Analyses of the Associations Between the Genes of 22Q11 Deletion Syndrome and Schizophrenia

Total Page:16

File Type:pdf, Size:1020Kb

Analyses of the Associations Between the Genes of 22Q11 Deletion Syndrome and Schizophrenia J Hum Genet (2006) 51:1037–1045 DOI 10.1007/s10038-006-0058-5 MINIREVIEW Analyses of the associations between the genes of 22q11 deletion syndrome and schizophrenia Tadao Arinami Received: 4 July 2006 / Accepted: 22 August 2006 / Published online: 13 September 2006 Ó The Japan Society of Human Genetics and Springer 2006 Abstract Schizophrenia is a severe, debilitating deletion region are conserved together on mouse mental disorder characterized by profound distur- chromosome 16, enabling the generation of mouse bances of cognition, emotion and social functioning. models. Similarities in the cardiovascular and other The lifetime morbid risk is surprisingly uniform at phenotypes between 22q11DS patients and mouse slightly less than 1% across different populations and models can provide important insights into roles of different cultures. The evidence of genetic risk factors genes in neurobehavioral phenotypes. Because more is our strongest clue to the cause of schizophrenia. than one gene in the 22q11DS region is likely to con- Linkage and association analyses have identified genes tribute to the marked risk for schizophrenia, further associated with the development of schizophrenia. extensive studies are necessary. Analyses of 22q11DS However, most of the alleles or haplotypes identified will help clarify the molecular pathogenesis of schizo- thus far have only a weak association or are reported to phrenia. be population specific. A deletion of 22q11.2 that causes the most common microdeletion syndrome Keywords Chromosome 22 Æ Microdeletion Æ (22q11DS) with an estimated prevalence of 1:2,500– Haploinsufficiency Æ Schizophrenia Æ 1:4,000 live births may represent one of the greatest Prepulse inhibition Æ Mouse model known genetic risk factors for schizophrenia. Schizo- phrenia is a late manifestation in approximately 30% of patients with 22q11.2 deletion, comparable to the Introduction risk to offspring of two parents with schizophrenia. Clinical and neuroimaging assessments indicate that Schizophrenia, a devastating mental disorder that af- 22q11DS-schizophrenia is a neurodevelopmental fects approximately 1% of the world’s population, is a model of schizophrenia. Recent studies have provided genetically complex disorder. The multifactorial poly- evidence that haploinsufficiency of TBX1 is likely to be genic model has received the most support for the responsible for many of the physical features associ- mode of inheritance responsible for the familial dis- ated with the deletion. Most of the genes in the 22q11 tribution of schizophrenia; therefore, a variety of ge- netic, environmental and stochastic factors are likely involved in the etiology. However, it is also possible T. Arinami (&) that specific genes play a major role in susceptibility to Department of Medical Genetics, schizophrenia, and efforts to identify such genes have Graduate School of Comprehensive Human Sciences, University of Tsukuba, revealed that an overall loss of DISC1 function by ei- Tsukuba, Ibaraki 305-8577, Japan ther haploinsufficiency or dominant-negative, or both e-mail: [email protected] (Ishizuka et al. 2006), or gene(s) involved in 22q11.2 deletion syndrome (22q11DS) substantially increases T. Arinami CREST, Japan Science and Technology Agency, susceptibility to schizophrenia. Alteration of DISC1 Kawaguchi-shi, Saitama 332-0012, Japan has been reported in only two families, whereas the 123 1038 J Hum Genet (2006) 51:1037–1045 22q11 deletion is detected relatively frequently in (borderline intellect, 51.3%; mild mental retardation, schizophrenia patients; a number of studies have 33.3% and moderate mental retardation, 7.7%). shown that 22q11DS-schizophrenia is a true genetic Adjusting for ascertainment source, 25.8% of patients subtype of schizophrenia (Bassett and Chow 1999; had cardiac anomalies and 22.6% had schizophrenia. Karayiorgou and Gogos 2004). Here I review recent studies of humans and rodents that have clarified the genetic basis for this specific subtype. Prevalence of the 22q11.2 deletion in unselected schizophrenia patients Several studies screened for 22q11.2 deletion in adult 22q11DS and psychiatric problems patients with schizophrenia. The first study found such a deletion in 2 of 100 patients with schizophrenia 22q11DS is the most common microdeletion syndrome, (Karayiorgou et al. 1995), and the second study found a with an estimated prevalence of 1:2,500–1:4,000 live deletion in 1 of 326 psychiatric inpatients (Sugama births (Tezenas Du Montcel et al. 1996; Oskarsdottir et al. 1999). The patient’s full IQ indicated mild et al. 2004). It is estimated that only 5–10% of 22q11.2 retardation with the verbal IQ being higher than the deletions are inherited (Scambler 2000). The deletion performance IQ. We screened 300 patients meeting the of 22q11.2 is associated with a wide variety of birth DSM-IIIR criteria for schizophrenia and identified 1 defects and malformations that occur in various com- patient with 22q11.2 deletion and mild retardation binations and with widely differing severity. 22q11DS (Arinami et al. 2001). Additional studies screened for is associated with several diagnostic labels including 22q11.2 deletion in a subset of schizophrenia patients. DiGeorge syndrome (DGS), velocardiofacial (or Usiskin et al. (1999) recruited 47 patients with child- Shprintzen) syndrome (VCFS), conotruncal anomaly hood onset schizophrenia and found that 3 carried a face, Cayler syndrome and Opitz GBBB syndrome. deletion of 22q11.2; all patients had premorbid 22q11DS is also associated with learning difficulties, impairment of language, motor and social develop- specific cognitive deficits and increased risk of neuro- ment. Thus, there is a 20- to 80-fold higher prevalence psychiatric disorders (Scambler et al. 1992; Swillen of the 22q11.2 microdeletion in patients with schizo- et al. 1997a, b; Henry et al. 2002). Attention-deficit/ phrenia relative to that of the general population. A hyperactivity disorder (ADHD) is one of the most deletion of chromosome 22q11.2 may represent one of common psychiatric problems associated with the greatest known genetic risk factors for schizo- 22q11DS in children. ADHD, primarily the inattentive phrenia. subtype, is present in 35–55% of 22q11DS cases (Gothelf et al. 2004a). In addition, approximately 11% of children with 22q11DS are autistic, and these chil- dren show greater developmental delay than those Psychopathologic characterization of 22q11.2 without autistic spectrum disorder (Fine et al. 2005). Other common psychiatric problems in children with Although many of physical symptoms in 22q11DS are 22q11DS include affective disorders such as bipolar well understood, far less is known about the apparent disorder and depression (Arnold et al. 2001). changes in brain structure and function, and their In adults with 22q11DS, high rates of obsessive- relation to the range of cognitive impairments and compulsive disorder (OCD) and schizophrenia have psychiatric disorders. A study of 33 children and adults been reported. In one study, diagnostic criteria for with 22q11DS reported a mean full-scale IQ in the OCD were fulfilled in 32.6% of individuals with borderline range of intellectural functioning 22q11DS (Gothelf et al. 2004b). Schizophrenia is a late (71.2±12.8) (Moss et al. 1999). With regard to psy- manifestation in approximately 30% of cases, which is chosocial and behavioral functioning, significantly ele- comparable to the risk to offspring of two parents with vated scores for the ‘‘social problems,’’ ‘‘attention schizophrenia. Bassett et al. (2005) described a study of problems’’ and ‘‘withdrawn’’ sub-scales were indicated 78 adults (age ‡17 years) with 22q11DS who met two by the Child Behvior Checklist (Swillen et al. 1997a, b). or more of seven broad categories of features (dys- Examination of the schizophrenia phenotype in morphic facies, hypernasal speech, history of learning individuals with 22q11DS without metal retardation difficulties, cardiac defect, thymic hypoplasia, other (IQ ‡70) revealed no significant differences in age at birth defects and hypocalcemia). Intellectual disability onset, lifetime or cross-sectional core positive and was observed in 92.3% of the adults with 22q11DS negative schizophrenic symptoms or global functioning 123 J Hum Genet (2006) 51:1037–1045 1039 between schizophrenic patients with 22q11DS and posterior brain regions may be indicative of corpus those without it. Thus, the core clinical schizophrenia callosum displacement due to enlarged cerebral ven- phenotype does not differ significantly between indi- tricles in individuals with 22q11DS. Campbell et al. viduals with the 22q11 deletion subtype and those with (2006) reported a significant reduction in cerebellar schizophrenia who do not have the 22q11 deletion grey matter and white matter reductions in the frontal subtype (Bassett et al. 2003). Because high rates of lobe, cerebellum and internal capsule in individuals congenital dysmorphic features, developmental struc- with 22q11DS. Among individuals with 22q11DS, a tural brain abnormalities and cognitive dysfunction in significant positive correlation was found between the 22q11DS are consistent with a subtype of schizophre- severity of the schizotypy score and grey matter vol- nia representing an especially neurodevelopmental ume of the temporo-occipital regions and the corpus form of the illness, the authors concluded that the striatum and between social behavioral difficulties and findings support the utility of 22qDS-schizophrenia as a grey matter volume in
Recommended publications
  • Diminished Dosage of 22Q11 Genes Disrupts Neurogenesis and Cortical Development in a Mouse Model of 22Q11 Deletion/Digeorge Syndrome
    Diminished dosage of 22q11 genes disrupts neurogenesis and cortical development in a mouse model of 22q11 deletion/DiGeorge syndrome Daniel W. Meechana, Eric S. Tuckera, Thomas M. Maynarda, and Anthony-Samuel LaMantiaa,b,1 aDepartment of Cell and Molecular Physiology and bNeuroscience Center, University of North Carolina School of Medicine, Chapel Hill, NC 27599 Edited by Pasko Rakic, Yale University School of Medicine, New Haven, CT, and approved July 22, 2009 (received for review May 28, 2009) The 22q11 deletion (or DiGeorge) syndrome (22q11DS), the result of flect changes in cortical neurogenesis. We focused on two a 1.5- to 3-megabase hemizygous deletion on human chromosome 22, distinct classes of cortical progenitors: basal progenitors–transit results in dramatically increased susceptibility for ‘‘diseases of cortical amplifying progenitors in the cortical subventricular zone connectivity’’ thought to arise during development, including schizo- (SVZ)–and apical progenitors–self-renewing radial glial stem phrenia and autism. We show that diminished dosage of the genes cells present in the cortical VZ. Each class can be recognized deleted in the 1.5-megabase 22q11 minimal critical deleted region in with combinations of proliferative and molecular markers (Fig. a mouse model of 22q11DS specifically compromises neurogenesis 1). We found reduced frequency of mitotic basal progenitors, and subsequent differentiation in the cerebral cortex. Proliferation of identified by phosphohistone 3 labeling (PH3; a G2/M-phase basal, but not apical, progenitors is disrupted, and subsequently, the cell-cycle marker) as well as SVZ location, throughout the frequency of layer 2/3, but not layer 5/6, projection neurons is altered.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name DiGeorge syndrome critical region gene 14 Gene Symbol Dgcr14 Organism Mouse Gene Summary The human ortholog of this gene is located within the minimal DGS critical region (MDGCR) thought to contain the gene(s) responsible for a group of developmental disorders. These disorders include DiGeorge syndrome velocardiofacial syndrome conotruncal anomaly face syndrome and some familial or sporadic conotruncal cardiac defects which have been associated with microdeletion of human chromosome band 22q11.2. The encoded protein localizes to the nucleus and the orthologous protein in humans co-purifies with C complex spliceosomes. Multiple transcript variants encoding different isoforms have been found for this gene. Gene Aliases AI462402, D16H22S1269E, Dgcr1, Dgsi, ES2, Es2el RefSeq Accession No. NC_000082.6, NT_039624.8, NT_187007.1 UniGene ID Mm.256480 Ensembl Gene ID ENSMUSG00000003527 Entrez Gene ID 27886 Assay Information Unique Assay ID qMmuCID0011048 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000003621 Amplicon Context Sequence GCCTGTAGCTTCTCCACATCAGGGAAGAAGTCTCTCTGGATAACTGTCTGAAGTC CCTCGATGTACTCTTCTTCATCCAGGACCCGCTGCCTGCTTCTCGCAACTCCGG CCT Amplicon Length (bp) 82 Chromosome Location 16:17910201-17911217 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 95 R2 0.9994 cDNA Cq 21.87 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79.5 gDNA Cq 23.94 Specificity (%) 100 Information to assist with data interpretation is provided
    [Show full text]
  • CRNKL1 Is a Highly Selective Regulator of Intron-Retaining HIV-1 and Cellular Mrnas
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934927; this version posted February 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 CRNKL1 is a highly selective regulator of intron-retaining HIV-1 and cellular mRNAs 2 3 4 Han Xiao1, Emanuel Wyler2#, Miha Milek2#, Bastian Grewe3, Philipp Kirchner4, Arif Ekici4, Ana Beatriz 5 Oliveira Villela Silva1, Doris Jungnickl1, Markus Landthaler2,5, Armin Ensser1, and Klaus Überla1* 6 7 1 Institute of Clinical and Molecular Virology, University Hospital Erlangen, Friedrich-Alexander 8 Universität Erlangen-Nürnberg, Erlangen, Germany 9 2 Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine in the 10 Helmholtz Association, Robert-Rössle-Strasse 10, 13125, Berlin, Germany 11 3 Department of Molecular and Medical Virology, Ruhr-University, Bochum, Germany 12 4 Institute of Human Genetics, University Hospital Erlangen, Friedrich-Alexander Universität Erlangen- 13 Nürnberg, Erlangen, Germany 14 5 IRI Life Sciences, Institute für Biologie, Humboldt Universität zu Berlin, Philippstraße 13, 10115, Berlin, 15 Germany 16 # these two authors contributed equally 17 18 19 *Corresponding author: 20 Prof. Dr. Klaus Überla 21 Institute of Clinical and Molecular Virology, University Hospital Erlangen 22 Friedrich-Alexander Universität Erlangen-Nürnberg 23 Schlossgarten 4, 91054 Erlangen 24 Germany 25 Tel: (+49) 9131-8523563 26 e-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934927; this version posted February 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • A Single-Cell Transcriptomic Landscape of Primate Arterial Aging
    ARTICLE https://doi.org/10.1038/s41467-020-15997-0 OPEN A single-cell transcriptomic landscape of primate arterial aging Weiqi Zhang 1,2,3,4,5,13, Shu Zhang6,7,13, Pengze Yan3,8,13, Jie Ren7,9,13, Moshi Song3,5,8, Jingyi Li2,3,8, Jinghui Lei4, Huize Pan2,3, Si Wang3,5,8, Xibo Ma3,10, Shuai Ma2,3,8, Hongyu Li2,3, Fei Sun2,3, Haifeng Wan3,5,11, ✉ ✉ ✉ Wei Li 3,5,11, Piu Chan4, Qi Zhou3,5,11, Guang-Hui Liu 2,3,4,5,8 , Fuchou Tang 6,7,9,12 & Jing Qu 3,5,11 Our understanding of how aging affects the cellular and molecular components of the vas- 1234567890():,; culature and contributes to cardiovascular diseases is still limited. Here we report a single-cell transcriptomic survey of aortas and coronary arteries in young and old cynomolgus monkeys. Our data define the molecular signatures of specialized arteries and identify eight markers discriminating aortic and coronary vasculatures. Gene network analyses characterize tran- scriptional landmarks that regulate vascular senility and position FOXO3A, a longevity- associated transcription factor, as a master regulator gene that is downregulated in six subtypes of monkey vascular cells during aging. Targeted inactivation of FOXO3A in human vascular endothelial cells recapitulates the major phenotypic defects observed in aged monkey arteries, verifying FOXO3A loss as a key driver for arterial endothelial aging. Our study provides a critical resource for understanding the principles underlying primate arterial aging and contributes important clues to future treatment of age-associated vascular disorders. 1 CAS Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China.
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • Análise Correlacional Entre a Expressão Dos Fatores De Splicing E a Ocorrência De Splicing Alternativo Em Tecidos Humanos E De Camundongos
    ANÁLISE CORRELACIONAL ENTRE A EXPRESSÃO DOS FATORES DE SPLICING E A OCORRÊNCIA DE SPLICING ALTERNATIVO EM TECIDOS HUMANOS E DE CAMUNDONGOS JULIO CÉSAR NUNES Dissertação apresentada à Fundação Antônio Prudente para a obtenção do título de Mestre em Ciências Área de Concentração: Oncologia Orientador: Dr. Sandro José de Souza São Paulo 2008 Livros Grátis http://www.livrosgratis.com.br Milhares de livros grátis para download. FICHA CATALOGRÁFICA Preparada pela Biblioteca da Fundação Antônio Prudente Nunes, Julio César Análise correlacional entre a expressão dos fatores de splicing e a ocorrência de splicing alternativo em tecidos humanos e de camundongos / Julio César Nunes – São Paulo, 2008. 79p. Dissertação (Mestrado) - Fundação Antônio Prudente. Curso de Pós-Graduação em Ciências - Área de concentração: Oncologia. Orientador: Sandro José Souza Descritores: 1. SPLICING ALTERNATIVO 2. BIOLOGIA MOLECULAR COMPUTACIONAL 3. CÂNCER 4. GENOMICA. AGRADECIMENTOS Agradeço à FAPESP e CAPES pela bolsa de Mestrado. Ao Sandro José de Souza agradeço toda orientação e conhecimento oferecido. Meus especiais agradecimentos ao Pedro Alexandre Favoretto Galante que dedicou atenção a minha formação no processo de Pós-Graduação na Fundação Antônio Prudente, bem como pela sua oficiosa co-orientação ao projeto de pesquisa. À grande família e amigos pela dedicação e incentivo a minha formação acadêmica. À Fundação Antônio Prudente, Hospital do Câncer e Instituto Ludwig de Pesquisa sobre o Câncer dedico os meus nobres agradecimentos finais. RESUMO Nunes JC. Análise correlacional entre a expressão dos fatores de splicing e a ocorrência de splicing alternativo em tecidos humanos e de camundongos. São Paulo; 2007. [Dissertacão de Mestrado - Fundação Antônio Prudente] Splicing alternativo desempenha uma significante função no aumento da complexidade genômica, produzindo um extenso número de mRNA e isoformas protéicas.
    [Show full text]
  • DGCR6 at the Proximal Part of the Digeorge Critical Region Is Involved in Conotruncal Heart Defects
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Institutional Repository : the EHIME area OPEN Citation: Human Genome Variation (2015) 2, 15004; doi:10.1038/hgv.2015.4 © 2015 The Japan Society of Human Genetics All rights reserved 2054-345X/15 www.nature.com/hgv ARTICLE DGCR6 at the proximal part of the DiGeorge critical region is involved in conotruncal heart defects Wenming Gao1, Takashi Higaki1, Minenori Eguchi-Ishimae1, Hidehiko Iwabuki1, Zhouying Wu1, Eiichi Yamamoto2, Hidemi Takata1, Masaaki Ohta1, Issei Imoto3, Eiichi Ishii1 and Mariko Eguchi1 Cardiac anomaly is one of the hallmarks of DiGeorge syndrome (DGS), observed in approximately 80% of patients. It often shows a characteristic morphology, termed as conotruncal heart defects. In many cases showing only the conotruncal heart defect, deletion of 22q11.2 region cannot be detected by fluorescence in situ hybridization (FISH), which is used to detect deletion in DGS. We investigated the presence of genomic aberrations in six patients with congenital conotruncal heart defects, who show no deletion at 22q11.2 in an initial screening by FISH. In these patients, no abnormalities were identified in the coding region of the TBX1 gene, one of the key genes responsible for the phenotype of DGS. However, when copy number alteration was analyzed by high-resolution array analysis, a small deletion or duplication in the proximal end of DiGeorge critical region was detected in two patients. The affected region contains the DGCR6 and PRODH genes. DGCR6 has been reported to affect the expression of the TBX1 gene. Our results suggest that altered dosage of gene(s) other than TBX1, possibly DGCR6, may also be responsible for the development of conotruncal heart defects observed in patients with DGS and, in particular, in those with stand-alone conotruncal heart defects.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients.
    [Show full text]
  • A Collection of Pre-Mrna Splicing Mutants in Arabidopsis Thaliana
    G3: Genes|Genomes|Genetics Early Online, published on April 7, 2020 as doi:10.1534/g3.119.400998 1 1 A collection of pre-mRNA splicing mutants in Arabidopsis thaliana 2 3 4 Tatsuo Kanno1,a, Peter Venhuizen2,a, Ming-Tsung Wu3, Phebe Chiou1, Chia-Liang Chang1, 5 Maria Kalyna2,c, Antonius J.M. Matzke1,c and Marjori Matzke1,c 6 7 1Institute of Plant and Microbial Biology, Academia Sinica, 128, Sec. 2, Academia Rd., Nangang 8 District, Taipei, 11529 Taiwan 9 10 2Department of Applied Genetics and Cell Biology, University of Natural Resources and Life 11 Sciences - BOKU, Muthgasse 18, 1190 Vienna, Austria 12 13 3Department of Plant Sciences, University of Cambridge, Downing Street, CB2 3EA Cambridge, 14 UK 15 16 athese authors should be regarded as joint first authors 17 18 19 cCorresponding authors: 20 Antonius J.M. Matzke ([email protected]) 21 Tel: +886-2787-1135 22 Marjori Matzke ([email protected]) 23 Tel: +886-2787-1135 24 Maria Kalyna ([email protected]) 25 Tel: +43-1-47654-94112 26 27 28 29 30 31 32 © The Author(s) 2020. Published by the Genetics Society of America. 2 33 34 Running title: Arabidopsis pre-mRNA splicing mutants 35 36 Key words: Arabidopsis thaliana, CBP80. miRNAs, mutant screen, pre-mRNA splicing 37 38 39 40 Corresponding authors: 41 Antonius J.M. Matzke ([email protected]), Institute of Plant and Microbial 42 Biology, Academia Sinica, 128, Sec. 2, Academia Rd., Nangang District, Taipei, 11529 Taiwan 43 Tel: +886-2787-1135 44 45 Marjori Matzke ([email protected]), Institute of Plant and Microbial Biology, 46 Academia Sinica, 128, Sec.
    [Show full text]
  • Molecular Characterization of Selectively Vulnerable Neurons in Alzheimer's Disease
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Neurosci Manuscript Author . Author manuscript; Manuscript Author available in PMC 2021 July 11. Published in final edited form as: Nat Neurosci. 2021 February ; 24(2): 276–287. doi:10.1038/s41593-020-00764-7. Molecular characterization of selectively vulnerable neurons in Alzheimer’s Disease Kun Leng1,2,3,4,13, Emmy Li1,2,3,13, Rana Eser5, Antonia Piergies5, Rene Sit2, Michelle Tan2, Norma Neff2, Song Hua Li5, Roberta Diehl Rodriguez6, Claudia Kimie Suemoto7,8, Renata Elaine Paraizo Leite7, Alexander J. Ehrenberg5, Carlos A. Pasqualucci7, William W. Seeley5,9, Salvatore Spina5, Helmut Heinsen7,10, Lea T. Grinberg5,7,11,*, Martin Kampmann1,2,12,* 1Institute for Neurodegenerative Disease, University of California, San Francisco, San Francisco, CA, USA. 2Chan Zuckerberg Biohub, San Francisco, CA, USA. 3Biomedical Sciences Graduate Program, University of California, San Francisco, San Francisco, CA, USA. 4Medical Scientist Training Program, University of California, San Francisco, San Francisco, CA, USA. 5Memory and Aging Center, Weill Institute for Neurosciences, Department of Neurology, University of California, San Francisco, San Francisco, CA, USA. 6Department of Neurology, Universidade de São Paulo, Faculdade de Medicina, São Paulo, Brazil. Users may view, print, copy, and download text and data-mine the content in such documents, for the purposes of academic research, subject always to the full Conditions of use:http://www.nature.com/authors/editorial_policies/license.html#terms * [email protected]; [email protected]. AUTHOR CONTRIBUTIONS K.L., E.L., L.T.G. and M.K. conceptualized and led the overall project. K.L., L.T.G.
    [Show full text]
  • Inducers of the Endothelial Cell Barrier Identified Through Chemogenomic Screening in Genome-Edited Hpsc-Endothelial Cells
    Inducers of the endothelial cell barrier identified through chemogenomic screening in genome-edited hPSC-endothelial cells Filip Roudnickya,1, Jitao David Zhang (张继涛)b,1,2, Bo Kyoung Kimc, Nikhil J. Pandyab, Yanjun Lana, Lisa Sach-Peltasond, Heloise Ragellec, Pamela Strassburgerc, Sabine Gruenerc, Mirjana Lazendicc, Sabine Uhlesc, Franco Revelantc, Oliv Eidamd, Gregor Sturmb, Verena Kueppersc, Klaus Christensena, Leonard D. Goldsteine, Manuel Tzourosb, Balazs Banfaib, Zora Modrusane, Martin Grafa, Christoph Patscha, Mark Burcina, Claas A. Meyera,3, Peter D. Westenskowc,2,3, and Chad A. Cowanf,g,h,2,3 aTherapeutic Modalities, Pharmaceutical Research and Early Development, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., CH-4070 Basel, Switzerland; bPharmaceutical Sciences, Pharmaceutical Research and Early Development, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., CH-4070 Basel, Switzerland; cOcular Technologies, Immunology, Infectious Diseases and Ophthalmology, Pharmaceutical Research and Early Development, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., CH-4070 Basel, Switzerland; dPharma Research and Early Development Informatics, Pharmaceutical Research and Early Development, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., CH-4070 Basel, Switzerland; eMolecular Biology Department, Genentech Inc., South San Francisco, CA 94080; fDivision of Cardiology, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215; gDepartment of Stem Cell and Regenerative
    [Show full text]