gula width, gula length, pronotum length, and pronotum width. Sample CG005MY was excluded from the morphometric measurements because it was a dried sample. Voucher specimens preserved in 100% ethanol are maintained at the Insect Museum, Vector Control Research Unit, School of
Biological Sciences, Universiti Sains Malaysia, Penang, Malaysia. Selected published sequences from GenBank (www.ncbi.nlm.nih.gov) on Coptotermes spp. were also included in phylogenetic analyses.
29
Table 3.1 Termite specimens and Genbank published sequences used in this study
Sample code Species Collecting sites GenBank Accession No. Samples from 12S 16S COII this study CG001MY C. gestroi Malaysia, Penang, USM. EF379982 EF379963 EF379945 CG004MY C. gestroi Malaysia, Kuala Lumpur, EF379987 EF379969 EF379951 Bangsar. CG005MY* C. gestroi Malaysia, Muar. EF379988 EF379970 EF379952 CG001SG C. gestroi Singapore, Serenity Terr. EF379983 EF379964 EF379946 CG002SG C. gestroi Singapore, Serangoon. EF379985 EF379967 EF379949 CG001TH C. gestroi Thailand, Bangkok1. EF379977 EF379965 EF379947 CG002TH C. gestroi Thailand, Bangkok2. EF379986 EF379968 EF379950 CG001IN C. gestroi Cibinong, Indonesia. EF379981 EF379962 EF379944 CG002IN C. gestroi Bogor, Indonesia. EF379984 EF379966 EF379948 CF001JP C. formosanus Japan, Wakayama. EF379978 EF379959 EF379941 CF002JP C. formosanus Japan, Wakayama. EF379979 EF379960 EF379942 CF003JP C. formosanus Japan, Okayama. EF379980 EF379961 EF379943 CF001HW C.formosanus USA, Hawaii, Oahu. EF379976 EF379958 EF379940 CV001HW C. vastator USA, Hawaii, Oahu. EF379990 EF379971 EF379953 CV001PHI C. vastator Los Banos, Laguna EF379989 EF379972 EF379954 Philippines, colony1. CV002PHI C. vastator Los Banos, Laguna EF379991 EF379973 EF379955 Philippines, colony2. CV003PHI C. vastator Los Banos, Laguna EF379992 EF379974 EF379956 Philippines, colony3. GS001MY G. sulphurues Malaysia, Penang, USM. EF379993 EF379975 EF379957
Samples from other studies C. gestroi Malaysia, Penang Island. AY536388 C. gestroi Thailand, Bangkok. AY302709 C. gestroi USA, Miama, Florida. AY558907
C. gestroi Turks and Caicos Islands: AY558906 Grand Turk. C. gestroi Antigua and Barbuda. AY558905
C. vastator Philippines, Manila. AY536394 C. vastator Philippines, Wedgewood. AY536393 C. vastator Philippines, Manila. AY536392 C. vastator Philippines, Wedgewood. AY302713 C. vastator Philippines, Manila. AY302712 C. vastator USA, Honolulu, Hawaii. AY302711 * Dried sample
30
3.2.2 DNA extraction
Absolute ethanol-preserved specimens were washed with distilled water and dried on a filter paper. Specimens were then placed in a 1.5-ml tube and homogenized in
STE buffer (50mMsucrose, 25 mM Tris-HCl, pH 7, and 10 mM EDTA). DNA was extracted by incubating with proteinase K at 55°C for 30 min and with 10% SDS for further 3-h incubation. After a single extraction using phenol/chloroform, total DNA was precipitated with absolute ethanol and then resuspended in 25 µl of distilled H2O.
3.2.3 Data collection
Amplification of the 12S, 16S, and COII genes was carried out by polymerase chain reaction (PCR) with primers 12SF (5’-TACTATGTTACGACTTAT-3’) and 12SR
(5’-AAACTAGGATTAGATACCC-3’) for 12S (Simon et al. 1994, Kambhampati
1995), LRJ-13007 (5’-TTACGCTGTTATCCCTAA-3’), and LRN-13398 (5’-
CGCCTGTTTATCAAAAACAT-3’) for 16S (Simon et al. 1994, Kambhampati and
Smith 1995), C2F2 (5’-ATACCTCGACGWTATTCAGA-3’) and TKN3785 for COII
(5’-GTTTAAGAGACCAGTACTTG-3’) (Simon et al. 1994, Hayashi et al. 2003). PCR was performed with 2 µl of extracted DNA and a profile consisting of a precycle denaturation at 94°C for 2 min, a postcycle extension at 72°Cfor 10 min, and 35 cycles of a standard three-step PCR (51.3, 53.1, and 58.2°C annealing) by using a PTC-200,
Peltier Thermal Cycler (MJ Research, Watertown, MA). Amplified DNA from individual termite was purified using a SpinClean Gel extraction kit (column). Samples were sent to Macrogen Inc. (Seoul, South Korea) for direct sequencing in both directions conducted under Big-DyeTM terminator cycling conditions. The reacted products were
31 then purified using ethanol precipitation and run using Automatic Sequencer 3730xl
(Applied Biosystems, Foster City, CA).
3.2.4 Nucleotide data analysis
BioEdit version 7.0.5 software was used to edit individual electropherograms and form contigs. Multiple consensus sequences were aligned using CLUSTAL X. The alignment results were adjusted manually for obvious alignment errors. DNAsequences of other Coptotermes spp. obtained from GenBank were also included into the alignments for phylogenetic comparisons. The distance matrix option of PAUP* 4.0b10
(Swofford 2002) was used to calculate genetic distance according to the Kimura 2- parameter model of sequence evolution (Kimura 1980). Maximum parsimony analyses on the alignments were conducted using Heuristic Search of PAUP* 4.0b10 (Swofford
2002). Gaps were treated as missing data. A bootstrap test was used to access the reliability of trees (Felsenstein 1985). Parsimony bootstrap analysis included 1,000 resamplings was carried out with RANDOM addition sequence procedure, tree bisection-reconnection branch swapping in PAUP*. For maximum likelihood (ML) analysis, the default likelihood analysis parameter settings were used (HKY85- parameter model of nucleotide substitution, empirical base frequencies) with the transition/transversion ratio set to 2:1. These parameters were used to carry out a heuristic search with PAUP*, by using the single most parsimonious tree as the starting tree.
32
3.3 Results and discussion
3.3.1 Morphological characteristics
Soldier of C. formosanus was readily distinguished from C. vastator and C. gestroi with two pairs of setae projecting dorso-laterally from the base of the fontanelle, compared with only a pair of setae in the latter two species (Roonwal and Chhotani 1962,
Scheffrahn et al. 1990, Su et al. 1997). However, it is difficult to distinguish C. vastator from C. gestroi. Both species have a long tongue-shaped labrum extending beyond the middle of the mandibles; hyaline tip with two long hairs at its base. The pronotum, gula, and I and II antennal segments for both species are also congruent.
Variability among C. vastator samples from Manila and Culasi, Philippines, was originally addressed by Light (1929). Large variations were found among the conspecifics of C. vastator from similar and different geographical locations. Su and
Scheffrahn (1998) reported a strong resemblance between the soldiers of C. vastator and
C. gestroi (= C. havilandi), although the soldiers of the latter species were slightly larger than the former species, and had half-moon-shaped antennal spots. Other variabilities such as coloration can be influenced by the age and state of the colony or by environmental and storage conditions (Scheffrahn et al. 2005).
All these previous findings were evident in the current studies where large variations among the examined individuals were recorded. For example, it can vary up to 26% in the length of the soldiers examined, 43 and 31% in terms of length and width of head at base of mandibles, respectively, and 51 and 21% in terms of pronotum length and width, respectively (Table 3.2). The length of the C. vastator soldiers that ranged between 3.93 and 4.95 mm concurs well with that reported in Su and Scheffrahn (1998),
33 but slightly shorter than that recorded in Light (1929). Most of the measured characteristics were found to overlap well with those recorded on the examined C. gestroi soldiers in this study. Our measurements on both C. vastator and C. gestroi also found that they fall within the range of the morphometric characteristics of C. vastator soldiers reported by Light (1929) (Table 3.2). Thus, it is likely that both C. vastator and
C. gestroi are synonymous.
34 Table 3.2 Measurements (in mm) of termite soldiers of three Coptotermes spp.
Length without Length of head at Head, length to Maximum width Width of head at Segment I of Segment I of Species n Length head base of mandibles fontanelle of head base of mandibles antennae, length antennae, width C. gestroi CG001IN 10 4.92 (4.59-5.29) 3.01 (2.81-3.23) 1.36 (1.30-1.44) 1.30 (1.26-1.35) 1.15 (1.10-1.18) 0.54 (0.46-0.58) 0.15 (0.13-0.18) 0.08 (0.07-0.09) CG002IN 10 4.86 (4.15-5.54) 2.92 (2.20-3.51) 1.32 (1.23-1.38) 1.21 (1.15-1.25) 1.14 (1.11-1.18) 0.58 (0.56-0.61) 0.16 (0.13-0.18) 0.08 (0.08-0.10) CG001MY 10 4.13 (3.60-5.11) 2.31 (2.06-2.90) 1.27 (1.12-1.44) 1.27 (1.17-1.47) 1.15 (1.05-1.50) 0.58 (0.50-0.75) 0.16 (0.13-0.21) 0.08 (0.08-0.11) CG004MY 5 3.73 (3.25-4.30) 2.03 (1.76-2.47) 1.24 (1.12-1.33) 1.19 (1.16-1.28) 1.02 (0.99-1.07) 0.52 (0.50-0.54) 0.15 (0.13-0.17) 0.08 (0.08-0.08) CG001TH 10 3.83 (3.51-4.16) 2.07 (1.68-2.33) 1.21 (1.13-1.26) 1.16 (1.12-1.22) 1.07(0.95-1.16) 0.52 (0.48-0.58) 0.15 (0.14-0.16) 0.08 (0.07-0.09) CG002TH 10 3.94 (3.66-4.27) 2.19 (1.96-2.45) 1.22 (1.15-1.30) 1.15 (1.07-1.21) 1.11 (1.06-1.19) 0.53 (0.47-0.60) 0.15 (0.13-0.18) 0.08 (0.07-0.09) CG001SG 1 4.41 2.58 1.34 1.25 1.09 0.6 0.16 0.08 CG002SG 1 5.65 3.71 1.3 1.28 1.05 0.58 0.16 0.08 C. vastator CV001HW 5 4.80 (4.60-4.95) 2.92 (2.65-3.19) 1.45 (1.42-1.49) 1.29 (1.26-1.32) 1.15 (1.09-1.21) 0.61 (0.57-0.68) 0.17 (0.16-0.18) 0.09 (0.08-0.10) CV001PH 10 4.16 (4.05-4.30) 2.47 (2.36-2.63) 1.26 (1.13-133) 1.21 (1.19-1.23) 1.07 (1.04-1.10) 0.54 (0.52-0.56) 0.17 (0.15-0.19) 0.08 (0.07-0.08) CV002PH 10 4.34 (4.03-4.52) 2.46 (2.05-2.73) 1.19 (0.99-1.43) 1.22 (1.17-1.25) 1.10 (1.06-1.16) 0.54 (0.52-0.57) 0.15 (0.15-0.17) 0.08 (0.07-0.09) CV003PH 10 4.24 (3.93-4.50) 2.52 (2.15-2.81) 1.33 (1.16-1.42) 1.31 (1.30-1.32) 1.15 (1.11-1.19) 0.55 (0.53-0.56) 0.16 (0.14-0.19) 0.08 (0.07-0.09) C. formosanus CF001HW 10 5.02 (4.10-5.49) 2.91 (2.04-3.25) 1.47 (1.42-1.54) 1.42 (1.38-1.48) 1.20 (1.17-1.24) 0.60 (0.58-0.64) 0.17 (0.16-0.19) 0.08 (0.08-0.10) CF001JP 10 4.61 (4.41-4.84) 2.50 (2.26-2.65) 1.41 (1.30-1.54) 1.33 (1.30-1.34) 1.20 (1.10-1.66) 0.60 (0.58-0.62) 0.16 (0.14-0.18) 0.08 (0.08-0.08) CF002JP 10 4.73 (4.34-5.02) 2.73 (2.19-2.93) 1.40 (1.24-1.48) 1.37 (1.34-1.41) 1.14 (1.11-1.21) 0.59 (0.56-0.61) 0.16 (0.14-0.18) 0.08 (0.08-0.09) CF003JP 10 4.93 (4.44-5.45) 2.84 (2.43-3.37) 1.44 (1.33-1.56) 1.40 (1.36-1.45) 1.16 (1.14-1.19) 0.60 (0.57-0.62) 0.17 (0.16-0.19) 0.08 (0.07-0.09)
35 Table 3.2 Measurements (in mm) of termite soldiers of three Coptotermes spp. (cont’d)
Segment II of Segment II of Labrum, Gula, minimum Gula, maximum Species Labrum, length Gula, length Pronotum, length Pronotum, width antennae, length antennae, width maximum width width width C. gestroi CG001IN 0.07 (0.06-0.08) 0.06 (0.06-0.07) 0.32 (0.29-0.37) 0.28 (0.27-0.30) 0.24 (0.22-0.25) 0.40 (0.40-0.41) 0.95 (0.84-1.05) 0.40 (0.36-0.43) 0.80 (0.75-0.84) CG002IN 0.06 (0.05-0.07) 0.06 (0.06-0.07) 0.37 (0.30-0.43) 0.28 (0.26-0.30) 0.22 (0.20-0.26) 0.38 (0.35-0.42) 1.04 (0.87-1.15) 0.41 (0.38-0.43) 0.79 (0.75-0.82) CG001MY 0.07 (0.06-0.08) 0.06 (0.06-0.08) 0.34 (0.31-0.40) 0.29 (0.27-0.34) 0.23 (0.20-0.24) 0.39 (0.38-0.43) 0.86 (0.70-1.01) 0.39 (0.34-0.48) 0.78 (0.67-1.06) CG004MY 0.07 (0.05-0.08) 0.06 (0.06-0.06) 0.34 (0.32-0.36) 0.26 (0.24-0.28) 0.21 (0.21-0.22) 0.35 (0.33-0.36) 0.79 (0.71-0.87) 0.32 (0.27-0.35) 0.66 (0.64-0.68) CG001TH 0.07 (0.06-0.07) 0.06 (0.06-0.07) 0.33 (0.26-0.37) 0.26 (0.23-0.28) 0.21 (0.19-0.23) 0.35 (0.34-0.36) 0.77 (0.67-0.93) 0.34 (0.29-0.36) 0.72 (0.68-0.78) CG002TH 0.06 (0.05-0.08) 0.06 (0.06-0.07) 0.33 (0.29-0.38) 0.27 (0.26-0.28) 0.21 (0.18-0.24) 0.36 (0.33-0.38) 0.79 (0.74-0.84) 0.36 (0.33-0.38) 0.75 (0.70-0.80) CG001SG 0.07 0.06 0.38 0.25 0.21 0.39 0.87 0.35 0.75 CG002SG 0.07 0.06 0.35 0.27 0.23 0.37 0.82 0.42 0.77 C. vastator CV001HW 0.07 (0.06-0.08) 0.06 (0.06-0.07) 0.38 (0.34-0.41) 0.29 (0.29-0.30) 0.24 (0.23-0.25) 0.38 (0.37-0.38) 0.84 (0.79-0.89) 0.38 (0.37-0.40) 0.81 (0.78-0.82) CV001PH 0.07 (0.05-0.08) 0.06 (0.05-0.07) 0.33 (0.30-0.36) 0.27 (0.26-0.28) 0.22 (0.20-0.25) 0.36 (0.32-0.38) 0.79 (0.75-0.84) 0.32 (0.28-0.35) 0.72 (0.68-0.76) CV002PH 0.07 (0.06-0.08) 0.06 (0.06-0.07) 0.36 (0.34-0.38) 0.28 (0.27-0.29) 0.21 (0.19-0.23) 0.36 (0.35-0.37) 0.82 (0.77-0.85) 0.35 (0.30-0.39) 0.73 (0.69-0.75) CV003PH 0.07 (0.06-0.08) 0.06 (0.05-0.07) 0.35 (0.33-0.36) 0.27 (0.25-0.29) 0.21 (0.19-0.23) 0.39 (0.37-0.40) 0.80 (0.74-0.90) 0.35 (0.31-0.40) 0.76 (0.72-0.79) C. formosanus CF001HW 0.07 (0.06-0.08) 0.07 (0.06-0.07) 0.42 (0.34-0.53) 0.30 (0.29-0.32) 0.24 (0.23-0.25) 0.42 (0.40-0.44) 0.95 (0.87-1.03) 0.40 (0.35-0.47) 0.81 (0.76-0.87) CF001JP 0.07 (0.05-0.08) 0.06 (0.06-0.07) 0.34 (0.32-0.37) 0.25 (0.25-0.27) 0.21 (0.20-0.23) 0.38 (0.36-0.39) 0.92 (0.84-0.99) 0.38 (0.36-0.41) 0.76 (0.74-0.79) CF002JP 0.06 (0.06-0.07) 0.06 (0.06-0.07) 0.37 (0.30-0.42) 0.27 (0.25-0.28) 0.21 (0.20-0.23) 0.38 (0.36-0.40) 0.90 (0.85-0.96) 0.37 (0.31-0.41) 0.77 (0.75-0.79) CF003JP 0.07 (0.04-0.09) 0.07 (0.06-0.08) 0.39 (0.33-0.44) 0.28 (0.27-0.29) 0.22 (0.21-0.23) 0.41 (0.40-0.42) 0.97 (0.86-1.06) 0.41 (0.37-0.43) 0.81 (0.75-0.84)
36 3.3.2 Nucleotide analyses
DNA sequences of ≈420, 428, and 680 base pairs were obtained for the genes
12S, 16S, and COII, respectively. The average base frequencies were A = 0.45, C = 0.22,
G = 0.12, and T = 0.21 for the 12S gene; A = 0.42, C = 0.25,G = 0.11, and T = 0.22 for the 16S gene; and A = 0.39, C = 0.24, G = 0.14, and T = 0.23 in the COII gene.
Among the 13 populations of C. gestroi/vastator DNA sequences, the genetic diversity ranged from 0 to 0.54% in 12S gene, from 0 to 0.76% in COII gene, and from
0 to 0.80% in 16S gene. The genetic diversity recorded in this study were much lower than that reported by Scheffrahn et al. (2005) where 0–1.8% was found between
Nasutitermes corniger (Motschulsky) and Nasutitermes costalis (Holmgren), which led the authors to propose that both species are synonymous. Within the aligned sequences of C gestroi/vastator, only two nucleotides (at nucleotide positions –61 and –170) in 12S gene, three nucleotides (at nucleotide positions –39, –103, and –135) in 16S gene, and five nucleotides (at nucleotide positions –174, –350, –490, –493, and –646) in COII gene were varied. At some of the above-mentioned positions, the two C. gestroi populations from Indonesia were sharing the same nucleotides as the C. vastator.
Scheffrahn et al. (2005) who proposed the synonymity between N. corniger and N. costalis had recorded variability of 13 nucleotides on 16S gene.
3.3.3 Phylogenetic relationships inferred from 12S, 16S, and COII genes
The multiple alignment of 12S gene sequences, including the outgroup taxon had
365 characters, of which 319 were constant and 15 parsimony informative. For the 16S gene, there were 385 characters, of which 326 were constant and 20 parsimony informative. There were 937 characters, of which 730 were constant and 77 parsimony
37 informative in the alignment for COII gene. The data set had only one most parsimonious tree for each of the genes (Figure 3.1: length = 187, CI = 0.663, RI =
0.841; Figure 3.2: length = 59, CI = 0.932, RI = 0.939; Figure 3.3: length = 231, CI =
0.920, RI = 0.831), as documented using the heuristic search algorithm of PAUP*. The relationship of C. gestroi and C. vastator relative to the other Coptotermes taxa was the same for the ML analysis (–In L 958.22732 for 12S, –In L 1566.57300 for 16S, –In L
2861.87516 for COII; trees not shown).
Bootstrap analysis of the aligned Coptotermes taxa for 12S, 16S, and COII genes with Globitermes sulphureus (Haviland) as the outgroup revealed that C. gestroi and C. vastator formed a common clade with strong bootstrap support. For 12S gene, I included
C. gestroi, C. vastator, C. acinaciformis , and C. lacteus sequences from the GenBank in the phylogenetic analysis. Coptotermes gestroi and C. vastator from existing GenBank fall within the same clade of C. gestroi and C. vastator in this study resulted in a sister group with C. acinaciformis and C. lacteus (Figure 3.1). Another clade was made up of
C. formosanus populations.
For 16S gene, I included more Coptotermes spp. into the analysis. Regardless, C. gestroi and C. vastator remained in the same clade with C. formosanus as its sister group.
Coptotermes acinaciformis and C. lacteus formed a common clade that resulted in a sister group with Coptotermes michaelseni Silvestri. Coptotermes curvignathus
Holmgren, C. heimi, Coptotermes intermedius Silvestri, and Coptotermes sjostedti
Holmgren branched out individually from the tree, whereas the last clade was made up of C. crassus and C. testaceus (Figure 3.2).
38 For the COII gene, the relationship exhibited was similar to that reported for 12S, which is likely due to the same species of Coptotermes used in the analysis (Figure 3.3).
39
Figure 3.1: A single most parsimonious tree obtained for 12S gene by using heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥ 50%. GenBank accession numbers represent the samples that are pooled from the National Center for Biotechnology Information (NCBI) database.
40
Figure 3.2: A single most parsimonious tree obtained for 16S gene by using heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥ 50%. GenBank accession numbers represent the samples that are pooled from the NCBI database.
41
Figure 3.3: A single most parsimonious tree obtained for COII gene by using heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥ 50%. GenBank accession numbers represent the samples that are pooled from the NCBI database.
42 Across the three genes, the transition rate was 100%. Substitutions involving C and T occurred between C. gestroi and C. vastator. Comparable with the results in Ye et al. (2004), COII is considered as the fastest evolving gene of those examined, whereas
12S is the most conserved gene. The three markers provided comparable results in phylogenetic analysis. Different populations of C. gestroi and C. vastator showed high similarity in genetic distance and formed a single C. gestroi/vastator clade in the three phylogenetic analyses. The DNA sequences and morphological data presented here clearly indicate that C. gestroi and C. vastator are synonymous.
3.3.4 Implication of findings to pest management industry
Kirton (2005) reviewed the importance of accurate termite identification to the pest management industry. With the recognition of a single pest species of Coptotermes in Southeast Asia, information concerning C. gestroi and C. vastator species from different geographical regions can be pooled.
In summary, morphometric and molecular phylogenetic analyses by using three mitochondrial genes in this study suggested that both C. gestroi and C. vastator are synonymous. In particular, 1) the morphological characters of both C. gestroi and C. vastator are highly parallel, 2) the genetic diversity between C. gestroi and C. vastator was very low (0–0.80%), and 3) there was only minimal nucleotide differences between
C. gestroi and C. vastator compared with C. gestroi/formosanus and C. vastator/formosanus. There were only 10 nucleotides difference detected across the three genes between C. gestroi and C. vastator. Moreover, out of the 10 nucleotides, only six nucleotides are species specific. In contrast, C. gestroi/vastator differ from C. formosanus at 166 nucleotide positions across the three genes. This suggests that
43 nucleotide differences between C. gestroi and C. vastator might only be due to population variation. I envisage that if a higher number of populations were to be analyzed, the number of species-specific nucleotides might be reduced.
44 CHAPTER FOUR
MOLECULAR SYSTEMATICS OF COPTOTERMES (BLATTODEA:
RHINOTERMITIDAE) FROM EAST ASIA AND AUSTRALIA2
4.1 Introduction
Coptotermes is a genus of the family Rhinotermitidae that is widely distributed in pantropical and subtropical regions. There is a growing concern about the economic impact of subterranean termites, especially those from genus Coptotermes, on urban structures, in forestry, and in agricultural crops in most subtropical and tropical countries of the world (Su and Scheffrahn 2000). These termites represent the major pest species in the Americas, Asia, and Australia (Lo et al. 2006, Takematsu et al. 2006). In
Malaysia, Coptotermes spp. cause >90% of all infestations in buildings and structures
(Lee 2002, 2007).
In addition, several invasive Coptotermes have been transported from their native range in the Orient to other parts of the world (Takematsu et al. 2006). These subterranean termites can extend themselves well beyond their normal habitation range.
For example, C. gestroi is now established as a serious structural pest in Florida, West
Indies, Mexico, Brazil, and Taiwan (Scheffrahn and Su 2000, Kirton and Brown 2003,
Tsai and Chen 2003, Ferraz and Mendez-Montiel 2004, Li et al. 2009).
The international termite taxonomy is in severe decline, especially due to the irregular taxonomic practice in China and Africa (Eggleton 1999). Description rates had risen enormously in China since the mid-1970s, but they decreased greatly in Africa
2 Published in Annals of the Entomological Society of America 102(6): 1077–1090 (2009), impact factor for 2008: 1.346
45 over the same period. In China, between 1946 and 1996, 24 new species of Coptotermes were described based on morphological characteristics that overlapped greatly with sympatric and allopatric specimens in China (Crosland 1995, Eggleton 1999). Two
Coptotermes spp. evaluated in this study, namely Coptotermes cochlearus Xia & He and
Coptotermes dimorphus Xia & He were described by Xia and He (1986) in a controversial taxonomic compilation of Chinese termites. Li (2000) synonymized several Coptotermes spp., but his efforts were limited as most of the earlier species were included without further scrutinization. The lack of robust morphological characters and the limited number of available specimens, especially the imago caste, have made identification of termite at the species level difficult and unreliable (Tho 1992).
On the contrary, outside China, several synonymities were described among the
Coptotermes spp. The current finding in Chapter Three has synonymized C. vastator with C. gestroi. Kirton and Brown (2003) reported taxonomic inconsistencies on the pest status of C. havilandi in different regions within its geographic range and concluded that it is a junior synonym of C. gestroi. The authors also proposed Coptotermes javanicus
Kemner to be a junior synonym to the latter species. Proper identification of species is imperative for generating accurate and good termite taxonomy that provides the baseline for all comparative biology. Moreover, accurate identification of species is needed for the effective management of these insects in urban settings and for establishing an environmentally sound management strategy (Copren et al. 2005, Takematsu et al.
2006).
It is critical to revise the unresolved issues pertaining to termite systematics especially Coptotermes spp.. Many recent studies on Rhinotermitidae have demonstrated the potential of using DNA sequence analysis in species identification, which would
46 enable better understanding of phylogenies (Jenkins et al. 2000, 2007, Austin et al. 2004,
Lo et al. 2004, Ohkuma et al. 2004, Takematsu et al. 2006). Mitochondrial genes have been widely used as reliable genetic markers for molecular phylogenetic studies of termites. However, the taxa analyzed so far include only a few Coptotermes spp..
In this study, I used mitochondrial DNA (mtDNA) sequences (12S, 16S, and
COII) to revise the taxonomy and reveal the relationships among 11 putative
Coptotermes spp. from 29 populations collected from East Asia and Australia. I also included Coptotermes sequences from GenBank into the phylogenetic analysis. By integrating molecular systematic data with morphometric analysis, I present here the phylogenetic relationships among various Coptotermes spp. from East Asia and
Australia.
4.2 Materials and methods
4.2.1 Sample collection
Twenty-nine populations of 11 putative Coptotermes spp. were studied.
Coptotermes samples were collected and preserved in 100% ethanol (Table 4.1).
Preserved soldier specimens were identified up to species level based on morphometric characters using an Olympus SZ2-LGB stereomicroscope connected to a computer- assisted imaging camera. The following eight morphological characteristics of the soldier termites were measured:
47 Table 4.1 Information on the termite specimens collected and used in this study
GenBank accession no. Sample codea Species Collecting sites 12S 16S COII CG001TW C. gestroi Taiwan, Tainan1 FJ235115 FJ376672 FJ384649 CG002TW C. gestroi Taiwan, Chang Jung Christian University FJ235116 FJ376673 FJ384650 CG003TW C. gestroi Taiwan, Tainan2 FJ235117 FJ376674 FJ384651 CF004JP C. formosanus Japan, Kagoshima, colony A FJ235103 FJ376661 FJ384640 CF005JP C. formosanus Japan, Kagoshima, colony B FJ235104 FJ376662 FJ384641 CF006JP C. formosanus Japan, Kagoshima, colony C FJ235105 FJ376663 FJ384642 CF007JP C. formosanus Japan, Kagoshima, colony 1 FJ235106 FJ376664 FJ384643 CF008JP C. formosanus Japan, Kagoshima, colony 3 FJ235107 FJ376665 FJ384644 CF009JP C. formosanus Japan, Kagoshima, colony 5 FJ235108 FJ376666 FJ384645 CF010JP C. formosanus Japan, Kagoshima, colony 6 FJ235109 FJ376667 FJ384646 CF001TW C. formosanus Taiwan, Taichung 1 FJ235096 FJ376659 FJ384647 CF002TW C. formosanus Taiwan, Taichung 2 FJ235097 FJ376660 FJ384648 CF001CN C. formosanus China, Guangzhou, Guangdong Entomological Institute FJ235098 FJ376668 FJ384636 CF002CN C. formosanus China, Guangzhou, Sun Yat-sen University, Pu Garden FJ235099 FJ376669 FJ384637 CF003CN C. formosanus China, Guangzhou, AVON Co. FJ235100 FJ376670 FJ384638 CF004CN C. formosanus China, Guangzhou, Guandong Entomological Institute FJ235101 FJ376671 FJ384639 CK001MY C. kalshoveni Malaysia, Penang, USM FJ235118 FJ376684 FJ384652 CK002MY C. kalshoveni Malaysia, Penang, Pantai Keracut FJ235119 FJ376685 N.A CC001MY C. curvignathus Malaysia, Penang, USM FJ235110 FJ376686 FJ384634 CC002MY C. curvignathus Malaysia, Penang FJ235111 FJ376680 FJ384635 CC001SG C. curvignathus Singapore, Nim Road FJ235112 FJ376681 N.A CT001MY C. travians Malaysia, Perak, Teluk Intan FJ915823 FJ915824 N.A CS001MY C. sepangensis Malaysia, Perak, Bagan Datoh estate FJ235120 FJ376679 N.A CCO001CN C. cochlearus China FJ235113 FJ376682 N.A CD001CN C. dimorphus China FJ235114 FJ376683 N.A CFR001AU C. frenchi Australia, Canberra, ACT FJ235094 FJ376677 FJ384632 CL001AU C. lacteus Australia, Canberra, ACT FJ235095 FJ376678 FJ384633 CA001AU C. acinaciformis Australia, Darwin, NT FJ235092 FJ376675 FJ384630 CA002AU C. acinaciformis Australia, Griffith, NSW FJ235093 FJ376676 FJ384631 a Sample code XX001YY: XX is species ; 001 is sample vial number, and YY is country of collection.
48 maximum head width, head width at base of mandibles, length of head from base of mandibles, maximum width of gula, minimum width of gula, gula length, pronotum length, and pronotum width. These measurement data along with data from Chapter
Three were subjected to analysis of variance (ANOVA), and means were separated by
Tukey’s honestly significant difference (HSD). The sequences for the outgroup species,
Globitermes sulphufeus (Haviland) and Reticulitermes flaviceps Oshima, were procured from Chapter Three and from GenBank from the work from Li et al. (2009), respectively.
Voucher specimens were preserved in 100% ethanol and kept at the Vector
Control Research Unit, School of Biological Sciences, Universiti Sains Malaysia,
Penang, Malaysia. Published sequences of Coptotermes spp. from GenBank
(www.ncbi.nlm.nih- .gov) were also included in the phylogenetic analysis (Table 4.2).
49 Table 4.2 Published GenBank sequences used in this study GenBank accession no. Species Collection sites References 12S 16S COII C. acinaciformis Australia: Darwin, Northern Territory AY536380 AY302701 unpublished C. acinaciformis Australia, Griffin, Canberra, New South Wales AY536381 AY302702 unpublished C. acinaciformis DQ441668 Inward et al. 2007 C. acinaciformis Australia: Darwin DQ367826 Lo et al. 2006 C. acinaciformis Australia: Townsville DQ367827 Lo et al. 2006 C. acinaciformis Australia: Sydney DQ367828 Lo et al. 2006 C. acinaciformis Australia: Olney State Forest, NSW DQ367829 Lo et al. 2006 C. acinaciformis Australia: Canberra DQ367831 Lo et al. 2006 C. acinaciformis Australia: Walpeup DQ367833 Lo et al. 2006 C. frenchi Australia: Canberra DQ367836 Lo et al. 2006 C. frenchi Australia: Melbourne DQ367837 Lo et al. 2006 C. lacteus Australia: Canberra, New South Wales AY536390 AY302710 unpublished C. lacteus Australia: Olney State Forest, NSW DQ367840 Lo et al. 2006 C. lacteus BYU IGC IS41 EU253886 Lo et al. 2006 C. curvignathus Malaysia AY683210 AJ854177 unpublished C. curvignathus Malaysia AY575852 AJ854178 unpublished C. curvignathus Indonesia AY575853 unpublished C. formosanus Japan, Wakayama EF379978 EF379959 EF379941 Chapter 3 C. formosanus Japan, Wakayama EF379979 EF379960 EF379942 Chapter 3 C. formosanus Japan, Okayama EF379980 EF379961 EF379943 Chapter 3 C. formosanus USA, Hawaii, Oahu EF379976 EF379958 EF379940 Chapter 3 C. formosanus USA: GA AY536385 AY302706 unpublished C. formosanus USA: HI AY536386 unpublished C. formosanus USA: New Orleans, LA AY536387 AY302707 unpublished C. formosanus USA: Florida, Golden Beach AY168212 AY168225 Ye et al. 2004 C. formosanus China: Guangzhou AY558911 Scheffrahn et al. 2004 C. formosanus China: Guangzhou AB262474 Noda et al. 2007 C. formosanus Japan: Kagoshima, Amami AB262501 unpublished C. formosanus USA: Hawaii, Oahu AY453588 Austin et al. 2004 C. formosanus China FJ423459 Unpublished C. formosanus Japan AB109529 Ohkuma et al. 2004 Yoshiro and Matsuura C. formosanus Japan DQ493744 2007 C. guangzhouensis Japan AB036673 unpublished C. gestroi Malaysia, Penang, USM EF379982 EF379963 EF379945 Chapter 3 C. gestroi Malaysia, Kuala Lumpur, Bangsar EF379987 EF379969 EF379951 Chapter 3 C. gestroi Malaysia, Johor, Muar EF379988 EF379970 EF379952 Chapter 3 C. gestroi Singapore, Serenity Terrace EF379983 EF379964 EF379946 Chapter 3
50 Table 4.2 Published GenBank sequences used in this study (Cont’d)
C. gestroi Singapore, Serangoon Avenue 3 EF379985 EF379967 EF379949 Chapter 3 C. gestroi Thailand, Bangkok 1 EF379977 EF379965 EF379947 Chapter 3 C. gestroi Thailand, Bangkok 2 EF379986 EF379968 EF379950 Chapter 3 C. gestroi Indonesia, Cibinong EF379981 EF379962 EF379944 Chapter 3 C. gestroi Indonesia, Bogor. EF379984 EF379966 EF379948 Chapter 3 C. gestroi Singapore: Sommerville Wak DQ004476 Jenkins et al. 2007 C. gestroi Singapore: Tampines DQ004477 DQ923419 Jenkins et al. 2007 C. gestroi Singapore: Sime Ave. DQ004478 Jenkins et al. 2007 C. gestroi Puerto Rico: Las Mareas DQ004485 DQ923418 Jenkins et al. 2007 C. gestroi Australia, Queensland, Hamilton DQ004487 Jenkins et al. 2007 C. gestroi Thailand, Bangkok, Royal Forest Department DQ004488 EF092290 Jenkins et al. 2007 C. gestroi USA: Cleveland, Ohio DQ004495 DQ923420 Jenkins et al. 2007 C. gestroi USA: Florida, Key West EF156760 EF092291 Jenkins et al. 2007 C. gestroi USA: Miama, FL AY558907 Scheffrahn et al. 2004 C. gestroi Turks and Caicos Islands: Grand Turk AY558906 Scheffrahn et al. 2004 C. gestroi Antigua and Barbuda AY558905 Scheffrahn et al. 2004 C. vastator USA, Hawaii, Oahu EF379990 EF379971 EF379953 Chapter 3 C. vastator Philippines, Laguna Philippines, Los Banos, colony 1 EF379989 EF379972 EF379954 Chapter 3 C. vastator Philippines, Laguna Philippines, Los Banos, colony 2 EF379991 EF379973 EF379955 Chapter 3 C. vastator Philippines, Laguna Philippines, Los Banos, colony 3 EF379992 EF379974 EF379956 Chapter 3 C. vastator USA: Kalaeloa, Oahu Island, Honolulu, HI AY536391 AY302711 unpublished C. vastator Philippines: Manila AY536392 AY302712 unpublished C. vastator Philippines: Wedgewood, Laguna, Manila AY536393 AY302713 unpublished C. vastator Philippines: Manila AY536394 unpublished C. sepangensis Malaysia AJ854163 unpublished C. sepangensis Malaysia AJ854165 unpublished C. travians Malaysia AJ854169 unpublished C. travians Malaysia AJ854170 unpublished R. flaviceps Taiwan, Taitung County, Lanyu Township EU667782 EU667778 EU627780 Li et al. 2008 G. sulphurues Malaysia, Penang, USM EF379993 EF379975 EF379957 Chapter 3
51 4.2.2 DNA extraction
Total genomic DNA was extracted from a single worker termite from the 29 populations. The preserved specimen was washed with distilled water and laid flat to dry on a piece of filter paper. The intact termite was then frozen with liquid nitrogen and ground in a 1.5-ml tube. After grinding, 800 µl of sterile STE buffer (50 mM sucrose, 25 mM Tris-HCl, pH 7.0, and 10 mM EDTA) was added. DNA was extracted by incubation with proteinase K at 55°C for 30 min, followed by the addition of 10% SDS and incubation for 3 h. After a single extraction using phenol/chloroform, total DNA was precipitated with ethanol and then resuspended in 25 µl of distilled water.
4.2.3 Polymerase chain reaction (PCR) amplification and DNA sequencing
PCR was conducted using the primers shown in Table 4.3 for amplification of
12S, 16S, and COII mtDNA genes (Kambhampati and Smith 1995, Miura et al. 1998).
PCR amplification was performed in a standard 25- or 50-µl reaction volume with 2 µl of total genomic DNA, 1 pmol of each primer, 1.5 mM MgCl2, 2 mM dNTPs, and 5 U/
µl TaqDNA polymerase. Amplification was performed in a PTC-200 Peltier Thermal
Cycler (MJ Research, Watertown, MA) with a profile consisting of precycle denaturation at 94°C for 2 min, a postcycle extension at 72°C for 10 min, and 35 cycles of a standard three-step PCR (51.3, 53.1, and 58.2°C annealing). Amplified DNA from individual termites was purified using a SpinClean gel extraction kit (Intron, Seongnam-
Si, Gyeonggi-do, Korea). Samples were sent to Macrogen Inc. (Seoul, South Korea) for direct sequencing in both directions, which was conducted under BigDye terminator
52
Table 4.3 Primers used for PCR and sequencing
Gene Name Sequence (5’- 3’) TTA CGC TGT TAT CCC TAA 16S LR-J-13007 LR-N-13398 CGC CTG TTT ATC AAA AAC AT
12S 12SF TAC TAT GTT ACG ACT TAT AAA CTA GGA TTA GAT ACC C 12SR
ATA CCT CGA CGW TAT TCA GA COII C2F2 TKN3785 GTT TAA GAG ACC AGT ACT TG
53 (Applied Biosystems, Foster City, CA) cycling conditions. The reacted products were then purified by using ethanol precipitation and ran for analysis using a DNA analyzer
(Automatic Sequencer 3730xl, Applied Biosystems).
4.2.4 Phylogenetic analysis
BioEdit version 7.0.5 software was used to edit individual electropherograms and form contigs (Hall 1999). Multiple consensus sequences were aligned using ClustalW
(Thompson et al. 1994). Multiple alignment parameters for gap opening and extension penalties were 10 and 0.2, respectively. DNA sequences of other Coptotermes spp. obtained from GenBank were included in the alignments for phylogenetic comparisons.
The distance matrix option of PAUP* 4.0b10 (Swofford 2002) was used to calculate genetic distance according to the Kimura 2-parameter model of sequence evolution (Kimura 1980). Maximum parsimony (MP) analysis was performed with TBR branch swapping and 10 random taxon addition replicates under a heuristic search, saving no >100 equally parsimonious trees per replicate. To estimate branch support on the recovered topology, nonparametric bootstrap values were assessed with 1,000 bootstrap pseudo-replicates (Felsenstein 1985).
Before the maximum likelihood (ML) analysis, Modeltest 3.7 was used to find the optimal model of DNA substitution (Posada and Crandall 1998). According to
Posada and Buckley (2004), the Akaike information criterion (AIC) (Akaike 1974) is more advantageous than the hierarchical likelihood ratio test. Therefore, the phylogenetic reconstruction for maximum likelihood was based on the best-fit model, which was selected by AIC. Heuristic ML searches using tree bisection-reconnection
(TBR) branch swapping were performed in PAUP 4.0b10 (Swofford 2002).ML nodal
54 support was estimated using the nonparametric bootstrap (Felsenstein 1985) and was restricted to 1,000 pseudo-replicates.
4.3 Results and discussion
4.3.1 Morphology
The soldier heads in the genus Coptotermes are pear-shaped and rounded laterally. Milky exudate from the fontanelle was produced on the anterior part of the head when the soldier termite was disturbed. No teeth were apparent on the mandibles.
Most standard morphological characters used for the identification of Coptotermes spp. have overlapping ranges; thus, identification was based only on several key characters.
Mandibles of all of the Coptotermes spp. in this study seemed to be similar, except for those of C. curvignathus, which strongly curved inwards. Coptotermes curvignathus was the largest species among all of the genera studied. Coptotermes kalshoveni Kemner is morphologically similar to Coptotermes sepangensis Krishna, but it is considerably smaller and the head capsule is narrow at the anterior end. Coptotermes formosanus is readily distinguished from C. gestroi; the former has two pairs of setae that project dorsal laterally from the base of the fontanelle compared with only one pair of setae in the latter species. For the Australian Coptotermes, C. frenchi is relatively small; the soldier’s head is circular behind and has short mandibles. Coptotermes lacteus is relatively larger and has a flat head and long mandibles. Coptotermes acinaciformis is generally larger than all other Australian Coptotermes spp., and the soldier’s head in this species is relatively long and has long mandibles.
Table 4.4 lists morphological measurements of the termite soldiers. It is clearly shown that the morphological characteristics of many Coptotermes spp. examined in this
55 study were overlapped. Even within the same species, variations in the characters occur.
For example, intraspecies comparisons of several populations of C. formosanus and C. gestroi revealed significant differences (P < 0.05) in morphological characteristics between the populations (Table 4.4). Coptotermes gestroi collected from the natural sites
(secondary rain forests) were found to be larger than those collected from urban areas
(data not shown). Dissimilarity in size between two populations of C. curvignathus from
Malaysia was also observed in this study (CC001MY and CC002MY). Light (1929) and
Kirton and Brown (2003) both reported a continuous variation in size and shape within a single Coptotermes spp.. In addition, termite morphology is influenced by the age and state of the colony and by habitat factors (Scheffrahn et al. 2005). Grace et al. (1995) noted that worker size is correlated with colony population size in aging colonies.
Husseneder et al. (2008) reported a negative correlation between worker size and the number of reproductives in extended family colonies of the Formosan subterranean termite. These observations explain the variation we observed in soldier head morphology in different populations of a given species. They also illustrate that morphological identification of Coptotermes samples at the species level is difficult and has limited reliability.
56 Table 4.4 Measurement (in millimeters) of the soldier termite specimens used in this study and those from Chapter Three
Length of head Species Head width at Species n Max head width from base of Gula, min width Gula, max width Gula, length Pronotum, length Pronotum, width code base of mandibles mandibles C. frenchi CFR001AU 7 0.930 ± 0.010 a 0.449 ± 0.006 b 1.037 ± 0.016 ab 0.213 ± 0.005 c-i 0.319 ± 0.002 ab 0.511 ± 0.040 a 0.293 ± 0.016 a 0.674 ± 0.008 abc C. lacteus CL001AU 10 1.134 ± 0.009 f-k 0.567 ± 0.007 d-k 1.333 ± 0.014 e-k 0.249 ± 0.006 mp 0.383 ± 0.005 f-l 0.689 ± 0.017 bc 0.350 ± 0.007 c-f 0.792 ± 0.011 f-j C. acinaciformis CA001AU 11 1.302 ± 0.017 opq 0.703 ± 0.012 m 1.524 ± 0.023 l-q 0.242 ± 0.004 j-p 0.438 ± 0.006 rs 0.986 ± 0.026 lm 0.438 ± 0.010 lm 0.837 ± 0.010 j-n C. acinaciformis CA002AU 11 1.235 ± 0.013 k-p 0.707 ± 0.010 m 1.571 ± 0.019 pq 0.235 ± 0.011 h-p 0.466 ± 0.009 s 0.89 ± 0.061 d-l 0.453 ± 0.011 m 0.909 ± 0.016 o
C. formosanus CF001CN 10 1.073 ± 0.007 c-h 0.563 ± 0.006 d-j 1.306 ± 0.020 d-j 0.201 ± 0.003 cde 0.356 ± 0.002 c-f 0.839 ± 0.023 d-k 0.374 ± 0.006 e-i 0.739 ± 0.005 d-g C. formosanus CF002CN 10 1.323 ± 0.018 pq 0.633 ± 0.010 l 1.583 ± 0.020 q 0.226 ± 0.006 e-o 0.421 ± 0.006 n-r 0.921 ± 0.027 e-m 0.428 ± 0.006 j-m 0.910 ± 0.007 o C. formosanus CF003CN 10 1.149 ± 0.009 f-l 0.591 ± 0.009 g-l 1.447 ± 0.014 i-q 0.199 ± 0.004 cde 0.383 ± 0.003 f-l 0.911 ± 0.017 e-m 0.389 ± 0.008 e-l 0.772 ± 0.009 d-i C. formosanus CF004CN 10 1.165 ± 0.021 f-l 0.608 ± 0.010 j-l 1.496 ± 0.028 k-q 0.204 ± 0.006 c-f 0.340 ± 0.006 i-o 0.948 ± 0.024 h-m 0.409 ± 0.010 h-m 0.867 ± 0.014 no C. formosanus CF001HW 10 1.204 ± 0.008 i-o 0.600 ± 0.006 i-l 1.468 ± 0.013 j-q 0.238 ± 0.003 h-p 0.416 ± 0.003 m-r 0.950 ± 0.017 h-m 0.405 ± 0.012 g-m 0.809 ± 0.012 h-n C. formosanus CF001JP 10 1.193 ± 0.053 i-n 0.597 ± 0.005 h-l 1.409 ± 0.022 f-q 0.213 ± 0.003 c-i 0.377 ± 0.003 d-k 0.924 ± 0.014 f-m 0.380 ± 0.005 e-j 0.764 ± 0.005 d-h C. formosanus CF002JP 10 1.144 ± 0.011 f-l 0.585 ± 0.004 f-l 1.399 ± 0.025 f-o 0.211 ± 0.002 c-h 0.379 ± 0.004 e-l 0.904 ± 0.012 d-m 0.371 ± 0.011 e-h 0.769 ± 0.005 d-i C. formosanus CF003JP 10 1.163 ± 0.005 f-l 0.600 ± 0.004 h-l 1.441 ± 0.023 h-q 0.218 ± 0.002 d-k 0.407 ± 0.002 k=q 0.968 ± 0.018 klm 0.407 ± 0.007 g-m 0.811 ± 0.009 h-n C. formosanus CF004JP 9 1.286 ± 0.025 nop 0.590 ± 0.008 g-l 1.335 ± 0.023 e-k 0.250 ± 0.005 n-p 0.395 ± 0.007 i-o 0.882 ± 0.040 d-l 0.422 ± 0.010 i-m 0.864± 0.010 mno C. formosanus CF005JP 10 1.159 ± 0.010 f-l 0.588 ± 0.002 g-l 1.439 ± 0.014 h-q 0.213 ± 0.004 c-j 0.403 ± 0.003 j-q 0.904 ± 0.020 d-m 0.404 ± 0.008 g-m 0.800 ± 0.009 g-k C. formosanus CF006JP 10 1.211 ± 0.009 j-o 0.620 ± 0.008 kl 1.530 ± 0.029 m-q 0.244 ± 0.003 k-p 0.423 ± 0.003 o-r 0.963 ± 0.017 j-m 0.434 ± 0.007 k-m 0.863 ± 0.005 l-o C. formosanus CF007JP 10 1.165 ± 0.007 f-l 0.608 ± 0.007 j-l 1.390 ± 0.022 f-n 0.223 ± 0.003 e-n 0.402 ± 0.005 i-p 0.957 ± 0.020 i-m 0.386 ± 0.008 e-k 0.797 ± 0.010 g-j C. formosanus CF008JP 10 1.247 ± 0.006 l-p 0.632 ± 0.008 l 1.567 ± 0.022 opq 0.255 ± 0.004 p 0.430 ± 0.005 pqr 0.992 ± 0.024 lm 0.453 ± 0.006 m 0.904 ± 0.007 o C. formosanus CF009JP 10 1.160 ± 0.004 f-l 0.598 ± 0.005 h-l 1.472 ± 0.012 j-q 0.221 ± 0.005 e-l 0.390 ± 0.003 g-m 0.897 ± 0.017 d-l 0.421 ± 0.006 h-m 0.797 ± 0.007 g-j C. formosanus CF010JP 10 1.171 ± 0.009 g-l 0.594 ± 0.006 g-l 1.419 ± 0.024 g-q 0.221 ± 0.005 e-m 0.403 ± 0.002 j-q 0.955 ± 0.018 h-m 0.434 ± 0.007 k-m 0.809 ± 0.009 h-n C. formosanus CF001TW 5 1.064 ± 0.020 b-f 0.524 ± 0.009 cde 1.292 ± 0.019 d-i 0.188 ± 0.007 bc 0.372 ± 0.009 c-i 0.822 ± 0.012 c-i 0.304 ± 0.012 abc 0.732 ± 0.022 c-f C. formosanus CF002TW 8 1.184 ± 0.015 i-m 0.569 ± 0.009 d-k 1.421 ± 0.031 g-q 0.221 ± 0.006 e-m 0.405 ± 0.005 j-q 0.925 ± 0.017 f-m 0.373 ± 0.006 e-i 0.829 ± 0.011 i-n
57 Table 4.4 Measurement (in millimeters) of the soldier termite specimens used in this study and those from Chapter Three (Cont’d)
C. gestroi CG001IN 10 1.149 ± 0.009 h-m 0.543 ± 0.011 d-h 1.357 ± 0.016 e-l 0.241 ± 0.003 i-p 0.402 ± 0.001 i-p 0.951 ± 0.020 h-m 0.405 ± 0.008 g-m 0.804 ± 0.009 h-m C. gestroi CG002IN 10 1.139 ± 0.007 f-k 0.581 ± 0.005 e-l 1.322 ± 0.017 e-k 0.221 ± 0.007 e-l 0.376 ± 0.007 d-j 1.038 ± 0.025 m 0.403 ± 0.005 g-m 0.793 ± 0.008 f-j C. gestroi CG001MY 10 1.146 ± 0.042 f-l 0.580 ± 0.023 e-l 1.268 ± 0.027 d-h 0.227 ± 0.004 e-o 0.391 ± 0.005 h-n 0.862 ± 0.028 d-l 0.390 ± 0.012 f-l 0.782 ± 0.033 e-j C. gestroi CG004MY 5 1.020 ± 0.014 a-d 0.520 ± 0.008 cd 1.244 ± 0.037 def 0.212 ± 0.002 c-h 0.348 ± 0.005 bcd 0.792 ± 0.033 c-f 0.314 ± 0.016 a-d 0.664 ± 0.007 ab C. gestroi CG001TH 10 1.066 ± 0.019 b-d 0.517 ± 0.009 cd 1.205 ± 0.014 b-e 0.212 ± 0.004 c-h 0.351 ± 0.003 cde 0.766 ± 0.028 cd 0.339 ± 0.007 a-e 0.717 ± 0.011 bcd C. gestroi CG002TH 11 1.112 ± 0.012 f-k 0.530 ± 0.011 c-f 1.215 ± 0.014 cde 0.212 ± 0.006 c-h 0.357 ± 0.006 c-f 0.789 ± 0.014 c-f 0.357 ± 0.006 d-g 0.753 ± 0.011 d-h C. gestroi CG001SG 1 1.093 0.604 1.340 0.208 0.388 0.866 0.350 0.745 C. gestroi CG002SG 1 1.048 0.583 1.299 0.234 0.369 0.822 0.421 0.769 C. gestroi CG001TW 10 1.134 ± 0.016 f-k 0.562 ± 0.014 d-j 1.259 ± 0.020 d-g 0.254 ± 0.004 o-p 0.408 ± 0.002 l-r 0.920 ± 0.026 e-m 0.404 ± 0.011 g-m 0.802 ± 0.005 h-l C. gestroi CG002TW 10 1.136 ± 0.009 f-k 0.564 ± 0.012 d-j 1.137 ± 0.114 a-d 0.248 ± 0.006 l-p 0.400 ± 0.004 i-p 0.914 ± 0.022 e-m 0.409 ± 0.007 h-m 0.807 ± 0.007 h-n C. gestroi CG003TW 10 1.125 ± 0.009 e-j 0.557 ± 0.011 d-j 1.277 ± 0.023 d-i 0.233 ± 0.003 g-p 0.391 ± 0.004 h-n 0.894 ± 0.016 d-l 0.379 ± 0.008 e-j 0.779 ± 0.006 e-j C. vastator CV001HW 9 1.152 ± 0.012 b-h 0.612 ± 0.011 j-l 1.450 ± 0.008 i-q 0.244 ± 0.004 k-p 0.376 ± 0.002 d-j 0.846 ± 0.016 d-k 0.380 ± 0.006 e-j 0.806 ± 0.007 h-n C. vastator CV001PH 10 1.068 ± 0.006 b-h 0.539 ± 0.004 c-g 1.263 ± 0.018 d-g 0.221 ± 0.005 e-m 0.360 ± 0.005 c-g 0.792 ± 0.009 c-f 0.317 ± 0.007 a-d 0.720 ± 0.008 b-e C. vastator CV002PH 11 1.100 ± 0.010 d-i 0.539 ± 0.005 c-g 1.187 ± 0.044 b-e 0.210 ± 0.004 c-h 0.358 ± 0.002 c-f 0.817 ± 0.009 c-h 0.347 ± 0.009 b-f 0.732 ± 0.007 c-f C. vastator CV003PH 10 1.152 ± 0.008 f-l 0.546 ± 0.004 d-i 1.332 ± 0.026 e-k 0.214 ± 0.004 c-j 0.390 ± 0.004 g-m 0.805 ± 0.016 c-g 0.345 ± 0.010 b-f 0.755 ± 0.007 d-h
C. kalshoveni CK001MY 10 1.010 ± 0.012 a-d 0.373 ± 0.006 a 1.066 ± 0.008 abc 0.205 ± 0.007 c-g 0.305 ± 0.005 a 0.621 ± 0.012 ab 0.297 ± 0.008 ab 0.638 ± 0.007 a C. kalshoveni CK002MY 10 0.965 ± 0.005 ab 0.369 ± 0.009 a 0.994 ± 0.020 a 0.212 ± 0.003 c-h 0.303 ± 0.007 t 0.610 ± 0.013 ab 0.300± 0.014 abc 0.646 ± 0.006 a
C. sepangensis CS001MY 5 1.024 ± 0.021 a-e 0.486 ± 0.016 bc 1.188 ± 0.029 b-e 0.170 ± 0.006 ab 0.343 ± 0.007 bc 0.783 ± 0.018 cde C. travians CT001MY 3 0.99 ± 0.011 abc 0.560 ± 0.009 d-j 1.280 ± 0.015 d-i 0.142 ± 0.002 a 0.361 ± 0.006 c-h 0.833 ± 0.052 d-k
C. curvignathus CC001MY 10 1.444 ± 0.010 r 0.690 ± 0.009 m 1.554 ± 0.026 n-q 0.230 ± 0.003 f-p 0.423 ± 0.004 o-r 0.934 ± 0.028 g-m 0.516 ± 0.006 n 0.999 ± 0.012 p C. curvignathus CC002MY 10 1.275 ± 0.018 m-p 0.593 ± 0.015 g-l 1.406 ± 0.027 f-p 0.190 ± 0.006 bcd 0.377 ± 0.004 d-k 0.824 ± 0.024 c-j 0.408 ± 0.009 h-m 0.850 ± 0.011 k-o C. curvignathus CC001SG 3 1.403 ± 00.007 qr 0.627 ± 0.012 l 1.357 ± 0.012 e-m 0.243 ± 0.003 k-p 0.433 ± 0.007 qr 0.900 ± 0.012 d-m 0.507 ± 0.007 n 1.017 ± 0.028 p
C. cochlearus CCO001CN 1 1.268 0.617 1.185 0.200 0.410 0.950 0.480 0.960 C. dimorphus CD001CN 1 1.227 0.640 1.442 0.228 0.391 0.916 0.440 0.910
Means followed by different letters within the same column are significantly different (P < 0.05; Turkey’s HSD).
58 4.3.2 DNA sequence results
DNA sequencing of 12S, 16S, and COII mtDNA amplicons from Coptotermes spp. revealed an average size of 420, 428, and 680 bp, respectively. The level of sequence variation based on the Kimura 2-parameter differed among the three genes.
Sequence divergence ranged from 0.0% between C. formosanus and C. dimorphus to
6.5% between C. sepangensis and C. curvignathus in the 12S gene, from 0.73% between
C. dimorphus and C. cochlearus to 7.6% between C. formosanus and C. travians in the
16S gene, and from 4.4% between C. lacteus and C. frenchi to 11.5% between C. gestroi and C. kalshoveni in the COII gene.
4.3.3 Phylogenetic analysis
The mtDNA sequences of Coptotermes spp. obtained in this study together with sequences from GenBank were aligned by using G. sulphureus and R. flaviceps as the outgroup taxa. The aligned DNA matrices are available at TreeBASE
(http://www.treebase.org, submission SN4594). Before the analysis, 31 characters, 29 characters, and 71 characters were removed from 5’ of the alignments of 12S, 16S, and
COII, respectively. The multiple sequence alignment for the 12S gene, including the outgroup taxa, had 389 characters, of which 299 were constant and 39 were parsimony- informative. For the 16S gene, there were 399 characters, of which 297 were constant and 61 are parsimony-informative. For the COII gene, there were 609 characters, of which 401 were constant and 144 were parsimony-informative.
Maximum parsimony analysis of 12S, 16S, and COII nucleotide matrices resulted in a total of 53, 100, 100 (initial MaxTrees setting = 100) equally most parsimonious trees, respectively (Figure 4.1: length = 257, consistency index [CI] =
59 0.805, retention index [RI] = 0.878; Figure 4.2: length = 219, CI = 0.932, RI = 0.939;
Figure 4.3: length = 372, CI = 0.616, RI = 0.838). The best model for the maximum likelihood analysis of the 12S gene was “GTR+I+G” with the following parameter settings: base = (0.4526, 0.2227, 0.1242, 0.2005), Nst = 6, Rmat = (553073.9375,
831360.3125, 286817.6250, 98618.3984, 1777170.8750), rates = gamma shape = 0.4675, and pinvar = 0.3652. For the 16S gene, the selected model was “HKY+I+G” with the following parameter settings: base = (0.4426, 0.2410, 0.0834, 0.2330), Nst = 2, TRatio =
3.2315, rates = gamma shape = 0.2658, and pinvar = 0.4684. For the COII gene, the
“GTR+I+G” model was selected with the following parameter settings: base = (0.3826,
0.2676, 0.1382, 0.2115), Nst = 6, Rmat = (2.6028, 14.4212, 2.1720, 0.5625, 45.7613), rates = gamma shape = 1.1930, and pinvar = 0.5309. A single tree was recovered for each of the genes (–In L 1369.6742 for 12S, –InL1421.4773 for 16S, and –In
L2792.4729 for COII; trees not shown). The most parsimonious trees with topology similar to that generated by the ML analysis were chosen (Figure 4.1–4.3).
A comparison of the three bootstrap trees revealed no cases in which a grouping with >50% bootstrap support in one tree conflicted with a grouping with >50% bootstrap support in another tree. Based on the overall low level of conflict between the three genes, the data were combined, and the most parsimonious tree was constructed. Two major clades within the Coptotermes genus with six subclades were apparent: I (C. acinaciformis), II (C. lacteus and C. frenchi), III (C. curvignathus), IV (C. kalshoveni, C. sepangensis and C. travians), V (C. gestroi) and VI (C. formosanus) (Figure 4.4). Poor phylogenetic resolution (as indicated by a low bootstrap value) was found among most of these six subclades. However, the monophyletic Coptotermes clade demonstrated that
60
Figure 4.1: The most parsimonious tree obtained for the 12S gene using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥50%.
61
Figure 4.2: The most parsimonious tree obtained for the 16S gene using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥50%.
62
Figure 4.3: The most parsimonious tree obtained for the COII gene using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥50%.
63
Figure 4.4: The most parsimonious tree obtained for combined genes using a heuristic search option in PAUP4.0b10 (Swofford 2002) with morphological characters (bold number below branches). Bootstrap values for 1,000 replicates are listed above the branches supported at ≥50%. 1, pear-shaped head; 2, large size head; 3, small size head; 4, flat head; 5, number of teeth on mandibles; 6, long mandibles; 7, short mandibles; 8, mandibles strongly curve inward; 9, one pair of setae of fontanelle; and 10, two pairs of setae at fontanelle.
64 genetic partitioning is stable for the studied species. The continuous overlapping nature of the data makes it difficult to code the morphological data in the molecular matrix
(Table 4.4). Therefore, only a few distinct morphological characters were mapped on the combined tree (Figure 4.4).
4.3.4 Australian Coptotermes
When other sequences of C. acinaciformis from GenBank were added into the analysis of the 12S, 16S, and COII genes, C. acinaciformis from Darwin (CA001AU) and C. acinaciformis from Griffith (CA002AU) branched out as a sister group with high bootstrap values in the 16S and COII trees (Figure 4.2 and 4.3). The genetic diversity between these two populations of C. acinaciformis was low for the 12S gene (0.5%).
However, for the 16S and COII genes, the genetic diversity between CA001AU and
CA002AU was notably high (3.0% and 3.5%, respectively), despite the morphological similarity of the two populations. Samples from Darwin were more closely related to the samples from Townsville (Figure 4.3). Samples from New South Wales, Griffith,
Sydney, and Canberra were clustered into the same group, with the New South Wales and Griffith samples being closely related to each another. Previous cuticular hydrocarbon and molecular studies suggested that C. acinaciformis was genetically diverse and may even consist of several species (Brown et al. 2004, Lo et al. 2006).
Besides nucleotide differences, termites of this species also are biologically distinct. In the north (Darwin), they are mound builders, whereas in southern Australia (e.g.,
Griffith) they generally nest inside trees, stumps, poles, or filled-in verandahs where timber has been buried. These habitat differences might explain why C. acinaciformis from Darwin and Griffith do not share the same lineage, as shown by differences in their
65 12S, 16S, and COII genes. Relative to the other species, C. acinaciformis exhibited a close relationship with the other two Australian Coptotermes (C. frenchi and C. lacteus).
Coptotermes lacteus formed a sister group with C. frenchi, with genetic diversity of 1.1,
1.3, and 4.4% for the 12S, 16S, and COII genes, respectively.
4.3.5 Southeast Asian Coptotermes
Coptotermes curvignathus is widely distributed in Southeast Asia and has caused damage to wooden construction and tree plantations (Roonwal 1970, Lee 2002,
Takematsu et al. 2006). Coptotermes curvignathus from Malaysia and Singapore share identical sequences across the 12S, 16S, and COII genes. The soldier measurements of one C. curvignathus sample (CC002MY) collected in Penang, Malaysia, were considerably smaller compared with those from other C. curvignathus samples.
However after phylogenetic analysis, CC002MY clustered together with the other C. curvignathus (Clade III) (Figure 4.4). This finding clearly indicates that size variation affects the reliability of morphologically based taxonomy (Takematsu et al. 2006).
The phylogenetic trees constructed based on the 12S, 16S, COII, and the combination of the three genes showed that C. kalshoveni, C. sepangensis, and C. travians are closely related species. These three species clustered under the same clade in all of the trees, although C. kalshoveni had a closer relationship with C. sepangensis than with C. travians. Coptotermes sepangensis closely resembles C. kalshoveni based on the soldier caste (Kemner 1934); morphologically, they can only be separated by the shape and the curvature of the mandibles (Tho 1992). Strong quantitative support by bootstrap analysis also indicated that C. kalshoveni and C. sepangensis are closely related. This result is supported by high degrees of similarity in the 12S (97%), 16S
66 (99%), and COII (99%) genes. Further assessment of the morphological features of alate forms and type specimens would be required to resolve the relationship between these two species. The phylogenetic trees inferred from the three mitochondrial genes demonstrated that Australian Coptotermes spp. have a closer relationship with C. curvignathus, C. kalshoveni, C. sepangensis, and C. travians than with C. gestroi.
However, this relationship was not supported by high bootstrap values.
4.3.6 Coptotermes gestroi
Coptotermes gestroi is believed to be native to Southeast Asia but has spread to the Marquesas Islands (Pacific Ocean), Mauritius and Reunion (Indian Ocean), the New
World tropics (Brazil and Barbados), some islands of the West Indies, southern Mexico, the Southeastern United States (Scheffrahn and Su 2000, Ferraz and Mendez-Montiel
2004), and more recently to Taiwan (Tsai and Chen 2003). The phylogenetic tree generated from the three mitochondrial genes revealed that the populations of C. gestroi could be divided into three geographical groups: group I: Taiwan, the Philippines, and
Hawaii populations (node support of 86%); group II: Thailand, Malaysia, and Singapore populations (node support of 67%); and group III: Indonesia populations (node support of 96%) (Figure 4.4). These results agree with the report of Li et al. (2009).
In this study, I found that the C. gestroi samples from southern Taiwan were more closely related to those from the Philippines and Hawaii than to those from other geographic locations. Luzon Strait is the passage between northern Luzon, the
Philippines, and southern Taiwan. It is an important strait connecting the China Sea on the west with the Philippine Sea on the east, and it extends 200 miles (320 km) between the islands of Taiwan (north) and Luzon, Philippines (south) and is used for shipping
67 and communication. Many ships from the Americas use this route to reach important
East Asian ports. It is possible that C. gestroi was introduced to Taiwan via this maritime route.
Thailand, Malaysia, and Singapore share a well-developed transportation infrastructure, including some world-renowned port systems, railway network, and modern highway system that accommodate intra- and intercountry travel and commerce
(Jenkins et al. 2007). Furthermore, a partnership between railway systems in Thailand and Malaysia allows minimum inspection of sealed railway containers. The numerous modes of transportation, many characterized by minimal inspection of cargo, may have enabled the easy spread of C. gestroi across the three countries. This may explain the close relationship between the C. gestroi samples collected from Thailand, Malaysia, and Singapore.
The two populations of C. gestroi from Indonesia (Cibinong and Bogor) branched out as a distinct group. This will certainly require more C. gestroi samples from Sumatra, Borneo, and Sulawesi to further substantiate current findings.
The high adaptability of C. gestroi allowed it to be transported and fortuitously introduced into many countries. Coptotermes vastator (= C. gestroi; see Chapter Three) was recently found in Minami Torishima (Marcus Island), Japan (Morimoto and Ishii
2000). This was the first record of C. gestroi in Japan. The island is located at 24° 18’ N
153° 58’ E, which shares a similar latitude with Miami, FL in the United States (25° 79’
N 80° 22’ W) where activities of C. gestroi have been recorded. According to Bess
(1970), in 1963 a number of C. vastator (= C. gestroi) imagos and soldiers were found in several buildings in Honolulu, USA. This was the period during which Minami
Torishima (Marcus Island) was occupied by the U.S. army (i.e., between 1952 and 1968).
68 Thus, material transportation conducted by the U.S. Army might be related to the expansion of Coptotermes to various places within the Pacific Ocean (Morimoto and
Ishii 2000).
4.3.7 Chinese Coptotermes
Populations of endemic species generally have higher genetic diversity in the center of origin than introduced regions (Austin et al. 2006, Li et al. 2009). Thus, C. formosanus is believed to have originated from southern China and Taiwan because of the higher level of genetic variability (Li et al. 2009). It is highly adapted to the urban environment and has been dispersed by the railway and by ships (Jenkins et al. 2002,
Scheffrahn and Su 2005, Austin et al. 2008) through 10 southeastern states in the United
States over the past 50 years (Su 2003). It accounts for a considerable amount of the total termite damages (Su 2002). In my study, among C. formosanus populations, samples form Taiwan, Japan, and China grouped together (node support of 63%) and separated out the Hawaii samples and one sample from China (CF001CN) (Figure 4.4).
This result agrees with data in Li et al. (2009). However, more samples of C. formosanus from Hawaii and Florida are required to generate a clearer picture of their population structures.
In this study I only obtained sequences of the 12S and 16S genes for C. dimorphus and C. cochlearus. Therefore, these two species could not be included in the overall analysis of the combined genes. Coptotermes dimorphus and C. cochlearus fell within the subclade of C. formosanus in the 12S tree (Figure 4.1); in fact, they showed
100% similar to C. formosanus for the 12S gene. They branched out as a sister group to
C. formosanus in the 16S tree (Figure 4.2). As the 16S gene is a faster evolving gene
69 than the 12S gene (Ye et al. 2004), this may explain why greater genetic diversity found between these species when the 16S gene was used.
From the phylogenetic analysis, only two haplotypes were found in the 12S gene among 17 populations of C. formosanus from China, Taiwan, Japan, and Hawaii (Table
4.5). These two haplotypes differ only by a single nucleotide. Both C. dimorphus and C. cochlearus differed from C. formosanus by only a single nucleotide in the 12S sequence.
For the 16S gene, four haplotypes were found among the 17 populations of C. formosanus (Table 4.6). These four haplotypes exhibited only one or two nucleotide differences among them. In total, C. dimorphus and C. cochlearus have eight and ten nucleotides that differ from those of C. formosanus, respectively. Thus, the molecular data strongly suggests that both C. dimorphus and C. cochlearus are junior synonyms of
C. formosanus. However, only limited sample size was used in this study. It is important to have more samples examined, including their morphological characters, before the current findings can be confirmed. In addition, C. guangzhouensis sequence from the
GenBank also was grouped within the C. formosanus subclade (Figure 4.2). A thorough molecular phylogenetic study of Coptotermes spp. in China is urgently warranted.
As mentioned before, accurate identification and information about phylogenetic diversity of Coptotermes are important for the improvement of termite management strategies. With the finding of synonymous species, information concerning those species from different geographical regions can now be pooled. Regulatory authorities may now be able to accept efficacy assessments of termite management strategies from any given region if the targeted species is the same, as compared with the past when they were thought to be different species. This will benefit all parties and will in the long run save time and resources (Kirton 2005).
70 Table 4.5 Nucleotide and haplotype variations for 12S gene among C. formosanus, C. dimorphus and C. cochlearus
Species Haplotype 28 124 348 CF001JP F1 A - A CF002JP F1 * - * CF003JP F1 * - * CF004JP F1 * - * CF005JP F1 * - * CF006JP F1 * - * CF007JP F2 * - G CF008JP F1 * - * CF009JP F1 * - * CF010JP F1 * - * CF001CN F1 * - * CF002CN F1 * - * CF003CN F1 * - * CF004CN F1 * - * CF001TW F1 * - * CF002TW F1 * - * CF001HW F1 * - * CD001CN * A * CCO001CN G - *
71
Table 4.6 Nucleotide and haplotype variations for 16S gene among C. formosanus, C. dimorphus, and C. cochlearus
Species Haploptye 60 82 96 107 131 144 145 163 169 185 212 240 277 374 CF001JP Fa A T T C T - - A C T C A T - CF002JP Fa * * * * * - - * * * * * * - CF003JP Fa * * * * * - - * * * * * * - CF004JP Fb * * C * * - - * * * * * * - CF005JP Fa * * * * * - - * * * * * * - CF006JP Fa * * * * * - - * * * * * * - CF007JP Fa * * * * * - - * * * * * * - CF008JP Fa * * * * * - - * * * * * * - CF009JP Fa * * * * * - - * * * * * * - CF010JP Fa * * * * * - - * * * * * * - CF001CN Fa * * * * * - - * * * * * * - CF002CN Fc * * * * * T A * * * * * * - CF003CN Fa * * * * * - - * * * * * * - CF004CN Fa * * * * * - - * * * * * * - CF001HW Fd * * * * * - - * * * * * * T CF001TW Fa * * * * * - - * * * * * * - CF002TW Fa * * * * * - - * * * * * * - CD001CN C * * * * - - C T C T G C T CCO001CN C C * T C - - C G C * G C T
72 In summary, the following six subclades with poor relationships among the
Coptotermes spp. from East Asia and Australia were revealed based on phylogenetic analyses of three mitochondrial genes: (I) C. acinaciformis; (II) C. frenchi and C. lacteus; (III) C. curvignathus; (IV) C. kalshoveni, C. sepangensis, and C. travians; (V)
C. gestroi; and (VI) C. formosanus. Based on the genetic evidence, it is likely that C. dimorphus and C. cochlearus are possibly junior synonyms of C. formosanus; however, more samples would be required to further substantiate this observation. Morphological characters are often ambiguous and the eight measurements on the soldier termites used in this study overlapped for the 11 Coptotermes spp. examined. These results suggest that the use of both molecular and morphological approaches is crucial in ensuring accurate species identification for this genus.
73 CHAPTER FIVE
GENETIC RELATIONSHIP BETWEEN Coptotermes heimi AND Coptotermes
gestroi (BLATTODEA: RHINOTERMITIDAE)3
5.1 Introduction
Coptotermes heimi is a destructive species of subterranean termite found in
Pakistan and India (Roonwal 1959, Roonwal and Chhotani 1962, Gay 1967, Chaudhary and Ahmad 1972). It was originally described as Arrhinotermes heimi (Wasmann 1902), but was later renamed C. heimi by Holmgren (1911). Another species, Coptotermes parvulus (Holmgren 1913), was found to be a junior synonym of C. heimi (Snyder 1949).
Coptotermes heimi attacks both dead and living trees and shrubs (Gay 1969). It has been reported to damage living shisham (Indian rosewood), morus (mulberry), and poplar trees in Pakistan. In India, C. heimi is a common polyphagous species that attacks over
35 different species of plants (Roonwal 1970). Besides being a serious pest of forest trees, this species also infests buildings and wooden structures, especially in Sind and the Northwest Frontier Province of Pakistan (Akhtar 1983).
Kirton and Brown (2003) suggested that C. heimi might be a junior synonym of
C. gestroi. As mentioned in Chapter Three, C. gestroi is a highly destructive subterranean termite species, widely distributed in tropical and subtropical regions
(Light 1929, Wasmann 1986, Scheffrahn et al. 1990, Su et al. 1997, Scheffrahn and Su
2000, Kirton and Brown 2003, Lee 2007). It is the primary subterranean termite species in urban areas in Southeast Asia, and it causes serious damage to timber and wooden
3 Under review in Journal of Economic Entomology, impact factor for 2008: 1.346
74 structures (Yudin 2002, Acda 2004, Kirton 2005). On the Indian subcontinent, C. gestroi has only been reported in Northern India (Assam); it never has been recorded in Pakistan.
According to Roonwal and Chhotani (1962), C. heimi and C. gestroi are very similar based on morphological characteristics. They stated that inconsistencies in the pest status of different species of Coptotermes in different geographical regions are likely due to persistent misidentification in the taxonomic literature, and the use of different names for the same species was likely the result of unrecognized synonymies.
Recognition of a single pest species of Coptotermes originating from Southeast Asia will enable the reorganization and pooling of scientific information from different countries, which in turn will facilitate the development of effective management strategies for the common pest species (Kirton and Brown 2003, Kirton 2005).
As referred to the results in Chapter Three, the combination of molecular phylogenetic analyses and analysis of morphological characteristics are able to reveal synonymity among termite species. Thus, in this Chapter, I used the morphometic data and same mitochondrial genes used in previous chapters (12S, 16S, and COII) to investigate the genetic relationship between C. heimi and C. gestroi.
5.2 Materials and methods
5.2.1 Termite samples
Thirteen populations of C. heimi and one population of C. gestroi were collected from Pakistan and Malaysia, respectively (Table 5.1). Samples were preserved in 70% ethanol for morphological studies and in 100% for molecular studies. Other data on C. heimi, C. gestroi, C. formosanus, Globitermes sulphureus (Haviland) and Reticulitermes
75 Table 5.1 Information on termite samples used in this study
GenBank accession no. Sample code Species Collecting sites 12S 16S COII Core samples from this study CH001PK C. heimi Pakistan, Lahore, Cheecha Watni GQ859246 GQ859252 GU931692 CH002PK C. heimi Pakistan, Lahore, Model Town GQ859247 GQ859253 GU931693 CH003PK C. heimi Pakistan, Lahore, Johar Town GQ859248 GQ859254 GU931694 CH004PK C. heimi Pakistan, Lahore, DHA GQ859249 GQ859255 GU931695 CH005PK C. heimi Pakistan, Lahore, Flate GQ859250 GQ859256 GU931696 CH006PK C. heimi Pakistan, Lahore, LCWU GQ859251 GQ859257 GU931697 CH007PK C. heimi Pakistan, Jhang GU812408 GU812415 GU812423 CH008PK C. heimi Pakistan, Jhang GU812409 GU812416 GU812424 CH009PK C. heimi Pakistan, Jhang GU812410 GU812417 GU812425 CH010PK C. heimi Pakistan, Kasur GU812411 GU812418 GU812426 CH011PK C. heimi Pakistan, Kasur GU812412 GU812419 GU812427 CH012PK C. heimi Pakistan, Attock GU812413 GU812420 GU812428 CH013PK C. heimi Pakistan, Lahore GU812414 GU812421 GU812429 CG088MY C. gestroi Malaysia, Kedah GU177845 GU177846 GU812422 Addition sequences from Chapter Three CG001MY C. gestroi Malaysia, Penang, USM EF379982 EF379963 EF379945 CG004MY C. gestroi Malaysia, Kuala Lumpur, Bangsar EF379987 EF379969 EF379951 CG005MY C. gestroi Malaysia, Johor EF379988 EF379970 EF379952 CG001SG C. gestroi Singapore, Serenity Terrace EF379983 EF379964 EF379946 CG002SG C. gestroi Singapore, Serangoon Avenue 3 EF379985 EF379967 EF379949 CG001TH C. gestroi Thailand, Bangkok 1 EF379977 EF379965 EF379947 CG002TH C. gestroi Thailand, Bangkok 2 EF379986 EF379968 EF379950 CG001IN C. gestroi Indonesia, Cibinong EF379981 EF379962 EF379944 CG002IN C. gestroi Indonesia, Bogor. EF379984 EF379966 EF379948 CV001PH C. gestroi Philippines, Laguna Philippines, Los EF379989 EF379972 EF379954 CV002PH C. gestroi Philippines,Banos Laguna Philippines, Los EF379991 EF379973 EF379955 CV001HW C. gestroi USA,Banos Hawaii, Oahu EF379990 EF379971 EF379953 CF001JP C. formosanus Japan, Wakayama EF379978 EF379959 EF379941 CF002JP C. formosanus Japan, Wakayama EF379979 EF379960 EF379942 CF003JP C. formosanus Japan, Okayama EF379980 EF379961 EF379943 CF001HW C. formosanus USA, Hawaii, Oahu EF379976 EF379958 EF379940 GS001MY G. sulphurues Malaysia, Penang, USM EF379993 EF379975 EF379957 Addition sequences from Chapter Four CG001TW C. gestroi Taiwan, Tainan1 FJ235115 FJ376672 FJ384649 CG002TW C. gestroi Taiwan, Chang Jung Christian FJ235116 FJ376673 FJ384650 CF004JP C. formosanus Japan,University Kagoshima A FJ235103 FJ376661 FJ384640 CF005JP C. formosanus Japan, Kagoshima B FJ235104 FJ376662 FJ384641 CF006JP C. formosanus Japan, Kagoshima C FJ235105 FJ376663 FJ384642 CF007JP C. formosanus Japan, Kagoshima 1 FJ235106 FJ376664 FJ384643 CF008JP C. formosanus Japan, Kagoshima 3 FJ235107 FJ376665 FJ384644 CF009JP C. formosanus Japan, Kagoshima 5 FJ235108 FJ376666 FJ384645 CF001TW C. formosanus Taiwan, Taichung 1 FJ235096 FJ376659 FJ384647 CF002TW C. formosanus Taiwan, Taichung 2 FJ235097 FJ376660 FJ384648
76 Table 5.1 Information on termite samples used in this study (Cont’d)
CF001CN C. formosanus China, Guangzhou, Guangdong FJ235098 FJ376668 FJ384636 CF002CN C. formosanus China, Guangzhou, Sun Yat-sen FJ235099 FJ376669 FJ384637 CF003CN C. formosanus UniversityChina, Guangzhou, AVON Co. FJ235100 FJ376670 FJ384638 CF004CN C. formosanus China,Guangzhou, Guandong FJ235101 FJ376671 FJ384639 Entomological Inst. CK001MY C. kalshoveni Malaysia, Penang, USM FJ235118 FJ376684 CK002MY C. kalshoveni Malaysia, Penang, Pantai Keracut FJ235119 FJ376685 FJ384652 CA001AU C. acinaciformis Australia, Darwin, NT FJ235092 FJ376675 FJ384630 CA002AU C. acinaciformis Australia, Griffith, NSW FJ235093 FJ376676 FJ384631 CFR001AU C. frenchi Australia, Canberra, ACT FJ235094 FJ376677 FJ384632 CL001AU C. lacteus Australia, Canberra, ACT FJ235095 FJ376678 FJ384633 Scheffrahn et al. (2004) C. heimi India AY558908 Sobti et al. (unpublished) C. heimi India EU553816 EU553817 C. heimi India EU553818 Li et al. (2008) TW223 R. flaviceps Taiwan, Taitung County, Lanyu EU627778 EU627780 EU627782 Township
77
flaviceps (Oshima) and other Coptotermes spp. from the GenBank, were also used for phylogenetic studies (see Table 5.1).
5.2.2 Morphological measurements
Twenty soldiers from each of the 13 populations of C. heimi were measured using a stereomicroscope (model SZ2-LGB, Olympus, Tokyo, Japan) connected to a computer-assisted imaging camera with 0.01 mm precision. The following seventeen morphological characteristics were measured: total length, length without head, length of head at base of mandibles, head (length to fontanelle), maximum width of head, width of head at base of mandibles, segment I of antennae (length), segment I of antennae
(width), segment II of antennae (length), segment II of antennae (width), labrum length, maximum width of labrum, minimum gula width, maximum gula width, gula length, pronotum length, and pronotum width. These data along with earlier morphological data of C. gestroi from Chapter Three were subjected to analysis of variance (ANOVA), and means were separated by Tukey HSD (Table 5.2) using SPSS software v18 (SPSS Inc.).
Next, the original values for the 17 characters were transformed to standardize the data set according to the formula: Mtrans = M x 100/SL by Schindler and Schmidt
(2006), where M is the original measurement, Mtrans represents transformed measurement, while SL is the standard length (in this study, I used the total length of the soldier head). The transformed data set was subjected to Principle Components Analysis.
Components are considered useful for explaining the data if the eigenvalues are greater than one (Kaiser 1960). To improve the interpretation of the data, varimax rotation was conducted on the original principle components.
78 Table 5.2 Morphometric data (in millimeters) of the soldier termite specimens of C. heimi and C. gestroi
Length of head at Head, length to Maximum width of Width of head at Segment I of Segment I of Species n Length Length without head base of mandibles fontanelle head base of mandibles antennae, length antennae, width C. gestroi CG001IN* 20 4.92 (4.59-5.29) h 3.01 (2.81-3.23) f 1.36 (1.30-1.44) de 1.30 (1.26-1.35) e 1.15 (1.10-1.18) ef 0.54 (0.46-0.58) ab 0.15 (0.13-0.18) bc 0.08 (0.07-0.09) de CG002IN* 20 4.86 (4.15-5.54) h 2.92 (2.20-3.51) ef 1.32 (1.23-1.38) cde 1.21 (1.15-1.25) b-e 1.14 (1.11-1.18) def 0.58 (0.56-0.61) c 0.16 (0.13-0.18) bc 0.08 (0.08-0.10) e CG001MY* 20 4.13 (3.60-5.11) a-d 2.31 (2.06-2.90) a-d 1.27 (1.12-1.44) b-e 1.27 (1.17-1.47) cde 1.15 (1.05-1.50) def 0.58 (0.50-0.75) c 0.16 (0.13-0.21) bc 0.08 (0.08-0.11) de CG004MY* 20 3.73 (3.25-4.30) a 2.03 (1.76-2.47) a 1.24 (1.12-1.33) bcd 1.19 (1.16-1.28) bcd 1.02 (0.99-1.07) b 0.52 (0.50-0.54) c 0.15 (0.13-0.17) bc 0.08 (0.08-0.08) cde CG001TH* 20 3.83 (3.51-4.16) ab 2.07 (1.68-2.33) ab 1.21 (1.13-1.26) abc 1.16 (1.12-1.22) bc 1.07(0.95-1.16) cde 0.52 (0.48-0.58) abc 0.15 (0.14-0.16) bc 0.08 (0.07-0.09) cde CG002TH* 20 3.94 (3.66-4.27) abc 2.19 (1.96-2.45) abc 1.22 (1.15-1.30) bcd 1.15 (1.07-1.21) b 1.11 (1.06-1.19) def 0.53 (0.47-0.60) abc 0.15 (0.13-0.18) bc 0.08 (0.07-0.09) cde C. heimi CH001PK 20 4.80 (4.60-4.95) gh 2.92 (2.65-3.19) ef 1.40 (1.15-1.49) e 1.29 (1.26-1.32) de 1.17 (1.13-1.21) f 0.57 (0.47-0.61) c 0.17 (0.16-0.18) c 0.09 (0.08-0.10) e CH002PK 20 4.16 (4.05-4.30) a-d 2.47 (2.36-2.63) bcd 1.26 (1.13-1.33) b-e 1.21 (1.19-1.23) b-e 1.07 (1.04-1.10) cd 0.55 (0.52-0.61) abc 0.17 (0.15-0.19) bc 0.08 (0.07-0.08) b-e CH003PK 20 4.34 (4.03-4.52) c-g 2.46 (2.05-2.73) bcd 1.16 (0.99-1.36) ab 1.22 (1.17-1.25) b-e 1.09 (1.06-1.15) c-f 0.54 (0.52-0.55) abc 0.16 (0.15-0.17) bc 0.08 (0.07-0.09) cde CH004PK 20 4.24 (3.93-4.50) b-e 2.52 (2.15-2.81) cde 1.34 (1.16-1.43) cde 1.31 (1.30-1.32) e 1.15 (1.11-1.19) ef 0.55 (0.53-0.57) abc 0.16 (0.14-0.19) bc 0.08 (0.07-0.09) cde CH005PK 20 4.46 (3.91-5.05) d-h 2.66 (2.13-3.06) def 1.29 (1.19-1.41) cde 1.23 (1.08-1.37) b-e 1.11 (1.04-1.18) def 0.55 (0.51-0.60) abc 0.16 (0.15-0.19) bc 0.08 (0.07-0.09) cde CH006PK 20 4.72 (4.32-5.34) fgh 2.93 (2.28-3.71) ef 1.04 (0.94-1.26) a 1.03 (0.94-1.26) a 0.92 (0.87 -1.06) a 0.47 (0.45-0.52) a 0.13 (0.12-0.14) a 0.06 (0.06-0.07) a CH007PK 20 4.35 (4.04-4.85) c-g 2.58 (2.24-3.16) c-f 1.24 (1.09-1.33) abc 1.21 (1.12-1.31) b-e 1.08 (1.03-1.18) cde 0.57 (0.53-0.62) c 0.15 (0.13-0.18) bc 0.08 (0.07-0.09) cde CH008PK 20 4.35 (3.93-4.67) c-g 2.65 (2.27-3.04) def 1.27 (1.18-1.34) bcd 1.27 (1.20-1.31) cde 1.12 (1.07-1.16) def 0.58 (0.54-0.61) bc 0.15 (0.15-0.16) bc 0.08 (0.07-0.08) b-e CH009PK 20 4.28 (4.04-4.64) b-f 2.55 (2.27-2.82) cde 1.25 (1.10-1.32) bcd 1.24 (1.20-1.32) b-e 1.10 (1.05-1.17) def 0.56 (0.52-0.60) c 0.15 (0.13-0.16) ab 0.07 (0.07-0.08) abc CH010PK 20 4.65 (4.23-5.44) e-h 2.90 (2.57-3.59) ef 1.31 (1.22-1.35) cde 1.24 (1.15-1.32) b-e 1.15 (1.10-1.17) ef 0.59 (0.55-0.63) bc 0.16 (0.14-0.18) bc 0.08 (0.06-0.08) b-e CH0011PK 20 4.57 (4.17-5.44) d-h 2.56 (2.27-2.81) cde 1.30 (1.22-1.35) b-e 1.24 (1.16-1.27) b-e 1.12 (1.06-1.17) def 0.58 (0.52-063) c 0.15 (0.13-0.18) bc 0.07 (0.06-0.08) bcd CH012PK 20 4.57 (4.17-5.44) d-h 2.72 (2.13-3.38) def 1.26 (1.23-1.30) b-e 1.24 (1.12-1.31) b-e 1.11 (1.04-1.15) def 0.57 (0.54-0.60) c 0.15 (0.13-0.17) bc 0.08 (0.07-0.08) b-e CH013PK 20 4.36 (3.93-4.63) c-g 2.58 (2.27-2.81) cde 1.22 (1.02-1.41) bcd 1.16 (0.97-1.37) b 1.14 (1.06-1.19) def 0.54 (0.46-0.60) abc 0.13 (0.12-0.14) a 0.07 (0.06-0.09) ab
79 Table 5.2 Morphometric data (in millimeters) of the soldier termite specimens of C. heimi and C. gestroi (Cont’d)
Segment II of Segment II of Labrum, maximum Gula, minimum Gula, maximum Species Labrum, length Gula, length Pronotum, length Pronotum, width antennae, length antennae, width width width width C. gestroi CG001IN 0.07 (0.06-0.08) ab 0.06 (0.06-0.07) bc 0.32 (0.29-0.37) abc 0.28 (0.27-0.30) bc 0.24 (0.22-0.25) bc 0.40 (0.40-0.41) de 0.95 (0.84-1.05) cd 0.40 (0.36-0.43) e-i 0.80 (0.75-0.84) e-h *CG002IN 0.06 (0.05-0.07) a 0.06 (0.06-0.07) bc 0.37 (0.30-0.43) bc 0.28 (0.26-0.30) bc 0.22 (0.20-0.26) ab 0.38 (0.35-0.42) bc 1.04 (0.87-1.15) d 0.41 (0.38-0.43) e-i 0.79 (0.75-0.82) d-g *CG001M 0.07 (0.06-0.08) ab 0.06 (0.06-0.08) bc 0.34 (0.31-0.40) abc 0.29 (0.27-0.34) bc 0.23 (0.20-0.24) ab 0.39 (0.38-0.43) cd 0.86 (0.70-1.01) bc 0.39 (0.34-0.48) d-h 0.78 (0.67-1.06) c-f Y*CG004M 0.07 (0.05-0.08) ab 0.06 (0.06-0.06) abc 0.34 (0.32-0.36) abc 0.26 (0.24-0.28) a 0.21 (0.21-0.22) a 0.35 (0.33-0.36) a 0.79 (0.71-0.87) ab 0.32 (0.27-0.35) a 0.66 (0.64-0.68) a Y*CG001TH 0.07 (0.06-0.07) ab 0.06 (0.06-0.07) abc 0.33 (0.26-0.37) abc 0.26 (0.23-0.28) ab 0.21 (0.19-0.23) a 0.35 (0.34-0.36) a 0.77 (0.67-0.93) a 0.34 (0.29-0.36) abc 0.72 (0.68-0.78) abc *CG002TH 0.06 (0.05-0.08) ab 0.06 (0.06-0.07) bc 0.33 (0.29-0.38) abc 0.27 (0.26-0.28) abc 0.21 (0.18-0.24) a 0.36 (0.33-0.38) ab 0.79 (0.74-0.84) ab 0.36 (0.33-0.38) a-e 0.75 (0.70-0.80) b-e *C. heimi CH001PK 0.07 (0.06-0.08) ab 0.06 (0.06-0.07) bc 0.38 (0.34-0.41) c 0.29 (0.29-0.30) c 0.24 (0.23-0.25) bcd 0.38 (0.37-0.38) bc 0.82 (0.78-0.86) ab 0.38 (0.37-0.40) c-g 0.81 (0.78-0.82) e-h CH002PK 0.06 (0.05-0.08) a 0.06 (0.05-0.07) bc 0.34 0.30-0.40) abc 0.27 (0.26-0.29) abc 0.22 (0.20-0.25) ab 0.36 (0.32-0.38) ab 0.80 (0.75-0.85) ab 0.32 (0.28-0.35) ab 0.72 (0.68-0.76) abc CH003PK 0.07 (0.07-0.08) ab 0.06 (0.06-0.07) bc 0.35 (0.30-0.38) abc 0.28 (0.27-0.29) abc 0.21 (0.19-0.23) a 0.36 (0.35-0.37) ab 0.81 (0.77-0.85) ab 0.35 0.30-0.39) a-d 0.73 (0.69-0.75) bcd CH004PK 0.07 (0.06-0.08) ab 0.06 (0.05-0.07) abc 0.34 (0.33-0.36) abc 0.28 (0.25-0.29) abc 0.21 (0.19-0.23) a 0.39 (0.37-0.40) cd 0.80 (0.74-0.90) ab 0.35 (0.31-0.40) a-d 0.76 (0.72-0.79) b-e CH005PK 0.06 (0.06-0.08) ab 0.06 (0.06-0.07) abc 0.35 (0.26-0.43) abc 0.26 (0.23-0.29) ab 0.26 (0.25-0.27) cde 0.40 (0.39-0.42) cde 0.84 (0.74-0.92) ab 0.41 (0.35-0.44) ghi 0.86 (0.79-0.93) h CH006PK 0.06 (0.05-0.06) a 0.05 (0.05-0.06) a 0.34 (0.25-0.44) abc 0.27 (0.25-0.29) ab 0.28 (0.26-0.29) e 0.41 (0.39-0.44) de 0.86(0.80-0.92) abc 0.36 (0.31-0.45) b-f 0.71 (0.66-0.81) ab CH007PK 0.07 (0.06-0.08) ab 0.07 (0.06-0.08) c 0.36 (0.34-0.38) abc 0.26 (0.22-0.28) ab 0.25 (0.22-0.28) cde 0.41 (0.39-0.43) de 0.84 (0.77-0.91) ab 0.43 (0.39-0.48) hi 0.85 (0.78-0.89) gh CH008PK 0.06 (0.05-0.07) a 0.07 (0.06-0.07) bc 0.36 (0.32-0.39) abc 0.27 (0.24-0.30) abc 0.27 (0.24-0.28) cde 0.42 (0.39-0.43) e 0.84 (0.80-0.90) ab 0.43 (0.40-0.48) hi 0.86 (0.84-0.91) h CH009PK 0.07 (0.06-0.08) ab 0.06 (0.06-0.07) bc 0.32 (0.24-0.37) ab 0.26 (0.22-0.30) ab 0.27 (0.24-0.32) de 0.42(0.38-0.45) de 0.79 (0.73-0.89) ab 0.44 (0.41-0.46) hi 0.85 (0.82-0.87) fgh CH010PK 0.07 (0.06-0.08) ab 0.06 (0.05-0.07) abc 0.36 (0.28-0.42) abc 0.27 (0.25-0.29) abc 0.28 (0.26-0.29) e 0.42 (0.40-0.44) e 0.86 (0.78-0.95) ab 0.44 (0.36-0.50) hi 0.84 (0.79-0.87) fgh CH0011P 0.07 (0.06-0.08) ab 0.06 (0.05-0.07) abc 0.35 (0.29-0.39) abc 0.27 (0.24-0.28) ab 0.28 (0.25-0.32) e 0.41 (0.38-0.45) de 0.82 (0.76-0.95) ab 0.44 (0.41-0.46) i 0.85 (0.82-0.87) fgh KCH012PK 0.06 (0.05-0.07) a 0.07 (0.06-0.08) c 0.31 (0.30-0.34) a 0.27 (0.23-0.29) ab 0.26 (0.22-0.28) cde 0.41 (0.39-0.43) de 0.85 (0.79-0.92) ab 0.44 (0.39-0.47) hi 0.85 (0.72-0.86) gh CH013PK 0.07 (0.06-0.08) b 0.06 (0.05-0.07) ab 0.33 (0.29-0.36) abc 0.27 (0.23-0.29) ab 0.27 (0.26-0.29) e 0.40 (0.39-0.42) cde 0.83 (0.74-0.90) ab 0.41 (0.35-0.45) f-i 0.74 (0.71-0.82) b-e *Based on Chapter Three.
Means followed by the range in parentheses, different letters within the same column are significantly different (P < 0.05; Turkey’s HSD). Discriminant Function Analysis (DFA) being a linear ordination technique was also performed to discriminate among groups. The coefficients of the linear combination obtained through maximizing the ratio of the between- to within-groups variance define canonical vectors (Owen and Chmielewski 1985). In this study, Wilks’ lambda was used in a stepwise method to calculate the percentage overlap between each group. All calculations were performed using SPSS software (SPSS Inc.). Voucher specimens were kept at the Vector Control Research Unit, School of Biological Sciences, Universiti
Sains Malaysia, Penang, Malaysia.
5.2.3 DNA extraction, amplification, and sequencing
Total genomic DNA of a single worker termite from each of the 13 populations of C. heimi and one population of C. gestroi was extracted. The preserved specimen was washed with distilled water and laid flat to dry on a piece of filter paper. The intact termite was frozen with liquid nitrogen and ground in a 1.5 ml tube. After grinding, the
DNA was extracted using the CTB Tissue Extraction Kit (Intron, Seongnam-Si,
Gyeonggi-do, Korea). Amplification of 12S, 16S and COII mitochondrial genes was carried out using polymerase chain reaction (PCR) with the primers 12SF (5’-
TACTATGTTACGACTTAT-3’) and 12SR (5’-AAACTAGGATTAGATACCC-3’) for
12S (Simon et al. 1994, Kambhampati and Smith 1995), LRJ-13007 (5’-
TTACGCTGTTATCCCTAA-3’) and LRN-152 13398 (5’-
CGCCTGTTTATCAAAAACAT-3’) for 16S (Simon et al. 1994, Kambhampati and
Smith 1995), C2F2 (5’-ATACCTCGACGWTATTCAGA-3’) and TKN3785 (5’-
GTTTAAGAGACCAGTACTTG-3’) for COII (Simon et al. 1994, Hayashi et al. 2003).
Two microliters of extracted DNA (>50 ng/µl) from each sample was prepared for PCR
81 using the PTC-200, Peltier Thermal Cycler (MJ Research, Watertown, MA, USA) with a profile consisting of a precycle denaturation at 94°C for 2 min, a postcycle extension at
72°C for 10 min, and 35 cycles of a standard three-step PCR (51.3, 53.1 and 58.2°C annealing). Amplified DNA from individual termites was purified using a SpinClean
Gel Extraction kit (Intron, Seongnam-Si, Gyeonggi-do, Korea). Samples were sent to
Macrogen Inc. (Seoul, South Korea) for direct sequencing in both directions, which was conducted under BigDyeTM terminator cycling conditions. The reacted products were then purified using ethanol precipitation and analyzed with a DNA analyzer (Automatic
Sequencer 3730xl; Applied Biosystems, Foster City, CA, USA).
5.2.4 Phylogenetic analysis
BioEdit v7.0.5 software was used to edit individual electropherograms and form contigs. Multiple consensus sequences were aligned using CLUSTAL W (Thompson et al. 1994). Multiple alignment parameters for gap opening and extension penalties were
10 and 0.2, respectively. The sequences for the outgroup species, G. sulphureus
(Haviland) and R. flaviceps (Oshima), were obtained from Chapter Three and from
GenBank from the work of Li et al. (2009), respectively. Published sequences of
Coptotermes spp. from GenBank (www.ncbi.nlm.nih.gov) also were included in the alignments for phylogenetic comparisons (Table 5.1).
The distance matrix option of PAUP* 4.0b10 (Swofford 2002) was used to calculate genetic distance according to the Kimura 2-parameter model of sequence evolution (Kimura 1980). Maximum parsimony analysis was performed with TBR branch swapping and 10 random taxon addition replicates under a heuristic search, saving no more than 100 equally parsimonious trees per replicate. To estimate branch
82 support on the recovered topology, non-parametric bootstrap values were assessed with
1,000 bootstrap pseudo-replicates (Felsenstein 1985).
Before the maximum likelihood (ML) analysis, I ran Modeltest 3.7 to find the optimal model of DNA substitution (Posada and Crandall 1998). Phylogenetic reconstruction for ML was based on the best-fit model, which was selected by the
Akaike information criterion (Akaike 1974), as it is more advantageous than the hierarchical likelihood ratio test (Posada and Buckley 2004). Heuristic ML searches using TBR branch swapping were performed in PAUP 4.0b10 (Swofford 2002). ML nodal support was estimated using the non-parametric bootstrap (Felsenstein 1985) and was restricted to 1,000 pseudo-replicates to limit computing time.
5.3 Results and discussion
5.3.1 Morphological characteristics
Morphologically, it is difficult to distinguish the soldiers of C. heimi and C. gestroi. Unlike C. formosanus (with two pairs of setae) (Scheffrahn et al. 1990, Su et al.
1997), both species have a pair of setae projecting dorsal laterally from the base of the fontanelle; a long tongue-shaped labrum extending beyond the middle of the mandibles; a hyaline tip with two long hairs at its base; a saddle-shaped pronotum with anterior lobes; and a head narrowed anteriorly. Our measurements of the 17 morphological characteristics of C. heimi soldiers all fell within the range of the morphometric data of
C. gestroi soldiers in Chapter Three (Table 5.2).
Roonwal and Chhotani (1962) stated that C. gestroi is close to C. heimi, as the range of the head length to the mandible base of both species overlapped (1.20–1.45 mm and 1.41–1.53 mm in C. heimi and C. gestroi, respectively). The measurement reported
83 for C. heimi also fell within the range of the described characteristic for C. gestroi in
Chapter Three (Table 5.2). These overlapping data supported Kirton and Brown’s (2003) report that C. heimi might be a junior synonym of C. gestroi. Roonwal and Chhotani
(1962) also stated that the dorsum of the head capsule behind the fontanelle of C. heimi is wavy and slightly swollen, but it is straight and not swollen in C. gestroi. I found this characteristic to be highly variable in C. heimi in the 13 populations that I examined.
Roonwal and Chhotani (1962) also reported great variation in the large samples that they examined and attributed this to intraspecific variation. Table 5.2 showed the variations in the characters occur within both C. gestroi and C. heimi species.
PCA revealed that the first principle component (PC 1) contributed over 89.5% of the morphological variation between C. gestroi and C. heimi (Table 5.3). PC I with all variables loaded strongly positive, representing the overall size. The second principle component (PC 2) accounted for 6.8% of the total variation and was correlated to almost all the characters except total length and length without head. The principle component scores were overlapped extensively in almost all the examined individuals (Figure 5.1).
There were only eight variables (LWH, HF, WH, GMAXW, GMINW, GL, PW and AIL) that were included in the analysis of DFA. The first canonical variate (CV 1) and second canonical variate (CV 2) accounted for 53.4% and 17.9% of total variance, respectively (Table 5.4). The plot of the first two canonical variates also failed to differentiate the two species (Figure 5.2). Plots for both multidimensional analysis showed individuals of C. gestroi and C.heimi were clustered together indicating that morphological characters of both species were highly overlapped. It is clearly shown that C. gestroi and C. heimi could not be distinguished by morphological characters.
84 Table 5.3 Eigenvector elements and percentage of total variance of principle components of morphometic data from C. gestroi and C. heimi soldiers
Measurement Description PC1 PC2 PC3 Lenght Total body length 0.996 -0.087 -0.007 LWH Length without head 0.996 -0.087 -0.007 HF Head, length to fontanelle 0.677 0.683 0.058 HM Length of head at base of mandibles 0.664 0.652 -0.33 WH Maximum width of head 0.694 0.651 0.114 WHM Width of head at base of mandibles 0.586 0.556 0.05 GMAXW Gula, maximum width 0.797 0.327 0.273 GMINW Gula, minimum width 0.719 0.183 0.267 GL Gula, length 0.753 0.216 0.276 LL Labrum, length 0.591 0.323 0.031 LW Labrum, width 0.714 0.431 0.121 PW Pronotum, width 0.757 0.453 0.278 PL Pronotum, length 0.686 0.282 0.346 AIL Segment I of antennae, length 0.546 0.536 -0.132 AIIL Segment II of antennae, length 0.349 0.361 0.052 AIW Segment I of antennae, width 0.476 0.602 -0.007 AIIW Segment II of antennae, width 0.523 0.562 0.124 % Variance 89.49 6.81 0.98
85 Table 5.4 Within-group correlation of variables to the canonical variates
Measurement CV1 CV2 CV3 LWH 0.476 -1.131 0.303 HF -0.697 -0.111 0.254 WH -2.258 -0.297 -2.132 GMAXW 1.34 -0.044 -0.04 GMINW 0.836 -0.263 -1.124 GL -0.213 -0.706 0.919 PW 1.065 2.307 1.433 AIL -0.484 0.264 0.572 % Variance 53.4 17.9 11.4
86
Figure 5.1: Plot of the first two principle components for nineteen termite populations.
87
Figure 5.2: Plot of the first two canonical variables for nineteen termite populations.
88 5.3.2 Genetic analysis
Partial DNA sequences consisting of 420, 428 and 680 bp of 12S, 16S and COII genes were obtained from the 13 populations of C. heimi and one population of C. gestroi in this study. In addition to DNA sequences on C. gestroi, C. formosanus and other Coptotermes spp. (Chapter Three and Four), C. heimi from India (Scheffrahn et al.
2004, Sobti et al. unpublished) were obtained from GenBank and included for phylogenetic analysis (Table 5.1). All of the three mitochondrial genes of all ingroup taxa were A + T rich (65.67% in 12S, 65.29% in 16S and 61.44% in COII genes) and had a base use with an excess of As. Of these gene fragments, COII was most variable
(431 constant characters) and informative (120 informative sites). 16S had 376 constant characters with 52 informative sites. 12S was more conserved (368 constant characters) and less informative (38 informative sites). Based on chi-square tests for base frequency homogeneity among taxa, the base frequency distribution of the two gene fragments and their combined data set were homogenous (P = 1.0). Among the C. gestroi DNA sequences, the genetic diversity ranged from 0.00% to 0.56% in 12S, 0–0.50% in 16S, and 0–1.43 % in COII genes.
Among the 13 populations of C. heimi from Pakistan, there were four haplotypes in 12S with the genetic diversity ranged from 0.00% to 0.51%; two halpotypes in 16S, genetic diversity range from 0 to 0.51%, and three haplotypes in COII, genetic diversity range from 0 to 0.47 %. Across the three genes, the transition rate was 100% between C. heimi and C. gestroi in 16S genes, while in 12S and COII genes, transition and tranversion rate was in a ratio of 60:40. The genetic divergence between C. heimi and C. gestroi based on the Kimura 2- parameter varied up to 1.7% (7 bp) in the 12S gene,
1.4% (5 bp) in the 16S gene, and 2.63% (23bp) in the COII gene.
89 The genetic divergence between C. gestroi and C. heimi in 12S and 16S genes is much lower when compared to the genetic divergence between Nasutitermes corniger
(Motschulsky) and Nasutitermes costalis (Holmgren). Scheffrahn et al. (2005) who proposed the synonymity of the latter two species had recorded the genetic divergence up to 1.8% with variability of 13 nucleotides in 16S gene. We found a higher genetic divergence between C. gestroi and C. heimi in COII gene (2.63%). As COII gene is considered as the fastest evolving and the longest gene examined (Ye et al. 2004), the value of 2.63% is considered relatively low. Among other species which we included in the analysis, the least genetic divergence between two different species was 8.2%.
Coptotermes gestroi is a widespread species in the tropics and subtropics, the base substitutions between C. heimi and C. gestroi recorded in this study could be considered to be intraspecies variation. The slight divergence of C. heimi from C. gestroi may due to 1) natural selection (the mutation occurred as a result of the adaptation of C. heimi to different geographical, climatic, and ecological niches, 2) the limited gene flow in Pakistan and India (interbreeding among these isolated C. heimi populations, along with introduced and accumulated mutation).
5.3.3 Phylogenetic relationship inferred from 12S, 16S, COII, and combined gene
analysis
Maximum parsimony analysis of the 12S, 16S, COII and the combined genes resulted in a total of 9, 16, 68, and 100 (initial MaxTrees setting = 100) equally most parsimonious trees, respectively (Figure 5.3: length = 127, Consistency Index (CI) =
0.889, Retention Index (RI) = 0.674; Figure 5.4: length = 168, CI = 0.912, RI = 0.684;
Figure 5.5: length = 223, CI = 0.877, RI = 0.763, Figure 5.6: length 269 = 237, CI =
90 0.902, RI = 0.859). The best model for the ML analysis of the 12S gene was
“GTR+I+G” with the following parameter settings: base = (0.4533, 0.2244, 0.1189,
0.2034), Nst = 6, Rmat = (563043.9745, 732350.2145, 266837.6836, 9673.2974,
1847327.7362), rates = gamma shape = 0.4975, and pinvar = 0.3272. For the 16S gene, the selected model was “HKY+I+G” with the following parameter settings: base =
(0.4335, 0.2377, 0.1094, 0.2194), Nst = 2, TRatio = 3.7352, rates = gamma shape =
0.2937, and pinvar = 0.4627. For the COII gene, the selected model was “HKY+I+G” with the following parameter settings: base = (0.3894, 0.2514, 0.1341, 0.2250), Nst = 4,
TRatio = 3.8645, rates = gamma shape = 0.3156, and pinvar = 0.4563. For the combined genes, the “GTR+I+G” model was selected with the following parameter settings: base
= (0.4159, 0.2408, 0.1242, 0.2191), Nst = 6, Rmat = (2.7546, 15.9667, 2.6439, 0.6456,
38.9887), rates = gamma shape = 2.2751, and pinvar = 0.6395. A single tree was recovered for each of the genes (–In L 1276.8662 for 12S, –In L 1553.4895 for 16S, –In
L 2695.3887 for COII, and –In L 28665.6983 for the combined genes, trees not shown).
The most parsimonious trees with a topology similar to that generated by the ML analysis were chosen (Figures 5.3–5.6).
A comparison of the three bootstrap trees revealed no cases in which a grouping with more than 50% bootstrap support in one tree conflicted with a grouping with more than 50% bootstrap support in another tree. Based on the overall low level of conflict between the three genes, the data were combined, and the most parsimonious tree was constructed.
For the parsimony tree of the 12S gene, populations of C. gestroi were partitioned into four groups (Figure 5.3). Group I consisted of C. gestroi from Taiwan,
Hawaii and the Philippines; group II contained C. gestroi from Malaysia, Singapore, and
91 Thailand; group III had C. gestroi from Indonesia; and group IV consisted of C. heimi from Pakistan and India. These groupings, however, had moderate bootstrap values (<
70%). They were distinctly different from C. formosanus and other Coptotermes spp. which were included in the analysis. For the 16S gene, populations of C. gestroi did not partition into four groups as in 12S gene, yet, C. gestroi and C. heimi remained in the same clade. Coptotermes gestroi from Kedah and Johor, Malaysia grouped together with
C. heimi with moderate bootstrap support of 68% (Figure 5.4). For COII and combined genes, the relationship exhibited was similar to 12S gene (Figures 5.5 & 5.6).
Coptotermes gestroi and C. heimi formed a common clade with strong bootstrap support
(91% and 85% in COII and combined genes, respectively).
92
Figure 5.3: A single most parsimonious tree obtained for 12S gene by using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1000 replicates are listed above the branches supported at >50%.
93 Figure 5.4: A single most parsimonious tree obtained for 16S gene by using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1000 replicates are listed above the branches supported at >50%.
94
Figure 5.5: A single most parsimonious tree obtained for COII gene by using a heuristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1000 replicates are listed above the branches supported at >50%.
95
Figure 5.6: The most parsimonious tree obtained for combined 12S, 16S and COII genes by using a heueristic search option in PAUP4.0b10 (Swofford 2002). Bootstrap values for 1000 replicates are listed above the branches supported at >50%.
96 Due to low intraspecies genetic variation, all C. formosanus populations from different regions fall into same clade without further subdivision into different geographical groups (Figures 5.3–5.6). On the other hand, the combination of 12S, 16S and COII genes revealed the phylogenetic relationship of C. gestroi populations which agree with the report of Li et al. (2009) and Chapter Four. The additional group IV from
C. gestroi clade in this study showed that C. heimi from Pakistan and India are belonged to another geographical group of C. gestroi. This result supported that C. heimi is a junior synonym of C. gestroi.
In summary, morphological analysis and molecular phylogenetic analyses using
12S, 16S, and COII mitochondrial genes suggested that C. heimi is a junior synonym of
C. gestroi. I found that the morphological characters of C. heimi and C. gestroi overlapped greatly, that low genetic diversity existed between C. heimi and C. gestroi
(1.4–2.63%). The nucleotide differences observed could be intraspecies variations that are due to different geographical, climatic, and ecological niches.
97 CHAPTER SIX
IDENTIFICATION OF POLYMORPHIC MICROSATELLITE
MARKERS FOR THE ASIAN SUBTERRANEAN TERMITE
Coptotermes gestroi (WASMANN) (BLATTODEA:
RHINOTERMITIDAE)4
6.1 Introduction
Subterranean termite, particulary Reticulitermes and Coptotermes spp. have gained increasing attention from entomologist. Besides exerting a major economic impact in many countries, these wide spread genera are among the most species-rich genera of all the lower termites, and are especially important as transitional taxa between the lower and higher temites (Kambhampati and Eggleton 2000, Austin et al. 2004, Lo et al. 2004, Inward et al. 2007). They exhibit features intermediate between lower and higher termites such as feeding and nesting habits. Thus, furthur understanding of the life history, population biology, community ecology, and invasion biology of these genera can provide insights into 1) the evolution and remarkable radiation of the higher termite, and 2) the factors underlying their invasion success (Vargo and Husseneder
2009).
Despite of the importance of C. gestroi which has been discussed earlier, many studies have only focused on C. formosanus. When compared to mitochondrial DNA sequences that show limited genetic variation at the intercolonial level (Chapter Three), polymorphic genetic markers can be used to elucidate the details of colony organization, population structure, and relationships among introduced and native populations (Thorne
4 Published in Molecular Ecology Resources 9, 1460 – 1559 (2009)
98 et al. 1999, Vargo 2003a, b, Vargo et al. 2003, Dronnet et al. 2005). To be able to address these issues and other ecological aspects of the species, I developed a set of microsatellite markers for C. gestroi.
6.2 Materials and methods
Termites were collected from infested buildings and trees at various localities in
Peninsular Malaysia, Singapore, Thailand, and Taiwan. Five worker termites from a colony from Penang Island were used to construct the genomic library. DNA from pooled sample tissue was extracted using the CTB Tissue Extraction Kit (Intron,
Seongnam-Si, Gyeonggi-do, Korea) after grinding in liquid nitrogen. The genomic DNA was digested with Rsal and ligated with MluI annealed adaptor. The ligation was hybridized on the Hybond N+ membrane with bound oligonucleotides consisting of 5–
14 repeats of di-, tri-, and tetra-nucleotide motifs (GACA, GATA, AAAT, GATG, CAA,
CA, GT, AAT, CT, and AAG). Fragments that contained a microsatellite were cloned into pGEM-T Easy vector (Promega, Madison,Wiscosin, USA). The plasmids were transformed using JM109 E. coli competent cells (Promega) to obtain a 100-clone library. After blue-white screening, 39 positive clones were sequenced. After elimination of overlapping sequences, 14 primer sets were designed using the web-based Primer3 plus program (www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). Each of the forward primers was fluorescently labeled using the fluorophores 6-FAM (Bioneer,
Daedeok-gu, Daejeon, Korea), PET, NED, or VIC (Applied Biosystems, Foster City,
California, USA).
To assess variability of the microsatellites, total genomic DNA of worker termites from different populations was extracted (20 populations from Malaysia, 3
99 populations from Singapore, 2 populations from Thailand, and 3 populations from
Taiwan) using the CTB Tissue Extraction Kit (Intron). Only one individual per population was genotyped. PCR amplification was performed in a standard 50 µl reaction volume with 4 µl of total genomic DNA, 1 pmol of each forward and reverse primer, 1.5 mM MgCl2, 2 mM dNTPs, and 5U/µl Taq DNA polymerase. All loci were amplified on a MJ Research PTC-200, Peltier Thermal Cycler (Waltham, USA), consisting of a precycle denaturation step at 94 ºC for 2 min, followed by 35 cycles of a standard three-step PCR at 94 ºC for 30 sec, 58 ºC for 30 sec, and 72 ºC for 1 min, and a postcycle extension at 72 ºC for 10 min. Fragment analysis was conducted using an
ABI3730 sequencer, GeneScan-500 LIZ size standard, and Peak Scanner v1.0 (Applied
Biosystems). Observed and expected heterozygosities were calculated and an exact
Hardy-Weinberg probability test was conducted using the Markov chain method with default parameters using GenePop version 3.1b (Raymond and Rousset 1995).
6.3 Results and discussion
From the 28 colonies of C. gestroi screened for variability using the 14 primer pairs, 11 loci showed variation within all of the study populations with 6–14 alleles per locus (Table 6.1). In five polymorphic loci (CG9, CG19, CG21, CG29, and CG31), the observed heterozygosity was less than the expected, with significant deviation from HW equilibrium (P < 0.05, HW exact test in GenPop version 3.1b; Raymond and Rousset
1995) at CG2, CG23, and CG33 in Malaysia. This result might have been due to the sampling strategy or might be unique to the populations tested. However, inbreeding is common in subterranean termites (Thorne et al. 1999). Further testing across different
100 populations is required. There was no significant linkage disequilibrium across all pairs of loci.
The microsatellite markers of 11 polymorphic loci described in this study provide a sensitive tool for investigating the colony and population genetic structure of both native and introduced populations of C. gestroi.
101 Table 6.1 Characterization of 11 microsatellite loci of C. gestroi. Number of individuals examined (n) (only one individual per colony was genotyped), sequenced allele (*), annealing temperature (Ta), number of alleles (Na), observed heterozygosity (HO), expected heterozygosity (HE), and probability by HW exact test (P) are listed for each locus Size Ta Locus Origin n Na H H P Core repeat* Primers (5’–3’) Accession no. (bp) (oC) o E
CG2 A 28 165-181 58 8 0.82 0.82 1.0 (CA)29 F: AAGCTTGCAGCGTTAAGTGG GQ412733 B 20 3 0.75 0.67 0.035 R: CCAGAGTTGGGTTTTGTGCT
CG6 A 28 160-188 58 12 089 0.88 0.798 (GT)12 F: CACCCGTTGAAATTGACCTT GQ412734 B 20 7 0.85 0.82 0.467 R: AGACCGTTCCCAGCAACTTA
CG9 A 28 241-259 58 9 0.82 0.83 0.758 (TATG)25(TG)10 F: AAAGCGCTCATCCGTCTATC GQ412735 B 20 4 0.80 0.70 0.206 R: CTCAAGCTATGCATCCAACG
CG19 A 28 198-210 58 6 0.89 0.90 0.798 (GT)22 F: TATGAAGGGGGAACAGAACG GQ412736 B 20 4 0.65 0.69 0.064 R: CTCAAGCTATGCATCCAACG
CG21 A 28 159-197 58 10 0.79 0.85 0.598 (CCAA)9(CCAT)6 F: TACCTACCGACCGAACGAAC GQ412737 B 20 8 0.85 0.76 0.057 R: TCCTGTTACAGCCCCAAAAG
CG23 A 28 170-190 58 10 0.86 0.85 0.962 (GT)9 F: GGGAATTCGATTGTCTCTGC GQ412738 B 20 8 0.80 0.85 0.029 R: CACAGTTTGACCCACACCTG
CG26 A 28 188-228 58 9 0.89 0.88 0.733 (CT)6(GTCT)7 F: AAGCTCATTACGCGCAACTT GQ412739 B 20 7 0.90 0.86 0.171 R: GTGAAGCCTCGACAATGAGG
CG29 A 28 213-245 58 14 0.89 0.95 0.822 (GT)15(GA)10 F: GCTGCCTTGTCCCTTACTCA GQ412740 B 20 10 0.85 0.90 0.119 R: AGCACACCGCTCTACGAAGT
102 Table 6.1 Cont’d
CG31 A 28 150-170 58 9 0.82 0.89 0.808 (GT)5 F: CGCATGGATGTTTTGTCTGT GQ412741 B 20 6 0.75 0.82 0.311 R: CCTACTCACAGCAGGTGTCG
CG33 A 28 185-224 58 13 0.92 0.89 0.471 (CAA)16 F: TTTCATCGAAAGTGCAGGTG GQ412742 B 20 5 0.94 0.81 0.004 R: TGTCGCATGAGGAAGATGTC
CG38 A 28 218-254 58 9 0.89 0.85 0.716 (GACA)18 F: GCCATAAAAGTGGTCCGTCA GQ412743 B 20 4 0.85 0.76 0.410 R: TTACGCGTGGACTAGATTCAG
Note: A: Malaysia, Singapore, Thailand, and Taiwan B: Malaysia only
103 CHAPTER SEVEN
GENETIC ANALYSIS OF COLONY AND POPULATION STRUCTURE OF
THE ASIAN SUBTERRANEAN TERMITE, Coptotermes gestroi, IN NATIVE
AND INTRODUCED POPULATIONS
7.1 Introduction
Successful spread of invasive termite species to new habitats mainly depends on the number of reproductives within a colony, its breeding system and modes of colony founding and dispersal (Ross 1993, Chapman and Bourke 2001, Dronnet et al. 2005,
Vargo and Husseneder 2009). A colony in insect socioecology, is often regarded as an important unit of selection, an intermingling group of socially cooperative individuals of a given species (Thorne et al. 1999). A number of distinct colonies in a particular area, each with its own nest, reproductive organization, genetic structure, foraging range and territory, and mechanisms for identifying colony members and non-members make up a population (Thorne et al. 1999, Vargo and Husseneder 2009).
Due to the cryptic nature of the subterranean termite, investigation into the colony and population structure, breeding system and dispersal behavior of C. gestroi have been difficult. This information is essential to provide a better understanding on the biology and ecology of C. gestroi. Polymorphic genetic markers are an effective tool to elucidate the details of colony organization, population structure, and relationships among introduced and native populations (Ross 2001, Vargo et al. 2003).
In this study, I used the polymorphic microsatellite markers of C. gestroi developed in Chapter Six to investigate the colony and population genetic structure of 89 colonies of C. gestroi collected from various parts of Asia. I also determined the
104 relationship between genetic variation and geographical distribution. Finally, I discerned the gene flow among the various populations.
7.2 Materials and methods
7.2.1 Site and sample collection
Coptotermes gestroi specimens were collected from infested buildings and trees at various localities in Peninsular Malaysia, East Malaysia, Singapore, Thailand,
Indonesia, the Philippines, Taiwan, and Hawaii (Figure 7.1). Eighty nine colonies were collected and sorted into 12 putative population groups (Kedah, Penang Island, Penang mainland, Kuala Lumpur, Johor, Sabah, Singapore, Thailand, Indonesia, the Philippines,
Taiwan, and Hawaii) based on their geographical localities to enable the hierarchical analysis of colony and population process to be carried out. Table 7.1 shows the details of the sample collections. All termites were preserved in 100% ethanol for subsequent microsatellite analysis. Voucher specimens from each colony were deposited at the
Vector Control Research Unit, School of Biological Sciences, Universiti Sains Malaysia,
Penang, Malaysia.
7.2.2 Genotype analysis and markers evaluation
Genomic DNA of individual termites was extracted using the CTB Tissue
Extraction Kit (Intron, Seongnam-Si, Gyeonggi-do, Korea) after grinding the whole worker bodies in liquid nitrogen. I used ten microsatellite markers which were developed in Chapter Six for the genotyping (Table 7.2). For each primer pair, the
105
Figure 7.1: Map of sample locations.
106 Table 7.1 Population, location, number of colony (N), and number of Coptotermes gestroi workers that were analyzed (n) Region Population N Locale n Malaysia Kedah 1 Kangar, Taman Mewah 8 1 Alor Setar, Pokok Sena 10 1 Alor Setar, Jalan Langgar 10 1 Alor Setar, Changloon 10 1 Alor Setar, Pulai 10 Penang Island 1 Minden, USM 20 1 Teluk Kumbar 12 1 Island Grades 10 Island Grade, Solok 1 Tembaga4 10 1 Balik Pulau 20 1 Pulau Betong 18 1 Bayan Lepas 8 1 Bayan Baru, Lintang Mashuri 10 1 Bayan Baru, Lorong Mahsuri 5 1 Maybank Union St 16 1 Jalan Bawasar 5 1 Jalan Taylor 10 1 Jalan Vermont 12 1 2 Derai Pinang 10 15 1 Jelutong, Jalan Perusahan 14 1 34, Jalan Phuah Hin Leong 11 1 LHK IC2 10 1 5 Lorong Macang Bubuk 6 10 1 Lengkok, Kg. Jawa 16 1 Air Itam 15 1 Botanical Garden 20 1 Permatang Damai Laut 10 1 Tanjung Bunga 10 1 Batu Feringgi 10 1 Tanjung Tokong 14 Penang Mainland Bukit Mertajam, Taman 1 Kaiki Bukit 10 1 Kulim, Taman Penaga 10 Kuala Lumpur 10 Selangor, Petaling Jaya 94 4 Selangor, Puchong 40 4 Selangor, Subang Jaya 37 2 Selangor, Sunway Jaya 20
107 BIBLIOGRAPHY
Abe, T. 1995. The termite-symbionts system: How does it work and has it evolved as a superefficient decomposer in tropical terrestrial ecosystems? Center for Ecological Research, Kyoto University, Kyoto.
Abe, T., D. E. Bignell, and M. Higashi. 2000. Termites: evolution, sociality, symbiosis, ecology. Kluwer Academic Publishers, Dordrecht.
Acda, M. N. 2004. Economically important termites (Isoptera) of the Philippines and their control. Sociobiology 43, 159–167.
Adamson, A. M. 1938. Notes on termites destructive to buildings in the Lesser Antilles. Trop. Arg. (Trinidad) 15, 220–224.
Ahmad, M. 1950. The phylogeny of termites genera based on imago-worker mandibles. Bull. Am. Mus. Nat. Hist. 95, 43–85.
Ahmad, M. 1965. Termites (Isoptera) of Thailand. Bull. Am. Mus. Nat. Hist. 131, 1–114.
Akaike, H. 1974. A new look at the statistical model identification IEEE Trans. Automat. Contr. 19, 716–723.
Akhtar M. S. 1983. Wood destroying termites (Isoptera) of Pakistan: Key to the most important species, their distribution and pattern of attack. Mat. Organis. 188, 277—291.
Araujo, R.L. 1958. Contribuica˜o a` biogeografia dos te´rmitas de Sa˜o Paulo, Brasil (Insecta, Isoptera). Arq. Inst. Biol. (Sa˜o Paulo) 25, 185–217.
Austin, J. W., A. L. Szalanski, and B. J. Cabrera. 2004. A phylogenetic analysis of the subterranean termite family Rhinotermitidae (Isoptera). Ann. Entomol. Soc. Am. 97, 548–555.
Austin, J. W., A. L. Szalanski, R. H. Scheffrahn, M. T. Messenger, S. Dronnet, and A-G. Bagnères. 2005. Genetic evidence for synonymy of two Reticulitermes species: Reticulitermes flavipes and Reticulitermes santonensis. Ann. Entomol. Soc. Am. 98, 395–401. 131 Austin, J. W., A. L. Szalanski, R. H. Scheffrahn, M. T. Messenger, J. A. McKern, and R. E. Gold. 2006. Genetic evidence for two introductions of the Formosan subterranean termite, Coptotermes formosanus (Isoptera: Rhinotermitidae), to the United States. Fla. Entomol. 89, 183–193.
Austin, J. W., G. J. Glenn, and R. E. Gold. 2008. Protecting urban infrastructure from Formosan termite (Isoptera: Rhinotermitidae), attack: a case study for United States railroads. Sociobiology 51, 231–247.
Beckmann, J. S., and J. L. Weber. 1992. Survey of human and rat microsatellites. Genomics 12, 627–631.
Bess, H. A. 1970. Termites of Hawaii and the Oceanic islands. In Biology of termites, vol. II (Krishna, K., and. Weesner, F. M. eds.), pp. 449–476. Academic, New York and London
Bignell, D. E. and P. Eggleton. 1998. Termites. In Encyclopedia of ecology and environmental management. (Calow, P. ed.), pp.744–746. Blackwell scientific, Oxford.
Bignell, D. E., P. Eggleton, L. Nunes, and K. L. Thomas. 1997. In Termites as mediators of carbon fluxes in tropical forests: budgets for carbon dioxide and methane emissions (Watt, A. B., Stork, N. E., and Hunter, M. D. eds.), Forests and Insects. Chapman and Hall, London, UK.
Boudreaux, H. B. 1979. Arhropod phylogeny with special reference to insects. Wiley and Sons, New York. 463 pp.
Breznak, J. A., and A. Brune 1994. Role of microorganisms in the digestion of lignocellulose by termites. Ann. Rev. Entomol. 39, 453–487.
Brohede, J. 2003. Rates and Patterns of Mutation in Microsatellite DNA. Ph.D thesis, Uppsala University.
Brown, W. V., M. J. Lacey, and M. Lenz. 2004. Further examination of cuticular hydrocarbons of worker termites of Australian Coptotermes (Isoptera: Rhinotermitidae) reveals greater taxonomic complexity within species. Sociobiology 44, 623–658.
132 Brussaard, L., and N. G. Juma. 1996. Organisms and humus in soil. In Humic substances in terrestrial ecosystems (Piccolo, A. ed.), pp.329–359. Elsevier, Amsterdam.
Bulmer M. S., E. S. Adams, and J. F. A. Traniello. 2001 Variation in colony structure in the subterranes termite Reticulitermes flavipes. Behav. Ecol. Sociobiol. 49, 236–243.
Cadrin, S. X. 2000. Advances in morphometic identification of fishery stocks. Rev. Fish Biol. Fisheries 10, 91–112.
Chapman R. E., and A. F. G. Bourke 2001. The influence of sociality on the conservation biology of social insects. Ecol. Lett. 4, 650–662.
Chaudhry, I. M., and M. Ahmad. 1972. Termites of Pakistan - identity, distribution and ecological relationships (Final Technical Report, 1972). Pakistan Forest Institute, Peshawar, Pakistan.
Chey, V. K. 1996. Forest Pest Insects in Sabah. Sabah Forest Department, Sandakan.
Clément, J-L. 1981. Enzymatic polymorphism in the European populations of various Reticulitermes species. In Biosystematics of Social Insects (Clément, J-L, and Howse, P.E. eds.), pp. 49–61. Academic Press, London.
Clément J. L. 1986. Open and closed societies in Reticulitermes termites (Isoptera, Rhinotermitidae): geographic and seasonal variations. Sociobiology 11, 311–323.
Clément J. L, A. G. Bagnères, P. Uva, L. Wilfert, A. Quintana, J. Rienhard, and S. Dronnet. 2001. Biosystematics of Reticulitermes termites in Europe: morphological, chemical and molecular data. Insect. Soc. 48, 202–215.
Collins, N. M. 1981. The role of termites in the decomposition of wood and leaf litter in the Southern Guinea Savanna of Nigeria. Oceologia 51, 389–399.
Collins, N. M. 1984. The termites (Isoptera) of the Gunung Mulu National Park, with a key to the genera known from Sarawak. Sarawak Mus. J. 30, 65–87.
133 Collins, N. M. 1988. Termites. In Key Environments Malaysia. (Cranbrook, E. ed) Oxford Pergamon Press.
Collins, N. M. 1989. Termites. In Tropical Rain Forest Ecosystems. (Lieth, H. and Werger, M.J.A. eds.), pp. 455–471. Elsevier Science Publishers, Amsterdam.
Constantino, R. 1998. Catalog of the living termites of the New World (Insecta: Isoptera). Arq. Zool. 35, 135–230.
Copren, K. A., L. J. Nelson, E. L. Vargo, and M. I. Haverty. 2005. Phylogenetic analyses of mtDNA sequences corroborate taxonomic designations based on cuticular hydrocarbons in subterranean termites. Mol. Phylogenet. Evol. 35, 689–700.
Costa-Leonardo A. M., R.C. Barsotti, and C. R. R. Camargo-Dietrich. 1999. Review and update on the biology of Coptotermes gestroi (Isoptera, Rhinotermitidae). Sociobiology 33, 339–356.
Costantino, R. 1995. Revision of the Neotropical termite genus. Syntermes Holmgren (Isoptera: Termitidae). Kans. Univ. Sci. Bull. 55, 455–518.
Crosland, M. 1995. Taxonomic splitters in China. Isoptera Newslett. 5: 1.
Crozier, R. H., and Y. C. Crozier. 1993. The mitochondrial genome of the honeybee Apis mellifera: complete sequence and genome organization. Genet. 133, 97–117.
Darlington, J. P. E. C. 1982. The underground passages and storage pits used in foraging by a mature nest of Macrotermes michaelseni in Kajiado, Kenya. J. Zool. 198, 237–247.
Donovan, S. E., P. Eggleton, W. E. Dubbin, M. Batchelder, and L. Dibog. 2001. The effect of a soil-feeding termite, Cubitermes fungifaber (Isoptera: Termitidae) on soil properties: termites may be an important source of soil microhabitat heterogeneity in tropical forests. Pedobiologia 45, 1–11.
Dronnet S, M. Chauisat, E.L. Vargo, C. Lohou, and A.G.. Bagnères 2005. Genetic analysis of the breeding system of an invasive subterranean termite, Reticulitermes santonensis, in urban and natural habitats. Mol. Ecol. 14,
134 1311–1320.
Edwards, R., and A. E. Mill 1986. Termites in buildings- their biology & control. Rentokil Ltd.
Eggleton, P. 2001. Termite and trees: a review of recent advances in termite phylogenetics. Insect. Soc. 48, 187–193.
Eggleton, P. 1999. Termite species description rates and the state of termite taxonomy. Insect. Soc. 46, 1–5.
Ehrhorn, E. M. 1934. The termites of Hawaii, their economic significance and control, and the distribution of termites by commerce. In Termites and termite control, 2nd ed. (Kofoid, C. A. ed.), pp.321–324. University of California Press, Berkeley, CA.
Eisen, J. A. 1999. Mechanistic basis for microsatellite instability. In Microsatellites Evolution and applications. (Goldstein, D.B., and Schlötterer, C. eds), pp. 34–48. New York, Oxford University Press,
Emerson, A. E. 1955. Geographical origin and dispersion of termite genera. Fieldina Zool. 37, 465–521.
Estoup, A., and J. Cornuet. 1999. Microsatellite evolution: inferences from population data. In Microsatellites – Evolution and applications, (Goldstein, D.B. and Schlötterer, C. eds) pp.49–65. New York, Oxford University Press.
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791.
Felsenstein J, 1989. PHYLIP: phylogeny inference package (version 3.2). Cladistics 5, 164–166.
Ferraz, M. V., and J. T. Mendez-Montiel. 2004. First record of a subterranean termite, Coptotermes havilandi Holmgren (Isoptera: Rhinotermitidae), on the west coast of North America (Mexico). Acta Zool. Mex. 20, 39–43.
Fisher, R. A. 1936. The use of multiple measurements in taxonomic problems. Ann.Eugenics 7, 179–188. 135 Frankham, R., J. R. Ballou, and D. A. Briscoe. 2002. Introduction to Conservation Genetics. Cambridge University Press, Cambridge.
Frati, F., C. Simon, J. Sullivan, and D. L. Swofford. 1997. Evolution of the mitochondrial cytochrome oxidase II gene in Collembola. J. Mol. Evol. 44,145–158.
Gay, F. J. 1967. A world review of introduce species of termites. Bull. Commonwealth Sci. Ind. Res. Organ., Melbourne, Australia 286, 1–88.
Gay, F. J. 1969. Species introduced by man, In Biology of termites, vol. I. (Krishna, K., and Weesner, F. M. eds.), pp. 459–494. Academic, New York.
Goudet, J. 2001 FSTAT: a program to estimate and test gene diversities and fixation indices (version 2.9.3). Updated from Goudet J (1995) FSTAT (version 1.2); a computer program to calculate F-statistics. J.Heredity. 86, 485–486.
Grace, J. K., R. T. Yamamoto, and M. Tamashiro. 1995. Relationship of individual worker mass and population decline in a Formosan subterranean termite colony (Isoptera: Rhinotermitidae). Environ. Entomol. 24, 1258–1262.
Hall, T. A. 1999. Bioedit: Auser friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.
Hancock, J. M. 1999. Microsatellites and other simple sequences: genomic context and mutational mechanisms. In Microsatellites Evolution and applications. (Goldstein, D. B., and Schlötterer, C. eds), pp.1–9. New York, Oxford University Press.
Harris, W.V. 1957. An introduction to Malayan termites. Malay. Nat. J. 12: 20-32.
Haslbrunner, E. H. Tuppy and G. Schatz. 1964. Deoxyribonucleic Acid Associated with Yeast Mitochondria Biochem. Biophys. Res. Commun. 15, 127–132.
Hayashi, Y., O. Kitade, and J. Kojima. 2003. Parthenogenetic reproduction in neotenics of the subterranean termite Reticulitermes speratus (Isoptera: Rhinotermitidae). Entomol. Sci. 6, 253–257.
136 Hennig, W. 1981. Insect phylogeny. Wiley and Sons, New York. 312 pp.
Hebert P. D. N., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. 270, 313–321.
Higashi, M., and T. Abe. 1997. Global diversification of termites driven by the evolution of symbiosis and sociality. In Biodiversity: An Ecological Perspective (Abe, T., Levin, S. A., and Higashi, M. eds.), pp.83−112. Springer Verlag, New York.
Hillis, D. M., B. K. Mable, A. Larson, S. K. Davis, and E. A. Zimmer. 1996. Nucleic Acids IV: Sequencing and cloning. In Molecular Systematics, Second Edition. (Hillis, D. M., Moritz, C., and Mable, B. K. eds), pp.321–378. Sinauer Associates, Sunderland, MA.
Holmgren, N. 1911. Termitenstudien 2. Systematik der Termiten. Die Familien Mastotermitidae, Protermitidae und Mesotermitidae. K. Svensk. Vet.-Akad. Handl. 46, 1–88.
Holmgren, N. 1913. Termites from British India (near Bombay, in Gujerat and Bangalore), collected by Dr. J. Assmuth, S. J. J. Bombay Nat. Hist. Soc. 22, 109–110.
Holt, J. A., and M. Lepage. 2000. Termites and soil properties. In Termites: Evolution, Sociality, Symbioses, Ecology (Abe, T., Bignell, D. E., and Higashi, M. eds), pp.389–407. Kluwer Academic Publishing, Dordrecht.
Honigberg, B.M. 1970. Taxonomy, phylogeny and distribution of termites, In Biology of termites, Vol. II. (Krishna, K., and Weesner, F.M eds.). pp.1–32. Academic press, New York.
Hoy, M. 1994. Insect molecular genetics. Academic Press, San Diego, CA.
Hu, X. P., and A. G. Appel. 2004. Seasonal variation of critical thermal limits and temperature tolerance in two subterranean termites (Isoptera: Rhinotermitidae). Environ. Entomol. 33,197–205
Husseneder, C., and J. K. Grace. 2001. Similarity is relative: hierarchy of genetic similarities in the Formosan subterranean termite (Isoptera: Rhinotermitidae)
137 in Hawaii. Environ. Entomol. 30, 262–266.
Husseneder, C., E. L. Vargo, and J. K. Grace. 2003. Molecular Genetic Methods: New Approaches to Termite Biology. In Wood deterioration and preservation: Advances in our changing world. (Goodell, B., Nicholas, D. D., and Schultz, T. P. eds), pp.358–376. American Chemical Society, Washington, D.C.
Husseneder, C., J. E. Powell, J. K. Grace, E. L. Vargo, and K. Matsuura. 2008. Worker size in the Formosan subterranean termite in relation to colony breeding structure as inferred from molecular markers. Environ. Entomol. 37, 400–408.
Husseneder, C., M. T. Messenger, N-Y. Su, J. K. Grace, and E. L. Vargo. 2005. Colony social organization and population genetic structure of an introduced population of Formosan subterranean termite from New Orleans, Louisiana. J. Econ. Entomol. 98, 1421– 434.
Husseneder, C., R. Brandl, C. Epplen, J. T. Epplen, and M. Kaib. 1998. Variation between and within colonies in the termite: morphology, genomic DNA, and behaviour. Mol. Ecol. 7, 983–990.
Inward, D. J., A. P. Vogler, and P. Eggleton. 2007. A comprehensive phylogenetic analysis of termites (Isoptera) illuminates key aspects of their evolutionary biology. Mol. Phylogenet. Evol. 44, 953–967.
Jeffrey, A. J., K. Tamaki, A. MacLeod, D. G. Monckton, D. L. Neil, and J.A.L. Armour. 1994. Complex gene conversion events in germline mutation at human minisatellites. Nature Genet. 6, 136–145.
Jenkins, T. M, C. J. Bastern, and R. Dean. 1999. Matriarchal genetic structure of Reticulitermes (Isoptera: Rhinotermitidae) populations. Sociobiology 33, 239–263.
Jenkins, T. M., M. I. Haverty, C. J. Basten, L. J. Nelson, M. Page, and B. T. Forschler. 2000. Correlation of mitochondrial haplotypes with cuticular hydrocarbon phenotypes of sympatric Reticultitermes species from the southeastern United States. J. Chem. Ecol. 26, 1525–1542.
138 Jenkins, T. M., R. E. Dean, and B. T. Forschler. 2002. DNA technology, interstate commerce, and the likely origin of Formosan subterranean termite (Isoptera: Rhinotermitidae) infestation in Alanta, Georgia. J. Econ. Entomol. 95, 381–389.
Jenkins, T. M., S. C. Jones, C-Y. Lee, B. T. Forschler, Z. Chen, G. Lopez-Martinez, N. T. Gallagher, G. Brown, M. Neal, B. Thistleton, and S. Kleinschimidt. 2007. Phylogeography illuminates maternal origins of exotic Coptotermes gestroi (Isoptera: Rhinotermitidae). Mol. Phylogenet. Evol. 42, 612–621.
Jones, S. C. 2000. In Handbook of structural insect pest, Entomology Social America (Gold, R. E., and Jones, S. C. eds.), pp.119–124. Lanham, MD.
Kaiser, H. F. 1960. The application of electronic computer to factor analysis. Edu. Psycho. Measurment 20, 141–151.
Kambhampati, S. 1995. A phylogeny of cockroaches and related insects based on DNA sequence of mitochondrial ribosomal RNA genes. Proc. Natl. Acad. Sci. U.S.A. 92, 2017–2020.
Kambhampati, S. 1996. Phylogenetic relationship among cockroach families inferred from mitochondrial 12S rRNA gene sequence. Syst. Entomol. 21, 89–98.
Kambhampati, S., and P. Eggleton. 2000. Phylogenetics and Taxonomy. In Termites: Evolution, Sociality, Symbiosis, Ecology. (Abe, T., Bignell, D.E. and Higashi, M. eds.), pp.1– 23. Kluwer Academic Publishers.
Kambhampati, S., and P. T. Smith. 1995. PCR primers for the amplification of four insect mitochondrial gene fragments. Insect. Mol. Biol. 4, 233–236.
Kambhampati, S., K. M. Kjer, and B. L. Thorne. 1996. Phylogenetic relationship among termite families based on DNA sequence of mitochondrial 16S ribosomal RNA gene. Insect Mol. Biol. 5, 229–238.
Kemner, N. A. 1934. Systematische und biologische Studienu¨ ber die Termiten Javas und Celebes. K. Svenska Vetenskapsakademiens Handlingar Ser. 3. 13, 1–241.
Kimura, M. 1980. A simple method for estimating evolutionary rate of base 139 substitutions through comparative study of nucleotide sequences. J. Mol. Evol. 16, 111–120.
Kimura, M., and Crow, J. F. 1964. The number of alleles that can be maintained in a finite population. Genet. 49, 725–738.
Kirton, L. G. 2005. The importance of accurate termite taxonomy in the broader perspective of termite management. In Proceedings of the Fifth International Conference on Urban Pests (Lee, C.-Y., and Robinson, W. H. eds.), pp.1–7. Printed by P&Y Design Network, Penang, Malaysia.
Kirton, L. G, and M. Azmi. 2005. Patterns in the relative incidence of subterranean termite species infesting buildings in Peninsular Malaysia. Sociobiology 46, 1–15.
Kirton, L. G., and V. K. Brown. 2003. The taxonomic status of pest species of Coptotermes in Southeast Asia: Resolving the paradox in the pest status of the termites Coptotermes gestroi, C. havilandi, and C. travians (Isoptera: Rhinotermitidae). Sociobiology 42, 43–63.
Kofoid, C. A. 1934. Termite and Termite Control. Second edition. University of California Press, New York, 643 pp.
Krishna, K. 1970. Taxonomy, phylogeny, and distribution of termites. In Biology of Termites. Volume II. (Krishna, K., and Weesner, F.M. eds.), pp.127–152. New York, Academic Press.
Krishna, K. 1989. Order Isoptera: Termites. In An Introduction to the Study of Insects (Borror D.J., Triplehorn C.A., and Johnson N.F. eds.), pp.234–241. Saunders College Publishing, Philadelphia, Pennsylvania.
Lain´e L. V., D. J. Wright 2003. The life cycle of Reticulitermes spp. (Isoptera: Rhinotermitidae): What do we know? Bull. Entomol. Res. 93, 267–78
Lavelle, P., D. E. Bignell, and M. Lepage. 1997. Soil function in a changing world: the role of invertebrate ecosystem engineers. Europ. J. Soil. Res. 33, 159–193.
Lee, C.-Y. 2002. Subterranean termite pests and their control in the urban 140 environment in Malaysia. Sociobiology 40, 3–9.
Lee, C.-Y. 2007. Perspective in Urban Insect Pest Management in Malaysia. Vector Control Research Unit, Universiti Sains Malaysia. 104 pp.
Lee, C.-Y., and W. H. Robinson. 2001. Termites and wood-infesting beetles. Handbook of Malaysian household and structural pests, pp. 50–70. The pest control associations of Malaysia, Kuala Lumpur.
Lee C.-Y., C. Vongkaluang, and M. Lenz. 2007. Challenges to subterranean termite management of multi-genera faunas in Southeast Asia and Australia. Sociobiology 50, 213–221.
Lee, C.-Y., H.-H. Yap, N.-L. Chong, and Z. Jaal. 1999. Urban Pest Control–a Malaysian Perspective. Publisher: Vector Control Research Unit, Universiti Sains Malaysia. 134 pp.
Lee, C.-Y., J. Zairi, H-H. Yap, and N-L. Chong. 2003. Urban pest control–a Malaysian perspective, 2nd edition Vector Control Research Unit, School of Biological Sciences, Universiti Sains Malaysia, Penang.
Lee, K. E., and T. G. Wood. 1971. Termites and soils. Academic press, London and New York.
Lelis, A. T. 1999. Primeiro registro no Brasil de rainha de substituição de Coptotermes gestroi e sua implicação no controle dessecupim. Vetores & Pragas 4, 19–23.
Lenz, M., and R. A. Barrett. 1982. Neotenic formation in field colonies of Coptotermes lacteus (Froggatt) in Australia, with comments on the roles of neotenics in the genus Coptotermes (Isoptera: Rhinotermitidae). Sociobiology 7, 47–59.
Lenz, M, and S. Runko. 1993. Long-term impact of orphaning on field colonies of Coptotermes lacteus (Froggatt) (Isoptera: Rhinotermitidae). Insect. Soc. 40, 439–456.
141 Lenz M, R. A. Barrett, and L. R. Miller. 1986. The capacity of colonies of Coptotermes acinaciformis acinaciformis from Australia to produce neotenics (Isoptera: Rhinotermitidae). Sociobiology 11, 237–244.
Lenz M, R. A. Barrett, and L. R. Miller. 1988. Mechanisms of colony reestablishment after orphaning in Coptotermes lacteus (Froggatt) (Isoptera; Rhinotermitidae). Sociobiology 14, 245–268.
Lever, R. J. A. W. 1952. New or recently introduced insect pests in Singapore, absent from the Federation of Malaya. Malay. Agr. J. 25, 214–217.
Levinson, G., and G. A. Gutman. 1987. Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4, 203–221.
Lewis P. O, and D. Zaykin. 2000. Genetic data analysis: computer program for the analysis of allelic data. Version 1.1.
Li, G. 2000. Coptotermes. In Fauna sinica, insecta vol. 17: Isoptera. (Huang, F., Zhu, S., Ping, Z., He, X., Li, G., and Gao D. eds.), pp.299–341. Science Press, Beijing, China.
Li, H-F., R. H. Scheffrahn, N-Y. Su, N. Kanzaki, and R-L. Yang. 2008. Survey of the termites (Isoptera: Kalotermitidae, Rhinotermitidae and Termitidae) of Lanyu Island, Taiwan. Fla. Entomol. 91, 472 – 473.
Li, H.-F., W. Ye, N.-Y. Su, and N. Kanzaki. 2009. Phylogeography of Coptotermes formosanus (Isoptera: Rhinotermitidae) in Taiwan. Ann. Entomol. Soc. Am. 102, 684–693.
Light, S. F. 1929. Notes on Philippine termites III. Philipp. J. Sci. 40, 421–452.
Light, S.F. 1932. Termites of the Marquesas Islands. Bishop Mus. Bull. 98, 73–86.
Litt, M., and J. A. Luty. 1989. A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. Am. J. Hum. Genet. 44, 397–401.
142 Liu, H., and A. T. Beckenbach. 1992. Evolution of the mitochondrial cytochrome oxidase II gene among 10 orders of insects. Mol. Phylogenet. Evol. 41, 41–52.
Lo, N., C. Bandi, H. Watanabe, C. Nalepa, and T. Beninati. 2003. Evidence for cladogenesis between diverse dictyopteran lineages and their intracellular endosymbionts. Mol. Biol. Evol. 20, 907–913.
Lo, N., G. Tokuda, H. Watanabe, H. Rose, M. Slaytor, K. Maekawa, C. Bandi, and H. Noda. 2000. Evidence from multiple gene sequences indicates that termites evolved from wood-feeding cockroaches. Curr. Biol. 10, 801–804.
Lo, N., O. Kitade, T. Miura, R. Costantino, and T. Matsumoto. 2004. Molecular phylogeny of the Rhinotermitidae. Insect. Soc. 51, 365–371.
Lo, N., R. H. Eldridge, and M. Lenz. 2006. Phylogeny of Australian Coptotermes (Isoptera: Rhinotermitidae) species inferred from mitochondrial COII sequences. Bull. Entomol. Res. 96, 433–437.
Maekawa, K., O. Kitade, and T. Matsumoto. 1999. Molecular phylogeneny of orthopteroid insects based on the mitochondrial cytochrome oxidase II gene. Zool. Sci. 16, 175–184.
Martius, C. 1994. Diversity and ecology of termites in Amazonian forests. Pedobiologia. 38, 407–428.
Matsuura, K., and T. Nishida. 2001. Colony fusion in a termite: what makes a society ‘open’? Insect. Soc. 48,378–383.
Miller, L. R. 1991. A revision of the Termes-Capritermes branch of the Termitinae in Australia (Isoptera: Termitidae). Invertebr. Taxon. 4, 1147–1282.
Miura, T., K. Maekawa, O. Kitade, T. Abe, and T. Matsumoto. 1998. Phylogenetic relationships among subfamilies in higher termites (Isoptera: Termitidae) based on mitochondrial COII gene sequences. Ann. Entomol. Soc. Am. 91, 515–523.
Miura, T., Y. Roisin, and T. Matsumoto. 2000. Molecular phylogeny and biogeography of the nasute termite genus Nasutitermes (Isoptera: Termitidae) 143 in the pacific tropics. Mol. Phylogenet. Evol. 17, 1–10.
Morimoto, K., and K. Ishii. 2000. Termite investigation and establishment of Philippines Milk Termite in Minami Torishima (Marcus Island). Shiroari 122, 9–17.
Moutia, A. 1936. Termites in Mauritius. Bull. Dept. Agr. Mauritius (Sci. Ser.) 21, 1–30.
Myles, T. G. 1999. Review of secondary reproduction in termites (Insecta: Isoptera) with comments on its role in termite ecology and social evolution. Sociobiology 33, 1–91.
Nalepa, C. A., and C. Bandi. 2000. Characterising the ancestors: paedomorphosis and termite evolution. In Termites: Evolution, Sociality, Symbiosis, Ecology (Abe, T., Bignell, D. E., and Higashi, M. eds.), pp.53–76. Kulwer Academic Publishers, Dordrecht.
Nass, M. M. and S. Nass. 1963. In Intramitochondrial Fibers with DNA characteristics J. Cell. Biol. 19, 593–629.
Nei, M. 1972. Genetic distance between populations. Am. Nat. 106, 283–292.
Noda, S., O. Kitade, T. Inoue, M. Kawai, M. Kanuka, K. Hiroshima, Y. Hongoh, R. Constantino, V. Uys, J. Zhong, T. Kudo, and M. Ohkuma. 2007. Cospeciation in the triplex symbiosis of termite gut (Pseudotrichonympha species), their hosts, and their bacterial endosymbionts. Mol. Ecol. 16, 1257–1266.
Noirot, C. 1970. The nests of termites. In Biology of Termites. Vol. II. (Krishna, K., and Weesner, F.M. eds.), pp. 73–125. New York, Academic Press.
Noirot, C. 1992. From wood- to humus-feeding: an important trend in termiteevolution. In Biology and evolution of social Insects. (Billen, J. ed.), pp.107−119. Leuven University Press, Leuven, Belgium.
Noirot, C. 1995. The gut of termites (Isoptera). Comparative anatomy, systematics, phylogeny. 1. Lower termites. Ann. Soc. Entomol.Fr. (N.S.) 31, 197–226.
144 Noirot, C. and C. Noirot-Timothee. 1969. The digestive system. In Biology of termites. (Krishna, K. and Weesner, F.M. eds), Academic Press, New York and London.
Nutting, W. L., and S. C. Jones. 1990. Methods for studying the ecology of subterranean termites. Sociobiology 17,167–189.
O’Connell, M., and Wright, J. M. 1997. Microsatellite DNA in fishes. Rev. Fish Biol. Fisheries 7, 331– 363.
O’Toole, D. K. 2003. Termite manual for government premises. 118 pp.
Ohkuma, M., H. Yuzawa, W. Amornsak, Y. Sornnuwat, Y. Takematsu, A. Yamada, C. Vongkaluang, O. Sarnthoy, N. Kirtibutr, N. Noparatnaraporn, T. Kudo, and T. Inoue. 2004. Molecular phylogeny of Asian termite (Isoptera) of the families Termitidae and Rhinotermitidae based on mitochondrial COII sequences. Mol. Phylogenet. Evol. 31: 701–710.
Owen, J. G., and M. A. Chmielewski. 1985. On canonical variates analysis and the construction of confidence ellipses in systematic studies. Syst. Zool. 34, 366–374.
Paulian, R. 1957. La faune entomologique de l’Ile de la Reunion. Mem. Inst. Sci. Madagascar E8, 29.
Pearce, M. J. 1997. Termites: Biology and pest management. CAB International. 166 pp.
Posada, D., and K. A. Crandall. 1998. Modeltest: testing the model of DNA substitution. Bioinform. 14, 817–818.
Posada, D., and T. R. Buckley. 2004. Model selection and model averaging in phylogenetics: Advantages of Akaike information criterion and Bayesian approaches over likelihood ratio test. Syst. Biol. 53, 793–808.
Queller, D. C., and K. F. Goodnight. 1989. Estimating relatedness using genetic markers. Evolution 43, 258–275.
145 Raina A, N. Osbrink, and Y. I. Park. 2004. Nymphs of the Formosan subterranean termite (Isoptera: Rhinotermitidae): aspects of formation and transformation. Ann. Entomol. Soc. Am. 97, 757–64
Raymond, M., and F. Rousset. 1995. Genepop (version 1.2): a population genetics software for exact tests and ecumenism. J. Heredity 86, 248.
Reeve, K. K., and L. Keller. 2001. Tests of reproductive-skew models in social insects. Ann. Rev. Entomol. 46, 347–385.
Reilly, L. M. 1986. Measuremtents of population structure in the termite Reticulitermes flavipes (Kollar) (Isoptera: Rhinotermitidae) and comparisons with the eusocial Hymenoptera. Ph.D. dissertation. Vanderbilt University, Nashville, TN.
Richards, O.W. and R.G. Davies, 1978. IMMS’ outlines of entomology. Chapman and Hall, London.
Robinson, W. H. 1996. Termites. Urban Entomology: Insect & Mite Pests in the Human Environment. pp.347–378. Chapman & Hall, London, Weinheim, New York, Tokyo, Melbourne, Madras.
Roisin Y, and M. Lenz. 1999. Caste developmental pathways in colonies of Coptotermes lacteus (Froggat) headed by primary reproductives (Isoptera, Rhinotermitidae). Insect. Soc. 46, 273–80.
Roisin, Y., R. H. Scheffrahn, and J. Krecek. 1996. Generic revision of the smaller nasute termites of the Greater Antilles (Isoptera, Termitidae, Nasutitermitinae). Ann. Entomol. Soc. Am. 89, 775–787.
Roonwal, M.L. 1959. Biology and ecology of Oriental termites (Isoptera). No.4. The dry wood termite Coptotermes heimi (Wasmann), in India. J. Bombay Natl. Hist. Soc. 56, 511–523.
Roonwal, M. L. 1970. Termites of the Oriental region. In Biology of Termites. Vol.II. (Krishna, K., and Weesner, F. M. eds.), pp.315–391. Academic Press, New York and London.
146 Roonwal, M. L. 1979. Termite life and termite control in tropical South Asia. Scientific Publishers, Jodhpur.
Roonwal, M. L., and O. B. Chhotani. 1962. Indian species of termite genus Coptotermes. Indian Council for Agricultural Research Entomological Monograph No. 2. 1–115.
Ross, H. H. 1956. A textbook of entomology. John Wiley and Sons, Inc, New York, London.
Ross, K. G. 1993. The breeding system of the fire ant Solenopsis invicta: effects on colony genetic structure. Am. Nat. 141, 554 – 576.
Ross, K. G. 2001. Molecular ecology of social behaviour: analyses of breeding systems and genetic structure. Mol. Ecol. 10, 265–284.
Rousset, F. 1997. Genetic differentiation and estimation of gene flow from F-statistics under isolation by distance. Genet. 145, 1219 – 1228.
Sanderson, M. G. 1996. Biomass of termites and their emissions of methane and carbon dioxide: A global database. Glob. Biogeochem. Cycl. 10, 543−557.
Scheffrahn, R. H., and N.-Y. Su. 2000. Asian subterranean termite, Coptotermes gestroi (=havilandi) (Wasmann) (Insecta: Isoptera: Rhinotermitidae). Extension document EENY-128. 5pp. Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL.
Scheffrahn, R. H., and N.-Y. Su. 2005. Distribution of the termite genus, genus Coptotermes (Isoptera: Rhinotermitidae) in Florida. Fla. Entomol. 88, 201–203.
Scheffrahn, R. H., J. Krecek, A. L. Szalanski and J. W. Austin. 2005. Synonymy of neotropical arboreal termites Nasutitermes corniger and N. costalis (Isoptera: Termitidae: Nasutitermitinae), with evidence from morphology, genetics, and biogeography. Ann. Entomol. Soc. Am. 98, 273–281.
Scheffrahn, R. H., J. Krecek, B. Maharajh, N-Y. Su, J. A. Chase, J. R. Mangold, A. L. Szalanski, J. W. Austin, and J. Nixon. 2004. Establishment of the African termite, Coptotermes sjostedti (Isoptera: Rhinotermitidae), on the island of 147 Guadeloupe, French, West Indies. Ann. Entomol. Soc. Am. 97, 872–876.
Scheffrahn, R. H., Jones, S. C., Krecek, J., Chase, J. A., Mangold, J. R., and Su, N.-Y. 2003. Taxonomy, distribution, and notes on the termites (Isoptera: Kalotermitidae, Rhinotermitidae, Termitidae) of Puerto Rico and the U.S. Virgin Islands. Ann. Entomol. Soc. Am. 96, 181–201.
Scheffrahn, R. H., J. P. E. C. Darlington, M. S. Collins, J. Krecěk, and N-Y. Su. 1994. Termites (Isoptera: Kalotermitidae, Rhinotermitidae, Termitidae) of the West Indies. Sociobiology 24, 213–238.
Scheffrahn, R. H., N.-Y. Su, and B. Diehl. 1990. Native, introduced and structure-infesting termites of the Turks and Caicos Islands, B.W.I. (Isoptera: Kalotermitidae, Rhinotermitidae, Termitidae). Fla. Entomol. 73, 622–627.
Schindler, I., and J. Schmidt. 2006. Review of the mouthbrooding Betta (Teleostei, Osphronemidae) from Thailand, with descriptions of two new species. Zeitschrift für Fischkunde 8, 47–69.
Schlötterer, C. 2000. Evolutionary dynamics of microsatellite DNA. Chromosoma 109, 365–371.
Selkoe, K.A., and R. J. Toonen. 2006. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol. Lett. 9, 615–629.
Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu, and P. Flook. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, 651–701.
Slatkin, M. 1993. Isolation by distance in equilibrium and non-equilibrium populations. Evolution 47, 264–279.
Smith, G.P. 1976. Evolution of repeated DNA sequences by unequal crossover. Science 191, 528–535.
Snyder, T.E. 1949. Catalog of the termites (Isoptera) of the world. Smiths. Misc. Coll. 112, 1–490.
148 Sornnuwat, Y. C, C. Vongkaluang, M. Takahashi, K. Tsunoda, and T. Yoshimura. 1996. Survey and observation on damaged houses and causal termite species in Thailand. Jpn. J. Entomol. Zool. 7, 191– 200.
Su, N.-Y. 2002. Novel technologies for subterranean termite control. Sociobiology 40, 95–101.
Su, N.-Y. 2003. Overview of the global distribution and control of the Formosan subterranean termite. Sociobiology 41, 7–16.
Su, N. Y., and R. H. Scheffrahn. 1990. Economically important termites in the United States and their control. Sociobiology 17, 77–94.
Su, N. Y., and R. H. Scheffrahn. 1998. Coptotermes vastator Light (Isoptera: Rhinotermitedae) in Guam. Proc. Hawaii Entomol. Soc. 33, 13–18.
Su, N.-Y., and R. H. Scheffrahn. 2000. Termites as pests of buildings. In Termites: evolution, sociality, symbioses, ecology. (Abe, T., Bignell, D. E., and Higashi, M. eds.), pp.437–453. Kluwer Academic Publishers, Dordrecht, The Netherlands.
Su, N.-Y., R. H. Scheffrahn, and T. Weissling. 1997. A new introduction of a subterranean termite, Coptotermes havilandi Holmgren (Isoptera: Rhinotermitidae) in Miami, Florida. Fla. Entomol. 80, 408–411.
Sugimoto, A., T. Inoue, N. Kirtibutr, and T. Abe. 1998. Methane oxidation by termite mounds estimated by the carbon isotopic composition of methane. Glob. Biogeochem. Cycl. 12, 595−605.
Swofford, D. L. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sinauer, Sunderland, MA.
Szalanski, A. L., J. W. Austin, and C. B. Owens. 2003. Identification of Reticulitermes spp. (Isoptera: Reticulitermatidae) from south central United States by PCR-RFLP. J. Econ. Entomol. 96, 1514–1519.
Taberlet, P., L.P. Waits, and G. Luikart. 1999. Noninvasive genetic sampling: look before you leap. Trend. Ecol. Evol. 14, 323–327.
149 Takematsu Y, T. Yoshimura, S. Yusuf, Y. Yanase, K. Kambara, A. Tashiro, S. Doi, M. Takahashi, P. Sukartana, T. Inoue, H. Yuzawa, M. Ohkuma, T. Kudo, Y. Sornnuwat, and C. Vongkaluang. 2006. Termite assemblages in urban areas of south east Asia – Diversity and economic impacts. In Sustainable development and utilization of tropical forest resources (Imamura, Y., Umezawa, T., and Hata, T. eds.), pp. 84–91. RISH, Kyoto University, Japan.
Tautz, D. 1989. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Research 17, 6463–6471.
Terry, M. D., and M. F. Whiting. 2005. Mantophasmatodea and phylogeny of the lower neopterous insects. Cladistics 21, 240–257.
Tho, Y. P. 1992. Termites of Peninsular Malaysia. Malay. Forest Rec. 36, 1–224.
Tho, Y. P., and L. G. Kirton. 1990. The economic significance of Coptotermes termites in Malaysia forestry. In Proceedings of the Third International Conference on Plant Protection in the Tropics, pp.193–199. Genting Highlands.
Thompson, G. J., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiples sequences alignments through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680.
Thompson, G. J., O. Kitade, N. Lo, and R. H. Crozier. 2000. Phylogenetic evidence for a single ancestral origin of a “true” worker caste in termites. J. Vol. Biol. 13, 869–881.
Thorne, B. L. 1996. Termite terminology. Sociobiology 28, 253–263.
Thorne, B. L., and J. M. Carpenter. 1992. Phylogeny of the Dictyoptera. Syst. Entomol. 17, 253–268.
Thorne, B. L, J. F. A. Traniello, E. S. Adams, and M. Bulmer. 1999. Reproductive dynamics and colony structure of subterranean termites of the genus Reticulitermes (Isoptera: Rhinotermitidae): a review of the evidence from behavioral, ecological, and genetic studies. Ethol. Ecol.Evol. 11, 149–169.
150 Tsai, C. C., and C. S. Chen. 2003. First record of Coptotermes gestroi (Isoptera: Rhinotermitidae) from Taiwan. Formosan Entomol. 23, 157–161.
Turan, C. 1999. A note on the examination of morphometric differentiation among fish populations: The Truss System. J. Zool. 23, 259–263.
Vargo, E. L. 2003a. Hierarchical analysis of colony and population genetic structure in the eastern subterranean termite, Reticulitermes flavipes, using two classes of molecular markers. Evolution 57, 2805–2818.
Vargo, E. L. 2003b. Genetic structure of Reticulitermes flavipes and R. virginicus (Isoptera: Rhinotermitidae) colonies in an urban habitat and tracking of colonies following treatment with hexaflumuron bait. Environ. Entomol. 32, 1271–1282.
Vargo, E.L., and C. Husseneder. 2009. Biology of subterranean termites: insights from molecular studies of Reticulitermes and Coptotermes. Annu. Rev. Entomol. 54, 379–403.
Vargo, E. L., C. Husseneder, and J. K. Grace. 2003. Colony and population genetic structure of the Formosan subterranean termite, Coptotermes formosanus, in Japan. Mol. Ecol. 12, 2599–2608.
Wasmann, E. 1896. Neue Termitophilen und Termiten aus Indien. Viaggo di Leonardo Fea in Birmania E Regioni Vicine. Ann. Mus. Civico Storia Nat. Genova 16, 613– 630.
Wasmann, E. 1902. Termiten, termitophilen und myrmecophilen. Gesammelt auf Ceylon von Dr. W. Horn. Zool. Jb. 17, 99–164.
Weber, J. L., and C. Wong. 1993. Mutation of human short tandem repeats. Hum. Mol. Genet. 2, 1123–1128.
Weesner, F. M. 1970. Termites of the Nearctic region. In Biology of Termites. Vol. II, (Krishna, K., and Weesner, F. M. eds.), pp.477–525. Academic Press, New York.
Weesner, F. M. 1987. Order Isoptera. In Immature Insects. (Stehp F. N. ed), pp.132–139. Kendall/Hunt Publishing Company, Michigan. 151 Weir, B. S., and C. C. Cockerham. 1984. Estimating F-statistics for the analysis of population structure. Evolution 38, 1358–1370.
Wiley, E. O. 1981. Phylogenetics. The theory and pratice of phylogenetics. Wiley- Intersciences, New York, 439 pp.
Woods, C. 2005. Researches find another termite as destructive as Formosan termite. Int. Pest Cont. 47, 218.
Wood, T. G. 1988. Termites and the soil environment. Biol. Fertl. Soils. 6, 228–236.
Wood, T. G., and W. A. Sands. 1978. The role of termites in ecosystems. In Production ecology of ants and termites (Brian, M. V. ed.), pp.245–292. Cambridge University Press, Cambridge.
Woodrow, R. J., J. K. Grace, and S. Y. Higa. 2001. Occurrence of Coptotermes vastator (Isoptera: Rhinotermitidae) on the island of Oahu, Hawaii. Sociobiology 38, 667–673.
Xia, K., and X. He. 1986. Studies on Coptotermes of China (Isoptera: Rhinotermitidae). Contr. Shanghai Inst. Entomol. 6, 157–182.
Ye, W., C.-Y. Lee, R. H. Scheffrahn, J. M. Aleong, N.-Y. Su, G. W. Bennett, and M. E. Scharf. 2004. Phylogenetic relationships of Nearctic Reticultitermes species (Isoptera: Rhiniotermitidae) with particular reference to Reticulitermes arenicola Goellner. Mol. Phylogenet. Evol. 30, 815–822.
Yudin, L. 2002. Termites of Mariana Islands and Philippines, their damage and control. Sociobiology 40, 71–74.
Zane, L., L. Bargelloni, and T. Patarnello. 2002. Strategies for microsatellite isolation: A review. Mol. Ecol. 11, 1–16.
Zimmerman, P. R., J. P. Greenberg, S. O. Wandiga, and P. J. Crutzen. 1982. Termites: A potentially large source of atmospheric methane, carbon dioxide, and molecular hydrogen. Science. 218, 563–565.
Zinder, S.H. 1993. Physiological ecology of methanogens. In Methanogenesis (Ferry, J. G. ed.). pp.128–206. Chapman and Hall, New York 152 VITAE
Author: YEAP BENG KEOK
Place of birth: Georgetown Penang, Malaysia
Date of birth: 10 October 1981
Education: Bachelor (Honour) of Science in Genetic and Molecular Biology,
CGPA: 3.87, 2004.
List of Publication:
1. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2007. Genetic relationship
between Coptotermes gestroi (Wasmann) and Coptotermes vastator Light
(Isoptera: Rhinotermitidae). J. Econ. Entomol. 100, 467–474.
2. Yeap, BK, A.S Othman, and C.Y. Lee. 2009. Identification of
polymorphic microsatellite markers for the Asian subterranean termite
Coptotermes gestroi (Wasmann) (Blattodea: Rhinotermitidae). in
(Almany GR, De Arruda, .....CY Lee, ...AS Othman...., BK Yeap et al.
2009. Permanent genetic resources added to Molecular Ecology
Resources Database 1 May 2009 - 31 July 2009) Mol. Ecol.y Res. 9,
1460–1559.
3. Yeap B.K., A.S. Othman, and C.Y. Lee. 2009. Molecular systematics of
Coptotermes (Isoptera: Rhinotermitidae) from East Asia and Australia.
Ann. Entomol. Soc. Am. 102, 1077–1090.
153 4. Yeap, B.K., F.M. Dugal, A.S. Othman, and C.Y. Lee. Genetic
relationship between Coptotermes heimi and Coptotermes gestroi
(Isoptera: Rhinotermitidae). Sociobiology (Under review).
5. Yeap, B.K, A.S. Othman, and C.Y. Lee. Genetic analysis of colony and
population structure of the Asian subterranean termite, Coptotermes
gestroi, in native and introduced populations (Isoptera: Rhinotermitidae).
Environ. Entomol. (Under review).
List of Presentation (Oral):
1. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2005. Molecular phylogenetic
relationship of Asian Coptotermes species based on mitochondrial 16S sequences.
Pp. 565. In Proceedings of the 5th International Conference on Urban Pests.
Suntec, Singapore,
2. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2006. Phylogenetic relationship of the
Asian subterranean termite, Coptotermes gestroi (Wasmann) and Philippine milk
termite, Coptotermes vastator Light (Isoptera: Rhinotermitidae) as inferred from
16S mitochondrial DNA. Pp. 47 – 51. In Proceedings of the Third Conference
of Pacific Rim Termite Research Group (K Tsunoda, ed.). Kyoto University,
Japan.
3. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2006. Phylogenetic relationships of the
Asian Coptotermes (Isoptera: Rhinotermitidae) as inferred using mitochondrial
16S gene. Pp. 37. In Proceedings of the 11th Biological Sciences Graduate
Congress. Chulalongkorn University, Bangkok, Thailand.
154 4. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2006. Molecular phylogenetic
relationship of Asian Coptotermes species based on mitochondrial 16S sequences.
Pp. 172. In Proceedings of the 3rd Life Sciences Postgraduate Conference.
Universiti Sains Malaysia, Penang, Malaysia.
5. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2007. Molecular phylogenetics of
Asian Coptotermes (Isoptera: Rhinotermitidae). Pp. 51 – 55. In Proceedings of
the Fourth Conference of the Pacific-Rim Termite Research Group (K. Tsunoda,
ed.). Kyoto University, Japan.
6. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2007. Phylogenetic relationships of
several Coptotermes species (Isoptera: Rhinotermetidae) from Asia. Pp. 129. In
Proceedings of the 12th Biological Sciences Graduate Congress. Universiti of
Malaya, Malaysia.
7. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2007. Synonymity of several
Coptotermes species (Isoptera: Rhinotermitidae) from Asia based on
morphological and genetic evidences. Pp. O-53. In Proceedings of the 9th
Symposium of the Malaysian Society of Applied Biology. Penang, Malaysia.
8. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2007. Phylogenetic relationships of the
Asian Coptotermes as inferred from mitochondrial DNA COII gene (Isoptera:
Rhinotermitidae). Pp. 48. In Proceedings of the 43rd Annual Scientific Seminar of
Malaysian Society of Parasitology and Tropical Medicine & Centenary
Celebration of The Royal Society of Tropical Medicine and Hygiene (UK). Kuala
Lumpur, Malaysia.
9. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2008. Phylogenetics of Coptotermes
(Blattodea: Termitoidae: Rhinotermitidae) from Asia and Australasia. Pp.122 In
155 Proceeding of the 10th Symposium of The Malaysian Society of Applied Biology.
Kuching, Malaysia.
10. Yeap, B.K., A.S. Othman, and C.Y. Lee. 2009. Microsatellite markers for the
Asian subterranean termite Coptotermes gestroi (Wasmann) (Blattodea:
Rhinotermitidae). Pp. 77–79. In Proceedings of the 6th Pacific-Rim Termite
Research Group Conference. Kyoto, Japan.
156