European Journal of Biotechnology and Bioscience
European Journal of Biotechnology and Bioscience Online ISSN: 2321-9122, Impact Factor: RJIF 5.44 www.biosciencejournals.com Volume 4; Issue 7; July 2016; Page No. 42-47
Phylogenetic analysis of some Puntius species based on 18S rDNA 1 Saroniya RK, 2 Nagpure NS, 3 Saksena DN, 4 Basdeo Kushwaha, 5 Ravindra Kumar, 6 Mahender Singh, 7 Vishwamitra Singh Baisvar, 8 Akhilesh Kumar Mishra 1 Department of Zoology, Government Degree College, Mant, Mathura, Uttar Pradesh, India 2 Central Institute of Fisheries Education, Panch Marg, Off Yari Road, Mumbai, Maharashtra, India 3 School of Studies in Zoology, Jiwaji University, Gwalior, Madhya Pradesh, India 4-8 National Bureau of Fish Genetic Resources, Canal Ring Road, P.O.- Dilkusha, Lucknow Uttar Pradesh, India
Abstract The molecular characterization and phylogenetic analysis have been carried out in four Puntius species using 18S rDNA sequences. The size of the consensus sequences of 18S rDNA ranged between 1807-1817 bp (i.e. 1810 bp in P. chola, 1809 bp in P. conchonius, 1817 bp in P. sophore and 1807 bp in P. ticto). The GC and AT content (%) was 56.96 and 43.04 in P. chola, 55.67 and 44.33 in P. conchonius, 56.69 and 43.31 in P. sophore and 55.06 and 44.94 in P. ticto. The dataset after multiple sequence alignment of these Puntius species contained 1906 nucleotide positions, out of which 1430 were conserved, 467 variable, 205 singleton, and 256 parsimony informative. The inter-specific genetic variation was low. P. chola revealed lowest genetic distance with P. sophore and same was true between P. conchonius and P. ticto. The evolutionary history was inferred by three methods, namely Maximum Parsimony, Neighbour-Joining and the Maximum Likelihood. The three different phylogenetic approaches resulted mostly in similar tree topologies and the clades were well supported with bootstrap values. P. chola and P. sophore clustered together as sister group and same was true with P. conchonius and P. ticto, which showed their close relationship. The phylogenetic reconstruction of present study was also in agreement with earlier studies based on morphometric, cytogenetic studies, mitochondrial cytochrome b gene and restriction fragment polymorphism analysis.
Keywords: Phylogenetic, rDNA, nucleotide, tree, sequences
1. Introduction In view of this, the present study was aimed to characterise Cypriniformes, an order of ray-finned fish that includes and find out phylogenetic relationship among these Puntius carps, minnows, loaches and relatives, is recognized as the species on the basis of 18S rDNA sequences to facilitate most varied group of freshwater fishes with estimated policy makers to make their conservation plans for sustainable diversity of over 3,500 species [1] contained in 280 genera and utilization. five families. The cyprinid genus Puntius comprises over 140 species [2] of small to medium sized barbs found in stagnant 2. Material and methods pools to fast flowing freshwater streams of tropical Asia. The Collection of specimens fishes of this mainly comprised of food as well as valuable Live specimens of P. conchonius, P. chola and P. ticto were ornamental fishes due to their attractive appearance. Presently, collected from Pahuj River at the site of village Pohra on the over 60 species of Puntius from India, largely from the border of Jhansi (Uttar Pradesh) and Datia (Madhya Pradesh). Eastern Himalayas and Eastern as well as Western Ghats, are Specimens of P. sophore were collected from Ramsagar known [2]. Four species of this genus, viz. P. conchonius, P. reservoir at Barauni, near Datia. Collected specimens were chola, P. sophore and P. ticto, are commonly found in the identified using the keys developed by Talwar and Jhingran freshwater bodies of the central part of India [3, 8]. [10], Srivastava [11] and Jayaram [12]. The nuclear ribosomal DNA (rDNA) are organized as multiple copies of a repeated unit that consists of a transcribed zone Genomic DNA isolation and amplification with coding regions for the 18S, 5.8S and 28S RNA genes, The total genomic DNA was isolated from the muscle tissue internal and external transcribed spacers (ITS & ETS) and samples following standard phenol: chloroform: isoamyl surrounded by non-transcribed spacers (NTS) sequences [9]. alcohol method of Sambrook and Russel [13] with minor The presence of large variable regions in rDNA offers modifications. Four specific primers (18SAF: 5’- sufficient scope for differentiating the species, so the authentic CTCAAAGATTAAGCCATGCAG GTC-3’ and 18SAR: 5’- phylogenetic relationship can also be deduced. ATGGGTAATTTGCGCGCCTGCTG-3’; 18SBF: 5’- However, the fish germplasm has been depleting very fast due CGGCTAC CACATTCAAGGAAGG-3’ and 18SBR: 5’- to various anthropogenic stresses like pollution, habitat ATCCTTTCGCTTCGTCCGTCTTG-3’; 18SCF: 5’- destruction, overexploitation etc. Thus, it is imperative to CGGCGCAAGACGGACGAAAGC-3’ and 18SCR: 5’- undertake remedial measures to conserve the germplasm. GACCTGTTATTCCTC CATCTCGCG-3’; and 18SDF: 5’- Genetic characterization of fish species is an important step CGTGCG GTCGGCGTTCAACTTC-3’ and 18SD R: 5’- taken towards conservation of fish species that enable precise CCTTGTTACGACTTTTACTTCCTC-3’) were used for identification of species and varieties / stocks within species. amplifications of complete 18S rDNA sequences. The PCR 42
European Journal of Biotechnology and Bioscience amplifications were performed in 50-µl reaction volume 3. Result containing 10X Taq polymerase buffer, 2 mM MgCl2, 0.2 mM Nucleotide composition dNTP mix, 10 pmol of each primer, 1U Taq DNA Polymerase The size of the sequences ranged between 1807-1817 bp (i.e. and 50 ng genomic DNA. The PCR cycling conditions were: 1810 bp in P. chola, 1809 bp in P. conchonius, 1817 bp in P. initiation denaturation at 94C for 4 min, followed by 32 sophore and 1807 bp in P. ticto). The nucleotide composition cycles of denaturation at 94C for 30 sec, primer annealing at was presented in Table 1. The GC content was higher than the 55C for 30 sec, primer extension at 72C for 60 sec, followed AT. by final extension at 72C for 10 min. The amplified products were resolved in 1.0% agarose gel stained with ethidium Table 1: Nucleotide composition of 18S rDNA sequences of Puntius species. bromide and custom sequenced. Number (values in bracket are Total G+C Name of Sequence alignment and molecular phylogenetic analysis in per cent) (base content species The raw DNA sequences were edited using BioEdit [14] and the A C G T pairs) (%) pairwise as well as multiple alignment of sequences was 404 486 545 375 P. chola 1810 56.96 performed using ClustalW [15] alignment editor. Multiple (22.32) (26.85) (30.11) (20.72) sequence alignment was also checked manually and the P. 413 467 540 389 1809 55.67 consensus sequences were obtained. Molecular phylogenetic conchonius (22.83) (25.82) (29..85) (21.50) [16] analyses were performed in MEGA (ver. 6) software . 407 486 544 380 P. sophore 1817 56.69 Sequence data was subsequently analysed for Neighbour- (22.40) (26.75) (29.94) (20.91) Joining, Maximum Parsimony and Maximum Likelihood 418 465 530 394 methods with bootstraps of 1000 replicates [17]. Nucleotide P. ticto 1807 55.06 (23.13) (25.73) (29.33) (21.80) composition analysis was carried out using BioEdit. Transition and transversions were equally weighted. The final consensus Molecular phylogenetic analysis sequences were submitted to NCBI database with accession The estimates of evolutionary divergence between nucleotide number - JN704069 (P. conchonius), JN704070 (P. ticto), sequences of 18S were conducted among 16 consensus JN704071 (P. sophore) and JN704072 (P. chola). The sequences (Table 2). The values indicated that P. chola have phylogenetic study also included 18S rDNA sequences of 11 lowest genetic distance (0.004) with P. sophore, and P. other fish species (P. chelynoides, GU568349; T. putitora conchonius (0.020) with P. ticto. Among the undertaken GU568351; Misgurnus anguillicaudatus, FJ710863; fishes, M. polynyma has lowest distance (0.193) with M. Nematalosa erebi, HQ615574; Porochilus rendahli, anguillicaudatus, and L. japonica (0.205) with P. Chelynoides HQ615581; Pangasianodon hypophthalmus, AJ876376; and N. erebi. Among the studied Puntius species, P. chola Leiocassis longirostris, GQ465842; Ictalurus punctatus, showed lowest genetic distance of 0.214 and 0.213 with M. GQ465835; Heteropneustes fossilis, AJ876377; Channallabes polynyma and L. japonica, respectively. This indicated that P. longicaudatus, AJ876391; and Ompok pabo, GU385711) and chola may be the most primitive among the four undertaken two Mollusc (Mactromeris polynyma, L11230 and Liolophura Puntius species. japonica, X70210) taken from GenBank.
Table 2: Estimates of pairwise K2P distance between the species using 18S rDNA sequences.
P. ticto P. ticto P. chola chola P. N. erebi N. erebi O. pabo H. fossilis P. sophore P. sophore T. putitora P. rendahli I. punctatus I. punctatus M. polynyma M. polynyma P. conchonius P. chelynoides P. chelynoides L. longirostris C. longicaudatus longicaudatus C. P. hypophthalmus P. hypophthalmus M. anguillicaudatus M. anguillicaudatus P. conchonius 0.068 ------P. sophore 0.004 0.070 ------P. ticto 0.063 0.020 0.065 ------P. chelynoides 0.023 0.067 0.025 0.069 ------T. putitora 0.023 0.069 0.026 0.070 0.005------M. anguillicaudatus 0.040 0.082 0.043 0.082 0.0300.031 ------N. erebi 0.044 0.084 0.046 0.081 0.0290.031 0.035 ------P. rendahli 0.047 0.088 0.050 0.087 0.0390.041 0.040 0.034 ------P. hypophthalmus 0.047 0.089 0.050 0.088 0.0420.043 0.040 0.036 0.002 ------L. longirostris 0.048 0.088 0.050 0.087 0.0410.041 0.041 0.035 0.002 0.002 ------O. pabo 0.048 0.088 0.050 0.087 0.039 0.041 0.042 0.036 0.004 0.007 0.005 - - - - - I. punctatus 0.053 0.094 0.055 0.093 0.044 0.045 0.044 0.038 0.011 0.011 0.011 0.015 - - - - H. fossilis 0.053 0.093 0.055 0.094 0.043 0.047 0.045 0.038 0.005 0.007 0.007 0.010 0.015 - - - C. longicaudatus 0.049 0.088 0.051 0.089 0.041 0.043 0.042 0.036 0.003 0.003 0.003 0.007 0.011 0.005 - - M. polynyma 0.214 0.235 0.216 0.239 0.206 0.209 0.193 0.202 0.202 0.202 0.202 0.208 0.204 0.207 0.201 - L. japonica 0.213 0.251 0.216 0.251 0.205 0.210 0.207 0.205 0.208 0.208 0.208 0.213 0.213 0.211 0.207 0.121
43
European Journal of Biotechnology and Bioscience
The analysis involved 17 nucleotide sequences. All positions method and are in the units of the number of base substitutions containing gaps and missing data were eliminated. There were per site. The rate variation among sites was modelled with a a total of 1699 positions in the final dataset. The 18S rDNA gamma distribution. in Maximum Parsimony approach Tree sequence of Mactromeris polynyma (accession no. L11230)-a #1 out of 3 most parsimonious trees (length = 657) is shown in bivalve Mollusc and Liolophura japonica (accession no. fig.2. The consistency index is (0.786517), the retention index X70210)-a polyplacophora Mollusc were taken from GenBank is (0.850863), and the composite index is 0.727831 (0.669218) as outgroup. The phylogenetic tree by Neighbor-joining, for all sites and parsimony-informative sites (in parentheses). Maximum Parsimony and Maximum likelihood methods The percentage of replicate trees in which the associated taxa revealed two clad strongly supported with the bootstrap values clustered together in the bootstrap test (1000 replicates) are (Fig. 1, 2 & 3). P. chola and P. sophore clustered together as shown next to the branches. The MP tree was obtained using sister group as well as P. conchonius and P. ticto are also the Subtree-Pruning-Regrafting (SPR) algorithm with search clustered as sister group in the same clad with P. chelynoides level 1 in which the initial trees were obtained by the random and T. putitora. The other fishes clustered in separate clad. addition of sequences (10 replicates). The tree is drawn to The variation was observed in Maximum Parsimony and scale, with branch lengths calculated using the average Maximum likelihood method as M. anguillicaudatus and N. pathway method and are in the units of the number of changes erebi clustered in one clad with Puntius fishes while in over the whole sequence. In case of Maximum Likelihood the Neighbor-joining method M. anguillicaudatus clustered with tree with the highest log likelihood (-5711.0915) is shown. Puntius fishes and N. erebi clustered in separate clad with The percentage of trees in which the associated taxa clustered other fishes. The phylogenetic trees indicated the close together is shown next to the branches. Initial tree(s) for the relationship between P. chola and P. sophore, and between P. heuristic search were obtained automatically by applying conchonius and P. ticto. The optimal tree for Neighbor- Neighbor-Join and BioNJ algorithms to a matrix of pairwise Joining have the sum of branch length = 0.42572478 and is distances estimated using the Maximum Composite shown in fig1. The percentage of replicate trees in which the Likelihood (MCL) approach, and then selecting the topology associated taxa clustered together in the bootstrap test (1000 with superior log likelihood value. A discrete Gamma replicates) are shown next to the branches. The tree is drawn distribution was used to model evolutionary rate differences to scale, with branch lengths in the same units as those of the among sites (5 categories (+G, parameter = 0.3457)). The tree evolutionary distances used to infer the phylogenetic tree. The is drawn to scale, with branch lengths measured in the number evolutionary distances were computed using the Tamura-Nei of substitutions per site.
31 Pangasianodon hypophthalmus
18 Leiocassis longirostris Heteropneustes fossilis 88 82 Channallabes longicaudatus
100 Porochilus rendahli 58 Ompok pabo 51 Ictalurus punctatus Nematalosa erebi Misgurnus anguillicaudatus
100 P.chelynoides 51 T.putitora
100 P.chola 97 P.sophore 79 P.conchonius 100 P.ticto Mactromeris polynyma 100 Liolophura japonica
0.02
Fig. 1: Neighbor-Joining phylogenetic tree based on the 18S rDNA nucleotide sequences.
44
European Journal of Biotechnology and Bioscience
100 P.chola
75 P.sophore P.conchonius 79 100 P.ticto
53 P.chelynoides 96 T.putitora 51 Misgurnus anguillicaudatus Nematalosa erebi Ictalurus punctatus Leiocassis longirostris
10072 Heteropneustes fossilis Channallabes longicaudatus 68 Pangasianodon hypophthalmus Porochilus rendahli 56 Ompok pabo Mactromeris polynyma 100 Liolophura japonica
50
Fig. 2: Maximum Parsimony phylogenetic tree based on the 18S rDNA nucleotide sequences.
99 P.chola
92 P.sophore P.conchonius 87 100 P.ticto
60 P.chelynoides 97 T.putitora 36 Misgurnus anguillicaudatus Nematalosa erebi Ompok pabo Porochilus rendahli 99 Ictalurus punctatus 25 Pangasianodon hypophthalmus
25 Leiocassis longirostris Heteropneustes fossilis 72 Channallabes longicaudatus Mactromeris polynyma 100 Liolophura japonica
0.02
Fig. 3: Maximum Likelihood phylogenetic tree based on the 18S rDNA nucleotide sequences using Tamura-Nei model.
4. Discussion distant phylogenetic relationships, providing a means of Nucleic acid sequences from small-subunit ribosomal RNAs assessing relationships between organisms which lack any (18s rRNAs) have proved useful for phylogenetic analysis in informative homologous morphological or developmental eukaryotes. Because of their ubiquity and evolutionary traits [18, 19]. conservation, these molecules are useful for deciphering 45
European Journal of Biotechnology and Bioscience
18S rDNA is a good source of phylogenetic information based conchonius with P. ticto was also recorded on the basis of on conservation of function, variable mutation rates depending mitochondrial cytochrome b gene [35]. A phylogenetic study on substructure position, and its ubiquity in all taxa. The based on restriction fragment polymorphism analysis among molecule provides readily obtainable nucleotide sequences different species of genus Puntius also indicated closeness of because of high rRNA transcript copy number in eukaryotes P. chola with P. sophore and P. conchonius with P. ticto [36]. and ease of PCR primer design [20]. The 18S rRNA molecule contains certain conserved regions having low substitution 5. Conclusion rates and can provide informative characters for assessing This is the first study to use molecular markers to elucidate the affiliations of evolutionarily distant taxa. 18S rRNAs also phylogenetic relationship of Puntius species using 18S rDNA contain variable regions having high substitution rates. In in India. Further studies with comprehensive sampling across some organisms these rapidly evolving regions provide geographical range of species distribution vis-a-vis more phylogenetic signals for discerning relationships between number of species are required to reaffirm their phylogenetic evolutionarily closer clades [21]. and evolutionary relationship. In 18S rDNA, all four nucleotide bases are nearly in equal proportion except guanine (G), which is a little higher 6. Acknowledgement percentage (table 1). The percentage of G+C content is found This study is a part of minor research project and the first higher than A+T content in all four species. The pairwise and author is highly thankful to UGC, New Delhi to provide multiple alignment of 18S rDNA sequences of these four financial help and to the Head, Department of Zoology, Jiwaji Puntius species contained 1906 positions, of which 1430 were University, Gwalior as well as to the Director of National constant, 467 variable, 205 singleton, and 256 parsimony Bureau of Fish Genetic Resources, Lucknow to provide all informative. This low level of variability in the 18S rDNA necessary facilities and help. gene was observed at the interspecific level. The pairwise alignment similarity shows greater identity 7. References between P. chola and P. sophore, and between P. conchonius 1. Nelson JS. Fishes of the world. 4th ed., Hoboken: John and P. ticto. The evolutionary distances between the species Wiley and Sons, Inc, 2006. were given in table 2. P. chola reveals lowest genetic distance 2. Froese R, Pauly D. Editors. Fish Base, World Wide Web with P. sophore and same is true between P. conchonius and electronic publication, 2011. P. ticto. Mactromeris polynyma shows lowest genetic distance 3. Agarwal SS, Saksena DN. A checklist of fishes from with P. chelynoides (0.206) and P. chola (0.214) among Gwalior, Madhya Pradesh. J Jiwaji Univ. 1977; 2:164- Puntius species while P. sophore (0.216) is next closer than P. 169. conchonius (0.235) and P. ticto (0.289). Among Puntius 4. Saksena DN, Verma MN. Ecodistribution des barbeaux species, Liolophura japonica had lowest genetic distance with des genres Tor et Puntius (Cyprinidae) au Madhya P. chelynoides (0.205) and P. chola (0.213) than P. sophore Pradesh. Inde Cahiers d’ Ethologie 1993; 13:235-238. (0.216) and same genetic distance with P. conchonius (0.251) 5. Saksena DN. Fish Diversity of northern Madhya Pradesh and P. ticto (0.251). Thus it indicated that P. chola may be (Gwalior and Chambal divisions). In: Fresh water fish most primitive among four selected Puntius species. diversity of central India (Lakra, W.S. and Sarkar, U.K. The three different phylogenetic approaches resulted in mostly Eds.), National Bureau of Fish Genetic Resources, similar tree topologies and the clades are well supported. P. Lucknow, 2007, 50-57. chola and P. sophore clustered together as sister group and 6. Garg RK, Rao RJ, Saksena DN. Checklist of fishes of same is true with P. conchonius and P. ticto which shows their Ramsagar reservoir, Datia district, Madhya Pradesh, close relationship. India. Zoos' Print J. 2007; 22(8):2801-2803. With the tremendous diversity in Cypriniformes, 7. Lakra WS, Sarkar UK, Kumar RS, Pandey A, Dubey VK, understanding of their phylogenetic relationship has not Gusain OP. Fish diversity, habitat ecology and their proceeded at an acceptable rate, despite a plethora of conservation and management issues of a tropical River in morphological and more recent molecular studies [22]. The Ganga basin, India. Environmentalist, 2010. DOI phylogenetic relationship based on nuclear rDNA genes was 10.1007/s10669-010-9277-6. studied in many organisms. 18S rDNA gene is used to infer 8. Uchchariya DK, Saxena M, Saksena DN. Fish phylogeny in many organism including Acanthocephala [23], biodiversity of Tighra reservoir of Gwalior, Madhya gallwasps, insect phylogenies [24], Anostracans, Crustacea [25], Pradesh, India. J Fish & Aqua. 2012; 3(1):37-43. Platyhelminthyes [26, 27], pearl oyster [28], Prochordates [29] and 9. Long EO, David IB. Repeated genes in Eukaryotes. fishes [30]. Annual Reviews in Biochemistry 1980; 49:727-764. The Cyprinidae family is monophyletic [31, 33] and this is also 10. Talwar PK, Jhingran AG. Inland Fishes of India and in agreement with present study of undertaken Puntius species Adjacent Countries, Oxford & IBH Publishing Co. Pvt. which showed monophyletic condition. The parsimony, Ltd. New Delhi-Calcutta 1991; 1:263-264. neighbor-joining and maximum-likelihood method for 18S 11. Srivastava G. Fishes of U.P. and Bihar. Vishwavidyalaya rDNA resulted in mostly identical tree topologies for Prakashan, Varanasi, 1980. undertaken Puntius species. 12. Jayaram KC. The Freshwater Fishes of the Indian Region. The phylogenetic reconstruction in the present study is also in Narendra Publishing House, Delhi, 1999. agreement with morphometric and cytogenetic studies, 13. Sambrook J, Russell I. Molecular cloning: a laboratory clustering together and showing close relationship between P. manual, 3rd edition. Cold Spring Harbor Laboratory Press, chola and P. sophore as well as between P. conchonius and P. Plainsview, New York, USA, 2001. ticto [34]. Similar closeness of P. chola with P. sophore and P. 14. Hall TA. BioEdit: a user-friendly biological sequence 46
European Journal of Biotechnology and Bioscience
alignment editor and analysis program for Windows cistron of the teleost fish Cyprinus carpio. Biol Res 95/98/NT. Nucl Acids Symp Ser 1999; 4:95-98. 2003; 36(2):402-419. 15. Larkin MA, Blackshields G, Brown NP, Chenna R, 31. Cavender TM, Coburn MM. Phylogenetic relationships of McGettigan PA, McWilliam H, et al. version 2.0. North American Cyprinidae. In: Mayden RL ed. Bioinformatics 2007; 23:2947-2948. Systematics, historical ecology, and North American 16. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. freshwater fishes. Palo Alto: Stanford University Press MEGA6: Molecular Evolutionary Genetics Analysis 1992, 293-327. version 6.0. Molecular Biology and Evolution 2013; 32. Saitoh K, Sado T, Mayden RL, Hanzawa N, Nakamura K, 30:2725-2729. Nishida M, et al. Mitogenomic evolution and 17. Felsenstein J. Confidence limits on phylogenies: An interrelationships of the Cypriniformes (Actinopterygii: approach using the bootstrap. Evolution 1985; 39:783- Ostariophysi): The first evidence toward resolution of 791. higher-level relationships of the world’s largest 18. Sogin SJ, Sogin ML, Woese CR. Phylogenetic freshwater fish clade based on 59 whole mitogenome measurement in prokaryotes by primary structural sequences. Journal of Molecular Evolution 2006; 63:826- characterization. J Mol Evol. 1977; 1:173-184. 841. 19. Field KG, Olsen GJ, Lane DJ, Giovannoni SJ, Ghiselen 33. He S, Mayden RL, Wang X, Wang W, Tang KL, Chen MT, et al. Molecular phylogeny of the animal kingdom. WJ, et al. Molecular phylogenetics of the family Science 1988; 239:748-753. Cyprinidae (Actinopterygii: Cypriniformes) as evidenced 20. Kjer KM. Use of rRNA secondary structure in by sequence variation in the first intron of S7 ribosomal phylogenetic studies to identify homologous positions: An protein-coding gene: Further evidence from a nuclear example of alignment and data presentation from the gene of the systematic chaos in the family. Molecular frogs. Mol Phylogenet Evol 1995; 4:314-330. Phylogenetics and Evolution 2008b; 46:818-829. 21. Ouvrard D, Campbell BC, Bourgoin T, Chan KL. 18S 34. Saroniya RK, Nagpure NS, Saksena DN, Kushwaha B, rRNA Secondary Structure and Phylogenetic Position of Kumar R. Cytotaxonomic Studies in Four Species of Peloridiidae (Insecta, Hemiptera). Molecular Genus Puntius (Hamilton, 1822) from Central India. Natl Phylogenetics and Evolution 2000; 16(3):403-417. Acad Sci Lett, 2013. DOI 10.1007/s40009-013-0148-9. 22. Mayden RL, Tang KL, Wood RM, Chen WJ, Agnew MK, 35. Pallavi, Goswami M, Nautiyal P, Malakar AK, Nagpure Conway KW, et al. Inferring the Tree of Life of the order NS. Genetic divergence and molecular phylogenetics of Cypriniformes, the earth’s most diverse clade of Puntius spp. based on the mitochondrial cytochrome b freshwater fishes: Implications of varied taxon and gene. Mitochondrial DNA. 2012; 23(6):477-483. character sampling. Journal of Systematics and Evolution. 36. Balaraj S, Basheer M. Genetic diversity among Puntius 2008; 46(3):424-438. sophore complex using restriction fragment length 23. Near TJ, Garey JR, Nadler SA. Phylogenetic relationships polymorphism. J Med Allied Sci. 2012; 2(2):49-53. of the Acanthocephala inferred from 18S ribosomal DNA sequences. Molecular Phylogenetics and Evolution 1998; 10(3):287-298. 24. Rokas A, Nylander JAA, Fredrik RF, Stone GN. A Maximum-Likelihood Analysis of Eight Phylogenetic Markers in Gallwasps (Hymenoptera: Cynipidae): Implications for Insect Phylogenetic Studies. Molecular Phylogenetics and Evolution 2002; 22(2):206-219. 25. Weekers PHH, Murugan G, Vanfleteren JR, Belk D, Dumonta HJ. Phylogenetic analysis of anostracans (Branchiopoda: Anostraca) inferred from nuclear 18S ribosomal DNA (18S rDNA) sequences. Molecular Phylogenetics and Evolution 2002; 25:535-544. 26. Campos A, Cummings MP, Reyes JL, Laclette JP. Phylogenetic relationships of Platyhelminthes based on 18S ribosomal gene sequences. Molecular Phylogenetics and Evolution 1998; 10(1):1-10. 27. Yoshida W, Kuznedelov KD, Kato C, Ishida S. Genetic diversity of Japanese Dugesiidae (Platyhelminthes, Tricladida, Paludicola) studied by comparisons of partial 18S rDNA. Belg J Zool. 2001; 131(Suppl. 1):55-57. 28. He M, Huang L, Shi J, Jiang Y. Variability of ribosomal DNA ITS2 and its utility in detecting genetic relatedness of Pearl oyster. Mar Biotechnol 2005; 7(1):40-45. 29. Zeng L, Swalla BL. Molecular phylogeny of the protochordates: chordate evolution. Can J Zool. 2005; 83:24-33. 30. Vera MI, Molina A, Pinto R, Reyes M, Alvarez M, Krauskopf E, et al. Genomic organization of the rDNA 47