AN ABSTRACT OF THE THESIS OF

Amy B. Peetz for the degree of Master of Science in Botany and Plant Pathology presented on July 23, 2007.

Title: Understanding Sporulation and Dissemination of Podosphaera macularis, Hop

Powdery Mildew.

Abstract approved:

Walter F. Mahaffee

Podosphaera macularis causes one of the most important diseases, powdery

mildew, of Humulus lupulus (hop). If left unmanaged, hop powdery mildew can cause

total crop loss due to disease or browning of hop cones rendering the cones unmarketable

to buyers. The Hop Powdery Mildew Infection Risk Index (HOPS) is heavily relied on

for management of the disease. However, HOPS assumes constant inoculum presence,

which is not likely to be true. Evidence suggests that temperature fluctuations influence

inoculum availability. As such, knowledge of inoculum presence and density and their

relationship to environmental conditions may increase management efficacy by reducing

pesticide use and cost of crop production.

Molecular methods for detecting and quantifying P. macularis were developed

and used to analyze air samples taken from hop fields for two seasons. A protocol for

DNA extraction from field samples was modified in order to use PCR to detect and

quantify P. macularis DNA from the field. Primers and a probe designed to the internal transcribed spacer (ITS) region of P. macularis ribosomal DNA have made inoculum detection possible using both conventional polymerase chain reaction (PCR) and real- time quantitative PCR (qPCR). DNA extracted from conidia impinged on glass rods coated in silicon grease has been used as template for qPCR, and we have successfully detected as DNA extracted from 10 spores

Specific and sensitive detection of P. macularis DNA with conventional PCR was possible under conditions typically used to evaluate qPCR; however results from field samples indicated that sensitivity was an issue, in that spores were not detected in samples from fields with high disease pressure.

The effects of constant exposure (5, 10, 15, 20, 25, 30, and 35°C) and 6 hr exposure (18, 22, 26, 30, 34, and 38°C) on sporulation of P. macularis were tested.

Exposure to constant low and high temperatures decreases sporulation, which indicates that inoculum may not always be available once the epidemic has started. Sporulation is also decreased during brief exposures to temperatures above 30°C. These data indicate that inoculum availability is reduced when the temperature exceeds 30°C in the field. A modification of HOPS should be examined to incorporate an algorithm which takes the findings in this study into account. Understanding Sporulation and Dissemination of Podosphaera macularis, Hop Powdery

Mildew

by

Amy B. Peetz

A THESIS

submitted to

Oregon State University

in partial fulfillment of

the requirements for the

degree of

Master of Science

Presented on July 23 2007

Commencement June 2008 Master of Science thesis of Amy B Peetz presented on July 23, 2007

Approved:

Major Professor, representing Botany and Plant Pathology

Chair of the Department of Botany and Plant Pathology

Dean of the Graduate School

I understand that my thesis will become part of the permanent collection of Oregon State

University libraries. My signature below authorizes release of my thesis to any reader upon request.

Amy B Peetz, Author ACKNOWLEDGEMENTS

I would like to thank my major professor, Dr. Walter Mahaffee for the opportunity to work toward a Masters of Science degree with him at the USDA-ARS

HCRL, and for the mentorship which reflected his own excellent standard of research, patience, and generosity. This is experience was not absent of challenge, and I learned a great deal of how to work through failure with a shrug and a smile in the pursuit of higher knowledge. I am also grateful to an excellent graduate committee, who guided and supported me through this research.

I wouldn’t have had a good start without the mentoring of Meredith Larson, and the technical and emotional support of Tara Neill was a constant throughout this process.

I greatly appreciate the countless conversations I had with Brenda Shaffer, Marcella

Henkels, Ruth Price, and Virginia Stockwell in Dr. Joyce Loper’s lab at the USDA-ARS

HCRL over troubleshooting molecular methods. The tips and techniques I picked up in those conversations were priceless, and my research was stronger for their input. The statistical analysis of my data was greatly enhanced by generous advice of Dr. Niklaus

Grunwald.

I am grateful to Madeline Dildine and Patricia Wallace for helping with the enormous task of processing field samples. Clair Elliott also generously contributed countless hours helping with temperature experiments. The field scouting reported in this study would not have been possible without the help of Andrew Albrect, Baird Chrisman, and data shared by Dr. David Gent of the USDA-ARS FSCRL and members of his lab. CONTRIBUTION OF AUTHORS

Dr. Walter Mahaffee was involved in the method development, data analysis, writing, and editing of all research reported in this thesis. Dr. John Jackson was involved in developing the first primer set used in this research to amplify Podosphaera macularis

DNA. Dr. Gary Grove assisted in the design of methods used in the research reported in

Chapter 3, including validation of the spore traps as a viable method for air sampling.

Dr. David Gent collected the majority of the field disease incidence data reported in

Chapter 3. TABLE OF CONTENTS

Page

Introduction...... 1 Sporulation of the Powdery Mildews ...... 3 Introduction...... 3 Ascospores ...... 5 Conidia...... 7 Conclusion ...... 18 Detection and quantification of airborne Podosphaera macularis conidia in hop yards . 19 Introduction...... 19 Materials and Methods...... 24 Results...... 33 Discussion...... 44 Effects of Temperature on the Sporulation of Podosphaera macularis on Humulus lupulus...... 50 Introduction...... 50 Materials and Methods...... 52 Results...... 57 Discussion...... 60 Conclusion ...... 64 Appendix...... 66 Appendix A: Podosphaera macularis ITS Region Consensus Sequence and Primer Target Locations ...... 67 Appendix B: Alignment of ITS sequence of Podosphaera macularis and Podosphaera clandestina ...... 68 Bibliography ...... 70 LIST OF FIGURES

Figure Page

3.1 Custom spore trap used to collect air samples in hop fields...... 30

3.2 Agarose gel electrophoreses of PCR-amplified products using template extracted using different lysis solutions...... 33

3.3 Melt curve analysis of products amplified using the Sybr-green assay...... 37

3.4 Sybr-green quantitative polymerase chain reaction (qPCR) standard curve of the log of the starting quantity of pHPM DNA versus the corresponding cycle threshold (Ct) values...... 38

3.5 Taqman quantitative polymerase chain reaction (qPCR) standard curve of the log of the initial concentration of template versus the corresponding cycle threshold (Ct) values...... 39

3.6 Disease progress curves of hop powdery mildew found in hop fields throughout the Oregon region with detection events indicated with asterisks…...... 41

3.7 Disease progress curves of hop powdery mildew found in hop fields throughout the Washington region with detection events indicated with asterisks... 42

3.8 Number of P. macularis conidia detected from field samples versus disease incidence found by field scouting in Oregon: A 2005 and B 2006...... 43

3.9 Number of P. macularis conidia detected from field samples versus disease incidence found by field scouting in Washington: A 2005 and B 2006...... 43

4.1 Prepared plants in plastic vessels mounted with custom impaction spore sampler...... 53

4.2 Temperature recorded within a vessel in each growth chamber used for the 6 hr exposure experiment...... 54

4.3 Effect of constant temperature on sporulation of hop powdery mildew...... 57

4.4 Effect of 6 hr exposure at different temperatures on sporulation...... 59 LIST OF TABLES

Table Page

3.1 Summary of specificity testing results...... 35

3.2 Sensitivity of PCR for detection of P. macularis conidia after extraction using the FastDNA Spin Kit...... 36

3.3 Detection P. macularis and disease incidence in OR and WA during 2005 and 2006...... 40 DEDICATION

I dedicate this thesis to my husband, my son, and my father; whose patience, surprise, and support, throughout this process was beyond measure. Introduction

Podosphaera macularis is an obligate fungal plant pathogen which causes powdery mildew of Humulus lupulus, hops. The epidemic begins shortly after bud break in the spring, and can cause devastating damage if left unmanaged. Successful management of powdery mildew is heavily dependent on early control and well timed applications of fungicides. The Hop Powdery Mildew Infection Risk Index (HOPS) (70) that was adapted from the Gubler/Thomas model for grape powdery mildew (48) is currently used for management of hop powdery mildew. The HOPS uses weather data such as temperature and precipitation to assess risk of infection. It runs on the assumption that inoculum is ever present, which is not likely to be true. Our limited understanding of inoculum presence and movement may be expanded through the use of molecular techniques. Such information could improve the accuracy of disease forecasting models, and would likely decrease the cost of production and the number of fungicide applications recommended by such models.

The use of molecular techniques such as the polymerase chain reaction (PCR), and real-time quantitative PCR (qPCR) has greatly improved the accuracy and speed at which fungal plant pathogens are detected in agricultural crops (133;134). The intertranscribed spacer (ITS) region of ribosomal DNA is a common target for molecular studies involving phylogenetics of Erysiphales (91), and detection of other plant pathogenic fungal species from environmental samples (98). The ITS region can be a reliable target for use in detection and quantification studies as it is fairly stable, typically has a high copy number, and is usually a region of high conservation within species. 2

Recent studies indicate that temperature has an important influence on disease progress (71;118). As such, it is possible that temperature is also an important factor in sporulation. If the presence of inoculum is dictated by temperature, and is not constantly present throughout the growing season, then the disease forecasting models could be improved by accounting for this.

The objectives of this thesis were: (i) develop primers specific to the internal transcribed spacer region of P. macularis (ii) develop a method for extraction and detection of P. macularis spores from field samples (iii) identify and develop an appropriate real time quantitative PCR assay to quantify P. macularis DNA from field samples (iv) determine whether the number of spores trapped correlate to disease levels in the field, and (v) gain further understanding about how temperature affects sporulation of P. macularis. 3

Sporulation of the Powdery Mildews

Introduction

The Erysiphales are obligate fungal biotrophic plant pathogens (94), which are commonly called powdery mildews in reference to their visible superficial white mycelia and conidia on the surface of leaves, stems, fruits, buds, and flowers (15;107). They cause important and severe disease epidemics in many agricultural crops world wide

(19;39;57;61;82), but particularly in regions with dry summer climates similar those found in the Pacific Northwest region of the United States (44;70;102). Severe leaf infections usually result in coalescing lesions that often cause wilting, chlorosis, curling, stunting, and/or senescence of the leaves (34;39;84;114) while infection of inflorescences and fruit can result in flower and fruit abscission, loss in fruit quality due to blemishes, cracking, and deformation is more common (2;84;127). Economic losses are generally associated with reduction in crop quality and cost of control but can also be due to yield reductions (60).

The Erysiphales are capable of 25-40 generations per growing season, and they can reproduce both sexually and asexually. They overwinter as either sexually derived ascospores within chasmothecia, or asexually as mycelia on perennated buds or on protected plant foliage (15;60). The following season, either ascospores or conidia derived from the overwintering mycelia serve as the primary inoculum with conidia serving as the inoculum for all subsequent generations. Only the asexual phase of some species may be observed, depending on crop or geographic region. As such, conidia are 4 the primary source of inoculum in many agricultural crops (17;101;115;128). Abundant production of conidia, which are readily wind disseminated throughout the growing season, underlies the explosive nature of the epidemic (2;13;27;101).

The influence of environmental factors on infection by conidia is fairly well understood (3;15;60;127), but limited for ascospore infection. Inversely, factors that influence ascospore production and dissemination are better understood than those influencing conidial production and dissemination. 5

Ascospores

Ascospores are produced primarily at the end of the growing season within chasmothecia (ascocarps) (38;60) when complementary hyphae come in contact with each other (109). As such, high levels of disease are positively associated with production of chasmothecia (101). When compatible hyphae come into contact, sexual recombination begins and initiates the cascade of events which results in the production of ascospores housed within a chasmothecium (9). The vast majority of Erysiphales species are heterothallic (37;87;110), with a few exceptions being homothallic (110).

Maturation of chasmothecia is evident by morphological changes, and coincides with the maturation of ascospores. The main distinction between young and mature chasmothecia is the presence or absence, respectively, of primary appendages. Primary appendages, otherwise referred to as receptive hyphae, are present on immature ascocarps, and act to anchor the ascocarp to the vegetative hyphae beneath it (9;43).

Secondary, or true, appendages emerge from all parts of the chasmothecium, and except for Phyllactinia, are thought to function as anchors during transport (9). Gadoury and

Pearson (36) found that as chasmothecia age, the quantity and distribution of lipids in the cytoplasm of the ascospore changes. As ascospores mature, the lipids became more aggregated. The authors speculated that it is possible that the conversion of lipids to a nonhydrophobic substance such as carbohydrates may lead to a decrease in water potential in the cytoplasm. Ascospore differentiation has been shown to be greatest after a period of wetness (77), however there is no information on how this process occurs. 6

When fully developed, ascospores are club shaped and number from 1-8 asci per ascus

(9).

Ascospore dispersal occurs either within chasmothecia or freely. After the connection between the receptive hyphae and the vegetative hyphae is broken, mature chasmothecia may be carried long distances in wind currents or on plant material (grove, plant disease 200?). Generally, chasmothecia are dislodged from leaves by wind, rain splash, or mechanical movement and become lodged in bark, bud scales, other cracks and crevices, or remain on fallen leaves (45)until dehiscence (38;127).

Chasmothecia dehiscence is a function of the weakening of the chasmothecial wall, a coinciding decrease in water potential of the ascospore cytoplasm, and swelling of asci and ascus (36). The chasmothecia wall significantly weakens as the chasmothecia age, and is also dependent on a corresponding warming event, such as conditions found in temperate regions in early spring (36;95). As ascospores mature, a decrease in water potential of the ascospore cytoplasm is associated with a decrease in glycogen content of the ascus (58), and is thought to lead to an increased pressure potential of viable ascospores as the ascocarp ages (36;58). The increased pressure potential, coupled with wetting causes chasmothecia to imbibe water. The ascus and the asci then begin to swell and continue to do so until the chasmothecia wall ruptures and the ascospores are discharged (36;58) (81).

Ascospores appear to be forcefully discharged (95) from chasmothecia and are disseminated in wind currents or rain splash. Ascospores are reported to be ejected from

3 to an impressive 31mm above the chasmothecia (95;130). Optimal conditions for 7 release are species dependent (45;59;60). In general, release follows a period of dormancy (69), exposure to free water(26;45;60;95;130), or repeated wetting events (36), and temperatures between 5-20°C(29;69;87). Ascospore release is most likely to occur in the morning when the temperature is rising but there is still high relative humidity (7).

Conidia

Production. Conidiophores develop from hyphal cells and, depending on species, produce either a single conidium or chains of 2 to 8 or more conidia every 24 hr. Non- chain forming conidiophores are characterized as having a simple structure consisting of a basal cell, a generative cell above it, and one or two maturing conidia on the distance end. Non-chain forming conidiophores produce a single conidia every 24 hr(64). Chain forming conidiophores consists of a long basal cell, 1-3 cylindrical cells above it, and a chain of 2 or more swollen conidia (64). Chain forming conidiophores produce 2-8 conidia every 24 hr. For both groups, a maturing conidium is separated from the cells below it by a gradual increasing constriction of the septa that link the cells together (50).

However, it is evident that the two types of conidiophores differ in their diurnal cycle of spore production (64).

The influences of temperature, relative humidity, available light, and rainfall on sporulation have been examined for their individual impacts on the rate of conidial production (23;24;60;64;83;127). However, the effects of these individual factors are confounded and difficult to separate in practice because they directly impact the growth and sporulation of the pathogen as well as the growth of the host, which in turn impacts 8 the pathogen. Temperature and light are two such variables which are closely linked and have confounding effects on the host-pathogen dynamic. Under natural conditions, temperature begins to rise shortly after the sun rises, continues through mid day, and then begins to fall prior to the setting of the sun.

There are many plausible effects of this daily event on the host and the pathogen.

Host photosynthesis increases with increasing sunlight (to a point) which results in increased nutrient availability to the powdery mildew. Increased photosynthesis, coupled with increasing temperatures, leads to an increase of respiration the host. Increased host respiration ultimately results in higher relative humidity within the canopy of a field crop and at the leaf surface it results in higher relative humidity and lower temperatures within the boundary layer (30) . Higher nutrient availability (65;66), an increase in relative humidity at the leaf surface(18;89;121), and lower temperatures within the boundary layer are to parameters which are likely to enhance pathogen growth or sporulation and increased disease development. However, light striking the leaf surface also causes an increase in leaf surface temperature (14;24). If extreme, this rise in temperature could lead to the host closing its stomata to preserve water, thereby lowering the relative humidity within the boundary layer and removing the buffer from extreme temperatures, both are parameters which can be unfavorable conditions for germination, infection, or sporulation (30;71;93;132). High temperatures can also cause alterations in the host physiology that result in reduced infection (71) such as increased thickness of the host’s cuticular layer to thicken. Host maturity is also a factor which influences host resistance to powdery mildew infection(40). The obligate nature of the Eryisphales dictates that 9 each environmental component will have both indirect and direct effects on sporulation.

It is this complex interaction of environmental parameters with the pathogen and host that ultimately affect the rate of sporulation. As such, it is important to keep the complexity of the system in mind when trying to interpret how individual factors affect sporulation.

Temperature appears to be the most influential environmental parameter on spore production. It has been shown to significantly impact the latent period, spore size, number of spores produced, etc. Optimal temperatures for conidial production appear to be species specific, ranging from 18-27ºC (22;30;46;89;117;121;132).

Stavely and Hansen (112) found a positive correlation between increasing temperature and spore size. Exposure to below-optimal temperatures delayed the onset of conidial production and caused a significant decrease in conidial length. Exposure to above-optimal temperature (28°C) severely inhibited sporulation. The authors speculated that the change in size of conidia was attributed to the host’s response to the temperatures. If the metabolism of the host was slowed at the below-optimal temperatures for disease development, it is possible that there were fewer nutrients available for the fungus to use for conidial production.

The latent period of Eryisphales is generally 14 days or greater at temperatures below 10°C(30;67;112;124-126), and shortest (5-7 days) around their optimal temperature (15-25°C depending on species)(22;30;46;67;89;124-126). Generally, temperatures above 25°C often result in inhibition or death of a sporulating colony colonies (30;73)(Newton and Cherewick, (89;112;121;132). For instance, exposure to

30°C for only 2 hr can reduce the risk of infection for Podosphaera macularis that grows 10 on Humulus lupulus by 50% (71). Additionally, infection of E. necator conidia drops to

60% at 26C(22) and down to 10% and less when exposed to temperatures between 33 and 35°C. (30;93;132).

The maximum rate of sporulation occurs from 15-23°C, and the numbers of spores produced every 24hr varies with species(73) (22;23;89;121;132). In general, conidia production declines as temperatures decrease from around 15-20°C

(23;49;65;121), and as temperatures rise above 26°C (22;89;132).

Reports on the effect of temperature on the number of conidia produced vary.

The differences in these reports are due to factors such as possible differences in experimental methods, and species specific response to temperature. In 1953, Last (65) reported that conidia of Erysiphe graminis were produced 10 times faster at 14°C than conidia produced at 7°C. This dramatic effect was not confirmed in a subsequent study(121), which reported conidial counts at 14°C were twice those recorded at 7°C. It is possible that the difference between these studies is due to different colony age, as this detail is not available in the study completed by Last. At 19°C, E. necator is reported to produce double the number of conidia when grown on Vitis vinifera ‘Carignane’ as compared to the numbers produced when it grows on Vitis vinifera ‘Chardonnay’(22).

However this difference is less dramatic when temperatures rise above 22°C.

Chain forming and non-chain forming species may respond differently to changes in temperature. Cole (23) reported no change in conidial production of E. cichoracearum, a non-chain producing powdery mildew, at 18 and 24°C in an alternating hot-cold regime over 24hr. This may indicate that, in a 24hr period, the effect of 11 temperature on the number of conidia produced is more dramatic for chain producing powdery mildews than for non-chain producers. Further research on how exposure to a range of constant temperatures affect conidial production of non-chain producing powdery mildews is needed.

The effect of relative humidity on disease development has been controversial in that there is no clear indication of whether high humidity is beneficial or detrimental to infection and sporulation. Some of this controversy stems from differences in how individual species respond to moisture stress. Some species are reported to have a high tolerance to low humidity (30;85;131), while others are not (131). Still other species are reported to be both strongly influenced developmentally and have a positive correlation of conidial production to an increasing relative humidity (18;89;121). Yarwood (1936) reported that E. polygoni on clover and bean has a high tolerance to low humidity. In

1954, Delp reported that exposure to high (99%) and low (≤25%) humidities had little, if any effect on development of U. necator on leaves. A range of 12-100% humidity was found to have no effect of the development of S. macularis(85). This is in contrast to development of E. polygoni on mustard, E. graminis, E. cichoracearum, and S. pannosa, which were less tolerant of low humidity(131). Ward and Manners(121) found a positive correlation of conidial production and an increasing relative humidity up to 100% for E. graminis. Carroll and Wilcox (18) report that humidity strongly influenced development of U. necator. Optimum relative humidity for development ranged from 83.0% to 86.5%.

Conidial production also generally increased with increasing humidity. Quinn and

Powell (89) report high relative humidities (80-100%) for optimal colony development 12 for Oidium begoniae. When E. graminis conidia were produced in conditions of 40% and 100% humidity, conidia from the latter group germinated at higher rates. Others have also reported that viability of E. graminis conidia is greater with exposure to high humidity. Differences in the conidia germinability produced at different humidity levels

(89) suggest that one or more processes of production were affected. It could be that conidia production at high humidity results in higher water content of conidia and therefore increased germination rates (18;89;121). However, the specific processes of conidial production that humidity effects are still unknown.

Conidial production is strongly influenced by components of light such as near

U.V. light, direct sunlight, and indirect or reflected sunlight. However, due to the obligate nature of powdery mildews, the effects of these parameters on the pathogen are a function of how the light impacts the host. Conidial production appears to follow a circadian rhythm(60;83;131), where conidial production slows in the dark and is completed in the light (24;25;64;89). This phenomenon may suggest that there is some level of photosensitivity for the maturation stage. Laboratory studies show that conidia develop faster when exposed to constant daylight than they do in periods of constant darkness (23;25;64;83;89;115;131). When exposed to alternating light and dark periods, there is a distinct increase in spore production during the light period following a dark period (24;25;83). This appears to be true for both chain forming and non-chain forming species of powdery mildews (64).

Conidia are produced more rapidly when exposed to near U.V. compared to fluorescent light (25) at the same intensity. This suggests that the effect of UV light on 13 sporulation is independent from the effects of light on the host and nutrient availability due to increased photosynthesis. However, it is possible that the UV light increased ambient and leaf surface temperature (14), which is likely to affect both the host and the pathogen.

Direct sunlight can cause the surface of a leaf to be 3-7°C hotter than ambient temperature due to transference of radiant energy (14). This increase in temperature could cause the conditions at the leaf surface to be above the upper temperature threshold conducive for fungal development. Early works suggest that the leaf surface temperature on a single hop leaf can vary greatly, and as such, different regions of the leaf surface itself may be more optimal for growth and development than others (14). The effect of radiant energy gain is probably a contributing factor to the differences in susceptibility of regions in a grape vine canopy. Regions of the grape that receive the most sunlight or reflected light from the soil are the least susceptible to infection, while regions receiving the greatest amount of shading the most susceptible (101).

Shade is reported to be more favorable for various stages of powdery mildew infection and development (101;127) , but no information is known about how shade may influence spore production. For several plants the eastern exposed side of the canopy develops more disease than the western exposed region of the canopy. Another possible explanation for the differences in susceptibility could be the increased cuticular wax thickness on leaves that are exposed to more sunlight (30). In the field, high temperatures are accompanied by increased transpiration which leads to an increase in humidity within a canopy. In the shaded areas, it is possible that higher levels of 14 humidity are maintained, and the host acts as a buffer from both direct sunlight, fluctuations in humidity, and extreme temperatures (30). All of which are factors that are conducive for disease development.

Conidial production is inhibited by rainfall. Physical damage to mycelium (12) or conidiophores (20;131) may prevent further production of conidia due to a decrease in available nutrients or a reduction of intact conidiophores. Sivapalan (108) found that sporulation was greatly reduced with simulated rain, and that sporulating colonies hit with natural rain may fail to continue to sporulate normally.

Young, healthy host tissue is optimal for sporulation(16). This is likely due to the relatively high levels of energy and nutrients available in the tissue. Young leaves are a sink for photosynthates and stored nutrients(56), and they tend to have reduced plant defenses. In addition to young tissue, succulent new tissue is also highly conducive to rapid disease development. In a study done on one species of Erysiphe, higher numbers of spores were caught in crops treated with nitrogenous fertilizer than in crops not treated with fertilizer (65;66). This suggests that well fertilized crops are more susceptible to powdery mildew than those which are deficient in nitrogen.

All of the aforementioned factors influence the physiology of the host and thereby affect the nutrients available to the pathogen and due to the obligate nature of Erysphales fungi it is difficult to determine direct and indirect effects of these factors. However, it is clear that knowledge of environmental conditions could be used to help predict the availability of conidia. This knowledge could then be used to enhance disease forecasting models. 15

Liberation. Powdery mildews are thought to have a gradual, passive mode of conidial release that is associated with a decrease in humidity and increase in temperature. Until the conidium on the distal end of the conidiophore is fully mature, a pore remains in the septum between it and the cell below it. This cytoplasmic connection allows fluid to continue to flow into the conidium, and it swells as water fills the vacuoles

(79). Upon maturation, the conidiophore cell wall rapidly invaginates until it is physically separated from the maturing conidium below. However, there is a mucilaginous coating on the exterior surface of the conidium that appears to function in holding the conidium in place (50;76). In response to low humidity and increasing temperatures, the mucilaginous coating dries and becomes brittle making the conidia more readily wind dispersed due to the decreased adhesion to the conidiophore (60;115).

This theory is supported by numerous studies monitoring the concentration of air borne conidia (1;24;25;49;115). The number of conidia trapped from the air is maximal between 1200 and 1800 hr on days when there are large decreases in humidity with rising temperature (46;66;86;102;131) and during periods when leaf surfaces are dry

(49;60;115).

Active conidial liberation can be triggered in still air in response to decreasing relative humidity combined with constant or increasing temperature (1)(Hammerlund,

1925 as cited by (127), where a sudden breakage of the rim of attachment between the mature conidium to the cell below results in the violent discharge of conidia. A combination of low relative humidity and high or increasing temperatures is commonly associated with active conidial release(1;24;25;49;115) but a sudden reduction of relative 16 humidity has been indicated as the main environmental factor (1;83). It is unlikely that active liberation is effective in conidia spore dissemination on its own, since in the absence of wind conidia appear to fall to base of conidiophores and form dense mats (50).

Dissemination. Multiple environmental factors contribute to conidial dissemination. Spore trapping studies (1;15;23;46;49;64;66;89;115) indicate that a combination of increasing wind speeds, decreasing relative humidity, drying of the leaves, and increasing temperature are associated with an increase in conidial release(49).

Most spores are caught when temperature and wind speed are at or nearing their peak, humidity levels are low, and on days with high solar radiation. As with conidial production, the effects of these factors on conidial liberation are confounded and not easily separated.

Wind appears to be the most significant factor in dissemination. Wind influences dissemination by causing leaf flutter and picking up conidia in gusts and transporting them to different locations. Bainbridge and Legg(4) found that wind speeds which cause leaves to shake may be more important for dispersal than wind speeds which actually remove conidia from conidiophores. However, wind speeds speeds greater than 2.25m/s tend to compact conidial mats (50).

Light induced diurnal periodicity is reported for studies on spore loads in the field and in the green house for a variety of species(89), (1;15;23;46;49;66;115), reports vary on the time of day conidial dissemination occurs(64). It is possible that the variance in the reports is correlated with variance in leaf wetness, temperature, and humidity. In general, these parameters are most often conducive to spore release at mid day. 17

Rainfall can have a positive and negative effect on dissemination. The mechanical movement of leaves associated with rain drops hitting them causes a dry liberation of spores, and this phenomenon is known as “tap-and-puff”(15;108). This led early researchers to assume that as with many other fungal pathogens, rain and the presence of free water was beneficial to disease development(11). However, we understand the powdery mildews to be dry weather fungi (129). Ultimately, continued rainfall results in spores being removed from the air and potentially washed from leaf surfaces (49;115). Patterns of spore catch suggest that a dry period with consecutive days of no rain is necessary for the onset of conidial dispersal (123).

The majority of conidia produced in plants growing close to the ground do not appear to be disseminated over long distances. Studies done on powdery mildews of cereal crops and strawberries indicate that most of the inoculum remains within the plant stand, and very little is found in the air above it (15;66;86). As such, disease develops as discrete disease foci. However, it is not clear if this holds true for crops such as grapes or cherries that are not as densely planted. Work on hop powdery mildew indicates that disease epidemics rapidly become non-focal in nature (117); indicating that dissemination is either extremely rapid or conidia are disseminated over longer distances than in row crops.

While dispersal gradients are steep, evidence for long distance travel indicates spores may travel very long distances. Spores of Erysiphe species have been collected by suction impactors mounted on airplanes (15;55). Other researchers have collected viable conidia at altitudes up to 1500 m high(15). The host is also used to help elucidate 18 geographic range and movement of Erysiphalean populations. Molecular markers for virulence genes have been used to study the movement of Blumeria graminis in wheat crops across Europe (68).

Conclusion

Further understanding about the factors which initiate and sustain sporulation and those which result in the death of a sporulating colony is needed in order to further increase the effectiveness and efficiency of powdery mildew management programs. Current management practices assume inoculum is continuously available throughout the duration of the growing season. However, our limited understanding of the environmental factors effecting sporulation indicates that this assumption is not correct. Thus, understanding how factors such as humidity and temperature, particularly periods when temperature is nonconductive to growth of Erysiphales fungi, influence inoculum availability would be useful in further developing disease or infection risk forecasters for powdery mildews. A more accurate prediction of disease or infection risk would likely mean that fewer pesticides would be used in managing powdery mildews thus increase the economical and environmental sustainability of powdery mildew management programs. 19

Detection and quantification of airborne Podosphaera macularis conidia in hop yards

Introduction

Powdery mildew of hop, Podosphaera macularis, Braun & Takamatsu (formerly

Sphaerotheca macularis (Wallr.:Fr.) Lind syn. S. humuli (DC.) Burrill) is one of the most economically important pathogens of commercially grown hops (Humulus lupulus) (82).

Introduction of this pathogen, and the crop losses associated with infection, have caused dramatic changes in hop production and management in the U.S. (17;70;118). Despite a growing understanding of the epidemiology of hop powdery mildew (41;42;70;117;118), our ability to estimate infection risk is limited due to sparse data on factors influencing inoculum production and density. The epidemiologically explosive nature of the disease requires early and efficient management, because it can rapidly become uncontrollable and result in complete crop loss due to rejection by buyers (70).

Currently, management of hop powdery mildew is strongly influenced by a Hop

Powdery Mildew Infection Risk Index (HOPS) (70) that was adapted from the

Gubler/Thomas model for grape powdery mildew (48). The model assesses the influence of temperature and precipitation on infection risk, and is used to determine the interval between fungicide applications that would be the most effective for managing the disease. While the use of HOPS has reduced the number of fungicide applications, it does not accurately reflect the epidemic under certain field conditions (41;42;117). In its present form, HOPS is too conservative, in that shorter intervals for fungicide applications are recommended than appear necessary in some regions or during specific 20 periods of the growing season. The model assumes that a constant source of inoculum is present in the field as soon as hop shoots emerge; which is likely an incorrect assumption.

Early in the growing season disease levels are low (70) and the distribution is random (117), making assessment by field scouts very difficult. Thus, growers have chosen to assume disease is present and apply protectant fungicides. Sometimes neither flagshoots nor disease is observed in fields for the entire growing season with little or no disease observed at harvest (41;42). Thus knowledge of inoculum presence could also be useful in determining whether to make fungicide applications.

In July and August, high daytime temperatures (30-40°C) are common throughout the hop growing regions in the U.S. Previous studies indicate that exposure to temperatures above 30°C for longer than 2 h has a marked effect on disease progress (71) and inoculum infectivity (Mahaffee, unpublished). This indirectly suggests that there is likely a decrease in viable inoculum due to the reduction in sporulating colonies following exposure to supra-conducive temperatures (>30°C). However, this impact may be less significant if disease severity is high and if supra-conducive temperatures are not sustained for long periods of time (71).

Our ability to elucidate the impact of environmental factors on sporulation is limited due to the difficulty in monitoring sporulation in the field, and the inherent variability of the number of spores produced from individual lesions. The most common methods for monitoring sporulation use various volumetric spore traps (e.g. Burkard and

Rotorod) which impinge spores on a sticky matrix and rely on visual identification and enumeration of spores. Due to the rather nondescript nature of powdery mildew conidia 21

(9), and the high abundance of several species in a field on the weeds and neighboring

crops, this method of enumeration is time consuming and inaccurate; often requiring

hours to evaluate individual samples and making assumptions that all powdery mildew-

like conidia present are the species of interest. The volume of air sampled must also be

limited in order to prevent dust, pollen and other debris from obscuring the mildew

spores on the sample rod (8). These difficulties might be overcome by using polymerase

chain reaction (PCR) approaches to detect and quantify fragments of DNA that are

specific to a particular species.

PCR methods have been used to detect and quantify numerous pathogens from

environmental samples (92;103;133;134) (5;5;31;53;97;100;104;119;119). Detection of

Fusarium oyxsporum f. sp. niveum and Mycospaerella melonis has been possible using a

range of concentration of templates from 10 pure microconidia or 100 microconidia in 1

g of artificially inoculated soil down to as low as 1ng pure DNA and 103 macroconidia g-1 soil (134). Detection of a single zoospore Phytophthora capsici in g-1 soil has also been

reported using nested PCR (133), a technique where two sets of primers were designed to

target regions of the ITS sequence. This improves the detection time from 2 weeks using

traditional methods to a matter of hours using molecular techniques, which could

dramatically shorten the time it takes to detect disease present in the soil.

The ITS region of ribosomal DNA is a region often used in diagnostic studies

(98). It is attractive because it is stable, has a high copy number, is heterogeneous among

species, and usually approaches near homogeneity within species. As such, there are

many reports on the DNA sequence of this region for the Erysiphales, which expedite 22 designing an assay to specifically target P. macularis DNA in a background of other potential powdery mildews found in and around hop yards. This region has proven to be useful for phylogenetic studies of the anamorphic state (28;54;62;91;116). Specific detection of different powdery mildew species from herbaria specimens has been possible using this region (62;80). Amplification has been reported from a single conidium of

Oidium neolycopersici using nested PCR (75), and 10 conidia of Erysiphe necator

(Falacy et al. 2007). The sensitivity of quantitative PCR (qPCR) has been reported as low as 100 copies of the ITS region of Cladosporium sp. (53) isolated from oak leaves.

DNA concentrations equivalent to 0.01 cystosori have been detected using a qPCR assay for detection of Spongospora subterranean in soil, water and plant tissue samples (120).

These reports indicate that the ITS region could be suitable target for the detection and quantification of P. macularis in hop yards.

Development and implementation of molecular techniques to detect P. macularis spores would help to expand our understanding of the parameters which influence inoculum availability. Eventually, this knowledge could help further refine the HOPS model in that it would be based off of when inoculum is available, rather than running on the assumption that inoculum is ever present. Highly sensitive detection could also be useful in helping growers determine if a field needs to be harvested early due to cone infection. Late season infections of hop cones which are not visible to the unaided eye are associated with rapid maturation of the crop and losses due to loss of cone quality

(51). Field observations indicate that harvesting fields just a few days early greatly reduce cone discoloration (Mahaffee, unpublished) 23

The objectives of this study were to: (i) develop primers specific to the internal transcribed spacer region of P. macularis (ii) develop a method for extraction and detection of P. macularis spores from field samples (iii) identify and develop an appropriate real time quantitative PCR assay to quantify P. macularis DNA from field samples, and (iv) determine whether the number of spores trapped correlate to disease levels in the field. 24

Materials and Methods

Plant maintenance. Symphony (John I. Haas, Inc., Yakima, WA) plants were clonally propagated from greenwood cuttings (52). Rooted cuttings were transplanted to

5 × 5 × 10 cm pots with a mixture of Sunshine Mix #1 (SunGro Horticulture, Bellevue,

WA) and Soil Moist (JRM Chemical, Cleveland, OH) to reduce irrigation frequency.

Plants were fertigated with Champion 17-17-17 fertilizer with micronutrients

(McConkey’s, Portland, OR) with each irrigation. Plant material was kept free from powdery mildew infection by vaporizing sulfur in the greenhouse (71).

Isolate maintenance. Single chain isolates collected from Oregon, Washington,

England and Germany were grown on ‘Symphony’ plants kept in 29.5 cm × 11.8 cm ×

12.1 cm plastic vessels (SNAPWARE®, Mira Loma, CA). A 10μm filter was used in place of the lid to allow for air exchange. The isolates were incubated at 18°C with a 16­ h day-length (~300μmol/m2/sec) in a SG-30 controlled Environment Chamber (Hoffman

Manufacturing, Albany, OR), and irrigated as needed. Isolates were transferred every 2 weeks to 3 months to new plants to maintain sporulating colonies.

P. macularis ITS consensus sequence. Conidia from colonies were scraped from the leaf surface into PCR tubes, pelleted by centrifugation (14,000 × g, 5 sec) suspended in 100μl of Millipore water, and then incubated at 100°C for 5 min. The resulting suspension was used as template for PCR amplification using the universal fungal ITS primers ITS1 and ITS4 (122) to amplify the ITS region with HotMaster™ Taq

DNA polymerase (Eppendorf North America, Inc.) in accordance with the supplier’s recommendations in a PTC-150 MiniCycler (MJ Research, Inc, Waltham, MA) with the 25 following cycling parameters: 94°C for 2 m, 35 cycles of 94°C for 20 s, 60°C for 44 s,

65°C for 30 s, followed by a final extension step at 72°C for 10min. PCR products were cleaned using a Microcon kit (Millipore, Bedford, MA) and subsequently cloned into

Escherichia coli Top10 One Shot® Chemically cells using a TOPO TA Cloning® kit

(Invitrogen Life Technologies, Carlsbad, CA). The plasmids were purified using a

Wizard® Plus Minipreps DNA Purification System (Promega Corporation, Madison, WI) using the recommended protocol. DNA concentration was calculated using an Ultraspec

3100 pro (Amersham Biosciences, Piscataway, NJ).

Sequencing was done with BigDye® Terminator v. 3.1 Cycle Sequencing Kit

(Applied Biosystems, Foster City, CA) using an ABI Prism®3730 Genetic Analyzer and

ABI Prism®3730 Data Collection (version 3.0) and DNA Sequencing Analysis (version

5.2) Software (Applied Biosystems), at the Center for Genome Research and

Biocomputing (Oregon State University, Corvallis, OR). DNA sequences were edited, aligned, and a consensus sequence was compiled using Vector NTI Advance™ Software

(Invitrogen Life Technologies, Carlsbad, CA).

P. macularis specific PCR Assay. The consensus sequence was aligned with ITS sequence of all species of Erysiphales in GenBank (NCBI, http;//www.ncbi.nlm.nih.gov) as of 4/8/2005 in order to identify regions unique to P. macularis. A series of primers were visually designed and analyzed using a blast search in GenBank to confirm specificity to P. macularis. Annealing temperature of the primers was optimized using a

RoboCycler® Gradient 96 (Cedar Creek, TX) with the following cycling parameters:

94°C for 2 m, 35 cycles of 94°C for 20 s, 60-72°C for 44 s, 72°C for 30 s, followed by a 26 final extension step at 72°C for 10min. DNA was resolved on a 1% agarose gel with

10% ethidium bromide in 1X Tris-borate-EDTA buffer (90 mM Tris-borate and 2 mM

EDTA). Amplified DNA fragments were visualized under UV light using an

AlphaImager 2000 (Alpha Innotech, San Leandro, CA) after electrophoresis at 70 V for 1 hr.

Primer specificity was tested against DNA extracted from powdery mildew found growing on several weeds found in and on crops growing near hop fields (Table 1).

Spore suspensions from P. macularis isolates collected from Oregon, Washington,

Germany, and England were used as template for PCR amplification using the P. macularis specific primers. The 25.0µl PCR reaction consisted of 10.0µl of HotMaster™

Taq DNA polymerase, 2.0µl of 10mM forward primer, 2.0µl of 10mM reverse primer,

9.0µl of nuclease free water, and 2.0µl of template DNA. A PTC-150 MiniCycler was used to perform the reaction and was programmed with the following cycling parameters:

94°C for 2 m, 35 cycles of 94°C for 20 s, 69°C for 44 s, 72°C for 30 s, followed by a final extension step at 72°C for 10min. DNA was resolved on a 1% agarose gel with

10% ethidium bromide in 1X Tris-borate-EDTA buffer (90 mM Tris-borate and 2 mM

EDTA). Amplified DNA fragments were visualized under UV light using an

AlphaImager 2000 (Alpha Innotech, San Leandro, CA) after electrophoresis at 70 V for 1 hr. PCR products were cleaned using a Microcon kit (Millipore, Bedford, MA), and sequenced.

Sybr-Green qPCR. An alignment of the P. macularis ITS region consensus sequence and all other reported ITS sequence for other Erysiphales species found in 27

Genbank (NCBI, http;//www.ncbi.nlm.nih.gov) as of 4/8/2005 as well as those we generated for Podosphaera aphanis from Strawberry and caneberries was done using

Vector NTI Suite v.9.0 (Invitrogen, Carlsbad, CA). The primers were visually designed to target areas within the consensus sequence for the ITS region that had the highest level of heterogeneity between P. macularis and all other reported ITS sequence for other

Erysiphales species. Primers were then analyzed using a blast search in GenBank to confirm specificity to P. macularis.

The qPCR reaction was optimized for annealing temperature, primer concentration (50, 300, and 900nM), and magnesium ion concentration using plasmid

DNA with the ITS region inserted into it as template (96). Bovine Serum Albumin

(BSA) was also examined for effects on binding inhibitors during qPCR to prevent binding and subsequent inhibition of amplification of target DNA. Melt curve analysis was performed after each qPCR run to determine whether the optimization was controlling for non specific amplification.

The final reaction included: 10.0µl of SYBR® Green JumpStart™ Taq ReadyMix™ for Quantitative PCR, Capillary Formulation (Sigma-Aldrich Corp. St. Louis, MO), 1.8µl of 10mM forward primer, 0.1µl of 10mM reverse primer, 3.9μl of nuclease free water,

2.2µl of 25mM MgCl2, and 2.0 µl of template DNA. Samples were processed using a three-step protocol with the following thermodynamic parameters: 94°C for 120s, 60 cycles of 94°C for 10s, 69°C for 5s with fluorescence data collection, 72°C for 22s; a melt curve analysis from 94-65°C at 1.5 s/°C using a LightCycler® II Instrument and

LightCycler® Software 3.5 (Roche Diagnostics Corporation Indianapolis, IN) 28 immediately followed QPCR amplification. A positive control was included in all experiments which consisted of the PCR product derived the ITS region of P. macularis amplified using the IT1 and ITS4 primers of White et al. (122) inserted into the TOPO plasmid (Invitrogen). Standard curves were generated using a dilution series of plasmid

DNA at concentrations of 5.152, 5.151, 5.15, 5.15-1, and 5.15-2ng/ul (Figure 2.3).

TaqMan qPCR. An alignment of the P. macularis ITS region consensus sequence and all other reported ITS sequence for other Erysiphales species found in

Genbank (NCBI, http;//www.ncbi.nlm.nih.gov) as of 9/12/2005 as well as those we generated for Podosphaera aphanis from Strawberry and caneberries was done using

Vector NTI Suite v.9.0 (Invitrogen, Carlsbad, CA). A custom TaqMan® primer/probe set was visually designed to target areas within the ITS region that had the highest level of heterogeneity between P. macularis and all other reported ITS sequence for other

Erysiphales. The probe was designed with a 6-carboxyfluorescein (6-FAM) reporter dye on the 3’ end, and a minor groove binder/Non-flourescent quencher (MGBNFQ ) molecule on the 5’ end. The probe was synthesized by PE Applied Biosystems (Foster

City, CA), and the primers were synthesized and HPLC purified by Integrated DNA

Technologies, Inc. (Coralville, IA).

PCR reactions were optimized as above with the final protocol consisting of

12.5µl of TaqMan® Universal PCR Master Mix, 2.0µl of 10mM forward primer, 2.0µl of

10mM reverse primer, 0.5µl of probe, 2.5µl 10X Exo IPC Mix (Applied Biosystems),

0.5µl of 50X Exo IPC DNA, and 5.0µl of template DNA. Optimal annealing temperature for the primer set was verified at 61°C. Samples were processed with a two-step protocol 29 with the following cycling parameters: 50°C for 2 m, 95°C for 10 min, 55 cycles of 95°C for 15 s with fluorescence data collection, and 61°C for 105 s using an AB 7500 Fast

System and software (version 1.3.1; Applied Biosystems). An exogenous internal positive control (IPC) (Applied Biosystems) was included to control for false negatives due to qPCR inhibition (33). We used a more dilute concentration of the IPC DNA than the manufacturer recommends in order to directly compare the Ct values of the IPC and the Ct values of the field samples. All reactions were run in triplicate. There were two negative controls; one with no template and IPC and another with no template and no

IPC. This allowed us to control for any possible contamination.

The relationship of the number of spores detected to the crossing threshold (Ct) was determined using air samples (glass rods used to run in spore traps for 7 days) from

Hyslop farm spiked with a dilution series of P. macularis spore suspensions in 0.05%

Tween (71) resulting in 0, 1×103, 7.0×103, 2.5×104, or 6.25×105 spores present on a set of rods. For consistency, the spore suspensions were aliquoted onto the rods in the equal volumes (222.2 μl) of 0.05% Tween solution. DNA was then extracted as above and used as template in the qPCR reactions described above. Verification of the spore concentrations was done using qPCR and comparing Ct values for each of the Hyslop farm samples. Each concentration of spore suspension in the extractions was then pooled together to create a consistent source of template for the standard curves to be generated with each qPCR reaction. A standard curve was generated by plotting the crossing threshold (Ct) value against the log10 of the number of spores in each dilution series of the 30

P. macularis spore suspensions. As Ct

values are known to fluctuate slightly

between experiments, the standards were

run on each plate used to analyze field

samples.

Spore Sample Collection. Air

borne spores in the field were trapped using

a custom spore trap (Figure 3.1) similar to

a Rotorod (Multidata, Plymouth Meeting,

PA), that sampled 334 ±7 liters/min using

two 50 × 1 mm glass rods coated with high

vacuum grease (Dow Corning, Midland,

MI) mounted on the rotating arm of the

spore trap. The traps were deployed in

fields on the leeward side of the prevailing Figure 3.1 Custom spore trap used to collect air samples in hop fields. Air was sampled at 334 wind direction. Samples were collected ±7 liters/min. weekly at the time of disease assessment and stored at -20°C until processing. Occasionally, sample periods were longer due to field management practices (e.g. pesticide application). Air samples that had a low probability of containing spores of P. macularis from Humulus spp. were also collected during July and August, 2006 at the Hyslop Crop Science Field Research Laboratory in 31

Corvallis, Oregon. This location was chosen due to it was remote in its proximity to known plantings of Humulus sp. and local wind patterns.

DNA extraction from spore trap samples. The FastDNA Spin kit (Qbio gene,

Morgan Irvine, CA), PowerSoil, UltraClean soil and Plant (MO BIO Laboratories, Inc.,

Carlsbad, CA) DNA Kits were tested for use in extracting P. macularis DNA from sample rods that was suitable for PCR using the manufacturers protocols. The FastDNA kit protocol for isolating plant DNA with the following modifications: 1) Plant DNA lysis solutions were used and the CLS-VF solution was amended with 2% polyvinylpyrrolidone (PVP-40) (Sigma-Aldrich, St. Louis, MO); 2) Samples were homogenized for 30 s at speed setting 5.0 in the FastPrep FP 120 homogenizer (BIO

101/Savant, Vista, CA) and repeated after a 5 min chilling period on ice (Falacy et al,

2007); 3) After incubation, the DNA binding matrix centrifuged for 5 m instead of 10 s, as described by the manufacturer (Qbio gene). DNA extraction efficiency was tested by extracting 10 replicates of 10, 100, and 1000 conidia. For consistency, the spore suspensions were aliquoted onto the rods in the equal volumes in 1.76μl of 0.05% Tween.

Glass, nylon, and acrylic rods, and various coating (vacuum grease, lecithin, honey, and petroleum jelly) were then tested for suitability for DNA extraction using the Fast

Protocol with glass rods coated with vacuum grease being the most suitable (data not shown). A subset of field samples which tested positive for the presence of P. macularis

DNA were randomly selected and sequenced to insure that amplicons were the target ITS region from P. macularis. 32

Disease Assessment. In 2005 and 2006, hop fields in the Willamette and Yakima

Valleys of Oregon and Washington respectively, were assessed weekly during the growing season for leaf (117) and cone (42) disease incidence. Briefly, transects (rows) were arbitrarily selected, and in each transect either 10 leaves or 25 cones were arbitrarily selected from the first 60 to 100 plants. A field infection percentage [p=(∑x/∑n)*100] for each field was calculated based on the number of diseased leaves or cones (x) and the number assessed (n). Detection of P. macularis spores from field samples collected using the modified spore samplers was recorded in either a binomial format (i.e.: detected or not detected) or the number of trapped conidia trapped in each sample which was extrapolated from a Ct value comparison with standard controls (Figure 3.5).

Statistical Analysis. Analyses were done using general linear model procedures of the SAS statistical software (SAS Institute Inc., Cary, NC). The relationship between

Ct values and P. macularis spore concentration of the standard curves was analyzed by regression analysis. The number of spores detected on sample rods was regressed against percent disease incidence found in the field. Efficiency of the Taqman assay was calculated using the following equation (88): Efficiency = [101/slope]-1. 33

Results

ITS consensus, specificity and sensitivity of P. macularis detection. The ITS1 and ITS4 (122) primers amplified a 564-bp product. The consensus sequence (Appendix) was derived from the ITS region obtained from two independent DNA amplifications from 26 isolates collected from hop fields in Oregon, Washington, Germany, and

England. There were 4 single nucleotide polymorphisms, 6 insertions, and 4 deletions found in a comparison of the consensus to a prior submission for P. macularis from H. lupulus (S. humuli AF448224). There was limited heterogeneity of the ITS consensus sequence of P. macularis to the Genbank accessions off species within the Podosphaera.

There were between 2-11 base pair differences between the new consensus sequence and the ITS sequence of P. aphanis var. aphanis (formerly S. aphanis var. aphanis (accession

AB000938, AB026136, AB026141,), and P. ferrugunea var ferrugunea (formerly S. ferrugunea var. ferruginea (accession AB026152, AB027232), and a complete homology was found with P. filipendulae (formerly S. filipendulae (accession AB022385) (10).

These species of Podospaera are not reported in the U.S., and the plants they grow on are not reported in the western U.S.

The P. macularis specific primers HPMF2 (5’­

TGAAGCCACGCAGGGCGCCTGTC-3’) and HPMR4 (5'­

ACTATGTTTAGGGGACGCCGAA-3'), amplified a 383-bp product. Detection of P. macularis conidia was possible when using DNA extracted from 10 conidia as template, but was detected consistently when using DNA extracted from 1000 conidia as template

(Table 3.2). All samples and were homologous with the consensus (data not shown). 34

DNA extraction. PCR using DNA extracted in the presence of either the glass or

acrylic rods as template did not appear to be inhibited while nylon rods did result in

inhibition (data not shown). Glass rods were chosen as the sample collection rods

because of potential comparison with other studies. Vacuum grease was selected as the

coating material for the glass rods because it did not appear to inhibit PCR amplification

and was readily available as a consistent quality controlled product.

The FastDNA Spin Kit appeared to yield DNA with the least amount of inhibitors

and was further refined to maximize inhibitors removal. Only the plant lysis solutions

provided by the Fast DNA Spin Kit with added 2.0% PVP-40 worked consistently when

using glass or acrylic rods coated with high vacuum grease (Dow Corning Corp.) (Figure

3.2).

.

1 2 3 4 5 6 7 8

Figure 3.2 Agarose gel electrophoreses of PCR-amplified products using template extracted using different lysis solutions. Lanes 1-2, DNA marker; Lanes 3-4, template from two separate extractions using the Fungal lysis solution from FastDNA Spin Kit in the presence of environmental debris; Lanes 5-6, template from two separate extractions using the Plant lysis solutions from FastDNA Spin Kit in the presence of environmental debris; Lane 7, positive control; Lane 8, negative control. 35

Table 3.1 Summary of specificity testing results

Detection with HPMF2/ TaqMan Pathogen Species Host HPMR4 c Assayd Blumeria graminis (DC.) Speer Poa sp. - - Erysiphe aquilegiae var. ranunculi (Grev.) R.Y. Zheng & G.Q. Chen Aquilegia canadensis - - E. convolvuli Convolvulus arvensis - - E. cichoracearum DC var. cichoracearum Callistephus - - Cirsium arvense - - Coreopsis sp. - - Lactuca serriola L. - - Mentha arvensis - - Rudbeckia laciniata L. - - Taraxacum officinale - - E. magnicellulata var. magnicellulata U. Braun Phlox - - E. pisi DC. Medicago sativa - - E. rhododendri Kapoor Rhododendron - - E. trifolii Trifolium pratense - - Leveillula taurica (Lév.) G. Arnaud Allium cepa L. - - E. syringae Schwein. syn Microsphaera Syringa vulgaris - - syringae (Schwein)H. Magn Caragana arborescens Lam. - - Microsphaera nemopanthis Ilex verticillata (L.) A. Gray - - Sawadea sp. Acer sp. - - Podosphaera aphanis (Wallr.) U. Braun & S. Rubus ursinus - - Takamatsub formerly Sphaerotheca macularis - - (Wallr.) U. Brauna Rubus idaeus Podosphaera aphanis (Wallr.) U. Braun & S. Takamatsub formerly Sphaerotheca macularis - - f. sp. fragariae (Wallr.) U. Brauna Fragaria sp. Podosphaera clandestina (Wallr.:Fr.) Lév. Prunus sp. - + P. delphinii (P. Karst) U. Braun & S. Takamatsub S. delphinii (P. Karst) S. Blumera Ranunculus abortivus L. - - P. fusca (Fr.) U. Braun & N. Shishkoffb formerly Sphaerotheca fusca (Fr.) S. Blumera Cucurbita pepo L. - - P. macularis (Wallr.:Fr.) U. Braun & S. Takamatsub formerly Sphaerotheca macularis (Wallr.:Fr.) Linda Humulus lupulus L. P. leucotrica (Ell. & Ev.) Salmon Malus domestica Borkh. P. pannosa (Wallr:.Fr.) de Baryb formerly Sphaerotheca pannosa (Wallr:.Fr.) Léva Prunus persica - - Uncinuliella flexuosa Peck Aesculus sp. - - a Binomial fide Braun (1987) (9) b Binomial fide Braun and Takamatsu (2000) (10) c The forward primer HPMF2 (5’-TGAAGCCACGCAGGGCGCCTGTC-3’) and the reverse primer HPMR4 (5'-ACTATGTTTAGGGGACGCCGAA-3') d The forward primer HPMTMF (5’-CTGTCCTGCGCGGCTGA-3’), the reverse primer HPMTMR (5’­ ACTATGTTTAGGGGACGCCGAA-3’), and the minor groove binding (MGB) probe HPMTMP (5’­ 6FAM - ATGTAGTTAGTGCAGTCTGAGAA - MGBNFQ-3’) 36

Table 3.2 Sensitivity of PCR for detection of P. macularis conidia after extraction using the FastDNA Spin Kit. # No. of conidia # No. of Amplifications # No. of successful Percent successful amplifications per extraction replicates per extraction amplifications per PCR reactiona 1000 10 2 20 100% 100 10 2 12 60% 10 10 2 2 10% aThe percentage of successful amplifications from 20 attempts to amplify DNA extracted from 1000, 100, or 10 conidia.

Sybr-green qPCR. The Sybr-green assay indicates that the primer sets HPMF2

(5’-TGAAGCCACGCAGGGCGCCTGTC-3’) and HPMR4 (5'­

ACTATGTTTAGGGGACGCCGAA-3') and HPMF2 with HPMR5 (5'­

GGGCTTCTCTGGCGGGCACTCC-3') successfully amplified a 123-bp and a 393-bp, respectively, fragment from the ITS region of P. macularis ITS DNA inserted into E. coli

(pHPM), from conidia, and from conidia acquired from field samples. Greater specificity to P. macularis DNA was found with the HPMF2/HPMR4 primer set and it was selected as the final set for use with the Sybr-green qPCR assay. However, melt curve analysis

(Figure 3.3) showed denaturation of a product at about 85.5ºC and at 90.5ºC, indicating that nonspecific binding or amplification was occurring. This secondary product was found to be independent of primer sequence or concentration, magnesium ion availability, target DNA concentration, template source (i.e. plasmid or spore DNA), or annealing temperature (Data not shown). Even though the presence of this secondary product was independent of template concentration, it was of concern because the aim of the project was to specifically detect P. macularis DNA in field samples, and the nature of the secondary product remained unknown. 37

The qPCR product was visualized on an agarose gel and showed two bands, the expected band at 393bp and the second band at around 90 bp. Sequence of the second band indicated that it was homologous to the 3’ end of the P. macularis consensus sequence (data not shown). Despite this anomaly, there was a significant (P> 0.0001) linear relationship between logarithm of the concentration of pHPM DNA, and Ct

(y=3.77x + 21.53; R2=0.99) (Figure 3.4).

Figure 3.3 Melt curve analysis of products amplified using the Sybr-green assay. Products were amplified from 5.15×102 ng/ul pHPM (green), 5.15×101 ng/ul pHPM (red), 5.15 ng/ul pHPM (black), and 5.15×10-1 ng/ul pHPM (purple), 5.15×10-2 ng/ul pHPM (gray), the P. macularis negative control (blue).

TaqMan qPCR. The taqman primers HPMTMF (5’­

CTGTCCTGCGCGGCTGA-3’), HPMTMR (5’-ACTATGTTTAGGGGACGCCGAA­

3’), and the minor groove binding (MGB) probe HPMTMP (5’-6FAM -

ATGTAGTTAGTGCAGTCTGAGAA - MGBNFQ-3’), amplified a 368 bp product from pHPM, from DNA extracted from conidia placed directly onto greased rods, and from conidia caught in field samples. Initially, DNA from twenty seven different powdery 38

30

26

22 t C

18

14

10 2.71 1.71 0.71 -0.29 -1.29 Log of the Quantity of pHPMLog0 Template DNA Used for qPCR

Figure 3.4 Sybr-green quantitative polymerase chain reaction (qPCR) standard curve of the log of the starting quantity of pHPM DNA, ranging from 5.15×102 ng/ul to 5.15×10-2 ng/ul pHPM versus the 2 corresponding cycle threshold (Ct) values. y=3.77x + 21.53; R =0.99

mildews known to occur in or near hop fields failed to be amplify with the

HPMTMF/HPMTMR primer set. However, at DNA concentrations near detection limits

P. clandestina was amplified despite four and two nucleotide differences in the primer

and probe, respectively (Table 3.1).

There was a significant (p<.0038) linear relationship between the log of the

number of spores spiked into each sample from Hyslop farms and the average Ct number

(y = -3.28224x + 41.11132; adjusted R2 = 0.9430) for each qPCR amplification (Figure

3.5). Efficiency of amplification was 101.7%. Some samples which had low levels of

quantifiable P. macularis DNA had an undetectable IPC Ct value (data not shown) and 39

the range of the Ct for the IPC was from 31.18 to 38.02. The mean IPC Ct value was

34.53 ± 1.34.

32

30

28

Ct 26

24

22

20 2.8 3.3 3.8 4.3 4.8 5.3 5.8 Log of the Quantity of P. macularis Conidia Extracted and Used for qPCR

Figure 3.5 Taqman quantitative polymerase chain reaction (qPCR) standard curve of the log of the initial concentration of template ranging from 1.0×103, 7.0×103, 2.5×104, and 6.25×105 P. macularis conidia spiked into air samples collected at Hyslop farms, versus the corresponding cycle threshold (Ct) values (y = -3.28224x + 41.11132; adjusted R2 = 0.9430). Data was a composite of nine separate runs of the TaqmanqPCR assay.

Field detection and quantification of P. macularis conidia. Detection events

were indicated on disease progress curves which were recorded in each field for each

region and for each year samples were collected (Figures 3.6 and 3.7). The number of

conidia detected in field samples was extrapolated from a comparison of the Ct values for

the sample and the Ct values for the standard curve, and plotted against disease incidence

recorded in the field by scouting (Figures 3.8 and 3.9). There was no relationship found 40 between detection or quantification of P. macularis spores and the disease incidence found in the field (Table 3.3).

Table 3.3 Detection P. macularis and disease incidence in OR and WA during 2005 and 2006.

+ Region & PCR/- Year Fielda - PCR/+Fieldb + PCR/+Fieldc - PCR/-Fieldd +PCR/-Fielde OR 2005 1 11 2 12 2 OR 2006 6 1 0 15 0 WA 2005 2 11 7 6 1 WA 2006 0 12 7 1 0 a The number of field samples which P. macularis ITS region was detected using PCR, but the disease was not observed in the field. b The number of field samples which P. macularis ITS region was not detected using PCR, and the disease was observed in the field. c The number of field samples which P. macularis ITS region was detected using PCR, and the disease was observed in the field d The number of field samples which P. macularis ITS region was not detected using PCR and no disease observed in the field e The number of field samples which P. macularis ITS region was detected using PCR, but field data was missing for the collection date. 41

100 eee B

ncncnc A C eee 80 cidcidcid nnn 60 ase Iase Iase I sesese iii

DDD 40 * 20 * * 0 * 1 D E F

eee 0.8 ccc nnn eee

ddd 0.6 cicici nnn

e Ie Ie I 0.4 easeaseas sss iii 0.2 DDD *** * ** 0 3/1 3/3 1 4/30 5/30 6/2 9 7/2 9 8/28 9/27 3/1 3/31 4/30 5/3 0 6/29 7/29 8/28 9/27 3/1 3/3 1 4/30 5/30 6/2 9 7/29 8/28 9/27 Date of Disease Assessment Date of Disease Assessment Date of Disease Assessment

Figure 3.6 Disease progress curves with detection events indicated by asterisks. Weekly incidence is of powdery mildew found in Oregon fields A, B, C during the 2005 growing season; and in fields D, E, F during the 2006 growing season. Asterisks indicate the occurrence of detection of P. macularis DNA in field samples. Open boxes indicate sample dates for which no sample was available for processing. Closed boxes indicate sample dates that samples were available for processing. 42

100 A B C 80 e e cc nn ee

dd 60 cici nn I I ee 40

easeas * ss

ii * DD 20 * * * * * * 0 **

100 D F E

80 eeee cccc nnnn eeee dddd 60 cicicici * nnnn e Ie Ie Ie I 40 easeaseaseas ssss iiii DDDD 20

0 3/1 3/31 4/30 5/30 6/29 7/29 8/28 9/27 3/1 3/31 4/30 5/30 6/29 7/29 8/28 9/27 3/1 3/31 4/30 5/30 6/29 7/29 8/28 9/27 Date of Disease Assessment Date of Disease Assessment Date of Disease Assessment

Figure 3.7 Disease progress curves with detection events in the Washington region. Weekly incidence is of powdery mildew found in Washington fields A, B, and C during the 2005 growing season; and in fields D, E, F during the 2006 growing season. Asterisks indicate the occurrence of detection of P. macularis DNA in field samples. Open boxes indicate sample dates for which no sample was available for processing. Closed boxes indicate sample dates that samples were available for processing. 43

200000 20000 A A d ed e 5600 t 800 ct c e e t t e e D D

a 4200 i a 600 d i di n ni o o

C 2800

C 400 f of r o e b er

m 1400

200 u mb N u N 0 0

100 24000 B

d B e

t 800 c 80 d e e t t c e e t D e

a 600 60 D di a ni di o ni

o 400 C

f 40 C f o o er r b e

b 200 m

20 m u u N N 0 0 0 5 10 15 20 25 30 0 255 07 510 0 Percent Disease Incidence Percent Disease Incidence

Figure 3.8 Number of P. macularis conidia detected Figure 3.9 Number of P. macularis conidia detected from field samples versus disease incidence found by from field samples versus disease incidence found field scouting in Oregon: A 2005 and B 2006. The by field scouting in Washington: A 2005 and B ■▲◊ symbols indicate data collected from fields 1, 2, 2006. The ■▲◊ symbols indicate data collected or 3 respectively. from fields 1, 2, or 3 respectively. 44

Discussion

Specific and sensitive detection of P. macularis DNA with conventional PCR using the primer set HPMF2/HPMR4 was possible using the typical evaluation methods for qPCR (5;31;35;96;98;100;120). Results from field samples indicated that the spore trapping and PCR methods were not suitable for detection or quantification since spores were not detected in samples from fields with high disease pressure and rapid disease spread. The lack of relationship between detection of P. macularis conidia from field samples to disease levels found in the field may be due to several factors, including: unresolved inefficiencies of DNA extraction from field samples, misplacement of traps resulting in a lack of conidia on the samples, degradation of DNA due to exposure to

U.V. radiation caused by natural sunlight, and length of sampling time.

Removal of PCR inhibitors from field samples is notoriously difficult

(74;78;113). Despite using field samples to develop a modified protocol for the FastPrep kit, it appears that some PCR inhibitors were present as indicated by the variation of Ct for IPC control. Material adhering to the sample rods consisted of varying levels of soil, pollen, insects (whole or parts), plant seeds, bird feathers, and other debris. There is also the potential for pesticide residue to be present. Any number of potential PCR amplification inhibitors may have been extracted along with the DNA thereby preventing amplification (74;78;113). It is possible that the modified FastPrep procedure for DNA extraction was not adequate for the removal inhibitors from some of these sources or that their concentrations were too high for complete removal. Polyphenolics and lignins are two compounds which are commonly found in environmental samples, and are known inhibitors of PCR amplification (64;72). 45

Prior to processing field samples we believed that the modifications to the

FastPrep DNA extraction protocol were sufficient for inhibitor removal. Steps taken to remove inhibitors included 1) the addition of PVP-40 during the lysis step, 2) additional 5 min centrifugation during the DNA binding step of the extraction protocol, and 3) amplification was done from a 1:7 dilution of the template DNA in a final attempt to decrease inhibition. These steps should have removed inhibitors via binding of polyphenolics by PVP-40, and removal of bound inhibitors from the supernatant so as to avoid transferring them to the following step during extraction. Also, the 1:7 template concentration was found to remove inhibitors collected in field samples, yet it was not dilute enough to cause problems with amplification due to lack of DNA in the sample

(data not shown) (Fallacy, in press).

It is difficult to determine if inconsistent detection was due to the lack of spores trapped onto the sample rods. For example, in one field where disease incidence reached

100% both years, detection occurred in 2006 but not in 2005. The location of the spore trap was the same between years, however the field was not trained up onto the trellis system in 2005, and it was in 2006. In 2005, the canopy would not have been more than

0.5 m above the ground, while in 2006, it reached 5 m. Based on the spatial spread of the disease in the field (data not shown), there appeared to be aerial spore movement in both years. It is possible that the P. macularis behaves similar to other powdery mildews where the aerial spores are not dispersed far above the canopy (15;66;86) and did not reach the height of the trap (1.5m) in 2005. This scenario is contrary to results from grape vineyards (Fallacy, in press); however the grape canopy was approximately 0.8m above the ground with little obstruction of airflow under the canopy. 46

It is possible that the quality of DNA collected in the samples was less than adequate for detection using PCR. The stability of DNA left on a sampling rod in the field for up to a week could be an issue. It is not clear if the cells remained intact or were lysed. The impact of a conidium onto the sampling rod may be sufficient for lysis, and it is possible that DNA in a desiccated or lysed conidium may become degraded due to enzymatic action. It is also possible for DNA to be degraded due to ultraviolet radiation

(90) after impingement on the sample rods. However, a similar study using a PCR assay to detect the Erysiphe necator ITS region in grape fields did not indicate that the quality of DNA was a problem for samples left in the field for 3-5 days (Fallacy, 2007).

Sequencing of positive field samples from our study indicated that DNA mutation within the ITS region of these samples did not occur. However, due to the length of sampling time, it is impossible to know when the conidia were collected on those samples, and whether lack of exposure was a contributing factor in the positive detection of P. macularis DNA.

The decision to collect samples weekly was directed by economic and logistic constraints. Through discussions with Hop growers and field scouts it was determined that acquiring field samples at frequencies less than 7 days would be cost prohibitive due to added labor and cost of sample processing. Experiments were planned to address the question of whether sampling once a week was justified, but disease in Oregon fields were insufficient or nonexistent during 2005 and 2006 production season. However, similar studies indicate that this method of spore trapping is effective for sampling intervals of 3-5 days to detect E. necator DNA (Fallacy, 2007). 47

The assay developed for conventional PCR appeared to be highly sensitive and specific to P. macularis DNA under both field and laboratory conditions. However, the modifications in primer design and PCR conditions required for qPCR appeared to result in a lack of primer specificity for P. macularis DNA. This decrease is likely due to reduced annealing temperature used in the qPCR reaction in order to accommodate the

IPC control for inhibition in each reaction. An annealing temperature of 61°C resulted in nonspecific amplification of DNA from P clandestina while no amplification was observed with an annealing temperature of 69°C (data not shown).

The inclusion of an internal positive control in our qPCR assay had both advantages and disadvantages. It gave an indication of when false negatives occurred due to inhibition. However, we believe that ultimately the use of this IPC was not to our advantage because 1) it restricted the annealing temperature of the reaction to 61°C, 2) it was not the same size as the target amplicon, and therefore it is difficult to determine whether it accurately reflects amplification efficiency of the target, and 3) fluctuations in the Ct values for amplification of the IPC DNA in the presence of field samples did not indicate the presence of any inhibitors in the field samples. The latter is highly unlikely.

All field samples were first analyzed using conventional PCR, and the positives were then analyzed with qPCR. The qPCR developed in this study is more sensitive to pcr inhibitors than the conventional assay, which was indicated both in preliminary analysis

(data not shown) and when amplification of some field samples by conventional pcr and inability to amplify with qPCR (Figure 3.6 a-d).

The sybr-green assay was compatible with the more specific primers developed for conventional PCR, however it was not selected for use because melt curve analysis 48 indicated that a second product amplified (Figure 3.3). It is possible, yet unlikely, that this unidentified amplicon was evidence of a primer-dimer formation. Exhaustion of options for optimization of the assay indicated that a more specific approach was necessary, and a TaqMan® qPCR assay was subsequently developed.

A thorough comparison of the sequence data for the P. macularis ITS region and

ITS sequence data reported for other members of the Erysiphales revealed that it may not be the best location to identify species within the Podosphaera group using qPCR and a taqman approach. Compromises between recommended assay design, such as a 150bp amplicon (our amplicon was 363bp), and placement of the probe with the base pair mismatches on the 3’ end rather than the 5’ end, jeopardized the utility of using this method for specific detection of P. macularis. The low heterogeneity of the ITS sequence of the P. macularis consensus generated in this study, and data collected from accessions of P. aphanis var. aphanis, P. ferrugunea var. ferruginea, and the complete homology of

P. filipendulae supports this conclusion. Additionally, this region is very similar in P. clandestina, which is found in cherry orchards near hop fields in Washington. Other regions used in fungal phylogenetic studies, such as within mitochondrial DNA or on the

RNA polymerase II (RPB2) (63) gene may be a better choice for future phylogenetic work within this group.

The results of this study indicate that there is no correlation of the number of P. macularis conidia collected in air samples to disease incidence in the field. Detection and quantification of P. macularis DNA in a laboratory setting was successful. Future studies using molecular techniques for highly specific detection and quantification of P. macularis DNA should include the generation of an internal positive control which is 49 similar in length and melting temperatures to the target amplicon, and the use of a molecular beacon or scorpion probes. These modifications to the assay would increase specificity because thermodynamic constraints would no longer be an issue. 50

Effects of Temperature on the Sporulation of Podosphaera macularis on Humulus lupulus

Introduction

Hop powdery mildew, caused by Podosphaera macularis, is an economically important disease of hops (Humulus lupulus L.) worldwide, which can result in 100% crop loss if not controlled. It is a polycyclic disease that can have as many as 40 generations in a growing season (7). Healthy sporulating colonies can produce as many as 3.53x105 conidia/cm2 of lesion area (7), which are readily wind disseminated throughout the growing season. These traits result in explosive epidemics where every leaf in a field can become infected within 6 weeks of first infection (Gent, unpublished).

Current management is accomplished by using protectant fungicides applied based on a calendar program or HOPS, an infection risk forecaster (70) that was adapted from the Gubler/Thomas infection risk forecaster for grape powdery mildew (47). The use of HOPS has resulted in the reduction of fungicide applications used to manage hop powdery mildew (HPM) but it still appears to call for shorter spray intervals than necessary which results in unnecessary applications (Mahaffee, unpublished). Currently,

HOPS assumes that the secondary spores are always present during the asexual phase of the epidemic (70). This assumption is probably incorrect.

It is likely that temperature impacts spore availability of P. macularis in a similar manner to which it impacts other powdery mildews. For many species that cause powdery mildew, conidial production is reduced or even severely inhibited as temperatures rise above 26°C (22;73;89;112;124-126;132). Germination and risk of 51 infection have also been shown to be greatly reduced when temperatures reach 26°C and higher for P. macularis (71) as well as other species(22;30;73;89;93;112;124-126;132).

Temperatures throughout July and August in the U.S. hop production regions fluctuate between inhibitory daytime highs of 30-40°C and conducive nighttime lows of 15-20°C

(71). As such, it is likely that conditions for sporulation and dissemination of P. macularis do not always precede conditions conducive to infection. Thus, the current

HOPS model would incorrectly classify periods as high risk for infection even when there are no viable spores available, potentially resulting in excessive fungicide applications.

The objective of this study was to gain further understanding about how temperature affects sporulation of P. macularis. 52

Materials and Methods

Plant maintenance. Clonal Symphony (John I. Haas, Inc., Yakima, WA) plants were propagated from greenwood cuttings (52). Rooted cuttings were transplanted to 5 cm × 5 cm × 10 cm pots with a mixture of Sunshine Mix #1 (SunGro Horticulture,

Bellevue, WA) and Soil Moist (JRM Chemical, Cleveland, OH) to reduce irrigation frequency. Plants were fertigated with Champion 17-17-17 fertilizer with micronutrients

(McConkey’s, Portland, OR) with each irrigation. Plant material was kept free from powdery mildew infection by vaporizing sulfur in the greenhouse (71).

Inoculation Procedure. Plants with 2-4 unfurled leaves were chosen for inoculations. All leaves on the plants and the apical bud were removed with the exception of two susceptible leaves. Plants were inoculated with spore suspensions of

60,000 conidia/ml with conidia from Oregon field populations of P. macularis using a handheld atomizer (Nalgene, Rochester, NY) (71). Plants were dried in a growth chamber at 25°C within an hour of washing the conidia from the leaves of the inoculum source, and then moved to an incubating chamber set at 18ºC with a 16h day length until mature sporulating colonies had developed (ranging from 9-14 days after inoculation).

Plant preparation. Once mature and sporulating colonies had developed, the plants were removed from the incubation chamber. Plants were pruned down to 1 infected leaf/plant. An air supply (14,000kg/m2) was used to blow the spores off the colonies. Efforts to control for variation were made by using plants with leaves of similar size and age, and by keeping the leaves 8 cm above the top of the pot.

In order to reduce the potential for disturbance of colonies prior to spore collection, plant movement was minimized during incubation prior to spore collection. 53

Perforated tubing was placed around the stem

of the plant approximately 4cm below the

infected leaf, and the plants were then placed

in 29.5 cm × 11.8 cm × 12.1 cm plastic

vessels (Snapware, Inc, Mira Loma, CA) with

an airtight lid. The lids of the plastic vessels

were mounted with custom impaction spore

samplers (Figure 4.1) which sampled the air at

57 L/min using 1.5 mm × 32 mm acrylic

collector rods (Multidata, Plymouth Meeting,

Figure 4.1 Prepared plants in plastic vessels PA) coated with a thin layer of petroleum jelly mounted with custom impaction spore sampler. (Vi-Jon Laboratories, Inc., St. Louis, MO).

These vessels were placed in the growth chambers with the plants inside them, and

attached to the air supply. The collector rods were installed and the lids closed. Thus, no

disturbance of the plants occurred prior to turning on the spore traps after the incubation

period (described below).

Effect of Constant Temperature. Four plants within four vessels were placed in

6 different growth chambers programmed to run at a constant temperature of 5, 10, 15,

20, 25, 30, or 35ºC with a 16h photoperiod (18.7 +/-1.7 μmol/s/m2 within a vessel. One

plant was used for visual analysis of how temperature effected sporulation, and the

remaining three plants were used for spore collection. Spore collection occurred

following the 48 h incubation. 54

Effect of 6 hr Exposure at Different Temperatures. Four plants in four vessels

were placed in 6 different growth chambers programmed to run at 18°C for 6h, then at

18, 22, 26, 30, 34, or 38°C for 6 h, and back down to 18°C for 12 h, respectively (Figure

4.2). One plant was used for visual analysis, and the remaining three plants were used for

spore collection. The plants were incubated for 24 h with a 16h photoperiod (18.7 +/- 1.7

μmol/s/m2 within a vessel), which began when the tubes were placed in the growth

chambers. Sample collection occurred following the 24h incubation

40

35 l e s s e V

n 30 i th i w e r tu a

r 25 e p m e T

20

15 9:36 14:24 19:12 0:00 4:48 9:36 14:24 Time Figure 4.2 Temperature recorded within a vessel in each growth chamber used for the 6 hr exposure experiment. Each line represents temperature recorded during the 24 hr incubation prior to sample collection. 6 hr exposure to 38°C represented the brown line; 34°C is represented by the purple line; 30°C is represented by the aqua line; 26°C is represented by the yellow line, 22°C represented by the pink line; and 18°C is represented by the blue line.

Sample Collection. Spore samples were collected by turning the custom

impaction spore samplers on, dislodging the spores with air blasts of 28,000kg/m2 at the following interval: 1 blast/sec for 15 sec, 1 continuous blast for 10 sec, and 1 blast/sec for 55

5 sec for a total of 30 seconds of air supplied through the perforated tubing. The spore traps were allowed to run for approximately 5 min, sampling 95× the air volume of the vessel, prior to collecting the rods and microscopically enumerating the number of spores trapped on the leading edge of both collection rods. Differences in the way leaves moved when the air was applied during sample collection were noted (data not shown). The leaf from each plant was removed and colony area was determined with Assess image analysis software (APS Press, St. Paul, MN).

Experimental Design and Data Analysis. Each experiment was a randomized complete block design with 3 replications and 3 sub samples per replication.

Replications occurred in time and growth chambers were randomly assigned a temperature regime for each replication. A control was placed in each chamber that consisted of a plant with mature sporulating colonies with spores removed (described above) and placed inside a vessel (as above) with a HOBO® U10 Temp/RH Data Logger

(Onset Computer Corp., Bourne, MA) suspended from the top of the vessel. The control was used to monitor temperature within the vessel and visually assess spore development.

Within chamber temperature was also measured using HOBO® U10 Temp/RH Data

Logger (Onset Computer Corp., Bourne, MA).

Data were transformed to number of trapped spores/cm2 of colony area for each leaf, averaged over sub samples and then over replications. The relationship between the temperature treatments and sporulation was described following multiple regression procedures. Quadratic, cubic, and nonlinear effects of constant temperature and 6 hr exposure to a range of temperatures were tested. Nonlinear models tested included a square root model proposed for bacteria by Ratkowsky et al. (111), and a thermodynamic 56 model described by Scherm and van Bruggen (99). Equations that resulted in regression terms whose coefficients were not significantly different from zero (P > 0.05) were dropped from the analysis. 57

Results

Effect of Constant Temperature on Sporulation. Sporulation increased with exposure to increasing temperatures up to 20ºC and began to decrease with exposure to temperatures >25ºC. There was a significant (P < 0.0001) non-linear relationship of temperature to the number of conidia trapped per cm2 of colony area that was described by Ratkowsky’s four-parameter equation, R(T)=[b(T-Tmin)(1-ec(T-Tmax)]2 (Fig 4.3). The number of spores trapped increased with increasing temperature until 25°C and then decreased with increasing temperature. However, there was increased variation in numbers of impinged spores at 15 and 25°C.

1400

1200

1000 rea A n o

i 800 s Le 2 m

c 600 / res o p S 400

200

0 0 5 10 15 20 25 30 35 Temperature

Figure 4.3 Effect of constant temperature on sporulation of hop powdery mildew. Each point represents the mean of 3 replications with 3 subsamples per replication. R(T)=[0.9225(T-9.5748)(1-e0.1986(T-34.5051)]2 Pseudo-R2=, P=0.0001. The error bars represent the standard deviation from the mean of 3 replications with 3 subsamples per replication. 58

Visual assessment of control plants exposed to 5, 10, 15, 20, and 25°C consistently indicated apparently healthy sporulating colonies with mature spores available for collection among these treatments. Spores from colonies exposed to 30°C appeared desiccated and had fewer mature spores available for collection than plants exposed to lower temperatures, but less desiccation than colonies exposed to 35°C.

Visual assessment of control plants revealed prolific and consistent desiccation of colonies occurring on control plants exposed to 35°C, and very few mature spores were available for collection.

Effect of 6 hr Exposure at Different Temperatures. There was a significant (P

= 0.035) quadratic relationship (y = -0.67x2 + 35.70x – 362.94; adjusted R2 = 0.8205) of temperature to number of spores/colony area (Figure 4.4). Sporulation increased with increasing temperature exposure up to 26°C and then decreased. Visual assessment of plants revealed consistent desiccation of colonies occurring on control plants exposed to

34°C, and this effect was more dramatic on control plants exposed to 38°C. Plants exposed to 34°C and above appeared to have far fewer mature spores available for dissemination than plants exposed to 22, 26, and 30°C. 59

200

160 rea A n

o 120 i s e L 2 m c

/ 80 res o p S 40

0 16 20 24 28 32 36 40 Temperature Figure 4.4 Effect of 6 hr exposure at different temperatures on sporulation. Each point is the mean of 3 replications with 3 subsamples per replication, y = -0.67x2 + 35.70x – 362.94; adjusted R2 = 0.8205. Error bars indicate the standard deviation from the mean for 5 replicates with 3 sub-samples per replication. 60

Discussion

Sporulation of P. macularis was reduced by exposure to temperatures above 25°C and less than 15°C and almost nonexistent when colonies were exposed to 35°C for 48 h.

These findings indicate that the assumption of continuous inoculum availability by the

HOPS infection risk forecaster is probably incorrect. The reduction in sporulation of P. macularis is similar to that reported for Erysiphe necator, where exposure to 30°C dramatically reduces both the number of spores produced and the duration of sporulation

(22;30;132). Also, infectivity of conidia is significantly reduced when exposed to temperatures between 33 and 35°C (30;93;132).

Despite considerable effort to standardize procedures for spore quantification, inoculation, and plant growth, there was a high degree of unexplained variation in the number of spores/colony area among replications. This variation may be due to inconsistencies in inoculation procedure, disease severity and location, sample collection among replications, inoculum source, plant age or health, or differences in greenhouse environment during plant production. Overall, it is difficult to single out an individual source of this variation and account for that covariance statistically.

Efforts were made to replicate plant inoculations consistently and select plants with similar colonies location and density, yet there was still variation in distribution of disease across replications. Some replications had colonies only on the adaxial leaf surface while other had colonies on both the adaxial and abaxial surfaces which may have not been visible or inadvertently missed during the first application of air applied to remove spores. Studies on other powdery mildews indicate that inoculum density and pattern of application can influence sporulation potential, and differences in infection 61 severity may cause variation in spore catch (83;106). As such, differences in inoculum density may have reduced colony development and sporulation due to increased competition for nutrients (22;106). The location of colonies may have influenced the efficacy with which the applied air blasts caused spores to be dislodged from conidiophores. The transference of single spores or chains to the leaf could have resulted in improved consistency in location and density of lesions, but was impractical due to the time and labor required.

Differences in leaf movement when air was applied during sample collection were noted, and may have influenced spore release (data not shown). Bainbridge and Legg (4) showed that the velocity at which a leaf moves is correlated to the number of spores released. Efforts to control for this variation were made by using plants that were roughly the same size, and also by manipulating the position of the leaf within the sampling tube with respect to the air supply.

The large variation of number of spores trapped following exposure to 15 and

25°C for the constant temperature and 18, 22, and 30°C for the 6h exposure could be due to disparities in how individual isolates in the population used as inoculum respond to these temperatures. The inoculum used in this study was obtained from conidia produced from field isolates collected throughout Oregon and maintained continuously in a growth chamber over the span of 8 years. Conidia of P. macularis collected in the field were added to the growth chamber yearly in order to maintain an accurate representation of the field population. Isolates of Erysiphe fischeri have varying responses to temperature (6), and it is possible that P. macularis isolates have a similar response. There are different races of P. macularis that are associated with regional variation in the cultivars planted 62

(105); however, it is not known if the different races have adapted to environmental differences among the regions.

Different levels of oncogenic resistance among the plants used may account for some of the variation in sporulation rate. Groups of young hop plants used in this experiment were propagated, transferred, and grown together. While the leaves used for inoculation were not all of the same age, they were all between 8-12 days old. Hop leaves are most susceptible to infection when they are about 9 -12 days old with a rapid decrease after 12 days (118). However, lesion area rapidly decreases as leaves age(118), which indicates that physiological changes in the host may also influence sporulation.

These physiological changes were partially accounted for by expressing sporulation in terms of the lesion area present on the leaf, but this would not account for differences in host factors that influence nutrient availability to powdery mildew colonies (56), which could result in an increase or decrease of sporulation. Infection, colonization, and sporulation of Erysiphe species have been shown to be inversely proportional to host leaf age (21;30;32). Stavely and Hanson (112) observed a positive correlation between increasing temperature and spore size and speculated that this is indicative of the fluctuations in available nutrients due to the host response to temperature.

Differences in the number of spores produced per lesion area among leaves of the same age could also be caused by water stress. It is possible that some of the plants may have been inadvertently subjected to water stress prior to inoculation. Water stress has been observed to be associated with decreased susceptibility and lesion development

(Turechek unpublished). This may be associated with the variation in temperature 63 response because it can take weeks for plants to fully recover from being water stressed, and during that time they are less susceptible to infection (82).

The effects of temperature on sporulation presented here indicate that inoculum is not always readily available after periods of exposure to temperatures greater 30°C, and that disease or risk forecasters may be improved by accounting for the effect of temperature on inoculum availability. Visual observations of conidial desiccation indicate that further research is needed on the effects of temperature on inoculum viability and infection potential. These results offer an explanation of why epidemics in hop yards slow during July and August when temperatures routinely exceed 30ºC for more than 6h continuously (118). 64

Conclusion

This research was intended to increase understanding of sporulation and dissemination of Podosphaera macularis, hop powdery mildew, by developing new methods for detecting and quantifying P. macularis in the field, and determining the relationship of temperature to sporulation. In order to accomplish these goals, molecular techniques were developed to detect and quantify DNA from air borne conidia collected in the field, and disease incidence was recorded by the scouting fields in which air borne spore samples were being collected. The effect of temperature on sporulation of P. macularis was examined using controlled environments and novel methods for assessment.

The intertranscribed spacer (ITS) region of ribosomal DNA was an adequate target for detection and quantification of P. macularis DNA in a laboratory setting. It was possible to detect 1000 spores in ten extractions 100% of the time, and 100 spores in ten extractions 60% of the time. However, no relationship was found between the number of conidia detected and disease incidence found in the field. This may be due to inefficiencies of extraction or DNA quality. The limited heterogeneity of this region among species within Podosphaera contributes to the fact that this region is not adequate for detection and quantification of P. macularis DNA collected in a field environment.

These results imply that the ITS region is not suitable for the detection and quantification and another region should be examined.

Temperature had a significant impact on sporulation and may thus have important implications for inoculum availability in the field. Exposure to constant low and high temperatures decreases sporulation, which indicates that inoculum may not always be 65 available once the epidemic has started. Sporulation is also decreased during brief exposures to temperatures above 30°C. These data indicate that inoculum availability is reduced when temperature exceed 30ºC in the field. Accounting for the inoculum reduction could further enhance the utility of an infection risk forecaster. Possible modifications of the Hop Powdery Mildew Infection Risk Index (HOPS) (70) model would be the inclusion of an algorithm that indicates a reduced potential for infection for at least 12 h after temperatures were greater than 30°C, and the reduced potential for infection for 1-2 days after temperatures are greater than 35°C. 66 Appendix 67

Appendix A: Podosphaera macularis ITS Region Consensus Sequence and Primer Target Locations 68

Appendix B: Alignment of ITS sequence of Podosphaera macularis and Podosphaera clandestina 69 70

Bibliography

1. Ad ams, G. J., T. Gottwald, and C. Leach. 1986. Environmental factors initiating liberation of conidia of powdery mildews. Phytopathology 76:1239-1245.

2. An onymous. 1983. Powdery mildew, p. 5-7. In K. R. Horst (ed.), Compendium of rose diseases. The American Phytopathological Society.

3. Aus t, H.-J. and J. v. Hoyningen-Huene. 1986. Microclimate in relation to epidemics of powdery mildew. Annual Reviews in Phytopathology 24:491-510.

4. Ba inbridge, A. a. L. B. 1976. Release of barley-mildew conidia from shaken leaves. Transactions of the British Mycological Society 66:495-498.

5. B ates, J., E. Taylor, D. Kenyon, and J. Thomas. 2001. The application of real-time PCR to the identification , detection and quantification of Pyrenophora species in barley seed. Molecular plant pathology 2:49-57.

6. Bevan, J., Crute, I., and Clarke, D.. 1993. Diversity and variation in expression of resistance to Erysiphe fischeri in Senecio vulgaris. Plant Pathology 42:647-653.

7. B lodgett, F.M. 1913. Hop Mildew. Cornell University, Ithaca, NY.

8. Bo ck, C. and P. Cotty. 2006. Methods to sample air borne propagules of Aspergillus flavus. European journal of plant pathology 114:357-362.

9. Braun, Uwe. A monograph of the Erysiphales (powdery mildews). 1987. Berlin, Gebuder borntraeger.

10. Braun, U. and S. Takamatsu. 2000. Phylogeeny of Erysiphe, Microsphaera, Uncinula (Erysipheae) and Cystotheca, Podosphaera, Sphaerotheca (Cystotheceae) inferred from rDNA ITS sequences some taonomic conseqeunces. Schlechtendalia 4:1-18.

11. Brisley, H. 1926. Recent information concerning powdery mildew of cantaloupe in northern arizona. Plant disease reporter 10:104.

12. Bulit, J. and Lafon, R.. 1978. Powdery mildew of the vine, p. 525-548. In D. M. Spencer (ed.), The Powdery Mildews. Academic Press.

13. Burchill, R.T. 1960. The role of econdary infections in the spread of apple mildew (Podosphaera leucotricha (Ell. and Ev.) Salm.) . Journal of horticultural science and biotechnology 35:66-72.

14. Burrage, S. 1971. The micro-climate at the leaf surface, p. 91-101. In T. Preece and C. Dickinson (eds.), Ecology of leaf surface micro-organisms. Academic press, London.

15. Butt, D. 1978. Epidemiology of the powdery mildews, p. 51-81. In D. Spencer (ed.), The Powdery Mildews. Academic press inc., New York, New York.

16. Butt, D. and M. Jeger. 1986. Components of spore production in apple powdery mildew (Podosphaera leucotricha), Plant Pathology 35 491-497. 71

17. Ocamb, C. M., Klein, R., Barbour, J., Griesbach,. and Mahaffee, W. 1999. First Report of Hop Powdery Mildew in the Pacific Northwest. Plant Disease 81:1071.

18. Carroll, J. and Wilcox, W. 2003. Effects of humidity on the development of grapevine powdery mildew. Phytopathology 93:1137-1144.

19. Celio, G. J. and M. K. Hausbeck. 1998. Conidial germination, infection structure formation, and early colony developement of powdery mildew on poinsettia. Phytopathology 88:105-113.

20. Chellemi, D. O. and J. J. Marois. 1991. Effect of fungicides and water on sporulation of Uncinula necator. Plant Disease 75:455-457.

21. Chellemi, D. O. and J. J. Marois. 1991. Sporulation of Uncinula necator on grape leaves as influenced by temperature and cultivar. Phytopathology 81:197-201.

22. Chellemi, D. O. and J. J. Marois. 1991. Sporulation of Uncinula necator on grape leaves as influenced by temperature and cultivar. Phytopathology 81:197-201.

23. Cole, J. 1971. Sporulation of powdery mildews, particularly Erysiphe cichoracearum DC. On Tobacco, p. 324-337. In T. Preece and C. Dickinson (eds.), Ecology of leaf surface micro-organisms. Academic press, London.

24. Cole, JS and Fernandes, Desiree L. Effects of light, temperature and humidity on sporulation of Erysiphe cichoracearum on tobacco. Transactions of the British Mycological Society 55(3), 345­ 353. 70.

25. Cole, J. and J. Geerligs. 1976. Time-lapse photoghraphy of formation and release of conidia of Erysiphe cichoracearum on tobacco. Transactions of the British Mycological Society 67:339-342.

26. Cook, R. and B. Wheeler. 1967. Overwintering of cleistocarps, and infection by ascospores, of Erysiphe cichoracearum on Arctium lappa. Transactions of the British Mycological Society 50:625­ 630.

27. Coyier, D. 1986. Powdery mildew, p. 24-25. In D. L. Coyier and M. K. Roane (eds.), Compendium of rhododendrom and azalea diseases. The American Phytopathological Society.

28. Cunnington, J. H., S. Takamatsu, A. C. Lawrie, and I. G. Pascoe. 2003. Molecular identification of anamorphic powdery mildews (Erysiphales). Australasian plant pathology 32:421-428.

29. Cutter, E. and B. Wheeler. 1968. Effect of temperature on ascospore discharge from cleistocarps of Erysiphe cichoracearum on Arctium lappa. Transactions of the British Mycological Society 51:791­ 795.

30. Delp, C. J. 1954. Effect of temperature and humidity on the grape powdery mildew fungus. Phytopathology 44:615-626.

31. Doohan, F., D. Parry, and P. Nicholson. 1999. Fusarium ear blight of wheat: the use of quantitative PCR and visual disease assessment in studies of disease control. Plant pathology 48:209-217.

32. Doster, M. A. and W. C. Schnathorst. 1985. Effects of leaf maturity and cultivar resistence on development of the powdery mildew fungus on grapevines. Phytopathology 75:318-321. 72

33. Eisler, D. L., A. McNabb, D. R. Jorgensen, and J. L. Isaac-Renton. 2006. Use of internal positive control in a multiplex reverse transcription-pcr to detect west nile virus rna in mosquito pools. Journal of clinical microbiology 42:841-843.

34. Ellis, M. 1991. Powdery mildew, p. 16-18. In M. A. Ellis, R. H. Converse, R. N. Williams, and B. Williamson (eds.), Compendium of raspberry and blackberry diseases and insects. The American Phytopathological Society.

35. Filion, M., M. St-Arnaud, and S. Jabaji-Hare. 2003. Quantification of Fusarium solani f. sp. phaseoli in mycorrhizal bean plants and surrounding mycorrhizosphere soil using real-time polymerase chain reaction and direct isolations on selective media. Phytopathology 93:229-235.

36. Gadoury, D. M. and R. C. Pearson. 1990. Ascocarp dehiscence and ascospore discharge in Uncinula necator. Phytopathology. St. Paul, Minn. American Phytopathological Society. Apr 1990. V. 80 (4) P. 393-401. Ill.

37. Gadoury, David M and Pearson, Roger C. 1967. Heterothallism and pathogenic specialization in Uncinula necator. Phytopathology 77 (11), 1614. 87.

38. Gadoury, D. M. and R. C. Pearson. 1988. Initiation,development,dispersal,and survival of cleistothecia of Uncinula necator in New York vineyards. Phytopathology 78:1413-1421.

39. Gadoury, D. M., R. C. Seem, R. C. Pearson, and W. F. Wilcox. 2001. Effects of powdery mildew on vine growth, yield, and quality of Concord grapes. Plant Disease 85:137-140.

40. Gee, CT, Gadoury, DM, and Cadle-Davidson, L. 2004. Variation in the timing of ontogenic resistance against Uncinula necator in the USDA-ARS PGRU Vitis germplasm collection. Phytopathology 95 (6), S169. 2004.

41. Gent, D. H., W. W. Turechek, and W. F. Mahaffee. 2007. Sequential sampling for estimation and classification of the incidence of hop powdery mildew I: leaf sampling. Plant disease 91:1002-1012.

42. Gent, D. H., W. W. Turechek, and W. F. Mahaffee. 2007. Sequential Sampling for Estimation and Classification of the Incidence of Hop Powdery Mildew II: Cone Sampling. Plant disease 91:1013-1020.

43. Gordan, C. 1966. A reinterpretation of the ontogeny of the ascocarp of species of the Erysiphaceae. American journal of botany 53:652-662.

44. Grove, G. G., R. J. Boal, and L. H. Bennett. 2000. Managing powdery mildew of cherry in Washington orchards and nurseries with spray oils. Online. Plant Health Progress doi:10.1094/PHP­ 2000-0728-01-RS.

45. Grove, G. G. 1991. Powdery mildew of sweet cherry: influence of temperature and wetness duration on release and germination of ascospores of Podosphaera clandestina . Phytopathology 81:1271­ 1275.

46. Grove, G. G. 1998. Meteorological factors affecting airborne conidia concentrations and the latent period of Podosphaera clandestina on sweet cherry. Plant Disease 82:741-746.

47. Gubler, W D, Rademacher, M R, Vasquez, S J, and Thomas, C S. Control of powdery mildew using the UC Davis powdery mildew misk index. APSnet Feature , 1-8. 99. 73

48. Gubler, W D and Thomas, C S. Control of grapevine powdery mildew using the U.C. Davis risk assessment model. Magarey, P A, Tschirpig, K L, and Scarfe, B F. Third International Workshop on Grapevine Downy and Powdery Mildew - Book of Abstracts. 98. SARDI Research Report Series.

49. Hammett, K. R. W. and J. G. Manners. 1971. Conidium liberation in Erysiphe graminis. Transactions of the British Mycological Society 56:387-401.

50. Hammett, K. R. W. and J. G. Manners. 1973. Conidium liberation in Erysiphe graminis. Transcripts of the British Mycological Society 61:121-133.

51. Hammond, W. 1900. On Red Mould, or the Premature Going Off of Hops. Journal of the South- Eastern Agricultural College Wye 19-20.

52. Haunold, A. and C. E. Zimmermann. 1974. Pollen collection, crossing, and seed germination of hop. Crop Science 14:774-776.

53. Heuser, T. and W. Zimmer. 2002. Quantitative analysis of phytopathogenic ascomycota on leaves of pedunculate oaks ( Quercus robur L.) by real-time PCR. FEMS Microbiology Letters 209:295­ 299.

54. Hirata, T. and S. Takamatsu. 1996. Nucleotide sequence diversity of rDNA internal transcribed spacers extracted from conidia and cleistothecia of several powdery mildew fungi. Mycoscience 37:283-288.

55. Hirst, J., O. Stedman, and W. Hogg. 1967. Long-distance spore transport: methods of measurement, vertical spore profiles and the detection of immigrant spores. Journal of general microbiology 48:329-355.

56. Hopkins, W. G. 1995. Introduction to plant physiology. John Wiley & Sons, Canada.

57. Horn, N. L., K. R. Burnside, and R. B. Carver. 1972. Powdery mildew of strawberry. Plant Disease Reporter. 56 4.

58. Jackson, G. and B. Wheeler. 1974. Perennation of Sphaerotheca mors-uv ae as cleistocarps. Transactions of the British Mycological Society 62:73-87.

59. Jailloux, F., T. Thind, and M. Clerjeau. 1998. Release, germination, and pathogenicity of ascospores of Uncinula necator under controlled conditions. Canadian Journal of Botany 76:777­ 781.

60. Jarvis, W., W. Gubler, and G. Grove. 2002. Epidemiology of powdery mildew in agricultural pathosystems, p. 169-199. In R. R. Belanger, W. R. Bushnell, A. J. DIK, and T. L. Carver (eds.), The powdery mildew a comprehensive treatise. The American Phytopathogical Society.

61. Jones, H., J. M. Whipps, and S. J. Gurr. 2001. The tomato powdery mildew fungus Oidium neolycopersici. Molecular Plant Pathology 2:303-309.

62. Kiss, L., R. T. A. Cook, G. S. Saenz, J. H. Cunnington, S. Takamatsu, I. Pascoe, M. Bardin, P. C. Nicot, Y. Sato, and A. Y. Rossman. 2001. Identification of two powdery mildew fungi, Oidium neolycopersici sp. nov. and O. lyocopersici, infecting tomato in different parts of the world. Mycological Research 105:684-697. 74

63. Koonin, E. V., N. D. Fedorova, J. D. Jackson, A. R. Jacobs, D. M. Krylov, K. S. Makarova, R. Mazumder, S. L. Mekhedov, A. N. Nikolskaya, B. S. Rao, I. B. Rogozin, S. Smirnov, A. V. Sorokin, A. V. Sverdlov, S. Vasudevan, Y. I. Wolf, J. J. Yin, and D. A. Natale. 2004. A comprehensive evolutionary classification of proteins encoded in complete eukaryotic genomes. Genome biology 5:R7.

64. Koonjul, P., W. F. Brandt, J. M. Farrant, and G. G. Lindsey. 1999. Inclusion of polyvinylpyrrolidone in the polymerase chain reaction reverses the inhibitory effects of polyphenolic contamination of RNA. Nucleic acids research 27:915-916.

65. Last, F. 1953. Some effects of temperature and nitrogen supply on wheat powdery mildew. Annals of applied biology 40:312-322.

66. Last, F. 1955. The spore content of air within and above mildew-infected cereal crops. Transactions of the British Mycological Society 38:453-464.

67. Last, F. 1963. Effect of temperature on cereal powdery mildews. Plant pathology 12:132-133.

68. Limpert, E. 1999. Dispersal of cereal mildews across Europe. Agricultural and Forest Meteorology 97:293-308.

69. Liyanage, A. d. S. and D. J. Royle. 1976. Overwintering of Sphaerotheca humuli, the cause of hop powdery mildew. The Annals of Applied Biology 83:381-394.

70. Mahaffee, W., C. Thomas, W. Turechek, C. Ocamb, M. Nelson, A. Fox, and W. Gubler. 2003. Responding to an Introduced Pathogen: Podsphaera macularis (Hop powdery mildew) in the Pacific Northwest. Online Plant Health Progress doi:10.1094/PHP-2003-1113-07-RV .

71. Mahaffee, W. F., W. W. Turechek, and C. M. Ocamb. 2003. Effect of variable temperature on infection severity of Podosphaera macularis on hops. Phytopathology 93:1587-1592.

72. Malvick, D. K. and E. Grunden. 2005. Isolation of fungal DNA from plant tissues and removal of DNA amplification inhibitors. Molecular ecology notes .

73. Manners, J. 1971. Spore formation by certain pathogens in infected leaves, p. 339-351. In T. Preece and C. Dickinson (eds.), Academic Press, London.

74. Martin-Laurent, F., L. Philippot, S. Hallet, R. Chaussod, J. Germon, G. Soulas, and G. Catroux. 2001. DNA extraction from soils: old bias for new microbial diversity analysis methods. Applied and environmental microbiology 67:2354-2359.

75. Matsuda, Y., T. Sameshima, N. Moriura, K. Inoue, T. Nonomura, K. Kakutani, H. Nishimura, S. Kusakari, S. Takamatsu, and H. Toyoda. 2005. Identification of individual powdery mildew fungi infecting leaves and direct detection of gene expression by single Conidium Polymerase chain reaction. Phytopathology 95:1137-1143.

76. McKeen, W., N. Mitchell, and R. Smith. 1967. The Erysiphe cichoracearum conidium. Canadian journal of botany 45:1489-96.

77. Merriman, P. and B. Wheeler. 1968. Overwintering of Sphaerotheca mors-uvae on black currant and gooseberry. Annals of applied biology 61:387-397. 75

78. Miller, D., J. Bryant, E. Madsen, and W. Ghiorse. 1999. Evaluation and optimization of DNA extraction and purification procedures for soil and sediments samples. Applied and environmental microbiology 65:4715-4724.

79. Mitchell, N. and W. McKeen. 1970. Light and electron microscope studies on the conidium and germ tube of Sphaerotheca macularis. Canadian journal of microbiology 16:273-280.

80. Mmbaga, M. T., N. B. Klopfenstein, M. S. Kim, and N. C. Mmbaga. 2004. PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers. Forest Pathology 34:321-328.

81. Moseman, J. and H. J. Powers. 1957. Function and longevity of cleistothecia of Erysiphe graminis f. sp. hordei. Phytopathology 47:53-56.

82. Neve, R. A. 1963. Plant breeding section; review of the year's work, London, England.

83. Pady, S. M., C. L. Kramer, and R. Clary. 1969. Sporulation in some species of Erysiphe. Phytopathology 59:844-848.

84. Pearson, R. 1988. Powdery mildew, p. 9-11. In R. C. Pearson and A. C. Goheen (eds.), Compendium of grape diseases. The American Phytopathological Society.

85. Peries, O. S. 1962. Studies on strawberry mildew, caused by Sphaerotheca macularis (Wallr. Ex Fries) Jaczewski. Annal of Applied Biology 50:211-224.

86. Peries, O. S. 1962. Studies on strawberry mildew, caused by Sphaerotheca macularis (Wallr. ex Fries) Jaczewski. Annals of Applied Biology 50:211-224.

87. Powers, Harry R Jr and Moseman, JG. Heterothallism in Erysiphe graminis tritici. Phytopathology 23:56.

88. Purcell, A. H. and S. R. Saunders. 1999. Fate of Pierce's disease strains of Xylella fastidiosa in common riparian plants in California. Plant Disease 83:825-830.

89. Quinn, J. A. and C. C. Powell, Jr. 1982. Effects of temperature, light, and relative humidity on powdery mildew of Begonia. Phytopathology 72:480-484.

90. Ratner, J. N., B. Balasubramanian, J. Corden, S. L. Warren, and D. B. Bregman. 1998. Ultraviolet radiation-induced ubiquitination and proteasonal degradation of the large subunit of RNA polymerase II implications for transcription-coupled DNA repair. The journal of biological chemistry 273:5184-5189.

91. Saenz, G. S. and J. W. Taylor. 1999. Phylogeny of the Erysiphales (powdery mildews) inferred from internal transcribed spacer ribosomal DNA sequences. Canadian Journal of Botany 77:150­ 168.

92. Salazar, O., M. Julian, and V. Rubio. 2000. Primers based on specific rDNA-ITS sequences for PCR detection of Rhizoctonia solani, R. solari AG 2 subgroups and ecological types, and binucleate Rhizoctiona. Mycological research 104:281-285.

93. Sall, M. A. 1980. Epidemiology of grape powdery mildew: a model. Phytopathology 70:338-342. 76

94. Salmon, E. S. 1900. A monograph of the Erysiphaceace. Mem. Torrey Bot. Club. 9.

95. Salmon, E. S. 1907. Notes on the hop mildew (Sphaerotheca humuli (DC.) Burr.). Journal of Agricultural Science 6:187-193.

96. Saunders, N. 2004. Quantitative real-time PCR, p. 103-123. In K. Edwards, J. Logan, and N. Saunders (eds.), Real-time PCR an essential guide. Horizon bioscience, Great britan.

97. Schena, L., F. Nigro, A. Ippolito, and D. Gallitelli. 2004. Real-time quantitative PCR: a new technology to detect and study phytopathogenic and antagonistic fungi. European Journal of Plant Pathology 110:893-908.

98. Schena, L., F. Nigro, A. Ippolito, and D. Gallitelli. 2004. Real-time quantitative PCR: a new technology to detect and study phytopathogenic and antagonistic fungi. European journal of plant pathology 110:893-908.

99. Scherm, H. and A. van Bruggen. 1994. Effects of fluctuating temperatures on the latent period of lettuce downy mildew (Bremia lactucae). Phytopathology 84:853-859.

100. Schmidt, H., M. Bannier, and V. a. L. Niessen. 2003. Detection and quantification of Aspergillus ochraceus in green coffee by PCR. Letters in applie microbiology 38:464-469.

101. Schnathorst, W. C. 1965. Environmental relationships in the powdery mildews. Annual Review of Phytopathology 3:343-366.

102. Schnathorst, W. 1959. Spread and life cycle of the lettuce powdery mildew fungus. Phytopathology 49:464-468.

103. Schneider, J., O. Salazar, V. Rubio, and J. Keijer. 1997. Identification of Rhizoctonia solani associated with field-grown tulips using ITS rDNA polymorphism and pectic zymograms. European journal of plant pathology 103:607-622.

104. Schweigkofler, W., K. O'Donnell, and M. Garbelotto. 2004. Detection and quantification of airborne conidia of Fusarium circinatum, the causal agent of pine pitch canker, from two California sites by using a real-time PCR approach combined with a simple spore trapping method. Applied and Environmental Microbiology 70:3512-3520.

105. Seigner, E., S. Seefelder, B. Haugg, B. Engelhard, S. Hasyn, and F. G. Felsenstein. 2003. Potential of powdery mildew (Sphaerotheca humuli) to infect hops (Humulus lupulus) in various developmental stages. Gesunde Pflanzen 55:29-33.

106. Shaner, G. 1973. Estimation of conidia production by individual pustules of Erysiphe graminis f. sp. tritici. Phytopathology 63:847-850.

107. Shurtleff, M. C. and C. W. I. Averre. 1997. Glossary of plant-pathogen terms. The american phytopathological society.

108. Sivapalan, A. 1993. Effects of impacting rain drops on the growth and development of powdery mildew fungi. Plant Pathology 42:256-263.

109. Smith, C. G. 1970. Production of powdery mildew cleistocarps in a controlled environment. Transactions-British Mycological Society 55:355-365. 77

110. Smith, C. 1970. Production of powdery mildew cleistocarps in a controlled invironment. Transactions of the British Mycological Society 55:355-365.

111. Smits, N., J.-F. Briere, and J. Fargues. 2003. Comparison of non-linear temperature-dependent development rate models applied to in vitro growth of entomopathogenic fungi. Mycological research 107:1476-1484.

112. Stavely, J. and E. Hanson. 1966. Some effects of temperature and relative humidity on development of Erysiphe polygoni on Trifolium pratense. Phytopatholofy 56:940-943.

113. Steffan, R., J. Goksoyr, A. Bej, and R. Atlas. 1988. Recovery of DNA from soils and sediments. Applied and environmental microbiology 54:2908-2915.

114. Sutton, J. 1998. Powdery mildew, p. 17-18. In J. Maas (ed.), Compendium of strawberry diseases. The american phytopathological society.

115. Sutton, T. and A. Jones. 1979. Analysis of factors affecting dispersal of Podosphaera leucotricha conidia. Phytopathology 69:380-383.

116. Takamatsu, S. 2004. Phylogeny and evolution of the powdery mildew fungi (Erysiphales, Ascomycota) inferred from nuclear ribosomal DNA sequences. Mycoscience 45:147-157.

117. Turechek, W. W. and W. F. Mahaffee. 2004. Spatial pattern analysis of hop powdery mildew in the Pacific Northwest: implications for sampling. Phytopathology 94:1116-1128.

118. Turechek, W. W., W. F. Mahaffee, and C. M. Ocamb. 2001. Development of Management Strategies for Hop Powdery Mildew in the Pacific Northwest. Online. Plant Health Progress doi:10.1094/PHP-2001-0313-01-RS.

119. Van de Graaf, P., A. K. Lees, D. W. Cullen, and J. M. Duncan. 2003. Detection and quantification of Spongospora subterranea in soil, water and plant tissue samples using real-time PCR. European Journal of Plant Pathology 109:589-597.

120. van de Graaf, P., A. K. Lees, D. W. Cullen, and J. M. Duncan. 2003. Detection and quantification of Spogospora subterranea in soil, water, and plant tissue samples using real-time PCR. Euoropean journal of plant pathology 109:589-597.

121. Ward, S. V. and J. G. Manner. 1974. Environmental effects on the quantity and viability of conidia produced by Erysiphe graminis. Transactions of The British Mycological Society 62:119­ 128.

122. White, T., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322. In M. Innis, D. Gelfand, J. Shinsky, and T. White (eds.), PCR protocols: a guide to methods and applications. Academic Press, San Diego.

123. Willocquet, L. and M. Clerjeau. 1998. An analysis of the effects of environmental factors on conidial dispersal of Uncinula necator (grape powdery mildew) in vineyards. Plant Pathology 47:227-233.

124. Xu, X. and J. Robinson. 2001. The effects of temperature on the incubation and latent periods of powdery mildew (Erysiphe polygoni) on clematis. Journal of Phytopathology 149:565-568. 78

125. Xu, X. M. 1999. Effects of temperature on the latent period of the rose powdery mildew pathogen, Spaerotheca pannosa. Plant Pathology 48:662-667.

126. Xu, X.-M. and J. D. Robinson. 2000. Effects of temperature on the incubation and latent periods of hawthorn powdery mildew (Podosphaera clandestina). Plant Pathology 49:791-797.

127. Yarwood, C. E. 1957. Powdery Mildews. The Botanical Review 23:235-301.

128. Yarwood, C. E. 1937. Observations on the overwintering of powdery mildews. Phytopathology 44.

129. Yarwood, C. 1950. Dry weather fungi-powdery mildew abundant in California where they thrive in the dry summer climate. California Agriculture 7 and 12.

130. Yarwood, C. and M. Gardner. 1972. Ascospore discharge by Erysiphe trina. Mycologia 64:799­ 805.

131. Yarwood, C. E. 1936. The diurnal cycle of the powdery mildew Erysiphe polygoni. Journal of agricultural research 52:645-657.

132. Ypema, H. L. and W. D. Gubler . 1997. Long-term effect of temperature and triadimefon on proliferation of Uncinula necator: implications for fungicide resistance and disease risk assessment. Plant Disease 81:187-192.

133. Zhang, Z., Y. Li, H. Fan, Y. Wang, and X. Zheng. 2006. Molecular detection of Phytophthora capsici in infected plant tissues, soil and water. Plant Pathology 55.

134. Zhang, Z., J. Zhang, Y. Wang, and X. Zheng. 2005. Molecular detection of Fusarium oxysporum f. sp. niveum and Mycosphaerella melonis in infected plant tissues and soil. FEMS Microbiology Letters 249:39-47.