The Nut Site of Bacteriophage K Is Made of R.NA and Is Bound by Transcripuon Anutermination Factors on the Surface of RNA Polymerase

Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

The nut site of bacteriophage k is made of R.NA and is bound by transcripuon anutermination factors on the surface of RNA polymerase

Justin Rea Nodwell and Jack Greenblatt Banting and Best Department of Medical Research and Department of Medical Genetics, University of Toronto, Toronto, Canada M5G 1L6

The boxA and boxB components of the k nut site are important for transcriptional antitermination by the phage N protein. We show here that boxA and boxB RNA in N-modified transcription complexes are inaccessible to ribonucleases and have altered sensitivity to dimethylsulfate. N and NusA suffice to weakly protect boxB, independently of boxA and other factors. However, efficient protection of the entire nut site from ribonucleases requires boxA and boxB, N, NusA, NusB, Sl0, and NusG. Mutations in RNA polymerase, which inhibit antitermination by N in vivo, disallow protection of the nut site during transcription in vitro; therefore, the surface of RNA polymerase must coordinate the formation of complexes containing the antitermination factors and nut site RNA. [Key Words: Transcription antitermination; RNA footprinting, bacteriophage h] Received June 14, 1991; revised version accepted September 11, 1991.

Shortly after bacteriophage h infects a cell or is induced 1986) and are known to be important for transcription from the prophage state, Escherichia coli RNA polymer- antitermination by N (Zuber et al. 1987). boxB is located ase initiates transcription from the h promoters PL and 9 or 10 bp downstream from the core boxA sequence. It p~, reads through the early genes N and cro, and is is a 15-bp sequence that has hyphenated dyad symmetry stopped by transcription terminators that are located and, hence, the capacity to form a stem-loop structure in downstream from the early genes. Once the N protein is single-stranded nucleic acid (Rosenberg et al. 1978). made, it modifies RNA polymerase molecules that are Four Escherichia coli proteins function as cofactors in transcribing the early genes so that they become resis- N-mediated antitermination: NusA, NusB, S10, and tant to transcription termination and read through the NusG (Friedman and Baron 1974; Keppel et al. 1974; terminators into the delayed early genes (Adhya et al. Friedman et al. 1976, 1981; Das and Wolska 1984; J. Li, 1974; Franklin 1974). The delayed early protein Q later R. Horwitz, S. McCracken, and J. Greenblatt, in prep.). causes a similar antitermination event during transcrip- N-modified transcription complexes assembled in vitro tion from the late promoter PR', resulting in the efficient contain N and all four host cofactors (Batik et al. 1987; transcription of the late genes. Thus, the order of expres- Horwitz et al. 1987; Mason and Greenblatt 1991; J. Li, R. sion of the genes of h during lytie development is deter- Horwitz, S. McCracken, and J. Greenblatt, in prep.). mined by their positions along the h chromosome rela- Antitermination by N in vitro at terminators located a tive to promoters and terminators and by the action of short distance downstream from a nut site requires only the antitermination proteins N and Q. the host factor NusA and the boxB component of the nut The modification of RNA polymerase N requires nut site (Whelan et al. 1988; J. Li, R. Horwitz, S. McCracken, sites, which are located in transcribed, but untranslated, and J. Greenblatt, in prep.). Antitermination by N in regions between the promoters and first terminators of vitro that persists far downstream from the nut site and the early operons (Friedman et al. 1973; Salstrom and reflects N function more closely in vivo, requires boxA Szybalski 1978). The nutL and nutR sites of bacterio- and the additional host factors NusB, S10, and NusG in phage h have two genetically defined components: boxA addition to N, NusA, and boxB (J. Li, R. Horwitz, S. and boxB. The k boxA sequence is traditionally defined McCracken, and J. Greenblatt, in prep.). as CGCTCTT (Olson et al. 1982; Peltz et al. 1985); how- The results of several indirect experiments have im- ever the 9 or 10 nucleotides immediately downstream of plied that the functional form of the nut site may be in it (the extended boxA homology region) are evolution- the nascent transcript RNA rather than the DNA of the arily conserved in lambdoid bacteriophages (Morgan chromosome of the phage. Ribosomes translating across Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

Nodwell and Greenblatt the nut site RNA in vivo inhibit antitermination by N (Olson et al. 1982; Warren and Das 1984; Zuber et al. 1987). Also, treatment of high-performance liquid chro- matograpy {HPLC)-purified N-modified transcription complexes with a large amount of ribonuclease T1 causes the loss of N and some of the NusA from the complex, indicating that the presence of these proteins in the complex is stabilized by RNA (Horwitz et al. 1987). To explain these results, we have proposed that N and one or more of the host antitermination proteins bind to the nut site in the nascent transcript and form a ribonucleoprotein complex that associates with RNA polymerase and renders it resistant to transcription termination (Greenblatt 1984; Horwitz et al. 1987). We have reconstituted antitermination by N in vitro using purified proteins (J. Li, R. Horwitz, S. McCracken, Figure 1. (A) The right early transcript of bacteriophage k, in- and J. Greenblatt, in prep.) and have now used this re- cluding the positions of the oligonucleotides JN-1 and JL-1, constituted system to perform footprinting experiments which were used for primer extension. (B,C) The results of on the nut site RNA in elongating transcription com- primer extension with JL-1 and JN-1, respectively, on the RNA plexes. Our results indicate that the nut site RNA in the produced following various times of chain elongation in the nascent transcript binds one or more of the transcription presence and absence of the N protein. NusA, NusB, $10, and antitermination factors and forms a stable ribonucle- NusG were present in all of the reactions at the concentrations oprotein complex that is carried along in association listed in Materials and methods for footprinting experiments. with RNA polymerase during chain elongation.

Results The RNA was partially digested with the single-stranded Reasoning that nut site RNA-protein complexes might RNA-specific ribonuclease M1 or the double-stranded normally only form during transcription, we set up ribo- RNA-specific ribonuclease V1 or it was partially meth- nuclease and dimethylsulfate (DMS} footprinting on the ylated with DMS. Because the primer extension assay RNA in active transcription complexes using conditions only detects methylation by DMS of N1 of adenine and in which processive antitermination by N in vitro re- N3 of cytosine, DMS is a single-stranded RNA-specific quires NusA, NusB, S10, and NusG (J. Li, R. Horwitz, S. reagent in this context. McCracken, and J. Greenblatt, in prep.}. Reactions were The elongation factors alone, in the absence of ribonu- programmed with pLS-1 (Lau et al. 1985), a plasmid con- cleases or DMS had no effect on the RNA {Fig. 2A, cf. taining a pR-nutR--tR1 insert derived from bacteriophage lanes 4 and 5; Fig. 2B, cf. lanes 7 and 8). In Figure 2A, the k (see Fig. 1AI. Transcription was synchronized by mak- ribonuclease cleavage and DMS methylation sites were ing use of rifampicin (see Materials and methods}. At detected with the primer JL-1, which hybridizes 100 nu- various times after chain elongation was initiated, the cleotides downstream of nutR. The nut site RNA was RNA was analyzed by primer extension with the 32p. protected against ribonucleases M1 and V1 (92% and end-labeled oligonucleotide primers JN-1 and JL-1 (see 93% protection, respectively) when the antitermination Fig. 1A), which hybridize to the RNA distal to the nut factors were added to the reaction {Fig. 2A, cf. lanes 2 and site. In this way we found that essentially all of the tran- 3 with lanes 6 and 7). For both ribonucleases the pro- scription complexes had passed the nut site after <40 sec tected region included boxB, bonA, and all of the nucle- of chain elongation at 37~ (see Fig. 1B, C). In the foot- otides in between them. A prominent DMS methylation printing experiments ribonuclease or dimethylsulfate site between boxA and boxB was also protected in the (DMSI was added to the transcription reaction after 1 presence of the antitermination factors [Fig. 2A, cf. lanes rain of chain elongation. After an additional 1 rain of 9 and 10). Cleavage by ribonuclease V1 and methylation incubation at 37~ the RNA was extracted from the re- by DMS upstream and downstream of the nut site were action and the ribonuclease cleavages or DMS methyl- not affected by the presence of N and the host factors. ation sites were detected by primer extension with a 32p. Many ribonuclease M 1 bands downstream of the nut site end-labeled oligonucleotide and AMV reverse tran- were somewhat suppressed in the presence of N, NusA, scriptase. All of the effects of the factors on the reactivity NusB, $10, and NusG. Several pieces of evidence indi- of the nut site RNA with the ribonucleases or DMS were cate that the downstream suppression was the result of a densitometrically quantitated. slight inhibition of ribonuclease M1 activity and not the Figure 2 shows footprinting experiments on the RNA interactions between the downstream RNA and the pro- synthesized in reactions programmed with pLS-1 DNA. tein factors. First, the reactivity of the downstream RNA Transcription was performed either in the absence of with ribonuclease V1 and DMS was not affected by the added antitermination factors or in the presence of N, factors {Fig. 2A). Second, protection of the nut site RNA NusA, NusB, S10, and NusG, as indicated in Figure 2. was specific because quantitation of densitometric scans Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

N utilization site is RNA

Figure 2. Footprinting the k nutR site RNA with ribonucleases M1 and V1 and the chemical DMS. Transcription reactions were carried out either in the absence of added transcription factors (lanes 1,2,4,6,8,9 in A; lanes 1,2,4,5,7,9 in B) or in the presence of N, NusA, NusB, S10, and NusG (lanes 3,5,7,10 in A; lanes 3,5,8,10 in B), as indicated. Analysis of the reaction products by primer extension was carried out by using the oligonucleotide JL-1 in A or the oligonucleotide JN-1 in B (Fig. 1). The positions of the boxA and boxB components of the nutR site are indicated. Sequencing lanes are marked G, A, U, C.

of lanes 2 and 3 of Figure 2A indicated that the cleavage Nucleotides near the 3' end of boxA and in between of the nut site RNA was reduced 12-fold by the presence boxA and boxB appeared to be in equilibrium between of the factors while the suppression of cleavage down- single-stranded and double-stranded forms because they stream of the nut site was only 2-3-fold. Third, the de- were sensitive to DMS, ribonuclease V1, and ribonu- letion of sequences downstream of the nut site has no clease M1. All of the nucleotides in nutR that were effect on antitermination by N (Horwitz et al. 1987). Fi- cleaved by ribonucleases were protected when transcrip- nally, a nut site consisting only of boxA and boxB can tion was performed in the presence of N and the host direct transcription antitermination by N when placed transcription factors (Fig. 2B, cf. lanes 3 and 2 and lanes in a different transcription unit (Doelling and Franklin 6 and 5), indicating that the nut site RNA in N-modified 1990), and such a nut site was protected from ribonu- transcription complexes was enveloped by protein. clease M1 by the factors (see Fig. 4 below). Many nucleotides in the nut site RNA had altered sen- The ribonuclease cleavage and DMS methylation sites sitivity to DMS in the presence of the transcription fac- in the nut site RNA were detected at higher resolution tors (Fig. 2B, cf. lanes 9 and 10). The nucleotides that by using the oligonucleotide JN-1, which hybridizes 12 were protected most strongly from DMS fell into two nucleotides downstream of boxB, for primer extension. clusters: one in the extended boxA homology region, and The results of this experiment are shown in Figure 2B the other in the loop of boxB. Two adenine residues in and summarized in Figure 3. Consistent with the pre- the loop of boxB that were protected by 50% have been dicted stem-loop structure of boxB RNA (Rosenberg et shown previously to be important for antitermination al. 1978), the loop of boxB was sensitive to ribonuclease (Doelling and Franklin 1990). The three residues ACA, M1 and to DMS but was resistant to ribonuclease V1 located 3' to the boxA sequence in the extended boxA (Fig. 2B, cf. lanes 1 and 2, lanes 4 and 5, and lanes 7 and homology region (Morgan 1986), were protected by 60%. 9). Conversely, the stem of boxB was sensitive to ribo- The DMS reactivity of five nucleotides was enhanced by nuclease V1 and resistant to ribonuclease M1 and DMS. N and the host factors. Two are conserved cytosine res- Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

Nodwell and Greenblatt

170 nM N protein. Therefore, the guanine to adenine mutation in the loop of boxB prevents the association of the transcription antitermination factors with the nut site

Ribonuclease M1 Protections RNA in vitro. Ribonuclease V1 Protections G A To determine whether all five antitermination factors DMS Protections were required for the protection of the nut site RNA DMS Enhancements UA m during transcription in vitro we carried out ribonuclease Unaffected DMS Sites ~>-- o CG .o M1 footprinting on reactions containing N, NusA, NusB, CG S10, and NusG (Fig. 5, lane 3; 90% protection) and on reactions from which one of the factors had been omitted CG (lanes 4--8). The omission of any one antitermination GC factor weakened the association of the remaining factors with the nut site to the extent that it was not signifi- cantly protected against ribonuclease M1 [< 10% protection). Similarly, when wild-type NusA protein was re- boxA placed with the antitermination defective protein [ NusB, $10, NusG [ N, NusA NusA1 (Friedman and Baron 1974), the protection of the nut site was greatly reduced (Fig. 5B, cf. lanes 3 and 4; Figure 3. Summary of ribonuclease and DMS footprinting on 80% and 20% protection, respectively). Rho factor was the nutR site, as shown in Fig. 2. Reverse transcriptase ceases not included in any of the footprinting reactions and was DNA synthesis immediately 3' to nucleotides that are methyl- not necessary for protection of the nut site RNA even ated by DMS; hence, each band on the autoradiograph that re- though some mutations in the rho gene interfere with suits from methylation by DMS actually refers to its 5' neigh- antitermination by N at Rho-dependent terminators bor. Apparent methylations by DMS of nucleotides other than (Das et al. 1983). cytosine or adenine have been disregarded, as such artifactual bands probably arise by the "stuttering" of reverse transcriptase Although all five antitermination factors were re- as it encounters methylated C or A nucleotides. The boxed lists quired for efficient protection of the nut site RNA, we of proteins at the bottom bracket the regions of nutR, which are suspected that NusA and a higher concentration of N protected against RNase M1 by N and NusA and by NusB, S10, might suffice for the protection of boxB because these and NusG (see Fig. 6). proteins suffice for transcription antitermination over short distances, independently of Nus, S10, NusG, and boxA (Whalen et al. 1988; J. Li, R. Horwitz, S. idues in boxA. The most striking enhancements were an adenine adjacent to the critical guanine (Salstrom and Szybalski 1978; Doelling and Franklin 1989) in the loop of boxA (54% enhancement) and two cytosine residues adjacent to the stem of boxB (230% enhancement) whose importance for antitermination is not known. In general, our footprinting data demonstrated that one or more of the antitermination factors must be in close proximity to most of the critical residues of the nutR RNA in N-modified transcription complexes. To test the biological significance of our footprinting experiments, we examined the effect of a guanine-to- adenine mutation in the loop of boxB, which destroys the capacity of the nut site to support antitermination by N in vivo (Salstrom and Szybalski 1978; Doelling and Franklin 1989). The plasmids pYl-1 and pA5-22 (Doel- ling and Franklin 1989), which contain, respectively, functional and nonfunctional synthetic nut sites down- Figure 4. Protection of the nutR site by antitermination fac- stream from a tac promoter, were used to program tran- tors requires the boxB component of the nut site. Ribonuclease scription reactions on which ribonuclease M1 footprint- M1 footprinting was carried out on the RNA in transcription ing was carried out. The reactions contained NusA, reactions programmed with either pYl-1, a plasmid containing a functional nut site, or pA5-22, in which the nut site has been NusB, S10, NusG, and various concentrations of N pro- deactivated by a guanine-to-adenine mutation in the loop of tein (Fig. 4). The activity of ribonuclease M1 was some- boxB. The sequencing lanes show the sequence of the mutant what inhibited in all reactions containing N [lanes 3-6 nut site. The adenine residue marked with an arrow is located in and 9-12). The functional nut site of pYl-1 (lanes 1-6) the loop of boxB and is a guanine in the plasmid pYl-1. Primer was protected almost completely at 58 nM N (95% pro- extension was performed with the oligonucleotide P2, which tection), whereas the nonfunctional nut site of pA-22 hybridizes downstream of the nut site in RNA produced from (lanes 7-12) was not protected even in the presence of either pYl-1 or pA5-22 (Doelling and Franklin 1989). Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

N utilization site is RNA

Figure 5. Antitermination factors required for the efficient protection of the nut site RNA. Ribonuclease M1 footprinting was performed on the RNA in transcription reactions programmed with pLS-1 and containing the indicated combinations of the antitermination factors NusA, NusB, S10, NusG, and N. (A) The effect of individually omitting one of the antitermination factors from the reaction. (B) The result of replac- ing wild-type NusA with the NusA1 mutant protein (Friedman and Baron 1974) in the presence of the other proteins. The oligonucleotide JN-1 was used for primer extension in the experiments shown in A and B.

McCracken, and J. Greenblatt, in prep.). When the con- the weak protection of boxB and several linker nucle- centration of N protein was varied in the presence of otides just upstream of it by N and NusA was not af- a constant amount of NusA, the boxB stem-loop and fected by the absence of a boxA sequence. Again, this the nucleotides UUC immediately upstream of it were protection was most evident by comparing lanes 14 and weakly protected against ribonuclease M1 (Fig. 6A, lanes 18 (150 nM N)with lanes 11 and 15 (no N). These results 2-5; see Fig. 3). This protection depended on the concen- suggested that in N-modified transcription complex, N tration of N and was most evident by comparing lane 5 and NusA are associated with boxB while NusB, S10, (150 nM N) with lane 2 (no N). The presence of NusB, and NusG are associated with nut site nucleotides 5' to S10, and NusG in the reaction extended the protected boxB. region to include the rest of the nut site (lanes 6--9). To quantitate the data shown in ' Figure 6A, densito- Furthermore, the addition of these factors stabilized metric scans of the autoradiograph were carried out. We the complex such that protection of the nut site was independently summed the densities of the three ribo- evident even at an N concentration of only 38 riM. When nuclease M1 cleavage bands in the core boxA sequence identical footprinting reactions were carried out on of pLS-1, the three replacement bands in the linker insert the RNA in transcription reactions programmed with in pLS-9, and the two prominent bands in boxB. Each the plasmid pLS-9, in which the nucleotides between sum was normalized to the density of the reverse tran- the 5' end of boxA and the 5' end of boxB are replaced scription stop at the 3' end of boxB, which is not a site with a linker sequence (Lau and Roberts 1985), boxB was for cleavage by ribonuclease M1. The quantitated data still weakly protected by N and NusA (lanes 11-14). The are presented in Figure 6B. As we had concluded from presence of the proteins NusB, S10, and NusG in the inspection of Figure 6A, the boxA region was protected reaction had no effect or a greatly reduced effect on the only when the boxA sequence was present (upper panel), stability of the protection of boxB and did not extend the and efficient protection of boxA and boxB at a low con- footprint to include the nucleotides of the oligonucle- centration of N required the boxA sequence and all of otide linker (of. lanes 11-14 and 15-18). Furthermore, the factors. Weak protection of boxB could occur when Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

Nodwell and Greenblatt

B 1.1 Protection of boxA

1.0

0.9

"~' 0.8

0.7 u

9-~ 0.6

n- 0.5

0.4

0.3

0.2 9 . , 9 , . , 9 , 9 , 9 , . 0 2() 40 60 80 100 120 140 160 [N] nM 1.1 Protection of boxB 1.0

0.9

"- 0.8

,- 0.7

9~ 0.6

n- 0.5

0.4

0.3

0.2 9 , . , . , 9 , . , . , . , . 0 20 40 60 80 100 120 140 160 [N] nM

Figure 6. The boxA sequence and the elongation factors NusB, S10, and NusG improve the protection of nutR RNA by N and NusA. (A) Ribonuclease M 1 footprinting was carried out on the RNA produced in reactions programmed with either pLS-1, which contains a wild-type nutR site, or pLS-9, in which the nucleotides from the 5' end of boxA to the 5' end of boxB were replaced with a linker (Lau and Roberts 1985). Reactions contained NusA, and various concentrations of N, NusB, S10, and NusG, as indicated. The oligonucleotide JN-1 was used for primer extension. (B) A graphic representation of densitometric scans of the lanes in A. The two most prominent ribonuclease M1 bands in the box B sequence, the three bands in the core boxA sequence, and the three bands at the 3' end of the oligonucleotide linker in pLS-9 were used for quantitation. (B boxA +boxB +, NusA only; (E3) boxA +boxB +, NusA, NusB, S10, NusG; (0) boxA-boxB +, NusA only; (O) boxA- boxB*; NusA, NusB, $10, NusG.

NusA and a high concentration of N were present (lower and 130 nM N (see bands indicated by arrows in lanes panel). 6-9). In contrast, transcription complexes assembled in We were unable to footprint the nut site RNA in re- reactions containing RNA polymerase with the ron mu- actions containing purified RNA and antitermination tation (lanes 4 and 10-13), or with the groN785 mutation factors (data not shown), suggesting that RNA polymer- (lanes 5 and 14-17} did not show efficient protection of ase might play a key role in the assembly of complexes the nut site RNA from ribonuclease M1 or any altered containing the antitermination factors and the nut site reactivity with DMS. Thus the mutations in RNA poly- RNA. There are mutations in the J3 subunit of RNA polymerase affected the binding of elongation factors to the merase, known as ron (Ghysen and Pironio 1972) and nut site RNA. groN785 (Georgopolous 1971), which interfere with antitermination by N in vivo. Ribonuclease M1 and DMS Discussion footprinting experiments were carried out on the RNA in transcription reactions containing these mutant RNA We have demonstrated that the k N protein and the E. polymerase enzymes in the presence of NusA, NusB, coli transcription elongation factors NusA, NusB, S10, S10, and NusG and various concentrations of N protein and NusG assemble into a complex with the nut site of (Fig. 7}. In transcription reactions containing wild-type phage k during transcription in vitro. The formation of RNA polymerase the nut site RNA was protected from this complex is biologically relevant by several criteria: ribonuclease M1 in the presence of 130 nM N (lane 3; It requires the critical guanine residue in the loop of 75% protection). The characteristic effects of N and the boxB (Salstrom and Szybalski 1978; Doelling and Frank- other factors on methylation by DMS were present at 80 lin 1989); it is stabilized by boxA, which is also impor- Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

N utilization site is RNA

Figure 7. Ribonuclease M 1 and DMS footprinting experiments showing the effect of the RNA polymerase mutations ron and groN785 on the ability of N and the host factors to protect the nut site. All reactions contained NusA, NusB, S10, and NusG, and the concentration of N was varied as indicated. The sites where reactivity of the RNA with DMS is enhanced (open arrowheads) or reduced (solid arrowheads) by the presence of N, NusA, NusB, S10, and NusG are indicated. The plasmid pLS-1 was used to program transcription, and the oligonucleotide JN-1 was used for primer extension.

tant for transcription antitermination by N in vivo (O1- the loop of boxB in N-modified transcription complexes son et al. 1982; Robledo et al. 1990); and it is affected by is almost certainly caused by the direct binding of N. mutations in NusA and RNA polymerase that affect an- The boxA component of the nut site is important for titermination in vivo (Friedman and Baron 1974; Geor- the association of NusB and NusG with elongation com- gopolous 1971; Ghysen and Pironio 1972). Therefore, we plexes (Horwitz et al. 1987; J. Li, R. Horwitz, S. Mc- have concluded that the functional nut sites of phage Cracken, and J. Greenblatt, in prep.), and it enables are made of RNA. Our current model for RNA-protein NusB, S10, and NusG to make antitermination by N interactions in N-modified transcription complexes is more processive {J. Li, R. Horwitz, S. McCracken, and J. shown in Figure 8. Greenblatt, in prep.). The protection of the extended The proteins that bind to the nut site RNA cause al- boxA sequence and the effect of this sequence on the tered sensitivity to DMS, suggesting that there are inti- protection of boxB require NusB, S10, and NusG, sug- mate contacts between particular elongation factors and gesting that at least one of these proteins binds directly nucleotides in boxA, in the loop of boxB, and between to the boxA component of the nut site RNA. This is boxA and boxB. The recognition specificity of the N pro- supported by recent in vivo studies showing that RNA teins of the lambdoid bacteriophages is determined by containing a consensus boxA sequence can inhibit tran- nucleotides in the loop of boxB and amino acid residues scription antitermination by N in trans and that this near the amino terminus of N (Lasinski et al. 1989). inhibition can be reversed by the simultaneous overex- Therefore, the altered DMS reactivity of nucleotides in pression of the nusB gene (Friedman et al. 1990). Further- Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

Nodwell and Greenblatt

A B S' S'

11111 I0~ALLL I I I I I IOt~AI I I

1.0~

0.8 84

0.6 84 Figure 8. The association of transcriptional elongation factors

B.F. 9 :::: " " "" "'" ...... i:i.~...... 1 ~ 10"M with the nut site RNA is coordinated by the surface of RNA polymerase. {A) A complete N-modified transcription complex. The critical guanine in the loop of boxB is indicated. (B) An incomplete complex lacking NusB, S10, and NusG. The theo- retical tethering effect of the loop in the nascent RNA on the binding of nut site RNA to the surface of RNA polymerase (see text) is represented graphically in C as the fraction of transcrip- ..... , ,_,.., .... 0 100 200 300 400 SO0 600 700 800 900 1000 tion complexes that are bound to the nut site RNA (B.F.) Bound distance past nut site (nucleotides) fraction. more, an extended boxA sequence directs transcription (Greenblatt and Li 1981b), S10 {Mason and Greenblatt antitermination in the rm operons of E. coli (Berg et al. 1991), and NusG {J. El, R. Horwitz, S. McCracken, and J. 1989), NusB is important for this antitermination (Shar- Greenblatt, in prep.) can bind directly to RNA polymer- rock et al. 1985), and elongating transcription complexes ase, independently of the nut site. Thus, the surface of synthesizing rRNA in vitro contain NusB and NusG (J. RNA polymerase may properly align NusA, $10, and Li, R. Horwitz, S. McCracken, and J. Greenblatt, in NusG so that N and NusB, which bind, respectively, to prep.). NusA and S10, (Greenblatt and Li 1981a; S. Mason and J. The N-dependent binding of antitermination factors to Greenblatt, in prep.) and the nut site RNA can be the nut site RNA probably reflects one mechanism by "captured" shortly after it is transcribed such that the which N prevents transcription termination. The termi- complete complex can form (see Fig. 8A). Once formed, nation factor Rho binds to an RNA site called rutA, the complete complex, containing N, NusA, NusB, S 10, which overlaps the boxA component of nutR and en- and NusG, would be stabilized by the multiple interac- hances the action of Rho at the tR1 terminator (Bektesh tions of the transcription factors with one another, with and Richardson 1980; Lau and Roberts 1985; Faus and RNA polymerase, and with the nut site RNA. The sta- Richardson 1990). We did not use Rho in our experi- bility of the complete complex would then allow it to ments and therefore have shown here that Rho is not remain intact during transcription through many kilo- necessary for the association of antitermination factors bases of DNA. with nut site RNA, but the N-dependent binding of ant- An incomplete complex containing N, NusA, and itermination factors to boxA may prevent the binding of boxB would be less stable because there would be fewer Rho to rutA and, hence, lower the activity of tR1. contacts made with the nut site RNA and fewer contacts Because our footprinting method did not detect any made with the surface of RNA polymerase (see Fig. 8B). binding of antitermination factors to free nut site RNA, However, such a complex would be transiently stabi- each of the individual RNA-protein interactions must lized by the high local concentration of nut site RNA, be quite weak. Moreover, the surface of RNA polymerase which would exist relative to the transcription complex must have a critical role in assembling the protein-RNA immediately following its transcription. In effect, the complex because mutations in the ~ subunit of RNA catalytic center of RNA polymerase would hold the nut polymerase inhibit the formation of the complex. We site on a tether, forcing it to remain close to the site believe that this can be explained in two ways: protein where NusA binds to RNA polymerase. As the length of coordination by the surface of RNA polymerase; and the the RNA chain separating the nut site from RNA poly- "tethering" of the nut site to the transcription complex merase increased during chain elongation, the concen- by the growing RNA chain (see Fig. 8). tration of nut site RNA relative to the transcription com- The coordinating effect of the surface of RNA poly- plex would decrease, ultimately leading to the dissocia- merase may reflect its interaction with antitermination tion of the complex. This phenomenon could quite factors. Work in our laboratory has shown that NusA naturally explain why antitermination by N and NusA Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

N utilization site is RNA persists for only a short distance downstream from a nut strain (J. Li, R. Horwitz, S. McCracken, and J. Greenblatt, in site (J. Li, R. Horwitz, S. McCracken, and J. Greenblatt, prep.). in prep.). All plasmids were purified by alkaline lysis, followed by CsC1 If there were no interference by other molecules in the gradient ultracentrifugation, pLS-1 and pLS-9 were described by Lau and Roberts (1985). pYl-1 and pA5-22 were described by cell, the relationship between the length of the tethering Doelling and Franklin (1990). The oligonucleotide primers RNA chain and the binding of the nut site RNA to the JN- 1 (TGCATACACCATAGGTGTGG) and JL- 1 (CGTAGAC- elongating transcription complex should be mathemati- CTCGTTGC), which were used for primer extension with RNA cally similar to the effect of the length of a linear DNA produced from the plasmids pLS-1 and pLS-9, were purchased molecule on the likelihood of its circularization. Thus, from Allelix Corporation (Toronto). The primer P2 (GCCAGT- the concentration of nut site RNA in the vicinity of the GCAATAGTGCTTTG), which was used for primer extension transcription complex would be defined by the following with RNA produced from the plasmids pYl-1 and pA5-22, was equation (Wang and Davidson 1966): provided by Dr. Naomi Franklin and purified by gel electrophoresis. 3 Ribonucleases M1 and V1, AMV reverse transcriptase, T4 1 polynucleotide kinase, and placental ribonuclease inhibitor ( t Ao were purchased from Pharmacia. DMS was purchased from Sigma. where 1 is the contour length of the intervening RNA chain as given the product of the number of nucleotides Transcription in vitro and footprinting and 3.4 A (the average internucleotide distance), Ao is Avogadro's constant, and b is the statistical segment The 40-~1 reactions containing RNA polymerase holoenzyme length of RNA in solution (Wang et al. 1968). The value (70 riM); 60 ~g/ml of purified plasmid DNA; 45 ~g/ml of yeast of b for poly(rU) in solution is 40 A (Inners and Felsenfeld tRNA; 0.5 mM each of ATP, GTP, and UTP, 80 mM HEPES (pH 7.3), 20 mM potassium acetate; 15 mM (NH4)2SO4, and 10 mM 1970; Record et al. 1981), but the value of b for a growing MgSO4 were incubated in the presence or absence of 670 nM mRNA chain might be >40 A because it would have NusA, 400 nM NusB, 330 nM S10, 180 nM NusG, and 100 nM N structural features that could make it less flexible. The (unless otherwise indicated in the figure legends) for 3 rain at fractions of elongating transcription complexes that are 37~ CTP and rifampicin were then added to 0.5 mM and 10 bound to the nascent nut site RNA (B.F.) would be given fxg/ml, respectively. After 1 min of chain elongation, 2.5 units of by the following equation: RNase M1, 0.2 units of RNase V1, or 5 Ixl of DMS {diluted fourfold in 95% ethanol) was added. After an additional 1 min of 1 incubation at 37~ the reactions were extracted with 20 ~1 of B.F.- Kd phenol (Tris-C1 buffered to pH 8) and 20 txl of chloroform/ ~+1 isoamyl alcohol (20 : 1). RNA was recovered from 40 txl of the [nut] aqueous phase by precipitation with three volumes of 98% ethanol. where K d is the (unknown) dissociation constant of the critical intermolecular interaction. This relationship is illustrated graphically in Figure 8C for various values of Time-course transcription experiments Kd. According to this calculation, the critical RNA-pro- Transcription was initiated in a 40-~1 reaction with the same tein or protein-protein interaction in a transcription composition as the footprinting reactions. Following the addi- complex containing N, NusA, and boxB, which cannot tion of rifampicin and CTP, 6 }xl aliquots were removed at var- support transcription antitermination at 1 values much ious time points mixed with 50 ~xl of 40 mM EDTA, 0.1% SDS, greater than 200 nucleotides (J. Li, R. Horwitz, S. extracted with 20 ~1 of phenol and 20 ~1 of chloroform/isoamyl McCracken, and J. Greenblatt, in prep.), would have a alcohol (20 : 1), and precipitated with 3 volumes of ethanol. The dissociation constant of -10-4 M (or lower if b is >40 A). pellets were resuspended in 45 Ixl of primer extension buffer; 20-~1 aliquots of this buffer were then used for primer extension The complete complex, which can support transcription with 32P-labeled JL-1 (Fig. 1B) or JN-1 (Fig. 1C). The primer antitermination in the rightward operon of h at least as extension products were run on 50% urea, 11% acrylamide, and far as the R gene >8000 bp downstream from nutR 0.37% bis-acrylamide gel at 300 V until the xylene cyanol had (Dambly and Couturier 1971; Greenblatt 1972), would run -6 cm. The gel was fixed, dried, and autoradiographed in have a dissociation constant of ~<10 -6 M. In both cases, the same manner as the sequencing gels. the influence of the tethering RNA chain on the initial formation of the complex would be sufficient to explain Primer extension, RNA sequencing, electrophoresis, and why the nut site must be in the nascent transcript to be densitom etry bound by the antitermination factors. Primers were labeled in 50-~1 reactions containing 20 pmoles of oligonucleotide primer, 50 mM Tris-C1 {pH 7.6), 10 mM MgCI~, 5 mM DTT, 50 IxCi of [~/-gzP]ATP (3000 Ci/mmole; New En- Materials and methods gland Nuclear) and 1 unit of polynucleotide kinase for 30 rain at RNA polymerase was purified by the method of Burgess and 37~ The polynucleotide kinase was deactivated by adding 2 ~1 Jendrisak {1975). N, NusA, and NusB were purified as previ- of 0.5 M EDTA (pH 8) to the reaction, incubating at 80~ for 10 ously described (Greenblatt et al. 1980, 1981 a; Greenblatt 1984; min and chilling on ice. Swindle et al. 1988}. Purified S10 was generously provided by A 20-~1 aliquot of a primer extension mix containing 40 Dr. Volker Nowotny. NusG was purified from an overproducer fmoles of g2P-labeled primer, 1 mM each of dATP, dTTP, dGTP, Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

NodweU and Greenblatt and dCTP, 20 mM HEPES (pH 8.3 at 50~ 80 mM KC1, 10 mM Dambly, C. and M. Couturier. 1971. A minor Q-independent MgC12, and 0.1 unit/~l of placental ribonuclease inhibitor (RNa- pathway for the expression of the late genes in bacteriophage sin) was added to each RNA pellet. The primer was annealed to lambda. Mol. Gen. Genet. 113: 244-250. the RNA for 5 min at 50~ Primer extension was initiated by Das, A. and K. Wolska. 1984. Transcription antitermination in adding 15 units of AMV reverse transcriptase. The reaction was vitro by lambda N gene product: Requirement for a phage incubated at 50~ for 1 hr and stopped by precipitating the nu- nut site and the product of host nusA, nusB and nusE genes. cleic acids with 3 volumes of 98% ethanol. Cell 38: 165-173. Parallel dideoxy sequencing reactions were performed on Das, A., M.E. Gottesman, I. Wardwell, P. Trisler, and S. Gottes- RNA extracted from transcription reactions that were not di- man. 1983. A mutation in the Escherichia coli rho gene that gested with RNase or methylated with DMS. They contained inhibits the N protein activity of phage lambda. Proc. Natl. the RNA pellet from one transcription reaction, 0.2 mM each of Acad. Sci. 80: 5530-5534. dATP, dTTP, dGTP, and dCTP, 40 fmoles of 32P-labeled oligo- Doelling, J. and N. Franklin. 1989. Effects of all single base nucleotide primer, 20 mM HEPES {pH 8.3 at 50~ 80 mM KC1, substitutions in the loop of boxB on antitermination by bac- 10 mM MgC12, 10 ~.m ddNTP (one per reaction), and 0.1 U/p.l of teriophage lambda's N protein. Nucleic Acids Res. 17: 5565- RNasin. Annealing of the primer and primer extension were 5577. performed as for the footprinting reactions. Nucleic acids from Faus, I. and J.P. Richardson. 1990. Structural and functional the primer extension and sequencing reactions were dissolved properties of the lambda cro mRNA that interact with the in 10 ~1 of 95% deionized formamide, 0.05% bromphenol blue, transcription termination factor Rho. J. Mol. Biol. 212: 53- and 0.05% xylene cyanol, incubated in a boiling water bath for 66. 5 min, and chilled on ice. A 4-~1 aliquot of each reaction was Franklin, N.C. 1974. Altered reading of genetic signals fused to electrophoresed at 2000 V on a 50% urea, 11% acrylamide, the N operon of bacteriophage lambda: Genetic evidence for 0.37% bis-acrylamide gel until the xylene cyanol had migrated the modification of polymerase by the protein product of the -20 cm. The gel was fixed in 15% methanol and 15% acetic N gene. J. Mol. Biol. 89: 33--48. acid and dried, and autoradiography was carried out for 12-36 hr Friedman, DT and L.S. Baron. 1974. Genetic characterization of with Kodak XAR-5 film. Densitometric scans of all autoradio- a bacterial locus involved in the activity of the N function of graphs were prepared by using the Abaton Scan 300/GS. Densi- phage lambda. Virology 58: 141-148. tometric data was analyzed by using the Image 1.33f program on Friedman, D.I., G.S. Wilgus, and R.J. Mural. 1973. Gene N reg- a Macintosh 1 lsi computer. ulator function of phage lambda imm21 : Evidence that a site of N action differs from a site of N recognition. J. Mol. Biol. 81: 505-516. Friedman, D.I., M. Baumann, and L.S. Baron. 1976. Cooperative effects of bacterial mutations affecting lambda N gene ex- Acknowledgments pression. I. Isolation and characterization of a nusB mutant. We thank Dr. Volker Nowotny for generously providing us with Virology 73:119-127. purified S10 protein; Dr. Naomi Franklin for providing us with Friedman, D.I., A.T. Schauer, M.R. Baumann, L.S. Baron, and the plasmids pYl-1, pA5-22, and the primer P2; and Dr. Jacque- S.L. Adhya. 1981. Evidence that ribosomal protein S10 par- line Segall for critically reviewing this manuscript. This work ticipates in the control of transcription termination. Proc. was supported by the Medical Research Council of Canada. Natl. Acad. Sci. 78: 1115-1118. The publication costs of this article were defrayed in part by Friedman, DT, E.R. Olson, L.L. Johnson, D. Alessi, M.G. Cra- payment of page charges. This article must therefore be hereby ven. 1990. Transcription-dependent competition for a host marked "advertisement" in accordance with 18 USC section factor: The function and optimal sequence of the phage k 1734 solely to indicate this fact. boxA transcription antitermination signal. Genes & Dev. 4: 2210-2222. Georgopoulos, C.P. 1971. A bacterial mutation affecting N function. In The bacteriophage lambda led. A.D. Hershey), References pp. 639-645. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Adhya, S., M. Gottesman, and B. de Crombrugghe. 1974. Re- Ghysen, A. and M. Pironio. 1972. Relationship between the N lease of polarity in E. coli by gene N of phage g: Termination function of bacteriophage lambda and host RNA polymer- and antitermination of transcription. Proc. Natl. Acad. Sci. ase. I. Mol. Biol. 65: 259-272. 71: 2534-2538. Greenblatt, J. 1972. Positive control of endolysin synthesis in Barik, S., B. Ghosh, W. Whalen, D. Lasinski, and A. Das. 1987. vitro by the gene N protein of phage lambda. Proc. Natl. An antitermination protein engages the elongating tran- Acad. Sci. 69: 3606-3610. scription apparatus at a promoter proximal recognition site. --. 1984. Regulation of transcription termination in E. coll. Cell 50: 885-899. Can. ]. Biochem. Cell. Biol. 62: 79-88. Bektesh, S.L. and J.p. Richardson. 1980. A gho recognition site Greenblatt, J. and J. Li. 1981a. The nusA gene product of Esch, on the phage lambda cro-gene mRNA. Nature 283: 102-104. erichia coli; its identification and a demonstration that it Berg, K.L., C.L. Squires, and C. Squires. 1989. Ribosomal RNA interact with gene N transcription antitermination protein operon antitermination: Function of leader and spacer region of bacteriophage lambda. J. Mol. Biol. 147:11-23. boxB-boxA sequences and their conservation in diverse mi- --. 198 lb. Interaction of the sigma factor and the nusA gene croorganisms. 1. Mol. Biol. 209: 345-358. protein of E. coli with RNA polymerase in the initiation- Burgess, R.R. and J.J. Jendrisak. 1975. A procedure for the rapid, termination cycle of transcription. Cell 24: 421-428. large-scale purification of Escherichia coli DNA-dependent Greenblatt, J., P. Malnoe, and J. Li. 1980. Purification of the gene RNA polymerase involving polymin P precipitation and N transcription antitermination protein of bacteriophage DNA-cellulose chromatography. Biochemistry 14: 4634- lambda. J. Biol. Chem. 255: 1465-1470. 4638. Horwitz, R.J., J. Li, and J. Greenblatt. 1987. An elongation con- Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

k N utilization site is RNA

trol particle containing the N gene transcription antitermination protein of bacteriophage lambda. Cell 51" 631-641. Inners, L.D. and G. Felsenfeld. 1970. Conformation of polyu- ridylic acid in solution. J. Mol. Biol. 50: 373-389. Keppel, F., C. Georgopoulos, and H. Eisen. 1974. Host interference with expression of the lambda N gene product. Bio- chimie 56: 1503-1509. Lasinski, D., E. Grzadzielska, and A. Das. 1989. Sequence-specific recognition of RNA hairpins by bacteriophage antiter- minators requires a conserved arginine-rich motif. Cell 59: 207-218. Lau, L.F. and l.W. Roberts. 1985. Rho-dependent transcription termination at tR1 requires upstream sequences. ]. Biol. Chem. 260: 574-584. Mason, S. and I. Greenblatt. 1991. Assembly of transcription elongation complexes containing the N protein of phage h and the Escherichia coli elongation factors NusA, NusB, NusG, and $10. Genes & Dev. 5: 1504-1512. Morgan, E.A. 1986. Antitermination mechanisms in rRNA operons of Escherichia coll. J. Bacteriol. 168: 1-5. Olson, E.R., E.R. Flamm, and D.I. Friedman. 1982. Analysis of nutR: A region of phage lambda required for antitermination of transcription. Cell 31- 61-70. Peltz, S.W., A.L. Brown, N. Hasan, A.J. Podhajska, and W. Szy- balski. 1985. Thermosensitivity of a DNA recognition site: Activity of a truncated nutL antiterminator of coliphage lambda. Science 228: 91-93. Record, M.T. Jr., S.J. Mazur, P. Melancon, J.-H. Roe, S.L. Shaner, and L. Unger. 1981. Double helical DNA conformations, physical properties, and interactions with ligands. Annu. Rev. Biochem. 50: 997-1024. Robledo, R., M.E. Gottesman, and R.A. Weisburg. 1990. Lambda nutR mutations convert HK022 Nun protein from a transcription termination factor to a suppressor of termination. J. Mol. Biol. 212: 635-643. Rosenberg, M., D. Court, H. Shimatake, C. Brady, and D.L. Wulff. 1978. The relationship between function and DNA sequence in an intercistronic regulatory region in phage lambda. Nature 272: 414--423. Salstrom, J.S. and W. Szybalski. 1978. Coliphage lambda nutL-: A unique class of mutants defective in the site of gene N product utilization for antitermination of leftward transcription. J. Mol. Biol. 124: 195-221. Sharrock, R.A., R.L. Gourse, and M. Nomura. 1985. Defective antitermination of rRNA transcription and derepression of rRNA and tRNA synthesis in the nusB5 mutant of E. coli. Proc. Natl. Acad. Sci. 82: 5275-5279. Swindle, J., M. Zylicz, C. Georgopoulos, J. Li, and J. Greenblatt. 1988. Purification and properties of the NusB protein of Escherichia coli. J. Biol. Chem. 263: 10229-10235. Wang, J.C. and N. Davidson. 1966. Thermodynamic and kinetic studies on the interconversion between the linear and circu- lar forms of phage lambda DNA. ]. Mol. Biol. 15:111-123. Warren, F. and A. Das. 1984. Formation of termination-resistant transcription complex at phage lambda nut locus: Effects of altered translation and a ribosomal mutation. Proc. Natl. Acad. Sci. 81: 3612-3616. Whalen, W., B. Ghosh, and A. Das. 1988. NusA protein is necessary and sufficient in vitro for phage lambda N gene product to suppress a Rho-independent terminator placed downstream of nutL. Proc. Natl. Acad. Sci. 85: 2494-2498. Zuber, M., T.A. Patterson, and D.L. Court. 1987. Analysis of nutR, a site required for transcription antitermination in phage lambda. Proc. Natl. Acad. Sci. 84: 4514--4518. Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press

The nut site of bacteriophage lambda is made of RNA and is bound by transcription antitermination factors on the surface of RNA polymerase.

J R Nodwell and J Greenblatt

Genes Dev. 1991, 5: Access the most recent version at doi:10.1101/gad.5.11.2141

References This article cites 41 articles, 15 of which can be accessed free at: http://genesdev.cshlp.org/content/5/11/2141.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the top Service right corner of the article or click here.