DOCSLIB.ORG

Phylogenetic Analysis of Some Puntius Species Based on 18S Rdna

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Analysis of Some Puntius Species Based on 18S Rdna European Journal of Biotechnology and Bioscience European Journal of Biotechnology and Bioscience Online ISSN: 2321-9122, Impact Factor: RJIF 5.44 www.biosciencejournals.com Volume 4; Issue 7; July 2016; Page No. 42-47 Phylogenetic analysis of some Puntius species based on 18S rDNA 1 Saroniya RK, 2 Nagpure NS, 3 Saksena DN, 4 Basdeo Kushwaha, 5 Ravindra Kumar, 6 Mahender Singh, 7 Vishwamitra Singh Baisvar, 8 Akhilesh Kumar Mishra 1 Department of Zoology, Government Degree College, Mant, Mathura, Uttar Pradesh, India 2 Central Institute of Fisheries Education, Panch Marg, Off Yari Road, Mumbai, Maharashtra, India 3 School of Studies in Zoology, Jiwaji University, Gwalior, Madhya Pradesh, India 4-8 National Bureau of Fish Genetic Resources, Canal Ring Road, P.O.- Dilkusha, Lucknow Uttar Pradesh, India Abstract The molecular characterization and phylogenetic analysis have been carried out in four Puntius species using 18S rDNA sequences. The size of the consensus sequences of 18S rDNA ranged between 1807-1817 bp (i.e. 1810 bp in P. chola, 1809 bp in P. conchonius, 1817 bp in P. sophore and 1807 bp in P. ticto). The GC and AT content (%) was 56.96 and 43.04 in P. chola, 55.67 and 44.33 in P. conchonius, 56.69 and 43.31 in P. sophore and 55.06 and 44.94 in P. ticto. The dataset after multiple sequence alignment of these Puntius species contained 1906 nucleotide positions, out of which 1430 were conserved, 467 variable, 205 singleton, and 256 parsimony informative. The inter-specific genetic variation was low. P. chola revealed lowest genetic distance with P. sophore and same was true between P. conchonius and P. ticto. The evolutionary history was inferred by three methods, namely Maximum Parsimony, Neighbour-Joining and the Maximum Likelihood. The three different phylogenetic approaches resulted mostly in similar tree topologies and the clades were well supported with bootstrap values. P. chola and P. sophore clustered together as sister group and same was true with P. conchonius and P. ticto, which showed their close relationship. The phylogenetic reconstruction of present study was also in agreement with earlier studies based on morphometric, cytogenetic studies, mitochondrial cytochrome b gene and restriction fragment polymorphism analysis. Keywords: Phylogenetic, rDNA, nucleotide, tree, sequences 1. Introduction In view of this, the present study was aimed to characterise Cypriniformes, an order of ray-finned fish that includes and find out phylogenetic relationship among these Puntius carps, minnows, loaches and relatives, is recognized as the species on the basis of 18S rDNA sequences to facilitate most varied group of freshwater fishes with estimated policy makers to make their conservation plans for sustainable diversity of over 3,500 species [1] contained in 280 genera and utilization. five families. The cyprinid genus Puntius comprises over 140 species [2] of small to medium sized barbs found in stagnant 2. Material and methods pools to fast flowing freshwater streams of tropical Asia. The Collection of specimens fishes of this mainly comprised of food as well as valuable Live specimens of P. conchonius, P. chola and P. ticto were ornamental fishes due to their attractive appearance. Presently, collected from Pahuj River at the site of village Pohra on the over 60 species of Puntius from India, largely from the border of Jhansi (Uttar Pradesh) and Datia (Madhya Pradesh). Eastern Himalayas and Eastern as well as Western Ghats, are Specimens of P. sophore were collected from Ramsagar known [2]. Four species of this genus, viz. P. conchonius, P. reservoir at Barauni, near Datia. Collected specimens were chola, P. sophore and P. ticto, are commonly found in the identified using the keys developed by Talwar and Jhingran freshwater bodies of the central part of India [3, 8]. [10], Srivastava [11] and Jayaram [12]. The nuclear ribosomal DNA (rDNA) are organized as multiple copies of a repeated unit that consists of a transcribed zone Genomic DNA isolation and amplification with coding regions for the 18S, 5.8S and 28S RNA genes, The total genomic DNA was isolated from the muscle tissue internal and external transcribed spacers (ITS & ETS) and samples following standard phenol: chloroform: isoamyl surrounded by non-transcribed spacers (NTS) sequences [9]. alcohol method of Sambrook and Russel [13] with minor The presence of large variable regions in rDNA offers modifications. Four specific primers (18SAF: 5’- sufficient scope for differentiating the species, so the authentic CTCAAAGATTAAGCCATGCAG GTC-3’ and 18SAR: 5’- phylogenetic relationship can also be deduced. ATGGGTAATTTGCGCGCCTGCTG-3’; 18SBF: 5’- However, the fish germplasm has been depleting very fast due CGGCTAC CACATTCAAGGAAGG-3’ and 18SBR: 5’- to various anthropogenic stresses like pollution, habitat ATCCTTTCGCTTCGTCCGTCTTG-3’; 18SCF: 5’- destruction, overexploitation etc. Thus, it is imperative to CGGCGCAAGACGGACGAAAGC-3’ and 18SCR: 5’- undertake remedial measures to conserve the germplasm. GACCTGTTATTCCTC CATCTCGCG-3’; and 18SDF: 5’- Genetic characterization of fish species is an important step CGTGCG GTCGGCGTTCAACTTC-3’ and 18SD R: 5’- taken towards conservation of fish species that enable precise CCTTGTTACGACTTTTACTTCCTC-3’) were used for identification of species and varieties / stocks within species. amplifications of complete 18S rDNA sequences. The PCR 42 European Journal of Biotechnology and Bioscience amplifications were performed in 50-µl reaction volume 3. Result containing 10X Taq polymerase buffer, 2 mM MgCl2, 0.2 mM Nucleotide composition dNTP mix, 10 pmol of each primer, 1U Taq DNA Polymerase The size of the sequences ranged between 1807-1817 bp (i.e. and 50 ng genomic DNA. The PCR cycling conditions were: 1810 bp in P. chola, 1809 bp in P. conchonius, 1817 bp in P. initiation denaturation at 94C for 4 min, followed by 32 sophore and 1807 bp in P. ticto). The nucleotide composition cycles of denaturation at 94C for 30 sec, primer annealing at was presented in Table 1. The GC content was higher than the 55C for 30 sec, primer extension at 72C for 60 sec, followed AT. by final extension at 72C for 10 min. The amplified products were resolved in 1.0% agarose gel stained with ethidium Table 1: Nucleotide composition of 18S rDNA sequences of Puntius species. bromide and custom sequenced. Number (values in bracket are Total G+C Name of Sequence alignment and molecular phylogenetic analysis in per cent) (base content species The raw DNA sequences were edited using BioEdit [14] and the A C G T pairs) (%) pairwise as well as multiple alignment of sequences was 404 486 545 375 P. chola 1810 56.96 performed using ClustalW [15] alignment editor. Multiple (22.32) (26.85) (30.11) (20.72) sequence alignment was also checked manually and the P. 413 467 540 389 1809 55.67 consensus sequences were obtained. Molecular phylogenetic conchonius (22.83) (25.82) (29..85) (21.50) [16] analyses were performed in MEGA (ver. 6) software . 407 486 544 380 P. sophore 1817 56.69 Sequence data was subsequently analysed for Neighbour- (22.40) (26.75) (29.94) (20.91) Joining, Maximum Parsimony and Maximum Likelihood 418 465 530 394 methods with bootstraps of 1000 replicates [17]. Nucleotide P. ticto 1807 55.06 (23.13) (25.73) (29.33) (21.80) composition analysis was carried out using BioEdit. Transition and transversions were equally weighted. The final consensus Molecular phylogenetic analysis sequences were submitted to NCBI database with accession The estimates of evolutionary divergence between nucleotide number - JN704069 (P. conchonius), JN704070 (P. ticto), sequences of 18S were conducted among 16 consensus JN704071 (P. sophore) and JN704072 (P. chola). The sequences (Table 2). The values indicated that P. chola have phylogenetic study also included 18S rDNA sequences of 11 lowest genetic distance (0.004) with P. sophore, and P. other fish species (P. chelynoides, GU568349; T. putitora conchonius (0.020) with P. ticto. Among the undertaken GU568351; Misgurnus anguillicaudatus, FJ710863; fishes, M. polynyma has lowest distance (0.193) with M. Nematalosa erebi, HQ615574; Porochilus rendahli, anguillicaudatus, and L. japonica (0.205) with P. Chelynoides HQ615581; Pangasianodon hypophthalmus, AJ876376; and N. erebi. Among the studied Puntius species, P. chola Leiocassis longirostris, GQ465842; Ictalurus punctatus, showed lowest genetic distance of 0.214 and 0.213 with M. GQ465835; Heteropneustes fossilis, AJ876377; Channallabes polynyma and L. japonica, respectively. This indicated that P. longicaudatus, AJ876391; and Ompok pabo, GU385711) and chola may be the most primitive among the four undertaken two Mollusc (Mactromeris polynyma, L11230 and Liolophura Puntius species. japonica, X70210) taken from GenBank. Table 2: Estimates of pairwise K2P distance between the species using 18S rDNA sequences. P. ticto P. ticto P. chola chola P. N. erebi N. erebi O. pabo H. fossilis P. sophore P. sophore T. putitora P. rendahli I. punctatus I. punctatus M. polynyma M. polynyma P. conchonius P. chelynoides P. chelynoides L. longirostris C. longicaudatus longicaudatus C. P. hypophthalmus P. hypophthalmus M. anguillicaudatus M. anguillicaudatus P. conchonius 0.068 - - - - - - - - - - - - - - - P. sophore 0.004 0.070 - - - - - - - - - - - - - - P. ticto 0.063 0.020 0.065 - - - - - - - - - - - - - P. chelynoides 0.023 0.067 0.025 0.069 - - - - - - - - - - - - T. putitora 0.023 0.069 0.026 0.070 0.005- - - - - - - - - - - M. anguillicaudatus 0.040 0.082 0.043 0.082 0.0300.031 - - - - - - - - - - N. erebi 0.044 0.084 0.046 0.081 0.0290.031 0.035 - - - - - - - - - P. rendahli 0.047 0.088 0.050 0.087 0.0390.041 0.040 0.034 - - - - - - - - P. hypophthalmus 0.047 0.089 0.050 0.088 0.0420.043 0.040 0.036 0.002 - - - - - - - L. longirostris 0.048 0.088 0.050 0.087 0.0410.041 0.041 0.035 0.002 0.002 - - - - - - O. pabo 0.048 0.088 0.050 0.087 0.039 0.041 0.042 0.036 0.004 0.007 0.005 - - - - - I. punctatus 0.053 0.094 0.055 0.093 0.044 0.045 0.044 0.038 0.011 0.011 0.011 0.015 - - - - H.
Load more

Recommended publications
  • IR 425 Sampling and Design Options for Monitoring Freshwater Fish
    internal report 425 Sampling and design options for monitoring freshwater fish: Potential strategies for the Darwin Harbour catchment B Pidgeon June 2003 supervising scientist Sampling and design options for monitoring freshwater fish: potential strategies for the Darwin Harbour catchment Bob Pidgeon Environmental Research Institute of the Supervising Scientist Darwin Supervising Scientist This talk was presented to the Department of Infrastructure, Planning and Environment, Water Monitoring Branch, in May 2003. It deals with the options for monitoring of freshwater fish in the Darwin Harbour catchment as part of a comprehensive environmental management program for Darwin Harbour being planned by DIPE. It accompanies a report prepared as part of a consultancy by the Environmental Research Institute of the Supervising Scientist to the Department of Infrastructure, Planning and Environment, June 2003. 1 Background • Plans by DIPE to begin monitoring freshwater fish as part of a comprehensive environmental management strategies for Darwin Harbour catchment • Why monitor fish? – Important role in determining structure of aquatic ecosystems – Sensitive to pollution, habitat change and altered hydrology – useful indicators of ecosystem health – High profile of conservation of biodiversity and food and recreation values – Concerns about contamination and human health Supervising Scientist Freshwater fish monitoring in the NT • Not widespread • Most extensive studies are in relation to uranium mining: – in Magela Creek & South Alligator River -Ranger mine; – Finnis River - Rum Jungle mine • Taxonomy is now well known and basic biology and ecology known for many species – good basis for use in monitoring and assessment* • Fisheries research focused on barramundi *The research on fish ecology and reproductive biology by the Office of the Supervising Scientist in 1978-79 (Bishop et al 1986, 1990 & 2002) provides a good basis for the evaluation of impacts on freshwater fish that might be detected in monitoring programs.
    [Show full text]
  • Resistance and Resilience of Murray-Darling Basin Fishes to Drought Disturbance
    Resistance and Resilience of Murray- Darling Basin Fishes to Drought Disturbance Dale McNeil1, Susan Gehrig1 and Clayton Sharpe2 SARDI Publication No. F2009/000406-1 SARDI Research Report Series No. 602 SARDI Aquatic Sciences PO Box 120 Henley Beach SA 5022 April 2013 Final Report to the Murray-Darling Basin Authority - Native Fish Strategy Project MD/1086 “Ecosystem Resilience and the Role of Refugia for Native Fish Communities & Populations” McNeil et. al. 2013 Drought and Native Fish Resilience Resistance and Resilience of Murray- Darling Basin Fishes to Drought Disturbance Final Report to the Murray-Darling Basin Authority - Native Fish Strategy Project MD/1086 “Ecosystem Resilience and the Role of Refugia for Native Fish Communities & Populations” Dale McNeil1, Susan Gehrig1 and Clayton Sharpe2 SARDI Publication No. F2009/000406-1 SARDI Research Report Series No. 602 April 2013 Page | ii McNeil et. al. 2013 Drought and Native Fish Resilience This Publication may be cited as: McNeil, D. G., Gehrig, S. L. and Sharpe, C. P. (2013). Resistance and Resilience of Murray-Darling Basin Fishes to Drought Disturbance. Final Report to the Murray-Darling Basin Authority - Native Fish Strategy Project MD/1086 ―Ecosystem Resilience and the Role of Refugia for Native Fish Communities & Populations‖. South Australian Research and Development Institute (Aquatic Sciences), Adelaide. SARDI Publication No. F2009/000406-1. SARDI Research Report Series No. 602. 143pp. Front Cover Images – Lake Brewster in the Lower Lachlan River catchment, Murray-Darling Basin during extended period of zero inflows, 2007. Murray cod (Maccullochella peelii peelii), olive perchlet (Ambassis agassizii) and golden perch (Macquaria ambigua) from the, lower Lachlan River near Lake Brewster, 2007 (all images - Dale McNeil).
    [Show full text]
  • Systematic Taxonomy and Biogeography of Widespread
    Systematics and Biogeography of Three Widespread Australian Freshwater Fish Species. by Bernadette Mary Bostock B.Sc. (Hons) Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Deakin University February 2014 i ABSTRACT The variation within populations of three widespread and little studied Australian freshwater fish species was investigated using molecular genetic techniques. The three species that form the focus of this study are Leiopotherapon unicolor, Nematalosa erebi and Neosilurus hyrtlii, commonly recognised as the three most widespread Australian freshwater fish species, all are found in most of the major Australian drainage basins with habitats ranging from clear running water to near stagnant pools. This combination of a wide distribution and tolerance of a wide range of ecological conditions means that these species are ideally suited for use in investigating phylogenetic structure within and amongst Australian drainage basins. Furthermore, the combination of increasing aridity of the Australian continent and its diverse freshwater habitats is likely to promote population differentiation within freshwater species through the restriction of dispersal opportunities and localised adaptation. A combination of allozyme and mtDNA sequence data were employed to test the null hypothesis that Leiopotherapon unicolor represents a single widespread species. Conventional approaches to the delineation and identification of species and populations using allozyme data and a lineage-based approach using mitochondrial 16S rRNA sequences were employed. Apart from addressing the specific question of cryptic speciation versus high colonisation potential in widespread inland fishes, the unique status of L. unicolor as both Australia’s most widespread inland fish and most common desert fish also makes this a useful species to test the generality of current biogeographic hypotheses relating to the regionalisation of the Australian freshwater fish fauna.
    [Show full text]
  • Chapter 3 Part 2 (PDF
    Family PLOTOSIDAE 3.11 Porochilus rendahli (Whitley) In the Oenpelli area, the Aboriginal name of this genus of eel-tailed catfishes is Maroonung or Nahgool. It is also generally known as Rendahl’s catfish. Data on P. rendahli will be presented together with that on Neosilurus sp. C. Porochilus rendahli is endemic to Australia. Miller (in Taylor 1964) found this species in billabongs and creeks of the Oenpelli area and in lower riverine floodplain billabongs of the East Alligator River. Previously it had been found in the Northern Territory only in the Howard, Roper and Emerald (Groote Eylandt) Rivers. Porochilus rendahli Detailed information on catches at each site and in each season is given in volume 2. In summary, P. rendahli (and Neosilurus sp. C) was common to moderately abundant in all lowland backflow billabongs and floodplain billabongs; it also occurred in some corridor waterbodies and escarpment perennial streams. The fewest specimens of Neosilurus sp. C were caught in the Mid-wet season; the greatest number of P. rendahli were caught in the Mid-dry. Size composition The lengths and weights of 328 P. rendahli and 147 Neosilurus sp. C were recorded. Seasonal length-frequency distributions and condition factors are based on Neosilurus sp. C through the Mid-wet season and then on P. rendahli. Neosilurus sp. C was probably contaminated by N. hyrtlii. Neosilurus sp. C and P. rendahli captured by the 26 mm mesh gillnet and the seine net were similar in size; Neosilurus sp. C was also captured by 44 and 58 mm mesh gillnets and the resultant peaks are apparent in the distribution.
    [Show full text]
  • Australian Atomic Energy Commission Research Establishment Lucas Heights
    AAEC/E305 to o ro W L> td AUSTRALIAN ATOMIC ENERGY COMMISSION RESEARCH ESTABLISHMENT LUCAS HEIGHTS THE ALLIGATOR RIVERS AREA FACT FINDING STUDY FOUR AAEC REPORTS by N. F. CONWAY D. R. DAVY M. S. GILES P.J.F. NEWTON (ed.) D. A. POLLARD* *NSW Department of Fisheries June 1974 ISBN 0 642 99634 2 AUSTRALIAN ATOMIC ENERGY COMMISSION RESEARCH ESTABLISHMENT LUCAS HEIGHTS THE ALLIGATOR RIVERS AREA FACT FINDING STUDY FOUR AAEC REPORTS by N. F. CONWAY D. R. DAVY M. S. GILES P.J.F. NEWTON (ed.) D. A. POLLARD* *NSW Department of Fisheries ABSTRACT The work described in this series of reports is part of the Joint Government-Industry Fact Finding Study carried out in the 'Uranium Province' of the Alligator Rivers Area, Northern Territory, during 1971-73. The primary objective was to determine the sensitivity of the exist- ing environment to the range of potential pollutants arising from a uranium extractive industry. A comprehensive ichthyography is given of species collected in the area. Results are reported of experimental and bioassay studies on selected flora and fauna exposed to heavy metals, raffinate and Alamine-336. Studies are also recorded on the chemical and radiological qualities of natural waters, the solubility of uranium in sediments, and the fate of dissolved trace elements in the drainage systems. The radiological aspects of the area are discussed with specific reference to exposure routes, biological concentration factors, and the significance of natural and man made changes in levels of radiation to man and other biota in the region. Radon levels in costeans, core-sheds and bore water are recorded and discussed.
    [Show full text]
  • Freshwater Fish and Aquatic Habitat Survey of Cape York Peninsula
    CAPE YORK PENINSULA NATURAL RESOURCES ANALYSIS PROGRAM (NRAP) FRESHWATER FISH AND AQUATIC HABITAT SURVEY OF CAPE YORK PENINSULA B. W. Herbert, J.A. Peeters, P.A. Graham and A.E. Hogan Freshwater Fisheries and Aquaculture Centre Queensland Department of Primary Industries 1995 CYPLUS is a joint initiative of the Queensland and Commonwealth Governments CAPE YORK PENINSULA LAND USE STRATEGY (CYPLUS) Natural Resources Analysis Program FRESHWATER FISH AND AQUATIC HABITAT SURVEY OF CAPE YORK PENINSULA B. W. Herbert, J. A. Peeters, P.A. Graham and A.E. Hogan Freshwater Fisheries and Aquaculture Centre Queensland Department of Primary Industries 1995 CYPLUS is a joint initiative of the Queensland and Commonwealth Governments Final report on project: NRlO - FISH FAUNA SURVEY Recommended citation: Herbert, B.W., Peeters, J.A., Graham, P.A. and Hogan, A.E. (1995). 'Freshwater Fish and Aquatic Habitat Survey of Cape York Peninsula'. (Cape York Peninsula Land Use Strategy, Office of the Co-ordinator General of Queensland, Brisbane, Department of the Environment, Sport and Territories, Canberra, Queensland Department of Primary Industries, Brisbane.) Note: Due to the timing of publication, reports on other CYPLUS projects may not be fully cited in the REFERENCES section. However, they should be able to be located by author, agency or subject. ISBN 0 7242 6204 0 The State of Queensland and Commonwealth of Australia 1995. Copyright protects this publication. Except for purposes permitted by the Copyright Act 1968, no part may be reproduced by any means without the prior written permission of the Office of the Co-ordinator General of Queensland and the Australian Government Publishing Service.
    [Show full text]
  • Through DNA Barcodes
    Received: 20 January 2021 | Revised: 6 April 2021 | Accepted: 13 April 2021 DOI: 10.1111/1755-0998.13411 RESOURCE ARTICLE Exploring the vertebrate fauna of the Bird’s Head Peninsula (Indonesia, West Papua) through DNA barcodes Evy Arida1 | Hidayat Ashari1 | Hadi Dahruddin1 | Yuli Sulistya Fitriana1 | Amir Hamidy1 | Mohammad Irham1 | Kadarusman2 | Awal Riyanto1 | Sigit Wiantoro1 | Moch Syamsul Arifin Zein1 | Renny K. Hadiaty1* | Apandi1 | Frengky Krey3 | Kurnianingsih1 | Edy H.P. Melmambessy4 | Mulyadi1 | Henderite L. Ohee5 | Saidin2 | Ayub Salamuk6 | Sopian Sauri1 | Suparno1 | Nanang Supriatna1 | Amir M. Suruwaky2 | Wahyudi Tri Laksono1 | Evie L. Warikar5 | Hadi Wikanta1 | Aksamina M. Yohanita7 | Jacques Slembrouck8 | Marc Legendre8 | Philippe Gaucher9 | Christophe Cochet8 | Erwan Delrieu- Trottin8 | Christophe Thébaud10 | Borja Mila11 | Antoine Fouquet10 | Alex Borisenko12 | Dirk Steinke12 | Régis Hocdé13 | Gono Semiadi1 | Laurent Pouyaud8 | Nicolas Hubert8 1Division of Zoology, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong, Indonesia 2Politeknik Kelautan dan Perikanan Sorong, Jl. Kapitan Pattimura, Suprau, Indonesia 3Jurusan Perikanan, Fakultas Perikanan dan Ilmu Kelautan, Universitas Papua, Jl. Gunung Salju Amban, Manokwari, Indonesia 4Program Studi Manajemen Sumberdaya Perairan, Fakultas Pertanian, Universitas Musamus, Jl. Kamizaun Mopah Lama, Rimba Jaya, Merauke, Indonesia 5Jurusan Biologi, Fakultas MIPA, Universitas Cendrawasih, Jl. Kamp Wolker Waena Jayapura, Jayapura, Indonesia 6Dinas Kelautan dan
    [Show full text]
  • Annan Endeavour Catchment Strategy
    Annan and Endeavour Strategic Plan MAY 2007 South Cape York Catchments Inc The Annan-Endeavour Catchment Management Group would like to acknowledge the traditional owners of this region the Kuku Yalanji and the Gugu Yimidirr South Cape York Catchments Email: [email protected] Ph 40696890 Po Box 546 Cooktown Qld 4895 Compiled by Jason Carroll Annan-Endeavour Catchment Management Group Coordinator Authors 1.0 Jason Carroll 2.0 Jason Carroll 3.1 Kim Stephan 3.2 Kim Stephan 3.3 Christina Howley 3.4 Kim Stephen 3.5 Dr Wendy Seabrook 3.6 Dr Wendy Seabrook 3.7 Jason Carroll 3.8 Diana Wood and Jason Carroll 3.9 Jason Carroll Front cover: SCYC 2 ANNAN ENDEAVOUR STRATEGIC PLAN CONTENTS CHAIRPERSON’S FORWORD .....................................................................................................8 ACKNOWLEDGMENTS ................................................................................................................9 1.0 INTRODUCTION.....................................................................................................................10 1.0 PURPOSE OF THIS STRATEGY .........................................................................................11 1.1 THE SOUTH CAPE YORK CATCHMENT MANAGEMENT GROUP.............................12 1.2 OUR VISION..........................................................................................................................13 1.3 WHAT WE WANT TO ACHIEVE .......................................................................................14 1.4 THE CATCHMENT
    [Show full text]
  • An Overview of the Impacts of Translocated Native Fish Species in Australia
    An overview of the impacts of translocated native fish species in Australia Final 11 August 2008 An overview of the impacts of translocated native fish species in Australia Final 11 August 2008 Sinclair Knight Merz ABN 37 001 024 095 590 Orrong Road, Armadale 3143 PO Box 2500 Malvern VIC 3144 Australia Tel: +61 3 9248 3100 Fax: +61 3 9248 3400 Web: www.skmconsulting.com © Commonwealth of Australia 2008 This work is copyright. Apart from any use as permitted under the Copyright Act 1968, no part may be reproduced by any process without prior written permission from the Commonwealth. LIMITATION: The views and opinions expressed in this publication are those of the authors and do not necessarily reflect those of the Australian Government or the Minister for the Environment, Heritage and the Arts. While reasonable efforts have been made to ensure that the contents of this publication are factually correct, the Commonwealth and the Authors do not accept responsibility for the accuracy or completeness of the contents, and shall not be liable for any loss or damage that may be occasioned directly or indirectly through the use of, or reliance on, the contents of this publication. The SKM logo is a trade mark of Sinclair Knight Merz Pty Ltd. © Sinclair Knight Merz Pty Ltd, 2006 Contents 1. Introduction 1 1.1 Background 1 1.2 Objectives 3 2. Project approach 5 2.1 Project review panel 5 2.2 Collation of information 5 2.2.1 Distributional data 7 2.3 Project workshop 7 2.4 Quality assurance 8 3.
    [Show full text]
  • THE AUSTRALIAN ZOOLOGIST , Vol
    “ FEB 2 7 194 2 l l z ‘ i n Oo . Ltd 29 Al b rta t and Melbourne Publi sh g , my" e S " Sydney. 1 London a n 4 Ahhur tr t New ord Ltd, 3 , 3 , d S ee , Oxf Street. w.o.z. dne tu fnissl on fl ési as a. ri c al G . P . O S for na odi . y y. , y p pe i . il bert P . W t . B Hull MB E. FR Z.8 G h ley. A F asset , , , " “ Li Roberts Al bert ttlej ohn , and Noel Lee ’ “ Emil Herman zeck . Edwar d John Lees Ha llstroin. Ba sse H l . Honora ry Seoreta ry : A . F . t ul Assista nt Honora ry Sec retary : Miss Betty French . : Honorary Trea surer : Philli p Shi pway. ' ’ n Tom re F sR.Z.S. n rs A s H l a d , Ho orary Edi to : . F . Bas et u l I dale K h A . Hindwood Honora ry Li bra ria n . eit , r o Sti fre FD A . ( us . ) Honora ry Audi tor : Robe t J hn , A t OFFICERS or: Ssqrm s ( 1 94 1 - 4 2 ) ‘ a ri ne zoozd zc a zSec tion. Avicultural Sec ti on . M g ai : Mi s M isi o i ng . Chairman : A . H . Brai n . Ch rman s a e G ld Har . Lee . Hon . Secreta ry : ry B Miss Joan Da vi es . ‘ t rni thol i c a l S ec ti on . Budger ga r Sec tion .
    [Show full text]
  • Fish of the Lake Eyre Catchment of Central Australia
    fish of the lake eyre catchment of central australia lake eyre 1 Rob Wager & Peter J. Unmack Department of Primary Industries Queensland Fisheries Service 2 lake eyre LAKE EYRE ZONAL ADVISORY COMMITTEE In recognition of the decentralised nature of fishing activities in Queensland, ten regionally based Zonal Advisory Committees (ZAC) were set up to advise the Queensland Fisheries Management Authority (QFMA) on local issues relating to fisheries management and fish habitats. The Lake Eyre ZAC was established by the QFMA to provide: a forum for discussion on regional fisheries and fisheries habitat issues; a vital two-way information flow between fisheries mangers and the community. ZAC membership is diverse, representing fisher groups and associations, conservation groups, tourism, fish stocking groups, local government, other government agencies, and other bodies with an interest in fisheries management and fish habitat issues. © Department of Primary Industries, Queensland, and Queensland Fisheries Management Authority 2000 Disclaimer This document has been prepared by the authors on behalf of the Queensland Fisheries Lake Eyre Zonal Advisory Committee. Opinions expressed are those of the authors. Acknowledgments for the photographs provided by G. E. Schmida and Ross Felix. NOTE: The management arrangements described in this document were accurate at the time of publication. Changes in these management arrangements may occur from time to time. Persons with any questions regarding fisheries management should contact the local office of
    [Show full text]
  • Fishes of the Murray-Darling Basin: an Introductory Guide Is the First Book Devoted Exclusively to the Fishes of Australia’S Largest River System
    Murray-Darling rainbowfish Fishes of the Murray-Darling Basin Redfin perch Freshwater catfish An introductory guide Mark Lintermans Southern purple-spotted gudgeon Mark Lintermans Fishes of the Murray-Darling Basin: An introductory guide is the first book devoted exclusively to the fishes of Australia’s largest river system. It contains information on the identification, habitats, biology and distribution of the 57 species of freshwater fish found in the Murray-Darling Basin, as well as background information on the threats to fish and aquatic ecosystems. An extensive reference list is also provided. of the Murray-Darling Basin This book will be an invaluable guide for naturalists, students, fishermen, A N I N T RO D UC TO RY G U id E scientists and anyone else interested in the life within our rivers. Learn about the iconic Murray cod (Australia’s largest freshwater fish), and the smaller species such as galaxias, gudgeons, hardyheads and pygmy perch that inhabit the Basin’s waterways. Mark Lintermans of the Murray-Darling Basin A N I N T R O D U C TO RY G U I D E Published by the Murray-Darling Basin Authority Postal address: GPO Box 1801, Canberra ACT 2601 Office location: Level 3, 51 Allara Street, Canberra City ACT Telephone: (02) 6279 0100, international + 61 2 6279 0100 Facsimile: (02) 6248 8053, international + 61 2 6248 8053 Email: [email protected] Internet: http://www.mdba.gov.au For further information contact the Murray-Darling Basin Authority office on (02) 6279 0100 This report may be cited as: Lintermans, M.
    [Show full text]