Riboswitch-Targeted Drug Discovery: Investigation of Factors That Affect the T Box

Riboswitch-targeted Drug Discovery: Investigation of Factors that Affect the T Box

Transcription Antitermination Mechanism

A dissertation presented to

the faculty of

the College of Arts and Sciences of Ohio University

In partial fulfillment

of the requirements for the degree

Doctor of Philosophy

Chunxi Zeng

April 2016

This dissertation titled

Riboswitch-targeted Drug Discovery: Investigation of Factors that Affect the T Box

Transcription Antitermination Mechanism

CHUNXI ZENG

has been approved for

the Department of Chemistry and Biochemistry

and the College of Arts and Sciences by

Jennifer V. Hines

Professor of Chemistry and Biochemistry

Robert Frank

Dean, College of Arts and Sciences 3

ABSTRACT

ZENG, CHUNXI, Ph.D., April 2016, Molecular and Cellular Biology

Riboswitch-targeted Drug Discovery: Investigation of Factors that Affect the T Box

Transcription Antitermination Mechanism

Director of Dissertation: Jennifer V. Hines

The T box riboswitch is a regulation mechanism at the level of transcription or translation which controls expression of amino acids related genes, including a lot of essential genes, in many bacteria. The T box riboswitch interacts with cognate tRNAs and senses their aminoacylation status. A charged cognate tRNA allows formation of the thermodynamically more stable terminator structure which induces transcription termination. An uncharged tRNA stabilizes the alternative antiterminator structure and prevents formation of the terminator. Transcription proceeds and leads to expression of the downstream gene(s). The T box riboswitch is a novel and promising drug target since multiple genes essential to bacterial survival are regulated by this mechanism in many pathogenic bacteria.

In order to further study the T box riboswitch mechanism and screen a synthetic ligands library, a fluorescently monitored multi-round in vitro antitermination assay with an enhanced throughput was successfully developed and comprehensively evaluated.

Using this assay, the effects of molecular crowding, spermidine and DMSO on the T box riboswitch function were studied and 304 ligands were screened. A total of nine ligands showed specific inhibition to the tRNA-induce antitermination. Combining melting 4 temperature analysis and structural probing, the binding of spermidine to the antiterminator was also characterized. 5

DEDICATION

To my beautiful wife, Weijun Meng and my little angles, Molly and Max. 6

ACKNOWLEDGMENTS

I would like to express my great gratitude to my advisor, Dr. Jennifer V. Hines.

The enclosed research and this dissertation would not be possible without her essential guidance and support. I would like to thank Dr. Stephen C. Bergmeier and his lab members, Dr. George Acquaah-Harrison, Dr. Crina M. Orac and Dr. Weihe Zhang,

Rumita Laha, Ian Armstrong, for providing all the synthetic ligands for this research. I would like to give special thanks to Dr. Xiaozhuo Chen for his support in the Molecular and Cellular Biology Program and his guidance when I encountered difficulties during coursework. I would like to thank Dr. Shiyong Wu for being my committee member and providing valuable insights for my research. I would like to thank Dr. Shu Zhou for teaching me many important lab skills when I first joined the lab. Her preliminary work also paved the way for this research. I would like to thank Vivian Hogan for her assistance to improve the tRNA purification method. I thank the Molecular and Cellular

Biology Program and the Department of Chemistry and Biochemistry for providing me financial support. And I want to thank all the lab colleagues, Dr. Shu Zhou, Jia Liu, Ali

Al-Dhumani, Vivian Hogan, Jacob Sieg for helpful research discussions.

My great appreciation goes to my wife, Weijun Meng, who spent tremendous amount of time to take good care of our children and me. I also want to thank my parents and my parents-in-law for giving financial support to my family.

TABLE OF CONTENTS

Page

Abstract ...... 3 Dedication ...... 5 Acknowledgments...... 6 List of Tables ...... 11 List of Figures ...... 12 List of Abbreviations ...... 15 Chapter 1. Introduction ...... 18 1.1 RNA Structure...... 18 1.2 Folding of RNA ...... 18 1.2.1 Folding Kinetics ...... 18 1.2.2 Folding Thermodynamics ...... 21 1.2.3 Factors Affecting RNA Folding ...... 22 1.3 Bacteria and Antibiotics ...... 25 1.3.1 Pathogenic Bacteria...... 26 1.3.2 Current Antibiotics ...... 26 1.4 Riboswitch ...... 31 1.4.1 Riboswitches in General ...... 31 1.4.2 Classification of Riboswitch ...... 32 1.4.3 Factors Affecting Riboswitch Function ...... 33 1.4.4 Riboswitches as Drug Targets ...... 34 1.5 The T box Riboswitch ...... 35 1.5.1 Discovery of the T Box Riboswitch ...... 35 1.5.2 T box Riboswitch in Bacillus Subtilis glyQS Gene ...... 36 1.5.3 The Natural Ligand of The T box Riboswitch: tRNA ...... 45 1.5.4 T box Riboswitch as a Drug Target ...... 47 1.5.5 Transcription Termination ...... 48 1.6 Principle of Experimental Methods ...... 50 1.6.1 Fluorescence Resonance Energy Transfer ...... 50 8

1.6.2 Fluorescence Quenching ...... 51 1.6.3 Molecular Beacon ...... 51 1.6.4 In Silico Prediction of Nucleic Acid Folding and Hybridization ...... 52 1.6.5 Fluorescence-monitored Thermal Denaturation Analysis ...... 53 1.6.6 Radioisotopic Labeling of RNA by 32P...... 54 1.6.7 Autoradiography ...... 54 1.6.8 In-line Probing of RNA Structure ...... 55 1.6.9 Enzymatic Probing of RNA Structure ...... 56

1.6.10 EC50, IC50 and Kd ...... 57 Chapter 2. Development of the Fluorescently-monitored Antitermination Assay ...... 59 2.1 Scheme of the Assay Mechanism ...... 59 2.2 Design of Probes ...... 60

2.2.1 Terminator Probes: TERprbRNA, TERprbDNA, TERprbCHIM ...... 61

2.2.2 Readthrough Probe: RTprb ...... 63

2.2.3 Upstream Probe: UPprb ...... 71 2.3 Evaluation and Optimization of the Assay ...... 76 2.3.1 Melting Curves and Preliminary Tests of the Probes ...... 76

2.3.2 Structural Integrity and Fluorophore Photostability of the Probes...... 87 2.3.3 Target Sensitivity of the Probes ...... 88 2.3.4 Optimize RNAP Concentration ...... 91 2.3.5 Selection of the Background Control ...... 92

2.3.6 Multiplexing of TERprbCHIM and RTprb ...... 95 2.3.7 Insufficient tRNA Folding can be Tolerated in this Assay ...... 96 2.3.8 Specific Recognition of tRNAGly ...... 98 Gly 2.3.9 Apparent Affinity (EC50) of tRNA in this Assay ...... 100 2.3.10 Nonspecific Enhancement of Fluorescence ...... 103 2.3.11 Determination of the Resolution of the Assay ...... 106 2.3.12 Determination of the Limiting Factor ...... 108 2.3.13 Effect of Ambient Temperature Variation ...... 112 2.3.14 Improve tRNA Yield in the Purification Process ...... 113 Chapter 3. Study the T Box Riboswitch Mechanism and Ligand Inhibition ...... 115 9

3.1 Possible Equilibrium between Antiterminator and Terminator Structures ...... 115 3.2 Effect of Molecular Crowding on the T Box Riboswitch ...... 116 3.3 Effect of DMSO on the T box Riboswitch Antitermination ...... 120 3.4 Characterization of Spermidine Binding to the glyQS Antiterminator ...... 124 3.4.1 Effect of Spermidine on the AM1A Stability ...... 124

3.4.2 Determination of the EC50 of Spermidine on the Antitermination Assay...... 125 3.4.3 Determine Binding Site of Spermidine to the Antiterminator ...... 128 3.5 Investigating the Putative Unknown Factor(s) ...... 132 3.6 Screening for Ligands that Target the T Box Riboswitch ...... 135 3.6.1 Determine Ligand Screening Condition and Data Analysis Method ...... 135 3.6.2 Detection of Nonspecific Inhibition to the Transcription Mechanism ...... 137 3.6.3 Screening of Small Molecule Libraries ...... 140 3.6.4 Self-fluorescence of Synthetic Ligands ...... 141 3.6.5 Screening of Aminoglycosides ...... 141 Chapter 4. Discussion and Conclusion ...... 147 4.1 Development of the Fluorescently Monitored Antitermination Assay ...... 147 4.2 Study the T box Riboswitch Mechanism ...... 149 4.3 Ligand Screening Cascade ...... 151 4.4 Identify Lead Compounds ...... 153 4.5 Future Work ...... 156 Chapter 5. Materials and Methods ...... 158 5.1 General Procedure ...... 158 5.2 Sources and Storage Conditions ...... 158 5.3 Preparation of T7 RNAP ...... 160 5.4 Cloning of Plasmid Containing DNA Templates ...... 160 5.5 DNA Amplification ...... 161 5.5 Preparation of tRNA ...... 163 5.5.1 In Vitro Synthesis of tRNA by Transcription ...... 163 5.5.2 Purification of tRNA ...... 163 5.6 Determination of Nucleic Acid Concentration ...... 164 5.7 In Vitro Transcription Antitermination Assay ...... 165 10

5.7.1 Materials ...... 165 5.7.2 Prediction of Folding Stability of the Probes ...... 167 5.7.3 Prediction of the Probe/target Hybridization ...... 168 5.7.4 Prediction of 2nd structure of the glyQS mRNA leader region ...... 168 5.7.5 Binding Site Specificity Check ...... 169 5.7.6 Optimization of Excitation, Emission and Cutoff ...... 169 5.7.7 Testing of the probes with target sequences ...... 171 5.7.8 Assay Procedure ...... 172 5.7.9 Data Analysis ...... 174 5.8 Fluorescence Monitored Thermal Denaturation Analysis of probes ...... 176 5.9 Structural Probing ...... 177 5.9.1 Labeling of AM1A at the 5' End ...... 177 5.9.2 In-line Probing ...... 178 5.9.3 Enzymatic Probing ...... 179 5.9.4 Autoradiography ...... 180 5.9.5 Analysis of Film Image ...... 180 Bibliography ...... 182 Appendix 1: DNA Templates for Transcription ...... 196 Appendix 2: Test Screening Ligands at 25°C and 28°C ...... 197 Appendix 3: Screening of Aminoglycoside at 25°C and 28°C ...... 198 Appendix 4: Ligand Screening Results in the tRNA-induced Reactions ...... 199 Appendix 5: Ligand Screening Results in Basal Level Reactions ...... 217 Appendix 6: Ligand Screening Results in Transcription Control Reactions ...... 224 Appendix 7: Self-fluorescence of Ligands ...... 231

LIST OF TABLES

Page

Table 2.1 Folding of the DNA equivalent sequence of RTprb predicted by Mfold...... 69

Table 2.2 Hybridization of the DNA equivalent sequence of RTprb with the target predicted by Hyther...... 69

Table 2.3 Thermodynamic properties of the two dominant UPprb conformations predicted by Mfold...... 75

Table 2.4 The UPprb-target hybridization predicted by Hyther...... 75

Table 2.5 Z' factors of the two experimental conditions...... 107

Table 2.6 The yield of tRNA after the soak-shake elution and the electroelution...... 114

Table 2.7 The yield of tRNA from ethanol precipitation and centrifugal filter unit...... 114

Table 3.1 Z' factor of the assay in the presence of various percent of DMSO ...... 123

Table 3.2 GHB-56 showed inconsistent screening results...... 142

Table 3.3 GHB-54 showed inconsistent screening results...... 145

Table 5.1 The primers used for amplification of the desired DNA templates...... 162

Table 5.2 The extinction coefficients of the nucleic acids used ...... 165

Table 5.3 The extinction coefficients of the constructs obtained from TriLink ...... 165

LIST OF FIGURES

Page

Figure 1.1 The primary structure of RNA...... 19

Figure 1.2 Secondary and tertiary structural motifs of RNA ...... 20

Figure 1.3 The rugged energy landscape of RNA folding...... 22

Figure 1.4 Structure of the Bacillus subtilis glyQS T box riboswitch ...... 38

Figure 1.5 Scheme of the global conformation of the tRNA-T box complex ...... 43

Figure 1.6 Sequences and structures of three antiterminators...... 45

Figure 1.7 Structure of tRNAs...... 46

Figure 1.8 Mechanism of RNA in-line cleavage ...... 56

Figure 2.1 Mechanism scheme of the in vitro transcription antitermination assay ...... 60

Figure 2.2 Secondary structure of the five molecular beacon probes ...... 65

Figure 2.3 Spectra of all fluorophores and quenchers used by the probes...... 65

Figure 2.4 Representative glyQS leader mRNA 2nd structure predicted by Mfold ...... 66

Figure 2.5 Melting curve of the RNA terminator probe: TERprbRNA ...... 78

Figure 2.6 Melting curve of the DNA terminator probe: TERprbDNA ...... 79

Figure 2.7 TERprbDNA transcribed by RNAP independent of promoter ...... 81

Figure 2.8 Melting curve of the chimeric terminator probe: TERprbCHIM ...... 83

Figure 2.9 Preliminary use of TERprbCHIM to monitor the antitermination...... 84

Figure 2.10 Melting curve of the chimeric readthrough probe: RTprb...... 85

Figure 2.11 Preliminary use of RTprb to monitor the T box riboswitch antitermination .. 86

Figure 2.12 Incubation of TERprbCHIM with the target sequence (TERseq) ...... 89 13

Figure 2.13 Incubation of RTprb with the target sequence (RTseq) ...... 90

Figure 2.14 Sensitivity of UPprb to the target sequence (UPseq) ...... 91

Figure 2.15 Reducing RNAP consumption ...... 93

Figure 2.16 Comparison of three background controls ...... 95

Figure 2.17 Multiplexing TERprbCHIM and RTprb ...... 96

Figure 2.18 Comparison of two tRNAGly folding protocols ...... 98

Figure 2.19 Specific recognition of tRNAGly by glyQS T box riboswitch ...... 99

Gly Figure 2.20 EC50 of tRNA when using 0.05U/µL or 0.02U/µL RNAP...... 102

Gly Figure 2.21 The unexpected interaction between RTprb and tRNA ...... 105

Gly Figure 2.22 Testing the interaction of RTprb with two analogs of tRNA ...... 105

Gly Figure 2.23 Prediction of the interaction between tRNA and RTprb by DINAmelt. ... 106

Figure 2.24 Determination of the limiting factor ...... 110

Figure 2.25 Stability of tRNAGly, RNAP and NTPs in the assay ...... 111

Figure 2.26 Effect of ambient temperature variation on the control reactions ...... 113

Figure 3.1 Possible equilibrium between the antiterminator and terminator...... 116

Figure 3.2 Effect of molecular crowding mimicked by PEG8000...... 118

Figure 3.3 Effect of molecular crowding mimicked by 5% of PEG...... 119

Figure 3.4 Effect of 5% PEG on the sensitivity of RTprb to the target sequence ...... 119

Gly Figure 3.5 Effect of 5% PEG on the EC50 of tRNA ...... 120

Figure 3.6 Effect of 0%, 2% and 5% DMSO on the assay ...... 121

Figure 3.7 Effect of 5% (v/v) DMSO on the RTprb sensitivity to the target sequence .... 122

Figure 3.8 Effect of 5% (v/v) DMSO on the assay ...... 122 14

Gly Figure 3.9 Effect of 5% (v/v) DMSO on the EC50 of tRNA ...... 123

Figure 3.10 Effect of spermidine on the stability of AM1A...... 125

Figure 3.11 EC50 of spermidine in the assay...... 127

Figure 3.12 In-line probing of 32P-AM1A with spermidine ...... 129

Figure 3.13 RNase T1 probing of the 32P-AM1A with spermidine ...... 130

Figure 3.14 RNase T1 probing of the 32P-AM1A with spermidine and tRNAGly ...... 131

Figure 3.15 Investigation of the effect of amino acids on the T box riboswitch...... 134

Figure 3.16 Comparison of screening conditions and analysis methods...... 138

Figure 3.17 Scheme of the transcripts control DNA template...... 140

Figure 3.18 Determination of the transcription control DNA template concentration ... 140

Figure 3.19 Results of the 11 ligands from all the three screening steps...... 144

Figure 3.20 Neomycin induced specific enhancement to tRNA-induced readthrough. . 146

LIST OF ABBREVIATIONS

MRSA Methicillin-Resistant Staphylococcus Aureus

HIV-1 Human Immunodeficiency Virus-1

TAR RNA Trans-activation Responsive RNA

Tat protein Trans-activating protein

RRE RNA Rev responsive element RNA

TPP Thiamine Pyrophosphate

FMN Flavin Mononucleotide

RNAP RNA polymerase tyS tyrosyl-tRNA synthetase glyQS glycyl-tRNA synthetase

5' UTR 5' untranslated region

K turn Kink turn

NMR Nuclear Magnetic Resonance

FRET Fluorescence Resonance Energy Transfer

LNA Locked Nucleic Acid

EC50 50% Effective Concentration

IC50 50% Inhibitory Concentration

Kd Dissociation Constant

FAM carboxyfluorescein

BLAST Basic Local Alignment Search Tool 16

NCBI National Center for Biotechnology Information

ΔG Change of Free Energy

ΔH Change of Enthalpy

ΔS Change of Entropy

Tm Melting Temperature

Frel Relative Fluorescence

NTP Nucleotide Triphosphate

RFU Relative Fluorescence Unit

DTT Dithiothreitol

DINAmelt DI-Nucleic Acid hybridization and melting prediction tool

DDI H2O Distilled De-Ionized H 2O

DMSO Dimethyl Sulfoxide

PEG Polyethylene Glycol wt/v weight/volume v/v volume/volume

BHQ2 Blackhole Quencher 2

EDTA Ethylenediaminetetraacetic acid dsDNA Double-stranded DNA

RPM Round Per Minute

TBE buffer Buffer containing Tris-HCl, Boric acid and EDTA

MWCO Molecular Weight Cutoff

TERprbRNA Terminator probe made of RNA 17

TERprbDNA Terminator probe made of DNA

TERprbCHIM Terminator probe made of chimeric backbone chemistry

RTprb Readthrough probe made of chimeric backbone chemistry

UPprb Upstream probe made of chimeric backbone chemistry

TERseq Short target sequence for the terminator probes

RTseq Short target sequence for the readthrough probe

UPseq Short target sequence for the upstream probe

PAGE Polyacrylamide Gel Electrophoresis

PMT Photomultiplier Tube

λex Excitation Wavelength

λem Emission Wavelength

λCF Cutoff filter Wavelength

CHAPTER 1. INTRODUCTION

1.1 RNA Structure

The primary structure of RNA is a long polymer chain made of four ribonucleosides: Adenosine, Guanosine, Cytidine and Uridine (1) (Figure 1.1). RNA can fold and base pair to form secondary structures, such as single strand, helix, loop and bulge (Figure 1.2A). These secondary elements further interact to generate tertiary structure motifs, such as pseudoknot, junction, coaxial stacking, kissing loop/bulge, triplex, etc (2) (Figure 1.2B).

1.2 Folding of RNA

RNA folding is a complex and highly coordinated process. The folding process is governed by kinetics and thermodynamics.

1.2.1 Folding Kinetics

The synthesis of RNA by transcription is followed by fast formation of local helices (3) in the timescale of microseconds (4). The whole RNA molecule then collapse nonspecifically with helices to compact intermediates upon interacting with metal ions within low milliseconds (5). For example, the early collapse stage of Tetrahymena ribozyme depends on metal ion mediated interactions, instead of long-range tertiary interactions found in the native conformation (6). The nonspecific collapse leads to formation of both the native-like and non-native intermediates. Slow searching for native structures occurs in the following time which ranges from milliseconds to minutes. 19

Native-like intermediates need only simple rearrangement, while non-native intermediates need intensive unfolding and refolding. While the three stages of kinetic

RNA folding sometimes occur in a clear stepwise order, they may occur simultaneously in other cases (5).

Figure 1.1 The primary structure of RNA. 20

Figure 1.2 Secondary and tertiary structural motifs of RNA (A) Secondary structure motifs. (B) Teritiary structure motifs. The Watson-Crick base pairs are indicated by short lines, while the Hoogsteen base pairs are shown by broken lines.

1.2.2 Folding Thermodynamics

Thermodynamic parameters are crucial in RNA folding. Enthalpy and/or entropy may contribute to the negative free energy necessary for folding.

If RNA folding occurs mostly due to exothermicity (H < 0), i.e. formation of hydrogen bonds and base stacking, the folding is considered enthalpically driven. For example, docking of the GAAA tetraloop to its receptor in the Tetrahymena ribozyme yields a favorable enthalpy (H < 0) and an unfavorable entropy (S < 0). Therefore the folding was enthalpically driven (7).

On the other hand, the folding of some RNAs does not provide a favorable enthalpy (H > 0) thus has to be driven by entropy (S > 0). The positive enthalpy was proposed to be a result of the necessary rearrangement of hydrogen bonding during the stage searching for the native conformation. The increase of entropy could be provided by releasing diffusely bound ions or water molecules to the solvent (8).

In the process of searching for the native conformation, a misfolded intermediate structure is sometimes thermodynamically more stable than the other similar local conformations. Although this intermediate is less stable than the native conformation, the energy barrier to reach the native state prevents the spontaneous proceeding of the folding (Figure 1.3). The folding is therefore trapped in the kinetic process and the intermediate is called a “kinetic trap” (9). Metal ions (Mg2+) (10), proteins (chaperon and cofactor) (11) and temperature (12) may prevent or overcome the kinetic trap and facilitate the folding to achieve the most stable native state.

Figure 1.3 The rugged energy landscape of RNA folding. The kinetic traps with regional low free energy is indicated by arrows.

1.2.3 Factors Affecting RNA Folding

RNA folding is affected by many factors. The primary sequence of RNA is the first factor in folding because base pairs are crucial for helices formation. Nucleotide composition dictates base pairs.

Metal ions are well-known factors affecting RNA folding. The conventional view considers metal ions as an enthalpic driving force of RNA folding which lowers the enthalpy through electrostatic interactions with phosphate groups of RNA(13). However, two recent studies using Na+ and Mg2+ indicated that metal ions allow the folding process to achieve a more favorable G by reducing the entropy penalty associated with counterion uptake or by limiting the structural diversity of the unfolded ensemble (14,15).

These discoveries highlight the important role of RNA-solvent interactions in the folding process (16) and agree with the enthalpy-entropy compensation theory which described 23 the changes in enthalpy (H) and entropy (S) during folding were canceled out thus

G remained constant (17).

Temperature plays two opposite roles in RNA folding.

On one hand, a moderate increase of temperature favors breaking of hydrogen bonding which facilitates the transition from misfolded intermediates to the native state.

The solvent and ion relaxation caused by the folding, i.e. releasing of water molecules and ions to a more chaotic solution at a higher temperature, could potentially provide a more favorable entropy to drive the process. A previous study determined that an elevation of temperature from 21°C to 51°C, below the melting point, accelerated the transition rate from the unfolded/intermediate structures to the native conformation (12).

On the other hand, an excess increase of temperature undoubtedly prevents RNA folding. The exothermic nature of the new bonds formation necessary for the native structure is more difficult at a higher temperature. The larger entropy difference between the diverse unfolded ensemble and the unified native structure also poses a bigger penalty. For an RNA folded in its native conformation, when the temperature reaches a threshold where endothermic bond breaking and increase of entropy become dominant, the RNA rapidly unfolds, i.e. melts. The characteristics of the melting is thus used to indicate the thermostability of the RNA structure (18).

Chaperon or protein cofactors are also involved in RNA folding. Two possible ways have been proposed based on current studies. First, chaperon or protein cofactor may facilitate folding through an induced fit mechanism, i.e. their binding to RNA initiates tertiary structure nucleation (19). Second, a protein cofactor may direct the 24 folding process via tertiary structure capture. One study showed that yeast CBP2 protein bound group I intron and facilitated folding in a manner of tertiary structure capture (20).

The intracellular environment is crowded with various micro- and macromolecules. Thus RNA folding is inevitably affected by the effect of molecular crowding. A previous study used polyethylene glycol (PEG) to mimic the effect of molecular crowding and found out that PEG stabilized the compact RNA conformation through the excluded volume effect (21). This effect was further studied at the single- molecule level by folding an isolated GAAA tetraloop-receptor in the presence of PEG

(22). The PEG greatly accelerated the RNA folding rate as shown by the increased rate constant. The driving force of this effect was suggested to be the favorable entropy gained from folding RNA into a more compact structure of a smaller radius in a space restricted by the cosolute, PEG. Other studies revealed that molecular crowding facilitated tRNA folding cooperativity (23), promoted group I ribozyme activity (24,25), overcame mutations destabilizing ribozyme structure (26) and lowered the Mg2+ concentration required for the ribozyme function (27).

Polyamines exist ubiquitously in all organisms in various forms and modulate many essential biological processes, such as cell growth and division (28). The total of free and bound cellular polyamine concentration is at millimolar level (29). Biogenic polyamines (e.g., spermine and putrescine) bind to RNA primarily through electrostatic interaction due to their positively charged amino groups. Many studies in the past decades showed that polyamines bind to mRNA, rRNA, tRNA, ribozyme and other

RNAs to modulate biological functions (30). For example, the stimulation of translation 25 initiation in the E. coli OppA modulon by spermidine was achieved by the binding of spermidine to the mRNA Shine-Dalgarno (SD) and AUG region. The spermidine binding increased the accessibility of SD and AUG regions, and stabilized an adjacent stem (31).

The specific binding to and stabilization of A-form helices with bulged out regions by spermidine was suggested to be the major reason of the enhanced translation initiation

(28). Three specific spermine binding sites on tRNAPhe were discovered (32,33). The bound spermine unsuprisingly facilitated tRNA folding because all the three sites were located near the junctions of the critical tRNA structural motifs, i.e. D-stem and anticodon stem, D-stem and variable loop, acceptor stem and T-stem. Overall, low concentrations of polyamine leads to RNA stabilization and increase of melting temperature (34), while high concentration of polyamines causes non-specific denaturation of RNA secondary structure (35).

1.3 Bacteria and Antibiotics

Bacteria is a very large domain of prokaryotic microorganisms (36). History of bacteria dates back to the early age of the earth, much earlier than the history of human beings. While some bacteria are beneficial to human, e.g. those living in the human intestine, termed microbiota, others are pathogens which cause diseases in the host. It is significant to understand bacteria and find ways of defeating pathogenic bacteria.

1.3.1 Pathogenic Bacteria

Diseases caused by bacteria vary dramatically from trivial to life-threatening.

Gram-negative bacterium E. coli causes gastrointestinal disease, such as diarrhea (37).

The notoriously difficult-to-treat methicillin-resistant Staphylococcus aureus (MRSA) is a Gram-positive bacterium, which causes serious infections throughout the body, including lung and bloodstream (38). Pneumococcal disease is caused by the Gram- positive Streptococcus pneumonia (39). The complex outer membrane structure makes

Gram-negative bacteria difficult to penetrate (40), while the absence of the outer membrane in Gram-positive bacteria make the cell wall more permeable to antibiotics diffusion (41).

1.3.2 Current Antibiotics

Since the discovery of penicillin in 1928, antibiotics have been used to treat bacterial infection for near a century. So far, more than twenty structural classes of antibiotics have been developed and hundreds of drugs are on the market (42) . These antibiotics can be classified according to their drug targets (43) .

1.3.2.1 Classes of Antibiotics and Their Targets

Based on the type of drug targets, current antibiotics can be categorized into five groups.

 Cell wall synthesis inhibitors. The β lactam class of antibiotics is most commonly used (44). Drugs in this class inhibit synthesis of the cell wall peptidoglycan layer which 27 leads to disruption of cell wall integrity and cell death. However, resistance arises mainly from β lactamase, an enzyme that catalyzes hydrolysis and deactivation of β lactam antibiotics (45) . Thus β lactamase inhibitors, such as culvanic acid (46) were developed to accompany and maintain the effectiveness of β lactam antibiotics.

 Protein synthesis inhibitors. Mupirocin from the monoxycarbolic acid class binds to aminoacyl-tRNA synthetase and inhibits the synthesis of aminoacyl-tRNA (47) .

 DNA replication inhibitors. Quinolones inhibit DNA replication by forming a complex with two DNA topoisomerases: DNA gyrase primarily in Gram-positive bacteria and topoisomerase IV primarily in Gram-negative bacteria (48) .

 RNA polymerase inhibitors. Rifampicin from the Rifampicin class binds to the beta subunit of the bacterial RNA polymerase and blocks the exit channel of new transcripts (49) .

 Folic acid metabolism inhibitors. Sulfonamide inhibited dihydropeteroate synthase by reversible competition of the active site with p-aminobenzoic acid. The competitive inhibition leads to stalled synthesis of folate, a folic acid derivative, and certain subsequent DNA bases (45) .

1.3.2.2 Antibiotics Targeting RNA

Among the antibiotics mentioned above, some inhibit bacteria through binding to bacterial RNA.

Macrolides bind to rRNA on the domain II and V of the 23S ribosomal subunit near the peptidyltransferase center (50). Binding of macrolides to the site inhibits 28 global protein synthesis by blocking either peptide formation or translocation (51,52).

Tetracycline, another structure class, binds the 16S rRNA and inhibits protein synthesis mainly by preventing tRNA binding to the A site (53).

The aminoglycosides are an old class of antibiotics introduced in the 1940s.

Amino groups on the sugar rings are protonated at pH 7.0 therefore could bind to the negative charged RNA backbone through electrostatic interactions, primarily at divalent metal ion binding sites (54). The well-studied drug target of aminoglycosides is the 30S subunit of rRNA at the bacterial ribosome A site (55,56). For example, streptomycin binds to the backbone of 16S rRNA, a component of the 30S subunit, through multiple interactions involving four functional groups of the molecule (57). Paromonmycin binds in the major groove of helix 44 in the A-site of 30S rRNA, increasing A-site’s affinity to tRNA, therefore diminishing the difference between cognate and non-cognate tRNA (57).

Moreover, aminoglycosides bind to structured RNA at stem-loop, internal loop and bulge regions (58,59). Direct binding of aminoglycosides to medicinally important RNA, i.e.

HIV-1 TAR RNA and RRE RNA led to inhibition of Tat (60) and Rev (61) protein binding respectively. Since both TAR-Tat and RRE-Rev interactions are necessary in

HIV-1 replication, aminoglycosides were suggested to have pharmaceutical potential for treating HIV-1 infection.

Research of oxazolidinones were initiated in the early 1980s and the first drug,

Linezolid, was approved by FDA in 2000 (62) and considered to be the “Drug of the last resort”(63). In general, Oxazolidinones bind to the peptidyltransferase center in the ribosome 23S rRNA. One study (64) using Linezolid revealed that binding of Linezolid 29 at the A site of the peptidyltransferase center caused improper positioning and subsequent dissociation of the aminoacylated-tRNA. Protein synthesis is thus inhibited. The selectivity of Linezolid for eubacteria over archaea/eukaryote was further explored in a computational study (65). In eubacteria, the two surrounding nucleotides restrain the free space of U2504. The restraint on the flexibility of U2504 fosters the direct interaction between U2504 and Linezolid, while the second shell nucleotides in archaea/eukaryote are not supportive for the Linezolid binding.

1.3.2.3 Antibiotics Resistance

Although many existing antibiotics are effective in treating specific bacterial infections, antibiotics resistance emerges inevitably due to the several major causes (66) .

Inactivating enzymes. Enzymatic deactivation renders drug molecules inactive by disruption of drug reactive centers. β-lactamase hydrolyzes the β-lactam ring and inactivates β-lactam antibiotics (45). There are several classes of β-lactamase according to the revised Ambler Classification method (67). Some require Zinc (68) and others use serine residue in active site.

 Altered targets. The target alteration can be achieved in two ways: genomic mutation and modification enzyme. One of the fluoroquolinone’s targets is DNA gyrase.

Chromosomal mutations altered the GyrA or GyrB subunits of DNA gyrase and caused resistance due to decreased drug affinity for the gyrase-DNA complex (69). The mechanisms of resistance to aminoglycoside antibiotics has been investigated. The expression of the acquired rRNA methylase or methyltransferase genes led to 30 methylation of A1408 located on the 16S rRNA (70). This enzymatic modification of the binding site nucleotide produced resistance to a few aminoglycosides, i.e. kanamycin, tobramycin, sisomicin, and apramycin (56). Chromosomal mutation of A1408 to G,

T1406 to A, C1409 to T and G1491 to T revealed by the genetic analysis in

Mycobacterium abscessus induced resistance to kanamycin with no observable biological cost (71).

 Impermeability. Antibiotics need to penetrate the bacterial cell wall to reach their sites of action. Although both polycationic aminoglycosides and lipophilic macrolides diffuse through the outer membrane, they utilize different pathways. Aminoglycosides bind to negatively charged residues, mostly phosphate groups in the lipopolysaccharides

(72). The binding disrupts local structures stabilized by Mg2+ bridge and enhances the permeability of the lipid bilayer ( 73). Macrolides simply diffuse passively across the bilayer (74). Small hydrophilic molecules, such as many beta-lactam antibiotics enter bacteria through a pathway mediated by outer membrane porin (75). Mutation in the lipid-protein composition of outer membrane decreased the efficiency of passive diffusion through the lipid-mediated pathway (40) . The porin-mediated pathway is impaired by reduced expression of porin proteins, e.g. ompF (76) and substitution of large general porins by narrower selective porin, for example, OmpK37 (77). Cell wall impermeability is one of the major causes of multidrug resistance (78).

 Efflux Pump. Efflux pump commonly exists in bacteria to remove a range of molecules from intracellular space, including a variety of cytotoxic antibiotics. Driven by either proton or ATP, elevated activities of single or multiple efflux pumps lead to 31 extrusion of antibiotics and drug resistance (79). Efflux pump is another major cause of the multidrug resistant bacteria ( 78).

1.3.2.4 Spread of Drug Resistance.

While some antibiotic resistance emerges in non-resistant bacterial strains as a result of antibiotic usage, there are two significant ways for drug resistance to spread.

One way is the transmission of the drug resistant bacterial strain itself. For instance, the notorious MRSA spreads around the world with the help of frequent international travel

(80). The other way is the spread of the resistance mechanism from one to another bacteria strains or species. Many mobile genetic materials, e.g., plasmids, bacteriophages and transposons, could mediate the spread of genes responsible for drug resistance, such as the genes encoding efflux pumps with elevated activities and inactivating enzymes

(81).

1.4 Riboswitch

1.4.1 Riboswitches in General

Riboswitches are highly structured cis-acting RNAs that regulate gene expression in bacteria at the level of transcription or translation by directly sensing metabolite abundance (82). In general, the riboswitch is made up of an aptamer domain and an expression platform. The aptamer domain is responsible for ligand binding which induces structural changes in the riboswitch. The expression platform directly turns on/off the downstream gene expression upon the structural change. In some riboswitches such as 32 coenzyme B12 riboswitch, the aptamer domain and expression platform are well separated

(83). In many other cases, the two structural elements are partially overlapped, for example, the T box family riboswitches and the Adenine-specific riboswitch (84).

The regulation of gene expression by the T box system was elucidated in early

1990s (85-87). Although the term “riboswitch” had not yet been coined, it undoubtedly marked the first discovery of a riboswitch regulatory mechanism. The word “riboswitch” was first used in 2002 by three publications (88-90). All the three studies were revealing the mechanism of small metabolites, namely thiamine pyrophosphate (TPP) (88), flavin mononucleotide (FMN) (90) and AdoCbl (89), altering gene expression through direct interacting with operon mRNA of the corresponding vitamin derivatives.

1.4.2 Classification of Riboswitch

Based on the process where riboswitches control gene expression, there are two classes of riboswitches: transcription control riboswitch or translation control riboswitch.

A transcription control riboswitch typically relies on an intrinsic termination mechanism in which a terminator is required to signal termination. Binding of a ligand to the aptamer domain of a translation control riboswitch modulates the accessibility of the Shine-

Dalgarno sequence which is responsible for the translation initiation (82). Recent research has uncovered a novel regulation mechanism: riboswitch control of Rho- dependent transcription termination (91). For example, in the E. coli FMN riboswitch, the

Rho protein binding site is single stranded and accessible in the presence of FMN, but forms a helix with an upstream region in the absence of FMN. Binding of Rho protein 33 and Rho-dependent transcription termination is therefore regulated by the FMN riboswitch (91).

Based on the ultimate effect on gene expression, riboswitches are divided into two groups: “on” and “off” riboswitches. The “on” riboswitches indicates that the default state of the riboswitch in the absence of cognate ligand is “on”, i.e. expression of downstream genes. The “off” riboswitch prevents gene expression in the absence of the corresponding natural ligand (92). The T box riboswitch is a typical “off” riboswitch as in the absence of the uncharged tRNA, transcription is blocked at the termination site.

Riboswitch control can occur either kinetically or thermodynamically ( 93). When the rate of ligand binding is more rapid than the riboswitch folding, the riboswitch is considered kinetically controlled. When a riboswitch structure forms, upon ligand binding, due to a higher thermodynamic stability over alternative foldings, the riboswitch is considered thermodynamically controlled (93).

1.4.3 Factors Affecting Riboswitch Function

Many cellular factors affect riboswitch function, e.g. ligand concentration, metal ion concentration, temperature, etc. Depending on how the ligand binding and the RNA folding are coupled at a specific condition, a riboswitch could be either kinetically controlled or thermodynamically controlled. Pausing of RNA polymerase (RNAP) gives a riboswitch extra time to accept a ligand or fold. This time is particularly important for thermodynamically controlled riboswitches. Transcription elongation proceeds in a fast manner, e.g. RNA Polymerase II transcribes about 33 bases per second (94). The length 34 of many commonly studied riboswitches are 100~200 nt (95) which can be transcribed in a few seconds in the absence of pausing. Riboswitch folding follows the same principle of general RNA folding which requires seconds to minutes to finish the three folding stages: local helices formation, nonspecific collapse and search for the native structure

(96). Therefore, the extra time given by the pausing is essential for the thermodynamically more stable conformation to outcompete alternatives. Notably, the transcription pausing provides a possible action window for drugs targeting a riboswitch.

1.4.4 Riboswitches as Drug Targets

Many studies have shown that riboswitches regulate expression of essential genes in bacterial metabolism (97). Proposed to be an ancient gene regulation mechanism in the

RNA world (98), all known riboswitches, except the TPP riboswitch (99), exist only in bacterial genomes. The absence of most riboswitches in eukaryotes could minimize cross-binding of drugs to non-bacterial targets, allowing a good therapeutic index. Since riboswitches commonly regulate the genes essential for bacterial survival and pathogenesis, the riboswitch-targeting drugs are proposed to have a promising potency

(100-102). A recent study published by Merck & Co. described a small molecule called ribocil that selectively inhibited bacteria growth through competitive inhibition of the

FMN riboswitch ( 103). This new advance further validated the approach of developing antibiotics by targeting a riboswitch.

1.5 The T box Riboswitch

1.5.1 Discovery of the T Box Riboswitch

The T box transcription antitermination system was first discovered in the early

1990s (85-87) before the use of the word “riboswitch” (88-90). While investigating the gene regulation mechanism of Tyrosyl-tRNA synthetase, Henkin et. al noticed the conserved elements, named the T box sequence, located directly upstream of intrinsic terminators in the 5' untranslated region (5' UTR) of multiple aminoacyl-tRNA synthetase genes (85,87). The subsequent studies discovered the structural similarity of the T box sequences and also a codon triplet corresponding to the amino acid related to the downstream tRNA synthetase gene. The confirmation of tRNA’s regulatory role in these tRNA synthetase genes marks the discovery of the T box transcription antitermination mechanism (86) which is commonly known as the T box riboswitch now.

The T box riboswitch is unique because it interacts with a macromolecule, tRNA

(86), rather than small-molecule metabolites (90,104,105) or metal ions (106) like other riboswitches do.

According to a previous phylogenetic study, the T box riboswitch is found in several major Gram-positive bacterial groups, including the Firmicutes, the

Actinobacteria, the Chloroflexi, and the Deinococcus-Thermus group (107). The operons and individual genes regulated by the T box riboswitch are essential to the amino acids metabolism. In the comprehensive study (107), 653 aminoacyl-tRNA synthetase genes,

250 amino acids biosynthesis genes, 159 amino acids transporter genes and 17 regulatory proteins were detected under the regulation of T box riboswitches. 36

1.5.2 T box Riboswitch in Bacillus Subtilis glyQS Gene

1.5.2.1 Mechanism of Function

The glycyl-tRNA synthetase (glyQS) gene in Bacillus subtilis is a combination of two genes, i.e. glyQ and glyS encoding alpha and beta subunits of the glycyl-tRNA synthetase respectively (108). The glyQS T box riboswitch is located at the beginning of the 5' UTR of the nascent transcript from +1 to +235 ribonucleotide.

The glyQS T box riboswitch functions in response to the aminoacylation state of the cognate tRNAGly which is modulated by the availability of the cognate glycine (109).

When the intracellular uncharged tRNAGly concentration is high, as a result of a limited supply of glycine, the uncharged tRNAGly binds more nascent transcripts and stabilizes their antiterminator structures. Formation of the antiterminator induces transcription antitermination and enhances the expression of the glycyl-tRNA synthetase in order to utilize the scarce glycine. When abundant glycine is present, the charged tRNAGly level is high, the binding of the charged tRNAGly to more nascent transcripts cannot stabilize their antiterminators, thus allows the formation of thermodynamically more stable terminators. The terminator leads to attenuated expression of the glycyl-tRNA synthetase through intrinsic transcription termination (109).

1.5.2.2 Structural Features

In general, the T box riboswitch has three stems (Stem I, II and III) followed by a section which could adopt two alternative structures, either terminator or antiterminator

(110).

The secondary structure of glyQS T box riboswitch (Figure 1.4) is simpler than other riboswitches in that only Stem I and Stem III are observed before the terminator/antiterminator region. The Stem II and psedoknot are replaced by a short single-stranded linker (111).

Multiple conserved elements are discovered in the Stem I, all of which are involved in the Stem I-tRNA interaction (112). The specifier sequence in the specifier loop of Stem I is one binding site of the cognate tRNAGly. The specifier sequence, which is the same as the codon for the corresponding amino acid, base pairs with the anticodon on the tRNAGly thus ensuring the recognition of only one cognate tRNA. However, a recent study demonstrated the specificity can be modulated by two overlapping codons at the same specifier loop. Two tRNAs, i.e., tRNAAsn and tRNAGlu control the biosynthesis of two amino acids, Glu and Asn through the same riboswitch, NT-box for asparagine

(113). The seven nucleotides in the specifier loop right above the specifier sequence are conserved and anchor the specifier loop at a more accessible position for the upcoming tRNA anticodon (114).

Figure 1.4 Structure of the Bacillus subtilis glyQS T box riboswitch The sequence that forms the antiterminator are indicated by the extra line. Highly conserved nucleotides are shown by bold letters. The nucleotides that base pair with the cognate tRNA are highlighted by open circles.

The apical loop and the AG bulge were found to be functionally important long before the elucidation of their structural roles.5 (11 ) The crystal structure solved in two recent studies (116,117) confirmed that this region formed the second point of contact with tRNAGly. The apical loop and the AG bulge hold together like a hand and thumb through layers of interactions (3 base triples and 2 base-ribose) between the two single 39 stranded regions. The elbow of the cognate tRNAGly where D–loop and T-loop contact exhibited extensive base stacking with the apical loop and the AG bulge region of the

Stem I. The base stacking provides the major driving force for the second interaction between the Stem I and tRNAGly. The interaction resembles the recognition of tRNA by

RNase P (118) and ribosome (119) both of which require the correct tertiary structure in tRNA. The length between tRNA anticodon and the elbow is thus monitored by the riboswitch, like a “molecular ruler” to ensure the specific recognition of the cognate tRNA (112).

The 3-4 nt bulge in the middle of Stem I enables Stem I to track the shape of tRNA. Although the sequence of this bulge varies among different T box riboswitches, the presence of the bulge structure is conserved in order to maintain the proper bending

(65°) of the Stem I ( 107).

The K turn is another conserved element formed by the GA motif near the base of the Stem I (107), although no evidence showed that the K turn interacted with tRNA or protein factor. A later study revealed that the role of the K turn is to rotate the specifier sequence towards the minor groove of Stem I. Such rotation is induced by Mg2+ binding and makes the specifier sequence more accessible for the incoming tRNA anticodon

(120).

Downstream of Stem I and Stem II, there are two mutually exclusive structures: terminator and antiterminator (86). When an uncharged tRNA is interacting with the

Stem I, its free acceptor end stabilizes the antiterminator and prevents formation of the 40 terminator. The 14 highly conserved nucleotides, namely the T box sequence, are responsible for the third point of contact between the tRNA and the riboswitch(87).

The antiterminator is a stem loop structure with a 7-nt bulge. The four nucleotides UGGX located at the 5' end of the bulge base pair with the last four nucleotides on the tRNA acceptor end, YCCA. The discriminator base Y on the tRNA is always complementary to the variable base X in the 7-nt bulge of the antiterminator (110).

To decode the critical third interaction that ultimately induces transcription antitermination, the solution structure of the complex 7-nt bulge was first resolved by nuclear magnetic resonance (NMR) in the Hines lab (121). The bulge induces a 80° bend between the two helices, A1 helix below and A2 helix above. The 7-nt bulge contains highly flexible regions and extensive stacking around the ACC nucleotides at the 3' end of the bulge which facilitates the pre-selection of conformations favorable for tRNA binding (121). One striking feature of the antiterminator is that the fifth nucleotide in the bulge, adenine, is 100% conserved across 248 T boxes analyzed in a phylogenetic study

(122). However, the real function of the A remains a mystery and awaits to be elucidated.

The Hines lab discovered one diffuse Mg2+ binding site around the stacked G in the A1 helix (123). Magnesium plays an essential role in the binding of the tRNA acceptor end to the antiterminator. In vitro fluorescence binding study (124) revealed that only three base pairs form at 5 mM Mg2+, while formation of the full four base pairs requires at least 15 mM Mg2+. This is consistent with the fact that 5 mM Mg2+ is sufficient for the riboswitch folding and tRNA binding, while 15 mM Mg2+ is the functional requirement necessary for tRNA-induced antitermination in vitro (109). 41

However, the intracellular free Mg2+ concentration is only about 1 mM (125). The difference indicates that additional unknown factor(s) may be contributing to the binding of tRNA to the antiterminator in vivo, possibly protein factor(s) that exist in the cell extract (126). The tertiary core structure of tRNA was found to be important for antiterminator binding as the in vitro selection study of tRNA resulted primarily in the wild-type core structure using randomized tRNA sequences (127).

Overall, binding of tRNA to the T box riboswitch was newly proposed to involve three points of contact ( 112). The anticodon of tRNA base pairs with the specifier sequence on the T box Stem I. Bending of the Stem I allows the apical loop and AG bulge stacks on the elbow of the tRNA, sensing the length and tertiary structure of the tRNA like a “molecular ruler”. The third interaction occurs only if the tRNA is uncharged. The free acceptor end of tRNA forms four base pairs with the complementary nucleotides in the 7-nt bulge of the antiterminator. While the tRNA can be displaced after the first two binding interactions, the final interaction locks tRNA in place so that the tRNA could not be displaced thereafter (128). Combining the co-crystal structure of

Stem I bound with tRNA (116) and a biochemical study (129), the global conformation of tRNA-T box riboswitch complex was proposed (129). The T box riboswitch forms a C shape structure surrounding the tRNA (Figure 1.5).

The T box riboswitch is controlled both kinetically and thermodynamically. The terminator is thermodynamically more stable than the antiterminator, thus it forms spontaneously in the absence the cognate uncharged tRNA (110,130). The interaction of the antiterminator with the cognate uncharged tRNA provides the antiterminator 42 additional stability and prevents formation of the terminator (131). In addition, the role of kinetics is also fundamental in the structural determination. The pausing of RNAP is critical for the T box transcription termination because the long terminator structure (>40 nt) needs time to nucleate and remove RNAP (213 ). Without pausing, RNAP would rush through the region and the T box riboswitch would lose its ability to terminate transcription, leading to universal readthrough. Three pausing sites were identified (133).

The first pausing site was located between the Stem I and the terminator/antiterminator region. The pausing of RNAP at this site gives time for the cognate tRNA to come and interact with the Stem I. The second pausing site was at the 3' side of the antiterminator structure before the completion of the overlapping terminator sequence. Pausing of

RNAP at this position gives the acceptor end of the uncharged cognate tRNA the time window to engage the antiterminator. The third pausing site was located directly after the terminator sequence. In the presence of a charged tRNA or in absence of any tRNA, pausing of RNAP at this site allowed the nucleation of the terminator and the dissociation of RNAP. In the presence of an uncharged tRNA, the pausing allowed additional time for the formation of the antiterminator through its interaction with the tRNA acceptor end, leading to transcription readthrough.

Figure 1.5 Scheme of the global conformation of the tRNA-T box complex The stem forms a C-shape structure surrounding and tracking the shape of tRNA.

1.5.2.3 T box Riboswitch Model Systems

The T box riboswitch has been intensively studied using the model systems from the Tyrosyl-tRNA synthetase (tyS) gene (114,127,130,131) and the Glycyl-tRNA synthetase (glyQS) gene (109,128,134) of Bacillus subtilis. While the tyrS T box riboswitch functions in vivo in the beta-galactosidase assay (131), an in vitro experiment was not able to demonstrate its function (122), possibly indicating the requirement for additional currently unknown cellular factor(s). TheS glyQ T box riboswitch is simpler than the tyrS T box structurally. Several previous studies exhibited the activity of the glyQS T box riboswitch in vitro using labor-intensive experimental methods (126,128).

Early studies for the T box riboswitch (109,111,122) employed a halted single-round in vitro transcription method (135) that separated the transcription initiation and elongation.

In the halted system, high Mg2+ concentration required for efficient antitermination during elongation was achieved without inhibiting transcription initiation. Another 44 research group simplified the in vitro transcription method by adding 5 mM spermidine to allow turn-over of RNAP (126). However, both of the two previous methods relied on the use of radioisotopic labeling by 32P, gel electrophoresis and subsequent imaging which were labor-intensive and low throughput.

The antiterminator model, AM1A (Figure 1.6) was developed by the Hines lab in the process of elucidating tRNA-antiterminator interactions (136). The sequence contained all the consensus structural elements found in most T box antiterminators. The consensus elements include the 14-nt T box sequence, the 7-nt bulge, the highly conserved flanking sequences in the two helices (A1 and A2), the 100% conserved A10, the functionally important C11. In order to use the construct in vitro successfully, a few modifications were also made to the antiterminator model. The antiterminator loop above the A2 helix was replaced by a well-studied stable UUCG tetraloop (137) as the loop sequence is not conserved (122). The UA and AU base pairs on top of the A2 helix was replaced by a GC base pair. The ninth nucleotide, U on the bulge was replaced by an A to prevent dimerization of the model (136). A GC base pair was added to the A1 helix to facilitate the transcription of the construct by T7 RNAP.

The matching tRNA model, tRNATyr(A73U) is from the Bacillus subtilis tRNATyr

(136). The Adenine (A) discriminator base of the wild-type tRNATyr was replaced by

Uracil (U) in order to maintain complementarity with the variable base, A in the antiterminator model. The binding of AM1A to tRNATyr(A73U) requires at least 5 mM

Mg2+ while 15 mM Mg2+ induces the optimal interaction (124).

Figure 1.6 Sequences and structures of three antiterminators. Highly conserved nucleotides are indicated by the bold letters. The Watson-Crick base pairs are indicated by short lines, while the G-U wobbles are shown by small dots.

1.5.3 The Natural Ligand of The T box Riboswitch: tRNA

The natural ligand for the T box riboswitch is tRNA. As an ubiquitous set of molecules existing in all organisms (138), tRNA has a common cloverleaf secondary structure (139) which is folded in to a L-shape tertiary structure (Figure 1.7). Several factors contribute to and maintain the native conformation of tRNA. Essential attractive tertiary interactions are identified at two regions in the tRNA 3-D structure: 1) the core interaction involving seven base pairs or base triples among conserved nucleotides from

D-stem, variable loop and anticodon stem, 2) the D/T loop interaction (140).

Furthermore, electrostatic repulsion and topological constraints have important roles in determination of the tRNA structure (141).

The primary role of tRNA is to bring the proper amino acid to the ribosome for protein synthesis. The three anticodon nucleotides on the tRNA complementary to the codon on the mRNA ensure the specificity. Discovery of T box riboswitch unveiled that 46 tRNA signals for transcription termination/antitermination in bacteria for regulating bacterial gene expression in response to changes of cognate amino acid levels (86,87).

Figure 1.7 Structure of tRNAs. (A) The secondary structure of tRNATyr. The long-range tertiary interactions are indicated by broken lines as an example. (B) The secondary structure of tRNAGly. (C) The L-shape cloverleaf represent

1.5.4 T box Riboswitch as a Drug Target

The T box riboswitch is a promising drug target. Many Gram-positive bacteria contain genes that are regulated by the T box riboswitch. Many of these genes encode proteins essential for bacterial survival, including aminoacyl-tRNA synthetases, amino acid biosynthesis proteins, amino acid transporters and regulatory proteins (107). It is not uncommon that multiple genes are regulated by the T box riboswitch in one bacterial species (107). Besides, future drugs could take advantage of the high sequence conservation of the T box riboswitch, especially in the T box sequence (87). Overall, the

T box riboswitch is an intriguing target for novel effective broad spectrum antibacterial drugs.

As a comprehensive effort to develop antibacterial drugs targeting the T box riboswitch, many small molecules have been synthesized in the Bergmeier lab and screened in the Hines lab.

Oxazolidinones. To develop drugs that target the T box riboswitch antiterminator, a series of new 3,4,5-trisubstituted and 4,5-disubstituted oxazolidinones were screened for binding to AM1A. The 4, 5-disubstituted oxazolidinones showed good binding selectivity and affinity (142,143). Further studies indicated that the binding of 4, 5- disubstituted oxazolidinones to the AM1A was surface binding with no stereospecificity

(144). The results obtained from changing acyl groups at the C-5 position (145) and in silico docking of the ligands to AM1A (144) suggested that hydrogen bonding and hydrophobic interaction played important role in the ligand binding to the antiterminator model. 48

Triazoles. To improve water solubility and synthesis process, 1,4-disubstituted

1,2,3-triazoles were developed in the Bergmeier lab as a bioisosteric replacement because the 1,2,3-triazole ring could replace the oxazolidinone nucleus (146). The fluorescence anisotropy studies of the tRNA-antiterminator complex (147) and the ligand induced stabilization studies (148) identified a few ligands (e.g., GHB-7) as the lead compounds that bound to AM1A and displaced tRNATyr(A73U). The follow-up characterization showed that GHB-7 interacted with phosphate groups through hydrogen bonding and nucleotides with π-π stacking around the kink region of AM1A, including 5' of the bulge that base paired with tRNA (149).

Aminoglycosides. In light of the previous discoveries that showed the binding of aminoglycosides to structured RNAs around loop and bulge regions (58,59), aminoglycosides were tested for their ability to bind the T box antiterminator RNA. All the eight aminoglycosides tested can bind to AM1A with dissociation constant (Kd) at

µM range (150). Neomycin B, the aminoglycoside with the lowest Kd with AM1A in the previous study, binds to the bulge nucleotides through electrostatic interaction (150).

Unfortunately, the discovery that the binding of neomycin B to AM1A facilitated, rather than inhibiting tRNA binding eliminated neomycin B’s medicinal potential against the T box riboswitch (151).

1.5.5 Transcription Termination

Although some were predicted by computational genomic analysis to regulate translation initiation (152), most T box riboswitches regulate gene expression at the level 49 of transcription (107). In general, the transcription process consists of three major stages: initiation, elongation and termination (153). Based on different mechanisms, transcription termination in bacteria could be categorized into two types: Rho-dependent and Rho- independent termination. Each type requires a specific hairpin structure called a terminator on the nascent RNA to mediate the termination.

1.5.5.1 Rho Dependent Transcription Termination

Rho protein is an ATPase that is recruited by the Rho-dependent terminator and causes forward (5' to 3') translocation of mRNA without nucleotide addition (154). Then

Rho removes RNA polymerase (RNAP) from the nascent RNA and template DNA and concludes the current transcription cycle (155). The Rho-dependent terminator, called rut, is a small segment of RNA containing about 80 nucleotides directly upstream of the termination site. Minimal secondary structure and high C content are the major characteristics of the rut (156). Nucleotide conservation was not observed in the rut as a synthetic DNA coding C and T rich RNA was sufficient to induce the Rho-dependent termination (157).

1.5.5.2 Rho-independent Transcription Termination

The other type of transcription termination does not require Rho protein, therefore is also called intrinsic termination. Several major steps in this process have been revealed: RNAP pausing, hairpin nucleation, disruption of RNAP and dissociation of the elongation complex (158). The Rho-independent terminator is a G-C rich hairpin 50 followed by a stretch of U and an intervening A (155). The higher stability of dA-dT in the dsDNA template than that of dA-rU in the new DNA/RNA complex provides an important signal for transcription pausing (159). The pausing of RNAP gives time for the

G-C rich hairpin to nucleate. The growing hairpin eventually exceeds the internal capacity of RNAP and disrupts the conformation of RNAP subunits. Opening of RNAP leads to dissociation of the elongation complex (132).

1.6 Principle of Experimental Methods

1.6.1 Fluorescence Resonance Energy Transfer

Fluorescence Resonance Energy Transfer (FRET) occurs between the donor fluorophore and the acceptor fluorophore that lie within a close proximity, typically 20-

100 Å (160), if the emission spectrum of a donor fluorophore overlaps considerably with the excitation spectrum of an acceptor fluorophore (161). When the donor fluorophore is excited by light of a particular wavelength (excitation light), the energy transfers to the nearby acceptor fluorophore so that the donor could return to the ground state. The acceptor is thus excited and subsequently returns to the ground state with the energy released as emission light whose wavelength is specific to the acceptor. When the donor and the acceptor are further apart, FRET does not occur efficiently because the energy transfer by FRET drops exponentially as the distance increases. The donor produces emission light directly without significant transfer of energy to the acceptor. Therefore, the wavelength and magnitude of emission light could be used to indicate the distance between the donor and the acceptor (161). 51

1.6.2 Fluorescence Quenching

A quencher absorbs energy from an excited donor fluorophore that is in a close proximity, but doesn’t emit light in the process of returning to its ground state, the donor fluorophore is thus quenched. There are two classes of quenching mechanisms depending on the distance of the donor and the acceptor: FRET quenching and contact quenching (161).

FRET quenching happens when the fluorophore and the quencher are 20-100 Å away, the appropriate distance for FRET. Same as FRET, significant overlap of the fluorophore’s emission spectrum and the quencher’s absorbance spectrum is required.

Contact quenching occurs when the fluorophore and the quencher have physical contact.

For the same fluorophore and quencher pair, efficiency of the contact quenching is always higher than the FRET quenching (160). Most importantly, contact quenching does not require extensive spectrum overlap. Efficient contact quenching was observed in the fluorophore and quencher pairs in which the fluorophore emission spectrum did not overlap significantly with the quencher absorbance spectrum (160).

1.6.3 Molecular Beacon

A molecular beacon is a stem-loop nucleic acid structure labeled by a fluorophore and a quencher (162). To detect the availability/abundance of a specific RNA/DNA sequence, the loop region of the molecular beacon is designed to be complementary to the sequence of interest. When the target is not available or in low copies, the molecular beacon stays in a closed stem-loop conformation. The blunt end of the stem allows 52 physical contact of the fluorophore and the quencher, thus allowing efficient contact quenching of the fluorescence. When the target is produced and available, the loop of the molecular beacon hybridizes with the target. The hybridization opens up the stem of the beacon and causes separation of the fluorophore from the quencher. The resulting fluorescence signal is an indicator of the target availability and quantity.

Different phosphodiester backbone analogs have been applied to molecular beacons, including RNA, DNA, Locked nucleic acid (LNA) (163) and 2'-O-methyl nucleotides (164). The 2'-O-methyl nucleotides showed particular merit in the detection of RNA targets (165,166). The 2'-O-methyl nucleotides have higher binding affinity to

RNA target so that a 2'-O-methyl molecular beacon binds tighter and faster than a DNA molecular beacon to the same RNA target (167,168). A tighter binding may overcome the complex secondary and tertiary structure of the RNA target, while a faster binding provides a quicker kinetics and a more sensitive response. The 2'-O-methyl nucleotides have lower affinity to DNA target (164) therefore can distinguish RNA transcripts better from its DNA template. In addition, the 2'-O-methyl nucleotides prevent promoter- independent non-specific transcription initiation because they are not the substrates of

RNA polymerase (166).

1.6.4 In Silico Prediction of Nucleic Acid Folding and Hybridization

In order to successfully design the molecular beacon probes, in silico prediction of their folding and hybridization before synthesizing or ordering the constructs is essential. Several online tools can be used to conduct the prediction. Mfold is a popular 53 web server that predicts intramolecular secondary folding of DNA or RNA sequences

(169). The desired metal ion concentrations and temperature may be customized for more accurate predictions. The “percent suboptimality” is a critical parameter in the server that determines how many different conformations other than the optimal will be displayed. A prediction with 100% suboptimality lists all the folding possibilities of the query sequence. Less folding variations with larger differences in free energy indicate a more reliable optimal structure determination. Another web server, Hyther, specifically computes the thermodynamic properties of intermolecular hybridization of two DNA or

RNA strands of the same length (170). Besides the metal ion strength and temperature, the concentrations of the two strands are individually customizable. Heterodimeric hybridization of a DNA strand and a RNA strand can also be handled by the Hyther server. However, both Mfold and Hyther accept only DNA and RNA sequences.

Prediction for nucleic acid sequences with alternative backbone chemistry (e.g., 2'-O- methyl nucleotides) needs to submit the sequence as either DNA or RNA and a manually estimated correction of the predicted results.

1.6.5 Fluorescence-monitored Thermal Denaturation Analysis

The AM1A is a stem-loop structure with a bulge. In order to assess the stability of

AM1A, melting temperature analysis was utilized which relies on the principle of FRET quenching (161). A fluorophore and a quencher were attached to the 5' and 3' of AM1A respectively ( 148). The fluorophore and the quencher are close to each other when

AM1A is stable in stem-loop structure, and are further apart when AM1A is destabilized 54 and not in the stem-loop conformation. According to the principle of FRET, the amount of emission light from the fluorophore could be used as an indicator of the stability and conformation of AM1A. The higher the emission, the larger distance between the fluorophore and the quencher, therefore the less stable AM1A is.

1.6.6 Radioisotopic Labeling of RNA by 32P

To visualize RNA molecules in autoradiography for structural probing, radioisotopic labels, for example, 32P can be used. Advantage of 32P includes its high sensitivity, short half-life (14 days) and the undisruptive nature to nucleotide structure and function (171). Integration of 32P can be in the middle (internal) or at the end (5’ or

3’) of a RNA molecule.

To label RNA internally, α-32P UTP is used. During the course of in vitro synthesis of RNA by transcription, trace amount of α-32P UTP is added and taken up randomly by RNAP (172). This results incorporation of 32P into all new transcripts. To label RNA at 5' end, γ-32P ATP is transferred to a RNA strand that has been dephosphorylated at 5' (172).

1.6.7 Autoradiography

Autoradiography is a way to detect the 32P labeled RNA. The silver halide in the crystals of the film’s photographic emulsion turn into metallic silver after being hit by the

β-particle emitted from 32P (173). The metallic silver subsequently causes conversion of the surrounding silver halide in the same crystal to silver atom. The film region exposed 55 to 32P thus appears black due to the presence of metallic silver in the film (173).

Subsequent developing and fixing desensitized the film from the ambient light, leaving only the trace of 32P on the film. The image on the film is scanned and analyzed by a gel imaging software to address experimental questions.

1.6.8 In-line Probing of RNA Structure

In-line probing is a way to characterize the binding of ligand to the labeled RNA structure (174). In all RNA molecules, the 2' hydroxyl group could engage in a nucleophilic attack on the adjacent phosphate group (175). The nucleophilic attack causes polynucleotide chain cleavage due to hydrolysis of the bond between the 5' oxygen and the 3' phosphorus (Figure 1.8). The in-line conformation from the attacking 2' oxygen, adjacent phosphorus to the leaving group’s 5' oxygen are essential for the cleavage.

Single-stranded RNA regions can adopt the in-line conformation readily while structured regions are restrained, thus are less likely to have the in-line cleavage (174). If a single- stranded region is bound by other molecules (e.g., synthetic ligands, other RNAs, proteins), its flexibility is restrained thus in-line cleavage is reduced. This process is naturally occurring at a slow rate. To accelerate the process to the point usable to experimentation, alkaline conditions (pH 8.4) and a high level of Mg2+ are needed to promote the nucleophilic property of the 2'-OH group (174). Overall, the change of in- line cleavage pattern of a RNA construct upon binding of a small molecule can be used to probe the binding site of the molecule to the RNA, especially to the single-stranded RNA region. 56

Figure 1.8 Mechanism of RNA in-line cleavage (A) The nucleophilic attack of 2'-OH on the adjacent phosphorus. (B) The intermediate state facilitates the hydrolysis. (C) Bond breaking occurs between 3'- phosphorus and the 5'-oxygen. The nucleophilic attack and electron movements are shown by arrows.

1.6.9 Enzymatic Probing of RNA Structure

Endonuclease enzymes cleave RNA internally at specific regions, for example,

Ribonuclease A (RNase A) cleaves 3' of U and C (176), Ribonuclease T1 (RNase T1) cleaves single-stranded G (177), Ribonuclease V1 (RNase V1) cleaves any base-paired nucleotide (178). Binding of small molecules to a RNA region leads to protection of the region and decrease of enzymatic cleavage. Therefore, changes in the enzymatic cleavage pattern of a labeled RNA could be used to identify the binding site of the small molecule on the RNA and/or ligand induced conformational change.

1.6.10 EC50, IC50 and Kd

The 50% effective concentration (EC50) is used to describe the ligand concentration needed to stimulate the target for 50% of the maximal biological response at a specific experimental condition.

By contrast, the 50% inhibitory concentration (IC50) is the inhibitor concentration required to inhibit the target for 50% of the maximal biological response at a specific experimental condition.

In the ligand binding study for drug discovery, the dissociation constant (Kd) is an affinity constant that describes the equilibrium of a ligand dissociates from the bound ligand-target complex in equilibrium. In a simplified system, i.e. in vitro binding condition without complex cellular factors, EC50 provides an useful method to estimate

Kd of the ligand binding (179). When a few assumptions can be made and the free ligand concentration approximates the total ligand concentration due to the small fraction of target in complex with the ligand, the ligand concentration which induced 50% of the maximal response (EC50) is approximately equal to the Kd. This simplified estimate of Kd is useful in early phases of drug screening when binding affinity of most ligands are low.

The free and total ligand concentration are not similar when a high affinity ligand is being tested. The ligand concentration used to study a high affinity lead compound is typically close to or below the target concentration. Thus a significant percentage of ligand would be in the ligand-target complex, resulting a dramatic difference between the free and total ligand concentrations. In this case, the dose response curve of the high 58 affinity ligand must be obtained to show the efficacy, the maximal response, of the ligand and the EC50 reported.

CHAPTER 2. DEVELOPMENT OF THE FLUORESCENTLY-MONITORED

ANTITERMINATION ASSAY

2.1 Scheme of the Assay Mechanism

In order to study the T box mechanism and screen T box targeting ligands in an efficient way that directly demonstrated the riboswitch function, a fluorescently monitored in vitro glyQS antitermination assay was needed. Previous research in the

Hines lab attempted to establish a multi-round in vitro transcription method using two fluorophore labeled single-strand probes (180). By design, the two probes should bind to two adjacent regions on the new transcripts and induce FRET. However, although this design showed promise on the isolated target sequence, FRET between the two probes did not occur during in vitro transcription as expected (180). The probable cause was that the complicated secondary and tertiary structures of the nascent transcript prevented binding of the probes.

To efficiently monitor T box antitermination during in vitro transcription, several molecular beacon probes were designed and used to monitor the T box riboswitch antitermination during in vitro transcription (Figure 2.1).

Figure 2.1 Mechanism scheme of the in vitro transcription antitermination assay Three difference types of molecular beacon probes were designed to monitor the T box riboswitch antitermination process: terminator probes, readthrough probe and upstream probe. (A) Termination, (B) Antitermination.

2.2 Design of Probes

Three types of molecular beacons were designed and tested: Terminator probe,

Readthrough probe and Upstream probe (Figure 2.2). The Terminator probe and 61

Readthrough probe were designed to detect the readthrough products (full length transcripts). The Upstream probe was designed to detect the total amount of both the terminated short transcripts and the full-length transcripts. They were made of different nucleotide backbones: ribonucleotides, deoxyribonucleotides, 2'-O-methyl ribonucleotides or a chimeric combination of two materials. In general, the loop regions of these probes were designed to be complementary to the desired target sequences. The stem nucleotides were artificially designed based on the knowledge obtained from a previous study using molecular beacons to monitor real-time PCR (181) and the Beacon

Designer software (www.premierbiosoft.com accessed on January 2013).

2.2.1 Terminator Probes: TERprbRNA, TERprbDNA, TERprbCHIM

The terminator probes were designed to bind to the sequence directly downstream of the antiterminator which is the 3' part of the terminator structure, 197-211nt in the

Bacillus subtilis glyQS gene mRNA leader region (Figure 2.1). A previous study using

RNase H mapping demonstrated that this region was single-stranded and available for a

DNA probe binding when the antiterminator is stabilized by the uncharged cognate tRNA

(109). When termination occurred, this region was sequestered in the long terminator stem thus not available for DNA probe binding and RNase H cleavage (109).

2.2.1.1 Terminator Probe Made of RNA (TERprbRNA)

This terminator-targeting molecular beacon probe (TERprbRNA, 5' (FAM) CCUCG

CCCGUCUCUAUGCUU CGAGG (C6-NH) (DABCYL) 3') consisted entirely of 62 ribonucleotides (upper case) labeled with FAM fluorophore at the 5' end and Dabcyl quencher at the 3' end. The underlined sequences are the region complementary to the selected target sequence. The shadowed letters are nucleotides involved in the stem. The target RNA sequence (TERseq 5' AAGCAUAGAGACGGG 3') was used to evaluate the probe in a simplified system.

The fluorophore carboxyfluorescein (FAM) was selected because of its excellent quantum yield and good compatibility with a wide range of spectrofluorometers (182).

The quencher Dabcyl was selected due to its reasonable spectrum overlap with the emission spectrum of FAM (Figure 2.3). The spectrum overlap ensures proper FRET quenching even if the fluorophore and the quencher do not have physical contact (160).

2.2.1.2 Terminator Probe Made of DNA (TERprbDNA)

To test the effect of backbone materials on the function of molecular beacon probes, the DNA molecular beacon probe [TERprbDNA: 5' (FAM) cctcgcccgucucuaugcuucgagg (C6-NH) (DABCYL) 3'] was obtained simultaneously with the RNA probe (TERprbRNA). The fluorophore and quencher pair remained unchanged between the two probes. The lower case letters indicate ribonucleotides respectively. The underlined sequences are the region complementary to the selected target sequence. The shadowed letters are nucleotides involved in the stem.

2.2.1.3 Terminator Probe Made of a Chimeric Backbone (TERprbCHIM)

This molecular beacon was designed and obtained after evaluation of the previous

RNA and DNA probes. A combination of deoxy- and 2'-O-methyl nucleotides was used in the chimeric probe [TERprbCHIM, 5' (FAM) cctcgCCCGTCTCTATGCTTcgagg (C6-

NH) (DABCYL) 3']. The stem of the probe was made of DNA (lowe case shaded) while the loop 2'-O-methyl nucleotides (upper case bold).

2.2.2 Readthrough Probe: RTprb

Although the target sequence of the terminator probes was shown by a previous study (109) to be inaccessible during termination and available during antitermination, the target sequence does exist in both the terminated and readthrough transcripts. Thus there is a possibility that a structural shift in the full length transcripts from antiterminator to terminator could occur after readthrough. Although this structural shift was not significant as determined in section 3.1, a new probe is preferred to target a region that exists only in the readthrough transcripts, completely abolishing such a possibility.

2.2.2.1 Sequence of RTprb and Its Target

The readthrough probe targeted 239-261 nt in the glyQS mRNA 5' UTR (109) which only existed in the readthrough transcripts. Intramolecular folding of the glyQS mRNA 5' UTR was first predicted in the Mfold web server (169) using 20% suboptimal energy as the cutoff (Figure 2.4). See Materials and Methods for the constraints used in the prediction. A portion of the selected target region (5' AAAAG 3', 248-252nt) 64 remained single-stranded among all possible folds, indicating a good starting point for strand invasion and annealing. The existence of 4-5 weak G-U (257-258 nt) wobble pairs and lower percentage of strong G-C base pairs (≤ 50%) could facilitate probing binding.

Besides, the sequence of the target determined the loop sequence of the probe due to their complementarity. An improper selection of the target region may lead to a probe sequence incapable of maintaining the desired stem-loop conformation due to unwanted base pairing between the stem and the loop nucleotides. The currently described target region was carefully selected to ensure a desired folding property as predicted in the

Mfold web server.

While using a different sequence to target a different RNA region, the new probe

(RTprb, 5' (Cy5) cgcaCCUCCACUUUUCUUUCAUAAtgcg (C6-NH) (Dabcyl) 3') had a similar infrastructure as the chimeric terminator probe. The stem was made of DNA

(lower case shaded) and loop 2'-O-methyl ribonucleotides (upper case bold). The short target sequence made of ribonucleotides (RTseq, 5' UUAUGAAAGAAAAGUGGAGGU

GC 3') was also obtained to evaluate the probe.

Figure 2.2 Secondary structure of the five molecular beacon probes The lower and upper case letters indicate deoxy- and ribonucleotides respectively, while the bold capital letters represent 2'-O-methyl nucleotides. The underlined sequences are the region complementary to the selected target sequence. The shadowed letters are nucleotides involved in the stem.

Figure 2.3 Spectra of all fluorophores and quenchers used by the probes. All the excitation/absorption spectra were indicated by solid lines and emission spectra by broken lines. Spectra data was obtained from Spectra Database hosted at the University of Arizona (www.spectra.arizona.edu, accessed on October 19, 2015)

Figure 2.4 Representative glyQS leader mRNA 2nd structure predicted by Mfold

The region targeted by RTprb was highlighted by the bold line. The red lines indicates strong G-C base pairs while blue indicates weak A-U base pairs. The G-U wobble pairs are shown by green lines. 67

2.2.2.2 In Silico Prediction of RTprb Folding and Binding

2.2.2.2.1 Predict intramolecular folding of the readthrough probe.

In the absence of the designated target sequence, the proper folding of the stem- loop structure was crucial and predicted in silico. Since the Mfold web server accepts only RNA or DNA sequences (169), the proposed molecular beacon was submitted as a

DNA sequence as described in a previous study (164). The probe combining 2'-O-methyl and deoxyribonucleotides should behave like a DNA sequence because the 2'-O-methyl nucleotides are not heavily involved in additional interactions, e.g. hydrogen bonding

(164). Effective T box regulation of transcription readthrough requires 4mM Mg2+ and

5mM spermidine (126). To better examine the folding behavior in the actual experimental condition, two folding conditions were used in the prediction. While other conditions were kept the same, folding condition I used 4mM Mg2+ and folding condition

II used 9mM Mg2+. The latter with 9 mM Mg2+ mimicked the combinational effect of

4mM Mg2+ and 5mM spermidine because polyamine was previously shown to substitute

Mg2+ in facilitating the T box riboswitch function (180). However, Mg2+ is divalent metal ion and spermidine is triprotonated at the assay pH of 8.1 (183). Both of Mg2+ (184) and spermidine (28) may have their own site-specific interactions with RNA . Thus the 9 mM

Mg2+ used in the prediction was merely an estimate for spermidine and may not accurately represent its real effect. More details of the predication is described in the

Materials and Methods.

Only one possible conformation, the desired stem-loop structure, was predicted in both foldings. (Table 2.1) This minimized the possibility of 2'-O-methyl/2'-O-methyl 68 base pairing within the loop region which was difficult to predict. If Mfold predicts a suboptimal structures involving base pairing within the DNA loop, such conformation may become dominant in reality, as the stability of 2'-O-methyl/2'-O-methyl base pair is higher than that of DNA/DNA base pair (164,167).

The two possible Tm values were within error of each other. Thus the predicted melting temperature of unfolding the probe made of DNA was around 46 °C. Since the stem of the probe was indeed made of DNA and the predicted folding did not involve any

2'-O-methyl nucleotide, this melting temperature was reliably predicted. However, more factors required consideration for a better prediction.

2.2.2.2.2 Estimating the melting temperature of unfolding RTprb.

The melting temperature of about 46°C was merely the Tm of the probe alone without considering the stabilization effect from the fluoropohore-quencher pair. A previous study used two complementary DNA strands labeled by Cy3 and Dabcyl respectively. The melting temperature of the hybridized duplex was increase by 5°C from 49°C in the duplex without labels to 54°C with labels (160). Another piece of evidence was the striking 18°C increase of the melting temperature of the stem-loop

AM1A from 51°C without labels to 69°C after attaching the ROX-BHQ2 pair to the stem

(185). The two examples suggested that the stabilization effect of fluorophore-quencher pair on stem-loop structures may be more dramatic since the pair may prevent the initial unzipping of the double-strand stem. Another study discovered that the measured Tm values with the Cy3-Dabcyl pair on the molecular beacons were 10-15°C higher than 69 those predicted in Mfold without considering the fluorophore and quencher pair (168).

Therefore the Tm of unfolding the probe with the Cy5-Dabcyl pair could be 55-60°C which is adequate for the application of in vitro transcription at or below 37°C.

Table 2.1 Folding of the DNA equivalent sequence of RTprb predicted by Mfold. Folding I Folding II [ Mg2+] 4 mM 9 mM Number of conformations 1 1 Free energy at 37 °C (ΔG) -0.88 kcal/mol ±5% -1.00 kcal/mol ±5% Enthalpy (ΔH) -31.10 kcal/mol ±10% -31.10 kcal/mol ±10% Entropy (ΔS) -97.4 cal/(K·mol) ±11% -97.0 cal/(K·mol) ±11%

Melting Temperature (Tm) 46 °C ± 2-4 °C 47.3 °C ± 2-4 °C The percent suboptimality was set to 100% free energy which displayed a full list of all possible conformations.

Table 2.2 Hybridization of the DNA equivalent sequence of RTprb with the target predicted by Hyther. Folding I Folding II Hybridization type DNA/RNA Input Probe (DNA) 5'-GCACCTCCACTTTTCTTTCATAA-3' sequences Target (RNA) 3'-CGUGGAGGUGAAAAGAAAGUAUU-5' [ Mg2+] 4 mM 9 mM Number of conformations 1 1 Prediction Free energy at 37 °C (ΔG) -27.60 kcal/mol -29.03 kcal/mol Results Enthalpy (ΔH) -172.83 kcal/mol -172.83 kcal/mol Entropy (ΔS) -468.24 eu -463.63 eu

Melting Temperature (Tm) 72.3°C 75.5°C Only the complementary regions between the probe and the target were submitted. The sequence from RTprb was submitted as DNA due to the server limitation.

2.2.2.2.3 Predict the Tm of probe/target RNA duplex hybridization.

In the presence of the target sequence, the probe needs to be unfolded through hybridization with the target. The binding affinity of the probe/target duplex must be able to overcome the free energy barrier of unzipping the stem. Thus a prediction of the duplex hybridization was conducted.

The Hyther server (170) has the function to predict hybridization between RNA and DNA strands. This server had been utilized to predict 2'-O-methyl molecular beacon/target RNA hybridization by submitting the molecular beacon as DNA in Hyther

(164). Only the hybridizing region in the probe was used in predicting the Tm of the hybridized duplex, as performed in an earlier study (186), because the Hyther server required two strands of the same length. Just as the prediction of intramolecular folding of the probe, two foldings were performed with 4mM Mg2+ and 9mM Mg2+ respectively.

(Table 2.2) Regardless of the Mg2+ and the spermidine concentration, the predicted Free energy at 37 °C was -27.60 to -29.03 kcal/mol, 27-fold higher than the predicted free energy of unfolding the stem-loop structure of the probe. It was worthy of noting that the free energy predictions made in Mfold and Hyther were from different algorithms thus can only serve as a coarse comparison. This roughly 27-fold difference in free energy seen here was so dramatic that a high affinity binding could readily be expected. And the predicted melting temperature of the duplex (72.3-75.5°C) ensured the duplex would not dissociate at the in vitro transcription temperature (25-37°C).

However, this predicted Tm was made by submitting the loop of the probe as

DNA. The experimental Tm is inevitably higher than the predicted value, since the 2'-O- 71 methyl nucleotides have higher binding affinity than 2'-deoxyl nucleotides to the same

RNA target (164,167). The Tm values of melting probe/target RNA duplexes were increased by 15-20°C from DNA probes to 2'-O-methyl probes in duplexes with about

50% GC content (167). Given that the designed probe has a lower GC content (39%), a reasonable estimate for the experimental Tm value of melting the probe/target duplex would be about 80-85°C, about 10°C higher than that predicted by the Hyther server.

2.2.2.2.4 Verification of the binding sit.

A target specificity check was conducted using Basic Local Alignment Search

Tool (BLAST) in National Center for Biotechnology Information (NCBI). The sequence of glyQS leader RNA (910 ) and the complement of the whole molecular beacon were submitted in “blastn”, the standard nucleotides alignment tool in BLAST (187). Only one hit showing the proposed target region was obtained with no similar domains. Therefore, the proposed molecular beacon was highly expected to bind only to the selected target sequence (239-261nt) in the glyQS mRNA leader region during in vitro transcription.

2.2.3 Upstream Probe: UPprb

2.2.3.1 Sequence of the Probe and the Target

The target sequences for all the previous probes were only available when the readthrough occurred. After the test of the terminator probes and the readthrough probe, the need to monitor the terminated transcripts arose. It is intriguing to monitor the full- length and the terminated transcripts simultaneously by using two probes. Thus another 72 probe [UPprb, 5' Cy3-(C6-NH)-cguAUAUUUUAUAGUacg-Dabcyl 3'] was designed that targeted the first 12nt in the glyQS 5' UTR. The lower letters indicate deoxyribonucleotides, while the upper case bold letters represent 2'-O-methyl nucleotides. The underlined sequences are the region complementary to the selected target sequence. The shadowed letters are the stem nucleotides.

Selecting a target sequence present in both the terminated and full-length transcripts of the glyQS T box riboswitch was particularly challenging due to the highly compact nature of this mRNA region (Figure 1.4 and Figure 1.5). The Stem I and antiterminator cannot be the probe target because they form a delicate complex with the natural ligand, tRNAGly. Although no evidence so far showed the linker region between the Stem I and antiterminator directly interacted with tRNAGly, the binding of an additional probe with a bulky fluorophore-quencher pair so close to the T box-tRNA complex may disturb the optimal interaction and the riboswitch function. Modification of the DNA template that resulted an additional stretch of A at the 5' of all transcripts was considered but later dismissed due to the possible interruption to the Stem I structure.

According to the recently solved crystal structure of the Stem I-tRNA complex (116), all the structural motifs on the Stem I were involved in the interaction, including the GA motif near the bottom (Figure 1.5). Addition of an unnatural sequence may adversely affect the integrity of the Stem I thus was considered unfavorable. Therefore, the only option for the probe target was the 12 nucleotides at the beginning of all transcripts.

2.2.3.2 In Silico Prediction of UPprb Folding and Binding

2.2.3.2.1 Prediction of intra-molecular folding of UPprb

To ensure the probe remains folded in the absence of the target, the prediction was conducted in Mfold (169) assuming in the same way as the readthrough probe, except the folding temperature. The UPprb failed to generate a negative free energy at

37°C, indicating it was possibly unfolded at this temperature. Thus 25°C was used in the prediction. The Mg2+ concentration was set at 9 mM. Two possible conformations were found within the 80% suboptimal free energy.

The two possible conformations differed in the size of the stem, 4nt or 5nt. Since the loop region remained single-stranded, both structures were appropriate for the application of a molecular beacon probe.

Although the predicted Tm values of unfolding the two possible structures were only 37.4°C and 35.4 °C, the experimental Tm would be higher due to the stabilization effect of the Cy3-Dabcyl pair. The increment of Tm should be similar to that mentioned above in the readthrough probe section because the stabilization caused by contact quenching through the same Dabcyl quencher was similar, regardless of the fluorophore identity (160). Thus the experimental Tm should be around 46°C, 10°C higher than the predicted value. This new probe should fold properly at both 25°C and 37°C in the absence of the target.

2.2.3.2.2 Predict the UPprb/target duplex hybridization

The thermodynamic property of the duplex was predicted in silico to confirm that the UPprb/target hybridization was able to unfold the intramolecular folding of the probe.

Just as with the RTprb, the 2'-O-methyl loop was entered into the Hyther web server (170) as DNA, while the stem region was omitted due to the server limit.

The free energy of hybridization (-8.96 kcal/mol in Table 2.3) was 8-fold higher than that of unfolding the stem-loop structure (-1.19 kcal/mol in Table 2.4). This difference in free energy was sufficient for unfolding the probe by hybridization.

Due to the high affinity of 2'-O-methyl nucleotides to RNA, the experimental free energy and Tm of the probe/target hybridization would likely be higher than that predicted by the Hyther web server. A single-stranded probe made of 14 2'-O-methyl nucleotides, in which 8 were G or C, had a Tm 23.4°C higher than another probe of the same length made of DNA (167). Since only one strong GC pair (1/12) was present in the UPprb/target duplex, much less than the eight GC pair (8/14) in the previous study (167), the increase of Tm due to the 2'-O-methyl nucleotides should not be as dramatic. Thus a reasonable estimate of the experimental Tm was about 32°C

Table 2.3 Thermodynamic properties of the two dominant UPprb conformations predicted by Mfold.

Conformation number 1 2 Free energy at 25 °C (ΔG) -1.19 kcal/mol ±5% -0.97 kcal/mol ±5% Enthalpy (ΔH) -29.70 kcal/mol ±10% -28.70 kcal/mol ±10% Entropy (ΔS) -95.6 cal/(K·mol) ±11% -93 cal/(K·mol) ±11%

Melting Temperature (Tm) 37.4 °C ± 2-4 °C 35.4 °C ± 2-4 °C The percent suboptimality was set to 100% free energy which displayed a full list of all possible conformations.

Table 2.4 The UPprb-target hybridization predicted by Hyther.

Hybridization type DNA/RNA Input Loop of the probe (DNA) 5'-ATATTTTATAGT-3' sequences Target (RNA) 3'-UAUAAAAUAUCA-5' Free energy at 25 °C (ΔG) -8.96 kcal/mol

Prediction Enthalpy (ΔH) -73.60 kcal/mol Results Entropy (ΔS) -216.80 eu

Melting Temperature (Tm) 22.6 °C Only the complementary regions between the probe and the target were submitted. The loop of UPprb was submitted as DNA due to the server limitation.

2.2.3.2.3 Verification of the binding site

Since the target region of UPprb was short (12nt), the possibility of undesired binding to a different region increased. Fortunately, no other site with seven or more adjacent nucleotides complementary to the probe was found in the 317-nt glyQS mRNA

5' UTR by BLAST (187). Sequences of six or less adjacent nucleotides complementary to the probe were not favorable comparing to the desired target region of twelve 76 complementary nucleotides, thus did not impose a problem for specific binding of the probe.

2.3 Evaluation and Optimization of the Assay

After the probes were designed and obtained, efforts were made to evaluate the probes and the assay experimentally.

2.3.1 Melting Curves and Preliminary Tests of the Probes

To determine their folding statuses between 25°C and 90°C, the melting profile of each probe in the absence and presence of the corresponding short target sequence was measured by fluorescence monitored thermal denaturation analysis. After a desired melting curve for a probe was obtained, an initial in vitro transcription using this probe was conducted to demonstrate the proof of concept.

2.3.1.1 TERprbRNA

The probe (TERprbRNA) was incubated with 0 nM, 0.1 nM, 1 nM, 10 nM, 100 nM and 1000 nM target sequence (TERseq). The fluorescence was measured at every degree from 25°C to 90°C (Figure 2.5). Between 25°C and 37°C, the fluorescence remained the same in the absence (0 nM) and presence of various amount (0.1~1000nM) of the target sequence concentration, indicating the probe did not bind the target sequence and remained in the stem-loop conformation. Certain unexpected intramolecular interaction within the probe, as a nature of the complex RNA folding, may prevent its binding and 77 unfolding. From 37°C to 90°C, different melting curves was observed when 100 nM or more target concentration was present, possibly implying moderate interaction between the probe and the target. However, no sign of binding at the feasible transcription temperature (25-37°C ) immediately eliminated the possibility of using this probe,

TERprbRNA.

2.3.1.2 TERprbDNA

At the temperature between 25°C and 65°C, In the presence of, TERprbDNA with

100 nM and 1000 nM target sequence generated apparently higher fluorescence than that with 10 nM or less target (Figure 2.6). This was a good sign showing the probe was unfolded through binding to the target sequence and the fluorescence was no longer quenched. However, the identical melting profile was seen in the presence of 10 nM or less target, showing that the detection limit of the probe, TERprbDNA, was possibly between 10 nM and 100 nM and was not sensitive enough.

Since the melting curve of TERprbDNA showed certain promise, this probe was tested in an initial in vitro transcription of the glyQS mRNA leader region in the presence

(tRNA-induce antitermination) and in the absence (basal level antitermination) of the cognate tRNAGly (Figure 2.7A). The temperature of the transcription was set at 25°C, since the fluorescence difference was the largest at this temperature when different amounts of the target sequence was present. The plot of fluorescence vs time appeared to be hyperbolic, implying the increase in RFU was due to the enzymatic activity of the

RNA polymerase. 78

Figure 2.5 Melting curve of the RNA terminator probe: TERprbRNA

The target sequence (TERseq) concentration was varied from 0 to 1000 nM as indicated in the graph (n=2). Buffer condition is: 20 mM Tris-HCl, pH 8.1, 40 mM KCl, 4 mM

MgCl2.

However, the fluorescence increase was not tRNAGly-dependent since the reactions in the presence and absence of tRNAGly had almost identical RFU readings throughout the 2-hr incubation time. Moreover, the fluorescence in the controls with no glyQS DNA template produced a similar increase. In other words, the fluorescence increase was not dependent on the glyQS leader DNA template either.

A previous study published in 1989 proved that the DNA-dependent RNAP was able to synthesize RNA in the absence of any RNAP promoter region. The unusual transcription was initiated by using a ds DNA region as the primer and proceeding using the adjacent ss DNA region as a template (188). A hypothesis was thus made: The increase of fluorescence was generated by a promoter-independent transcription of the loop of the DNA probe (TERprbDNA). The new transcripts complementary to the probe unfolded the stem-loop structure and held the probe in the linear conformation. 79

Figure 2.6 Melting curve of the DNA terminator probe: TERprbDNA

The target sequence (TERseq) concentration was varied from 0 to 1000 nM as indicated in the graph (n=2). Buffer condition is as follow: 20 mM Tris-HCl, pH 8.1, 40 mM KCl, 4 mM MgCl2.

Follow-up experiments were performed to test this hypothesis and proved that the

DNA probe (TERprbDNA) was used as the template in the promoter-independent transcription (Figure 2.7). Two sets of transcription mixture were prepared and both were incubated in a thermocycler at 25°C for 90 min. TERprbDNA was added to the first set before the 90-min incubation and to the second set after the incubation. Reaction mixtures were then transferred to a spectrofluorometer for fluorescence reading in the next 20 min. The first set of reactions with TERprbDNA added at the beginning (0 min) showed no RFU increase between 90 and 110 min, since the fluorescence had reached the plateau within the first 90 min (Figure 2.7B). The second set of reactions with TERprbDNA added after the 90-min incubation showed lower fluorescence than those in the first set

(Figure 2.7C). The most striking difference was that further fluorescence increase was 80 observed after addition of the probe to the second set after the 90-min incubation, indicating the undesired stimulation of fluorescence by the TERprbDNA.

Control reactions in the absence of RNAP or NTPs were included to prove the increase in RFU was indeed a result of the enzymatic activity. Without RNAP or NTPs, the fluorescence remained constant over the whole incubation time (Figure 2.7 B and C).

This clearly suggested that the observed fluorescence increase was indeed because of the transcription by the E.coli RNA polymerase. And the NTPs were depleted by such promoter-independent transcription of the probe.

To prevent the undesired non-specific transcription, deoxynucleotides should not be used. Given the RNA probe failed to bind the RNA target, a probe made of a backbone material other than DNA and RNA was needed. 81

Figure 2.7 TERprbDNA transcribed by RNAP independent of promoter (A) Transcription monitored in real-time by using TERprbDNA (n=2).

(B) Left: After adding TERprbDNA, reaction mixture was incubated for 90 mins. Right:

Reaction mixture was incubated for 90 mins first in the absence of TERprbDNA, followed by addition TERprbDNA. Fluorescence of all reaction mixture was then measured (n=2). In 2+ all reactions, [RNAP] = 0.06U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM. The concentration of tRNAGly, when needed, was 1.6 µM.

2.3.1.3 TERprbCHIM

According to a previous study, a molecular beacon fully made of 2'-O-methyl nucleotides did not have non-specific transcription, because 2'-O-methyl nucleotides were not tolerable substrates for E.coli RNAP (166). And the use of DNA as the stem 82 helped improve the hybridization kinetics of a molecular beacon (189). Therefore,

TERprbCHIM was designed as mentioned above.

The melting curve of TERprbCHIM was obtained in the presence of various amounts of the target sequence, TERseq (Figure 2.8). In the absence of the target sequence, the Tm of this MB appears to be between 50°C and 60°C, indicating the probe was in the closed conformation at and below 37°C. This Tm remained within the similar range until the concentration of the target sequence and the probe was equal (100 nM). When the target concentration (1 µM or 10 µM) exceeded the probe concentration, the melting curve was clearly shifted to a different profile with a Tm around 38°C. This different melting temperature possibly reflected the unzipping of the probe/target duplex. The clear fluorescence differences observed between 25°C and 37°C suggested TERprbCHIM was monitoring the amount of the target sequence. However, these melting profiles were obtained in the absence of spermidine. When the probe was used in an in vitro transcription mixture in the presence of 5 mM spermidine, the possibility of spermidine- induced stabilization of the stem-loop structure of the probe cannot be excluded. Thus the

Tm of the probe in the transcription mixture may be higher than what was observed here.

The chimeric probe, TERprbCHIM was then tested in a preliminary in vitro transcription (Figure 2.9). In the presence of 1.6µM tRNAGly, the fluorescence increase was obviously more dramatic than that in the basal level reaction in the absence of tRNAGly. The tRNAGly-induced stimulation of antitermination was successfully detected using TERprbCHIM. More importantly, the control with the DNA template omitted showed 83 no increase of fluorescence (blue, MB background), suggesting the promoter-independent transcription was prevented by the 2'-O-methyl loop.

Figure 2.8 Melting curve of the chimeric terminator probe: TERprbCHIM

The target sequence (TERseq) concentration was varied from 0 to 10000 nM as indicated in the graph (n=2). Buffer condition is as follow: 20 mM Tris-HCl, pH 8.1, 40 mM KCl,

4 mM MgCl2.

Figure 2.9 Preliminary use of TERprbCHIM to monitor the antitermination. (A) real-time fluorescence during the transcription (n=2). (B) Analysis of (A) by

Readthroughmax (n=2). In all reactions, [RNAP] = 0.06U/µL, [TERprbCHIM] = 100 nM, [Mg2+] = 4 mM, [spermidine] = 5 mM. The concentration of tRNAGly, when needed, was

1.6 µM. Readthroughmax = the final relative fluorescence unit (RFU) at 180 min minus the initial RFU.

2.3.1.4 RTprb

The melting curve of RTprb was obtained in the presence of various amounts of the corresponding target sequence, RTseq (Figure 2.10). One striking unusual feature of the melting result was the overall decrease of fluorescence while the temperature was increased. This was caused by the poor quantum yield of the fluorophore Cy5 at higher temperatures (182).

In the absence of the target sequence, the fluorescence had an initial decrease when the temperature was raised from 25°C to 44°C, followed by a relatively stable stage including a minor increase from 45°C to 65°C and a minor decrease from 66°C to 90°C.

When only small amount of the target was present, the melting curve remained similar to that without the target, demonstrating the thermal denaturation of the probe. Similar to 85 those observed with TERprbDNA and TERprbCHIM, the melting curves started shifting to a different profile when equal amount of RTprb and the target was present. When excess amount of the target was present (1µM and 10µM), the fluorescence became almost linear against temperature. This implied that the probe remained complexed with the target throughout the heating process from 25°C to 90°C and the decrease in RFU was likely a quantum yield reduction of the fluorophore Cy5. The Hyther web sever (170) predicted the melting temperature of the probe/target duplex was 80 - 85°C when the probe was submitted as DNA. It was known that 2'-O-methyl nucleotides had a higher affinity to RNA than a DNA probe to the same RNA target (164). Therefore, it is possible that the actual melting temperature of the probe/target duplex exceeded 90°C, so the temperature used in this test was not enough to separate the duplex.

Figure 2.10 Melting curve of the chimeric readthrough probe: RTprb.

The target sequence (RTseq) concentration was varied from 0 to 10000 nM as indicated in the graph (n=2). Buffer condition is as follow: 20 mM Tris-HCl, pH 8.1, 40 mM KCl, 4 mM MgCl2.

The preliminary use of RTseq distinguished the basal level and the tRNA-induced reaction clearly (Figure 2.11). Since the target region of RTprb only existed in the full- length transcripts, avoiding a possible shift between antiterminator and terminator, more evaluations were performed with this probe.

Figure 2.11 Preliminary use of RTprb to monitor the T box riboswitch antitermination A) Real-time fluorescence during the transcription (n=2). B) Analysis of (A) by 2+ Readthroughmax (n=2). In all reactions, [RNAP] = 0.02U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM. The concentration of tRNAGly, when needed, was 1 µM.

Readthroughmax = the final relative fluorescence unit (RFU) at 180 min minus the initial RFU.

2.3.1.5 UPprb

A preliminary in vitro transcription was conducted using UPprb. Unfortunately, the probe did not induce any increase of fluorescence during the whole incubation process

(data not shown), suggesting the probe did not bind to the target during transcription.

Two possible causes may explain the failure of UPprb-target binding: 1) The first 12nt in 87 the glyQS mRNA leader region may be structured rather than single-stranded predicted in

Mfold (Figure 2.4). The 12 2'-O-methyl nucleotides with only one G-C pair did not have sufficient favorable hybridization free energy to overcome the intrinsic local structures.

2) The bulky three-dimensional structures of the fluorophore Cy3 did not fit into the limited space on the bottom of the Stem I (Figure 2.4). Thus the desired hybridization did not occur due the local structural hindrance to the incoming Cy3.

2.3.2 Structural Integrity and Fluorophore Photostability of the Probes

The structural integrity and fluorophore photostability of RTprb and TERprbCHIM were tested by incubating each of them with various concentrations of their corresponding targets under the in vitro transcription condition (Figure 2.12A, 2.13A).

During the 3-hour incubation time, the fluorescence in all the reaction wells remained stable. In the absence of their target sequence ([target sequence ] = 0 nM), the stable fluorescence over the 3-hour incubation indicated the probes had a good structural integrity free of significant degradation, because the degradation of the probes would lead to an increase of RFU through separation of the fluorophore and the quencher. The lower fluorescence than that in the presence of the targets suggested, in the absence of the target, the probes adopted a stem-loop conformation which allowed the contact quenching between their respective fluorophore and quencher.

In addition, although the fluorophore was exposed to the excitation light frequently due to the reading taken every five minutes, the stable outcome in RFU 88 suggested a good photostability of the fluorophores, FAM on TERprbCHIM and Cy5 on

RTprb, free of photobleaching during the 3-hour incubation.

2.3.3 Target Sensitivity of the Probes

For the three probes, RTprb, TERprbCHIM and UPprb, the fluorescence and the target sequence concentration was plotted (Figure 2.12B, 2.12C, 2.13B, 2.13C, 2.14B, 2.14C).

For RTprb and TERprbCHIM, the fluorescence was obtained at the end of 3-hour incubation, while for UPprb, the fluorescence was obtained after a 10-min incubation. The plots clearly reflected the process of saturating all the thre e probes with their respective targets at high concentrations. When the target sequence was less than the amount of the probe, there was a reasonable linear relationship between observed fluorescence and the target sequence concentration. This suggested all the three probe were sensitive enough to detect 5 nM target sequence.

Figure 2.12 Incubation of TERprbCHIM with the target sequence (TERseq) A) Representative fluorescence monitored throughout the 3-hour incubation of

TERprbCHIM with indicated concentration of TERseq. Fluorescence measurements were taken every five minutes in which every 15-minute data were plotted (n=2). [TERprbCHIM] = 100 nM, [Mg2+] = 4 mM, [Spermidine] = 5 mM, [RNAP] = 0.02 U/µL.

B) Fluorescence measurement at 180 min in (A) was plotted against TERseq concentration. Fitting was conducted in Prism using one-site specific binding model 2 (n=2, R =0.94). The relative fluorescence (Frel) equals the fluorescence in the presence of target sequence minus the fluorescence in the absence of the target sequence. C) The linear portion of the plot when the target sequence concentration was equal to or below 80 nM (y=3.19x-1.28, R2=0.998).

Figure 2.13 Incubation of RTprb with the target sequence (RTseq)

A) Representative fluorescence monitored throughout the 3-hour incubation of RTprb with indicated concentration of the target sequence. Fluorescence measurements were taken every five minutes in which every 15-minute data were plotted (n=2). [RTprb] = 100 nM, [Mg2+] = 4 mM, [Spermidine] = 5 mM, [RNAP] = 0.02 U/µL.

B) Fluorescence measurement at 180 min in (A) was plotted against RTseq concentration. Fitting was conducted in Prism using one-site specific binding model (n=2, R2=0.92).

The relative fluorescence (Frel) equals the fluorescence in the presence of target sequence minus the fluorescence in the absence of the target sequence. C) The linear portion of the plot when the target sequence concentration was equal to or below 80 nM (y=3.10x+1.91, R2=0.991).

Figure 2.14 Sensitivity of UPprb to the target sequence (UPseq) A) Fluorescence measurement was taken after 10-min incubatioon and plotted against

UPseq concentration. Background in the absence of the target sequence (UPseq) was subtracted from every data point. Fitting was conducted in Prism using one-site specific 2 binding model (n=2, R =0.98). The relative fluorescence (Frel) equals the fluorescence in the presence of target sequence minus the fluorescence in the absence of the target sequence. B) The linear portion of the plot when the target sequence concentration was equal to or below 60 nM. RFU-RFU0 = fluorescence in the presence of target sequence minus that in 2 2+ the absence of target sequence (y=1.08x+3.79, R =0.974). [UPprb] = 100 nM, [Mg ] = 4 mM, [Spermidine] = 5 mM, [RNAP] = 0.02 U/µL.

2.3.4 Optimize RNAP Concentration

Several different RNAP concentrations were tested to determine the optimal for the assay (Figure 2.15). To determine the maximum response, 1.6µM tRNAGly was used with 0.06U/µL or 0.03 U/µL RNAP. The ratio of the Readthroughmax in the tRNA- induced and the basal level reactions indicated a better dynamic range associated with a higher enzyme concentration. 92

To conserve the RNAP and reduce the cost for future large scale ligand screening, a lower enzyme concentration was needed. While 0.02 U/µL RNAP provided an acceptable Readthroughmax ratio between the tRNA-induced and the basal level reactions, further decrease of the RNAP concentration led to an overly small dynamic range.

Hence the optimal RNAP concentration was about 0.05-0.06 U/µL and the lowest useful concentration was 0.02 U/µL.

2.3.5 Selection of the Background Control

Among all the necessary components in the reaction mixture, three reagents were essential for function: NTPs, RNAP and DNA template. Omitting any one of the three should lead to complete abolition of transcription and steady fluorescence. However, the comparison among the three different control reactions showed differences (Figure 2.16).

The no-NTPs control correctly showed no increase of fluorescence over the 3-hour incubation. By contrast, the no-RNAP control had a slight increase in RFU, while the no- template control had a minor but significant increase of fluorescence. Hence, the no-

NTPs control was selected as the background control used in the future.

Figure 2.15 Reducing RNAP consumption Different concentrations of RNAP were tested as indicated in the graphs. The tRNAGly was used in tRNA-induced reactions at 1.6µM in (A) and 40 nM in (B). In all reactions, 2+ [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM, 5% (v/v) DMSO.

Readthroughmax (RFU) = the final relative fluorescence unit (RFU) at 180 min minus the initial RFU at 5 min (n=2).

Interestingly, the differences among the three candidate background controls provided additional insights of the assay. The fluorescence level was different in the controls at the beginning of the reaction (Figure 2.16A). The fluorescence difference in the no-RNAP control and the no-template control implied the impact of RNAP on the readthrough probe. The E. coli RNAP may bind to two sites in this assay. Firstly, since the study mentioned above showed the non-specific transcription of the DNA probe,

TERprbDNA, by the E. coli RNAP, it was likely that the RNAP bound to the stem of RTprb made of DNA as well. While the RNAP was not able to transcribe the loop of RTprb made of 2'-O-methyl nucleotides, the binding unfolded a small percentage of the probe and stimulated a small signal. Secondly, the promoter region on the glyQS DNA template was the other obvious binding site of the RNAP in the in vitro system. The omission of the 94

DNA template (no-template control) reduced the total number of the RNAP binding sites and forced more RNAP to bind to and unfold more RTprb, leading to the highest fluorescence background signal. The no-RNAP control did not have the RNAP-induced unfolding of RTprb, thus had the lowest background signal. The difference in the two controls confirmed the minor RNAP-RTprb interaction. The no-NTPs control had the same number of the potential RNAP binding interactions as the tRNA-induced and basal reactions so the fluorescence was the most useful in the determination of the background.

The minor increase of RFU in the no-template control was possibly caused by the transcription of the stem of the readthrough probe. Although the 2'-O-methyl nucleotides in the loop of RTprb cannot be transcribed by the E. coli RNAP, the short DNA stem may still be used as a transcription template (188) which may produce single-stranded RNAs complementary to the DNA stem and opening of the stem-loop structure. Although this activity may not be as strong as that observed with the promoter-free transcription of a single stranded DNA template (188), the presence of the large amount of spare RNAP with necessary NTPs may promote the action to a small extent and cause the minor fluorescence increase.

Nevertheless, the undesired activity was negligible in the tRNA-induced and basal reactions likely because most RNAP engaged in the transcription of the glyQS leader

DNA template.

Figure 2.16 Comparison of three background controls (A) Real-time fluorescence during the transcription. Either NTPs, DNA template or RNAP was omitted to obtain the background fluorescence (n=2, error bars smaller than symbol size). (B) Analysis of (A) by Readthroughmax(RFU). In all reactions, [RNAP] = 2+ 0.02U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 1 mM, 5% (v/v) DMSO, 5% PEG8000. The concentration of tRNAGly in the tRNA-induced reaction was 1.6 µM.

Readthroughmax (RFU) = the fluorescence (RFU) at 180 min minus that at 5 min.

2.3.6 Multiplexing of TERprbCHIM and RTprb

Since only minimal spectra overlap was observed between Cy5 and FAM (Figure

2.3), the two probes labeled by the two fluorophores, TERprbCHIM and RTprb, respectively was used simultaneously in one reaction to enable a multiplex detection. The use of two probes may provide cross verification of the results.

The multiplex reaction was compared with transcriptions with only either of the two probes (Figure 2.17). Although the multiplex reaction properly yielded signal from both probes, the signal strength was not as good as the reactions with either of the two probes used individually. Besides, the dynamic range of the assay, i.e. the difference 96 between the tRNA-induced reaction and the basal level reaction, was decreased by using the two probes simultaneously. Consequently, only one probe, RTprb was used in the following studies due to a simpler interpretation. Unlike TERprbCHIM, the target region selected for RTprb was only synthesized when the readthrough occurred.

Figure 2.17 Multiplexing TERprbCHIM and RTprb

Reactions was monitored by using a single probe, TERprbCHIM or RTprb, were compared with those monitored by using a multiplex of both probes (n=2). In all reactions, [RNAP] = 0.03 U/µL, [probe] = 100 nM, [Mg2+] = 4 mM, [spermidine] = 5 mM. The Gly concentration of tRNA , when needed, was 40 nM. Readthroughmax(RFU) = the final relative fluorescence unit (RFU) at 180 min minus the initial RFU at 5 min.

2.3.7 Insufficient tRNA Folding can be Tolerated in this Assay

Previous research showed that a misfolded tRNA impaired the proper aminoacylation process by tRNA synthetases ( 190). Thus the effect of RNA folding in this antitermination assay was investigated. The cognate tRNAGly was folded in two 97 ways. The properly folded tRNAGly was produced by an incubation at 80°C for 2 minutes followed by a 60-minute slow cooling at the room temperature (111,180). The misfolded tRNAGly was generated by an incubation at 80°C for 90 seconds followed by addition of

Mg2+ to 10 mM and a snap cooling and incubation in ice-water (190). The tRNAGly produced by the two different folding methods were tested (Figure 2.18). Surprisingly, a similar enhancement of the antitermination was observed, regardless of the tRNAGly folding protocols.

Given the intensive interaction between the T box riboswitch and the cognate tRNA (127,134), especially the recognition of tRNA D/T loop core tertiary interaction by the T box AG bulge-Distal loop (112,117) (Figure 1.5), it was unlikely that the T box riboswitch did not require the proper tRNA folding. Instead, the misfolded tRNAGly may be rescued in two ways. Firstly, the misfolded tRNA species may be rescued by the reaction buffer condition and high room temperature during the half hour reaction set up time. Secondly, during the 3-hour in vitro transcription time, the misfolded tRNAGly was incubated at 25°C with 4 mM Mg2+ and 5 mM spermidine both of which were known to facilitate RNA folding (51 ,191). The tRNA folding intermediate trapped in the misfolded conformation might have been rescued by the temperature and salt condition. Since the rate of transcription was kept low intentionally by using a low temperature (25°C) and small amount of NTPs, the rate of fixing the misfolded tRNAGly might exceed the rate of transcription. Nevertheless, the assay was not affected intensively by the folding protocols of tRNAGly. This observation eliminated a possible factor that may affect the 98 outcome of the assay, allowing a simpler interpretation of the factor being examined, such as the effect of a ligand.

Figure 2.18 Comparison of two tRNAGly folding protocols A) Real-time fluorescence during the transcription (n=2). B) Analysis of (A) by

Readthroughmax(RFU). In all reactions, [RNAP] = 0.06U/µL, [TERprbCHIM] = 100 nM, [Mg2+] = 4 mM, [spermidine] = 5 mM. The concentration of tRNAGly, when needed, was

1.6 µM. Readthroughmax (RFU) = the final relative fluorescence unit (RFU) at 180 min minus the initial RFU at 5 min.

2.3.8 Specific Recognition of tRNAGly

Since the T box riboswitch in the Bacillus subtilis glyQS responsed only to tRNAGly (109), the specificity of the in vitro antitermination assay was tested.

Two tRNAs from the Bacillus subtilis and their mutants were used in the specificity test. The wild-type tRNAGly is the cognate ligand (109). The wild-type tRNATyr (131) was used as a negative control because most of its nucleotides were 99 different from the tRNAGly (e.g., different anticodon, different D/T loop nucleotides, different acceptor stem sequence and different discriminator base). The tRNAGly (U73A) was a mutant of the cognate tRNAGly with a single nucleotide mismatch at the discriminator base. The tRNATyr (A73U) (136) was a mutant of the negative control with a matched acceptor end (Figure 2.19).

Despite the initial attempts to show different levels of tRNA-induced antitermination and obtain EC50 values for each of the four tRNAs, all tRNAs, except the cognate tRNAGly, produced the same amount of the readthrough products as the basal level reaction (Figure 2.19). This suggested that the tRNA-antiterminator interaction was so paramount in the T box function under these conditions that even a single nucleotide mismatch in the discriminator base (tRNAGly (U73A)) was not tolerable.

Figure 2.19 Specific recognition of tRNAGly by glyQS T box riboswitch

Averages of Readthroughmaxwere compared (n=3). In all reactions, [RTprb] = 100 nM, [Mg2+] = 4 mM, [spermidine] = 5 mM. The concentration of each tRNA was 100 nM.

Readthroughmax(RFU) = the fluorescence (RFU) at 180 min minus that at 5 min. 100

Gly 2.3.9 Apparent Affinity (EC50) of tRNA in this Assay

The apparent affinity of tRNAGly was investigated. The tRNAGly concentration ranging from 0 to 1 µM was used in the antitermination assay and the resulting fluorescence was monitored in real-time over a 3-hour incubation. The reaction time was plotted against fluorescence (Figure 2.20A, 2.20C). To obtain the Readthroughrate30-60, the slopes of each plot were obtained from the seven data points between 30 to 60 minutes where the increase of fluorescence appeared linear.

The apparent affinity of tRNAGly to the T box riboswitch in the current experimental condition (20 mM Tris-HCl, pH 8.1, NaCl 40 mM, MgCl2 4 mM, spermidine 5 mM, 25°C) was derived in Prism by plotting the logarithmic concentration

Gly of tRNA against the Readthroughrate30-60 (Figure 2.20B, 2.20D). A dose-response stimulation model with a variable slope was selected when fitting in Prism.

Gly The EC50 of tRNA were determined for two RNAP concentrations, 0.05 U/µL and 0.02 U/µL. The RNAP concentration of 0.05 U/µL yielded an EC50 of 31 nM for

Gly tRNA , while 0.02 U/µL RNAP yielded 47 nM. The two EC50 values were within the

95% CI of each other, suggesting a similar apparent affinity of tRNAGly in this assay.

Combining the results from incubating RTprb with the target sequence (Figure 2.13), this assay demonstrated a highly sensitive response to the cognate tRNA level with the lowest detection limit of 1 nM and an EC50 of 30-50 nM.

The first 30 minutes was avoided to allow NTPs enough time to diffuse across the whole mixture volume and mobilize all RNAP. In order to monitor the reaction as soon as possible and prevent introduction of additional variation by pipetting up and down, no 101 mixing was performed after addition of NTPs. The diffusion of NTPs was efficient and similar to the facilitated diffusion (153) since the RNAP was constantly taking up NTPs and creating regional low concentration to allowing easy diffusion of NTPs. Being cautious, the initial 30 minutes were still given to NTPs for diffusion.

The fluorescence readings after 60 minutes were not included in the slope calculation because the plots started to deviate from the linearity and became flat in the current assay condition (0.05 U/µL RNAP). The deviation was possibly caused by the depletion of certain reaction component(s) over the course of transcription, possible

NTPs or RTprb, or the accumulation of inhibitory products, such as pyrophosphate. 102

Gly Figure 2.20 EC50 of tRNA when using 0.05U/µL or 0.02U/µL RNAP. A) and C) Representative real-time fluorescence in the presence of different [tRNAGly] as indicated in the graph. RNAP concentration was 0.05U/µL in A) and 0.02U/µL in C);

B) and D) Fitting the Readthroughrate30-60 obtained from A) and C) to the logarithmic concentration of tRNAGly. A dose-response stimulation model with a variable slope was Gly used in fitting. (B) With 0.05U/µL RNAP, the EC50 of tRNA was 31 nM (95% CI = 2 Gly 23-42 nM, n=3, R =0.97). (D) With 0.02U/µL RNAP, the EC50 of tRNA was 47 nM 2 2+ (95% CI = 23-92 nM, n=3, R =0.91). In all reactions, n=3, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM. See Materials and Methods for definition of

Readthroughrate30-60.

103

2.3.10 Nonspecific Enhancement of Fluorescence

When tRNAGly was used in high concentrations, i.e. 5µM to 10µM, an unusual high fluorescence at the beginning of the transcription was observed. No unusual signal was recorded when TERprbCHIM was in use.

A possible hypothesis to explain the cause of the high starting RFU is that there may be a burst phase reaction at the beginning of the incubation time when all reagents are at the maximum concentration. However, the real-time monitoring of the transcription did not show any sign of burst phase reaction. Another possibility is that the origin of high RFU occurred before the start of the transcription, i.e. addition of NTPs.

The reaction setup process was thus monitored by taking a fluorescence reading after addition of each reagent (Figure 2.21A). The step-wise measurement enabled a reliable tracking of the fluorescence change. The first reagent being transferred to the reaction wells was the master mix which included most components in the reaction, such as Tris buffer, MgCl2, NaCl, spermidine, Dithiothreitol (DTT), RNase inhibitor, RNAP and

DNA template. The RFU reading in all wells after adding the master mix was the same, differing only slightly due to the pipetting error. By contrast, a dramatic increase of fluorescence was observed right after adding 1µM or more of the tRNAGly. The NTPs were not present in the mixture at this stage, so no transcription was initiated and no target RNA was synthesized. The increase in RFU suggested an unexpected direct

Gly interaction of RTprb with high concentration of tRNA .

After plotting the tRNAGly concentration against the fluorescence (Figure 2.21B), a clear correlation was observed when the tRNAGly concentration exceeded 1µM. 104

In an effort to elucidate the initial high fluorescence caused by the tRNAGly, the two previously used mutant, tRNAGly(U73A) and tRNATyr(A73U) were tested in the assay at various concentrations (Figure 2.22). While the same initial high fluorescence was detected with tRNAGly(U73A), the tRNATyr(A73U) did not induce the RFU increase before the start of transcription.

Gly The possible hybridization of tRNA and RTprb was examined by checking sequence complementarity by performing alignment in BLAST (188). No intensive complementary regions were found. A follow-up in silico analysis using the DI-Nucleic

Acid hybridization and melting prediction tool (DINAmelt) (192) did not predict any interaction (Figure 2.23).

Gly Therefore, the unexpected interaction between tRNA and RTprb possibly involved certain tertiary contacts beyond sequence complementarity. The core structure of the tRNAGly likely is involved, however, the affinity of the reaction was low because

Gly Gly more than 10-fold tRNA (>1 µM tRNA and 100 nM RTprb) was required to move the equilibrium to a detectable level. While these unexpected results are intriguing from the standpoint of tertiary recognition of tRNA by a small nucleic acid analog, further investigation was beyond the scope of this project and will be investigated in other studies.

Gly Although the undesired tRNA -RTprb interaction posed a complication for the in vitro antitermination assay, a close examination of the plot of tRNAGly concentration against fluorescence showed no detectable correlation when tRNAGly was lower than 1

µM. Therefore the assay was valid when the tRNAGly was kept below 1 µM. 105

Gly Figure 2.21 The unexpected interaction between RTprb and tRNA A) Representative fluorescence monitored during reaction setup and first 50 mins. Arrows showed the time points of adding the labeled reaction component to the mixture. The 0 min indicated the start of plate preparation, while addition of NTPs at 40 minute 2+ marked the actual start of transcription. In all reactions, n=3, [RTprb] = 100 nM, [Mg ] = 4 mM, [Spermidine] = 5 mM, [RNAP] = 0.02 U/µL. B) Plot of fluorescence against logarithmic tRNAGly concentration.

Gly Figure 2.22 Testing the interaction of RTprb with two analogs of tRNA Fluorescence was plotted against logarithmic concentration of two analogs of tRNAGly: Gly Tyr 2+ (A) tRNA (U73A), (B) tRNA (A73U). In all reactions, n=3, [RTprb] = 100 nM, [Mg ] = 4 mM, [Spermidine] = 5 mM, [RNAP] = 0.02 U/µL. 106

Gly Figure 2.23 Prediction of the interaction between tRNA and RTprb by DINAmelt. Gly Both the tRNA and RTprb sequences were submitted as DNA due to the server Gly limitation. Initial concentration of tRNA (A) was 10 µM and RTprb (B) 0.1 µM. The Na+ and Mg2+ concentrations were set to 40 mM and 4 mM respectively. Au (solid red Gly Gly line): unfolded tRNA , Bu: unfolded RTprb, Af (broken blue line): folded tRNA , Bf: Gly Gly folded RTprb, AA: tRNA homodimer, BB:RTprb homodimer, AB: dimerized tRNA Gly and RTprb. Tm: melting temperature of tRNA .

2.3.11 Determination of the Resolution of the Assay

Since the RNAP was kept at a low concentration to conserve materials and reduce cost, a well-defined statistical method was needed to evaluate the separation of the tRNA- induced (positive) and the basal level (negative) controls for the assay at the current condition. The Z' factor was previously described as the window coefficient for high- throughput screening (193). The Z' factor for any assay ranges from 1 (perfect) to 107 negative values (worst). An excellent assay should have a Z' factor between 1 and 0.5, while an acceptable assay between 0.5 and 0.

Two experimental conditions were tested and Z' factor was obtained for each.

(Table 2.5). When using 0.05U/μL RNAP with 100 nM tRNAGly, excellent Z' factors (>

0.5) were obtained. When using 0.02U/μL RNAP with 15 nM tRNAGly, the resolution was reduced but remained acceptable shown by smaller Z' factors (0< Z'<0.5 ).

Therefore, the high RNAP concentration should be used if the consumption of the enzyme was feasible, for example, in structure-function relationship studies. In large scale ligand screenings, the low RNAP concentration is not optimal but acceptable and more cost-feasible.

Table 2.5 Z' factors of the two experimental conditions.

Z' factor calculated using: [RNAP] [tRNAGly] Application Readthroughmax Readthroughrate30-60

0.02U/μL 15 nM 0.24 0.14 Ligand screening Structure-function 0.05U/μL 100 nM 0.59 0.57 study Both Readthroughmax and Readthroughrate30-60 were used to calculate Z' factor respectively. The concentrations of RNAP and tRNAGly were indicated in the table. In all reactions, [RTprb] = 100 nM, [Mg2+] = 4 mM, [spermidine] = 5 mM. See “Materials and Methods” for the method of calculating Z' factor.

108

2.3.12 Determination of the Limiting Factor

To comprehensively understand the way in which the antitermination assay works, the limiting factor(s) that caused the fluorescence to reach a plateau required elucidation. Several possible causes for the fluorescence plateau were hypothesized. 1)

The GTP, CTP and UTP were used at a low concentration (0.1 mM) to promote RNAP pausing and tRNAGly-induced antitermination. Thus the plateau was possibly caused by the depletion of the small amount of GTP, CTP or UTP. The E. coli RNAP holoenzyme saturated with the α-subunit is sensitive to temperature. 2) A higher temperature causes dissociation of the subunits and subsequent loss of enzymatic activity. Thus the manufacturer recommended storage temperature for the RNAP is -80°C. The loss of enzymatic activity at the assay temperature of 25°C was a possible cause. 3) The degradation of tRNAGly or DNA template may contribute to the fluorescence plateau as well. These hypothesis were tested separately.

After the fluorescence reached the plateau in a 6-hour incubation, additional NTPs were added to the reaction mixture (Figure 2.24 filled circle). The same amount of DDI

H2O was added to the controls to maintain the same volume. The rise of fluorescence was successfully restored and comparable to the fluorescence increase at the beginning of the

6-hour incubation. Therefore the depletion of NTPs was a plausible explanation of the plateau and likely to be the major limiting factor of the assay. Besides, the restoration of fluorescence increase showed that the accumulation of pyrophosphate was not significant enough to cause product inhibition. 109

In separate wells, addition of fresh RNAP to the reaction mixture after the 6-hour incubation was tested similarly (Figure 2.24 empty diamond). The fluorescence remained constant after adding the active RNAP freshly taken out of the -80°C storage.

When additional RNAP and NTPs were added simultaneously to the reactions after 6 hours (Figure 2.24 empty square), the restored increase in RFU was the same as adding NTPs alone. This confirmed that the additional NTPs added was the sole cause of the restoration of fluorescence increase without any contribution from the additional

RNAP.

To test the hypothesized degradation of the reaction components, especially tRNAGly and glyQS DNA template, another set of reactions were prepared. In some reactions, the reaction mixture was pre-incubated for 6-hour with all the necessary components except the RNAP and/or tRNAGly. These reactions with the pre-incubation were compared with the control reactions without the pre-incubation (Figure 2.25A). The tRNA-induced and basal level reactions with both of the RNAP and tRNAGly added after the 6-hour pre-incubation (Figure 2.25A empty circle) produced the same fluorescence as the controls, suggesting degradation of any other components, i.e. NTPs, spermidine and

DNA template, was not a concern. However, when the tRNAGly was included in the pre- incubated mixture for 6 hours (Figure 2.25A filled circle), the final fluorescence was

~10% lower than that in reactions where tRNAGly was not exposed to the experimental mixture for the extra six hours. This indicated the tRNAGly had a minor degradation in the

6-hour incubation, possibly due to a spontaneous in-line cleavage (174) triggered by the 4 mM Mg2+ and enhanced by the 5 mM spermidine present in the mixture. 110

To directly exhibit the remaining activity of the RNAP after the static pre- incubation, another set of reactions pre-incubated the reaction mixture without NTPs for six hours followed by the addition of NTPs (Figure 2.25B). The final fluorescence produced by the RNAP pre-incubated for six hour (Figure 2.25B filled and empty triangle) was not lower than the controls. Hence there was no evidence for loss of the

RNAP enzymatic activity during the reaction period.

Figure 2.24 Determination of the limiting factor

Real-time average fluorescence (n=3) with background subtracted (Frel) was plotted. The arrow indicated the time point (370 min) of adding more components whose identities were labeled after a plus sign (+). “+H2O” indicated the controls with the same amount of

H2O added to maintain the same volume with other reactions. In all reactions, [RTprb] = 100 nM, [Mg2+] = 4 mM, [spermidine] = 5 mM. The tRNAGly concentration in the tRNA- induced reactions were 100nM. Initial concentration of [RNAP] = 0.05 U/µL, [ATP] = 400 µM, [CTP/GTP/UTP] = 10 µM. When indicated, the same amount of RNAP and/or NTPs as that at the beginning were added at 370 min. 111

Figure 2.25 Stability of tRNAGly, RNAP and NTPs in the assay

Real-time average fluorescence (n=3) with background subtracted (Frel) was plotted. The arrow indicated the time point (370 min) of adding the omitted (A) RNAP or (B) NTPs. Omission of RNAP or NTPs only allowed a 6-hour pre-incubation for testing component stability in the reaction mixture. The tRNA-induced reactions were supplied with 100nM tRNAGly at different time points, 0 min or 370 min, as specified in the graph. In all wells, 2+ the final reaction condition was [RNAP] = 0.05 U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM.

112

2.3.13 Effect of Ambient Temperature Variation

The thermal control module of the microplate reader used active heating and passive cooling. The different ambient temperature in the lab at different times of the year varied from 20°C to 28°C. This variable room temperature impacted the assay temperature directly. When the room temperature was below 25°C, the assay temperature was well-kept at 25°C. When the room temperature exceeded 25°C, however, the assay temperature followed.

In order to determine if the minor increase in the assay temperature impaired the assay, all the control reactions were performed at 25°C and 28°C (Figure 2.26). Although the reactions at 28°C showed a slightly larger Readthroughmax possibly due to the better

RNAP activity at a higher temperature, the dynamic range of the assay was not altered significantly. The same observation was obtained both in the presence and absence of

DMSO. Besides, similar results were obtained at 25°C and 28°C when test screening was performed using 2 ligands in 3% DMSO (Appendix 1), and 8 aminoglycosides in the absence of DMSO (Appendix 2). Therefore, the ligand screening was unlikely to be affected by the small variation in the ambient temperature.

113

Figure 2.26 Effect of ambient temperature variation on the control reactions The control reactions were tested at 25°C and 28°C in the presence and absence of 3% 2+ DMSO. In all reactions, n=6, [RNAP] = 0.02 U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM. The concentration of tRNAGly in the tRNA-induced reactions was 15 nM. For an explanation of the transcription control, refer to the section 3.6.2.

2.3.14 Improve tRNA Yield in the Purification Process

To maintain an adequate supply of tRNA essential for the current assay, the tRNA synthesis and purification procedure was reviewed. After in vitro synthesis of tRNA by transcription and separation by PAGE, the conventional purification method used soak- shake elution followed by ethanol precipitation. The yield of tRNA was improved dramatically by replacing the two steps with electroelution and use of a centrifugal filter unit. The electroelution yielded over three-fold more tRNA than the soak-shake elution

(Table 2.6), while the use of a centrifugal filter unit yield over two-fold more tRNA than the ethanol precipitation (Table 2.7). 114

Table 2.6 The yield of tRNA after the soak-shake elution and the electroelution.

Soak-shake elution Electroelution

Ab260/Ab280 1.71 2.20 Concentration 115 µM 6.74 µM Volume 40 µL 2300 µL Total amount retrieved 4.6 nmol 15.5 nmol

Table 2.7 The yield of tRNA from ethanol precipitation and centrifugal filter unit. Concentrating by Ethanol precipitation centrifugal filter unit

Ab260/Ab280 1.75 1.70 1.832 Concentration 83µM 32 µM 131 µM volume 40 µL 15 µL 66.4 µL Total amount retrieved 3.80 nmol 8.70 nmol The total volume of tRNA extracted from the gel by eletroelution was divided equally into two halves. One half was subjected to ethanol precipitation, while the other half was concentrated by using a centrifugal filter unit. Due to the volume limit, the ethanol precipitation was conducted in two separate microtubes and results combined.

115

CHAPTER 3. STUDY THE T BOX RIBOSWITCH MECHANISM AND LIGAND

INHIBITION

After the comprehensive evaluation, the in vitro antitermination assay was used to study the mechanism of the T box riboswitch.

3.1 Possible Equilibrium between Antiterminator and Terminator Structures

Although different accessibility was shown in the termination and antitermination, the target sequence of TERprbCHIM does exist in both the terminated and full transcripts

(109). And the ultimate accessibility of the target region on the readthrough transcripts over a long period of time, i.e. 2-3 hours for in vitro transcription, remains unknown. This is due to the unknown fate of the cognate tRNA in the T box riboswitch. If the tRNA dissociates first before the degradation of the riboswitch, the structure of the full-length transcripts may shift from the antiterminator to the terminator because of the higher thermodynamic stability of the latter. In such a scenario, the target region in the full- length transcripts would become inaccessible and prevent binding and unfolding of the probe, leading to a fluorescence signal disproportional to the amount of the readthrough products.

To determine whether the structural shift existed, in vitro transcription was incubated for 20 hours to deplete all NTPs and establish the fluorescence plateau. A second dose of tRNAGly equal to the amount added before transcription initiation was added to the reaction mixture to re-bind any full-length transcripts not in complex with the previously added tRNAGly. Such re-binding would re-liberate the target sequence of 116

TERprbCHIM, leading to an obvious increase in fluorescence. However, no significant increase of fluorescence was detected after the second addition of tRNAGly (Figure 3.1).

This suggested that the proposed structural shift between the antiterminator and terminator on the full-length transcripts, if any, was insignificant. In addition, the detection of the readthrough transcripts by the terminator probe, TERprbCHIM is valid.

Figure 3.1 Possible equilibrium between the antiterminator and terminator.The tRNAGly- induced reaction contained 30 pmol tRNAGly. The same amount of tRNAGly was added to all the three reactions at 1220 min. n=2.

3.2 Effect of Molecular Crowding on the T Box Riboswitch

Molecular crowding was mimicked by using poly-ethylene glycol (PEG) of a molecular weight of 8000 Dalton (Figure 3.2 insert). The following three reactions were tested at 0%, 10%, 15% and 20% PEG (wt/v): antitermination induced by the minimal

(15 nM) and the maximal (1.6 µM) amount of tRNAGly, basal level reaction, background 117 control (Figure 3.2). The 10%, 15% and 20% PEG (v/v) completely abolished the difference among the reactions observed in the no-PEG controls. It was likely that the overly crowded environment prevented the interactions necessary for the transcription, i.e. binding of the RNAP to the DNA template or uptake of NTPs by the RNAP.

The follow-up study reduced the PEG to 5% (wt/v) (Figure 3.3). Inhibition to the transcription control and the tRNAGly-induced readthrough was similar, indicating the inhibitory effect of PEG on the transcription mechanism. However, a similar inhibition was not observed in the basal level reaction, i.e. in the absence of tRNAGly. A possible explanation was the known effect of PEG to facilitate the folding of compact RNA structures with a smaller radius (21-23). The stem-loop glyQS antiterminator made of 33- nt was obviously smaller and more compact than the long terminator made of 55nt. In the presence of tRNAGly, tRNAGly-T box interaction greatly stabilized the antiterminator so that the molecular crowding may not affect the equilibrium between the antiterminator and the terminator. And the inhibitory effect of the molecular crowding on the transcription was detected when more transcripts were synthesized. In the absence of tRNAGly, the 5% (wt/v) PEG had a detectable impact on the spontaneous folding of the riboswitch, favoring the smaller more compact antiterminator over the larger terminator.

Thus the inhibitory effect of PEG on the transcription mechanism was offset by the enhanced readthrough which was a result of the PEG-facilitated antiterminator folding.

When incubating RTprb and the corresponding target sequence RTseq, the 5%

(wt/v) PEG did not interfere with the linear portion of the plot, implying the PEG did not affect the probe-target binding (Figure 3.4). 118

The presence of 5% (wt/v) PEG reduced the dynamic range of the tRNAGly- induced readthrough without affecting the apparent affinity of tRNAGly to the riboswitch.

(Figure 3.5) The inhibition to the transcription mechanism was an obvious cause of the small dynamic range observed with PEG. However, the possibility of an impaired tRNAGly-antiterminator interaction induced by 5% (wt/v) PEG cannot be eliminated.

Figure 3.2 Effect of molecular crowding mimicked by PEG8000. The structure of PEG is shown by the insert. RNAP holoenzyme was used at 0.02U/µL in all reactions. Readthroughmax was plotted (n=2).

119

Figure 3.3 Effect of molecular crowding mimicked by 5% of PEG.

RNAP holoenzyme was used at 0.05 U/µL in all reactions. The Readthroughrate was plotted (n=3). For an explanation of the transcription control, refer to the section 3.6.2.

Figure 3.4 Effect of 5% PEG on the sensitivity of RTprb to the target sequence

The relative fluorescence (Frel) equals the fluorescence in the presence of target sequence minus the fluorescence background in the absence of the target sequence. (A) Fitting was conducted in Prism using one-site specific binding model (n=2, no PEG: R2=0.98, 5% PEG: R2=0.98). (B) The linear portion of the plot when the target sequence concentration was equal to or below 80 nM (0% PEG y=3.10x+1.91, R2=0.991; 5% PEG 2 2+ y=3.03x-0.99, R =0.982 ). In all reactions, [RTprb] = 100 nM, [Mg ] = 4 mM, [Spermidine] = 5 mM, [RNAP] = 0.02 U/µL. 120

Gly Figure 3.5 Effect of 5% PEG on the EC50 of tRNA . Gly All Readthroughrate30-60 were normalized to that with the lowest tRNA concentration tested (1 nM) and plotted. A dose-response stimulation model with a variable slope was Gly used in fitting. In the absence of PEG, the EC50 of tRNA was 30 nM (95% CI = 23-40 2 Gly nM, n=3, R =0.97). In the presence of 5% PEG, the EC50 of tRNA was 26 nM (95% CI 2 2+ =31-50 nM, n=3, R =0.84). In all reactions, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM. [RNAP] = 0.05 U/µM.

3.3 Effect of DMSO on the T box Riboswitch Antitermination

Dimethyl sulfoxide (Figure 3.6A) is an organic solvent commonly used to help dissolve less soluble synthetic small molecules. The effect of DMSO on this assay must be determined in order to correctly interpret ligand screening results.

The inclusion of 2% or 5% (v/v) DMSO allowed a larger fluorescence increase in both the tRNA-induced and the basal level reactions. The percent enhancement in fluorescence induced by 15 nM tRNAGly was reduced from 65% with no DMSO to 35% with 5% DMSO (Figure 3.6B). The 5% (v/v) DMSO did not affect the probe-target binding because the linear portion was unchanged when the incubating RTprb and RTseq with 5% (v/v) DMSO (Figure 3.7). The subsequent experiment revealed the enhanced 121 fluorescence was likely due to a stimulated transcription mechanism (Figure 3.8). The

Gly apparent affinity of tRNA (EC50) was not significantly altered by the addition of 5%

(v/v) DMSO (Figure 3.9). However, while fluorescence was enhanced by the 5% (v/v)

DMSO, the dynamic range, the difference in RFU between the tRNAGly-induced and the basal level reaction, was instead diminished. For a confident small-molecule screening, the Z' factor was determined in the presence of various percentages of DMSO (Table

3.1). In general, the more DMSO included, the smaller Z' factors were observed.

Therefore the inclusion of DMSO had a deleterious effect on the efficacy of the assay. It was advisable to limit the presence of DMSO to a necessarily minimal percentage.

Figure 3.6 Effect of 0%, 2% and 5% DMSO on the assay

A) The structure of DMSO. B) Averages of Readthroughmax were compared. In all 2+ reactions, n=4, [RNAP] = 0.02 U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM. The percent enhancement was induced by 15 nM tRNAGly from the basal level reaction was indicated in the graph. Percent enhancement = 100% × (Readthroughmax-tRNA

- Readthroughmax-basal)/Readthroughmax-basal. Readthroughmax-tRNA and Readthroughmax-basal Gly were the Readthroughmax in the presence and absence of tRNA respectively. 122

Figure 3.7 Effect of 5% (v/v) DMSO on the RTprb sensitivity to the target sequence

The relative fluorescence (Frel) equals the fluorescence in the presence of target sequence minus the fluorescence background in the absence of the target sequence. (A) Fitting was conducted in Prism using one-site specific binding model (n=2, no DMSO: R2=0.92, 5% DMSO: R2=0.88). (B) The linear portion of the plot when the target sequence concentration was equal to or below 80 nM (no DMSO, y=3.10x+1.91, R2=0.991, 5% 2 2+ DMSO, y=2.86x+3.68, R =0.983). In all reactions, [RTprb] = 100 nM, [Mg ] = 4 mM, [Spermidine] = 5 mM, [RNAP] = 0.02 U/µL.

Figure 3.8 Effect of 5% (v/v) DMSO on the assay

Averages of Readthroughrate30-60 were compared. In all reactions, n=4, [RTprb] = 100 nM, 2+ [Mg ] = 4 mM, [spermidine] = 5 mM. Readthroughrate30-60 = the relative fluorescence unit change (RFU) between 30 and 60 minutes divided this time interval (t). For an explanation of the transcription control, refer to the section 3.6.2. 123

Table 3.1 Z' factor of the assay in the presence of various percent of DMSO

Condition Z' factor Gly [RNAP] [tRNA ] DMSO (v/v) Readthroughmax Readthroughrate30-90 0.02U/μL 15 nM 0% 0.59 0.19 0.02U/μL 15 nM 2% 0.42 0.43 0.02U/μL 15 nM 3% 0.48 0.38 0.02U/μL 15 nM 4% 0.60 0.48 0.02U/μL 15 nM 5% 0.10 -0.12 0.05U/μL 40 nM 5% 0.26 0.35

For the same condition, two Z' factors calculated from Readthroughmax and

Readthroughrate30-90 were listed.

Gly Figure 3.9 Effect of 5% (v/v) DMSO on the EC50 of tRNA Gly All Readthroughrate30-60 were normalized to that with the lowest tRNA concentration tested (1 nM) and plotted. A dose-response stimulation model with a variable slope was 2+ used in fitting. In all reactions, [RTprb] = 100 nM, [Mg ] = 4 mM, [SPD] = 5 mM. (A) Gly 0.02 U/µL RNAP: In the absence of DMSO, the EC50 of tRNA was 47 nM (95% CI = 2 Gly 24-93 nM, n=3, R =0.91). In the presence of 5% (v/v) DMSO, the EC50 of tRNA was 17 nM (95% CI =11-26 nM, n=3, R2=0.95). (B) 0.05 U/µM RNAP: In the absence of Gly 2 DMSO, the EC50 of tRNA was 30 nM (95% CI = 23-40 nM, n=3, R =0.97). In the Gly presence of 5% (v/v) DMSO, the EC50 of tRNA was 40 nM (95% CI =13-50 nM, n=3, R2=0.98). 124

3.4 Characterization of Spermidine Binding to the glyQS Antiterminator

Spermidine was added to the reaction mixture to enable a multi-round in vitro transcription that remained sensitive to the tRNA-induced readthrough. Thus it was interesting to elucidate the interaction between spermidine and the glyQS antiterminator.

3.4.1 Effect of Spermidine on the AM1A Stability

Fluorescence monitored thermal denaturation was used to investigate the effect of spermidine on the AM1A labeled by a fluorophore/quencher pair (Figure 3.10). Low concentration of spermidine (< 5 mM) stabilized the AM1A construct and raised the melting temperature, indicating the binding of spermidine to AM1A. High concentration of spermidine (>5 mM) exhibited a denaturation effect on AM1A. This agrees with the previous observed denaturation of RNA by excess polyamines (35).

125

Figure 3.10 Effect of spermidine on the stability of AM1A. AM1A was labeled by a ROX fluorophore at 5' and a BHQ2 quencher at 3'. The spermidine concentration was varied from 0 to 15000 nM as indicated in the graph. The melting was conducted in 10 mM sodium cacodylate, pH 6.5, 0.01 mM EDTA (n=2). The structure of spermidine was shown as an insert.

3.4.2 Determination of the EC50 of Spermidine on the Antitermination Assay

Various amounts of spermidine were tested in the assay and the fluorescence was monitored in real-time (Figure 3.11A, B, C). The plots of time against fluorescence showed a larger dynamic range induced by the change of spermidine concentration in the tRNAGly-induced reactions (Figure 3.11A), implying a stronger effect of spermidine in this reaction than that in the basal level (Figure 3.11B) and transcription control reactions

(Figure 3.11C). The further analysis graphed the slopes of each real-time plot against the logarithmic concentration of spermidine (Figure 3.11 D, E). A striking observation was that the tRNAGly-induced readthrough intensively relied on the presence of spermidine

(Figure 3.11E). When the spermidine concentration was low (0.001~ 0.01 mM), the 126 stimulation effect of tRNAGly was completely abolished, resulting in the same slopes between reactions in the presence and absence of tRNAGly. When the spermidine concentration is equal to and above 0.1 mM, the tRNAGly-induced readthrough started to become apparent with the maximal enhancement observed at 5 mM spermidine. The highest concentration of spermidine (10 mM) tested in the study caused a dramatic decrease in fluorescence universally. This was not surprising because high polyamine concentration was known to denature RNA structure (35) and inhibit RNAP function

(194). Spermidine also enhanced the basal level readthrough and the transcription efficiency. However, the normalized plots revealed that the enhancement by spermidine to other reactions was not as effective as that to the tRNAGly-induced readthrough.

Therefore, specific interaction likely exists between spermidine and the antiterminator.

127

Figure 3.11 EC50 of spermidine in the assay Representative real-time fluorescence of (A) tRNA-induced, (B) basal level and (C) transcription control reactions in the presence of different concentration of spermidine.

Readthroughrate30-60 was obtained from each plot. (D) Fitting Readthroughrate30-60 to the logarithmic concentration of spermidine. A dose-response stimulation model with a variable slope was used in fitting. The EC50 of spermidine was 58 µM (95% CI = 49-68 µM, n=2, R2=0.98) in tRNA-induced readthrough, 49 µM (95% CI = 41-59 µM, n=2, R2=0.96) in basal level reaction and 82 µM (95% CI = 74-91 µM, n=2, R2=0.95) in transcription control. (E) Readthroughrate30-60 in (D) was normalized to the fluorescence when 1µM spermidine was used. Normalized Readthroughrate30-60 = Readthroughrate30-60/

(Readthroughrate30-60 in the absence of spermidine). In all reactions, [RNAP] = 0.05 U/µL, 128

2+ [RTprb] = 100 nM, [Mg ] = 4 mM. For an explanation of the transcription control, refer to the section 3.6.2.

3.4.3 Determine Binding Site of Spermidine to the Antiterminator

Structural probing studies were performed using the 32P labeled antiterminator model, AM1A to characterize the spermidine-antiterminator interaction.

In-line probing (174) of 32P-AM1A was conducted in the presence of various concentration of spermidine (Figure 3.12A). While denaturation of RNA was observed with the high spermidine concentration, the cleavage profiles obtained at low spermidine levels (0-5 mM) were reliable. The slopes of the tread lines showing the change of cleavage percentage at each nucleotide position were compared (Figure 3.12B). The significant changes were found at the 7-nt bulge region which the tRNA acceptor end bound. The results obtained from the RNase T1 32P-AM1A also suggested the bulge was the binding site for spermidine (Figure 3.13). In the presence of the cognate tRNA,

RNase T1 enzymatic probing showed the increased concentration of spermidine protected the 5' portion of the bulge and the top of the A1 helix (Figure 3.14), indicating the spermidine facilitated the binding of tRNA to the antiterminator bulge.

Overall, spermidine bound to the 7-nt bulge and induced a tighter antiterminator- tRNA binding which is beneficial for the tRNA-induced readthrough.

129

Figure 3.12 In-line probing of 32P-AM1A with spermidine (A) T1: denaturing T1 cleavage ladder showed the positions of all Gs. OH: hydrolysis ladder showed all the nucleotide positions of AM1A. LC: RNA integrity control. NR: no reaction. The spermidine concentration was indicated in the graph. (B) Due to RNA denaturation induced by high level of spermidine, only the probing with 0-5 mM spermidine was analyzed and plotted. (C) Summary of the secondary structure change of AM1A induced by spermidine. Gray circle: increase flexibility, Open circle: stabilized nucleotides.

130

Figure 3.13 RNase T1 probing of the 32P-AM1A with spermidine (A) T1: denaturing T1 cleavage ladder showed the positions of all Gs. OH: hydrolysis ladder showed all the nucleotide positions of AM1A. LC: RNA integrity control. The spermidine concentration was indicated in the graph. (B) The band intensity at every nucleotide position was analyzed and plotted. (C) Summary of the secondary structure change of AM1A induced by spermidine. Gray circle: increase flexibility, Open circle: stabilized nucleotides.

131

Figure 3.14 RNase T1 probing of the 32P-AM1A with spermidine and tRNAGly (A) T1: denaturing T1 cleavage ladder showed the positions of all Gs. OH: hydrolysis ladder showed all the nucleotide positions of AM1A. LC: RNA integrity control. NR: no reaction. The spermidine concentration was indicated in the graph. The cognate tRNATyr(A73U) was present at 20μM in all reactions. (B) The lanes in (A) with 0-7 mM spermidine was analyzed and plotted. (C) Summary of the secondary structure change of AM1A induced by spermidine. Open circle: stabilized nucleotides.

132

3.5 Investigating the Putative Unknown Factor(s)

A cell extract facilitated the tRNA-induced antitermination in vitro, indicating additional unknown protein cofactor(s) may facilitate the riboswitch function ( 126).

Since the free amino acids were always present in the cellular environment in decent quantities, it was possible that the small amino acid molecules may play roles in the T box riboswitch. The newly developed antitermination assay was used to investigate if free amino acids were the proposed unknown factor(s). Since the cognate amino acid in the current in vitro antitermination assay was Glycine, it was reasonable to focus the test on Glycine and similar amino acids with short and uncharged side chains. Various quantities of free D-amino acids are present in some bacteria families, including Bacillus subtilis (195). Thus both of the D and L isomers of these amino acids were examined, except Glycine. A total number of 9 amino acids (Glycine, D- and L- isomer of Alanine,

Valine, Leucine, Isoleucine) were used in two concentrations: the physiological concentration in the Bacillus subtilis (196) and the maximum solubility concentration achievable in preparation.

The first attempt was made by adding amino acids to the basal level reaction in the absence of tRNAGly. If the spontaneous readthrough was altered significantly, the amino acid may be affecting the folding equilibrium between the antiterminator and the terminator, implying a specific interactions with the riboswitch.

Out of the nine amino acid isomers, most did not significantly stimulate the basal level readthrough, except Glycine, D-Alanine, D-Valine and D-Leucine which induced a minor, but significant dose-dependent stimulation of the basal level readthrough (Figure 133

3.15A). Since spermidine was merely a replacement rather than the natural cofactor

(126), these amino acids were tested for their ability to facilitate tRNA-induced readthrough and replace spermidine (Figure 3.15B). The use of amino acids in the absence of spermidine resulted in very low Readthroughmax and complete abolition of the tRNA-induced effect. This was consistent with the low increase in RFU observed in the spermidine dose-response curve when spermidine was in very low concentration or absent (Figure 3.11E). Thus none of the amino acids were able to replace spermidine.

The next attempt was made by a combinational use of the amino acids and spermidine. The four amino acids that stimulated basal level reactions showed a similar enhancement in the tRNA-induced (Figure 3.15C) and transcription control (Figure

3.15D) reactions. Therefore, the facilitating effects were not specific to tRNA-induced antitermination. This suggested these amino acids was unlikely to be the proposed unknown cofactor(s) that facilitated the function of the T box riboswitch in vivo.

134

Figure 3.15 Investigation of the effect of amino acids on the T box riboswitch. 135

(A) Replacing tRNAGly with amino acids. The amino acids were used at the indicated concentration. (B) Replacing spermidine with amino acids. Spermidine was not added to the all reactions. (C) Facilitation of tRNA-induced readthrough with amino acids. (D) Effect of amino acids in the transcription control reaction. The reactions in the presence of 15 nM tRNAGly were shown by gray bars, while those in the absence of tRNAGly were shown by empty bars. In all reactions, n=2, [RNAP] = 0.02 U/µL, [RTprb] = 100 nM, [Mg2+] = 4 mM. The concentration of spermidine in (A) and (C) was 5 mM, while in (B) 0 mM. For an explanation of the transcription control, refer to the section 3.6.2.

3.6 Screening for Ligands that Target the T Box Riboswitch

One of the main goals of developing this in vitro antitermination assay was to screen large ligand libraries in an efficient manner. The use of the fluorescence monitored approach in a 384-well microplate enabled a moderate-throughput screening.

In order to screen ligand libraries, further optimization was needed.

3.6.1 Determine Ligand Screening Condition and Data Analysis Method

Since a possible mechanism for the ligands of interest to displace tRNA is competitive inhibition, the tRNAGly concentration in the ligand screening should be kept low to reduce the possible competition pressure. A ligand with a current moderate inhibitory effect could provide an opportunity for developing more potent future ligands.

Although an excellent efficacy was approachable, an overwhelming tRNA concentration may lead to considerable “misses” of moderate inhibitors. When the tRNA concentration was close to the EC50 value, the fluorescence response was sensitive to minor inhibition because a small inhibition or displacement of tRNA leads to a large reduction in 136 fluorescence. The appropriate RNAP concentration for large scale ligand screening was determined in section 2.3.4 to be 0.02U/μL. Under this RNAP concentration, the EC50 value of tRNAGly was 17 nM (95% CI: 11-26 nM) in the presence of the necessary 5%

(v/v) DMSO for increasing ligand solubility. Thus 15 nM was selected as the tRNAGly concentration in the large scale screening. When the near-optimal RNAP concentration

(0.05U/μL) was used in the presence of 5% (v/v) DMSO, the determined EC50 value was

40 nM (95% CI: 30-50 nM). Thus the following comparison was performed to evaluate the outcome of using 0.02U/μL RNAP with 15 nM tRNAGly, while 0.05U/μL RNAP with

40 nM tRNAGly was used as a comparison (Figure 3.16).

Unsurprisingly, more RNAP yielded a larger dynamic range between the tRNA- induced and basal level reactions. The dynamic range obtained with the two analysis methods, i.e. Readthroughmax and Readthroughrate30-60, for each of the two experimental conditions were compared (Figure 3.16 A2 vs A3, B2 vs B3). For the same experimental condition, similar dynamic ranges (percent stimulation by tRNAGly) were observed with

Readthroughmax and Readthroughrate30-60.

Gly When 0.02U/μL RNAP and 15 nM tRNA were used, Readthroughmax appeared to be a better choice since the real-time plots did not deviate significantly from linearity and the error bars associated with Readthroughrate30-60 were larger. The Z' factor determined using Readthroughmax yielded a small advantage over that from

Readthroughrate30-60, as shown by section 2.3.11. In this case, the Readthroughmax would be able to demonstrate the accumulative effect over the whole 3-hour incubation. When

0.05U/μL RNAP and 40 nM tRNAGly were used, the real-time plot started to approach 137 the plateau 60 minutes after the start of incubation, therefore the Readthroughrate30-60 appeared to be the more reasonable choice of analysis. In addition, the error bars observed with Readthroughrate30-60 were smaller. No significant difference was observed in the Z' factors derived from Readthroughmax and Readthroughrate30-60 when 0.05U/μL

RNAP was used.

3.6.2 Detection of Nonspecific Inhibition to the Transcription Mechanism

During the study of the T box riboswitch mechanism and ligand screening, it was possible that the variants, such as DMSO, spermidine and ligands, may affect the riboswitch function as well as the transcription mechanism, i.e. promote or hinder RNAP during initiation, elongation or turn-over. In order to distinguish any effect not specific to the riboswitch, a transcription control DNA template was designed and tested.

138

Figure 3.16 Comparison of screening conditions and analysis methods. The representative real-time fluorescence observed with (A1) 0.02 U/μL and 15 nM tRNAGly and (B1) 0.05 U/μL and 40 nM tRNAGly were shown on the top. Analysis by using Readthroughmax and Readthroughrate30-60 for the two reaction conditions were shown in the middle (A2 and B2) and bottom (A3 and B3) respectively. The percent stimulation 2+ by tRNA was shown in the graphs. In all reactions, n=4, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM, 5% (v/v) DMSO. The concentration of RNAP and tRNAGly was indicated in the graphs. 139

3.6.2.1 Design of Transcription Control DNA Template

This double-stranded template was designed by connecting the DNA template of the glyQS mRNA promoter region to that of the target region. Two primer binding sites were retained to enable PCR amplification if needed (Figure 3.17). The detailed sequence of the template was included in the Appendix 1.

The DNA template for T box riboswitch does not exist in this short template construct. As long as transcription is occurring, the target RNA sequence should always be transcribed and cause RTprb to fluoresce. No known pausing site exists in this short

DNA template. Thus the fluorescence generated by transcription of this control DNA template is a direct indicator of transcription efficiency.

3.6.2.2 Determine the Concentration of Transcription Control dsDNA

In order to determine the appropriate concentration for the transcription control

DNA template, the fluorescence when using 10 nM and 5 nM of the template were compared (Figure 3.18). The 10 nM was the concentration of glyQS leader DNA template in the tRNA-induced and basal level reactions. Since the short transcription control DNA template may have a faster transcription rate due to the lack of pausing sites located in the riboswitch region (133), a lower concentration of the transcription control DNA template

(5 nM) was tested. Similar fluorescence was observed with 5 nM and 10 nM the transcription control DNA template, indicating the amount of DNA template was a limiting factor. Therefore 10 nM transcription control DNA template was used to match the concentration of glyQS leader DNA template in other reactions. 140

Figure 3.17 Scheme of the transcripts control DNA template. The DNA template for the glyQS mRNA 5' UTR and that for transcripts control were compared. The role of each region was labeled. Above: the DNA template for the glyQS mRNA 5' UTR. The regions absent in the transcription control DNA template was shown in gray. Below: the DNA template for the transcription control.

Figure 3.18 Determination of the transcription control DNA template concentration Real-time fluorescence during the transcription was plotted against time. In all reactions, 2+ n=2, [RNAP] = 0.02U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM.

3.6.3 Screening of Small Molecule Libraries

The ligand screening cascade consisted of three steps: 1) test of inhibition to tRNA-induced antitermination, 2) test of inhibition to basal level antitermination, 3) test 141 of inhibition to transcription mechanism. Only those ligands with an inhibitory effect in the first step were further tested in the following steps. The 3-hour Readthroughmax of each reaction was compared and significance (P value) was determined by a t-test.

Among the total number of 304 ligands tested from oxazolidinone, triazole and amino alcohol groups (Appendix 4, Appendix 5, Appendix 6), 25 ligands showed significant inhibition in the test of inhibition to tRNA-induced antitermination with P values smaller than 0.05. More than 10% inhibition was observed with 13 ligands. The inhibitory effects of GHB-54 and GHB-56 were not consistent over time (Table 3.2). The rest 11 ligands were further tested for their inhibition to the basal level antitermination and the transcription mechanism (Figure 3.19). Significant inhibition to the basal level readthrough reaction was observed with four ligands (GHB-1, GHB-7), two of which

(GHB-1, GHB-7) also inhibited the transcription mechanism (Figure 3.19).

3.6.4 Self-fluorescence of Synthetic Ligands

All ligands were tested for self-fluorescence before the screening (Appendix 7).

The fluorescence was measured before and after addition of 2µL of 50µM ligand in 50%

(v/v) DMSO to the reaction mixture. To compare with the solvent background, 2µL 50%

(v/v) DMSO solution was added to the controls. No ligand induced significant fluorescence beyond the controls was observed.

3.6.5 Screening of Aminoglycosides

Eight aminoglycosides, i.e. amikacin, gentamycin, kanamycin A, kanamycin B, neomycin, paromonmycin, streptomycin, tobramycin, were previously shown to bind the 142 antiterminator with various binding affinity (150). Thus they were tested in the current method. Unfortunately, no significant inhibition to all the three screening steps was detected (Appendix 3). Interestingly, neomycin moderately, but specifically, enhanced the tRNA-induced antitermination (Figure 3.20). This result is consistent with a previous study in the Hines lab in which neomycin stabilized the tRNA-AM1A interaction through binding to the antiterminator bulge nucleotides (197).

Table 3.2 GHB-56 showed inconsistent screening results.

Ligand Date Tested µM P value % inhibition October 21, 2013 50 *0.0235 -15.4 June 26, 2015 175 ***0.0004 -20.9 July 01, 2015 175 ***<0.0001 -18.6 August 20, 2015 175 **0.0183 -12.9 GHB-56 September 04, 2015 175 *0.0101 -11.7 September 20, 2015 175 *0.0297 -11.6 September 24, 2015 175 NS N/A September 24, 2015 175 NS N/A P values was obtained by a two-tail unpaird T test in Prism. The number of stars indicates significance: *** (P<0.001), ** (0.001

143

144

Figure 3.19 Results of the 11 ligands from all the three screening steps. Ligand identities are labeled on top of each graph. Open bars indicate control reactions, while shaded bars represent the same reaction in the present of 50µM ligand. The arrows in the graphs indicate significant % inhibition with the percent labeled above. The stars indicate the significance of P value as determined in Prism. In all reactions, n=2, [RNAP] 2+ = 0.02U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM, 5% (v/v) DMSO. 145

15nM tRNAGly was used in the tRNA-induced readthrough. The number of stars indicates significance: *** (P<0.001), ** (0.001

Table 3.3 GHB-54 showed inconsistent screening results. % inhibition to Ligand Date Tested µM P value tRNA-induced reaction October 21, 2013 50 **0.0089 -14.4 June 26, 2015 175 ***0.0003 -19.8 July 01, 2015 175 ***<0.0001 -15.2 July 02, 2015 175 ***0.0006 -26.3 July 08, 2015 175 ***<0.0001 -24.1 GHB-54 July 10, 2015 175 ***0.0002 -18.8 August 20, 2015 175 **0.0067 -12.8 September 04, 2015 175 **0.0053 -13.2 September 20, 2015 175 NS N/A September 24, 2015 175 NS N/A September 24, 2015 175 NS N/A December 04, 2014 50 NS N/A December 05, 2014 100 NS N/A December 05, 2014 200 NS N/A ISA03057-2 June 26, 2015 175 NS N/A August 20, 2015 175 NS N/A November 09, 2015 175 NS N/A ISA03057-2 was the re-synthesized GHB-54. P values was obtained by a two-tail unpaird T test in Prism. The number of stars indicates significance: *** (P<0.001), ** (0.001

146

Figure 3.20 Neomycin induced specific enhancement to tRNA-induced readthrough. Open bars indicate control reactions, while shaded bars represent the same reaction in the presence of 100µM neomycin. The arrows in the graphs indicate significant % enhancement with the percent labeled above. The stars indicate the significance of P value as determined in Prism. In all reactions, n=3, [RNAP] = 0.02U/µL, [RTprb] = 100 nM, [Mg2+] = 4 mM, [spermidine] = 5 mM, 0% (v/v) DMSO. 15nM tRNAGly was used in the tRNA-induced reaction. The number of stars indicates significance: ** (0.001

147

CHAPTER 4. DISCUSSION AND CONCLUSION

4.1 Development of the Fluorescently Monitored Antitermination Assay

This currently described assay significantly improved the efficiency of studying the T box riboswitch. Two T box in vitro transcription methods were previously established, but both were labor-intensive. The single-round transcription method separated the initiation, which required low Mg2+ concentration, from the elongation which needed a high Mg2+ concentration (15-30 mM) for efficient antitermination (111).

Another multi-round method simplified the process by combinational use of Mg2+ and spermidine to avoid the high Mg2+ concentration (126). Both of the single-round and multi-round methods were low throughput due to the unavoidable use of the radioisotopic

α-32P-UTP internal label, subsequent PAGE and autoradiography. Previous research in the Hines lab attempted to develop an efficient method monitored by two short single- stranded fluorescence probes but was unsuccessful (180).

While maintaining an enhanced throughput, the assay extended the scope of the study to the kinetic transcription process. Previous research in the lab utilized the carefully designed functionally relevant antiterminator model AM1A. Many critical interactions, e.g., binding of tRNA(124,127,136,198,199) and ligands (142-144,146,149-

151,200) to the antiterminator, ligand-induced disruption of tRNA-antiterminator complex (147,201), were investigated by using AM1A in equilibrium solution. The developed assay allowed examination of the riboswitch mechanism and ligand screening at a level more relevant to the physiological function. 148

The readthrough probe (RTprb) used throughout this study was designed by taking advantage of many important tools and knowledge. Before obtaining the probes, in silico tools, i.e. Mfold, Hyther, BLAST, were used to predict secondary structure and thermodynamic parameters of intramolecular folding and intermolecular hybridization all of which were critical to ensure the expected function the probes. The knowledge of 2'-O- methyl nucleotides (164,167) and the chimeric backbone chemistry ( 189) led to the successful design of RTprb and TERprbCHIM. The two probes, especially RTprb, was comprehensively evaluated in the following aspects: thermal denaturation curve, background fluorescence, specific recognition of the cognate tRNAGly, apparent binding

Gly affinity (EC50) of tRNA , effect of tRNA folding, effect of ambient temperature variation, limiting factor of the reaction, multiplexing of RTprb and TERprbCHIM. In the

Gly evaluation process, an unexpected interaction between RTprb and tRNA was encountered and determined to be insignificant at low tRNAGly concentration (<1 µM), thus did not affect the applications of the assay that usually used 15–100 nM tRNAGly.

Further optimization was conducted to find better experimental conditions for structure- function study of the riboswitch and ligand screening. Several RNAP concentrations were tested and the assay resolution window coefficient (Z') was determined in the two experimental condition tested. To obtain a large amount of tRNAGly for the study, the

RNA purification process was improved and the yielded was increased significantly.

Through the evaluation and optimization, the assay showed high specificity, as shown by the failure of induction by tRNAGly analogs, and high sensitivity, as shown by

(a) the linear relationship between the concentration of the probe and the corresponding 149

Gly target sequence and (b) the low EC50 of tRNA to the riboswitch (30-50 nM). Sufficient dynamic range was observed for reliable detection in the T box mechanism study and ligand screening.

4.2 Study the T box Riboswitch Mechanism

Using the evaluated and optimized assay, several questions related to the T box riboswitch mechanism were addressed.

A putative structural equilibrium between the antiterminator and the terminator on the full length transcripts was found to be insignificant in vitro even in the presence of

Gly tRNA . Thus the availability of the region targeted by TERprbCHIM in the full length transcripts remained unchanged after transcription. The results obtained from TERprbCHIM were reliable.

The molecular crowding mimicked by PEG had an inhibitory effect on the T box riboswitch function likely due to inhibition to the transcription mechanism. Interestingly, the basal level reaction was not inhibited, indicating a promotive effect of molecular crowding on the spontaneous folding of the smaller antiterminator. This agrees with a previous publications in which use of PEG led to RNA folding into a more compact structure (22). This indicated that, in the cellular environment, the readthrough of the T box riboswitch relies mostly on the interaction with the natural ligand, tRNA, without heavy interference by molecular crowding. In the absence of tRNA, the spontaneous antiterminator folding and readthrough may rely on a delicate balance between the 150 molecular crowding-induced transcription inhibition and facilitated antiterminator folding.

The binding of spermidine to the antiterminator was thoroughly characterized by thermal denaturation analysis, in vitro transcription antitermination assay and structural probing. Spermidine enhanced the stability of the antiterminator. The spermidine showed a well-fit dose-response curve to specifically enhance the efficacy of the tRNA-induced antitermination with a low nanomolar EC50. In-line and enzymatic probings were used to examine the binding of spermidine to the antiterminator. The spermidine binding site was the junction of the 7-nt bulge and A1 helix. The binding of tRNAGly to the 7-nt bulge was facilitated by the binding of spermidine at the nearby region.

To increase the solubility of ligands to be screened, a small amount of DMSO (3-

5% v/v) was needed in the solution. Therefore, it was important to determine whether

DMSO affected the detection by this assay. Addition of 5% DMSO did not affect the sensitivity of the readthrough prbe, RTprb, to detect the target sequence, because the linear relationship between the target sequence concentration and the fluorescence was still observed in the presence of 5% (v/v) DMSO (Figure 3.7). DMSO nonspecifically enhanced the fluorescence signal in all the three reaction types (tRNA-induced, basal level and transcription control) (Figure 3.8), but the dynamic range of the assay between the tRNA-induced and the basal level reactions was diminished when the concentration of DMSO was increased (Figure 3.6B). The smaller dynamic range was confirmed by the decreasing assay window coefficients (Z' factor) obtained when the percent of DMSO was raised from 0% to 5% (v/v). This observation is likely due to the effect of DMSO on 151 the spontaneous formation of the terminator mediated by one or all of the three following hypothesis. (1) The denaturing effect of DMSO adversely affects the formation of the long terminator structure, allowing more spontaneous readthrough. (2) The rate of RNAP transcription was enhanced by DMSO, reducing the time needed for nucleating the terminator. (3) The denaturing effect of DMSO may affect the necessary RNAP pausing sites, reducing the time window for the terminator nucleation. However, the apparent

Gly affinity of tRNA (EC50) was not significantly altered since the two EC50 values were within experimental errors in the presence and absence of 5% (v/v) DMSO. Taken together, DMSO can be used in ligand screening but should be limited to a low percentage in order to avoid false positive or false negative results caused by an overly small dynamic range, i.e. difference between the tRNA-induced and the basal level reactions.

4.3 Ligand Screening Cascade

The 3-step ligand screening cascade was designed to make the screening process time-efficient and cost-effective. In the first step, the effect of each ligand on the tRNA- induced antitermination was investigated. This step examined the comprehensive effect of each ligand in the reaction mixture. The individual effects may include the inhibition to the tRNA-induced antitermination, the shifting of the spontaneous folding of the antiterminator as well as the undesired inhibition to the transcription mechanism.

Regardless of which was the actual cause, only the ligand with an inhibitory effect was selected for further testing. This significantly reduced the number of ligands in the 152 following screening steps. In the second and third step, the effect of each ligand on the basal level antitermination and on the transcription mechanism was assessed respectively.

The transcription mechanism test helped eliminate ligands with the undesired effect, i.e. inhibition to the transcription initiation, the RNAP processivity or turn-over. Although this step was able to pinpoint what the real cause the inhibition to the transcription mechanism was, ligands with such effects were eliminated due to the structural and functional similarities between prokaryotic and eukaryotic RNA polymerases (202,203).

The comprehensive result was of more interest to the goal of the screening and the ultimate drug discovery. Testing of ligands in the basal level antitermination determined whether the inhibition observed in the first step was specific to the tRNA-induced antitermination. Since RTprb targeted a region that was only synthesized when the readthrough occurred, the basal level test was monitoring the spontaneous formation of the antiterminator in the absence of tRNA which led to a spontaneous readthrough. The spontaneous readthrough may result from the failure of the terminator to remove RNAP or the folding equilibrium between the terminator and the antiterminator.

In the ligand screening condition, the RNAP was used at an acceptable minimal concentration. While the cost was reduced, caution should be exercised to avoid further reducing the dynamic range of the assay by additional variations, such as aging of enzyme stock solutions and inaccurate concentration of reaction components.

153

4.4 Identify Lead Compounds

The fluorescent probe based functional assay identified 13 ligands with over 10% inhibition to the tRNA-induced readthrough in the first screening step. Out of the 13 ligands, 12 belonged to the GHB series of 1,4-disubstitute 1,2,3-triazole, strongly suggesting the value of the triazole class compounds. The last one belonged to the WZB series from the amino alcohol group. The results agreed well with the previous research in the lab as all the five lead compounds (GHB-7, GHB-54, GHB-56, GHB-134 and

WZB-72) identified by multiple equilibrium screening assays using the isolated antiterminator model RNA (180) were included. This clearly indicated the strength of the current assay.

GHB-7 was one of the previous lead compounds. A preliminary screening assay detected the binding of GHB-7 to the isolated antiterminator model, AM1A (146).

Although the observed Kd to AM1A determined by a FRET binding assay was moderate

(56±16 µM), the tRNA-AM1A complex was clearly disrupted as indicated by a 79% reduction in the anisotropy value and the binding site of GHB-7 was mostly likely to be the bulge of AM1A as suggested by the molecular docking study (149). In the current molecular beacon based functional screening, GHB-7 at 50 µM inhibited tRNA-induced and basal level antitermination significantly by 26.0 ± 5.9% and 28.7 ± 9.4% respectively. However, a similar inhibition by 19.2 ± 4.7% to transcription suggested the observed inhibition to the tRNA-induced and basal level antitermination was largely due to an impaired transcription efficiency, thus eliminated GHB-7 from the list of interest. 154

Additionally, the fact that GHB-7 stabilized AM1A undesirably also diminished the promise of this compound.

Another compound, GHB-1 showed significant inhibition in all the three screening steps (Figure 3.19). However, the result of GHB-1 was susceptible because a visible yellow precipitation was present in the stock solution before testing. Mostly importantly, the newly re-synthesized GHB-1, named ISA03041-2, did not show inhibition to any reaction. GHB-1 was therefore removed from the list.

It should be noted that although the inhibitory effects of GHB-7 and GHB-1 in the tRNA-induced antitermination were indeed higher than that to the other two reactions, possibly implying additional specific inhibition to the riboswitch, the additional effect was not dramatic. The limited outcome and the difficulty of characterizing the specific effect in the presence of the transcription inhibition suggested that GHB-1 and GHB-7 were of little interest for further investigation.

GHB-54 and GHB-56 were previously shown to bind AM1A and disrupt tRNA-

AM1A complex in the FRET binding assay and the anisotropy assay respectively (180).

In the current study, the individual effects of the two ligands were inconsistent over time.

Initially, good inhibition of 14.4±2.8% and 15.9±4.6% were obtained with 50 µM GHB-

54 and GHB-56 respectively. No significant inhibition was observed in the basal level read-though and the translation mechanism. Twenty month later, a confirmative testing of the two at 50 µM was not able to show significant inhibition. After raising the concentration of both ligands to 175 µM, great average inhibition of 18.1% (n=8) for

GHB-54 and 15.1% (n=5) for GHB-56 to the tRNA-induced readthrough were achieved 155 by independent experiments conducted on multiple days. However, most recent experiments on the two ligands were not able to confirm the inhibitory effect with P value smaller than 0.05. Moreover, the re-sythesized GHB-54, named ISA03047-2, did not demonstrate the expected inhibitory activity either. It was possible that unknown derivative(s) with higher potency formed spontaneously in the GHB-54 and GHB-56 stock solution over the several years of storage and usage. Due to the structural similarity of the two ligands, the derivative(s) may have the same structure and activity. Since the unknown derivative(s) were likely to be present in small amount, further oxidation or degradation may abolish the desired activity.

Both GHB-134 and WZB-72 exhibited the desired features in the previous studies: binding to AM1A and disrupting tRNA-AM1A complex (180). While GHB-134 did not increase AM1A stability (180), WZB-72 may capture an alternative conformation of the antiterminator (180). The current results proved that the two ligands were indeed able to function in the kinetic transcription process.

The rest of the 7 ligands, i.e. GHB-14, GHB-15, GHB-25, GHB-26, GHB-27,

GHB-51 and GHB-89, did not stand out in the previous screening methods possibly due to their limited binding affinities to AM1A and moderate abilities to disrupt tRNA-

AM1A complex. However, the current assay detected adequate inhibition (>10%) specific to the tRNA-induced readthrough. These ligands may be able to bind the antiterminator in faster rates and displaced tRNA during the short pausing time before the complete formation of the tRNA-T box complex and commitment to transcription readthrough. 156

Given the kinetic nature of transcription, it is reasonable to believe the ligand- target binding kinetics, in addition to binding affinity, may play a critical role in the ligand effect on the function of the T box riboswitch during the active transcription process. Future ligands should combine binding affinity with adequate binding kinetics for more potent inhibition of the T box riboswitch.

4.5 Future Work

Future study will be needed to measure binding kinetics of all ligands, with the emphasis on the lead compounds identified here. Ligands with a fast binding kinetic may bind even though the binding affinity determined in equilibrium assays are not optimal.

Another piece of useful work in the future is to establish a new probe to replace the current upstream probe, UPprb, for monitoring the total amount of transcripts. Since the only possible native sequence did not enable UPprb binding, addition of a stretch of T in the DNA template strand right after the transcription start site could provide a stretch of A in the transcript for probe binding. This added region would allow more nucleotides in the loop of the probe and increase the hybridization affinity. And the extra length may be able to avoid the possible structural hindrance between fluorophore and local RNA tertiary structure.

A probe monitoring the total number of transcripts is beneficial in several ways:

(a) When multiplexing with RTprb in the well, a 5' probe would serve as an internal transcription mechanism control specific to every individual reactions. Any inhibition to the transcription mechanism would be easily detected by a decreased total number of 157 transcripts in the same reaction. This would simplify the ligand screening procedure by eliminating the need for the external transcription mechanism control. Therefore, only two steps tRNA-induced and basal level reaction would be needed to screen one ligands.

In addition, the internal transcription control specific to each reaction would be more accurate. (b) It would provide a baseline to eliminate unknown variations among replicates obtained at different time. The new upstream probe in tRNA-induced and basal level control reactions can be used to normalize those reactions in the presence of ligands. This would help reduce the possible differences in the RNAP enzymatic activity, subtle aging of certain reaction component, ambient temperature, etc.

Characterization of the binding of the 7 previously unnoticed lead compounds to the antiterminator will be useful. Structural probing could be used to probe the specific interaction. In order to enhance throughput and possible establish a screening method for structural probing of ligand libraries, an antiterminator model longer than the current

AM1A should be labeled by a fluorophore. The products of structural probings could be resolved in capillary electrophoresis and quantified by a sequencer, rather than traditional gel electrophoresis and autoradiography, to significantly increase efficiency.

158

CHAPTER 5. MATERIALS AND METHODS

5.1 General Procedure

All experiments were performed using sterile techniques. Gloves were used to handle reagents, bottles and equipment. Autoclaved purified DI water was used to prepare buffers in large volume. All buffers were autoclaved after preparation. RNase free DDI H2O (Qiagen) was used in all the transcription and PCR reactions.

5.2 Sources and Storage Conditions

 Ni-NTA agarose resin was obtained from Qiagen and stored at 4°C.

 Centrifugal concentrator Centriprep-30 with 30,000 NMWL was obtained from

Millipore and stored at room temperature.

 Zero Blunt® TOPO® PCR Cloning Kit with One Shot® TOP10 Chemically

Competent E. coli cells was obtained from Life Technologies and stored at -80°C.

 QIAprep Spin Miniprep Kit and QIAquick PCR Purification Kit were obtained

from Qiagen and stored at 4°C.

 PfuTurbo® DNA Polymerase was obtained from Agilent Technologies and stored

at -20°C.

 AmpliScribe™ T7-Flash™ Transcription Kit was obtained from Epicentre and

stored at -20°C.

 RiboGuard™ RNase Inhibitor was obtained from Epicentre and stored at -20°C. 159

 E. coli RNA polymerase sigma-saturated holoenzyme was obtained from

Epicentre and Affymetrix and stored at -80°C.

 F1-ClipTip™ Multichannel Pipettes were obtained from Thermo Scientific.

 The VWR® Polyolefin Films with Silicone Adhesive was obtained from VWR.

 The 384-well microplates (Low Volume Black Round Bottom Polystyrene

NBS™, 10 per Bag, without Lid, Nonsterile, Product number: 4514) were

obtained from Corning.

 The γ-32P-ATP was obtained from PerkinElmer and KinaseMaxTM 5' end labeling

Kit (Thermo Fisher Scientific) both of which were stored at -20°C.

 All the tRNA variants were aliquoted and stored in 1mM MOPS buffer, pH 6.5 at

-80°C.

 All plasmids and DNA constructs were stored at -20°C in the Elution Buffer

(10mM Tris-HCl, pH 8.5) supplied in the QIAprep Spin Miniprep Kit and

QIAquick PCR Purification Kit.

 Polyethylene glycol with 8000 Dalton molecular weight (PEG8000, molecular

biology grade) and DMSO (>99.9%, molecular biology grade) were both obtained

from Sigma-Aldrich and stored at room temperature.

 Aminoglycosides was obtained from Sigma-Aldrich and stored at -20°C.

 Spermidine (≥99.5%, molecular biology grade) was obtained from Sigma-Aldrich

and stored at -20°C.

 Dithiothreitol (DTT) was obtained from Sigma-Aldrich and stored at -20°C.

 All amino acids were obtained from Sigma-Aldrich and stored at -20°C. 160

 All the buffers and solutions used directly in the in vitro transcription reaction

were stored at -20°C.

 General buffer stocks are stored at room temperature.

5.3 Preparation of T7 RNAP

His-tagged T7 RNAP was prepared according to the previous descriptions

(204,205) with modification (206). Briefly, E. coli transfected with the plasmid of His- tagged T7 RNAP was allowed to grow exponentially followed by sonication to lyse cells.

The T7 RNAP was extracted from cell lysate using Ni-NTA agarose resin. The Millipore

Centriprep-30 tubes was then used to concentration the enzyme until the concentration was between 8 ~ 12 mg/mL as determined by the absorbance at 280nm (1 Absorbance unit at 280nm is equivalent to 1.3 mg/mL T7 RNAP). Typical yield is 8-10 mL of 10 mg/mL T7 RNAP.

5.4 Cloning of Plasmid Containing DNA Templates

According to the manufacturer’s protocol, the Top 10 competent cells (Life

Technologies) were thawed on ice and mixed with 2 μL of plasmid (approximately 100 ng/µL) containing the desired DNA template. The cell and plasmid mixture was incubated on ice for 30 min followed by 42℃ 90 second and ice water 2 min. S.O.C

(Super Optimal broth with Catabolite repression) medium pre-warmed at room temperature was added to the mixture. The tube was shaked at 37℃ 250 RPM for one hour in a cell growth shaker. The resulting cell solution was spread onto Lysogeny broth 161

(LB) agar plates containing 50 μg/mL kanamycin (172). The plates with cells were inverted and incubated at 37℃ for 16-23 hours until size of colonies grew to about 1 mm diameter. One colony was transferred by using a sterile inoculation loop to one 5 mL LB medium solution containing 50 μg/mL kanamycin in a plastic conical 50 mL centrifuge tube. Four colonies were enough to produce a large amount of plasmid. Tubes were incubated at 37℃ for 16 hours with 250 RPM shaking in an incubator shaker. Cells were harvested by centrifuge at 2000×g for 10 min at 20℃ in an IEC Centra CL2 centrifuge.

Plasmid was extracted by using QIAprep Spin Miniprep Kit (Qiagen) following the manufacturer’s protocol.

5.5 DNA Amplification

The DNA templates for in vitro transcription were amplified by PCR from corresponding plasmids using Pfu turbo DNA polymerase (Agilent Technologies) according to the manufacturer’s manual. Appropriate plasmids, forward and reverse primers for tRNATyr(A73U), tRNAGly and glyQS leader region ( 133) were used as described previously (180). The reverse primers for tRNATyr(A73U) and tRNAGly were replaced by mismatched primers in order to generate variants: tRNATyr and tRNAGly(U73A) (Table 5.1).

The length of PCR products was examined by agarose gel electrophoresis containing 0.5 µg/mL ethidium bromide in the gel and run in 0.5×TBE buffer (25mM

Tris-HCl, pH 8.3, 25mM Boric acid, 0.5mM EDTA) (172). The DNA templates for tRNA requires 3% agarose, while the template for glyQS leader region 2% agarose. Each 162 well in the electrophoresis contains 1 µL G190A Blue/Orange 6X Loading Dye

(Promega) mixed with 4 µL of the resulting PCR mixture or the PhiX174 DNA/HinfI

Dephosphorylated Markers (Promega). After running electrophoresis at 125V for 1 hour, a gel image was taken under UV in a Nucleotech UV Transilluminator (NucleoVision).

The amplified DNA templates were purified by the QIAquick PCR Purification Kit

(Qiagen) following the instructions provided in the kit.

Table 5.1 The primers used for amplification of the desired DNA templates.

Forward primer Reverse primer

5′-TAATACGACTCACTATAG 5′-TGGAGCGGAAGACG tRNAGly CGGAAGTAGTTCAGTGG-3′ GGATTCGAAC-3′

5'- tRNAGly 5′-TAATACGACTCACTATAG TGGTGCGGAAGACGGG (U73A) CGGAAGTAGTTCAGTGG-3′ ATTCGAAC-3'

5′-GATAATACGACTCACT 5′-TGGAGGAGGGGG tRNATyr(A73U) ATAGGAGGGGTAGCG-3′ GCAG-3′

5′-GATAATACGACTCACT 5' -TGGTGGAGGGG tRNATyr ATAGGAGGGGTAGCG-3′ GGCAG-3'

5′-GGGTATTTAATT 5′-ATTAATCTAGATTACGAA glyQS 5' UTR AAGCTTTTGCAAG GAATATTCGGGATTGTA-3′ GTTAGAATCA-3′ 5′-GGGTATTTAATT Transcription 5′-ATTAATCTAGATTACGAA AAGCTTTTGCAAGG control GAATATTCGGGATTGTA-3′ TTAGAATCA-3′

163

5.5 Preparation of tRNA

5.5.1 In Vitro Synthesis of tRNA by Transcription

All tRNAs were made using this method. The tRNA was synthesized by in vitro transcription (172) using the AmpliScribe™ T7-Flash™ Transcription Kit (Epicentre) with the following ingredients in one reaction: 7.6μL RNase free H2O, 4 μL Ampliscribe

T7 flash 10×reaction buffer, 3.6μL each of 100mM ATP/CTP/GTP/UTP, 6μL resulting purified PCR mixture containing the amplified DNA template, 4 μL 100 mM DTT and

4μL AmpliScribe™ T7 RNA polymerase solution (Epicentre).

5.5.2 Purification of tRNA

A denaturing 20% PAGE (7M Urea, 19:1 acrylamide/bis-acrylamide, 42 cm × 33 cm × 8 mm) in 1×TBE (50mM Tris-HCl, pH 8.3, 50mM Boric acid, 1mM EDTA) was used to purify the transcribed tRNA. The solution containing tRNA resulted from transcription was loaded with equal volume of 2×denaturing loading buffer with dye

(0.1% (w/v) xylene cyanol FF, 0.1 % (w/v) bromophenol blue, 9 M Urea, 2 mM EDTA,

50 mM Tris-HCl, pH 8.3, 50 mM Boric acid). The electrophoresis was conducted at 2000

V for 10 hours. The tRNAs migrated at a rate similar to that of the bromophenol blue dye. The bands were visualized using UV shadowing and the gel area containing tRNA was cut and subsequently treated in an Elutrap electroelution system (VWR) at 125 V for

24 hours in 50mM Tris-HCl, pH 8.3, 50mM Boric acid and 1mM EDTA. The buffer was collected from the electroelution chamber once an hour for seven hours. The obtained buffer containing tRNA was applied to an Amicon Ultra-4 centrifugal filter unit with 10K 164

MWCO (Millipore). The filter unit containing the buffer with tRNA was spun at 4°C and

2400×g in a Beckman GPR centrifuge for 30 min. The same centrifugation was repeated

Gly twice after refilling the filter unit with DDI H2O each time. The resulting tRNA was retrieved and dialyzed against two bottles of 1L 1mM MOPS (pH 6.5) buffer for 24 hours. The first bottle was replaced by the second at around 10 hour.

5.6 Determination of Nucleic Acid Concentration

The concentrations of all nucleic acids were determined by measuring the absorbance at 260 nm in the Beckman DU 530 UV/Vis Spectrophotometer and subsequent calculations using Beer’s law. The extinction coefficients for double-strand

DNA templates were obtained from the UV spectrum calculator tool (IDT, http://biophysics.idtdna.com/UVSpectrum.html). The sequences of either strand of the

DNA template were submitted and “duplex DNA” was selected. The extinction coefficients for RNA were obtained from the OligoAnalyzer tool (IDT, https://www.idtdna.com/calc/analyzer) (Table 5.2). The algorithm in both of the two tools was based on the nearest neighboring approach (207,208).

When a nucleic acid construct labeled by a fluorophore and/or a quencher ( e.g., molecular beacon probes) was obtained from TriLink, the extinction coefficient provided in the manufacturer’s Certificate of Analysis was used. TriLink technical support indicated that the values included the absorption and emission of the fluorophore and quencher. Therefore the extinction coefficient were used directly without any correction.

The extinction coefficients of all the labeled nucleic acids were summarized in Table 5.3. 165

Table 5.2 The extinction coefficients of the nucleic acids used

Extinction Coefficient Nucleic Acids (L/mol·cm) glyQS mRNA leader region DNA template (dsDNA) 7020408 transcription control DNA template (ds DNA) 2659503 Antiterminator model AM1A (RNA) 256000 tRNAGly 668800 tRNAGly(U73A) 674400 tRNATyr(A73U) 771500 tRNATyr 777100

Table 5.3 The extinction coefficients of the constructs obtained from TriLink

Extinction coefficients Constructs obtained from TriLink (OD units/µmole)

TERprbRNA 263.6

TERprbDNA 256.6

TERprbCHIM 262.8

RTprb 298.0

UPprb 219.1 ROX-AM1A-BHQ2 307.7

5.7 In Vitro Transcription Antitermination Assay

5.7.1 Materials

The following probes and target sequences obtained from TriLink were purified in PAGE and/or HPLC by the manufacturer. The lower and upper case letters indicate deoxy- and ribonucleotides respectively, while the bold capital letters represent 2'-O- 166 methyl nucleotides. The underlined sequences are the region complementary to the selected target sequence. The shadowed letters are nucleotides involved in the stem.

Terminator probe made of RNA (TERprbRNA):

5' (FAM) CCUCGCCCGUCUCUAUGCUUCGAGG (C6-NH) (DABCYL) 3'

The target sequence for terminator probes (TERseq):

5' AAGCAUAGAGACGGG 3'

Terminator probe made of DNA (TERprbDNA):

5' (FAM) cctcgcccgucucuaugcuucgagg (C6-NH) (DABCYL) 3'

Chimeric terminator probe made of DNA and 2'-O-methyl nucleotides

(TERprbCHIM): 5' (FAM) cctcgCCCGTCTCTATGCTTcgagg (C6-NH) (DABCYL) 3'

Chimeric readthrough probe made of DNA and 2'-O-methyl nucleotides (RTprb)

5' (Cy5) cgcaCCUCCACUUUUCUUUCAUAAtgcg (C6-NH) (Dabcyl) 3'

The target sequence for the readthrough probe (RTseq):

5' UUAUGAAAGAAAAUGGGAGGUGC 3'

Chimeric upstream probe made of DNA and 2'-O-methyl nucleotides (UPprb)

5' Cy3-(C6-NH)-cguAUAUUUUAUAGUacg-Dabcyl 3'

The target sequence for the upstream probe (UPseq)

5' ACUAUAAAAUAUGUUGC 3'

The template strand of the transcription control DNA template:

5′-gggtatttaattaagcttttgcaaggttagaatcatgtcttgaatatgccctccacttttctttcataagtatagtaaatg atcatataaaaagatggaccaaatgtcaacttttgttttcgcgctttgattttaaatacaatcccgaatattcttcgtaatctagattaat-

3′ 167

The coding strand of the transcription control DNA template:

5′-attaatctagattacgaagaatattcgggattgtatttaaaatcaaagcgcgaaaacaaaagttgacatttggtccat ctttttatatgatcatttactatacttatgaaagaaaagtggagggcatattcaagacatgattctaaccttgcaaaagcttaattaaata ccc-3′

The template strand and coding strand were ordered from IDT separately. The dsDNA template was obtained by mixing the two ssDNAs in 1:1 ratio followed by DNA amplification according to the standard PCR procedure described above. The same forward and reverse primers for amplification of glyQS leader DNA template were used.

The amplified dsDNA template was stored at -20°C.

All the constructs were dissolved in DDI H2O without further purification and stored at -20°C.

5.7.2 Prediction of Folding Stability of the Probes

The DNA folding form in the Mfold web server (http://unafold.rna.albany.edu)

(169) was used to predict the folding stability of the two chimeric molecular beacons.

The sequences of the molecular beacons were submitted as DNA because this approach was used to estimate stability of other molecular beacons (189). The following settings were used: linear DNA folding, temperature 37°C, 40 mM Na+, 4 mM or 9 mM Mg2+ (as indicated) and 100% suboptimal free energy. The prediction assumes a two-state model between the unfolded and the folded conformation without additional intermediates

(169).

168

5.7.3 Prediction of the Probe/target Hybridization

The Hyther server (ozone3.chem.wayne.edu/cgi-bin/login/login/showLoginPage

.cgi) (170), as one of a few online servers that work with DNA/RNA heterodimers, was used to predict the hybridization between the probe and the corresponding target. Since the server requires two strands of the same length, the loop region was submitted as DNA without the stem nucleotide sequence. The target RNA sequence was submitted as it is.

The module 1, i.e. “Calculation of the hybridization thermodynamics for a given duplex”, was used in the prediction. The following settings were used: hybridization type =

DNA/RNA, temperature 37.0℃, [DNA probe] = 100 nM, [RNA target] = 200 nM,

[NaCl] = 40 mM, [Mg2+] = 4 mM

5.7.4 Prediction of 2nd structure of the glyQS mRNA leader region

The full-length glyQS mRNA transcripts consisting of 317 nt was entered into the

Mfold web server (http://unafold.rna.albany.edu) (169) with the following constraints to ensure formation of Stem I and the antiterminator in the prediction: F 15 112 3/F 24 106

4/F 36 93 6/F 46 86 5/F 59 81 6/F 127 146 7/F 150 182 5/F 162 177 6. Each “/” represents starting a new line. To compare with the terminated short transcripts, the mRNA consisting of the first 223 nt in the full-length transcripts was entered into Mfold with the following constraints to ensure formation of Stem I and the terminator: F 15 112

3/F 24 106 4/F 36 93 6/F 46 86 5/F 59 81 6/F 127 146 7/F 171 213 8/F 180 204 10. Each

“/” represents starting a new line.

169

5.7.5 Binding Site Specificity Check

Nucleotide Basic Local Alignment Search Tool (BLASTn) in NCBI

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) (187) was used to examine whether there were undesired binding sites in vitro within the glyQS leader region for the molecular beacons.

The “Search for short nearly exact matches” was used, while the smallest word size was set to seven nucleotides, the least stringent criteria.

5.7.6 Optimization of Excitation, Emission and Cutoff

According to a personal communication with a Molecular Devices technical support specialist, the following protocol was used to optimize the SpectraMax® M5

Microplate Reader (Molecular Devices):

Excitation and emission settings were initially optimized in cuvette with the

Photomultiplier Tube (PMT) setting to medium. If the emission signal was weak, the

PMT setting was switched to high. An excitation scan was performed in a cuvette using the literature emission value for the fluorophore plus 50 nm as the single emission wavelength. The excitation scan started from 50nm below the literature excitation value and ended at 10 nm below the emission value in use. The wavelength where the maximum RFU was observed was recorded as the selected excitation for the next step.

Using the excitation wavelength selected above, a background emission scan using buffer alone without the fluorophore started 10nm above the excitation in use and ended 50nm above the literature emission value of the fluorophore. A cutoff filter was not needed at this time. The scan was repeated for 10 times with the excitation 170 wavelength 5nm below the previous one every time. Totally 10 different excitation wavelengths spanning from the initially selected wavelength to 50nm below that wavelength were tested for background emission. After adding the fluorophore to the cuvette to a final concentration of 100nM, the above mentioned 10 scans were repeated.

The best emission was located at the wavelength where the fluorescence peak was observed. The background and emission in all scans were plotted and compared in one graph in SoftMax Pro (Molecular Devices). The best excitation wavelength was the one whose background at the maximum emission wavelength was below 1 RFU.

Selection of the optimal cutoff filter was conducted in a microplate. Two wells were used in this step: buffer-only control and buffer with 100 nM fluorophore. Using the excitation and emission optimized in cuvette, multiple emission scans were conducted in both wells to test all the available cutoff filters in the microplate reader. Several cutoff filters close to the emission wavelength of the fluorophore were selected. One emission scan was performed without using the cutoff filter as a control. Since the fluorophore was unchanged, the wavelength of the emission peak remained at the same wavelength.

Background fluorescence in the buffer-only well in every scan was examined. A good cutoff filter suppresses the fluorescence at the fluorophore emission wavelength below 1

RFU in the buffer-only well, since background above 1 RFU was usually caused by undesired stray light. If none of the cutoff filters avoided stray light, another excitation wavelength 5-10 nm lower than the previous one was used. Multiple emission scans with different cutoff filters were repeated until a good cutoff filter was identified. If necessary, fine tuning of excitation by 1-2 nm at a time was performed to find the very best 171 excitation and excitation wavelengths. The best cutoff filter was usually the one about 5-

15nm below the best emission wavelength.

5.7.7 Testing of the probes with target sequences

The probes, TERprbCHIM, RTprb and UPprb, were incubated with their corresponding short target sequences, TERseq, RTseq and UPseq respectively in the solution containing 20 mM Tris-HCl, pH 8.1, 40mM KCl, 4 mM MgCl2, 5 mM spermidine, 1 mM DTT, 0.23

U/µL Riboguard RNase inhibitor (Epicentre), 100 nM molecular beacon, 10S nM glyQ leader region DNA template or transcription control DNA template and 0.4 µL 1 U/µL

E.coli RNAP holoenzyme (Epicentre or Affymetrix). See the following section 5.7.8 for the preparation of the incubation mixture. NTPs was not included in the mixture to prevent transcription and production of new transcripts. The target sequence concentration was indicated in each figure. The incubation was conducted for three hours at 25°C in the SpectraMax M5 microplate reader (Molecular Devices) with a fluorescence measurement taken every 5 minutes.

The graph of target sequence concentration against the relative fluorescence (Frel) was plotted. The relative fluorescence (Frel) equals the fluorescence in the presence of target sequence minus the fluorescence in the absence of the target sequence. The saturation of the probes by their corresponding target sequence was fitted in Prism using nonlinear one-site specific binding model. The linear relationship before the saturation was fitted in Prism using linear regression model without forcing the line to go through

(0,0). 172

5.7.8 Assay Procedure

In the ligand screening studies, the following procedure was used. The tRNAGly with 10 times the desired final concentration was denatured at 80°C in DDI H2O for 2 min followed by a renaturation at room temperature for about 1 hour. The master mix for each reaction was prepared by mixing the following stock solutions: 2µL IVT buffer II

(200 mM Tris-HCl, pH 8.1, 400mM KCl, 40 mM MgCl2), 0.8µL 125 mM spermidine,

0.8µL 25 mM DTT, 0.8µL 5.71 U/µL Riboguard RNase inhibitor (Epicentre), 0.8µL

2.5µM molecular beacon, 2 µL 100 nM glyQS leader region DNA template or transcription control DNA template, 0.4 µL 1 U/µL E.coli RNAP holoenzyme (Epicentre or Affymetrix). Appropriate amount of RNase free DDI H2O (Qiagen) was added to make the total volume of the master mix for one reaction well 14 µL.

The 14 µL master mix was added to each well in a 384-well microplate (Corning

3676, black, round bottom, non-binding surface, non-sterile) while minimizing introduction of bubbles. The ligand was diluted by 50% (v/v) DMSO solution to 10 times of the desired final concentration. 2μL the diluted ligand solution and 2μL the renatured tRNAGly were added into each sample well. For reactions that did not need ligand or

Gly tRNA , e.g., controls and basal level reaction, 2μL 50% (v/v) DMSO and 2μL DDI H2O were added to maintain the same volume at every addition step. After each addition, a fluorescence reading was taken in the endpoint mode in the SoftMax Pro software

(Molecular Devices) using the SpectraMax M5 microplate reader (Molecular Devices) with the following settings. For the fluorophore FAM: excitation wavelength

(λex)=485nm, emission wavelength (λem)=527nm, cutoff filter wavelength (λCF)=515nm, 173 medium PMT sensitivity, number of readings 4-12. For the fluorophore Cy5: λex=642nm,

λem=672nm, λCF=665nm, high PMT sensitivity, number of readings 12. For the fluorophore Cy3: λ ex=525nm, λem=570nm, λCF=550nm, high PMT sensitivity, number of readings 12. The reaction mixture in each well was mixed by pipetting up and down carefully to avoid incorporation of air and centrifuged briefly with a film in a benchtop microplate centrifuge to remove bubbles. 2μL NTPs, consisting of 0.1 mM GTP, 0.1 mM

CTP, 0.1 mM UTP and 4 mM ATP, was added by using F1-ClipTip Multichannel

Pipettes (Thermo Scientific) to each well to initiate the transcription reaction. After another 12-second centrifugation, an optically clear polyolefin film (VWR) was applied to the entire microplate to prevent sample evaporation.

The final reaction mixture contained 20 mM Tris-HCl, pH 8.1, 40 mM KCl, 4 mM MgCl2, 5 mM spermidine, 1 mM DTT, 0.23 U/μL Riboguard RNase inhibitor

(Epicentre), 10 nM molecular beacon, 10nM glyQS leader region DNA template or transcription control DNA template, 0.02 U/μL E.coli RNAP holoenzyme (Epicentre or

Affymetrix).

The microplate was then incubated at 25°C in the SpectraMax M5 plate reader.

The antitermination during in vitro transcription was monitored in real-time using the kinetic mode with the same excitation, emission and cutoff settings as those used in the endpoint mode, except one reading was taken every 5 min over a course of 3 hours. At the end of 3-hour incubation, the polyelefin film was removed to obtain the final fluorescence reading in the endpoint mode. 174

In the structure-function studies, the same procedure as the ligand screening was followed, except: 1µL 1 U/µL E.coli RNAP holoenzyme was used for each reaction, the

2µL ligand solution in 50% (v/v) DMSO was replaced by 2µL DDI H2O. When the effect of molecular crowding was studied, the PEG8000 stock solution with 10 times the desired final concentration was included in the 14 µL master mix.

Gly To determine the EC50 of tRNA , the same procedure as mentioned above was used except the 2µL tRNAGly solution added to the wells had different tRNAGly concentrations.

To determine the EC50 of spermidine, the same procedure for the structure- function studies was followed, except the spermidine was omitted in the master mix.

After transferring the 14 µL master mix, 2µL spermidine 10 times of the desired final concentration was added to each well, followed by the addition of tRNAGly, the mixing and the addition of NTPs as mentioned above.

5.7.9 Data Analysis

The fluorescence measurement data was exported from the SoftMax® Pro software (Molecualr Devices) as a .txt file. Calculations and analyses were performed in the Excel software (Microsoft) and the Prism software (Graphpad). Readthroughmax,

Readthroughrate30-60 were determined using the following methods:

Readthroughmax = RFU180min – RFU5min. RFU5min and RFU180min were the fluorescence readings at the beginning and 180 minute of the kinetic mode respectively. 175

Readthroughrate30-60 equaled the slope obtained from Prism by fitting to a linear regression model the seven fluorescence readings obtained between 30 and 60 minute in the kinetic mode. In another word, it was similar to RFU30-60/t.

To determine the significant inhibition induced by a ligand during screening, an unpaired two-tail t-test was conducted in the Prism software (Graphpad) to determine the significance of the observed differences between the control reactions and the reactions in the presence of a ligand. When a significant difference was determined by the t-test, % inhibition was calculated to quantify the inhibitory effect of a ligand on the reaction.

% inhibition = 100% × (Rligand - Rctrl)/ Rctrl

In the step of testing the inhibition to the tRNA-induced reaction, Rctrl was the

Readthroughmax in the tRNA-induced control in the absence of the ligand. Rligand was the

Gly Readthroughmax in the sample well in the presence of both tRNA and ligand.

In the assay testing the inhibition to the basal reaction, Rctrl was the Readthroughmax in the basal control in the absence of the ligand. Rligand was the Readthroughmax in the sample well in the absence of tRNAGly and presence of the ligand.

In the assay testing the inhibition to the transcription mechanism, Rctrl was the

Readthroughmax in the transcription control. Rligand was the Readthroughmax in the transcription control in the presence of a ligand.

The apparent affinity of ligands to the riboswitch, EC50, was determined after the initial data analysis was finished. The result in each experimental condition obtained by the preferred method of analysis, Readthroughmax or Readthroughrate30-60, were plotted against the logarithmic concentration of the query reagent whose EC50 awaited 176 determination, e.g., tRNAGly or spermidine. The control reaction in the absence of the query reagent (0µM) was not included in the plot due to the infinite value of log(0). A does-response stimulation model with a variable slope was selected with the ordinary

2 least square fit in Prism. The EC50 value, 95% CI and R were obtained from the Prism and reported. The number of independent replicates (n) was also reported.

Z' factor (193) was determined by the following equation: Z' =1 –

[3×(SDX+SDY)/(X – Y)]. X and Y were the Readthroughmax or Readthroughrate30-60 in the

Gly presence and absence of tRNA respectively, while SDX and SDY are their standard deviations.

5.8 Fluorescence Monitored Thermal Denaturation Analysis of probes

All the probe (TERprbRNA, TERprbDNA and TERprbCHIM labeled by FAM and

Dabcyl, and RTprb labeled by Cy5 and Dabcyl) were diluted and mixed with appropriate concentration of the corresponding target sequences, TERseq or RTseq. The concentration of the target sequences, specified in each experiment, typically ranged from 0 to 10 µM.

The 25µL final mixture, containing 100 nM probe, desired amount of target sequence, 20 mM Tris-HCl, pH 8.1, 40 mM KCl, 4 mM MgCl2, was transferred to a PCR tube and incubated in the Mx3000P Q-PCR system (Stratagene). The incubation temperature was initially kept at 25℃ for 15 minute, then raised by 1℃ at a time and hold for 3 minutes.

The heating and holding cycle was repeated 66 times from 25℃ to 90℃. The emission of the fluorophores was recorded at the end of the 3-minute holding using the default 177 wavelength provided in the equipment for the corresponding fluorophores (FAM:

λex=492nm, λem=516nm, Cy5: λex=635nm, λem=665nm,).

To detect the effect of spermidine on the stability of the antiterminator model

RNA (AM1A), 100nM ROX-AM1A-BHQ2 was incubated in 25µL buffer (10 mM sodium cacodylate, pH 6.5, 0.01 mM EDTA) with various concentration of spermidine ranged from 0 to 15 mM as indicated. The melting procedure was the same as that mentioned above, except different wavelengths for ROX (λex=585nm, λem=610nm)

5.9 Structural Probing

5.9.1 Labeling of AM1A at the 5' End

AM1A was labeled at 5' using γ-32P-ATP (PerkinElmer) and KinaseMaxTM 5' end labeling Kit (Thermo Fisher Scientific) following the kit manufacturer’s manual. The 32P

-AM1A in the labeling solution was purified by a denaturing 20% PAGE (7M Urea, 19:1 acrylamide/bis-acrylamide, 42 cm × 33 cm × 5 mm) in 1×TBE (50mM Tris-HCl, pH 8.3,

50mM Boric acid, 1mM EDTA) buffer using the same 2×denaturing loading buffer with dye described in section 5.5.2. The electrophoresis was conducted under 2000V for about

2 hour until the bromophenol blue dye migrated to the top 1/3 position of the gel. The

32P-AM1A in the resulting gel was visualized by exposing an autoradiography film

(Kodak, BioMax) to the gel in a dark room for 10 min at room temperature. The gel bands containing 32P-AM1A were cut into 1cm ×0.5cm pieces and stored at -20°C. Prior to the probing experiment, 32P-AM1A was eluted from the gel pieces by vigorous shaking for 4 hour with 330μL elution buffer (500 mM sodium acetate, pH 5.2, 1 mM EDTA) in 178 each 1.5 mL microtube. The eluted 32P-AM1A was collected using ethanol precipiation.

32 The resulting P-AM1A pellet was dried in air and resuspended in 10μL DDI H2O. The

32P-AM1A was denatured by an incubation at 90°C for 1.5 min and renatured by a slow cooling at room temperature for 30 min.

5.9.2 In-line Probing

In-line probing of 32P-AM1A was conducted in the presence of spermidine and/or tRNATyr(A73U). The following components were mixed to make the 10μL reaction mixture: 5μL 2× in-line probing buffer (100 mM Tris-HCl, pH 8.3, 200 mM KCl, 40 mM

MgCl2), 1μL 200mM MgCl2, 1μL spermidine at 10 times of the desired final concentration, 1μL tRNATyr(A73U) at 10 times of the desired final concentration, 1μL

32 trace amount of P-AM1A and 1μL H2O. The concentration of spermidine and tRNATyr(A73U) was specified in each experiment. The resulting reaction mixture (final condition: 20 mM MgCl2, 100 mM KCl, 50 mM Tris-HCl, pH 8.3) was incubated in a

25℃ water bath for 40 hrs.

The full hydrolysis ladder, RNase T1 cleavage ladder and RNA integrity controls were prepared near the end of the 40-hrs incubation. To obtain bands with similar intensity as those in reaction lanes, the incubation condition of each control was controlled carefully as described below. The denaturing T1 cleavage control was made by adding 1μL of 32P-AM1A into 7μL of the sequencing buffer (Ambion® RNase T1 Kit,

Biochemistry Grade). The mixture was incubated at 50℃ for 5 mins and cooled at room temperature for 15 mins. The denatured 32P-AM1A was cleaved by 1 U RNase 179

T1(Ambion®, Biochemistry Grade) for 12 mins, using 1μL yeast RNA (10 μg/μL) as carrier. The alkaline hydrolysis ladder was generated by adding 1μL of 32P-AM1A into

9μL of the alkaline hydrolysis buffer (Ambion® RNase T1 Kit, Biochemistry Grade) and incubated at 90℃ for 18mins. To monitor the integrity of 32P-AM1A, the integrity control was treated similarly as the hydrolysis ladder except the 9μL alkaline hydrolysis buffer was replaced by DDI. H2O

All in-line probing and control reactions were stopped by adding the equal volume (10µL) of 2×denaturing loading buffer with dye (0.1% (w/v) xylene cyanol FF,

0.1 % (w/v) bromophenol blue, 9 M Urea, 2 mM EDTA, 50 mM Tris-HCl, pH 8.3, 50 mM Boric acid).

5.9.3 Enzymatic Probing

RNase T1 enzymatic probing of 32P-AM1A was conducted in the presence of spermidine and/or tRNATyr(A73U). The following components were mixed to make the

10μL reaction mixture: 5μL DDI H2O, 1μL structure buffer (Ambion® RNase T1 Kit,

Biochemistry Grade), 1μL spermidine at 10 times of the desired final concentration, 1μL tRNATyr(A73U) at 10 times of the desired final concentration, 1μL trace amount of 32P-

AM1A. The concentration of spermidine and tRNATyr(A73U) was specified in each experiment. The resulting reaction mixture was pre-incubated for 15 min on ice at the following final condition: 10 mM MgCl2, 10 mM Tris, pH 7.0, 100mM KCl. 1μL RNase

T1 (1U/μL, Ambion® RNase T1 Kit) was added to the mixture followed by 15-min 180 incubation on ice. The reactions were stopped and control reactions prepared according to the same procedure described under the in-line probing section.

5.9.4 Autoradiography

After in-line and enzymatic probings, the cleavage profile of 32P-AM1A was analyzed by denaturing Urea PAGE (20% 19:1 acrylamide: bisacrylamide, 7M Urea,

50mM Tris-HCl, pH 8.3, 50mM Boric acid, 1mM EDTA) followed by exposing gel to an autoradiography film (Kodak, BioMax). The gel and film were placed in a cassette with an intensifying screen and incubated at -80℃ for appropriate length of time ranging from

30 min to 4 hours depending on the radioactivity of the 32P label on that day. The cassette was warmed up at room temperature for 30 mins before developing and fixing the film in a dark room.

5.9.5 Analysis of Film Image

The film image was scanned in an office scanner and analyzed by Quantity One

4.6.9 (Bio-Rad, Hercules, CA). Band and lane were selected manually by drawing a rectangle covering them. Rectangles were copied to select other bands, lanes or empty space at corresponding positions to ensure the same size. The area (mm2) and the density

(intensity/mm2) of each rectangle were obtained in “volume analysis report” generated by

Quantity One. Intensity of each rectangle [the product of area (mm2) and density

(intensity/ mm2)] was calculated in Excel. The background intensity was obtained from a nearby empty space by a rectangle of the same size, and then was subtracted from the 181 intensity of every band. To calculate th e cleavage percentage of one band in the whole lane, the intensity of the band with the background subtracted was divided by that of the whole lane without the background. The cleavage percentages of one band were plotted against the spermidine or tRNA concentration gradient in which the reactions were incubated. In Excel, a trendline was then added to each plot to show the change of cleavage upon the condition change. A slope was obtained from each trendline

(intensity/[ligand]). For gel images from RNase T1 probing, slopes of trendlines were used directly to compare the frequency of the cleavage; for gel images from in-line probing, the average of the absolute values of all slopes from one gel was calculated and used as an arbitrary range to show the pronounced changes in the in-line cleavage.

182

BIBLIOGRAPHY

1. Egli, M., Flavell, A., Pyle, A.M., Wilson, W.D., Haq, S.I., Luisi, B., Fisher, J., Laughton, C., Allen, S., Engels, J., Blackburn, G.M., Gait, M.J., Loakes, D. and Williams, D.M. (2006) Nucleic Acids in Chemistry and Biology. 3rd ed. Cambridge: RSC. 2. Tyagi, R. and Mathews, D.H. (2007) Predicting helical coaxial stacking in RNA multibranch loops, RNA, 13, 7, 939-951. 3. Zarrinkar, P.P. and Williamson, J.R. (1994) Kinetic intermediates in RNA folding, Science, 265, 5174, 918-924. 4. Woodson, S.A. (2010) Compact intermediates in RNA folding, Annual Review of Biophysics, 39, 61-77. 5. Russell, R., Millett, I.S., Tate, M.W., Kwok, L.W., Nakatani, B., Gruner, S.M., Mochrie, S.G.J., Pande, V., Doniach, S., Herschlag, D. and Pollack, L. (2002) Rapid compaction during RNA folding, Proceedings of the National Academy of Sciences, 99, 7, 4266-4271. 6. Das, R., Kwok, L.W., Millett, I.S., Bai, Y., Mills, T.T., Jacob, J., Maskel, G.S., Seifert, S., Mochrie, S.G.J., Thiyagarajan, P., Doniach, S., Pollack, L. and Herschlag, D. (2003) The fastest global events in RNA folding: electrostatic relaxation and tertiary collapse of the tetrahymena ribozyme, Journal of Molecular Biology, 332, 2, 311-319. 7. Fiore, J.L., Kraemer, B., Koberling, F., Edmann, R. and Nesbitt, D.J. (2009) Enthalpy-driven RNA folding: single-molecule thermodynamics of tetraloop- receptor tertiary interaction, Biochemistry, 48, 11, 2550-2558. 8. Mikulecky, P.J., Takach, J.C. and Feig, A.L. (2004) Entropy-driven folding of an RNA helical junction: an isothermal titration calorimetric analysis of the hammerhead ribozyme, Biochemistry, 43, 19, 5870-5881. 9. Hoyer, W., Ramm, K. and Plückthun, A. (2002) A kinetic trap is an intrinsic feature in the folding pathway of single-chain Fv fragments, Biophysical Chemistry, 96, 2–3, 273-284. 10. Fang, X.W., Pan, T. and Sosnick, T.R. (1999) Mg2+-dependent folding of a large ribozyme without kinetic traps, Nature Structural Biology, 6, 12, 1091-1095. 11. Weeks, K.M. (1997) Protein-facilitated RNA folding, Current Opinion in Structural Biology, 7, 3, 336-342. 12. Schlatterer, J.C., Martin, J.S., Laederach, A. and Brenowitz, M. (2014) Mapping the Kinetic Barriers of a Large RNA Molecule's Folding Landscape, PLoS One, 9, 2, e85041. 13. Bowman, J.C., Lenz, T.K., Hud, N.V. and Williams, L.D. (2012) Cations in charge: magnesium ions in RNA folding and catalysis, Current Opinion in Structural Biology, 22, 3, 262-272. 14. Holmstrom, E.D., Fiore, J.L. and Nesbitt, D.J. (2012) Thermodynamic origins of monovalent facilitated RNA folding, Biochemistry, 51, 18, 3732-3743. 183

15. Fiore, J.L., Holmstrom, E.D. and Nesbitt, D.J. (2012) Entropic origin of Mg2+- facilitated RNA folding, Proceedings of the National Academy of Sciences, 109, 8, 2902-2907. 16. Nikolova, E.N. and Al-Hashimi, H.M. (2010) Thermodynamics of RNA melting, one base pair at a time, RNA, 16, 9, 1687-1691. 17. Baldwin, R.L. (1986) Temperature dependence of the hydrophobic interaction in protein folding, Proceedings of the National Academy of Sciences of the United States of America, 83, 21, 8069-8072. 18. Puglisi, J.D. and Tinoco, I., Jr. (1989) Absorbance melting curves of RNA, Methods in Enzymology, 180, 304-325. 19. Saldanha, R., Ellington, A. and Lambowitz, A.M. (1996) Analysis of the CYT-18 protein binding site at the junction of stacked helices in a group I intron RNA by quantitative binding assays and in vitro selection, Journal of Molecular Biology, 261, 1, 23-42. 20. Weeks, K.M. and Cech, T.R. (1996) Assembly of a ribonucleoprotein catalyst by tertiary structure capture, Science, 271, 5247, 345-348. 21. Kilburn, D., Roh, J.H., Guo, L., Briber, R.M. and Woodson, S.A. (2010) Molecular Crowding Stabilizes Folded RNA Structure by the Excluded Volume Effect, Journal of the American Chemical Society, 132, 25, 8690-8696. 22. Dupuis, N.F., Holmstrom, E.D. and Nesbitt, D.J. (2014) Molecular-crowding effects on single-molecule RNA folding/unfolding thermodynamics and kinetics, Proceedings of the National Academy of Sciences, 111, 23, 8464-8469. 23. Strulson, C.A., Boyer, J.A., Whitman, E.E. and Bevilacqua, P.C. (2014) Molecular crowders and cosolutes promote folding cooperativity of RNA under physiological ionic conditions, RNA, 20, 3, 331-347. 24. Desai, R., Kilburn, D., Lee, H.T. and Woodson, S.A. (2014) Increased Ribozyme Activity in Crowded Solutions, Journal of Biological Chemistry, 289, 5, 2972- 2977. 25. Paudel, B.P. and Rueda, D. (2014) Molecular crowding accelerates ribozyme docking and catalysis, Journal of the American Chemical Society, 136, 48, 16700- 16703. 26. Lee, H.T., Kilburn, D., Behrouzi, R., Briber, R.M. and Woodson, S.A. (2015) Molecular crowding overcomes the destabilizing effects of mutations in a bacterial ribozyme, Nucleic Acids Research, 43, 2, 1170-1176. 27. Nakano, S., Karimata, H.T., Kitagawa, Y. and Sugimoto, N. (2009) Facilitation of RNA enzyme activity in the molecular crowding media of cosolutes, Journal of the American Chemical Society, 131, 46, 16881-16888. 28. Lightfoot, H.L. and Hall, J. (2014) Endogenous polyamine function—the RNA perspective, Nucleic Acids Research, 42, 18, 11275-11290. 29. Stevens, L. and McCann, L.M. (1970) Interaction of polyamines with ribosomes and RNA, Annals of the New York Academy of Sciences, 171, 3, 827-837. 30. Bachrach, U. (2005) Naturally occurring polyamines: interaction with macromolecules, Current Protein & Peptide Science, 6, 6, 559-566. 184

31. Yoshida, M., Meksuriyen, D., Kashiwagi, K., Kawai, G. and Igarashi, K. (1999) Polyamine stimulation of the synthesis of oligopeptide-binding protein (OppA). Involvement of a structural change of the Shine-Dalgarno sequence and the initiation codon aug in OppA mRNA, The Journal of Biological Chemistry, 274, 32, 22723-22728. 32. Holbrook, S.R., Sussman, J.L., Warrant, R.W. and Kim, S.H. (1978) Crystal structure of yeast phenylalanine transfer RNA. II. Structural features and functional implications, Journal of Molecular Biology, 123, 4, 631-660. 33. Quigley, G.J., Teeter, M.M. and Rich, A. (1978) Structural analysis of spermine and magnesium ion binding to yeast phenylalanine transfer RNA, Proceedings of the National Academy of Sciences of the United States of America, 75, 1, 64-68. 34. Venkiteswaran, S., Vijayanathan, V., Shirahata, A., Thomas, T. and Thomas, T.J. (2005) Antisense recognition of the HER-2 mRNA: effects of phosphorothioate substitution and polyamines on DNA.RNA, RNA.RNA, and DNA.DNA duplex stability, Biochemistry, 44, 1, 303-312. 35. Ouameur, A.A., Bourassa, P. and Tajmir-Riahi, H.-A. (2010) Probing tRNA interaction with biogenic polyamines, RNA, 16, 10, 1968-1979. 36. Kim, B.H. and Gadd., G.M. (2008) Bacterial Physiology and Metabolism. Cambridge University Press. 37. Paton, J.C. and Paton, A.W. (1998) Pathogenesis and Diagnosis of Shiga Toxin- Producing Escherichia coli Infections, Clinical Microbiology Reviews, 11, 3, 450- 479. 38. Lowy, F.D. (1998) Staphylococcus aureus Infections, New England Journal of Medicine, 339, 8, 520-532. 39. AlonsoDeVelasco, E., Verheul, A.F., Verhoef, J. and Snippe, H. (1995) Streptococcus pneumoniae: virulence factors, pathogenesis, and vaccines, Microbiological Reviews, 59, 4, 591-603. 40. Delcour, A.H. (2009) Outer membrane permeability and antibiotic resistance, BBA Proteins and Proteomics, 1794, 5, 808-816. 41. Lambert, P.A. (2002) Cellular impermeability and uptake of biocides and antibiotics in Gram-positive bacteria and mycobacteria, Journal of applied microbiology, 92 Suppl, 46s-54s. 42. Hamad, B. (2010) The antibiotics market, Nature Reviews Drug Discovery, 9, 9, 675-676. 43. Lewis, K. (2013) Platforms for antibiotic discovery, Nature Reviews Drug Discovery, 12, 5, 371-387. 44. Jovetic, S., Zhu, Y., Marcone, G.L., Marinelli, F. and Tramper, J. (2010) β- Lactam and glycopeptide antibiotics: first and last line of defense?, Trends in Biotechnology, 28, 12, 596-604. 45. Foye, W.O., Lemke, T.L. and Williams, D.A. (2008) Foye's principles of medicinal chemistry. Lippincott Williams & Wilkins, Philadelphia. 46. Neu, H.C. and Fu, K.P. (1978) Clavulanic acid, a novel inhibitor of beta- lactamases, Antimicrobial Agents and Chemotherapy, 14, 5, 650-655. 185

47. Gurney, R. and Thomas, C.M. (2011) Mupirocin: biosynthesis, special features and applications of an antibiotic from a Gram-negative bacterium, Applied Microbiology and Biotechnology, 90, 1, 11-21. 48. Drlica, K., Malik, M., Kerns, R.J. and Zhao, X. (2008) Quinolone-Mediated Bacterial Death, Antimicrobial Agents and Chemotherapy, 52, 2, 385-392. 49. Campbell, E.A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb, A. and Darst, S.A. (2001) Structural Mechanism for Rifampicin Inhibition of Bacterial RNA Polymerase, Cell, 104, 6, 901-912. 50. Hansen, L.H., Mauvais, P. and Douthwaite, S. (1999) The macrolide-ketolide antibiotic binding site is formed by structures in domains II and V of 23S ribosomal RNA, Molecular Microbiology, 31, 2, 623-631. 51. Mao, J.C.H. and Robishaw, E.E. (1971) Effects of macrolides on peptide-bond formation and translocation, Biochemistry, 10, 11, 2054-2061. 52. Lovmar, M., Tenson, T. and Ehrenberg, M. (2004) Kinetics of Macrolide Action: the Josamycin and Erythromycin Cases, Journal of Biological Chemistry, 279, 51, 53506-53515. 53. Oehler, R., Polacek, N., Steiner, G. and Barta, A. (1997) Interaction of Tetracycline with RNA: Photoincorporation into Ribosomal RNA of Escherichia coli, Nucleic Acids Research, 25, 6, 1219-1224. 54. Mikkelsen, N.E., Johansson, K., Virtanen, A. and Kirsebom, L.A. (2001) Aminoglycoside binding displaces a divalent metal ion in a tRNA-neomycin B complex, Nature Structural Biology, 8, 510-514. 55. Becker, B. and Cooper, M.A. (2013) Aminoglycoside antibiotics in the 21st century, ACS Chemical Biology, 8, 1, 105-115. 56. Jana, S. and Deb, J.K. (2006) Molecular understanding of aminoglycoside action and resistance, Applied Microbiology and Biotechnology, 70, 2, 140-150. 57. Carter, A.P., Clemons, W.M., Brodersen, D.E., Morgan-Warren, R.J., Wimberly, B.T. and Ramakrishnan, V. (2000) Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics, Nature, 407, 6802, 340-348. 58. Velagapudi, S.P. and Disney, M.D. (2013) Defining RNA motif-aminoglycoside interactions via two-dimensional combinatorial screening and structure-activity relationships through sequencing, Bioorganic & Medicinal Chemistry, 21, 20, 6132-6138. 59. Wang, Y. and Rando, R.R. (1995) Specific binding of aminoglycoside antibiotics to RNA, Chemistry & Biology, 2, 5, 281-290. 60. Wang, S., Huber, P.W., Cui, M., Czarnik, A.W. and Mei, H.Y. (1998) Binding of neomycin to the TAR element of HIV-1 RNA induces dissociation of Tat protein by an allosteric mechanism, Biochemistry, 37, 16, 5549-5557. 61. Werstuck, G., Zapp, M.L. and Green, M.R. (1996) A non-canonical base pair within the human immunodeficiency virus rev-responsive element is involved in both rev and small molecule recognition, Chemistry & Biology, 3, 2, 129-137. 186

62. Zaffiri, L., Gardner, J. and Toledo-Pereyra, L.H. (2013) History of antibiotics: from fluoroquinolones to daptomycin (Part 2), Journal Of Investigative Surgery, 26, 4, 167-179. 63. Bode, C., Muenster, S., Diedrich, B., Jahnert, S., Weisheit, C., Steinhagen, F., Boehm, O., Hoeft, A., Meyer, R. and Baumgarten, G. (2015) Linezolid, vancomycin and daptomycin modulate cytokine production, Toll-like receptors and phagocytosis in a human in vitro model of sepsis, Journal of Antibiotics, 68, 8, 485-490. 64. Wilson, D.N., Schluenzen, F., Harms, J.M., Starosta, A.L., Connell, S.R. and Fucini, P. (2008) The oxazolidinone antibiotics perturb the ribosomal peptidyltransferase center and effect tRNA positioning, Proceedings of the National Academy of Sciences of the United States of America, 105, 36, 13339-13344. 65. Saini, J.S., Homeyer, N., Fulle, S. and Gohlke, H. (2013) Determinants of the species selectivity of oxazolidinone antibiotics targeting the large ribosomal subunit, Biological Chemistry, 394, 11, 1529-1541. 66. Savjani, J.K., Gajjar, A.K. and Savjani, K.T. (2009) Mechanisms of resistance: useful tool to design antibacterial agents for drug - resistant bacteria, Mini Reviews in Medicinal Chemistry, 9, 2, 194-205. 67. Hall, B.G. and Barlow, M. (2005) Revised Ambler classification of β-lactamases, Journal of Antimicrobial Chemotherapy, 55, 6, 1050-1051. 68. Wang, Z., Fast, W., Valentine, A.M. and Benkovic, S.J. (1999) Metallo-beta- lactamase: structure and mechanism, Current Opinion in Chemical Biology, 3, 5, 614-622. 69. Hooper, D.C. (1999) Mechanisms of fluoroquinolone resistance, Drug Resistance Updates, 2, 1, 38-55. 70. Galimand, M., Courvalin, P. and Lambert, T. (2003) Plasmid-Mediated High- Level Resistance to Aminoglycosides in Enterobacteriaceae Due to 16S rRNA Methylation, Antimicrobial Agents and Chemotherapy, 47, 8, 2565-2571. 71. Nessar, R., Reyrat, J.M., Murray, A. and Gicquel, B. (2011) Genetic analysis of new 16S rRNA mutations conferring aminoglycoside resistance in Mycobacterium abscessus, Journal of Antimicrobial Chemotherapy, 66, 8, 1719- 1724. 72. Alexander, C. and Rietschel, E.T. (2001) Bacterial lipopolysaccharides and innate immunity, Journal of Endotoxin Research, 7, 3, 167-202. 73. Hancock, R.E., Farmer, S.W., Li, Z.S. and Poole, K. (1991) Interaction of aminoglycosides with the outer membranes and purified lipopolysaccharide and OmpF porin of Escherichia coli, Antimicrob Agents Chemother, 35, 7, 1309-1314. 74. Nikaido, H. (2003) Molecular basis of bacterial outer membrane permeability revisited, Microbiology and Molecular Biology Reviews, 67, 4, 593-656. 75. Nikaido, H. and Rosenberg, E.Y. (1983) Porin channels in Escherichia coli: studies with liposomes reconstituted from purified proteins, Journal of Bacteriology, 153, 1, 241-252. 187

76. Viveiros, M., Dupont, M., Rodrigues, L., Couto, I., Davin-Regli, A., Martins, M., Pages, J.M. and Amaral, L. (2007) Antibiotic stress, genetic response and altered permeability of E. coli, PLoS One, 2, 4, e365. 77. Domenech-Sanchez, A., Hernandez-Alles, S., Martinez-Martinez, L., Benedi, V.J. and Alberti, S. (1999) Identification and characterization of a new porin gene of Klebsiella pneumoniae: its role in beta-lactam antibiotic resistance, Journal of Bacteriology, 181, 9, 2726-2732. 78. Alekshun, M.N. and Levy, S.B. (2007) Molecular Mechanisms of Antibacterial Multidrug Resistance, Cell, 128, 6, 1037-1050. 79. Borges-Walmsley, M.I., McKeegan, K.S. and Walmsley, A.R. (2003) Structure and function of efflux pumps that confer resistance to drugs, Biochemical Journal, 376, Pt 2, 313-338. 80. Zhou, Y.P., Wilder-Smith, A. and Hsu, L.Y. (2014) The Role of International Travel in the Spread of Methicillin-Resistant Staphylococcus aureus, Journal of Travel Medicine, 21, 4, 272-281. 81. Levy, S.B. and Marshall, B. (2004) Antibacterial resistance worldwide: causes, challenges and responses, Nature Medicine, 10, 12 Suppl, S122-129. 82. Henkin, T.M. (2008) Riboswitch RNAs: using RNA to sense cellular metabolism, Genes & Development, 22, 24, 3383-3390. 83. Vitreschak, A.G., Rodionov, D.A., Mironov, A.A. and Gelfand, M.S. (2003) Regulation of the vitamin B(12) metabolism and transport in bacteria by a conserved RNA structural element, RNA, 9, 9, 1084-1097. 84. Mandal, M. and Breaker, R.R. (2004) Adenine riboswitches and gene activation by disruption of a transcription terminator, Nature Structural & Molecular Biology, 11, 1, 29-35. 85. Henkin, T.M., Glass, B.L. and Grundy, F.J. (1992) Analysis of the Bacillus subtilis tyrS gene: conservation of a regulatory sequence in multiple tRNA synthetase genes, Journal of Bacteriology, 174, 4, 1299-1306. 86. Grundy, F.J. and Henkin, T.M. (1993) tRNA as a positive regulator of transcription antitermination in B. subtilis, Cell, 74, 3, 475-482. 87. Grundy, F.J. and Henkin, T.M. (1994) Conservation of a Transcription Antitermination Mechanism in Aminoacyl-tRNA Synthetase and Amino Acid Biosynthesis Genes in Gram-positive Bacteria, Journal of Molecular Biology, 235, 2, 798-804. 88. Winkler, W., Nahvi, A. and Breaker, R.R. (2002) Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression, Nature, 419, 6910, 952-956. 89. Nahvi, A., Sudarsan, N., Ebert, M.S., Zou, X., Brown, K.L. and Breaker, R.R. (2002) Genetic Control by a Metabolite Binding mRNA, Chemistry & Biology, 9, 9, 1043-1049. 90. Mironov, A.S., Gusarov, I., Rafikov, R., Lopez, L.E., Shatalin, K., Kreneva, R.A., Perumov, D.A. and Nudler, E. (2002) Sensing Small Molecules by Nascent RNA: A Mechanism to Control Transcription in Bacteria, Cell, 111, 5, 747-756. 188

91. Hollands, K., Proshkin, S., Sklyarova, S., Epshtein, V., Mironov, A., Nudler, E. and Groisman, E.A. (2012) Riboswitch control of Rho-dependent transcription termination, Proceedings of the National Academy of Sciences, 109, 14, 5376- 5381. 92. Nudler, E. and Mironov, A.S. (2004) The riboswitch control of bacterial metabolism, Trends in Biochemical Sciences, 29, 1, 11-17. 93. Coppins, R.L., Hall, K.B. and Groisman, E.A. (2007) The intricate world of riboswitches, Current Opinion in Microbiology, 10, 2, 176-181. 94. Mason, P.B. and Struhl, K. (2005) Distinction and Relationship between Elongation Rate and Processivity of RNA Polymerase II In Vivo, Molecular Cell, 17, 6, 831-840. 95. Kazanov, M.D., Vitreschak, A.G. and Gelfand, M.S. (2007) Abundance and functional diversity of riboswitches in microbial communities, BMC Genomics, 8, 347-347. 96. Chen, S.-J. (2008) RNA Folding: Conformational Statistics, Folding Kinetics, and Ion Electrostatics, Annual Review of Biophysics, 37, 197-214. 97. Mandal, M. and Breaker, R.R. (2004) Gene regulation by riboswitches, Nat Rev Mol Cell Biol, 5, 6, 451-463. 98. Vitreschak, A.G., Rodionov, D.A., Mironov, A.A. and Gelfand, M.S. (2004) Riboswitches: the oldest mechanism for the regulation of gene expression?, Trends in Genetics, 20, 1, 44-50. 99. Li, S. and Breaker, R.R. (2013) Eukaryotic TPP riboswitch regulation of alternative splicing involving long-distance base pairing, Nucleic Acids Research, 41, 5, 3022-3031. 100. Lünse, C.E., Schüller, A. and Mayer, G. (2014) The promise of riboswitches as potential antibacterial drug targets, International Journal of Medical Microbiology, 304, 1, 79-92. 101. Diegan, K.E. and Ferré-D'Amaré, A.R. (2011) Riboswitches: discovery of drugs that target bacterial gene-regulatory RNAs, Accounts of Chemical Research, 44, 1329-1338. 102. Henkin, T.M. (2014) The T box riboswitch: a novel regulatory RNA that utilizes tRNA as its ligand, BBA Gene Regulatory Mechanisms, 1839, 959-963. 103. Howe, J.A., Wang, H., Fischmann, T.O., Balibar, C.J., Xiao, L., Galgoci, A.M., Malinverni, J.C., Mayhood, T., Villafania, A., Nahvi, A., Murgolo, N., Barbieri, C.M., Mann, P.A., Carr, D., Xia, E., Zuck, P., Riley, D., Painter, R.E., Walker, S.S., Sherborne, B., de Jesus, R., Pan, W., Plotkin, M.A., Wu, J., Rindgen, D., Cummings, J., Garlisi, C.G., Zhang, R., Sheth, P.R., Gill, C.J., Tang, H. and Roemer, T. (2015) Selective small-molecule inhibition of an RNA structural element, Nature, 526, 7575, 672-677. 104. Winkler, W.C., Nahvi, A., Roth, A., Collins, J.A. and Breaker, R.R. (2004) Control of gene expression by a natural metabolite-responsive ribozyme, Nature, 428, 6980, 281-286. 189

105. Epshtein, V., Mironov, A.S. and Nudler, E. (2003) The riboswitch-mediated control of sulfur metabolism in bacteria, Proceedings of the National Academy of Sciences of the United States of America, 100, 9, 5052-5056. 106. Cromie, M.J., Shi, Y., Latifi, T. and Groisman, E.A. (2006) An RNA sensor for intracellular Mg(2+), Cell, 125, 1, 71-84. 107. Gutierrez-Preciado, A., Henkin, T.M., Grundy, F.J., Yanofsky, C. and Merino, E. (2009) Biochemical features and functional implications of the RNA-based T-box regulatory mechanism, Microbiology and Molecular Biology Reviews, 73, 1, 36- 61. 108. Webster, T.A., Gibson, B.W., Keng, T., Biemann, K. and Schimmel, P. (1983) Primary structures of both subunits of Escherichia coli glycyl-tRNA synthetase, The Journal of Biological Chemistry, 258, 17, 10637-10641. 109. Yousef, M.R., Grundy, F.J. and Henkin, T.M. (2005) Structural Transitions Induced by the Interaction between tRNAGly and the Bacillus subtilis glyQS T Box Leader RNA, Journal of Molecular Biology, 349, 2, 273-287. 110. Grundy, F.J., Rollins, S.M. and Henkin, T.M. (1994) Interaction between the acceptor end of tRNA and the T box stimulates antitermination in the Bacillus subtilis tyrS gene: a new role for the discriminator base, Journal of Bacteriology, 176, 15, 4518-4526. 111. Grundy, F.J., Winkler, W.C. and Henkin, T.M. (2002) tRNA-mediated transcription antitermination in vitro: codon-anticodon pairing independent of the ribosome, Proceedings of the National Academy of Sciences, 99, 17, 11121- 11126. 112. Grigg, J.C., Chen, Y., Grundy, F.J., Henkin, T.M., Pollack, L. and Ke, A. (2013) T box RNA decodes both the information content and geometry of tRNA to affect gene expression, Proceedings of the National Academy of Sciences, 110, 18, 7240-7245. 113. Saad, N.Y., Stamatopoulou, V., Brayé, M., Drainas, D., Stathopoulos, C. and Becker, H.D. (2013) Two-codon T-box riboswitch binding two tRNAs, Proceedings of the National Academy of Sciences of the United States of America, 110, 31, 12756-12761. 114. Wang, J., Henkin, T.M. and Nikonowicz, E.P. (2010) NMR structure and dynamics of the Specifier Loop domain from the Bacillus subtilis tyrS T box leader RNA, Nucleic Acids Research, 38, 10, 3388-3398. 115. Rollins, S.M., Grundy, F.J. and Henkin, T.M. (1997) Analysis of cis-acting sequence and structural elements required for antitermination of the Bacillus subtilis tyrS gene, Molecular Microbiology, 25, 2, 411-421. 116. Zhang, J. and Ferre-D/'Amare, A.R. (2013) Co-crystal structure of a T-box riboswitch stem I domain in complex with its cognate tRNA, Nature, 500, 7462, 363-366. 117. Grigg, Jason C. and Ke, A. (2013) Structural Determinants for Geometry and Information Decoding of tRNA by T Box Leader RNA, Structure, 21, 11, 2025- 2032. 190

118. Reiter, N.J., Osterman, A., Torres-Larios, A., Swinger, K.K., Pan, T. and Mondragón, A. (2010) Structure of a bacterial ribonuclease P holoenzyme in complex with tRNA, Nature, 468, 7325, 784-789. 119. Korostelev, A., Trakhanov, S., Laurberg, M. and Noller, H.F. (2006) Crystal Structure of a 70S Ribosome-tRNA Complex Reveals Functional Interactions and Rearrangements, Cell, 126, 6, 1065-1077. 120. Wang, J. and Nikonowicz, E.P. (2011) Solution structure of the K-turn and Specifier Loop domains from the Bacillus subtilis tyrS T-box leader RNA, Journal of Molecular Biology, 408, 1, 99-117. 121. Gerdeman, M.S., Henkin, T.M. and Hines, J.V. (2003) Solution structure of the Bacillus subtilis T-box antiterminator RNA: seven nucleotide bulge characterized by stacking and flexibility, Journal of Molecular Biology, 326, 1, 189-201. 122. Grundy, F.J., Moir, T.R., Haldeman, M.T. and Henkin, T.M. (2002) Sequence requirements for terminators and antiterminators in the T box transcription antitermination system: disparity between conservation and functional requirements, Nucleic Acids Research, 30, 7, 1646-1655. 123. Jack, K.D., Means, J.A. and Hines, J.V. (2008) Characterizing riboswitch function: Identification of Mg2+ binding site in T box antiterminator RNA, Biochemical and Biophysical Research Communications, 370, 306-310. 124. Means, J.A., Simson, C.M., Zhou, S., Rachford, A.A., Rack, J. and Hines, J.V. (2009) Fluorescence probing of T box antiterminator RNA: Insights into riboswitch discernment of the tRNA discriminator base, Biochemical and Biophysical Research Communications, 389, 616-621. 125. Cowan, J.A. (1995) The biological chemistry of magnesium. VCH, New York. 126. Putzer, H., Condon, C., Brechemeier-Baey, D., Brito, R. and Grunberg-Manago, D. (2002) Transfer RNA-mediated antitermination in vitro, Nucleic Acids Research, 30, 3026-3033. 127. Fauzi, H., Jack, K.D. and Hines, J.V. (2005) In vitro selection to identify determinants in tRNA for Bacillus subtilis tyrS T box antiterminator mRNA binding, Nucleic Acids Research, 33, 8, 2595-2602. 128. Grundy, F.J., Yousef, M.R. and Henkin, T.M. (2005) Monitoring Uncharged tRNA During Transcription of the Bacillus subtilis glyQS Gene, Journal of Molecular Biology, 346, 1, 73-81. 129. Zhang, J. and Ferre-D'Amare, A.R. (2014) Direct evaluation of tRNA aminoacylation status by the T-box riboswitch using tRNA-mRNA stacking and steric readout, Molecular Cell, 55, 1, 148-155. 130. Grundy, F.J., Hodil, S.E., Rollins, S.M. and Henkin, T.M. (1997) Specificity of tRNA-mRNA interactions in Bacillus subtilis tyrS antitermination, Journal of Bacteriology, 179, 8, 2587-2594. 131. Grundy, F.J., Collins, J.A., Rollins, S.M. and Henkin, T.M. (2000) tRNA determinants for transcription antitermination of the Bacillus subtilis tyrS gene, RNA, 6, 8, 1131-1141. 191

132. Epshtein, V., Cardinale, C.J., Ruckenstein, A.E., Borukhov, S. and Nudler, E. (2007) An Allosteric Path to Transcription Termination, Molecular Cell, 28, 6, 991-1001. 133. Grundy, F.J. and Henkin, T.M. (2004) Kinetic Analysis of tRNA-Directed Transcription Antitermination of the Bacillus subtilis glyQS Gene In Vitro, Journal of Bacteriology, 186, 16, 5392-5399. 134. Yousef, M.R., Grundy, F.J. and Henkin, T.M. (2003) tRNA requirements for glyQS antitermination: A new twist on tRNA, RNA, 9, 9, 1148-1156. 135. Landick, R., Wang, D. and Chan, C.L. (1996), Methods in Enzymology. Academic Press, Vol. Volume 274, pp. 334-353. 136. Gerdeman, M.S., Henkin, T.M. and Hines, J.V. (2002) In vitro structure-function studies of the Bacillus subtilis tyrS mRNA antiterminator: Evidence for factor independent tRNA acceptor stem binding specificity, Nucleic Acids Research, 30, 4, 1065-1072. 137. Allain, F.H.T. and Varani, G. (1995) Structure of the P1 Helix from Group I Self- splicing Introns, Journal of Molecular Biology, 250, 3, 333-353. 138. Abe, T., Ikemura, T., Ohara, Y., Uehara, H., Kinouchi, M., Kanaya, S., Yamada, Y., Muto, A. and Inokuchi, H. (2009) tRNADB-CE: tRNA gene database curated manually by experts, Nucleic Acids Research, 37, Database issue, D163-D168. 139. Bhattacharyya, D. and Bansal, M. (1994) Analysis of sequence dependent variations in secondary and tertiary structure of tRNA molecules, Journal of Biomolecular Structure & Dynamics, 11, 6, 1251-1275. 140. Giege, R., Juhling, F., Putz, J., Stadler, P., Sauter, C. and Florentz, C. (2012) Structure of transfer RNAs: similarity and variability, Wiley interdisciplinary reviews. RNA, 3, 1, 37-61. 141. Mustoe, A.M., Bailor, M.H., Teixeira, R.M., Brooks, C.L. and Al-Hashimi, H.M. (2012) New insights into the fundamental role of topological constraints as a determinant of two-way junction conformation, Nucleic Acids Research, 40, 2, 892-904. 142. Anupam, R., Nayek, A., Green, N.J., Grundy, F.J., Henkin, T.M., Means, J.A., Bergmeier, S.C. and Hines, J.V. (2008) 4,5-Disubstituted oxazolidinones: High affinity molecular effectors of RNA function, Bioorganic & Medicinal Chemistry Letters, 18, 12, 3541-3544. 143. Means, J., Katz, S., Nayek, A., Anupam, R., Hines, J.V. and Bergmeier, S.C. (2006) Structure-activity studies of oxazolidinone analogs as RNA-binding agents, Bioorganic & Medicinal Chemistry Letters, 16, 13, 3600-3604. 144. Orac, C.M., Zhou, S., Means, J.A., Boehme, D., Bergmeier, S.C. and Hines, J.V. (2011) Synthesis and stereospecificity of 4,5-disubstituted oxazolidinone ligands binding to T-box riboswitch RNA, Journal of Medicinal Chemistry, 54, 6786- 6795. 145. Maciagiewicz, I., Zhou, S., Bergmeier, S.C. and Hines, J.V. (2011) Structure activity studies of RNA-binding oxazolidinone derivatives, Bioorganic & Medicinal Chemistry Letters, 10.1016/j.bmcl.2011.05.130, 4524-4527. 192

146. Acquaah-Harrison, G., Zhou, S., Hines, J.V. and Bergmeier, S.C. (2010) Library of 1,4-disubstituted 1,2,3-triazole analogs of oxazolidinone RNA-binding agents, Journal of Combinatorial Chemistry, 12, 4, 491-496. 147. Zhou, S., Acquaah-Harrison, G., Bergmeier, S.C. and Hines, J.V. (2011) Anisotropy studies of tRNA-T box antiterminator RNA complex in the presence of 1,4-disubstituted 1,2,3-triazoles, Bioorganic & Medicinal Chemistry Letters, 21, 23, 7059-7063. 148. Zhou, S., Acquaah-Harrison, G., Jack, K.D., Bergmeier, S.C. and Hines, J.V. (2012) Ligand-induced changes in T box antiterminator RNA stability, Chemical Biology & Drug Design, 79, 2, 202-208. 149. Zhou, S., Means, J.A., Acquaah-Harrison, G., Bergmeier, S.C. and Hines, J.V. (2012) Characterization of a 1,4-disubstituted 1,2,3-triazole binding to T box antiterminator RNA, Bioorganic & Medicinal Chemistry, 20, 3, 1298-1302. 150. Means, J.A. and Hines, J.V. (2005) Fluorescence resonance energy transfer studies of aminoglycoside binding to a T box antiterminator RNA, Bioorganic & Medicinal Chemistry Letters, 15, 2169-2172. 151. Anupam, R., Denapoli, L., Muchenditsi, A.M. and Hines, J.V. (2008) Identification of neomycin B binding site in T box antiterminator model RNA, Bioorganic & Medicinal Chemistry, 16, 4466-4470. 152. Vitreschak, A.G., Mironov, A.A., Lyubetsky, V.A. and Gelfand, M.S. (2008) Comparative genomic analysis of T-box regulatory systems in bacteria, RNA, 14, 4, 717-735. 153. Nelson, D.L., Nelson, D.L., Lehninger, A.L. and Cox, M.M. (2008) Lehninger principles of biochemistry. W.H. Freeman, New York. 154. Bear, D.G. and Peabody, D.S. (1988) The E. coli rho protein: an ATPase that terminates transcription, Trends in Biochemical Sciences, 13, 9, 343-347. 155. Peters, J.M., Vangeloff, A.D. and Landick, R. (2011) Bacterial transcription terminators: the RNA 3'-end chronicles, Journal of Molecular Biology, 412, 5, 793-813. 156. Chen, C.Y. and Richardson, J.P. (1987) Sequence elements essential for rho- dependent transcription termination at lambda tR1, Journal of Biological Chemistry, 262, 23, 11292-11299. 157. Hart, C.M. and Roberts, J.W. (1991) Rho-dependent transcription termination. Characterization of the requirement for cytidine in the nascent transcript, Journal of Biological Chemistry, 266, 35, 24140-24148. 158. Wilson, K.S. and von Hippel, P.H. (1995) Transcription termination at intrinsic terminators: the role of the RNA hairpin, Proceedings of the National Academy of Sciences of the United States of America, 92, 19, 8793-8797. 159. Huang, Y., Weng, X. and Russu, I.M. (2010) Structural Energetics of the Adenine Tract from an Intrinsic Transcription Terminator, Journal of Molecular Biology, 397, 3, 677-688. 160. Marras, S.A.E., Kramer, F.R. and Tyagi, S. (2002) Efficiencies of fluorescence resonance energy transfer and contact-mediated quenching in oligonucleotide probes, Nucleic Acids Research, 30, 21, e122-e122. 193

161. Lakowicz, J.R. (2006) Principles of fluorescence spectroscopy. Springer, New York. 162. Tyagi, S. and Kramer, F.R. (1996) Molecular beacons: probes that fluoresce upon hybridization, Nature Biotechnology, 14, 3, 303-308. 163. Wang, L., Yang, C.J., Medley, C.D., Benner, S.A. and Tan, W. (2005) Locked Nucleic Acid Molecular Beacons, Journal of the American Chemical Society, 127, 45, 15664-15665. 164. Tsourkas, A., Behlke, M.A. and Bao, G. (2002) Hybridization of 2′-O-methyl and 2′-deoxy molecular beacons to RNA and DNA targets, Nucleic Acids Research, 30, 23, 5168-5174. 165. Bratu, D.P., Catrina, I.E. and Marras, S.A. (2011) Tiny molecular beacons for in vivo mRNA detection, Methods in Molecular Biology, 714, 141-157. 166. Marras, S.A.E., Gold, B., Kramer, F.R., Smith, I. and Tyagi, S. (2004) Real‐time measurement of in vitro transcription, Nucleic Acids Research, 32, 9, e72. 167. Majlessi, M., Nelson, N.C. and Becker, M.M. (1998) Advantages of 2'-O-methyl oligoribonucleotide probes for detecting RNA targets, Nucleic Acids Research, 26, 9, 2224-2229. 168. Tsourkas, A., Behlke, M.A., Rose, S.D. and Bao, G. (2003) Hybridization kinetics and thermodynamics of molecular beacons, Nucleic Acids Research, 31, 4, 1319- 1330. 169. Zuker, M. (2003) Mfold web server for nucleic acid folding and hybridization prediction, Nucleic Acids Research, 31, 13, 3406-3415. 170. SantaLucia, J. (1998) A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics, Proceedings of the National Academy of Sciences of the United States of America, 95, 4, 1460-1465. 171. Huang, C. and Yu, Y.-T. (2013) Synthesis and Labeling of RNA In Vitro, Current Protocols in Molecular Biology, 0 4, Unit4.15-Unit14.15. 172. Sambrook, J. (2001) Molecular cloning : a laboratory manual / Joseph Sambrook, David W. Russell. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 173. Laskey, R. (1993) Efficient Detection of Biomolecules by Autoradiography, Fluorography or Chemiluminescence, Amersham Pharmacia Biotech, Review 23 (RPN 1706). 174. Soukup, G.A. and Breaker, R.R. (1999) Relationship between internucleotide linkage geometry and the stability of RNA, RNA, 5, 10, 1308-1325. 175. Kuimelis, R.G. and McLaughlin, L.W. (1998) Mechanisms of Ribozyme- Mediated RNA Cleavage, Chemical Reviews, 98, 3, 1027-1044. 176. Raines, R.T. (1998) Ribonuclease A, Chemical Reviews, 98, 3, 1045-1066. 177. Pace, C.N., Heinemann, U., Hahn, U. and Saenger, W. (1991) Ribonuclease T1 - structure, function and stability, Angewandte Chemie-International Edition in English, 30, 4, 343-360. 178. Lockard, R.E. and Kumar, A. (1981) Mapping tRNA structure in solution using double-strand-specific ribonuclease V1 from cobra venom, Nucleic Acids Research, 9, 19, 5125-5140. 194

179. Hulme, E.C. and Trevethick, M.A. (2010) Ligand binding assays at equilibrium: validation and interpretation, British Journal of Pharmacology, 161, 6, 1219- 1237. 180. Zhou, S. (2011) Riboswitch Drug Discovery: Identification and Characterization of T Box Antiterminator RNA Ligands as Potential Antibacterial Agents, Ohio University, Athens, OH. 181. Vet, J.A. and Marras, S.A. (2005) Design and optimization of molecular beacon real-time polymerase chain reaction assays, Methods in Molecular Biology, 288, 273-290. 182. Marras, S.A. (2006) Selection of fluorophore and quencher pairs for fluorescent nucleic acid hybridization probes, Methods in Molecular Biology, 335, 3-16. 183. Kimberly, M.M. and Goldstein, J.H. (1981) Determination of pKa values and total proton distribution pattern of spermidine by carbon-13 nuclear magnetic resonance titrations, Analytical Chemistry, 53, 6, 789-793. 184. Misra, V.K. and Draper, D.E. (1998) On the role of magnesium ions in RNA stability, Biopolymers, 48, 2-3, 113-135. 185. Liu, J., Zeng, C., Hogan, V., Zhou, S., Monwar, M.M. and Hines, J.V. (2015) Identification of Spermidine Binding Site in T-box Riboswitch Antiterminator RNA, Chemical Biology & Drug Design, 10.1111/cbdd.12660, n/a-n/a. 186. Marras, S.E., Russell Kramer, F. and Tyagi, S. (2003) In Kwok, P.-Y. (ed.), Single Nucleotide Polymorphisms. Springer New York, Vol. 212, pp. 111-128. 187. Madden, T.L., Tatusov, R.L. and Zhang, J. (1996) Applications of network BLAST server, Methods in Enzymology, 266, 131-141. 188. Krupp, G. (1989) Unusual promoter-independent transcription reactions with bacteriophage RNA polymerases, Nucleic Acids Research, 17, 8, 3023-3036. 189. Nitin, N., Rhee, W.J. and Bao, G. (2009) Translation inhibition reveals interaction of 2′-deoxy and 2′-O-methyl molecular beacons with mRNA targets in living cells, Nucleic Acids Research, 37, 15, 4977-4986. 190. Bhaskaran, H., Rodriguez-Hernandez, A. and Perona, J.J. (2012) Kinetics of tRNA folding monitored by aminoacylation, RNA, 18, 3, 569-580. 191. Higashi, K., Terui, Y., Suganami, A., Tamura, Y., Nishimura, K., Kashiwagi, K. and Igarashi, K. (2008) Selective structural change by spermidine in the bulged- out region of double-stranded RNA and its effect on RNA function, The Journal of Biological Chemistry, 283, 47, 32989-32994. 192. Markham, N.R. and Zuker, M. (2005) DINAMelt web server for nucleic acid melting prediction, Nucleic Acids Research, 33, Web Server issue, W577-581. 193. Zhang, J.H., Chung, T.D.Y. and Oldenburg, K.R. (1999) A simple statistical parameter for use in evaluation and validation of high throughput screening assays, Journal of Biomolecular Screening, 4, 2, 67-73. 194. Frugier, M., Florentz, C., Hosseini, M.W., Lehn, J.-M. and Giegé, R. (1994) Synthetic polyamines stimulate in vitro transcription by T7 RNA polymerase, Nucleic Acids Research, 22, 14, 2784-2790. 195. Bhattacharyya, S.K. and Banerjee, A.B. (1974) D-amino acids in the cell pool of bacteria, Folia Microbiologica, 19, 1, 43-50. 195

196. (1962) In Holden, J. T. (ed.), Amino Acid Pools. Elsevier Publishing Company, Amsterdam, pp. 73. 197. Anupam, R., Denapoli, L., Muchenditsi, A. and Hines, J.V. (2008) Identification of neomycin B-binding site in T box antiterminator model RNA, Bioorganic & Medicinal Chemistry, 16, 8, 4466-4470. 198. Fauzi, H., Agyeman, A. and Hines, J.V. (2009) T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element, BBA Gene Regulatory Mechanisms, 1789, 185-191. 199. Means, J.A., Wolf, S., Agyeman, A., Burton, J.S., Simson, C.M. and Hines, J.V. (2007) T box riboswitch antiterminator affinity modulated by tRNA structural elements, Chemical Biology & Drug Design, 69, 2, 139-145. 200. Liu, J., Zeng, C., Zhou, S., Means, J.A. and Hines, J.V. (2015) Fluorescence assays for monitoring RNA-ligand interactions and riboswitch-targeted drug discovery screening, Methods in Enzymology, 550, 363-383. 201. Zhou, S. (2015) Fluorescence anisotropy: analysis of tRNA binding to the T box riboswitch antiterminator RNA, Methods in Molecular Biology, 1240, 143-152. 202. Sweetser, D., Nonet, M. and Young, R.A. (1987) Prokaryotic and eukaryotic RNA polymerases have homologous core subunits, Proceedings of the National Academy of Sciences, 84, 5, 1192-1196. 203. Decker, K.B. and Hinton, D.M. (2013) Transcription regulation at the core: similarities among bacterial, archaeal, and eukaryotic RNA polymerases, Annual Review of Microbiology, 67, 113-139. 204. Jack, K.D. (2007) Metal Ion Effects on the T Box Antiterminator RNA and Complex Formation with TRNA, Ohio University, Athens, OH. 205. Agyeman, A. (2007) T Box Antiterminator-tRNA Recognition Elements, Ohio University. 206. Means, J.A. (2007) Fluorescence and NMR Characterization of a T Box Antiterminator-tRNA Complex, Ohio University, Athens, OH. 207. Cantor, C.R., Warshaw, M.M. and Shapiro, H. (1970) Oligonucleotide interactions. III. Circular dichroism studies of the conformation of deoxyoligonucleolides, Biopolymers, 9, 9, 1059-1077. 208. Cavaluzzi, M.J. and Borer, P.N. (2004) Revised UV extinction coefficients for nucleoside‐5′‐monophosphates and unpaired DNA and RNA, Nucleic Acids Research, 32, 1, e13.

196

APPENDIX 1: DNA TEMPLATES FOR TRANSCRIPTION

Only the template strands are shown below. The coding strands are fully complementary to the template strands.

3’ TAA TTA GAT CTA ATG CTT CTT ATA AGC CCT AAC ATA AAT TTT AGT TTC GCG AAA AAT CTA GTT TAC CTT TCG TAC TTT GTA GAA TAC CCA CTT TTG TTT TCA ACT GTA AAC CAG GTA GAA AAA TAT ACT AGT AAA TGA TAT TTT ATA CAA CGT CAC TCT CTT TCT TCA TGA ACG CAA ATG GAG TAC TTT CGC TGG AAT CCC GCC ACA TTC GAT TCC TAC TCG TGC GTT GCT TTC CGT AAG AAC TCG TTA AAA TTT TTT CTC CGA CCC TAA AAC AAG AGT CGT TGA TCC CAC CTT GGC GCC CTC TTG AGA GCA GGG ATA CAA ACG CCG ACC GTT CGT ATC TCT GCC CTC AAA AAA CCA ACG ACG GCG TCA GTT GAA TAC TTT CTT TTC ACC TCC ACG AAC TTT ACT TAT AAG TTC TGT ACT AAG ATT GGA ACG TTT TCG AAT TAA TTT ATG GG 5’

Figure A.1a The DNA template sequence of the glyQS leader region

5' GGG TAT TTA ATT AAG CTT TTG CAA GGT TAG AAT CAT GTC TTG AAT ATG CAC CTC CAC TTT TCT TTC ATA AGT ATA GTA AAT GAT CAT ATA AAA AGA TGG ACC AAA TGT CAA CTT TTG TTT TCG CGC TTT GAT TTT AAA TAC AAT CCC GAA TAT TCT TCG TAA TCT AGA TTA AT 3'

Figure A.1b The DNA template sequences of the transcription control

197

APPENDIX 2: TEST SCREENING LIGANDS AT 25°C AND 28°C

Figure A.2 Screening test was performed using GHB-54 and GHB-56 in all the three steps: (A) tRNA-induced, (B) basal level, (C) transcription control. In all reactions, n=3, 2+ DMSO = 3% (v/v), [RNAP] = 0.02 U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM. The concentration of tRNAGly, in the tRNA-induced reactions was 15 nM.

198

APPENDIX 3: SCREENING OF AMINOGLYCOSIDE AT 25°C AND 28°C

Figure A.3 Screening was performed using 8 aminoglycosides in all the three steps: (A) tRNA-induced, (B) basal level, (C) transcription control. In all reactions, n= 3, DMSO = 2+ 0% (v/v), [RNAP] = 0.02 U/µL, [RTprb] = 100 nM, [Mg ] = 4 mM, [spermidine] = 5 mM. The concentration of tRNAGly, in the tRNA-induced reactions was 15 nM. 199

APPENDIX 4: LIGAND SCREENING RESULTS IN THE TRNA-INDUCED

REACTIONS

All ligands were tested at 50µM unless otherwise specified. %inhibition was only calculated when the difference between the control and the ligand result was significant as determined by Prism (P value < 0.05).

Plate 1

Controls

Average Range of error Replicates tRNA-induced 64.8 0.9 3 Basal level 46.7 0.3 3

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition WZB-73 58.9 5.5 2 NS WZB-72 49.8 2.1 2 **0.0032 -23.1 IMB-16 63.6 6.6 2 X GHB-76 60.3 2.0 2 X GHB-7 46.1 2.0 2 **0.0015 -28.9 GHB-56 54.8 3.0 2 *0.0235 -15.4 GHB-54 55.5 1.8 2 **0.0089 -14.4 GHB-23 60.2 0.2 2 **0.0085 -7.0 GHB-146 66.0 9.1 2 X GHB-134 55.5 2.5 2 *0.0184 -14.4

200

Plate 2

Controls

Average Range of error Replicates tRNA-induced 41.7 2.3 3 Basal level 28.9 1.1 3

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition FFB-10 38.3 2.8535 2 X FFB-11 41.1 1.5625 2 X FFB-12 42.4 1.5345 2 X FFB-13 43.9 2.158 2 X FFB-14 39.8 2.6045 2 X FFB-15 39.4 2.366 2 X FFB-16 41.2 1.4875 2 X FFB-2 43.6 3.1005 2 X FFB-3 39.2 3.4865 2 X FFB-4 38.4 3.9815 2 X FFB-5 38.6 3.186 2 X FFB-6 41.4 1.4595 2 X FFB-7 43.0 1.3915 2 X FFB-8 39.8 2.599 2 X FFB-9 39.2 5.0745 2 X IAB-1 38.7 2.037 2 X IAB-2 36.9 2.093 2 X IAB-3 36.8 1.8575 2 NS IAB-4 37.2 0.0305 2 NS

201

Plate 3

Controls

Average Range of error Replicates tRNA-induced 53.4 2.3 5 Basal level 39.3 3.7 3

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition GHB-9 54.0 1.6 2 X GHB-51 47.5 2.6 2 *0.0282 -11.1 GHB-50 48.1 0.1 2 *0.0112 -9.9 GHB-49 47.5 3.8 2 X GHB-48 54.4 2.3 2 X GHB-47 53.8 0.8 2 X GHB-46 56.0 0.1 2 X GHB-45 52.3 0.5 2 X GHB-44 49.0 2.6 2 NS GHB-43 49.0 2.4 2 NS GHB-42 49.6 3.3 2 X GHB-41 54.5 0.7 2 X GHB-40 55.1 0.6 2 X GHB-39 53.8 2.5 2 X GHB-38 53.6 0.2 2 X GHB-37 52.1 1.9 2 X GHB-36 50.8 0.6 2 NS GHB-35 50.5 3.2 2 X GHB-34 50.2 2.4 2 X GHB-33 54.4 1.6 2 X GHB-32 54.8 2.1 2 X 202

Ligand Readthroughmax Range Replicates P value % inhibition GHB-31 52.2 0.7 2 X GHB-30 50.9 3.8 2 X GHB-29 50.1 0.7 2 X GHB-28 52.1 3.0 2 X GHB-27 47.0 0.0 2 **0.0049 -12.1 GHB-22 49.5 4.5 2 X GHB-21 51.3 1.4 2 X GHB-20 49.3 4.9 2 X GHB-19 55.0 3.3 2 X GHB-18 55.4 0.4 2 X GHB-17 54.4 2.6 2 X GHB-16 53.3 0.8 2 X GHB-15 45.3 0.9 2 **0.0023 -15.3 GHB-14 47.7 1.6 2 *0.0164 -10.7 GHB-13 52.1 0.6 2 X GHB-12 53.0 0.4 2 X GHB-11 54.4 0.6 2 X GHB-10 55.9 1.2 2 X

203

Plate 4

Controls

Average Range of error Replicates tRNA-induced 54.4 1.5 4 Basal level 40.2 3.1 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition GHB-94 57.3 0.1 2 X GHB-93 56.4 1.0 2 X GHB-92 27.8 27.3 2 X GHB-91 54.3 0.2 2 X GHB-90 49.9 1.4 2 *0.0349 -8.4 GHB-89 48.0 1.0 2 **0.0084 -11.9 GHB-88 51.2 2.5 2 X GHB-87 54.4 1.6 2 X GHB-86 57.3 0.1 2 X GHB-85 55.2 2.1 2 X GHB-84 53.0 0.0 2 X GHB-83 51.4 1.6 2 X GHB-82 51.9 0.4 2 NS GHB-81 51.3 1.7 2 X GHB-80 50.7 1.7 2 X GHB-79 56.8 0.3 2 X GHB-78 55.4 0.4 2 X GHB-77 54.6 1.2 2 X GHB-75 52.8 2.4 2 X GHB-74 51.2 0.4 2 NS GHB-73 52.3 1.9 2 X 204

Ligand Readthroughmax Range Replicates P value % inhibition GHB-72 52.6 4.5 2 X GHB-71 56.4 3.2 2 X GHB-70 56.7 0.8 2 X GHB-69 56.7 1.2 2 X GHB-68 52.0 4.5 2 X GHB-67 52.2 2.4 2 X GHB-66 50.4 3.3 2 X GHB-65 52.8 1.8 2 X GHB-64 56.2 0.7 2 X GHB-63 56.3 1.5 2 X GHB-62 54.6 0.6 2 X GHB-61 52.6 3.7 2 X GHB-59 53.7 1.1 2 X GHB-58 52.5 3.0 2 X GHB-57 51.6 5.1 2 X GHB-55 56.3 0.7 2 X GHB-53 57.4 1.3 2 X GHB-52 54.3 0.6 2 X GHB-26 47.4 0.4 2 **0.0042 -13.0 GHB-25 47.7 0.9 2 **0.0062 -12.4 GHB-24 46.8 4.4 2 NS

205

Plate 5

Controls

Average Range of error Replicates tRNA-induced 59.1 2.1 4 Basal level 44.2 2.8 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition GHB-99 55.4 3.3 2 X GHB-98 53.3 4.8 2 X GHB-97 59.4 2.4 2 X GHB-96 62.5 0.6 2 X GHB-95 56.4 0.0 2 X GHB-154 55.1 2.9 2 X GHB-153 54.0 1.2 2 *0.0369 -8.7 GHB-152 55.1 3.4 2 X GHB-151 62.5 2.5 2 X GHB-150 59.5 0.6 2 X GHB-149 60.4 1.0 2 X GHB-148 58.9 0.3 2 X GHB-147 54.5 2.5 2 X GHB-145 54.0 0.9 2 *0.0318 -8.7 GHB-144 53.7 4.2 2 X GHB-143 60.8 4.0 2 X GHB-142 61.2 1.2 2 X GHB-141 59.3 1.5 2 X GHB-140 57.6 0.8 2 X GHB-139 54.5 1.7 2 NS GHB-138 56.1 2.3 2 X 206

Ligand Readthroughmax Range Replicates P value % inhibition GHB-137 54.4 3.5 2 X GHB-136 53.2 3.8 2 X GHB-135 62.0 2.6 2 X GHB-133 59.2 1.4 2 X GHB-132 56.7 1.2 2 X GHB-131 53.6 5.3 2 X GHB-130 55.7 1.8 2 X GHB-114 54.7 3.6 2 X GHB-113 55.6 4.6 2 X GHB-112 59.4 3.0 2 X GHB-111 60.9 0.3 2 X GHB-110 59.6 1.7 2 X GHB-109 56.1 4.3 2 X GHB-108 57.2 0.2 2 X GHB-107 53.9 4.2 2 X GHB-105 61.7 2.7 2 X GHB-104 60.4 1.4 2 X GHB-103 59.7 2.2 2 X GHB-102 57.0 0.4 2 X GHB-101 55.8 4.2 2 X GHB-100 56.5 0.6 2 NS

207

Plate 6

Controls

Average Range of error Replicates tRNA-induced 55.5 2.2 4 Basal level 43.2 3.5 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition GHB-161 51.9 4.0 2 X GHB-160 53.4 0.0 2 NS GHB-159 53.7 3.8 2 X GHB-158 53.8 4.7 2 X GHB-157 59.6 0.7 2 X GHB-156 61.4 0.5 2 X GHB-155 56.3 0.8 2 X IMB-9 58.3 3.0 2 X IMB-8 56.5 0.9 2 X IMB-7 54.6 2.1 2 X IMB-58 52.7 1.9 2 X IMB-57 51.3 0.7 2 *0.0399 -7.6 IMB-56 52.3 5.8 2 X IMB-55 58.2 1.6 2 X IMB-54 59.2 0.1 2 X IMB-53 57.4 1.4 2 X IMB-52 54.9 1.1 2 X IMB-51 52.2 2.3 2 X IMB-50 52.0 1.3 2 NS IMB-49 50.6 2.7 2 NS IMB-47 58.4 2.2 2 X 208

Ligand Readthroughmax Range Replicates P value % inhibition IMB-40 55.9 0.9 2 X IMB-39 57.6 0.8 2 X IMB-33 55.3 1.1 2 X IMB-32 53.3 2.4 2 X IMB-31 54.4 2.0 2 X IMB-30 54.3 2.1 2 X IMB-29 52.4 4.1 2 X IMB-28 56.5 1.5 2 X IMB-25 57.1 2.3 2 X IMB-24 53.8 0.2 2 NS IMB-23 52.8 4.7 2 X IMB-22 53.3 0.1 2 NS IMB-21 53.0 3.1 2 X IMB-20 51.2 4.4 2 X IMB-19 57.7 3.0 2 X IMB-18 56.5 0.2 2 X IMB-15 56.7 3.0 2 X IMB-14 51.3 5.0 2 X IMB-13 55.5 2.7 2 X IMB-12 52.6 3.8 2 X IMB-1 53.1 0.6 2 NS

209

Plate 7

Controls

Average Range of error Replicates tRNA-induced 55.5 3.2 4 Basal level 42.1 4.2 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition IMB-99 53.2 3.3 2 X IMB-89 57.1 2.3 2 X IMB-85 57.8 1.6 2 X IMB-81 54.8 0.2 2 X IMB-80 52.7 1.3 2 X IMB-79 54.6 1.0 2 X IMB-78 53.4 4.3 2 X IMB-77 53.3 3.0 2 X IMB-76 56.6 2.9 2 X IMB-75 57.8 0.3 2 X IMB-74 56.3 0.2 2 X IMB-73 53.6 3.9 2 X IMB-72 53.9 2.9 2 X IMB-71 53.3 2.1 2 X IMB-69 57.9 1.9 2 X IMB-68 56.7 0.1 2 X IMB-67 58.4 1.1 2 X IMB-66 55.1 1.2 2 X IMB-65 51.0 2.3 2 X IMB-64 52.2 0.2 2 NS IMB-63 53.1 3.3 2 X 210

Ligand Readthroughmax Range Replicates P value % inhibition IMB-62 52.2 4.1 2 X IMB-61 56.9 1.2 2 X IMB-60 59.6 0.1 2 X IMB-59 54.6 0.3 2 X IMB-183 53.1 0.8 2 X IMB-182 51.7 1.4 2 X IMB-181 53.5 4.2 2 X IMB-180 59.1 2.5 2 X IMB-179 59.0 0.8 2 X IMB-127 57.0 0.4 2 X IMB-126 44.7 11.2 2 X IMB-125 53.2 2.1 2 X IMB-124 53.0 1.7 2 X IMB-110 54.1 2.9 2 X IMB-109 58.3 1.8 2 X IMB-108 58.8 0.8 2 X IMB-107 59.1 1.7 2 X IMB-106 56.1 1.7 2 X IMB-104 52.4 2.6 2 X IMB-101 54.3 0.9 2 X IMB-100 55.5 2.8 2 X

211

Plate 8

Controls

Average Range of error Replicates tRNA-induced 57.9 3.2 4 Basal level 43.1 3.8 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition WZB-71 54.5 6.1 2 X WZB-70 56.4 3.8 2 X WZB-69 59.1 1.2 2 X WZB-68 59.8 3.5 2 X WZB-67 59.3 2.2 2 X WZB-66 53.4 2.4 2 X WZB-65 53.0 0.5 2 NS WZB-64 54.1 4.1 2 X WZB-63 58.9 3.9 2 X WZB-62 58.0 0.8 2 X WZB-61 58.1 1.8 2 X WZB-60 58.7 2.0 2 X WZB-59 55.3 4.2 2 X WZB-58 54.6 0.1 2 NS WZB-47 50.8 3.9 2 NS WZB-41 53.7 3.8 2 X WZB-40 61.6 2.9 2 X WZB-39 59.7 2.1 2 X WZB-38 57.4 0.8 2 X WZB-37b 55.0 4.4 2 X WZB-37a 52.8 1.2 2 NS WZB-36 54.0 3.2 2 X 212

Ligand Readthroughmax Range Replicates P value % inhibition WZB-35 54.0 4.4 2 X WZB-34 59.0 3.2 2 X WZB-33 58.2 0.6 2 X WZB-32 57.8 0.3 2 X WZB-31 52.7 3.5 2 X WZB-30 54.7 2.1 2 X WZB-29 52.3 3.3 2 X WZB-28 58.8 1.6 2 X IMB-199 58.6 0.1 2 X IMB-198 58.6 2.2 2 X IMB-193 56.6 0.5 2 X IMB-192 53.6 2.9 2 X IMB-189 54.2 0.3 2 NS IMB-188 52.9 1.6 2 NS IMB-187 53.3 4.2 2 X IMB-186 61.5 3.8 2 X IMB-185 60.9 1.2 2 X IMB-184 57.5 0.9 2 X GHB-92 53.3 1.0 2 NS

213

Plate 9

Controls

Average Range of error Replicates tRNA-induced 55.0 6.1 4 Basal level 41.8 1.7 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition RLB-44 52.7 0.8 2 X RLB-43 54.2 1.1 2 X RLB-42 52.8 4.4 2 X RLB-41 52.6 0.1 2 X RLB-40 52.0 3.2 2 X RLB-39 59.8 2.9 2 X RLB-38 58.4 0.5 2 X RLB-37 54.5 0.8 2 X COB-35 55.6 2.1 2 X COB-34 56.2 0.5 2 X COB-33 51.0 1.3 2 X COB-32 50.0 2.5 2 X COB-31 50.7 4.1 2 X COB-30 52.5 0.8 2 X ANB-40 53.8 0.8 2 X ANB-22 59.5 0.8 2 X

214

Plate 10

Controls

Average Range of error Replicates tRNA-induced 38.4 3.4 4 Basal level 27.9 1.1 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition

GHB-106 35.9 2.1 2 X GHB-60 37.6 2.3 2 X IMB-17 38.3 0.2 2 X

215

Plate 11

Controls

Average Range of error Replicates tRNA-induced 46.5 5.7 4 Basal level 34.1 0.2 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition GHB-1 33.1 1.3 2 *0.0370 -28.9 GHB-2 44.1 3.3 2 NS GHB-4 39.5 0.5 2 NS GHB-6 47.0 0.4 2 NS

Plate 12

Controls

Average Range of error Replicates tRNA-induced 43.1 4.7 4 Basal level 30.6 1.6 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition IMB-10 43.7 1.1 2 X IMB-11 44.7 1.6 2 X

216

Plate 13

Controls

Average Range of error Replicates tRNA-induced 43.3 3.6 6 Basal level 33.5 1.8 6

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition ISA03041-2 47.1 1.8 4 X ISA03057-2 47.7 1.7 4 X

Plate 14

Controls

Average Range of error Replicates tRNA-induced 38.1 2.8 6 Basal level 23.9 0.4 4

Ligand-induced inhibition in tRNA-induced reactions

Ligand Readthroughmax Range Replicates P value % inhibition IAB-5 39.2 3.6 3 NS (175µm) IAB-6 36.0 1.0 3 NS (175µm)

217

APPENDIX 5: LIGAND SCREENING RESULTS IN BASAL LEVEL REACTIONS

Plate 1

Controls

Average Range of error Replicates tRNA-induced 48.1 4.0 3 Basal level 36.5 1.3 3

Ligand-induced inhibition in basal level reactions

Ligand Readthroughmax Range Replicates P value % inhibition WZB-73 35.5 0.5 2 X WZB-72 36.3 1.8 2 X IMB-16 36.4 1.6 2 X GHB-76 36.3 1.2 2 X GHB-7 33.9 2.1 2 X GHB-56 34.8 1.8 2 X GHB-54 34.9 2.0 2 X GHB-23 39.7 0.4 2 X GHB-146 34.6 3.0 2 X GHB-134 35.1 0.3 2 X IAB-1 38.2 6.7 2 X IAB-2 35.6 0.8 2 X IAB-3 37.0 0.6 2 X IAB-4 35.7 3.8 2 X WZB-73 35.5 0.5 2 X WZB-72 36.3 1.8 2 X IMB-16 36.4 1.6 2 X GHB-76 36.3 1.2 2 X 218

GHB-7 33.9 2.1 2 X

Ligand Readthroughmax Range Replicates P value % inhibition GHB-56 34.8 1.8 2 X GHB-54 34.9 2.0 2 X GHB-23 39.7 0.4 2 X GHB-146 34.6 3.0 2 X GHB-134 35.1 0.3 2 X IAB-1 38.2 6.7 2 X IAB-2 35.6 0.8 2 X IAB-3 37.0 0.6 2 X IAB-4 35.7 3.8 2 X WZB-73 35.5 0.5 2 X WZB-72 36.3 1.8 2 X IMB-16 36.4 1.6 2 X GHB-76 36.3 1.2 2 X GHB-7 33.9 2.1 2 X GHB-56 34.8 1.8 2 X GHB-54 34.9 2.0 2 X GHB-23 39.7 0.4 2 X GHB-146 34.6 3.0 2 X GHB-134 35.1 0.3 2 X IAB-1 38.2 6.7 2 X IAB-2 35.6 0.8 2 X IAB-3 37.0 0.6 2 X IAB-4 35.7 3.8 2 X

219

Plate 2

Controls

Average Range of error Replicates tRNA-induced 53.2 2.3 4 Basal level 36.6 3.6 4

Ligand-induced inhibition in basal level reactions

Ligand Readthroughmax Range Replicates P value % inhibition IMB-57 39.7 1.1 2 X IMB-54 39.0 1.2 2 X IMB-64 38.9 1.5 2 X IMB-60 42.2 0.7 2 X IMB-179 38.6 1.1 2 X IMB-108 35.3 3.8 2 X WZB-65 36.9 1.2 2 X WZB-58 34.5 5.6 2 X WZB-37b 40.8 3.8 2 X WZB-37a 39.8 0.9 2 X IMB-189 39.0 1.4 2 X IMB-188 35.5 4.7 2 X RLB-38 38.3 2.9 2 X COB-35 37.5 0.7 2 X COB-34 37.8 2.6 2 X COB-33 36.6 4.5 2 X COB-32 41.8 1.6 2 X COB-31 42.7 1.1 2 X COB-30 38.5 0.5 2 X

220

Plate 3

Controls

Average Range of error Replicates tRNA-induced 45.8 5.7 4 Basal level 39.5 2.9 4

Ligand-induced inhibition in basal level reactions

Ligand Readthroughmax Range Replicates P value % inhibition GHB-51 37.5 1.7 2 X GHB-50 36.9 0.6 2 X GHB-29 36.3 2.0 2 X GHB-27 37.1 0.4 2 X GHB-15 35.3 3.6 2 X GHB-14 33.5 2.6 2 X GHB-94 37.6 2.0 2 X GHB-92 35.7 3.8 2 X GHB-90 35.8 0.4 2 NS GHB-89 37.3 2.0 2 X GHB-84 33.8 3.8 2 X GHB-74 42.2 1.6 2 X GHB-26 39.5 0.3 2 X GHB-25 34.6 0.1 2 NS GHB-96 41.7 4.0 2 X GHB-153 37.3 0.9 2 X GHB-145 35.8 4.5 2 X GHB-139 34.7 4.9 2 X GHB-138 39.4 1.9 2 X GHB-160 44.2 3.3 2 X GHB-159 37.2 1.2 2 X GHB-157 37.8 0.8 2 X GHB-156 36.9 2.8 2 X IMB-9 28.4 1.6 2 X IMB-56 37.2 0.3 2 X IMB-55 37.7 0.4 2 X 221

Plate 4

Controls

Average Range of error Replicates tRNA-induced 30.5 2.7 4 Basal level 22.8 0.4 4

Ligand-induced inhibition in basal level reactions

Ligand Readthroughmax Range Replicates P value % inhibition GHB-106 32.7 7.2 2 X GHB-146 26.1 1.9 2 X GHB-55 26.4 0.7 2 X GHB-60 26.4 2.5 2 X IMB-17 28.1 1.1 2 X WZB-47 28.7 1.8 2 X

Plate 5

Controls

Average Range of error Replicates tRNA-induced 46.5 5.4 4 Basal level 34.1 0.2 4

Ligand-induced inhibition in basal level reactions

Ligand Readthroughmax Range Replicates P value % inhibition GHB-1 24.9 0.7 2 ***<0.0001 -27.2 GHB-2 32.3 0.0 2 ***0.0005 -5.3 GHB-4 29.8 0.5 2 ***0.0002 -12.8 GHB-6 34.3 1.9 2 NS 222

Plate 6

Controls

Average Range of error Replicates tRNA-induced 43.1 4.7 4 Basal level 30.6 1.6 4

Ligand-induced inhibition in basal level reactions

Ligand Readthroughmax Range Replicates P value % inhibition IMB-10 32.3 2.7 2 X IMB-11 33.9 1.1 2 X

Plate 7

Controls

Average Range of error Replicates tRNA-induced 43.3 3.6 6 Basal level 33.5 1.8 6

Ligand-induced inhibition in basal level reactions

Ligand Readthroughmax Range Replicates P value % inhibition ISA03041-2 33.5 3.3 4 X ISA03057-2 33.2 1.4 4 X

223

Plate 8

Controls

Average Range of error Replicates tRNA-induced 45.8 3.9 8 Basal level 32.8 1.5 8

Ligand-induced inhibition in basal level reactions

% Ligand Readthroughmax Range Replicates P value inhibition GHB-7 23.3 3.3 4 ***<0.0001 -28.7

224

APPENDIX 6: LIGAND SCREENING RESULTS IN TRANSCRIPTION CONTROL

REACTIONS

Plate 1

Controls

Average Range of error Replicates Transcription ctrl. 230.3 28.6 3

Ligand-induced inhibition to the transcription mechanism

Ligand Readthroughmax Range Replicates P value % inhibition WZB-73 216.5 14.8 2 X WZB-72 265.2 17.3 2 X IMB-16 234.8 2.2 2 X GHB-76 232.2 5.3 2 X GHB-7 215.7 14.3 2 X GHB-56 219.5 19.3 2 X GHB-54 210.9 18.0 2 X GHB-23 245.3 1.6 2 X GHB-146 252.5 0.9 2 X GHB-134 222.1 0.4 2 X

225

Plate 2

Controls

Average Range of error Replicates Transcription ctrl. 194.2 11.3 4

Ligand-induced inhibition to the transcription mechanism

Ligand Readthroughmax Range Replicates P value % inhibition IAB-1 195.6 7.6 2 X IAB-2 199.2 1.5 2 X IAB-3 190.9 0.3 2 X IAB-4 180.2 14.6 2 X

226

Plate 3

Controls

Average Range of error Replicates Transcription ctrl. 173.0 17.9 6

Ligand-induced inhibition to the transcription mechanism

Ligand Readthroughmax Range Replicates P value % inhibition GHB-51 165.3 6.1 2 X GHB-50 168.1 0.4 2 X GHB-29 170.1 7.6 2 X GHB-27 154.1 0.4 2 NS GHB-15 166.4 8.7 2 X GHB-14 173.5 4.6 2 X GHB-94 168.5 4.8 2 X GHB-92 170.1 0.7 2 X GHB-90 166.2 8.5 2 X GHB-89 165.1 5.9 2 X GHB-84 155.2 11.1 2 X GHB-74 159.5 0.1 2 X GHB-26 160.7 10.8 2 X GHB-25 153.3 14.5 2 X GHB-96 155.3 15.3 2 X GHB-153 165.2 4.2 2 X GHB-145 158.5 8.7 2 X GHB-139 154.3 5.2 2 NS GHB-138 152.0 1.8 2 NS GHB-160 157.9 10.9 2 X GHB-159 163.3 5.1 2 X GHB-157 165.7 8.4 2 X GHB-156 162.6 5.3 2 X 227

Plate 4

Controls

Average Range of error Replicates Transcription ctrl. 139.1 21.2 6

Ligand-induced inhibition to the transcription mechanism

Ligand Readthroughmax Range Replicates P value % inhibition IMB-57 149.6 9.6 2 X IMB-54 144.1 4.3 2 X IMB-64 149.6 5.7 2 X IMB-60 150.8 3.0 2 X IMB-179 170.3 32.5 2 X IMB-108 136.6 14.2 2 X WZB-65 138.0 5.0 2 X WZB-58 134.6 17.7 2 X WZB-37b 159.6 11.2 2 X WZB-37a 148.7 6.5 2 X IMB-189 141.5 6.7 2 X IMB-188 171.0 25.4 2 X RLB-38 133.8 6.0 2 X COB-35 133.3 2.0 2 X COB-34 137.2 12.4 2 X COB-33 136.2 13.8 2 X COB-32 149.8 9.6 2 X COB-31 150.1 5.3 2 X COB-30 146.3 1.9 2 X

228

Plate 5

Controls

Average Range of error Replicates Transcription ctrl. 113.9 3.0 4

Ligand-induced inhibition to the transcription mechanism

Ligand Readthroughmax Range Replicates P value % inhibition GHB-106 112.0 9.1 2 X GHB-55 110.9 1.0 2 X GHB-60 127.4 5.5 2 X IMB-16 112.2 8.2 2 X IMB-17 118.1 7.5 2 X

Plate 6

Controls

Average Range of error Replicates Transcription ctrl. 159.1 7.2 8

Ligand-induced inhibition to the transcription mechanism

Ligand Readthroughmax Range Replicates P value % inhibition GHB-1 139.6 8.9 2 **0.0072 -11.6 GHB-2 146.3 9.1 2 *0.0483 -8.9 GHB-4 139.8 3.2 2 **0.0022 -11.3 GHB-6 146.2 7.2 2 *0.0332 -8.2 229

Plate 7

Controls

Average Range of error Replicates

Transcription ctrl. 136.9 5.8 4

Ligand-induced inhibition to the transcription mechanism

Ligand Readthroughmax Range Replicates P value % inhibition IMB-10 127.6 2.3 2 NS IMB-11 123.9 5.1 2 NS

230

Plate 8

Controls

Average Range of error Replicates

Transcription ctrl. 136.7 10.3 8

Ligand-induced inhibition to the transcription mechanism

% Ligand Readthroughmax Range Replicates P value inhibition GHB-7 110.5 7.8 5 ***<0.0001 -19.2

231

APPENDIX 7: SELF-FLUORESCENCE OF LIGANDS

The self-fluorescence was checked by comparing the fluorescence before and after addition of 2µL 50µM ligand in 50% (v/v) DMSO to the reaction mixture.

Background control [addition of 2µL 50% (v/v) DMSO]: RFUaddition ± SD = 11.3 ± 2.3

Ligand RFUaddition SD Ligand RFUaddition SD GHB-134 9.4 1.3 FFB-7 8.8 1.9 GHB-146 9.3 1.1 FFB-8 9.0 1.5 GHB-23 12.4 0.2 FFB-9 8.5 0.9 GHB-54 11.7 0.5 IAB-1 4.6 2.0 GHB-56 9.4 0.9 IAB-2 5.3 0.4 GHB-7 13.4 0.2 IAB-3 4.5 1.8 GHB-76 11.8 0.0 IAB-4 5.4 0.6 IMB-16 3.1 0.5 GHB-9 12.8 0.9 WZB-72 6.9 0.3 GHB-51 5.3 2.4 WZB-73 6.0 1.5 GHB-50 6.7 0.9 FFB-10 6.2 0.8 GHB-49 5.0 0.6 FFB-11 7.4 0.3 GHB-48 5.5 0.1 FFB-12 7.2 0.9 GHB-47 7.0 0.6 FFB-13 7.9 0.1 GHB-46 7.0 0.2 FFB-14 6.8 1.1 GHB-45 5.7 0.8 FFB-15 6.5 0.9 GHB-44 6.4 0.5 FFB-16 6.0 0.1 GHB-43 6.0 1.5 FFB-2 10.9 0.9 GHB-42 6.0 0.6 FFB-3 8.9 1.4 GHB-41 6.9 0.7 FFB-4 9.0 0.1 GHB-40 9.1 1.0 FFB-5 9.7 0.8 GHB-39 7.9 1.4 FFB-6 10.4 0.3 GHB-38 8.1 0.7

232

Ligand RFUaddition SD Ligand RFUaddition SD GHB-37 8.3 1.2 GHB-92 8.5 0.5 GHB-36 6.9 0.0 GHB-91 8.5 0.2 GHB-35 7.7 0.3 GHB-90 7.1 0.2 GHB-34 9.5 0.9 GHB-89 7.7 1.8 GHB-33 10.5 1.0 GHB-88 8.1 2.3 GHB-32 10.3 0.1 GHB-87 10.4 0.6 GHB-31 9.7 0.8 GHB-86 9.6 0.8 GHB-30 9.2 1.5 GHB-85 10.6 0.1 GHB-29 9.0 0.9 GHB-84 9.9 1.0 GHB-28 9.5 0.4 GHB-83 9.0 0.7 GHB-27 9.4 0.8 GHB-82 10.1 1.8 GHB-22 9.8 1.7 GHB-81 9.7 1.9 GHB-21 11.4 1.2 GHB-80 9.6 1.2 GHB-20 10.3 1.4 GHB-79 10.9 0.8 GHB-19 13.4 0.1 GHB-78 11.6 1.9 GHB-18 11.3 1.3 GHB-77 11.4 0.7 GHB-17 12.3 1.0 GHB-75 8.2 1.2 GHB-16 12.8 1.2 GHB-74 10.0 0.7 GHB-15 10.1 0.5 GHB-73 10.7 0.9 GHB-14 11.4 1.8 GHB-72 10.2 1.7 GHB-13 11.9 0.5 GHB-71 11.2 1.8 GHB-12 11.8 0.4 GHB-70 12.1 0.4 GHB-11 12.7 0.7 GHB-69 12.5 0.7 GHB-10 14.9 0.2 GHB-68 11.0 1.7 GHB-94 7.6 0.1 GHB-67 10.7 0.2 GHB-93 6.6 0.4 GHB-66 11.7 2.1

233

Ligand RFUaddition SD Ligand RFUaddition SD GHB-65 12.3 0.8 GHB-147 7.2 0.8 GHB-64 13.4 1.1 GHB-145 5.7 0.9 GHB-63 12.7 0.5 GHB-144 7.3 0.1 GHB-62 12.6 0.1 GHB-143 9.0 0.3 GHB-61 12.0 0.8 GHB-142 7.5 0.1 GHB-59 12.1 1.0 GHB-141 9.5 1.5 GHB-58 11.9 0.8 GHB-140 8.7 1.2 GHB-57 11.3 0.1 GHB-139 7.7 0.6 GHB-55 14.1 0.6 GHB-138 7.0 1.5 GHB-53 14.2 0.0 GHB-137 8.8 0.3 GHB-52 12.8 0.3 GHB-136 9.2 0.1 GHB-26 6.4 0.3 GHB-135 9.0 0.1 GHB-25 7.3 1.6 GHB-133 8.5 0.4 GHB-24 6.7 2.3 GHB-132 10.2 0.5 GHB-99 12.6 1.2 GHB-131 9.3 0.8 GHB-98 11.9 1.6 GHB-130 9.7 2.1 GHB-97 12.5 1.2 GHB-114 9.5 1.4 GHB-96 13.3 0.3 GHB-113 10.8 0.8 GHB-95 13.1 0.3 GHB-112 13.1 0.6 GHB-154 4.2 0.2 GHB-111 12.3 0.6 GHB-153 4.0 0.4 GHB-110 11.9 1.1 GHB-152 5.3 0.1 GHB-109 10.5 1.4 GHB-151 6.8 0.4 GHB-108 11.3 0.4 GHB-150 6.2 0.3 GHB-107 11.6 0.9 GHB-149 6.1 2.0 GHB-105 11.8 1.4 GHB-148 6.2 0.7 GHB-104 11.6 0.8

234

Ligand RFUaddition SD Ligand RFUaddition SD GHB-103 12.6 0.9 IMB-25 10.1 1.7 GHB-102 12.9 0.1 IMB-24 8.6 1.0 GHB-101 11.1 0.2 IMB-23 8.6 1.1 GHB-100 11.4 0.1 IMB-22 9.6 0.8 IMB-9 12.8 0.6 IMB-21 9.2 1.0 IMB-8 11.6 2.4 IMB-20 9.9 0.7 IMB-7 12.7 0.7 IMB-19 10.9 0.9 IMB-58 3.9 0.7 IMB-18 11.8 1.1 IMB-57 4.1 0.2 IMB-15 11.8 0.4 IMB-56 6.1 2.2 IMB-14 10.0 1.2 IMB-55 9.1 1.2 IMB-13 11.7 2.4 IMB-54 6.9 0.9 IMB-12 11.3 0.6 IMB-53 6.3 0.0 IMB-1 10.4 0.3 IMB-52 7.5 1.0 GHB-161 11.6 1.6 IMB-51 5.9 0.1 GHB-160 10.9 0.8 IMB-50 6.7 0.6 GHB-159 12.6 2.3 IMB-49 7.6 0.3 GHB-158 11.7 1.6 IMB-47 8.4 0.3 GHB-157 13.6 0.6 IMB-40 8.7 0.1 GHB-156 13.5 0.2 IMB-39 8.9 0.8 GHB-155 13.4 0.6 IMB-33 9.6 1.4 IMB-99 7.7 0.3 IMB-32 8.8 2.6 IMB-89 9.3 0.1 IMB-31 8.9 1.9 IMB-85 10.0 0.6 IMB-30 7.9 0.4 IMB-81 8.6 0.1 IMB-29 8.9 2.5 IMB-80 9.6 1.4 IMB-28 10.5 0.0 IMB-79 9.0 0.8

235

Ligand RFUaddition SD Ligand RFUaddition SD IMB-78 9.4 2.4 IMB-125 7.9 0.7 IMB-77 8.7 0.2 IMB-124 7.1 0.4 IMB-76 10.8 0.9 IMB-110 6.9 0.2 IMB-75 11.2 0.4 IMB-109 7.0 1.0 IMB-74 9.7 2.0 IMB-108 7.2 0.1 IMB-73 10.9 1.0 IMB-107 7.8 0.1 IMB-72 11.3 0.2 IMB-106 6.7 0.8 IMB-71 11.4 0.6 IMB-104 8.9 0.1 IMB-69 12.6 0.2 IMB-101 7.8 0.8 IMB-68 12.2 0.9 IMB-100 7.3 1.4 IMB-67 12.1 0.1 WZB-72 4.3 0.1 IMB-66 12.3 0.1 WZB-71 4.2 0.5 IMB-65 11.9 1.4 WZB-70 6.7 0.5 IMB-64 11.8 1.0 WZB-69 5.8 0.8 IMB-63 12.4 2.4 WZB-68 6.2 0.1 IMB-62 11.5 0.2 WZB-67 7.2 0.1 IMB-61 13.3 1.0 WZB-66 6.3 0.3 IMB-60 13.4 0.1 WZB-65 6.2 1.0 IMB-59 12.4 1.4 WZB-64 6.4 0.9 IMB-183 5.4 0.7 WZB-63 9.3 1.2 IMB-182 5.6 0.0 WZB-62 8.2 0.4 IMB-181 5.7 0.9 WZB-61 9.9 1.3 IMB-180 6.5 0.6 WZB-60 8.4 0.1 IMB-179 6.3 1.3 WZB-59 6.9 0.5 IMB-127 5.3 0.2 WZB-58 8.4 0.1 IMB-126 6.5 0.0 WZB-47 10.0 1.7

236

Ligand RFUaddition SD Ligand RFUaddition SD WZB-41 7.9 0.7 IMB-188 12.9 0.8 WZB-40 9.1 1.2 IMB-187 11.7 2.3 WZB-39 10.5 0.1 IMB-186 13.4 0.1 WZB-38 10.3 1.5 IMB-185 13.5 0.3 WZB-37b 9.1 0.1 IMB-184 13.2 1.1 WZB-37a 9.3 0.5 GHB-92 4.6 1.8 WZB-41 7.9 0.7 RLB-44 7.3 0.7 WZB-40 9.1 1.2 RLB-43 9.0 0.2 WZB-39 10.5 0.1 RLB-42 9.3 1.1 WZB-38 10.3 1.5 RLB-41 8.5 0.9 WZB-37b 9.1 0.1 RLB-40 7.8 1.1 WZB-37a 9.3 0.5 RLB-39 10.2 0.1 WZB-36 8.8 3.4 RLB-38 10.2 1.4 WZB-35 9.8 1.4 RLB-37 10.6 0.1 WZB-34 12.7 0.9 COB-35 6.7 1.3 WZB-33 11.4 1.5 COB-34 6.6 1.1 WZB-32 11.5 1.9 COB-33 8.5 0.5 WZB-31 10.9 0.5 COB-32 8.4 1.2 WZB-30 10.3 0.4 COB-31 7.7 0.6 WZB-29 10.5 1.4 COB-30 8.5 1.5 WZB-28 11.9 0.8 ISA03041-2 3.1 0.8 IMB-199 11.7 0.0 ISA03057-2 3.9 0.8 IMB-198 13.8 1.0 IMB-193 12.5 0.7 IMB-192 12.6 0.7 IMB-189 12.4 0.7

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

Thesis and Dissertation Services ! !