Detection of the ETV6-NTRK3 Chimeric RNA of Infantile Fibrosarcoma/Cellular Congenital Mesoblastic Nephroma in Paraffin-Embedded Tissue: Application to Challenging Pediatric Renal Stromal Tumors Pedram Argani, M.D., Michael Fritsch, M.D., Ph.D., ShriHari S. Kadkol, M.D., Ph.D., Amy Schuster, B.S., J. Bruce Beckwith, M.D., Elizabeth J. Perlman, M.D. Department of Pathology, The Johns Hopkins Medical Institutions (PA, MF, SSK, AS, EJP), Baltimore, Maryland, and Department of Pathology and Human Anatomy, Loma Linda University School of Medicine (JBB), Loma Linda, California The discoveries of specific chromosomal transloca- We report the development of a reverse transcrip- tions associated with many pediatric soft-tissue tu- tase polymerase chain reaction assay that reliably mors represent major advances toward understand- detects the ETV6-NTRK3 chimeric RNA characteris- ing the molecular pathogenesis of these lesions (1). tic of infantile fibrosarcoma and the cellular variant The chimeric RNAs produced from the gene fusions of congenital mesoblastic nephroma (CMN) in can be detected by reverse transcriptase polymerase formalin-fixed, paraffin-embedded tissue blocks. chain reaction (RT-PCR), creating sensitive and spe- The 188 base pair polymerase chain reaction fusion cific diagnostic assays for each of these tumors. Typ- product was detected in 11 of 12 cases of cellular ically, such analysis requires fresh tissue that yields CMN from which a larger sized control RNA band intact RNA. The adaptation of these RT-PCR assays could be amplified, and even in 7 of 8 cases in which to RNA extracted from formalin-fixed, paraffin- the control band was not detectable. A variety of embedded tissue (2–4) has made these tests applica- other tumors that are in the histologic differential ble to virtually all specimens and has helped to more diagnosis of cellular CMN yielded negative results, sharply define the clinical and pathologic spectra of including four classic CMNs, four rhabdoid tumors many of these tumors. of the kidney, and four clear cell sarcomas of the A novel t(12;15)(p13;q25) translocation that re- kidney, confirming the assay’s specificity. We fur- sults in an ETV6-NTRK3 gene fusion was recently ther demonstrate the assay’s utility by illustrating discovered in infantile fibrosarcoma (5). Of note, two cases of molecularly confirmed cellular CMN this fusion was not found in a limited number of that mimicked rhabdoid tumor and clear cell sar- cases of either adult type fibrosarcoma or infantile coma of the kidney. In contrast to previous reports, fibromatosis. Subsequently, two groups (6, 7) have five mixed CMNs that had both classic and cellular demonstrated the identical ETV6-NTRK3 gene fu- areas all lacked the ETV6-NTRK3 fusion transcript. sion in the cellular variant of congenital mesoblas- These results suggest that cases morphologically de- tic nephroma (CMN) of the kidney, which is mor- fined as mixed CMN may represent a mixed group phologically identical to infantile fibrosarcoma and of genetically distinct entities. affects the same age group. The classical variant of CMN, which is morphologically identical to infan- KEY WORDS: Congenital mesoblastic nephroma, tile fibromatosis, did not contain the fusion tran- Infantile fibrosarcoma, Reverse transcriptase poly- script. These results strongly support that cellular merase chain reaction. CMN represents infantile fibrosarcoma of the kid- Mod Pathol 2000;13(1):29–36 ney and renal sinus and indicate that the classical variant of CMN represents a distinct entity. It is interesting that a small number of cases of “mixed” CMN, which have both cellular and classical foci, Copyright © 2000 by The United States and Canadian Academy of were reported to be fusion positive (6, 7). Pathology, Inc. VOL. 13, NO. 1, P. 29, 2000 Printed in the U.S.A. Because of the tremendous morphologic overlap Date of acceptance: July 1, 1999. that exists among pediatric renal tumors and the Address reprint requests to: Pedram Argani, M.D., The Johns Hopkins Hospital, Pathology Building, Room 612, 600 North Wolfe Street, Balti- diagnostic dilemmas thereby created, and to ana- more, MD 21287; e-mail: [email protected]; fax: 410-614-9386. lyze a larger number of mixed CMN cases, we at- 29 tempted to adapt an RT-PCR assay for the ETV6- mM each nucleotide, 5 mM magnesium chloride, NTRK3 gene fusion to formalin-fixed, paraffin- and 20 units RNase inhibitor (Boehringer Mann- embedded tissue. We report the development of heim, Indianapolis, IN) in PCR buffer (Perkin- this assay and its application to problematic renal Elmer, Norwalk, CT). The reaction was performed tumor cases and to mixed CMN cases. at 42° C for 30 min in a Coy Tempcycler II thermo- cycler, Model 110 S (Coy Corp., Grass Lake, MI). MATERIALS AND METHODS The enzyme and first-strand cDNA were then de- natured at 94° C for 5 min and chilled on ice for 5 Case Selection min. To assess the adequacy of the RNA, the entire The files of the National Wilms Tumor Study 20 ␮L RT reaction was subjected to PCR using prim- Pathology Center and the personal consultation ers (2) (Table 1) that span an intron of the ubiqui- files (OCWT files) of one of the authors (JBB) were tously expressed phosphoglycerate kinase gene searched for cases of CMN or cases in which CMN (PGK). Because the primers chosen span an intron, was a strong diagnostic consideration but for which the product of amplification of any contaminating another diagnosis had been rendered. From this DNA would be approximately 200 base pairs larger group of more than 300 cases, those for which a than and hence readily distinguishable from the paraffin-embedded, formalin-fixed tissue block was product of RNA amplification (263 base pairs). Be- available (approximately 30) were selected. All cause PGK has no known processed pseudogenes, slides were reviewed by one author (PA). Cases for the ability to produce this 263 base pair product which an alternative diagnosis seemed possible and indicates that intact, amplifiable RNA fragments of all cases of mixed cellular and classical mesoblastic at least that size are still present in the block, de- nephroma were reviewed together by two of the spite processing. A negative (water) control was run authors (PA and JBB) using a dual observer micro- with each set of cases. The PCR cycling parameters scope. Clinical data were gleaned from the submit- were as follows: 1 min each at 95, 66, 72, 95, 65, 72, ting institution’s pathology report. 95, 64, 72, 95, 63, 72, 95, 62, 72, 95, 61, and 72° C, followed by 35 cycles at 95, 60, and 72° C for 1 min RNA Extraction each. A 10-min final extension at 72° C ended the protocol. Twenty-five microliters of each PCR reac- A detailed description of this method has been previ- tion (approximately one fourth) underwent electro- ously published (3); the following summary includes phoresis in 2.5% agarose gels containing 50% Nu- minor modifications from that method. Briefly, four Sieve Agarose (FMC Bioproducts, Rockland, ME) 10-␮ sections from each tissue block were cut and and 50% Ultrapure agarose (Gibco BRL), and was placed in a sterile Eppendorf tube. Microtome blades visualized with ethidium bromide staining. were changed between cutting each block. After two To detect the ETV6-NTRK3 fusion transcript, we xylene washes for deparaffinization and two ethanol designed primers (Table 1) that closely flanked the washes to remove xylene, the tissue was resuspended in published fusion breakpoint, so as to amplify a 0.35 mL of digestion buffer (20 mM Tris pH 8.0, 10 mM relatively small 188 base pair PCR product. This EDTA, 1% sodium dodecyl sulfate [SDS] in strategy has previously proved effective in detecting diethylpyrocarbonate-treated, autoclaved water) and di- chimeric RNA transcripts among the partially de- gested with 500 ␮g proteinase K overnight at 55° C. The graded RNA present in tissue blocks (2–4). The next day, RNA was extracted using 0.9 mL of phenol/ primers chosen were designed and optimized using guanidine isothiocyanate (Trizol; Gibco BRL, Friends- the Oligo Primer Analysis Software Version 5.0 (Mo- wood, TX) and 0.2 mL chloroform followed by vortexing. lecular Biology Insights, Inc., Cascade, CO), and After centrifugation, the upper aqueous phase was re- BLAST analysis (http://www.ncbi.nih.gov) was per- moved; placed in a new Eppendorf tube; and precipi- formed to rule out significant primer annealing tated with 0.7 mL isopropanol, 75 ␮lof3M sodium with other known genes. Reverse transcription, acetate, and 2 ␮l of Pellet Paint Co-Precipitant (Nova- PCR, and electrophoresis conditions were identical gen, Madison, WI). After successive 70% and 100% eth- to those used with the PGK primers. A negative anol washes, the pellet was resuspended in 30 ␮Lof diethylpyrocarbonate-treated water, treated with DNase Ϫ I (Gibco BRL), and frozen at 20° C until use. TABLE 1. Polymerase Chain Reaction Primers and Probes Reverse Transcriptase Polymerase Chain Primer/Probe Name Sequence Reaction PGK forward CAGTTTGGAGCTCCTGGAAG ␮ PGK reverse TGCAAATCCAGGGTGCAGTG Approximately one tenth (4 L) of each RNA ex- ETV6 forward AGCCCATCAACCTCTCTCAT tract was reverse transcribed in a volume of 20 ␮l NTRK3 reverse CTCGGCCAGGAAGACCTTTC with 50 pmol random hexamers, 100 units of Su- ETV6-NTRK3 fusion probe GGGAGAATAGCAGATGTGCAGCAC perscript II Reverse Transcriptase (Gibco BRL), 2 PGK, phosphoglycerate kinase gene. 30 Modern Pathology (water) control and a known positive control block (Amersham) for periods of 10 seconds (short expo- were run with every set of cases tested. All primers sure), 2 min, and 20 min (long exposure). were synthesized at the Johns Hopkins University School of Medicine DNA Analysis Facility. RESULTS Assay Verification Southern Blotting and Oligonucleotide Probing RNA extracted from a known case of CMN was After the products of the ETV6-NTRK3 PCR reac- subjected to RT-PCR using the designed ETV6- tions were visualized by ethidium bromide staining, NTRK3 primer pair to test its performance.