Detection of the ETV6-NTRK3 Chimeric RNA of Infantile

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Detection of the ETV6-NTRK3 Chimeric RNA of Infantile Fibrosarcoma/Cellular Congenital Mesoblastic Nephroma in Paraffin-Embedded Tissue: Application to Challenging Pediatric Renal Stromal Tumors Pedram Argani, M.D., Michael Fritsch, M.D., Ph.D., ShriHari S. Kadkol, M.D., Ph.D., Amy Schuster, B.S., J. Bruce Beckwith, M.D., Elizabeth J. Perlman, M.D. Department of Pathology, The Johns Hopkins Medical Institutions (PA, MF, SSK, AS, EJP), Baltimore, Maryland, and Department of Pathology and Human Anatomy, Loma Linda University School of Medicine (JBB), Loma Linda, California The discoveries of specific chromosomal transloca- We report the development of a reverse transcrip- tions associated with many pediatric soft-tissue tu- tase polymerase chain reaction assay that reliably mors represent major advances toward understand- detects the ETV6-NTRK3 chimeric RNA characteris- ing the molecular pathogenesis of these lesions (1). tic of infantile fibrosarcoma and the cellular variant The chimeric RNAs produced from the gene fusions of congenital mesoblastic nephroma (CMN) in can be detected by reverse transcriptase polymerase formalin-fixed, paraffin-embedded tissue blocks. chain reaction (RT-PCR), creating sensitive and spe- The 188 base pair polymerase chain reaction fusion cific diagnostic assays for each of these tumors. Typ- product was detected in 11 of 12 cases of cellular ically, such analysis requires fresh tissue that yields CMN from which a larger sized control RNA band intact RNA. The adaptation of these RT-PCR assays could be amplified, and even in 7 of 8 cases in which to RNA extracted from formalin-fixed, paraffin- the control band was not detectable. A variety of embedded tissue (2–4) has made these tests applica- other tumors that are in the histologic differential ble to virtually all specimens and has helped to more diagnosis of cellular CMN yielded negative results, sharply define the clinical and pathologic spectra of including four classic CMNs, four rhabdoid tumors many of these tumors. of the kidney, and four clear cell sarcomas of the A novel t(12;15)(p13;q25) translocation that re- kidney, confirming the assay’s specificity. We fur- sults in an ETV6-NTRK3 gene fusion was recently ther demonstrate the assay’s utility by illustrating discovered in infantile fibrosarcoma (5). Of note, two cases of molecularly confirmed cellular CMN this fusion was not found in a limited number of that mimicked rhabdoid tumor and clear cell sar- cases of either adult type fibrosarcoma or infantile coma of the kidney. In contrast to previous reports, fibromatosis. Subsequently, two groups (6, 7) have five mixed CMNs that had both classic and cellular demonstrated the identical ETV6-NTRK3 gene fu- areas all lacked the ETV6-NTRK3 fusion transcript. sion in the cellular variant of congenital mesoblas- These results suggest that cases morphologically de- tic nephroma (CMN) of the kidney, which is mor- fined as mixed CMN may represent a mixed group phologically identical to infantile fibrosarcoma and of genetically distinct entities. affects the same age group. The classical variant of CMN, which is morphologically identical to infan- KEY WORDS: Congenital mesoblastic nephroma, tile fibromatosis, did not contain the fusion tran- Infantile fibrosarcoma, Reverse transcriptase poly- script. These results strongly support that cellular merase chain reaction. CMN represents infantile fibrosarcoma of the kid- Mod Pathol 2000;13(1):29–36 ney and renal sinus and indicate that the classical variant of CMN represents a distinct entity. It is interesting that a small number of cases of “mixed” CMN, which have both cellular and classical foci, Copyright © 2000 by The United States and Canadian Academy of were reported to be fusion positive (6, 7). Pathology, Inc. VOL. 13, NO. 1, P. 29, 2000 Printed in the U.S.A. Because of the tremendous morphologic overlap Date of acceptance: July 1, 1999. that exists among pediatric renal tumors and the Address reprint requests to: Pedram Argani, M.D., The Johns Hopkins Hospital, Pathology Building, Room 612, 600 North Wolfe Street, Balti- diagnostic dilemmas thereby created, and to ana- more, MD 21287; e-mail: [email protected]; fax: 410-614-9386. lyze a larger number of mixed CMN cases, we at- 29 tempted to adapt an RT-PCR assay for the ETV6- mM each nucleotide, 5 mM magnesium chloride, NTRK3 gene fusion to formalin-fixed, paraffin- and 20 units RNase inhibitor (Boehringer Mann- embedded tissue. We report the development of heim, Indianapolis, IN) in PCR buffer (Perkin- this assay and its application to problematic renal Elmer, Norwalk, CT). The reaction was performed tumor cases and to mixed CMN cases. at 42° C for 30 min in a Coy Tempcycler II thermo- cycler, Model 110 S (Coy Corp., Grass Lake, MI). MATERIALS AND METHODS The enzyme and first-strand cDNA were then de- natured at 94° C for 5 min and chilled on ice for 5 Case Selection min. To assess the adequacy of the RNA, the entire The files of the National Wilms Tumor Study 20 ␮L RT reaction was subjected to PCR using prim- Pathology Center and the personal consultation ers (2) (Table 1) that span an intron of the ubiqui- files (OCWT files) of one of the authors (JBB) were tously expressed phosphoglycerate kinase gene searched for cases of CMN or cases in which CMN (PGK). Because the primers chosen span an intron, was a strong diagnostic consideration but for which the product of amplification of any contaminating another diagnosis had been rendered. From this DNA would be approximately 200 base pairs larger group of more than 300 cases, those for which a than and hence readily distinguishable from the paraffin-embedded, formalin-fixed tissue block was product of RNA amplification (263 base pairs). Be- available (approximately 30) were selected. All cause PGK has no known processed pseudogenes, slides were reviewed by one author (PA). Cases for the ability to produce this 263 base pair product which an alternative diagnosis seemed possible and indicates that intact, amplifiable RNA fragments of all cases of mixed cellular and classical mesoblastic at least that size are still present in the block, de- nephroma were reviewed together by two of the spite processing. A negative (water) control was run authors (PA and JBB) using a dual observer micro- with each set of cases. The PCR cycling parameters scope. Clinical data were gleaned from the submit- were as follows: 1 min each at 95, 66, 72, 95, 65, 72, ting institution’s pathology report. 95, 64, 72, 95, 63, 72, 95, 62, 72, 95, 61, and 72° C, followed by 35 cycles at 95, 60, and 72° C for 1 min RNA Extraction each. A 10-min final extension at 72° C ended the protocol. Twenty-five microliters of each PCR reac- A detailed description of this method has been previ- tion (approximately one fourth) underwent electro- ously published (3); the following summary includes phoresis in 2.5% agarose gels containing 50% Nu- minor modifications from that method. Briefly, four Sieve Agarose (FMC Bioproducts, Rockland, ME) 10-␮ sections from each tissue block were cut and and 50% Ultrapure agarose (Gibco BRL), and was placed in a sterile Eppendorf tube. Microtome blades visualized with ethidium bromide staining. were changed between cutting each block. After two To detect the ETV6-NTRK3 fusion transcript, we xylene washes for deparaffinization and two ethanol designed primers (Table 1) that closely flanked the washes to remove xylene, the tissue was resuspended in published fusion breakpoint, so as to amplify a 0.35 mL of digestion buffer (20 mM Tris pH 8.0, 10 mM relatively small 188 base pair PCR product. This EDTA, 1% sodium dodecyl sulfate [SDS] in strategy has previously proved effective in detecting diethylpyrocarbonate-treated, autoclaved water) and di- chimeric RNA transcripts among the partially de- gested with 500 ␮g proteinase K overnight at 55° C. The graded RNA present in tissue blocks (2–4). The next day, RNA was extracted using 0.9 mL of phenol/ primers chosen were designed and optimized using guanidine isothiocyanate (Trizol; Gibco BRL, Friends- the Oligo Primer Analysis Software Version 5.0 (Mo- wood, TX) and 0.2 mL chloroform followed by vortexing. lecular Biology Insights, Inc., Cascade, CO), and After centrifugation, the upper aqueous phase was re- BLAST analysis (http://www.ncbi.nih.gov) was per- moved; placed in a new Eppendorf tube; and precipi- formed to rule out significant primer annealing tated with 0.7 mL isopropanol, 75 ␮lof3M sodium with other known genes. Reverse transcription, acetate, and 2 ␮l of Pellet Paint Co-Precipitant (Nova- PCR, and electrophoresis conditions were identical gen, Madison, WI). After successive 70% and 100% eth- to those used with the PGK primers. A negative anol washes, the pellet was resuspended in 30 ␮Lof diethylpyrocarbonate-treated water, treated with DNase Ϫ I (Gibco BRL), and frozen at 20° C until use. TABLE 1. Polymerase Chain Reaction Primers and Probes Reverse Transcriptase Polymerase Chain Primer/Probe Name Sequence Reaction PGK forward CAGTTTGGAGCTCCTGGAAG ␮ PGK reverse TGCAAATCCAGGGTGCAGTG Approximately one tenth (4 L) of each RNA ex- ETV6 forward AGCCCATCAACCTCTCTCAT tract was reverse transcribed in a volume of 20 ␮l NTRK3 reverse CTCGGCCAGGAAGACCTTTC with 50 pmol random hexamers, 100 units of Su- ETV6-NTRK3 fusion probe GGGAGAATAGCAGATGTGCAGCAC perscript II Reverse Transcriptase (Gibco BRL), 2 PGK, phosphoglycerate kinase gene. 30 Modern Pathology (water) control and a known positive control block (Amersham) for periods of 10 seconds (short expo- were run with every set of cases tested. All primers sure), 2 min, and 20 min (long exposure). were synthesized at the Johns Hopkins University School of Medicine DNA Analysis Facility. RESULTS Assay Verification Southern Blotting and Oligonucleotide Probing RNA extracted from a known case of CMN was After the products of the ETV6-NTRK3 PCR reac- subjected to RT-PCR using the designed ETV6- tions were visualized by ethidium bromide staining, NTRK3 primer pair to test its performance.
Recommended publications
  • Non-Wilms Renal Cell Tumors in Children

    Non-Wilms Renal Cell Tumors in Children

    PEDIATRIC UROLOGIC ONCOLOGY 0094-0143/00 $15.00 + .OO NON-WILMS’ RENAL TUMORS IN CHILDREN Bruce Broecker, MD Renal tumors other than Wilms’ tumor are tastases occur in 40% to 60% of patients with infrequent in childhood. Wilms’ tumors ac- clear cell sarcoma of the kidney, whereas they count for 6% to 7% of childhood cancer, are found in less than 2% of patients with whereas the remaining renal tumors account Wilms’ tumor.**,26 This distinct clinical behav- for less than l%.27The most common non- ior is one of the features that has led to its Wilms‘ tumors are clear cell sarcoma of the designation as a separate tumor. Other clini- kidney, rhabdoid tumor of the kidney (both cal features include a lack of association with formerly considered unfavorable Wilms’ tu- sporadic aniridia or hemihypertrophy. mor variants but now considered separate tu- Clear cell sarcoma of the kidney has not mors), renal cell carcinoma, mesoblastic been reported to occur bilaterally and is not nephroma, and multilocular cystic nephroma. associated with nephroblastomatosis. It has Collectively, these tumors account for less been reported in infancy and adulthood, but than 10% of the primary renal neoplasms in the peak incidence is between 3 and 5 years childhood. of age. It has an aggressive behavior that responds poorly to treatment with vincristine and actinomycin alone, leading to its original CLEAR CELL SARCOMA designation by Beckwith as an unfavorable histology pattern. The addition of doxorubi- Clear cell sarcoma of the kidney is cur- cin in aggressive chemotherapy regimens has rently considered a separate tumor distinct improved outcome.
  • Novel KHDRBS1-NTRK3 Rearrangement in a Congenital Pediatric CD34-Positive Skin Tumor: a Case Report

    Novel KHDRBS1-NTRK3 Rearrangement in a Congenital Pediatric CD34-Positive Skin Tumor: a Case Report

    Virchows Archiv (2019) 474:111–115 https://doi.org/10.1007/s00428-018-2415-0 BRIEF REPORT Novel KHDRBS1-NTRK3 rearrangement in a congenital pediatric CD34-positive skin tumor: a case report Matthias Tallegas1 & Sylvie Fraitag2 & Aurélien Binet3 & Daniel Orbach4 & Anne Jourdain5 & Stéphanie Reynaud6 & Gaëlle Pierron6 & Marie-Christine Machet1,8 & Annabel Maruani7,8,9 Received: 15 May 2018 /Revised: 11 July 2018 /Accepted: 12 July 2018 /Published online: 6 September 2018 # Springer-Verlag GmbH Germany, part of Springer Nature 2018 Abstract Cutaneous spindle-cell neoplasms in adults as well as children represent a frequent dilemma for pathologists. Along this neoplasm spectrum, the differential diagnosis with CD34-positive proliferations can be challenging, particularly concerning neoplasms of fibrohistiocytic and fibroblastic lineages. In children, cutaneous and superficial soft-tissue neoplasms with CD34-positive spindle cells are associated with benign to intermediate malignancy potential and include lipofibromatosis, plaque-like CD34-positive dermal fibroma, fibroblastic connective tissue nevus, and congenital dermatofibrosarcoma protuberans. Molecular biology has been valuable in showing dermatofibrosarcoma protuberans and infantile fibrosarcoma that are characterized by COL1A1-PDGFB and ETV6-NTRK3 rearrangements respectively. We report a case of congenital CD34- positive dermohypodermal spindle-cell neoplasm occurring in a female infant and harboring a novel KHDRBS1-NTRK3 fusion. This tumor could belong to a new subgroup of pediatric cutaneous spindle-cell neoplasms, be an atypical presentation of a plaque-like CD34-positive dermal fibroma, of a fibroblastic connective tissue nevus, or represent a dermatofibrosarcoma protuberans with an alternative gene rearrangement. Keywords Cutaneous . Neoplasms . Spindle-cell Introduction Cutaneous spindle-cell proliferations form a large spectrum of * Annabel Maruani neoplasms occurring in children and adults.
  • Morphological and Immunohistochemical Characteristics of Surgically Removed Paediatric Renal Tumours in Latvia (1997–2010)

    Morphological and Immunohistochemical Characteristics of Surgically Removed Paediatric Renal Tumours in Latvia (1997–2010)

    DOI: 10.2478/v10163-012-0008-6 ACTA CHIRURGICA LATVIENSIS • 2011 (11) ORIGINAL ARTICLE Morphological and Immunohistochemical Characteristics of Surgically Removed Paediatric Renal Tumours in Latvia (1997–2010) Ivanda Franckeviča*,**, Regīna Kleina*, Ivars Melderis** *Riga Stradins University, Riga, Latvia **Children’s Clinical University Hospital, Riga, Latvia Summary Introduction. Paediatric renal tumours represent 7% of all childhood malignancies. The variable appearances of the tumours and their rarity make them especially challenging group of lesions for the paediatric pathologist. In Latvia diagnostics and treatment of childhood malignancies is concentrated in Children’s Clinical University Hospital. Microscopic evaluation of them is realised in Pathology office of this hospital. Aim of the study is to analyze morphologic spectrum of children kidney tumours in Latvia and to characterise them from modern positions with wide range of immunohistochemical markers using morphological material of Pathology bureau of Children’s Clinical University Hospital. Materials and methods. We have analyzed surgically removed primary renal tumours in Children Clinical University Hospital from the year 1997 till 2010. Samples were fixed in 10% formalin fluid, imbedded in paraffin and haematoxylin-eosin stained slides were re-examined. Immunohistochemical re-investigation was made in 65.91% of cases. For differential diagnostic purposes were used antibodies for the detection of bcl-2, CD34, EMA, actin, desmin, vimentin, CKAE1/AE3, CK7, Ki67, LCA, WT1, CD99, NSE, chromogranin, synaptophyzin, S100, myoglobin, miogenin, MyoD1 (DakoCytomation) and INI1 protein (Santa Cruz Biotechnology). Results. During the revised period there were diagnosed 44 renal tumours. Accordingly of morphological examination data neoplasms were divided: 1) nephroblastoma – 75%, 2) clear cell sarcoma – 2.27%, 3) rhabdoid tumour – 4.55%, 4) angiomyolipoma – 4.55%, 5) embrional rhabdomyosarcoma – 2.27%, 6) mesoblastic nephroma – 4.55%, 7) multicystic nephroma – 4.55%, 8) angiosarcoma – 2.27%.
  • Pediatric Abdominal Masses

    Pediatric Abdominal Masses

    Pediatric Abdominal Masses Andrew Phelps MD Assistant Professor of Pediatric Radiology UCSF Benioff Children's Hospital No Disclosures Take Home Message All you need to remember are the 5 common masses that shouldn’t go to pathology: 1. Infection 2. Adrenal hemorrhage 3. Renal angiomyolipoma 4. Ovarian torsion 5. Liver hemangioma Keys to (Differential) Diagnosis 1. Location? 2. Age? 3. Cystic? OUTLINE 1. Kidney 2. Adrenal 3. Pelvis 4. Liver OUTLINE 1. Kidney 2. Adrenal 3. Pelvis 4. Liver Renal Tumor Mimic – Any Age Infection (Pyelonephritis) Don’t send to pathology! Renal Tumor Mimic – Any Age Abscess Don’t send to pathology! Peds Renal Tumors Infant: 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor Child: 1) Wilm's tumor 2) lymphoma 3) angiomyolipoma 4) clear cell sarcoma 5) multilocular cystic nephroma Teen: 1) renal cell carcinoma 2) renal medullary carcinoma Peds Renal Tumors Infant: 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor Child: 1) Wilm's tumor 2) lymphoma 3) angiomyolipoma 4) clear cell sarcoma 5) multilocular cystic nephroma Teen: 1) renal cell carcinoma 2) renal medullary carcinoma Renal Tumors - Infant 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor Renal Tumors - Infant 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor - Most common - Can’t distinguish from congenital Wilms. Renal Tumors - Infant 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor Look for Multiple biggest or diffuse and masses. ugliest. Renal Tumors - Infant 1) mesoblastic
  • NY-ESO-1 (CTAG1B) Expression in Mesenchymal Tumors

    NY-ESO-1 (CTAG1B) Expression in Mesenchymal Tumors

    Modern Pathology (2015) 28, 587–595 & 2015 USCAP, Inc. All rights reserved 0893-3952/15 $32.00 587 NY-ESO-1 (CTAG1B) expression in mesenchymal tumors Makoto Endo1,2,7, Marieke A de Graaff3,7, Davis R Ingram4, Simin Lim1, Dina C Lev4, Inge H Briaire-de Bruijn3, Neeta Somaiah5, Judith VMG Bove´e3, Alexander J Lazar6 and Torsten O Nielsen1 1Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, British Columbia, Canada; 2Department of Orthopaedic Surgery, Kyushu University, Fukuoka, Japan; 3Department of Pathology, Leiden University Medical Center, Leiden, The Netherlands; 4Department of Surgical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA; 5Department of Sarcoma Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA and 6Department of Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA New York esophageal squamous cell carcinoma 1 (NY-ESO-1, CTAG1B) is a cancer-testis antigen and currently a focus of several targeted immunotherapeutic strategies. We performed a large-scale immunohistochemical expression study of NY-ESO-1 using tissue microarrays of mesenchymal tumors from three institutions in an international collaboration. A total of 1132 intermediate and malignant and 175 benign mesenchymal lesions were enrolled in this study. Immunohistochemical staining was performed on tissue microarrays using a monoclonal antibody for NY-ESO-1. Among mesenchymal tumors, myxoid liposarcomas showed the highest positivity for NY-ESO-1 (88%), followed by synovial sarcomas (49%), myxofibrosarcomas (35%), and conventional chondrosarcomas (28%). Positivity of NY-ESO-1 in the remaining mesenchymal tumors was consistently low, and no immunoreactivity was observed in benign mesenchymal lesions.
  • Congenital Mesoblastic Nephroma: Possible Prognostic and Management Value of Assessing J Clin Pathol: First Published As 10.1136/Jcp.44.4.317 on 1 April 1991

    Congenital Mesoblastic Nephroma: Possible Prognostic and Management Value of Assessing J Clin Pathol: First Published As 10.1136/Jcp.44.4.317 on 1 April 1991

    J Clin Pathol 1991;44:317-320 317 Congenital mesoblastic nephroma: Possible prognostic and management value of assessing J Clin Pathol: first published as 10.1136/jcp.44.4.317 on 1 April 1991. Downloaded from DNA content J C Barrantes, C Toyn, K R Muir, S E Parkes, F Raafat, A H Cameron, H B Marsden, J R Mann Abstract appears benign with a leiomyomatous pattern The case records and pathology of all composed of interlacing bundles of spindle children with kidney tumours treated in cells and few mitotic figures; congenital the West Midlands Health Authority mesoblastic nephroma is densely cellular, with Region (WMHAR) from 1957 to 1986 many mitotic figures. Both patterns can be were reviewed. The histology was re- found in the same tumour, referred to as a viewed by a panel of three paediatric mixed tumour.9 pathologists. Thirteen (6%) out of 211 In trying to explain the histogenesis of these cases were considered to have congenital tumours, Snyder et al"' proposed a theory mesoblastic nephroma (CMN). Nine using the "two hit" model, described by were of the conventional type, three of Knudson." In this model congenital meso- the atypical cellular type, and one blastic nephroma would occur after a neoplas- mixed. DNA ploidy was investigated and tic mutation in the early stages of embryogen- showed two of the tumours to be aneu- esis, whereas atypical cellular mesoblastic ploid and nine diploid (tissue was not nephroma would develop in the later stages, available in the two other cases). The two but before the blastema has undergone meta- aneuploid tumours were of atypical nephric differentiation.
  • Cellular Mesoblastic Nephroma: Report of 3 Cases M

    Cellular Mesoblastic Nephroma: Report of 3 Cases M

    CASE REPORT CELLULAR MESOBLASTIC NEPHROMA: REPORT OF 3 CASES M. Ramani, C. Sandhya Rani, K. Geetha, K. Ramesh Reddy. 1. Professor, Department. of Pathology, Niloufer Hospital for Women and Children. 2. Post Graduate, Department of Pathology, Niloufer Hospital for Women and Children 3. Assistant Professor, Department of Pathology, Niloufer Hospital for Women and Children 4. Professor, Department of Pediatric Surgery, Niloufer Hospital for Women and Children CORRESPONDING AUTHOR: Dr Ramani M, Professor, Department of Pathology, Osmania Medical College, Koti, Hyderabad, Andhra Pradesh, India. E-mail: [email protected] ABSTRACT: Mesoblastic nephroma is a relatively rare infantile renal tumor. It comprises 3–6% of pediatric renal masses. It comprises of three histological types namely classic, cellular and mixed variants. Cellular variant accounts for 60% cases and is associated with poor prognosis with survival rate of 85% compared to 100% for classic variant. It remains a diagnostic challenge for pathologists due to its similarity to other more frequent kidney neoplasms. Here we report 3 cases of cellular mesoblastic nephroma which presented over a period of 4 years from January 2007 to December 2010. KEYWORDS : cellular mesoblastic nephroma, poor prognosis, differential diagnosis. INTRODUCTION : Mesoblastic nephroma first described by Bolande et al. in 1967 as leiomyoma like tumor of kidney 1. It’s a congenital neoplasm commonly diagnosed before 6 months age. Histological variants include classic, cellular and mixed. Cellular variant demonstrates more local recurrences and invasion of perirenal fat, adjacent organs, distant metastasis, and accompanied by intramural hemorrhage with large cystic or necrotic component. Most renal neoplasms in childhood are represented by Wilms tumor, leading to treatment directed at Wilms tumor, without pathological confirmation.
  • Mesoblastic Nephroma: Pathological Features

    Mesoblastic Nephroma: Pathological Features

    African Journal of Urology (2015) 21, 1–3 HOSTED BY Pan African Urological Surgeons’ Association African Journal of Urology www.ees.elsevier.com/afju www.sciencedirect.com Editorial ଝ Mesoblastic nephroma: Pathological features Abstract This correspondence is an editorial comment on the previously published article entitled “Trois observations de néphrome mésoblastique avant l’âge de 6 mois” in AFJU Vol. 20, No. 3 Pages 161–164”. Since the authors of that article focused mainly on the clinical and radiological aspects of the tumor with only very brief reference to its pathological features, and since the variable behavior of mesoblastic nephroma is determined mainly by its histologic type, we found it worthwhile to elaborate more on the gross and microscopic features of that tumor. © 2014 Pan African Urological Surgeons’ Association. Production and hosting by Elsevier B.V. All rights reserved. We had the privilege of reviewing the manuscript submitted for parenchyma and even the perirenal fat. Cysts are occasionally publication in this journal, reporting three cases of mesoblastic present. There may be also hemorrhage and necrosis. Mesoblastic nephroma. Since the authors of the manuscript focused mainly on nephromas may extensively involve the renal sinus. Therefore, care- the clinical and radiological aspects of the tumor with only very ful examination of the medial aspect of the nephrectomy specimen brief reference to its pathological features, and since the variable by the surgeon and the pathologist is extremely important [4]. behavior of mesoblastic nephroma is determined mainly by its his- tologic type, we found it worthwhile to elaborate more on the gross Mesoblastic nephroma is classified into classic and cellular types and microscopic features of that tumor in an editorial comment.
  • Benign Mixed Epithelial and Stromal Tumor of the Kidney

    Benign Mixed Epithelial and Stromal Tumor of the Kidney

    Case Study TheScientificWorldJOURNAL (2006) 6, 615–618 ISSN 1537-744X; DOI 10.1100/tsw.2006.115 Benign Mixed Epithelial and Stromal Tumor of the Kidney A. Işın Doğan Ekici1,3, Sinan Ekici2,4,*, Bora Gürel1, Gülçin Altinok1, İlhan Erkan2, and Yücel Güngen1 Departments of 1Pathology and 2Urology, Hacettepe University School of Medicine, Ankara; 3Department of Pathology, Yeditepe University School of Medicine, Istanbul; 4Department of Urology, Maltepe University School of Medicine, Istanbul E-mail: [email protected] Received March 14, 2006; Accepted May 3, 2006; Published June 1, 2006 A 51-year-old, perimenopausal, female patient with 1-month history of right flank pain who was diagnosed with a renal mass and underwent nephron-sparing partial nephrectomy is presented. The renal mass was found to be a benign, biphasic tumor composed of an epithelial component, consisting of ducts of variable size scattered within a mesenchymal component, composed of spindle cells arranged in sheets and fascicles. No atypia, mitosis, or necrosis was found. The spindle component shows desmin, smooth muscle actin, and estrogen and progesterone receptor positivity immunohistochemically. The diagnosis of benign mixed epithelial and stromal tumor of the kidney is rendered. No recurrent disease has been detected during 2 years of follow up. KEYWORDS: benign mixed epithelial and stromal tumor of the kidney, biphasic tumor, estrogen receptor, kidney, progesterone receptor INTRODUCTION In 1998, a distinctive, benign, renal neoplasm composed of an epithelium with solid and cystic architecture within a spindle stroma was recognized by Michal and Syrucek. They named this tumor as “Benign Mixed Epithelial and Stromal Tumor” (BMEST)[1].
  • A Brighter Future Pediatric Malignancies and IHC Mike Lacey, M.D

    A Brighter Future Pediatric Malignancies and IHC Mike Lacey, M.D

    A Brighter Future Pediatric Malignancies and IHC Mike Lacey, M.D. Pediatric Pathology The life science business of Merck KGaA, Darmstadt, Germany operates as MilliporeSigma in the U.S. and Canada. Pediatric Malignancies and IHC Mike Lacey, M.D. Pediatric tumors are heterogenous and can be quite varied in appearance. However, those in the infamous “small round blue- cell tumor” group, with their hyperchromatic nuclei and small amount of cytoplasm can be challenging, and their detection require cost-efficient and focused immunohistochemistry and ancillary testing. Ideally, ample material should be obtained for routine histology and ancillary testing, including immunohistochemistry, fluorescentin situ hybridization, fresh tissue for cytogenetic studies, and snap-frozen tumor for DNA/ RNA extraction both for routine molecular testing (i.e., reverse- transcription PCR studies), as well as future research study protocols (genome wide studies, targeted gene sequencing). The term “blastoma” refers to a tumor that recapitulates its embryological origin. Although the cellular origin of many pediatric tumors is presumed and even accepted in many cases, it is important to emphasize that they are labeled according to their morphologic differentiation patterns. 2 Pediatric Malignancies and IHC Neuroblastoma markers including neuron-specific enolase (NSE), protein gene product 9.5 (PGP 9.5), synaptophysin, Neuroblastic tumors (NT) represent a spectrum NB84 (antibody to NB cell lines), CD56, CD57, and with variable degrees of cell maturation along the tyrosine hydroxylase. embryological development of the sympathetic nervous system and include 3 main categories: Similar to CD99, PGP 9.5 may show cytoplasmic neuroblastoma (NB), ganglioneuroblastoma (GNB), and staining within a number of other tumors with ganglioneuroma (GN), based on the amount of S-100 neuroectodermal lineage, including Ewing sarcoma positive schwannian stroma (SCHNS) and ganglion family of tumors (EWSFT), synovial sarcoma cell differentiation.
  • Congenital Mesoblastic Nephroma - a Case Report

    Congenital Mesoblastic Nephroma - a Case Report

    :U$ 1ilt射훌훌뿔슐誌 第 25 卷 第 2 號 pp. 326 - 329, 1989 Journal of Korean Radiol앵 ical Soc iety, 25(2) 326 - 329, 1989 Congenital Mesoblastic Nephroma - A Case Report- Dong Ho Lee, M.D., Jae Hooo Lim, M.D., Young Tae Ko, M.D. Department of Radiology, Kyung Hee University Hospital 〈 國文沙錄 〉 先天性 中 R조좋性 賢睡 慶熙大學校 醫科大學 放射線科學敎室 李東鎬·林在勳·高永泰 先天性 中)ff葉性 賢睡은 新生兒 複部睡塊로 냐타냐는 賢藏의 良↑生睡場이 다 . 著者들은 先天性 中 R조葉↑生 賢睡 1 例를 經驗하였기에 報告하고자 한마. 超音波檢훌 및 電算化斷層握影上 境界가 分 明 한 固形睡場으로 內部에 마수의 짧性 壞死을 보였다. - Abstract- Congenital mesoblastic nephroma is a benign renal tumor that appears as a neonatal abdominal mass We have experienced a case of congenital mesoblastic nephroma. The ultrasonographic and CT findings are well-demarcated solid mass containing large portion of cystic necrosis and congenital fibrosarcomaJ). The behavior of this tumor is benign, so complete removal is Introduction cura tIveL2.5\,~) Authors report one patient of congenital meso­ Congenital mesoblastic nephroma is the com­ blastic nephroma with presentation of IVP, ult­ monest neonatal renal neoplasml- 6), and it is alm­ rasonographic, CT and pathologic findings. ost always discovered in the first few months of 4 life2- ). Synonyms for this tumor include fetal re­ Case Report nal hamartoma, leiomyomatous hamartoma, mesenchymal hamartoma of infancy, congenital A 2-month-old boy was referred to our hospital Wilms’ tumor, fibroma, fibromyoma, fibrosarcoma due to abdominal mass . He was born at local clinic with NFSD (normal fullterm spontaneous 이 논문은 1989 년 l 월 1 6 일 접 수하여 19 89 년 2 월 10 일에 채택되었음 delivery)and 3.3 Kg.
  • Adult Mesoblastic Nephroma) Mimicking Intraparenchymal Leiomyoma of the Kidney- Zafer Demirer- Eskisehir Military Hospital

    Adult Mesoblastic Nephroma) Mimicking Intraparenchymal Leiomyoma of the Kidney- Zafer Demirer- Eskisehir Military Hospital

    Short Communication Journal of Nephrology & Therapeutics 2021 Vol.11 No.1 Global Nephrology: A giant mixed epithalial and stromal tumor (Adult Mesoblastic Nephroma) mimicking intraparenchymal leiomyoma of the kidney- Zafer Demirer- Eskisehir Military Hospital Zafer Demirer Eskisehir Military Hospital, Turkey Background & Aims: Adult’s kidneys tumor classification tumors. The main differential diagnosis of (MEST) is renal cell expands rapidly with new categories which are including carcinoma. For accurate diagnosis, histopathologic examination recently being incorporated tumors also. Mixed epithelial is a gold standard. stromal tumor of the kidney (MESTs) was recently described and unusual entity. This rare complex renal neoplasm composed of a mixture of cystic and solid components. Although mesoblastic nephroma mostly detected in during the first few weeks of life, the first case of adult mesoblastic nephroma which was grossly and microscopically similar to congenital mesoblastic nephroma was described in 1973. These tumors also termed as benign mixed epithelial and stromal tumor (MESTs) by Michal and Syrucek in 1998. Since then, it has been reported with different names which are leiomiyomatous renal hamartoma, adult type congenital mesoblastic nephroma, adult metanephric stromal tumor, cystic hamartoma of renal pelvis, solitary multilocular cysts of the kidney and multilocular renal cyst with mullerian-like stroma. Herein, we report unusual tumor of the kidney which abundant stroma and devoid of epithelial component. Patient & Methods: A 22-year old female presented with a palpable right-sided abdominal mass and microscopic hematuria. She had no history of hypertension and all laboratory values were normal. A 15 cm heterogenous solid, right renal mass which was displacing the renal parenchyma revealed by contrast-enhanced CT scan without adenopathies Renal mass was also confirmed by MR imaging and there was marked displacement of the inferior vena cava without tumoral infiltration.