European Journal of Biotechnology and Bioscience European Journal of Biotechnology and Bioscience Online ISSN: 2321-9122, Impact Factor: RJIF 5.44 www.biosciencejournals.com Volume 4; Issue 7; July 2016; Page No. 42-47 Phylogenetic analysis of some Puntius species based on 18S rDNA 1 Saroniya RK, 2 Nagpure NS, 3 Saksena DN, 4 Basdeo Kushwaha, 5 Ravindra Kumar, 6 Mahender Singh, 7 Vishwamitra Singh Baisvar, 8 Akhilesh Kumar Mishra 1 Department of Zoology, Government Degree College, Mant, Mathura, Uttar Pradesh, India 2 Central Institute of Fisheries Education, Panch Marg, Off Yari Road, Mumbai, Maharashtra, India 3 School of Studies in Zoology, Jiwaji University, Gwalior, Madhya Pradesh, India 4-8 National Bureau of Fish Genetic Resources, Canal Ring Road, P.O.- Dilkusha, Lucknow Uttar Pradesh, India Abstract The molecular characterization and phylogenetic analysis have been carried out in four Puntius species using 18S rDNA sequences. The size of the consensus sequences of 18S rDNA ranged between 1807-1817 bp (i.e. 1810 bp in P. chola, 1809 bp in P. conchonius, 1817 bp in P. sophore and 1807 bp in P. ticto). The GC and AT content (%) was 56.96 and 43.04 in P. chola, 55.67 and 44.33 in P. conchonius, 56.69 and 43.31 in P. sophore and 55.06 and 44.94 in P. ticto. The dataset after multiple sequence alignment of these Puntius species contained 1906 nucleotide positions, out of which 1430 were conserved, 467 variable, 205 singleton, and 256 parsimony informative. The inter-specific genetic variation was low. P. chola revealed lowest genetic distance with P. sophore and same was true between P. conchonius and P. ticto. The evolutionary history was inferred by three methods, namely Maximum Parsimony, Neighbour-Joining and the Maximum Likelihood. The three different phylogenetic approaches resulted mostly in similar tree topologies and the clades were well supported with bootstrap values. P. chola and P. sophore clustered together as sister group and same was true with P. conchonius and P. ticto, which showed their close relationship. The phylogenetic reconstruction of present study was also in agreement with earlier studies based on morphometric, cytogenetic studies, mitochondrial cytochrome b gene and restriction fragment polymorphism analysis. Keywords: Phylogenetic, rDNA, nucleotide, tree, sequences 1. Introduction In view of this, the present study was aimed to characterise Cypriniformes, an order of ray-finned fish that includes and find out phylogenetic relationship among these Puntius carps, minnows, loaches and relatives, is recognized as the species on the basis of 18S rDNA sequences to facilitate most varied group of freshwater fishes with estimated policy makers to make their conservation plans for sustainable diversity of over 3,500 species [1] contained in 280 genera and utilization. five families. The cyprinid genus Puntius comprises over 140 species [2] of small to medium sized barbs found in stagnant 2. Material and methods pools to fast flowing freshwater streams of tropical Asia. The Collection of specimens fishes of this mainly comprised of food as well as valuable Live specimens of P. conchonius, P. chola and P. ticto were ornamental fishes due to their attractive appearance. Presently, collected from Pahuj River at the site of village Pohra on the over 60 species of Puntius from India, largely from the border of Jhansi (Uttar Pradesh) and Datia (Madhya Pradesh). Eastern Himalayas and Eastern as well as Western Ghats, are Specimens of P. sophore were collected from Ramsagar known [2]. Four species of this genus, viz. P. conchonius, P. reservoir at Barauni, near Datia. Collected specimens were chola, P. sophore and P. ticto, are commonly found in the identified using the keys developed by Talwar and Jhingran freshwater bodies of the central part of India [3, 8]. [10], Srivastava [11] and Jayaram [12]. The nuclear ribosomal DNA (rDNA) are organized as multiple copies of a repeated unit that consists of a transcribed zone Genomic DNA isolation and amplification with coding regions for the 18S, 5.8S and 28S RNA genes, The total genomic DNA was isolated from the muscle tissue internal and external transcribed spacers (ITS & ETS) and samples following standard phenol: chloroform: isoamyl surrounded by non-transcribed spacers (NTS) sequences [9]. alcohol method of Sambrook and Russel [13] with minor The presence of large variable regions in rDNA offers modifications. Four specific primers (18SAF: 5’- sufficient scope for differentiating the species, so the authentic CTCAAAGATTAAGCCATGCAG GTC-3’ and 18SAR: 5’- phylogenetic relationship can also be deduced. ATGGGTAATTTGCGCGCCTGCTG-3’; 18SBF: 5’- However, the fish germplasm has been depleting very fast due CGGCTAC CACATTCAAGGAAGG-3’ and 18SBR: 5’- to various anthropogenic stresses like pollution, habitat ATCCTTTCGCTTCGTCCGTCTTG-3’; 18SCF: 5’- destruction, overexploitation etc. Thus, it is imperative to CGGCGCAAGACGGACGAAAGC-3’ and 18SCR: 5’- undertake remedial measures to conserve the germplasm. GACCTGTTATTCCTC CATCTCGCG-3’; and 18SDF: 5’- Genetic characterization of fish species is an important step CGTGCG GTCGGCGTTCAACTTC-3’ and 18SD R: 5’- taken towards conservation of fish species that enable precise CCTTGTTACGACTTTTACTTCCTC-3’) were used for identification of species and varieties / stocks within species. amplifications of complete 18S rDNA sequences. The PCR 42 European Journal of Biotechnology and Bioscience amplifications were performed in 50-µl reaction volume 3. Result containing 10X Taq polymerase buffer, 2 mM MgCl2, 0.2 mM Nucleotide composition dNTP mix, 10 pmol of each primer, 1U Taq DNA Polymerase The size of the sequences ranged between 1807-1817 bp (i.e. and 50 ng genomic DNA. The PCR cycling conditions were: 1810 bp in P. chola, 1809 bp in P. conchonius, 1817 bp in P. initiation denaturation at 94C for 4 min, followed by 32 sophore and 1807 bp in P. ticto). The nucleotide composition cycles of denaturation at 94C for 30 sec, primer annealing at was presented in Table 1. The GC content was higher than the 55C for 30 sec, primer extension at 72C for 60 sec, followed AT. by final extension at 72C for 10 min. The amplified products were resolved in 1.0% agarose gel stained with ethidium Table 1: Nucleotide composition of 18S rDNA sequences of Puntius species. bromide and custom sequenced. Number (values in bracket are Total G+C Name of Sequence alignment and molecular phylogenetic analysis in per cent) (base content species The raw DNA sequences were edited using BioEdit [14] and the A C G T pairs) (%) pairwise as well as multiple alignment of sequences was 404 486 545 375 P. chola 1810 56.96 performed using ClustalW [15] alignment editor. Multiple (22.32) (26.85) (30.11) (20.72) sequence alignment was also checked manually and the P. 413 467 540 389 1809 55.67 consensus sequences were obtained. Molecular phylogenetic conchonius (22.83) (25.82) (29..85) (21.50) [16] analyses were performed in MEGA (ver. 6) software . 407 486 544 380 P. sophore 1817 56.69 Sequence data was subsequently analysed for Neighbour- (22.40) (26.75) (29.94) (20.91) Joining, Maximum Parsimony and Maximum Likelihood 418 465 530 394 methods with bootstraps of 1000 replicates [17]. Nucleotide P. ticto 1807 55.06 (23.13) (25.73) (29.33) (21.80) composition analysis was carried out using BioEdit. Transition and transversions were equally weighted. The final consensus Molecular phylogenetic analysis sequences were submitted to NCBI database with accession The estimates of evolutionary divergence between nucleotide number - JN704069 (P. conchonius), JN704070 (P. ticto), sequences of 18S were conducted among 16 consensus JN704071 (P. sophore) and JN704072 (P. chola). The sequences (Table 2). The values indicated that P. chola have phylogenetic study also included 18S rDNA sequences of 11 lowest genetic distance (0.004) with P. sophore, and P. other fish species (P. chelynoides, GU568349; T. putitora conchonius (0.020) with P. ticto. Among the undertaken GU568351; Misgurnus anguillicaudatus, FJ710863; fishes, M. polynyma has lowest distance (0.193) with M. Nematalosa erebi, HQ615574; Porochilus rendahli, anguillicaudatus, and L. japonica (0.205) with P. Chelynoides HQ615581; Pangasianodon hypophthalmus, AJ876376; and N. erebi. Among the studied Puntius species, P. chola Leiocassis longirostris, GQ465842; Ictalurus punctatus, showed lowest genetic distance of 0.214 and 0.213 with M. GQ465835; Heteropneustes fossilis, AJ876377; Channallabes polynyma and L. japonica, respectively. This indicated that P. longicaudatus, AJ876391; and Ompok pabo, GU385711) and chola may be the most primitive among the four undertaken two Mollusc (Mactromeris polynyma, L11230 and Liolophura Puntius species. japonica, X70210) taken from GenBank. Table 2: Estimates of pairwise K2P distance between the species using 18S rDNA sequences. P. ticto P. ticto P. chola chola P. N. erebi N. erebi O. pabo H. fossilis P. sophore P. sophore T. putitora P. rendahli I. punctatus I. punctatus M. polynyma M. polynyma P. conchonius P. chelynoides P. chelynoides L. longirostris C. longicaudatus longicaudatus C. P. hypophthalmus P. hypophthalmus M. anguillicaudatus M. anguillicaudatus P. conchonius 0.068 - - - - - - - - - - - - - - - P. sophore 0.004 0.070 - - - - - - - - - - - - - - P. ticto 0.063 0.020 0.065 - - - - - - - - - - - - - P. chelynoides 0.023 0.067 0.025 0.069 - - - - - - - - - - - - T. putitora 0.023 0.069 0.026 0.070 0.005- - - - - - - - - - - M. anguillicaudatus 0.040 0.082 0.043 0.082 0.0300.031 - - - - - - - - - - N. erebi 0.044 0.084 0.046 0.081 0.0290.031 0.035 - - - - - - - - - P. rendahli 0.047 0.088 0.050 0.087 0.0390.041 0.040 0.034 - - - - - - - - P. hypophthalmus 0.047 0.089 0.050 0.088 0.0420.043 0.040 0.036 0.002 - - - - - - - L. longirostris 0.048 0.088 0.050 0.087 0.0410.041 0.041 0.035 0.002 0.002 - - - - - - O. pabo 0.048 0.088 0.050 0.087 0.039 0.041 0.042 0.036 0.004 0.007 0.005 - - - - - I. punctatus 0.053 0.094 0.055 0.093 0.044 0.045 0.044 0.038 0.011 0.011 0.011 0.015 - - - - H.